WO2005063987A1 - Gp153 : methodes et compositions de traitement du cancer - Google Patents

Gp153 : methodes et compositions de traitement du cancer Download PDF

Info

Publication number
WO2005063987A1
WO2005063987A1 PCT/US2004/042505 US2004042505W WO2005063987A1 WO 2005063987 A1 WO2005063987 A1 WO 2005063987A1 US 2004042505 W US2004042505 W US 2004042505W WO 2005063987 A1 WO2005063987 A1 WO 2005063987A1
Authority
WO
WIPO (PCT)
Prior art keywords
mammal
expression
cells
cancer
cell
Prior art date
Application number
PCT/US2004/042505
Other languages
English (en)
Inventor
Murray Robinson
Ronan C. O'hagan
Karuppiah Kannan
David Bailey
Jeno Gyuris
Bijan Etemad-Moghadam
Original Assignee
Aveo Pharmaceuticals, Inc.
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Aveo Pharmaceuticals, Inc. filed Critical Aveo Pharmaceuticals, Inc.
Publication of WO2005063987A1 publication Critical patent/WO2005063987A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C12N15/1138—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against receptors or cell surface proteins
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/705—Receptors; Cell surface antigens; Cell surface determinants
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C07K16/18—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • C07K16/28—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
    • C07K16/30—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants from tumour cells
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid
    • C12N2310/14—Type of nucleic acid interfering N.A.

Definitions

  • the field of the invention is molecular biology and oncology. Background of the Invention Surprisingly little is known about the genetic lesions responsible for its genesis, progression, and clinical behavior. For example, in the case of melanoma, although many genes have been implicated in the genesis of this disease, only the INK4a, RAS and BRAF genes have been shown to be true etiologic lesions in a formal genetic sense (Chin et al., Genes Devel. 11:2822-34 (1997); Davies et al., Nature 417:949-54 (2002)). Moreover, advanced malignancy represents the phenotypic endpoint of many successive genetic lesions that affect many oncogene and tumor suppressor gene pathways.
  • GP153 functionally complements the K-ras oncogene in an inducible, spontaneous, in vivo cancer model (mouse). It has also been discovered that interfering RNAs that target GP 153 expression inhibit the growth of certain human tumor cell lines in vitro. Based in part on these discoveries, the invention provides GP153 antagonists that inhibit GP153 gene expression or GP153 protein activity.
  • Antagonists that inhibit GP153 gene expression include an interfering RNA that inhibits the expression of GP153, a GP153 antisense nucleic acid, and an anti- GP 153 ribozyme.
  • the sense strand sequences of four exemplary interfering RNAs of the invention include SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5 and SEQ ID NO:6.
  • Antagonists that inhibit GP153 protein activity include blocking antibodies that bind to a GP 153 protein fragment consisting of the extracellular domain, or amino acids 30-704 of SEQ ID NO: 1.
  • GP153 antagonists include, but are not limited to, blocking antibodies that bind to a GP153 protein fragment consisting of amino acids 30-280, 236-488 or 500-704 of SEQ ID NO:l.
  • GP153 antagonists of the invention inhibit tumorigenesis, tumor development, tumor maintenance, tumor recurrence, tumor growth, or the growth of tumor cells in vitro.
  • the invention also provides methods of inducing apoptosis in a cell. The methods include contacting the cell with an effective amount of a GP 153 antagonist.
  • the invention also provides methods of treating a hyperproliferative condition in a mammal, e.g., a human patient. The method includes administering to the mammal an effective amount of a GP 153 antagonist.
  • the method of treating a hyperproliferative condition includes administering a second therapeutic agent.
  • the second therapeutic agent can be, for example, an anti-angiogenic agent, anti-metastatic agent, agent that induces hypoxia, agent that induces apoptosis, or an agent that inhibits cell survival signals.
  • cancer therapeutics include farnesyl transferase inhibitors, tamoxifen, herceptin, taxol, STI571, cisplatin, fluorocil, cytoxan, and ionizing radiation.
  • the invention also provides a host cell containing a recombinant DNA construct that includes a GP153-encoding sequence operably linked to an expression control sequence, and a genetic mutation that causes the host cell to have a greater likelihood of becoming a cancer cell than a cell not comprising the genetic mutation.
  • a mutation can be, e.g., a mutation that deletes or inactivates a tumor suppressor gene, or a mutation that activates an oncogene.
  • tumor suppressor genes include INK4a, P53, Rb, PTEN, LATS, APAF1, Caspase 8, APC, DPC4, KLF6, GSTP1, ELAC2 HPC2 and J KX3.1.
  • oncogenes include K-RAS, H-RAS, N-RAS, EGFR, MDM2, TGF-ft RhoC, AKT family members, myc, /3-catenin, PGDF, C-MET, PI3K-C A, CDK4, cyclin Bl, cyclin DI, estrogen receptor gene, progesterone receptor gene, HER2 (also known as neu or ErbB2), ErbBl, ErbB3, ErbB4, TGF ⁇ , ras-GAP, She, Nek, Src, Yes, Fyn, Wnt, and Bcl2.
  • the invention also provides a genetically modified non-human mammal, e.g., a mouse, at least some of whose cells contain a genome that includes: (a) a recombinant GP153-encoding nucleic acid operably linked to an expression control sequence, and (b) a genetic mutation that causes the mammal to have a greater susceptibility to cancer than a mammal whose cells do not contain the genetic mutation, hi preferred embodiments, the genetic mutation involves a tumor suppressor gene and renders the tumor suppressor gene non-functional.
  • the genetically modified nonhuman mammal can be a conventional transgenic mammal, all of whose cells contain the recombinant GP153-encoding nucleic acid operably linked to an expression control sequence, and the genetic mutation that causes the mammal to have increased susceptibility to cancer.
  • the mammal can be a chimeric mammal at least some of whose, but not all of whose, somatic cells contain the recombinant GP153-encoding nucleic acid operably linked to an expression control sequence, and the genetic mutation that causes the mammal to have a increased susceptibility to cancer.
  • the percentage of somatic cells containing the recombinant GP153-encoding nucleic acid operably linked to an expression control sequence, and a genetic mutation that causes the mammal to have a greater susceptibility to cancer is between 5% and 95%. Preferably it is between 15% and 85%.
  • the GP153-encoding nucleic acid is operably linked to a tissue-specific expression system.
  • the invention also provides a genetically modified nonhuman mammal, wherein the genetic modification reduces or eliminates expression of one or both of the mammal's endogenous GP153 alleles. Such reduction or elimination of
  • GP153 expression can be achieved, for example, when the genetic modification is addition of an RNAi expression construct targeting GP153 gene expression, or when the genetic modification is a knockout of one or both of the GP153 alleles. Such a genetic modification can reduce or eliminate GP153 expression in a tissue- specific manner.
  • the genetically modified mammal is chimeric with respect to the genetic modification.
  • the invention also provides a screening method for identifying a compound useful for treating a hyperproliferative condition such as cancer.
  • the method includes: (a) identifying a biomarker whose level correlates with inhibition of GP153 activity; and (b) detecting a change in the level of the biomarker in the presence of a test compound relative to the level of the biomarker detected in the absence of the test compound.
  • the invention also provides a screening method for identifying a compound useful in treatment of a hyperproliferative condition such as cancer.
  • the method includes: (a) providing an inhibitor of GP153 expression or activity; (b) identifying a negative control biomarker pattern formed by a plurality of biomarkers in a cancer cell wherein the cell is not contacted with the inhibitor of GP153 expression or activity; (c) identifying a positive control biomarker pattern formed by a plurality of biomarkers in the cancer cell wherein the cancer cell is contacted with the inhibitor of GP153 expression or activity; (d) identifying a test biomarker pattern formed by a plurality of biomarkers in the cancer cell wherein the cancer cell is contacted with a candidate compound but not contacted with the inhibitor of GP153 expression or activity; and (e) comparing the negative control biomarker pattern, positive control biomarker pattern and test biomarker pattern, and detecting a greater similarity between the positive control biomarker pattern and the test biomarker pattern than between the negative control biomarker pattern and i the test biomarker pattern.
  • the invention also provides methods of diagnosing an abnormal hyperproliferative condition, e.g., cancer, in a subject. These methods involve detecting the expression level of a GP153 gene or the activity level of a GP153 protein. An abnormally high level relative to control, e.g., at least about 50%, 100%, 150%, 200%, 250%, or 300% higher, indicates an abnormal hyperproliferative condition.
  • the invention also provides GP153 polypeptide antigens consisting essentially of amino acids 30-280; 30-320; 221-500; 236-488; 409-690; 500-704; 1-704; and 30-704 of SEQ ID NO:l.
  • any of these GP153 polypeptide antigens can be incorporated into a fusion protein, e.g., an Fc fusion or a GST fusion.
  • a fusion protein e.g., an Fc fusion or a GST fusion.
  • all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which the invention pertains. In case of conflict, the present specification, including definitions, will control. All publications, patents and other references mentioned herein are incorporated by reference in their entirety.
  • the word "comprise,” or variations such as “comprises” or “comprising” is intended to include the stated integer or group of integers, but not to exclude any other integer or group of integers.
  • the GP153 protein i.e., protein-tyrosine-kinase-7 or PTK7 or colon carcinoma kinase-4 or CCK4, belongs to a family of receptor tyrosine kinases (RTKs) that lack detectable catalytic tyrosine kinase activity. Nevertheless, this protein may have a role in signal transduction. It may interact with other protein kinases and mediate their activity or induce intracellular signaling by binding to extracellular ligands.
  • RTKs receptor tyrosine kinases
  • An exemplary human GP153 protein has the following polypeptide sequence:
  • a coding sequence for this polypeptide is: gcggcgcgcgg gggactcgga ggtactgggc gcgcgcggct ccggctcggg acgcctcggg acgcctcggg gtcgggctcc ggctgcggct gctgcggct gctgcggctgcgg ctgcgg cgctgcgg cgcct cccgcgcgcgcgcgcgc ggagcgcagt ctgcgcgcccc gctcagctcct ttcctgagccccgcgcgat gggagctgcgcgcgcccccgat gggagctgcgcgcgccccgat gggagctgcgcg
  • Other human GP153 sequences include transcript variants encoding different isoforms of GP153.
  • Other human GP153 polypeptide sequences include different isoforms of GP153 such as GenBank accession numbers NP_690619, NP_690620, NP_690621, and NP_690622.
  • GP153 coding sequences include GenBank accession numbers NM_152880.2, NM_152881.2, NM_152882.2, NM 52883.1, BC046109.2, AK124108.1, NM_002821.3, AL157486.1, U33635.1, U40271.2, AK055648.1, BC014626.1, AF531872.1, AF531871.1, AF531870.1, AF531869.1, AF531868.1, and BC002377.1. GP153 orthologs in other animal species have also been identified.
  • GenBank accession numbers BE233531.1 (S.scrof ⁇ ), XM_217346.2 (R.norvegicus), NM_175168.2 (M.musculus), and BF606652.1 (B.taurus).
  • the GP153 gene is expressed in a variety of tissues, including adipose tissue, eye (including retina and lens), fetus, gastrointestinal tract (including colon), genitourinary organs (e.g., prostate, testis, and ovaries), heart, kidney, lung, breast, stomach, nervous systems (e.g., brain), pancreas, placenta, spleen, thymus, and uterus.
  • the GP153 gene is also expressed in a broad spectrum of cancer tissue types (e.g., adenocarcinoma, colon tumor, prostate tumor, squamous cell carcinoma, rhabdomyosarcoma, neuroblastoma, mucoepidermoid carcinoma, and retinoblastoma) and their derivative cancer cell lines (e.g., cancer cell lines derived from neuroblastoma and adenocarcinoma). GP153 is also expressed at elevated levels in brain tumors, colon cancer and lung cancer.
  • cancer tissue types e.g., adenocarcinoma, colon tumor, prostate tumor, squamous cell carcinoma, rhabdomyosarcoma, neuroblastoma, mucoepidermoid carcinoma, and retinoblastoma
  • their derivative cancer cell lines e.g., cancer cell lines derived from neuroblastoma and adenocarcinoma.
  • GP 153 antagonists are useful for inhibiting, treating or preventing the development of cancers such as cancers found in skin (e.g., melanoma), lung, prostate, breast, colorectal, liver, pancreatic, brain, testicular, ovarian, uterine, cervical, kidney, thyroid, bladder, esophageal, and hematological tissues.
  • Inhibition of GP153 function inhibits the growth of different human tumor cell lines in a soft agar colony formation assay (Example 3, below). This demonstrates a role for GP153 in the regulation of tumor cell growth.
  • GP153 may form heterodimers with other active RTKs, which themselves can be targeted for drug discovery efforts.
  • GP153 can be found by searching for RTKs that display the same expression pattern as GP153.
  • partners of GP 153 can be found by using proteomic or yeast two- hybrid approaches.
  • GP153 can be crosslinked to associated proteins using chemical crosslinking agents, and the crosslinked GP153- protein complex can be isolated using antibodies specific to GP153.
  • the GP153 associated proteins or their fragments can be analyzed using mass spectrometry to identify the GP153 associated, catalytically active RTK.
  • the extracellular or intracellular domain of GP153 can be used as a bait in a yeast two-hybrid experiment to identify RTKs that form heterodimers with GP153.
  • This approach can also be used to identify proteins that interact with the intracellular domain of GP153 and are therefore likely to be downstream effectors of GP153, and maybe additional drug targets in the GP153 pathway.
  • this approach can be used to identify proteins that interact with the extracellular domain of GP153, including ligand(s) for GP 153.
  • Antibodies that bind to the activating ligand of GP153, and prevent its binding to the extracellular domain of GP153, may provide an additional therapeutic intervention point in the GP 153 pathway.
  • nucleic acid sequences specifically provided herein are sequences of deoxyribonucleotides. However, the given sequences are to be interpreted as would be appropriate to the polynucleotide composition. For example, if the isolated nucleic acid is RNA, the given sequence intends ribonucleotides, with uridine substituted for thymidine. In some embodiments, differences from naturally occurring nucleic acids, e.g., non-native bases, altered internucleoside linkages, and post-synthesis modification, can be present throughout the length of the GP153 nucleic acid or can be usefully localized to discrete portions thereof.
  • a chimeric nucleic acid can be synthesized with discrete DNA and RNA domains and demonstrated utility for targeted gene repair. See, e.g., U.S. Pat. Nos. 5,760,012 and 5,731,181.
  • Polymorphisms such as single nucleotide polymorphisms (SNPs) occur frequently in eukaryotic genomes. Additionally, small deletions and insertions, rather than SNPs, are not uncommon in the general population, and often do not alter the function of the protein. Accordingly, this invention provides not only isolated nucleic acids identical in sequence to those described with particularity herein, but also isolated nucleic acids that are allelic variants of those particularly described nucleic acid sequences.
  • nucleic Acids Encoding GP153 Protein or Portions Thereof The invention provides isolated nucleic acid molecules that encode the entirety or part (e.g., at least five, seven, or nine contiguous amino acid residues) of the GP153 protein, including allelic variants of this protein. These nucleic acids can be used, for example, to express the GP153 protein or specific portions of the protein, either alone or as elements of a fusion protein, e.g., to express epitopic or immunogenic fragments of the GP153 protein. For example, such nucleic acids are used to produce non-human mammals of the invention.
  • nucleic acids also can be used as probes to hybridize to GP153 nucleic acids and related nucleic acid sequences.
  • This invention also relates to nucleic acids comprising sequences coding for polypeptides containing conservative amino acid substitutions or moderately conservative amino acid substitutions from those polypeptides described with particularity herein. These amino acid substitutions can be due to, e.g., allelic variations, naturally occurring mutations, or man-made mutations.
  • Cross-Hybridizing Nucleic Acids This invention also relates to isolated polynucleotides that hybridize to one or more of the above-described GP153 nucleic acids.
  • cross-hybridizing nucleic acids can be used, e.g., as hybridization probes, primers, and/or for expression of proteins that are related to GP153 as isoforms and homologs, e.g., paralogs, and orthologs.
  • the invention relates to an isolated nucleic acid comprising a sequence that hybridizes under high stringency conditions to a probe comprising a fragment of SEQ LD NO: 2 having at least 15, 16, 18, 20, 24, or 25 nucleotides.
  • high stringency conditions are defined for solution phase hybridization as aqueous hybridization (i.e., free of formamide) in 6X SSC (where 20X SSC contains 3.0 M NaCl and 0.3 M sodium citrate), 1% SDS at 65°C for 8-12 hours, followed by two washes in 0.2X SSC, 0.1% SDS at 65°C for 20 minutes. It will be appreciated by the skilled worker that hybridization at 65 °C will occur at different rates depending on a number of factors including the length and percent identity of the sequences which are hybridizing.
  • the hybridizing portion of a reference nucleic acid is typically at least 15 nucleotides in length, and often at least 17 , 20, 25, 30, 35, 40 or 50 nucleotides in length.
  • Cross-hybridizing nucleic acids that hybridize to a larger portion of the reference nucleic acid - for example, to a portion of at least 50, 100, 150, 200, 250, 300, 350, 400, 450, 500 or more nucleotides, up to and including the entire length of the reference nucleic acid, are also useful.
  • Nucleic Acid Fragments Fragments of the above-described nucleic acids also relate to this invention.
  • the nucleic acid probes may comprise a detectable label, e.g., a radioisotope, a fluorescent compound, an enzyme, or an enzyme co-factor.
  • a detectable label e.g., a radioisotope, a fluorescent compound, an enzyme, or an enzyme co-factor.
  • Such probes can be used as a part of a diagnostic kit for identifying cells or tissues that (i) incorrectly express a GP153 protein, e.g., aberrant splicing, or abnormal mRNA levels, or (ii) harbor a mutation in the GP153 gene, such as a deletion, an insertion, or a point mutation.
  • the nucleic acid primers can be used in PCR, primer extension and the like. They can be, e.g., at least 6 nucleotides (e.g., at least 7, 8, 9, or 10) in length.
  • the primers can hybridize to an exon sequence of a GP 153 gene, e.g., for amplification of a GP 153 mRNA or cDNA.
  • the primers can hybridize to an intron sequence or an upstream or downstream regulatory sequence of a GP153 gene, to utilize non-transcribed, e.g., regulatory portions of the genomic structure of a GP153 gene.
  • the nucleic acid primers also can be used, e.g., to prime single base extension (SBE) for SNP detection (see, e.g., U.S. Pat. No. 6,004,744).
  • SBE single base extension
  • Isothermal amplification approaches, such as rolling circle amplification, are also now well- described. See, e.g., Schweitzer et al., Curr. Opin. Biotechnol. 12(l):21-7 (2001); U.S. Patent Nos. 5,854,033 and 5,714,320 and PCT international patent publications WO 97/19193 and WO 00/15779.
  • Rolling circle amplification can be combined with other techniques to facilitate SNP detection.
  • nucleic acid fragments that encode 5 or more contiguous amino acids are useful in directing the synthesis of peptides that have utility in mapping the epitopes of the GP153 protein. See, e.g., Geysen et al, Proc. Natl. Acad. Sci. USA 81:3998-4002 (1984); and U.S. Pat. Nos. 4,708,871 and 5,595,915. Such nucleic acid fragments are also useful in directing the synthesis of peptides that have utility as immunogens.
  • the invention also relates to single exon probes having portions of no more than one exon of the GP 153 gene. Such single exon probes have particular utility in identifying and characterizing splice variants.
  • Antisense Reagents Some embodiments of the invention relate to antisense polynucleotides that specifically hybridize to GP153 sense polynucleotides.
  • the antisense nucleic acid molecule can be complementary to the entire coding or non-coding region of GP153, but more often is antisense to only a portion of the coding or non-coding region of GP153 mRNA.
  • the antisense oligonucleotide can be complementary to the region surrounding the translation start site of GP153 mRNA.
  • An antisense oligonucleotide can be, for example, about 5, 10, 15, 20, 25, 30, 35, 40, 45 or 50 nucleotides in length.
  • the antisense nucleic acids of this invention may form a stable duplex with its target sequence, or, in the case of an antisense nucleic acid molecule that binds to DNA duplexes, through specific interactions in the major groove of the double helix.
  • the antisense nucleic acid molecule of the invention is an ⁇ -anomeric nucleic acid molecule.
  • An -anomeric nucleic acid molecule forms specific double-stranded hybrids with complementary RNA in which, contrary to the usual ⁇ -units, the strands run parallel to each other (Gaultier et al. Nucl. Acids Res 15: 6625-6641 (1987)).
  • An antisense target sequence is a nucleotide sequence specific to GP153, and can be designed through use of a publicly available sequence database, and/or through use of commercially available sequence comparison programs. Antisense nucleic acids of the invention can then be constructed using procedures known in the art.
  • an antisense nucleic acid e.g., an antisense oligonucleotide
  • an expression vector into which a nucleic acid has been inserted in an antisense orientation i.e., RNA transcribed from the inserted nucleic acid will be of an antisense orientation to a target nucleic acid of interest.
  • the antisense nucleic acid can be chemically synthesized using naturally occurring nucleotides or variously modified nucleotides designed to increase the biological stability of the molecule or to increase the physical stability of the duplex formed between the antisense and sense nucleic acids. For example, phosphorothioate derivatives and acridine substituted nucleotides can be used.
  • Phosphorothioate and methylphosphonate antisense oligonucleotides are useful in practicing the invention.
  • the antisense nucleic acid molecule can also comprise a
  • the antisense oligonucleotides may be further modified by adding poly-L-lysine, transferrin, polylysine, or cholesterol moieties at their 5' end.
  • the antisense molecules will be tested for undesired non-specific effects such as the induction of ds-RNA stress response genes in the interferon pathway.
  • Antisense molecules can be administered to a mammal or generated in situ via an expression vector, such that they bind to cellular RNA and/or genomic DNA encoding a GP153 protein, thereby inhibiting GP153 expression. Suppression of
  • an antisense nucleic acid of the invention is part of a GP153-specific ribozyme (or, as modified, a "nucleozyme").
  • Ribozymes are catalytic RNA molecules with ribonuclease activity capable of cleaving a single- stranded nucleic acid, such as an mRNA, to which they have a complementary region.
  • ribozymes such as hammerhead, hairpin, and Group I intron ribozymes can cleave GP153 mRNA transcripts catalytically, thereby inhibiting translation of GP153 mRNA.
  • a ribozyme having specificity for a GP 153- encoding nucleic acid can be designed based upon the nucleotide sequence of a GP153 polynucleotide disclosed herein (SEQ ID NO: 2). See, e.g., U.S. Patent Nos.
  • a derivative of a Tetrahymena L-19 IVS RNA can be constructed in which the nucleotide sequence of the active site is complementary to the nucleotide sequence to be cleaved in a GP153-encoding mRNA. See, e.g., Cech et al. U.S. Pat. Nos. 4,987,071 and 5,116,742.
  • GP153 mRNA can be used to select a catalytic RNA having a specific ribonuclease activity from a pool of RNA molecules.
  • the ribozymes and other antisense reagents of this invention include appended groups such as peptides. This is useful for targeting host cell receptors, facilitating transport across the cell membrane (Letsinger et al., Proc. Natl. Acad. Sci. USA 86:6553-6556 (1989); Lemaitre et al., Proc. Natl. Acad. Sci. USA 84:648-652 (1987); WO 88/09810), or facilitating transport across the blood-brain barrier (WO 89/10134).
  • PNA Peptide Nucleic Acids
  • PNA compounds the phosphodiester backbone of the nucleic acid is replaced with an amide-containing backbone, in particular by repeating N-(2-aminoethyl) glycine units linked by amide bonds.
  • Nucleobases are bound directly or indirectly to aza-nitrogen atoms of the amide portion of the backbone, typically by methylene carbonyl linkages.
  • the synthesis of PNA oligomers can be performed using conventional solid phase peptide synthesis as described in Hyrup et al., supra; and Perry-O'Keefe et al., Proc. Natl. Acad. Sci. USA 93:14670-675 (1996).
  • GP 153-based PNAs can be used in therapeutic and diagnostic applications.
  • PNAs can be used as antisense or antigene agents for sequence- specific modulation of gene expression by, e.g., inducing transcription or translation arrest or inhibiting replication.
  • GP153-based PNAs also can be used in the analysis of single base pair mutations in a gene. This can be done by PNA directed PCR clamping; as artificial restriction enzymes when used in combination with other enzymes, e.g., SI nucleases, or as probes or primers for DNA sequence and hybridization (Hyrup et al., supra; Perry-O'Keefe, supra).
  • PNAs of GP153 are modified, e.g., to enhance their stability or cellular uptake, by attaching lipophilic or other helper groups to PNA, by the formation of PNA-DNA chimeras, or by the use of liposomes or other techniques of drug delivery known in the art.
  • PNA-DNA chimeras of GP153 can be generated that may combine the advantageous properties of PNA and DNA.
  • Such chimeras allow DNA recognition enzymes, e.g., RNase H and DNA polymerases, to interact with the DNA portion while the PNA portion would provide high binding affinity and specificity.
  • RNA Interference The invention provides RNA interference (RNAi) for use in silencing the expression of the GP153 gene.
  • RNAi is a sequence-specific posttranscriptional gene silencing mechanism triggered by double-stranded RNA (dsRNA) and causes degradation of mRNAs homologous in sequence to the dsRNA.
  • the mediators of the degradation are 21- to 23 -nucleotide small interfering RNAs (siRNAs) generated by ribonuclease III cleavage from the longer dsRNAs.
  • Molecules of siRNA typically have 2- to 3 -nucleotide 3' overhanging ends resembling the RNAse III processing products of long dsRNAs that normally initiate RNAi. When introduced into a cell, they assemble with an endonuclease complex (RNA- induced silencing complex), which then guides target mRNA cleavage.
  • siRNAs As a consequence of degradation of the targeted mRNA, cells with a specific phenotype of the suppression of the corresponding protein product are obtained (e.g., reduction of tumor size, metastasis, angiogenesis, and growth rates).
  • the small size of siRNAs compared with traditional antisense molecules, prevents activation of the dsRNA-inducible interferon system present in mammalian cells. This helps avoid the nonspecific phenotypes normally produced by dsRNA larger than 30 base pairs in somatic cells.
  • dsRNA larger than 30 base pairs in somatic cells.
  • RNA oligonucleotides can be designed by using any one of a number of software programs, e.g., the OligoEngineTM siRNA design tool available at www.oligoengine.com; and RNA Oligo Retriever design tool available from Cold Spring Harbor Laboratory at www.cshl.org/public/SCIENCE/hannon.html (see Paddison et al., 2002, Genes & Dev.16: 948-958).
  • siRNAs of this invention range about 19-29 base pairs in length for the double- stranded portion.
  • the siRNAs are hairpin RNAs having an about 19-29 bp stem and an about 4-34 nucleotide loop.
  • Preferred siRNAs are highly specific for a GP153 target region and may comprise any 19-29 bp fragment of a GP153 mRNA that has at least 1 (e.g., at least 2 or 3) bp mismatch with a nonGP153 -related sequence.
  • the preferred siRNAs do not bind to RNAs having more than 3 mismatches with the target region.
  • the target sequences of exemplary siRNAs for GP153 are:
  • sequences correspond to nucleotides 201-29, 3379-3407, 1782-1810, and 896-924 respectively of SEQ ID NO:2.
  • Exemplary 19-mer target sequences for GP 153 are:
  • siRNAs that target an RNA region having 10 or more nucleotide overlaps with an aforementioned exemplary target region are also useful.
  • Intracellular transcription of siRNAs can be achieved by cloning the siRNA templates into RNA polymerase III (Pol III) transcription units, which normally encode the small nuclear RNA U6 or the human RNAse P RNA HI .
  • RNA polymerase III Poly III
  • siRNAs Two approaches can be used for expressing siRNA: (1) sense and antisense strands constituting the siRNA duplex are transcribed by individual promoters; or (2) siRNAs are expressed as fold-back stem-loop structures that give rise to siRNAs after intracellular processing. Inducible promoters can also be used to drive the expression of the siRNA.
  • shRNA short hairpin RNA
  • the shRNA will have inhibitory effects on GP153 expression.
  • 1) Oligonucleotide to target SEQ ID NO:3 ggaattcaaaaatccgg.ccgaggatccccacgcagctcccccaagggagctgcg cggggatccccggccagactagtatatgtgctgccgaagc SEQ ID NO: 11; SEQ ID NO:3 in boldface
  • nucleic acids can be used as hybridization probes to characterize GP153 nucleic acids in both genomic and transcript-derived nucleic acid samples.
  • the probes can be used to detect gross alterations in the GP153 genomic locus, such as deletions, insertions, translocations, and duplications of the GP153 genomic locus.
  • Methods of detection include fluorescence in situ hybridization (FISH) to chromosome spreads, comparative genomic hybridization (CGH), array CGH (e.g., on microarrays containing GP153 -coding sequences or BAC comprising GP153 -coding sequences), and spectral karyotyping (SKY).
  • FISH fluorescence in situ hybridization
  • CGH comparative genomic hybridization
  • array CGH e.g., on microarrays containing GP153 -coding sequences or BAC comprising GP153 -coding sequences
  • SKY spectral karyotyping
  • the probes can also be used to assess smaller genomic alterations using, e.g., Southern blot detection of restriction fragment length polymorphisms.
  • the nucleic acid probes can be also used to isolate genomic clones that include the nucleic acids of the present invention, which thereafter can be restriction mapped and sequenced to identify deletions, insertions, amplifications, translocations, and substitutions (e.g., SNPs) at the sequence level.
  • the nucleic acid probes can also be used to isolate GP153 nucleic acids from cDNA libraries, permitting sequence level characterization of GP153 RNA messages, including identification of deletions, insertions, truncations (including deletions, insertions, and truncations of exons in alternatively spliced forms) and single nucleotide polymorphisms.
  • Some nucleic acids of this invention can also be used as amplification primers for PCR (e.g., real time PCR) to detect the above- described genomic alterations.
  • PCR real time PCR
  • the nucleic acid probes can be used to measure the representation of GP153 clones in a cDNA library, used as primers for quantitative real time PCR, or otherwise used to measure expression level of the GP153 gene. Measurement of GP 153 expression has particular utility in diagnostic assays for cancer-related conditions associated with abnormal GP153 expression. Moreover, differences in the expression levels of the gene before and after a cancer event (e.g., cancer genesis, maintenance, regression, and metastasis) are useful in determining the effect of a candidate cancer drug, identifying cancer types, designing diagnostics and prognostics, and predicting likely outcome of a cancer therapy.
  • a cancer event e.g., cancer genesis, maintenance, regression, and metastasis
  • the nucleic acids of this invention can also be used to introduce mutations (e.g., null mutations, dominant negative mutations, dominant acting mutations) into a GP153 locus of an animal via homologous recombination.
  • Such animals e.g., knock out mice
  • homologous recombination can be used to replace the endogenous regulatory elements with heterologous regulatory elements, i.e., elements not natively associated with the gene in the same manner. This can alter the expression of GP153, both for production of GP153 protein, and for gene therapy. See, e.g., U.S. Pat. Nos.
  • Fragments of the polynucleotides of the present invention smaller than those typically used for homologous recombination can also be used for targeted gene correction or alteration, possibly by cellular mechanisms different from those engaged during homologous recombination. See, e.g., U.S. Pat. Nos. 5,945,339, 5,888,983, 5,871,984, 5,795,972, 5,780,296, 5,760,012, 5,756,325, 5,731,181; and Culver et al., "Correction of chromosomal point mutations in human cells with bifunctional oligonucleotides," Nature Biotechnol. 17(10):989-93 (1999); Gamper et al., Nucl. Acids Res. 28(21):4332-9 (2000).
  • This invention relates to nucleic acid constructs containing one or more of the isolated nucleic acid molecules of the invention.
  • the vectors can be used to propagate the new nucleic acid molecules in host cells, to shuttle the molecules between host cells derived from disparate organisms, to insert the molecules into host genomes, to express sense or antisense RNA transcripts or interfering RNAs, and/or to express GP153 polypeptides.
  • the vectors are derived from virus, plasmid, prokaryotic or eukaryotic chromosomal elements, or some combination thereof, and may optionally include at least one origin of replication, at least one site for insertion of heterologous nucleic acid, and at least one selectable marker.
  • This invention relates to host cells, which can be either prokaryotic (bacteria) or eukaryotic, e.g., yeast, insect, plant and animal cells.
  • a host cell strain may be chosen for its ability to process the expressed protein in the desired fashion.
  • post-translational modifications of the polypeptide include, but are not limited to, acetylation, carboxylation, glycosylation, phosphorylation, hydroxylation, sulfation, lipidation, and acylation.
  • Some embodiments of the invention may involve GP 153 proteins with such post-translational modifications.
  • Exemplary prokaryotic host cells are E. coli, Caulobacter crescentus, Streptomyces species, and Salmonella typhimurium cells.
  • Vectors useable in these cells include, without limitation, those related to pBR322 and the pUC plasmids.
  • Exemplary yeast host cells are Saccharomyces cerevisiae, Schizosaccharomyces pombe, Pichia pastoris, and Pichia methanolica.
  • Vectors useable in these host cells are integrative YIp vectors, replicating episomal YEp vectors containing centromere sequences CEN and autonomously replicating sequences ARS. Insect cells are often chosen for high efficiency protein expression.
  • Exemplary insect host cells are those from Spodopterafrugiperda (e.g., Sf9 and Sf21 cell lines, and EXPRESSFTM cells (Protein Sciences Corp., Meriden, CT, USA)), Drosophila S2 cells, and Trichoplusia ni HIGH FIVE® Cells (frivitrogen, Carlsbad, CA, USA).
  • Spodopterafrugiperda e.g., Sf9 and Sf21 cell lines, and EXPRESSFTM cells (Protein Sciences Corp., Meriden, CT, USA)
  • Drosophila S2 cells Drosophila S2 cells
  • Trichoplusia ni HIGH FIVE® Cells frivitrogen, Carlsbad, CA, USA.
  • Exemplary mammalian host cells are COS1 and COS7 cells, NSO cells,
  • CHO cells Chinese hamster ovary (CHO) cells, NJH 3T3 cells, 293 cells, HEPG2 cells, HeLa cells, L cells, MDCK, HEK293, WI38, murine ES cell lines (e.g., from strains 129/SV, C57/BL6, DBA-1, 129/SVJ), K562, Jurkat cells, BW5147 and any other commercially available human cancer cell lines.
  • Cells with K-r s 0130 such as human colon cancer cell lines DLD-1 and HCT-116, and revertants thereof having a null mutation in the activated K-ras gene, can also be used.
  • mammalian host cells also include those in the body of a subject (e.g., a human patient or an animal).
  • Vectors intended for autonomous extrachromosomal replication in mammalian cells will typically include a viral origin, such as the SV40 origin (for replication in cell lines expressing the large T-antigen, such as COS1 and COS7 cells), the papillomavirus origin, or the EBV origin for long term episomal replication (for use in, e.g., 293-EBNA cells, which constitutively express the EBV EBNA-1 gene product and adeno virus El A).
  • Vectors intended for integration, and thus replication as part of the mammalian chromosome can, but need not, include an origin of replication functional in mammalian cells, such as the SV40 origin.
  • Useful vectors also include vectors based lentiviruses, adenovirus, adeno- associated virus, vaccinia virus, parvoviruses, herpesviruses, poxviruses, Semliki Forest viruses, and retro viruses.
  • Plant cells can also be used for expression, with the vector replicon typically derived from a plant virus (e.g., cauliflower mosaic virus (CaMV); tobacco mosaic virus (TMV)) and selectable markers chosen for suitability in plants.
  • a plant virus e.g., cauliflower mosaic virus (CaMV); tobacco mosaic virus (TMV)
  • the invention relates to artificial chromosomes, e.g., bacterial artificial chromosomes (BACs), yeast artificial chromosomes (YACs), mammalian artificial chromosomes (MACs), and human artificial chromosomes (HACs), that contain the GP 153 nucleic acid of interest.
  • Vectors often include elements that permit in vitro transcription of RNA from the inserted heterologous nucleic acid.
  • Such vectors typically include a phage promoter, such as that from T7, T3, or SP6, flanking the nucleic acid insert. Often two different such promoters flank the inserted nucleic acid, permitting separate in vitro production of both sense and antisense strands.
  • Expression vectors often include a variety of other genetic elements operatively linked to the protein-encoding heterologous nucleic acid insert.
  • examples of other genetic elements are promoters and enhancer elements, elements that facilitate RNA processing, e.g., transcription termination, splicing signals and/or polyadenylation signals, and elements that facilitate translation, e.g., ribosomal consensus sequences.
  • Examples of other transcription control sequences include operators and silencers.
  • Use of such expression control elements including those that confer constitutive or inducible expression, and developmental or tissue-regulated expression, is within ordinary skill in the art.
  • Useful constitutive promoters include, without limitation, a CMV promoter, EFla, retro viral LTRs, and SV40 early region.
  • Inducible promoters useful in this invention include, without limitation, a tetracycline-inducible promoter, a metallothionine promoter, the IP TG/lacI promoter system, the ecdysone promoter system, and the "lox stop lox" system for irreversibly deleting inhibitory sequences for translation or transcription, hi some embodiments, a GP153 gene is placed between lox sites. Upon expression of the ere enzyme, the GP153 gene is deleted from the genome so that the GP153 activity is permanently eliminated.
  • a GP153 protein also can be inducibly switched on or off by fusing the GP153 protein to, e.g., an estrogen receptor polypeptide sequence, where administration of estrogen or an estrogen analog (e.g., hydroxytamoxifen) will allow the correct folding of the GP153 polypeptide into a functional protein.
  • an estrogen receptor polypeptide sequence e.g., an estrogen receptor polypeptide sequence
  • an estrogen analog e.g., hydroxytamoxifen
  • Tissue-specific promoters that can be used in driving expression of GP153 in animal models include, without limitation: a tyrosinase promoter or a TRP2 promoter in the case of melanoma cells and melanocytes; an MMTV or WAP promoter in the case of breast cells and/or cancers; a Villin or FABP promoter in the case of intestinal cells and/or cancers; a RIP promoter in the case of pancreatic beta cells; a Keratin promoter in the case of keratinocytes; a Probasin promoter in the case of prostatic epithelium; a Nestin or GFAP promoter in the case of CNS cells and/or cancers; a Tyrosine Hydroxylase, SI 00 promoter or neurofilament promoter in the case of neurons; the pancreas-specific promoter described in Edlund et al.
  • Expression vectors Encoding Peptide Tags Expression vectors can be designed to fuse the expressed polypeptide to small protein tags that facilitate purification and/or visualization. Many such tags are known and available.
  • Expression vectors can also be designed to fuse proteins encoded by the heterologous nucleic acid insert to polypeptides larger than purification and/or identification tags.
  • Useful protein fusions include those that permit display of the encoded protein on the surface of a phage or cell, fusions to intrinsically fluorescent proteins, such as luciferase or those that have a green fluorescent protein (GFP)-like chromophore, and fusions for use in two hybrid selection systems.
  • GFP green fluorescent protein
  • Vectors designed for phage display, yeast display, and mammalian display for example, target recombinant proteins using an N-terminal cell surface targeting signal and a C-terminal transmembrane anchoring domain.
  • a wide variety of vectors now exist that fuse proteins encoded by heterologous nucleic acids to the chromophore of the substrate-independent, intrinsically fluorescent green fluorescent protein from Aequorea victoria ("GFP") and its many color-shifted and/or stabilized variants.
  • GFP Aequorea victoria
  • stable expression is preferred. Stable expression is readily achieved by integration into the host cell genome of vectors (preferably having selectable markers), followed by selection for integrants.
  • the present invention relates to full-length GP153 proteins and GP153 protein fragments suitable for use, for example, as antigens, as biomarkers for diseases, and in therapeutic compositions.
  • the invention also relates to fusions of GP153 polypeptides to heterologous polypeptides or conjugation to other moieties.
  • the invention relates to a full-length GP153 protein (SEQ ID NO:l) optionally having one or more conservative amino acid substitutions.
  • the invention also relates to polypeptide fragments of the GP153 protein, particularly fragments having at least 5, 6, 8, or 15 amino acids of SEQ ID NO:l. Larger fragments of at least 20, 25, 30, 35, 50, 75, 100, 150 or more amino acids are also useful, and at times preferred.
  • the GP153 fragments may be continuous portions of the native GP153 protein. However, knowledge of the complete GP153 amino acid sequence allows a person of skill in the art to recombine various domains that are not contiguous in the native GP153 protein, through application of conventional recombinant DNA technology.
  • Specific examples of GP153 fragments useful as antigens include, but are not limited to, amino acids 1-704 (extracellular domain, including signal sequence); 30-704 (extracellular domain without signal sequence); 30-280; 30-320; 221-500; 236-488; 409-690; and 500-704 of SEQ ID NO:l.
  • the GP153 antigen optionally can be conjugated to another moiety or incorporated into a fusion protein, e.g., an Fc fusion, His-tag fusion or GST fusion. Fusion proteins and conjugates
  • This invention also relates to fusions of GP153 polypeptides to heterologous polypeptides.
  • fusion means that the GP153 polypeptide is linearly contiguous to the heterologous polypeptide in a peptide- bonded polymer of amino acids or amino acid analogues.
  • heterologous polypeptide means a polypeptide that does not naturally occur in contiguity with the GP 153 fusion partner.
  • the fusion can consist entirely of a plurality of fragments of the GP153 protein in altered arrangement.
  • any of the GP153 fragments can be considered heterologous to the other GP153 fragments in the fusion protein.
  • the heterologous polypeptide included within the fusion protein preferably is at least 6 amino acids in length, more preferably at least 8 amino acids in length, and most preferably, at least 15, 20, or 25 amino acids in length.
  • the heterologous sequences can target the GP153 polypeptide to a selected cell by binding to a cell surface receptor, prolong the serum life of the GP153 polypeptide (e.g., an IgG Fc region), make the GP153 polypeptide detectable (e.g., a luciferase or a green fluorescent protein), facilitate purification (e.g., His tag, FLAG, etc.), facilitate secretion of recombinantly expressed proteins (e.g., into the periplasmic space or extracellular milieu for prokaryotic hosts, into the culture medium for eukaryotic cells, through incorporation of secretion signals and/or leader sequences).
  • a cell surface receptor e.g., an IgG Fc region
  • make the GP153 polypeptide detectable e.g., a luciferase or a green fluorescent protein
  • facilitate purification e.g., His tag, FLAG, etc.
  • secretion signals and/or leader sequences e.
  • Polypeptides used in practicing the invention can be composed of natural amino acids linked by native peptide bonds, or can contain any or all of nonnatural amino acid analogues, nonnative bonds, and post-synthetic (post-translational) modifications, either throughout the length of the polypeptide or localized to one or more portions thereof.
  • nonnatural amino acid analogues nonnative bonds
  • post-synthetic (post-translational) modifications either throughout the length of the polypeptide or localized to one or more portions thereof.
  • post-synthetic (post-translational) modifications either throughout the length of the polypeptide or localized to one or more portions thereof.
  • the range of such nonnatural analogues, nonnative inter-residue bonds, or post-synthesis modifications will be limited to those that do not interfere with the biological function of the polypeptide. Techniques for incorporating non-natural amino acids during solid phase chemical synthesis or by recombinant methods are well established in the art.
  • D-enantiomers of natural amino acids can readily be incorporated during chemical peptide synthesis: peptides assembled from D-amino acids are more resistant to proteolytic attack; incorporation of D-enantiomers can also be used to confer specific three dimensional conformations on the peptide.
  • Other amino acid analogues commonly added during chemical synthesis include ornithine, norleucine, phosphorylated amino acids (typically phosphoserine, phosphothreonine, phosphotyrosine), L-malonyltyrosine, a non-hydrolyzable analog of phosphotyrosine (Kole et al, Biochem. Biophys. Res. Com.
  • Polypeptides used in practicing the invention can include non-native inter- residue bonds.
  • the polypeptides also can include post-translational and post- synthetic modifications, either throughout the length of the protein or localized to one or more portions thereof.
  • the polypeptide when produced by recombinant expression in eukaryotic cells, can include N-linked and/or O- linked glycosylation, the pattern of which will reflect both the availability of glycosylation sites on the protein sequence and the identity of the host cell. Further modification of glycosylation pattern can be performed enzymatically.
  • recombinant polypeptides may also include an initial modified methionine residue, in some cases resulting from host-mediated processes.
  • Amino acid analogues having detectable labels are also usefully incorporated during synthesis to provide a labeled polypeptide (e.g., biotin, various chromophores, or fluorophores).
  • the GP153 polypeptides of this invention can also usefully be conjugated to polyethylene glycol (PEG). PEGylation increases the serum half life of proteins administered intravenously for replacement therapy. Purification of the Polypeptides Production of the polypeptides optionally can be followed by one or more purification steps.
  • Producing cells include, without limitation, recombinant cells overexpressing the polypeptides, naturally occurring cells (e.g., cancer cells) overxpression the polypeptides, or established cancer cell lines overexpressing the polypeptides.
  • purification tags have been fused through use of an expression vector that encodes such tags, purification can be achieved, at least in part, by means appropriate to the tags, such as use of immobilized metal affinity chromatography for polyhistidine tags.
  • Other conventional techniques include ammonium sulfate fractionation, immuno-precipitation, fast protein liquid chromatography (FPLC), high performance liquid chromatography (HPLC), and preparative gel electrophoresis.
  • Purification of chemically-synthesized peptides can be achieved, e.g., by HPLC.
  • a purified protein is present at a concentration of at least 95%, as measured on a mass basis (w/w) with respect to total protein in a composition. Such purities can often be obtained during chemical synthesis without further purification, as, e.g., by HPLC.
  • Purified proteins can be present at a concentration (measured on a mass basis with respect to total protein in a composition) of 96%, 97%, 98%, and even 99%. The proteins even can be present at levels of 99.5%, 99.6%, and even 99.7%, 99.8%, or even 99.9% following purification.
  • substantially purified protein means an isolated protein, as above described, present at a concentration of at least 70%, measured on a mass basis with respect to total protein in a composition. Usually, the substantially purified protein is present at a concentration, measured on a mass basis with respect to total protein in a composition, of at least 75%, 80%, or even at least 85%, 90%, 91%, 92%, 93%, 94%, 94.5% or even at least 94.9%.
  • the purified and substantially purified proteins are in compositions that lack detectable ampholytes, acrylamide monomers, bis-acrylamide monomers, and polyacrylamide.
  • Exemplary Uses of GP153 Polypeptides Certain fragments of at least 8, 9, 10 or 12 contiguous amino acids are also useful as competitive inhibitors of binding of the GP153 protein to its ligand. Such fragments can be used as anti-cancer agents to reduce the activity of GP153. Fragments of at least six contiguous amino acids are useful in mapping B cell and T cell epitopes of the reference protein.
  • Fragments of at least eight contiguous amino acids, often at least fifteen contiguous amino acids, have utility as immunogens for raising antibodies that recognize the proteins of the present invention or as vaccines for GP153 -mediated diseases such as cancers.
  • the GP153 proteins, fragments, and fusions of the present invention can be usefully attached to a substrate.
  • the polypeptides When bound to a substrate, the polypeptides can be used to detect and quantify antibodies, e.g., in serum, that bind specifically to the immobilized protein.
  • the invention relates to antibodies that bind specifically to the GP153 polypeptides.
  • the antibodies can be specific for linear epitopes, discontinuous epitopes, or conformational epitopes of such polypeptides, either as present on the polypeptide in its native conformation or, in some cases, as present on the polypeptides as denatured, as, e.g., by solubilization in SDS.
  • the invention provides antibodies, both polyclonal or monoclonal, that bind specifically to a polypeptide having an amino acid sequence presented in SEQ ID NO: 1.
  • antibody means a full antibody, e.g., an antibody comprising two heavy chains and two light chains, or to an antigen-binding fragment of a full antibody.
  • fragments include, but are not limited to, those produced by digestion with various proteases, those produced by chemical cleavage and/or chemical dissociation, and those produced recombinantly, so long as the fragment remains capable of specific binding to an antigen.
  • fragments include Fab, Fab', F(ab') 2 and single chain Fv (scFv) fragments.
  • An antibody can be a murine or hamster antibody or a homolog thereof, or a fully human antibody.
  • An antibody can also be a humanized antibody, a chimeric antibody, an antibody fusion, a diabody, an intrabody, or a single-chained antibody.
  • An antibody can be of any isotype and subtype, for example, IgA (e.g., IgAl and IgA2), IgG (e.g., IgGl, IgG2, IgG3 and IgG4), IgE, IgD, IgM, wherein the light chains of the immunoglobulin may be of type kappa or lambda. While monoclonal antibodies are generally preferred, polyclonal antibodies, e.g., from mice, rabbits, turkeys, or sheep, also may be used.
  • the affinity or avidity of an antibody (or antibody multimer, as in the case of an IgM pentamer) will be at least 1 x 10 "6 molar (M), preferably at least 7 7
  • Antibodies are useful in various in vitro immunoassays, such as western blotting and ELISA, in isolating and purifying GP153 proteins (e.g., by immunoprecipitation, immunoaffinity chromatography, and magnetic bead- mediated purification).
  • the antibodies are also useful as modulators (i.e., antagonists or agonists) of a GP 153 protein in vivo to modulate the protein's interaction with its natural ligand.
  • the antibodies can also be used to conjugate to cytotoxic reagents for in vivo targeted delivery.
  • Anti-GP153 antibodies can be associated with moieties appropriate for their uses.
  • the moieties can be an enzyme that catalyzes production and local deposition of a detectable product.
  • Exemplary enzymes are alkaline phosphatase, ⁇ 8-galactosidase, glucose oxidase, horseradish peroxidase (HRP), and urease.
  • the antibodies also can be labeled using colloidal gold. When the antibodies are used, e.g., for flow cytometric detection and scanning laser cytometric detection, they can be labeled with fluorophores.
  • the antibodies of the present invention can be labeled with biotin.
  • the antibodies also can be labeled with radioisotopes.
  • the antibodies can be rendered detectable by conjugation to MRI contrast agents, such as radioisotopic labeling or gadolinium diethylenetriaminepentaacetic acid (DTP A).
  • the antibodies also can be conjugated to cytotoxic agents for targeting the agents to a tumor site.
  • the antibody can be conjugated to Pseudomonas exotoxin A, diphtheria toxin, shiga toxin A, anthrax toxin lethal factor, or ricin. See, e.g., Hall (ed.), hnmunotoxin Methods and Protocols (Methods in Molecular Biology, Vol 166), Humana Press (2000)
  • Small molecule toxins such as calicheamycin or chemotherapeutic agents also can be delivered via chemical conjugation to the antibodies.
  • the antibodies also can be used to deliver DNA to a tumor site as gene therapy to inhibit or otherwise modify the behavior of the tumor, e.g., to deliver an antisense reagent to the GP153 oncogene.
  • the antibodies can be bound to a substrate via a linker moiety.
  • the antibodies can usefully be conjugated to filtration media, such as NHS-activated Sepharose or CNBr-activated Sepharose for immunoaffinity chromatography.
  • the antibodies can also be attached to paramagnetic microspheres, e.g., by biotin-streptavidin interaction. The microsphere then can be used for isolation of cells that express or display the protein of interest.
  • the antibodies can also be attached to the surface of a microtiter plate for ELISA.
  • Nucleic Acid Aptamers Aptamers for GP153 are DNA-based or RNA-based molecules that bind to GP153 proteins with high affinity and specificity.
  • nucleic acid compounds can be screened to identify specific molecules that e.g., bind GP153 polypeptides, or inhibit GP153 enzymatic activity. Like antibodies and small molecules, they can be used as research tools or therapeutic agents. For a review, see Rimmele, Chembiochem 4:963-71 (2003)).
  • compositions comprising antagonists of GP153 activity, and methods of using them to prevent or treat (i.e., ameliorate, mitigate, alleviate, slow, or inhibit) tumor growth, angiogenesis, metastasis or otherwise inappropriate cell proliferation.
  • Inhibitors of GP153 activity also can be used in combination with one or more other therapeutic agents, for improved cancer treatment.
  • Other therapeutic agents suitable for co-administration with a GP153 inhibitor include, for example, an anti-angiogenic agent, an anti-metastatic agent, or an agent used to create a hypoxic environment.
  • Chemotherapeutic agents that can be co-administered with inhibitors of GP153 include folate antagonists, pyrimidine and purine antimetabolites, alkylating agents, platinum antitumor compounds, DNA interchelators, other agents that induce DNA damage, microtubule targeting products, small molecule inhibitors of protein kinases and biological inhibitors of growth factor receptors.
  • the GP153 inhibitor and additional therapeutic agent(s) may be used concurrently or sequentially.
  • the subject is pre-treated with one or more agents, followed by treatment with a GP153 inhibitor.
  • the ability of tumor cells to detach from the primary site and produce metastases in a distant organ is due to the survival and growth of a unique subpopulation of cells with metastatic properties.
  • Angiogenesis inhibitors e.g. angiostatin, endostatin, AvastinTM or VEGF trap technology
  • GP153 inhibitors can be used in combination with GP153 inhibitors as an effective anti- cancer therapy.
  • Such a combination can be expected to have a synergistic effect. This may also allow the use of a lower dose of GP 153 inhibitor or anti-angiogenic agent or both in chemotherapy. This is desirable because it is likely to cause less toxicity in patients.
  • GP153 inhibitors also can be used in combination with agents that create a hypoxic environment to enhance the effect of GP153 inhibitor.
  • Hypoxia i.e., lack of oxygen
  • mammalian cells activate and express multiple genes. Tumor cells may respond to hypoxia by diminishing their proliferative rates leaving the cells viable but nonproliferating. Some transformed cell lines can also undergo apoptosis in extreme hypoxia and an acidic environment.
  • agents that induce a hypoxic environment may sensitize tumor cells to inhibition of GP 153 and use of hypoxia inducing agents in combination with inhibiting GP 153 is therefore another promising therapeutic strategy.
  • An increase in apoptosis has been associated with a decrease in tumor proliferation.
  • Tumor necrosis factor-related apoptosis- inducing ligand TRAIL
  • a number of cell regulatory pathways such as Rb/E2F pathway, the c-Myc transcription factor, and the Ras signaling molecule have also been shown to control not only cell proliferation but also pathways leading to apoptosis.
  • GP153 antagonist or inhibitor with reagents that activate apoptotic signals, or inhibit survival signals, can also be used for cancer therapy.
  • Survival signals that recently have been shown to modulate apoptotic signaling include the focal adhesion kinase (FAK), the phosphinositol 3 ' kinase (PI3 'K), and protein kinase B (PKB, also known as Akt).
  • a composition of the invention typically contains from about 0.1 to 90% by weight (such as 1 to 20% or 1 to 10%) of a therapeutic agent of the invention in a pharmaceutically accepted carrier.
  • Solid formulations of the compositions for oral administration can contain suitable carriers or excipients, such as corn starch, gelatin, lactose, acacia, sucrose, microcrystalline cellulose, kaolin, mannitol, dicalcium phosphate, calcium carbonate, sodium chloride, or alginic acid.
  • Disintegrators that can be used include, without limitation, microcrystalline cellulose, corn starch, sodium starch glycolate, and alginic acid.
  • Tablet binders that can be used include acacia, methylcellulose, sodium carboxymethylcellulose, polyvinylpyrrolidone(PovidoneTM), hydroxypropyl methylcellulose, sucrose, starch, and ethylcellulose.
  • Lubricants that can be used include magnesium stearates, stearic acid, silicone fluid, talc, waxes, oils, and colloidal silica.
  • Liquid formulations of the compositions for oral administration prepared in water or other aqueous vehicles can contain various suspending agents such as methylcellulose, alginates, tragacanth, pectin, kelgin, carrageenan, acacia, polyvinylpyrrolidone, and polyvinyl alcohol.
  • the liquid formulations can also include solutions, emulsions, syrups and elixirs containing, together with the active compound(s), wetting agents, sweeteners, and coloring and flavoring agents.
  • Various liquid and powder formulations can be prepared by conventional methods for inhalation into the lungs of the mammal to be treated.
  • frijectable formulations of the compositions can contain various carriers such as vegetable oils, dimethylacetamide, dimethylformamide, ethyl lactate, ethyl carbonate, isopropyl myristate, ethanol, polyols (glycerol, propylene glycol, liquid polyethylene glycol, and the like).
  • Physiologically acceptable excipients can include, for example, 5% dextrose, 0.9% saline, Ringer's solution or other suitable excipients.
  • Intramuscular preparations e.g., a sterile formulation of a suitable soluble salt form of the compounds
  • a pharmaceutical excipient such as Water-for-Injection, 0.9% saline, or 5% glucose solution.
  • a suitable insoluble form of the compound can be prepared and administered as a suspension in an aqueous base or a pharmaceutically acceptable oil base, such as an ester of a long chain fatty acid (e.g., ethyl oleate).
  • a topical semi-solid ointment formulation typically contains a concentration of the active ingredient from about 1 to 20%, e.g., 5 to 10%, in a carrier such as a pharmaceutical cream base.
  • formulations for topical use include drops, tinctures, lotions, creams, solutions, and ointments containing the active ingredient and various supports and vehicles.
  • the optimal percentage of the therapeutic agent in each pharmaceutical formulation varies according to the formulation itself and the therapeutic effect desired in the specific pathologies and correlated therapeutic regimens.
  • a transdermal pharmaceutical formulation can be administered to a patient by applying to the skin of the patient a transdermal patch containing the pharmaceutical formulation, and leaving the patch in contact with the patient's skin (generally for 1 to 5 hours per patch).
  • the pharmaceutical formulation(s) can also be administered via other conventional routes (e.g., parenteral, subcutaneous, intrapulmonary, transmucosal, intraperitoneal, intrauterine, sublingual, intrathecal, or intramuscular routes) by using standard methods.
  • the pharmaceutical formulations can be administered to the patient via injectable depot routes of administration such as by using 1-, 3-, or 6-month depot injectable or biodegradable materials and methods.
  • the therapeutic protein or antibody agent typically is administered at a daily dosage of 0.01 mg to 30 mg/kg of body weight of the patient (e.g., lmg/kg to 5 mg/kg).
  • the pharmaceutical formulation can be administered in multiple doses per day, if desired, to achieve the total desired daily dose.
  • the effectiveness of the method of treatment can be assessed by monitoring the patient for known signs or symptoms of a disorder.
  • the pharmaceutical compositions of the invention may be included in a container, package or dispenser alone or as part of a kit with labels and instructions for administration. These compositions can also be used in combination with other cancer therapies involving, e.g., radiation, photosensitizing compounds, anti- neoplastic agents and immunotoxics.
  • Non-Human Mammals Genetically Modified with Respect to GP153 Genetically Modified with Respect to GP153 General Considerations
  • This invention provides genetically modified nonhuman transgenic mammals, e.g., mice, at least some of whose cells whose somatic cells express a recombinant gene encoding GP153. Such mammals can be used to study the effect of GP153 expression on tumorigenicity and tumor development, to study the role of GP153 on normal tissue development and differentiation, to identify via array CGH regions of the genome whose amplification or deletion is correlated with GP153 status, and to screen for and establish toxicity profiles of anti-cancer drugs.
  • This invention also provides transgenic non-human mammals with targeted disruption of one or both copies of the endogenous GP153 gene.
  • Animal models according to the invention can be conventional germline transgenic animals or chimeric animals.
  • This invention provides an inducible cancer model to study tumor biology and to screen for anti-cancer drugs.
  • the inducible cancer model is a mouse whose genome has been modified to include: (a) an expression construct comprising a GP153 coding sequence operably linked to an inducible promoter, and (b) a genetic mutation that causes the mouse to have greater susceptibility to cancer than a mouse not comprising the genetic mutation.
  • expression of the GP153 coding sequence leads to development of cancer in the transgenic mouse. The cancer regresses when expression of the GP153 coding sequence is reduced or eliminated.
  • Mutations that render the animal more susceptible to cancer include disabling mutations in a tumor suppressor gene (e.g., INK4a), disabling mutations in a DNA repair gene (e.g., MSH2), and activating mutations in an oncogene (e.g., myc and ras).
  • a tumor suppressor gene e.g., INK4a
  • a DNA repair gene e.g., MSH2
  • activating mutations in an oncogene e.g., myc and ras.
  • an oncogene e.g., myc and ras.
  • the animal's genome comprises (i) a first expression construct containing a gene encoding a reverse tetracycline transactivator operably linked to a promoter, such as any tissue or cell type-specific promoter or any general promoter, and (ii) a second expression construct containing the GP153 coding sequence operably linked to a promoter that is regulated by the reverse tetracycline transactivator and tetracycline (or a tetracycline analogue, for example, doxycycline).
  • a promoter such as any tissue or cell type-specific promoter or any general promoter
  • a second expression construct containing the GP153 coding sequence operably linked to a promoter that is regulated by the reverse tetracycline transactivator and tetracycline (or a tetracycline analogue, for example, doxycycline).
  • This animal model can be used to determine the efficacy of a candidate compound in preventing or treating cancer.
  • This method involves administering to the animal a candidate compound and observing the effect of the compound on tumor development, maintenance, angiogenesis and/or progression in the animal. Regression and/or reduction of tumor size in the presence of the compound is indicative of the effectiveness of the compound.
  • the effect of a candidate compound on the level of GP153 mRNA, protein, or activity in the animal or cell lines derived from the mammal (or cell lines transfected with the gene) can be used to identify the candidate as an agonist or antagonist.
  • the ability to compare the effect of a test compound to that of genetically switching off the inducible oncogene in this system allows the identification of surrogate markers that are predictive of the clinical response to the compound.
  • the inducible model can be used to determine whether a compound can eradicate minimal residual tumor. Normally in the inducible model, a tumor regresses when the GP153 gene is switched from “on” to "off via the inducible promoter. But if a compound can eradicate minimal residual tumor, switching the gene back on after administration of the compound will not bring back the tumor.
  • the animal model can also be used to identify other cancer-related elements. To do this, a detailed expression profile of gene expression in tumors undergoing regression or regrowth due to the inactivation or activation of the
  • GP153 transgene is established.
  • Techniques used to establish the profile include the use of suppression subtraction (in cell culture), differential display, proteomic analysis, serial analysis of gene expression (SAGE), and expression/transcription profiling using cDNA and/or oligonucleotide microarrays. Then, comparisons of expression profiles at different stages of cancer development can be performed to identify genes whose expression patterns are altered.
  • This animal model can also be used to identify molecular surrogates of GP153 in another manner. To do this, the expression of the GP153 gene is turned off by removal of the inducer, and another round of MaSS screening is performed using retro viral integration, cDNA complementation, or the genetic supressor elements (GSE) method.
  • GSE genetic supressor elements
  • the animal model also can be used to identify surrogate biomarkers for diagnosis or for following disease progression in patients.
  • the biomarkers can be identified based on the differences between the expression profiles of the "on" and “off states in the animal model. Blood or urine samples from the animal can be tested with ELIS As or other assays to determine which biomarkers are released from the tumor into circulation during tumor genesis, maintenance, or regression (when GP153 is turned off). These biomarkers are particularly useful clinically in following disease progression post anti-GP153 therapy.
  • GP153 expression and/or activity is up-regulated in tumor cells
  • the above-described nucleic acid probes or antibodies are used to quantify the expression level of GP153 in a tissue sample.
  • An increase in that level relative to control is indicative of cancerous, neoplastic, or hyperplastic pathology of the tissue sample.
  • This type of test can be performed using conventional techniques such as RT-PCR, ribonuclease protection assays, in situ hybridization, Northern blot analysis, FISH, CGH, array CGH, SKY, or immunohistochemistry.
  • a GP153 polypeptide may be elevated in a tissue sample (e.g., blood or urine) of cancer patients relative to that of normal individuals. This elevation can be detected, e.g., by ELISAs, radioimmunoassays, or protein chip assays. Such tests may not be useful only for diagnosis of GP153 -related diseases such as cancers, but also for monitoring the progress of therapy using GP153 inhibitors.
  • tissue sample e.g., blood or urine
  • ELISAs e.g., radioimmunoassays, or protein chip assays.
  • Such tests may not be useful only for diagnosis of GP153 -related diseases such as cancers, but also for monitoring the progress of therapy using GP153 inhibitors.
  • EXAMPLES The invention is further illustrated by the following examples. The examples are provided for illustrative purposes only, and are not to be construed as limiting the scope or content of the invention in any way.
  • Example 1 MaSS Screening Identification of the Gene This example describes the procedures for identifying the GP153 gene by MaSS screening.
  • Mo-MuLV producer cell line TMJ (NTH3T3 based cell line) was plated to the required number of plates (100 mm). These cells were cultured and maintained in RPMI media with 10% FBS. For viral production, TMJ cells were fed with 4-5 ml of fresh culture media, and culture supernatant was harvested 8-12 hours later. The supernatant was filtered through a 0.45 ⁇ M filter. Meanwhile, doxycycline-dependent, RAS-induced melanoma cells (R545 cells) were maintained in RPMI media with 10% fetal calf serum in the presence of doxycycline (2 ⁇ g/mi).
  • the R545 cells were infected with the filtered viral supernatant in the presence of polybrene (6-8 ⁇ g/ml). From this point on, the R545 cells were maintained in the absence of doxycycline. Eighteen hours after infection, infected R545 cells were trypsinized, rinsed and resuspended in Hanks' Balanced Salt Solution. Cell suspensions were kept on ice and the handling time after trypsinization was kept to a minimum. About 1 X 10 6 cells were injected onto the flank of SCE) mice fed with water without doxycycline. The animals were observed for tumor development.
  • polybrene 6-8 ⁇ g/ml
  • Control animals were similarly injected with 1 X 10 6 uninfected R545 cells. Tumors typically developed after approximately 21 days. Tumors were harvested and tumor tissues were immediately snap-frozen in liquid nitrogen. DNA was isolated from tumor tissues using the PUREGENETM DNA isolation kit. 10 ⁇ g of genomic DNA was digested to completion with either BamHI or SacII and the reaction was terminated by incubation at 65°C for 20 minutes. The digested samples were self-ligated in a diluted 600 ⁇ l reaction volume using 4000 U of high concentration T4 Ligase (NEB, Cat. # M0202M). The ligation was performed overnight to 24 hrs at 16°C. The ligated DNA was precipitated with ethanol and dissolved in 40 ⁇ l of sterile water.
  • the ligated DNA was then serially diluted to 1:10 and 1:100 ratios and subjected to inverted polymerase chain reaction (IPCR).
  • IPCR inverted polymerase chain reaction
  • the PCR reaction mix had a total volume of 50 ⁇ l and contained l ⁇ l of the ligated DNA, 25 nmol of each dNTP, 10 pmol each of the forward and reverse primers, 1 X Buffer 2, and 2.5 U of Enzyme Mix in the EXPAND Long Template PCR System (Roche).
  • Amplification was performed as follows: 92°C for 2 min, then 10 cycles of (92°C for 10 sec, 63° for 30 sec, 68°C for 15 min), then 20 cycles of (92°C for 10 sec, 63°C for 30 sec, 68°C for 15 min, and a 20 sec auto extension), and a final extension step at 68°C for 30 min (TETRADTM Thermocycler, MJ Research).
  • the primer sets used in JPCR were: S5'1F: GAGGCCACCTCCACTTCTGAGAT (SEQ ID NO:15);
  • S5'2F CAUCAUCAUCAUCCTGCCCCCTCTCCCATAGTGT (SEQ ID NO:17);
  • S5'2R CUACUACUACUAGGCGTTACTGCAGTTAGCTGGCT (SEQ ID NO:18); S3 ' IF: GGCTGCCATGCACGATGACCTT (SEQ ID NO: 19);
  • S3'2F CUACUACUACUAGGGAGGGTCTCCTCAGAGTGATT (SEQ ID NO:21);
  • S3'2R CAUCAUCAUCAUGGAAAGCCCGAGAGGTGGT (SEQ ID NO:22); B3 ' 1R: CGGGAAGGTGGTCGTCGGTCT (SEQ ID NO:23); and
  • B3'2R CAUCAUCAUCAUGGGGCCCCGAGTCTGTAATTT (SEQ LD NO:24).
  • BamHI 5' cloning primary PCR was done by using S5'1F and S5'1R followed by nested PCR using S5'2F and S5'2R.
  • BamHI 3 ' cloning primary PCR was done by using S3 ' IF and B3 ' 1R followed by nested PCR using S3 '2F and B3 '2R.
  • SacII 5 ' cloning primary PCR was done by using S5 ' IF and S5'1R followed by nested PCR using S5'2F and S5'2R.
  • Retroviral leader sequences were trimmed from the raw sequences of IPCR products, and homology searches for the trimmed sequences were performed in the NCBI MGSCV3 database by using the BLAST software program.
  • BLAST hits were analyzed and recurrent sites of integration in multiple mouse tumors were identified. Recurrence was defined as 2 or more integrations within a 10 kb region.
  • NCBI Map View was used to identify the site of each recurrent retroviral integration onto the mouse genome. Genes immediately neighboring the site were identified by using the MGSCV3 Gene map. These genes were defined as candidate cancer-related genes because in the vast majority of cases, MuLV integration affects the most proximal genes. When the integration occurred within a gene, that gene was deemed the best candidate as the target for the effects of retroviral integration.
  • Example 2 Expression in Human Tumors and Tumor Cell Lines This example describes the protocols for expressing the candidate gene identified above in human cancer cells. Primer pairs for each human gene are designed as described for the mouse gene. Expression of each candidate gene is assessed in a panel of 31 human cancer cell lines and 47 human primary tumors by using real-time reverse transcription PCR. The forward and reverse primers are 5'- ccatgattagcaggccttatagc -3' (SEQ ID NO:25) and 5'- ccaggtcaaacaactctgcaaa -3' (SEQ ID NO:26), respectively.
  • RNA is prepared from the cells using QIAGEN RNEASYTM mini-prep kits and QIAGEN RNEASY maxi-prep columns.
  • RNA preparations are treated with DNase during column purification according to manufacturer's instructions. Expression of each gene is determined in triplicate for all tumors and cell lines using SYBR green-based real-time PCR. To do this, 2X SYBR green PCR master mix (ABI) is mixed with the MULTISCRIBETM reverse transcriptase (ABI) and RNase inhibitor (ABI). Forward and reverse primers are added at ratios previously optimized for each gene using control human reference RNA (Stratagene). 50 ng of RNA template is used per reaction, and the reactions are performed in a total volume of 20 ⁇ l. Real-time quantification is performed using the ABI 7900HT and SDS2.0 software. RNA loading is normalized for ⁇ -actin and 18S rRNA. RNA quantity is determined relative to human universal reference RNA (Stratagene) to permit run-to-run comparisons.
  • Example 3 Inhibition of Human Cancer Cell Lines by siRNA
  • Double-stranded siRNA oligonucleotides were designed using the OligoEngine siRNA design tool (http ://www.oligoengme.com). HPLC purified siRNA oligonucleotides were incubated at 95°C for 1 minute, 37°C for 1 hour, and room temperature for 30 minutes. The siRNAs were stored at -20°C prior to use. Human cancer cell lines were transfected with siRNA using the Oligofectamine reagent from Invitrogen. Transfected cells were allowed to grow for at least 24 hours.
  • the cells were then trypsinized and reseeded for growth curve analysis or growth in soft agar.
  • early passage cell lines were seeded at 2 X 10 4 cells per well in 12-well plates.
  • 24 (Day 1), 48 (Day 2), 72 (Day 3), 96 (Day 4) and 120 hours (Day 5) after plating duplicate plates of cells were washed, fixed in 10% buffered formalin, and stained with crystal violet for 30 minutes at room temperature. Stained cells were washed in double distilled water, and stain was extracted using 10% acetic acid. Absorbance of the extracted stain was read at 590 nm. The mean absorbance per well of duplicate cultures was determined. Colony formation assay.
  • SKOV3 1 38 n/c 90 Values shown for expression indicate the level of expression of GP-153 in cells transfected with the siRNA to GP-153 as a percentage of the level of expression of GP-153 in cells transfected with the negative control siRNA. Values shown for apoptosis indicate the level of apoptosis of GP-153 in cells transfected with siRNA to GP-153 relative to the level of apoptosis in cells transfected with the negative control siRNA. Values shown for colony growth in soft agar indicate the number of colonies formed in soft agar by cells transfected with siRNA to GP- 153 as a percentage of the number of colonies formed in soft agar by cells transfected with the negative control siRNA.
  • n/c indicates no change as compared to the negative control.
  • Significant inhibition of growth in soft agar was observed in SW620 colon carcinoma and LNCAP prostate carcinoma cell lines upon inhibition of GP-153 expression with 3 independent siRNAs. No significant inhibition of growth in soft agar was observed in 8 other human cancer cell lines tested. This suggested that GP-153 is essential for tumorigenesis and/or tumor maintenance in specific tumor settings. Growth curve experiments also can be performed in a similar manner to the experiment described above, but in a hypoxic chamber under conditions where the oxygen level is reduced to 0.2 - 1.0%. Growth of cells under hypoxic conditions in the face of inhibition of GP153 by siRNA is assessed at 6 (Day 0), 24 (Day 1), 48 (Day 2), 72 (Day 3), 96 (Day 4) and 120 hours (Day 5) after plating.
  • Example 4 MEF Transformation This example describes the protocols for using the candidate gene to transform mouse embryonic fibroblasts.
  • MEFs are isolated from 100 individual 13.5-day-old embryos. The isolated MEFs are pooled and grown in DMEM supplemented with 10% FBS, penicillin and streptomycin.
  • pl6 Ink4a /pl9 Arf -/- mouse embryonic fibroblasts are transfected with: (1) pKO-Myc; (2) pKO-Myc andpT24- RasV12; (3) pKO-Myc and GP153 cDNA (GeneCopeia); or (4) pKO-Myc, pT24- RasV12, and GP153 cDNA (GeneCopeia). All transfections are done in duplicate cultures (8 X 10 5 cells) using Lipofectamine PlusTM in Optimem (Gibco) without serum or antibiotics. Cultures are split 1:3 a day after transfection. Foci are counted on day 12.
  • Example 5 Inhibition of Tumor Growth by si RNA in Tumor Explant Models
  • Human cancer cell lines are infected with a retrovirus driving constitutive expression of luciferase.
  • Stable cell lines expressing high levels of luciferase are selected using antibiotic resistance markers in the integrated retrovirus.
  • These cell line are then transfected with siRNA using the Oligofectamine reagent from Invitrogen.
  • Transfected cells are allowed to grow for at least 24 hours. The cells are then trypsinized and resuspended in Hank's Buffered Salt Solution.
  • One million cells are injected subcutaneously into the flanks of BalbC nude mice.
  • Mice are imaged daily to determine the size of each tumor based upon the level of luciferase detected, an indicator of the number of tumor cells present. Imaging is performed by intra-peritoneal injection of 250 ⁇ g of luciferin per gram of mouse weight. Luminescence is detected using a cooled CCD camera and quantification of image intensity, a measure of tumor size, is performed using Winlight 32 software from Berthold.
  • Example 6 Effect of shRNA on Human or Mouse Cancer Cell Lines in SCIDs
  • Human cancer cell lines expressing high levels of GP 153, or cell lines established from the inducible mouse cancer model described above, are transfected with a vector encoding a short hairpin RNA (shRNA) homologous to GP153 gene. Expression of the shRNA is placed under the control of an inducible U6 promoter. Stable cell lines are established. Approximately 5 X 10 5 cells are injected subcutaneously into the flank of 6 week old female inbred SCID mice. Tumor formation is observed visually. For cell lines derived from the inducible mouse model, tumor formation is induced by doxycycline. Expression of the shRNA is induced once tumors were visually identified.
  • shRNA short hairpin RNA
  • mice are fed with doxycycline. Tumor regression is followed using calipers to measure the shrinking tumor diameter.
  • Example 7; Tumor Formation in SCIDs Tumor cells derived from the tumor suppressor null (LNK4/arf -/-) doxycycline-inducible oncogene mouse model are infected with retrovirus encoding the candidate gene under the control of an IPTG-inducible promoter. Stable cell lines are established. 10 cell are injected subcutaneously into the flank of 6 week old female inbred SCID mice. Mice are fed with doxycycline for 7-12 days. 24 hours prior to doxycycline withdrawal, mice are fed XPTG.
  • LNK4/arf -/- tumor suppressor null
  • Example 8 Effect of Anti-GP153 Antibody on Human Cancer Cell Lines
  • a panel of human cancer cell lines is examined for expression of mRNAs encoding GP153.
  • the human cancer cells are cultured in 10 cm tissue culture dishes until 95% confluence.
  • the total cellular RNA is harvested using Trizol (Invitrogen) and used in real time PCR for determination of mRNA expression.
  • Specific PCR primers are designed using Primer 3 software (Whitehead Institute).
  • the quantitative real time PCR is conducted in an ABI Prism 7900HT Sequence Detection System (AB Applied Biosystems) using human beta-2 microglobulin as internal control.
  • mRNA The relative expression of mRNA is derived using the software of the equipment and calculated with Microsoft Excel.
  • Human cancer cell lines expressing GP 153 mRNA are chosen for further testing with anti-GP 153 antibody.
  • soft agar and MTT assays are used.
  • human cancer cells are inoculated into 12-well tissue culture plates at densities of 20,000 to 50,000 cells/well and incubated at 37°C for 24 to 40 hours. Then, the cells in the plates are treated with different concentrations of antibody for 48 hours.
  • the cells are harvested by trypsinization and inoculated into soft agar or fresh 24-well plates for soft agar and MTT assay, respectively.
  • soft agar assay antibody-treated cells in soft agar are incubated at 37°C for 5 days. Fresh media containing antibody are added to the wells on day 3 and the colonies are counted on day 5.
  • MTT assay antibody-treated cells in 24-well plates are incubated at 37°C for 48 hours. After washing the cells with PBS, fresh media containing MTT are added to the wells and the plates are incubated at 37°C for an additional 24 hours. The amount of MTT converted by living cells is determined by photo- spectrometry.
  • Example 9 GP153 shRNA competition in vivo
  • the tumor maintenance function of GP153 was validated in vivo using an inducible shRNA system and tumor xenografts.
  • the inducible shRNA system employed was an in vivo RNAi competition assay.
  • HCT116/Tet repressor cells individually expressing approximately a dozen shRNAs against genes of interest were mixed and injected into SCID mice. The mice then were divided into two groups: one group received doxycycline to induce the expression of shRNAs and the other group did not.
  • the representation of the cells expressing each individual shRNA in the tumor samples harvested was measured by quantitative PCR analysis.
  • the target gene has an essential role in tumor viability or maintenance. If the abundance of a particular shRNA in tumors is increased upon doxycycline treatment, the target gene has a negative role in tumor growth. If the abundance is unchanged, the gene has no effect on tumor growth.
  • HCT116/Tet repressor cells were first engineered to express an shRNA against a gene of interest as previously described. These cells were cultured in vitro separately in DMEM with 10% Fetal Bovine Serum, and then harvested and mixed in equal ratio.
  • the mixed population of cells was injected into 20 SCID mice (10e+6 cells per injection, 2 injection sites per mouse). The mice were then divided into two groups: one group received doxycycline at day 6 to induce the expression of shRNAs and the other group did not.
  • the tumors were collected at day 26.
  • the DNA was extracted (Qiagen genomic DNA extraction kit) followed by quantitative PCR with SYBR green (Qiagen) to examine the abundance of the shRNA hairpins using a vector specific primer (pLentiTO2B_l, CTCGACGGTATCGCTAGTCC (SEQ ID NO:27) and a hairpin-specific primer (Table 2).
  • pLentiTO2B_l CTCGACGGTATCGCTAGTCC
  • SEQ ID NO:27 a hairpin-specific primer
  • Table 2 a hairpin-specific primer
  • HCT116/Tet repressor cells individually expressing a dozen shRNAs against genes of interest were cultured in vitro separately and then mixed in equal ratio at concentration of 10 7 cells/ml.
  • the mixed population of cells was mixed with MatrigelTM (1:1) and injected into 20 SCID mice (10 6 cells/0.2 mis per injection, 2 injection sites per mouse). The mice were then divided into two groups: one group received doxycycline at day 6 to induce the expression of shRNAs and the other group did not.
  • the tumors were collected at day 21.
  • the DNA was extracted (Qiagen). Equal amount of DNA from tumors with or without doxycycline treatment was pooled into two separate samples. Quantitative PCR with SYBR green (Qiagen) was used to examine the abundance of the shRNA hairpins using a vector specific primer, pLentiTO2B_l CTCGACGGTATCGCTAGTCC (SEQ ID NO:38), and a hairpin-specific primer (listed in Table 3) in the two groups of DNA.
  • the polymerase was first activated at 95°C for 15 minutes, followed by 40 cycles of denaturation at 95°C, annealing at 54°C and elongation at 72°C.
  • the representation of the cells expressing each individual shRNA in the tumor samples was calculated.
  • the abundance of the cells expressing PTK-7 hai ⁇ in 1 or 2 was decreased by 92.6% or 58.1% respectively in tumors exposed to doxycycline compared to that in untreated tumors.
  • Table 3 In vivo RNAi competition
  • a conventional Protein A purification technique was used to obtain an IgG fraction from the GP153SD1 and GP153SD3 sera.
  • This partially purified polyclonal antibodies were subjected to fluorescence activated cell sorting (FACS) analysis, using cells known to display GP153 on their surface. This analysis demonstrated that the GP153 polyclonal antibodies were binding specifically to the GP153 extracellular domain.
  • FACS fluorescence activated cell sorting
  • Test bleeds were assessed every month, until the titers remained high (EC50 ⁇ 10-3).
  • Spleens from mice immunized with GP153Fc were isolated and fused with human FO myeloma cells.
  • the fusion products were plated into 96-well plates and subsequently tested by ELISA.
  • Supernatants from fusion products that were positive by ELISA displayed EC50 values that ranged from 0.1 to ⁇ 10-3. Fusion products from the positive wells will be further subcloned and tested to generate monoclonal hybridoma lines.
  • Example 11 In vitro validation of GP153 using shRNA and antibodies Lentiviral vectors expressing interfering dsRNA against PTK7 were generated to modulate the expression of PTK7 in vitro and in vivo and assess its possible role in tumor maintenance. Lentiviral vectors expressing sequences encoding interfering dsRNA agains PTK7 were generated. To target specific regions of a PTK7 mRNA, the following oligonucleotides were used with a primer specific to the U6 small RNA promoter to form double-stranded DNA in a polymerase chain reaction, using a vector containing this U6 promoter as a template.
  • the PCR product was then ligated into a pENTRl 1 vector (Invitrogen) into which the inducible U6TO2B promoter (described in WO 2004/056964) was cloned. Expression of the insert resulted in expression of a short hai ⁇ in RNA.
  • the hai ⁇ in structure displayed inhibitory effects on PTK7 expression.
  • the sequence of the sense-loop-antisense sequence is shown below for each shRNA transcript. Termination of shRNA transcription is caused by addition of four or more Ts after the shRNA sequence. This results in the terminal UU doublet below:
  • PTK7_1130-1154 shRNA transcript PTK7 target nucleotides (in boldface) GGCCAAUGUUGCUGAAAGGGAGCUUCCUGUCACUCACUUUCAGCAA UAUUGGCCUU (SEQ ID NO:51) (2) PTK7_1996-2020 shRNA transcript. PTK7 target nucleotides (in boldface)
  • the U6TO2B-PTK7 shRNA expression cassettes generated were subsequently shuttled into the pLenti ⁇ lentiviral vector using LR Clonase (Invitrogen V496-10 and 11791-019). Lentiviruses were generated using Invitrogen's packaging system. Briefly, 6 ⁇ g of lentiviral DNA was mixed with 6 ⁇ g of packaging mix from the ViraPower lentiviral support kit (Invitrogen K4970- 00), and transfected into 293T cells using Lipofectamine 2000 (Invitrogen 11668- 027).
  • HCT116 Human colorectal carcinoma cells, HCT116, were previously infected with retroviruses containing a luciferase expression construct containing the hygromycin resistance gene. After selection with hygromycin (50 ⁇ g/ml), the cells were subsequently infected with lentiviruses expressing a codon-optimized version of TetR (gpTetR), under the control of the PGK promoter.
  • the gpTetR expression construct contains a Zeocin resistance gene.
  • the stably transfected cells were selected with Zeocin (50 ⁇ g/ml) and then subcloned. Single clones were tested for adequate gpTetR expression, using real time RT-PCR, and subsequently infected with lentiviral vectors containing two different PTK7 shRNAs under the control of the inducible promoter U6TO2B, or no hai ⁇ in (empty vector). Following selection, cells were grown with or without doxycycline, and tested for: (a) expression of PTK7, (b) ability to form colonies on soft agar, and (c) growth kinetics.
  • Cells were grown for 72 hours with and without doxycycline (1 ⁇ g/ml in DMEM, 10% FBS, 1% penicillin-streptomycin, 10 ⁇ g/ml blasticidin, 50 ⁇ g/ml zeocin and 50 ⁇ g/ml hygromycin). Medium was changed every 24 hours.
  • Table 6 summarizes results from experiments showing that in the presence of doxycycline, cell surface expression of PTK7 was decreased in cells expressing the PTK7 hai ⁇ ins, but not decreased in cells transfected with the empty vector.
  • MTT assay cells were plated in 24-well plates. After 72 hours, supernatant was removed and replaced with fresh media containing 3-4, 5- dimethylthiazol-2-yl-2,5diphenyl tetrazolium bromide (0.5 mg/ml in media). Cells were then incubated for four hours, and lysed in 0.4 N HCl in isopropanol to assess uptake of the chemical by live cells. Low OD 580 values indicate inability to take up the chemical, as a result of cell death. Table 6: MTT Assay Results
  • Cyquant analysis Cells were seeded as above (except 1,000 cells cell/cell in a 96-well plate). Media with and without doxycycline were changed every 48 hours. After 96 hours, the media were removed and the plates frozen at -20°C. Cell proliferation was quantified by Cyquant Cell Proliferation KitTM (Molecular Probes C7026) as follows. The cell plate was thawed at room temperature and 150 ⁇ l cyquant solution (according to vendor's instructions) was added to each well. The plate was then incubated at 37°C for 30 minutes, and the signal was recorded on a fluorescent plate reader with excitation at 485 nm and emission at 528 nm.
  • HCT116-Luc-TetR cells expressing PTK7 hai ⁇ ins or empty vector were grown in soft agar with and without doxycycline for seven days. The number of colonies was assessed for each sample and condition. Briefly, 2 x 10 3 cells were mixed with top agar mix ( 2 x DMEM, 10% FBS, and SeaPlaque agarose, for a final concentration of 0.4% agarose) over a layer of bottom agarose (0.8% final agarose concentration). Media were added the next day (plus or minus doxycycline) and replenished every 24 hours. Colonies were counted after six days in culture. The average number of colonies per well is shown in Table 8 below. Table 8: Colony Formation in Soft Agar

Abstract

L'invention concerne l'utilisation de molécules associées au gène GP153 (PTK-7) pour traiter le cancer et d'autres états hyperprolifératifs. L'invention concerne également des mammifères non humains présentant une modification génétique associée au gène GP153, ainsi que leur utilisation en tant que modèles expérimentaux du cancer.
PCT/US2004/042505 2003-12-19 2004-12-17 Gp153 : methodes et compositions de traitement du cancer WO2005063987A1 (fr)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US53125103P 2003-12-19 2003-12-19
US60/531,251 2003-12-19

Publications (1)

Publication Number Publication Date
WO2005063987A1 true WO2005063987A1 (fr) 2005-07-14

Family

ID=34738633

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2004/042505 WO2005063987A1 (fr) 2003-12-19 2004-12-17 Gp153 : methodes et compositions de traitement du cancer

Country Status (1)

Country Link
WO (1) WO2005063987A1 (fr)

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP2380909A1 (fr) * 2010-04-26 2011-10-26 Max-Planck-Gesellschaft zur Förderung der Wissenschaften e.V. Protéine PTK-7 impliquée dans le cancer du sein
US9505845B2 (en) 2005-12-08 2016-11-29 E. R. Squibb & Sons, L.L.C. Treating lung cancer using human monoclonal antibodies to protein tyrosine kinase 7 (PTK7)
WO2024038144A1 (fr) * 2022-08-18 2024-02-22 Tribune Therapeutics Ab Agents inhibant la signalisation induite par un ligand ccn pour traiter une maladie

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1996037610A2 (fr) * 1995-05-25 1996-11-28 MAX-PLANCK-Gesellschaft zur Förderung der Wissenschaften e.V. Cck-4, une tyrosine kinase recepteur, techniques diagnostiques et therapeutiques de troubles de la transduction du signal cck-4
WO2004017992A2 (fr) * 2002-08-24 2004-03-04 Oxford Glycosciences (Uk) Ltd Proteine impliquee dans le carcinome

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1996037610A2 (fr) * 1995-05-25 1996-11-28 MAX-PLANCK-Gesellschaft zur Förderung der Wissenschaften e.V. Cck-4, une tyrosine kinase recepteur, techniques diagnostiques et therapeutiques de troubles de la transduction du signal cck-4
WO2004017992A2 (fr) * 2002-08-24 2004-03-04 Oxford Glycosciences (Uk) Ltd Proteine impliquee dans le carcinome

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
DATABASE UniProt 1 June 2003 (2003-06-01), XP002329427, Database accession no. Q86X91 *

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US9505845B2 (en) 2005-12-08 2016-11-29 E. R. Squibb & Sons, L.L.C. Treating lung cancer using human monoclonal antibodies to protein tyrosine kinase 7 (PTK7)
EP2380909A1 (fr) * 2010-04-26 2011-10-26 Max-Planck-Gesellschaft zur Förderung der Wissenschaften e.V. Protéine PTK-7 impliquée dans le cancer du sein
WO2024038144A1 (fr) * 2022-08-18 2024-02-22 Tribune Therapeutics Ab Agents inhibant la signalisation induite par un ligand ccn pour traiter une maladie

Similar Documents

Publication Publication Date Title
EP2407483A1 (fr) Procédé de traitement, de diagnostic ou de détection du cancer
JP2007524622A (ja) 抗癌治療に対する腫瘍細胞の感受性を回復させてアポトーシスを誘導するための組成物及び方法
AU2023203737A1 (en) Methods for diagnosing and treating metastatic cancer
KR100740974B1 (ko) Ｒｎａ 앱타머 및 그의 용도
WO2004050834A2 (fr) Gpc99 et gpc99a: compositions et methodes de traitement du cancer
EP3042955B1 (fr) Utilisation de rhoa dans le diagnostic du cancer et criblage d'inhibiteur
US20160075752A1 (en) B-type plexin antagonists and uses thereof
WO2005063987A1 (fr) Gp153 : methodes et compositions de traitement du cancer
Kuznetsov et al. The evolutionarily conserved single-copy gene for murine Tpr encodes one prevalent isoform in somatic cells and lacks paralogs in higher eukaryotes
WO2006023210A2 (fr) Gene gp132: techniques et compositions de traitement du cancer
KR20230048234A (ko) Dna 손상 복구 효율 조절용 조성물
WO2014005153A9 (fr) Procédés pour le traitement d'un cancer médié par la protéine mds1-evi1
US20070042980A1 (en) Gp131: methods and compositions for treating cancer
WO2005021724A2 (fr) Gp115: methodes et compositions permettant de traiter le cancer
WO2004043408A2 (fr) Gpc15 : methodes et compositions pour le traitement du cancer
WO2006053125A2 (fr) Gp201: procedes et compositions de traitement du cancer
WO2006053155A2 (fr) Gp202: procedes et compositions destines au traitement du cancer
US9644026B2 (en) Antibody against mutant α-actinin-4
US7335747B2 (en) Cancer associated gene mina 53, protein Mina 53 and monoclonal antibody thereof
WO2003104488A1 (fr) Utilisation de eef1a2 dans le pronostic, le diagnostic et le traitement du cancer
JPWO2005061704A1 (ja) 癌の予防・治療剤
JP6462632B2 (ja) 変異型α−アクチニン−４に対する抗体
WO2004046356A1 (fr) Exon 1$g(b) du gene $g(a) du recepteur du pdgf et son utilisation
JPWO2013035208A1 (ja) 変異型α−アクチニン−４に対する抗体

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BW BY BZ CA CH CN CO CR CU CZ DE DK DM DZ EC EE EG ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NA NI NO NZ OM PG PH PL PT RO RU SC SD SE SG SK SL SY TJ TM TN TR TT TZ UA UG US UZ VC VN YU ZA ZM ZW

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): BW GH GM KE LS MW MZ NA SD SL SZ TZ UG ZM ZW AM AZ BY KG KZ MD RU TJ TM AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IS IT LT LU MC NL PL PT RO SE SI SK TR BF BJ CF CG CI CM GA GN GQ GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
NENP Non-entry into the national phase

Ref country code: DE

WWW Wipo information: withdrawn in national office

Country of ref document: DE

122 Ep: pct application non-entry in european phase