WO2001055401A1 - Nouveau polypeptide, helicase atp-dependante humaine 31, et polynucleotide codant pour ce polypeptide - Google Patents
Nouveau polypeptide, helicase atp-dependante humaine 31, et polynucleotide codant pour ce polypeptide Download PDFInfo
- Publication number
- WO2001055401A1 WO2001055401A1 PCT/CN2001/000069 CN0100069W WO0155401A1 WO 2001055401 A1 WO2001055401 A1 WO 2001055401A1 CN 0100069 W CN0100069 W CN 0100069W WO 0155401 A1 WO0155401 A1 WO 0155401A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- polypeptide
- polynucleotide
- dependent helicase
- human atp
- sequence
- Prior art date
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/90—Isomerases (5.)
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
Definitions
- the present invention belongs to the field of biotechnology. Specifically, the present invention describes a new polypeptide, a human ATP-dependent helicase 31, and a polynucleotide sequence encoding the polypeptide. The invention also relates to a method and application for preparing the polynucleotide and polypeptide. Background technique
- the role of these proteins in the body is ATP-dependent.
- the distribution of such proteins in the body is very extensive.
- the presence of this protein is found in various organisms, which constitutes a large family of proteins, namely ATP-dependent Helicase superfamily.
- RNA structure such as splicing of precursor RNA, assembly of spliceosome, protein translation, etc.
- proteins are all necessary regulatory steps. These processes are usually regulated by a variety of different helicases.
- Helicases are detected in many biological systems where MA plays an important role. They are widely distributed in various tissues and organs from prokaryotes (including viruses) to lower and higher organisms. They are involved in cell and mitochondrial division, RNA editing, rRNA processing, transcription initiation, nuclear niRNA transport, and mRM. Degradation and other processes.
- Helicases are considered to be important factors in cell development and differentiation, and some of them also play a role in the transcription and replication of viral single-stranded NA [Arr i Ei sen, John C. Lucches i, Bioes says, 1998, 20: 634-641] 0 It provides an effective means for the diagnosis, prevention and treatment of cancer, nervous system diseases and immune system diseases in vivo.
- members of the ATP-dependent helicase superfamily contain multiple conserved sequence motifs, some of which are specific to members of the family; while others exist not only in members of the family, but also in some ATP-binding proteins Also exists.
- One of these sequence motifs is the "D-E-A-D box", which is present in the B motif of the ATP-binding protein.
- Other members of the helicase superfamily contain a "DEAH box", which replaces the asparagine residues in the "D-E-A-D box” with a set of amino acid residues.
- the structure of the box Motifs are specific to the helicase superfamily.
- the "DEAD box” and "D-E-AH box” all exist in the B structure motif of the ATP-dependent helicase, and the B structure motifs of all members of this family contain the following consensus sequence fragments: [LIVMF] (2) -DEAD- [R EN] -X- [LIVMFYGSTN]; The sequence fragment is a key site for regulating the ATP hydrolysis. The mutation of this motif will lead to the inhibition of ATP hydrolysis, which will affect the enzyme performance. Normal physiological function. ATP-dependent helicase is an important regulator in the process of cell development and differentiation. Some neurological diseases, immune system diseases, tumors and cancers are related.
- the new human ATP-dependent helicase of the present invention also contains a "DEA-D box” structure, which is a new member of the human DEAD / DEAH box ATP-dependent helicase family and is similar to other members of the family. Similar physiological functions.
- This protein regulates the development and differentiation of various cells in the body. The abnormal expression of this protein is usually closely related to the occurrence of some related nervous system diseases, immune system diseases and tumors and cancers in related tissues.
- the human ATP-dependent helicase 31 protein plays an important role in important functions in the body as described above, and it is believed that a large number of proteins are involved in these regulatory processes, there has been a need in the art to identify more human ATP-dependent participants in these processes.
- the helicase 31 protein in particular, identifies the amino acid sequence of this protein. Isolation of the newcomer's ATP-dependent helicase 31 protein encoding gene also provides a basis for research to determine the role of this protein in health and disease states. This protein may form the basis for the development of diagnostic and / or therapeutic drugs for diseases, so isolating its coding DNA is important. '' Disclosure of invention
- Another object of the invention is to provide a polynucleotide encoding the polypeptide.
- Another object of the present invention is to provide a recombinant vector containing a polynucleotide encoding a human ATP-dependent helicase 31.
- Another object of the present invention is to provide a genetically engineered host cell containing a polynucleotide encoding a human ATP-dependent helicase 31.
- Another object of the present invention is to provide a method for producing human ATP-dependent helicase 31.
- Another object of the present invention is to provide an antibody against the polypeptide of the present invention-human ATP-dependent helicase 31.
- Another object of the present invention is to provide mimetic compounds, antagonists, agonists, and inhibitors against the human ATP-dependent helicase 31 of the polypeptide of the present invention.
- Another object of the present invention is to provide a method for diagnosing and treating diseases associated with abnormalities of human ATP-dependent helicase 31.
- the present invention relates to an isolated polypeptide, which is of human origin and comprises: a polypeptide having the amino acid sequence of SEQ ID No. 2, or a conservative variant, biologically active fragment or derivative thereof.
- the polypeptide is a polypeptide having the amino acid sequence of SEQ ID NO: 2.
- the invention also relates to an isolated polynucleotide comprising a nucleotide sequence or a variant thereof selected from the group consisting of:
- sequence of the polynucleotide is one selected from: (a) a sequence having positions 158-997 in SEQ ID NO: 1; and (b) having a sequence of 1-1208 in SEQ ID NO: 1 Sequence of bits.
- the invention further relates to a vector, in particular an expression vector, containing the polynucleotide of the invention; a host cell genetically engineered with the vector, including a transformed, transduced or transfected host cell; and a method comprising culturing said Host cell and method of preparing the polypeptide of the present invention by recovering the expression product.
- a vector in particular an expression vector, containing the polynucleotide of the invention
- a host cell genetically engineered with the vector including a transformed, transduced or transfected host cell
- a method comprising culturing said Host cell and method of preparing the polypeptide of the present invention by recovering the expression product.
- the invention also relates to an antibody capable of specifically binding to a polypeptide of the invention.
- the invention also relates to a method for screening compounds that mimic, activate, antagonize or inhibit the activity of human ATP-dependent helicase 31 protein, which comprises utilizing the polypeptide of the invention.
- the invention also relates to compounds obtained by this method.
- the present invention also relates to a method for in vitro detection of a disease or disease susceptibility associated with abnormal expression of a human ATP-dependent helicase 31 protein, comprising detecting a mutation in the polypeptide or a polynucleotide sequence encoding the same in a biological sample, or Detection of the amount or biological activity of a polypeptide of the invention in a biological sample.
- the invention also relates to a pharmaceutical composition
- a pharmaceutical composition comprising a polypeptide of the invention or a mimetic thereof, an activator, an antagonist or an inhibitor, and a pharmaceutically acceptable carrier.
- the present invention also relates to the use of the polypeptide and / or polynucleotide of the present invention in the preparation of a medicament for treating cancer, developmental disease or immune disease or other diseases caused by abnormal expression of human ATP-dependent helicase 31.
- Nucleic acid sequence refers to an oligonucleotide, a nucleotide or a polynucleotide and a fragment or part thereof, and may also refer to a genomic or synthetic DNA or RNA, they can be single-stranded or double-stranded, representing the sense or antisense strand.
- amino acid sequence refers to an oligopeptide, peptide, polypeptide or protein sequence and fragments or portions thereof.
- amino acid sequence in the present invention relates to the amino acid sequence of a naturally occurring protein molecule
- polypeptide or “protein” does not mean to limit the amino acid sequence to a complete natural amino acid related to the protein molecule .
- a protein or polynucleotide “variant” refers to an amino acid sequence having one or more amino acids or nucleotide changes, or a polynucleotide sequence encoding it. The changes may include deletions, insertions or substitutions of amino acids or nucleotides in the amino acid sequence or nucleotide sequence.
- Variants may have "conservative" changes in which the substituted amino acid has a structural or chemical property similar to the original amino acid, such as replacing isoleucine with leucine. Variants can also have non-conservative changes, such as replacing glycine with tryptophan.
- “Deletion” refers to the deletion of one or more amino acids or nucleotides in an amino acid sequence or nucleotide sequence.
- Insertion means that a change in the amino acid sequence or nucleotide sequence results in an increase in one or more amino acids or nucleotides compared to a molecule that exists in nature.
- Replacement refers to the replacement of one or more amino acids or nucleotides with different amino acids or nucleotides.
- Bioactivity refers to a protein that has the structure, regulation, or biochemical function of a natural molecule.
- immunologically active refers to the ability of natural, recombinant or synthetic proteins and fragments thereof to induce a specific immune response in appropriate animals or cells and to bind to specific antibodies.
- An "agonist” is a molecule that, when combined with human ATP-dependent helicase 31, causes a change in the protein to regulate the activity of the protein.
- An agonist may include a protein, a nucleic acid, a carbohydrate, or any other molecule that can bind human ATP-dependent helicase 31.
- Antagonist refers to a molecule that can block or regulate the biological or immunological activity of human ATP-dependent helicase 31 when combined with human ATP-dependent helicase 31.
- Antagonists and inhibitors may include proteins, nucleic acids, carbohydrates or any other molecule that can bind to human ATP-dependent helicase 31.
- Regular refers to a change in the function of human ATP-dependent helicase 31, including an increase or decrease in protein activity, a change in binding characteristics, and any other biological properties, functions, or immunity of human ATP-dependent helicase 31 Change of nature.
- substantially pure 1 'means substantially free of other proteins, lipids, sugars or other substances with which it is naturally associated.
- Those skilled in the art can purify human ATP-dependent helicase 31 using standard protein purification techniques.
- the substantially pure human ATP-dependent helicase 31 can generate a single main band on a non-reducing polyacrylamide gel.
- the purity of the human ATP-dependent helicase 31 polypeptide can be analyzed by amino acid sequence.
- Complementary refers to the natural binding of a nucleotide by base-pairing under conditions of acceptable salt concentration and temperature.
- sequence "C-T-G-A” can be combined with the complementary sequence "G-A-C-T”.
- the complementarity between two single-stranded molecules may be partial or complete.
- the degree of complementarity between nucleic acid strands has a significant effect on the efficiency and strength of hybridization between nucleic acid strands.
- “Homology” refers to the degree of complementarity and can be partially homologous or completely homologous.
- Partially homologous means A partially complementary sequence that at least partially inhibits hybridization of a fully complementary sequence to a target nucleic acid. The inhibition of such hybridization can be detected by performing hybridization (Southern or Northern blotting, etc.) under conditions of reduced stringency. Substantially homologous sequences or hybridization probes can compete and inhibit the binding of completely homologous sequences to the target sequence under conditions of reduced stringency. This does not mean that the conditions of reduced stringency allow non-specific binding, because the conditions of reduced stringency require that the two sequences bind to each other as a specific or selective interaction.
- Percent identity refers to the percentage of sequences that are the same or similar in the comparison of two or more amino acid or nucleic acid sequences. The percent identity can be determined electronically, such as through the MEGALIGN program (Lasergene sof tware package, DNASTAR, Inc., Madison Wis.). The MEGALIGN program can compare two or more sequences according to different methods such as the Clus ter method (Higg ins, D. G. and P. M. Sharp (1988) Gene 73: 237-244). The Clus ter method arranges groups of sequences into clusters by checking the distance between all pairs. The clusters are then assigned in pairs or groups. The percent identity between two amino acid sequences such as sequence A and sequence B is calculated by:
- the percent identity between nucleic acid sequences can also be determined by the Clus ter method or by a method known in the art such as Jotun Hein ( Hein J., (1990) Methods in emzumology 183: 625-645) 0
- Similarity refers to the degree of identical or conservative substitutions of amino acid residues at corresponding positions in the alignment of amino acid sequences.
- Amino acids used for conservative substitutions for example, negatively charged amino acids may include aspartic acid and glutamic acid; positively charged amino acids may include lysine and arginine; having an uncharged head group is Similar hydrophilic amino acids may include leucine, isoleucine and valine; glycine and alanine; asparagine and glutamine; 'serine and threonine; phenylalanine and tyrosine .
- Antisense refers to a nucleotide sequence that is complementary to a particular DNA or RNA sequence.
- the "antisense strand” refers to a nucleic acid strand that is complementary to the “sense strand”.
- Derivative refers to a chemical modification of HFP or a nucleic acid encoding it. Such a chemical modification may be the replacement of a hydrogen atom with an alkyl group, an acyl group or an amino group. Nucleic acid derivatives can encode polypeptides that retain the main biological characteristics of natural molecules.
- Antibody refers to a complete antibody molecule and its fragments, such as Fa,? ( ⁇ ') 2 and?, Which specifically bind to the epitope of human ATP-dependent helicase 31.
- a “humanized antibody” refers to an antibody in which the amino acid sequence of a non-antigen binding region is replaced to become more similar to a human antibody, but still retains the original binding activity.
- isolated refers to the removal of a substance from its original environment (for example, its natural environment if it occurs naturally).
- a naturally occurring polynucleotide or polypeptide is not isolated when it is present in a living animal, but the same polynucleoside or polypeptide is separated from some or all of the substances that coexist in the natural system.
- Such a polynucleotide may be part of a certain vector, or such a polynucleotide or polypeptide may be part of a certain composition. Since the carrier or composition is not a component of its natural environment, they are still isolated.
- isolated refers to the separation of a substance from its original environment (if it is a natural substance, the original environment is the natural environment).
- polynucleotides and polypeptides in a natural state in a living cell are not isolated and purified, but the same polynucleotides or polypeptides are separated and purified if they are separated from other substances existing in the natural state. . '
- isolated human ATP-dependent helicase 31 means that human ATP-dependent helicase 31 is substantially free of other proteins, lipids, sugars, or other substances with which it is naturally associated. Those skilled in the art can purify human ATP-dependent helicase 31 using standard protein purification techniques. Substantially pure peptides can produce a single main band on a non-reducing polyacrylamide gel. The purity of the human ATP-dependent helicase 31 polypeptide can be analyzed by amino acid sequence.
- the present invention provides a new polypeptide, a human ATP-dependent helicase 31, which basically consists of the amino acid sequence shown in SEQ ID NO: 2.
- the polypeptide of the present invention may be a recombinant polypeptide, a natural polypeptide, or a synthetic polypeptide, and preferably a recombinant polypeptide.
- the polypeptides of the present invention can be naturally purified products or chemically synthesized products, or can be produced from prokaryotic or eukaryotic hosts (eg, bacteria, yeast, higher plants, insects, and mammalian cells) using recombinant techniques. Depending on the host used in the recombinant production protocol, the polypeptide of the invention may be glycosylated, or it may be non-glycosylated. Polypeptides of the invention may also include or exclude initial methionine residues.
- the invention also includes fragments, derivatives and analogs of human ATP-dependent helicase 31.
- fragment refers to a polypeptide that substantially maintains the same biological function or activity of the human ATP-dependent helicase 31 of the present invention.
- a fragment, derivative, or analog of the polypeptide of the present invention may be: (I) a kind in which one or more amino acid residues are substituted with conservative or non-conservative amino acid residues (preferably conservative amino acid residues), and the substitution
- the amino acid may or may not be encoded by a genetic codon; or ( ⁇ ) a type in which a group on one or more amino acid residues is replaced by another group to include a substituent; or ( ⁇ ⁇ )
- Such a type, in which the mature polypeptide is fused with another compound such as a compound that prolongs the half-life of the polypeptide, such as polyethylene glycol
- a piece Segments, derivatives and analogs are considered to be within the knowledge of those skilled in the art.
- the present invention provides an isolated nucleic acid (polynucleotide), which basically consists of a polynucleotide encoding a polypeptide having the amino acid sequence of SEQ ID NO: 2.
- the polynucleotide sequence of the present invention includes the nucleotide sequence of SEQ ID NO: 1.
- the polynucleotide of the present invention is found from a CDM library of human fetal brain tissue. It contains a polynucleotide sequence of 1208 bases in length and its open reading frame of 158-997 encodes 279 amino acids.
- This polypeptide has a characteristic sequence of a human DEAD / DEAH box ATP-dependent helicase family member, and it can be deduced that the human ATP-dependent helicase 31 has a structure represented by a human DEAD / DEAH box ATP-dependent helicase family member and function.
- the polynucleotide of the present invention may be in the form of DNA or RNA.
- DNA forms include cDNA, genomic DNA or synthetic DNA.
- DNA can be single-stranded or double-stranded.
- DNA can be coding or non-coding.
- the coding region sequence encoding a mature polypeptide may be the same as the coding region sequence shown in SEQ ID NO: 1 or a degenerate variant.
- a "degenerate variant" refers to a nucleic acid sequence encoding a protein or polypeptide having SEQ ID NO: 2 but different from the coding region sequence shown in SEQ ID NO: 1 in the present invention.
- the polynucleotide encoding the mature polypeptide of SEQ ID NO: 2 includes: only the coding sequence of the mature polypeptide; the coding sequence of the mature polypeptide and various additional coding sequences; the coding sequence of the mature polypeptide (and optional additional coding sequences); Coding sequence.
- polynucleotide encoding a polypeptide refers to a polynucleotide that includes the polypeptide and a polynucleotide that includes additional coding and / or non-coding sequences.
- the invention also relates to variants of the polynucleotides described above, which encode polypeptides or fragments, analogs and derivatives of polypeptides having the same amino acid sequence as the invention.
- This polynucleotide variant can be a naturally occurring allelic variant or a non-naturally occurring variant.
- These nucleotide variants include substitution variants, deletion variants, and insertion variants.
- an allelic variant is an alternative form of a polynucleotide that may be a substitution, deletion, or insertion of one or more nucleotides, but does not substantially change the function of the polypeptide it encodes .
- the invention also relates to a polynucleotide that hybridizes to the sequence described above (having at least 50%, preferably 70% identity between the two sequences).
- the invention particularly relates to polynucleotides that can hybridize to the polynucleotides of the invention under stringent conditions.
- “strict conditions” means: (1) hybridization and elution at lower ionic strength and higher temperature, such as 0.2xSSC, 0.1% SDS, 60 ° C; or (2) Add denaturants during hybridization, such as 50% (v / v) formamide, 0.1% calf serum / 0.1% Ficol 1, 42 ° C, etc .; or (3) only between the two sequences Hybridization occurs only when the identity is at least 95%, and more preferably 97%.
- the polypeptide encoded by the hybridizable polynucleotide has the same biological function and activity as the mature polypeptide shown in SEQ ID NO: 2.
- the invention also relates to nucleic acid fragments that hybridize to the sequences described above.
- nucleic acid fragment contains at least 10 nucleotides in length, preferably at least 20-30 nucleotides, more preferably at least 50-60 nucleotides, and most preferably at least 100 nuclei. Glycylic acid or more. Nucleic acid fragments can also be used in nucleic acid amplification techniques, such as PCR, to identify and / or isolate polynucleotides encoding human ATP-dependent helicase 31.
- polypeptides and polynucleotides in the present invention are preferably provided in an isolated form and are more preferably purified to homogeneity.
- the specific polynucleotide sequence encoding the human ATP-dependent helicase 31 of the present invention can be obtained by various methods.
- polynucleotides are isolated using hybridization techniques well known in the art. These techniques include, but are not limited to: 1) hybridization of probes to genomic or cDNA libraries to detect homologous polynucleotide sequences, and 2) antibody screening of expression libraries to detect cloned polynucleosides with common structural characteristics Acid fragments.
- the DNA fragment sequence of the present invention can also be obtained by the following methods: 1) isolating the double-stranded DNA sequence from the genomic DNA; 2) chemically synthesizing the DNA sequence to obtain the double-stranded DNA of the polypeptide.
- genomic DNA isolation is the least commonly used. Direct chemical synthesis of DNA sequences is often the method of choice. The more commonly used method is the isolation of cDNA sequences.
- the standard method for isolating the cDNA of interest is to isolate mRNA from donor cells that overexpress the gene and perform reverse transcription to form a plasmid or phage cDNA library.
- Various methods have been developed for mRNA extraction, and kits are also commercially available (Q i agene).
- the construction of cDNA libraries is also a common method (Sarabrook, et al., Mol ecul ar Clinging, A Labora tory Manua l, Col d Harbora tory. New York, 1989).
- Commercially available cDNA libraries are also available, such as different cDNA libraries from Clontech. When polymerase reaction technology is used in combination, even very small expression products can be cloned.
- genes of the present invention can be selected from these cDNA libraries by conventional methods. These methods include (but are not limited to): (l) DNA-DNA or DNA-RM hybridization; (2) the presence or absence of marker gene functions; (3) determining the level of human ATP-dependent helicase 31 transcripts; (4) Detecting protein products expressed by genes through immunological techniques or measuring biological activity. The above methods can be used alone or in combination. '
- the probe used for hybridization is homologous to any part of the polynucleotide of the present invention, and its length is at least 10 nucleotides, preferably at least 30 nucleotides, more preferably At least 50 nucleotides, preferably at least 100 nucleotides.
- the length of the probe is usually within 2000 nucleotides, preferably within 1000 nucleotides.
- the probe used here is usually a DM sequence chemically synthesized based on the gene sequence information of the present invention.
- the genes or fragments of the present invention can of course be used as probes.
- DNA probes can be labeled with radioisotopes, luciferin, or enzymes (such as alkaline phosphatase).
- the protein product of the 31 ATP-dependent expression of human ATP-dependent helicase can be detected by immunological techniques such as Western blotting, radioimmunoprecipitation, and enzyme-linked immunosorbent assay (ELISA).
- immunological techniques such as Western blotting, radioimmunoprecipitation, and enzyme-linked immunosorbent assay (ELISA).
- ELISA enzyme-linked immunosorbent assay
- the primers used for PCR may be appropriately based on the polynucleotide sequence information of the present invention disclosed herein Select and synthesize using conventional methods.
- the amplified DNA / RM fragments can be isolated and purified by conventional methods such as by gel electrophoresis.
- polynucleotide sequence of the gene of the present invention or various DM fragments and the like obtained as described above can be determined by a conventional method such as dideoxy chain termination method (Sanger et al. PNAS, 1977, 74: 5463-5467). Such polynucleotide sequences can also be determined using commercial sequencing kits and the like. In order to obtain the full-length cDNA sequence, the sequencing must be repeated. Sometimes it is necessary to determine the cDNA sequence of multiple clones in order to splice into a full-length cDNA sequence.
- the present invention also relates to a vector comprising the polynucleotide of the present invention, and a host cell that is genetically engineered using the vector of the present invention or directly using a human ATP-dependent helicase 31 coding sequence, and the recombinant technology to produce the polypeptide of the present invention Methods.
- a polynucleotide sequence encoding a human ATP-dependent helicase 31 can be inserted into a vector to constitute a recombinant vector containing the polynucleotide of the present invention.
- vector refers to bacterial plasmids, phages, yeast plasmids, plant cell viruses, mammalian cell viruses such as adenoviruses, retroviruses or other vectors well known in the art.
- Vectors suitable for use in the present invention include, but are not limited to: T7 promoter-based expression vectors expressed in bacteria (Rosenberg, et al.
- any plasmid and vector can be used to construct a recombinant expression vector.
- An important feature of expression vectors is that they usually contain an origin of replication, a promoter, a marker gene, and translational regulatory elements.
- Methods known to those skilled in the art can be used to construct expression vectors containing a DNA sequence encoding human ATP-dependent helicase 31 and appropriate transcription / translation regulatory elements. These methods include in vitro recombinant DNA technology, DNA synthesis technology, and in vivo recombination technology (Sambroook, et al. Molecular Cloning, a Laboratory Manual, cold Spring Harbor Laboratory. New York, 1989).
- the DNA sequence can be operably linked to an appropriate promoter in an expression vector to guide mRNA synthesis. Representative examples of these promoters are: the lac or trp promoter of E.
- the expression vector also includes a ribosome junction for translation initiation Binding site and transcription terminator, etc. Insertion of enhancer sequences into the vector will enhance its transcription in higher eukaryotic cells.
- Enhancers are cis-acting factors expressed by DM, usually about 10 to 300 base pairs, which act on promoters to enhance gene transcription. Illustrative examples include SV40 enhancers of 100 to 270 base pairs on the late side of the origin of replication, polyoma enhancers on the late side of the origin of replication, and adenovirus enhancers.
- the expression vector preferably contains one or more selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
- selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
- GFP fluorescent protein
- tetracycline or ampicillin resistance for E. coli.
- a polynucleotide encoding a human ATP-dependent helicase 31 or a recombinant vector containing the polynucleotide can be transformed or transduced into a host cell to form a genetically engineered host cell containing the polynucleotide or the recombinant vector.
- the term "host cell” refers to a prokaryotic cell, such as a bacterial cell; or a lower eukaryotic cell, such as a yeast cell; or a higher eukaryotic cell, such as a mammalian cell. Representative examples are: E.
- coli Streptomyces
- bacterial cells such as Salmonella typhimurium
- fungal cells such as yeast
- plant cells such as fly S2 or Sf 9
- animal cells such as CH0, COS or Bowes melanoma cells.
- Transformation of a host cell with a DNA sequence described in the present invention or a recombinant vector containing the DNA sequence can be performed using conventional techniques well known to those skilled in the art.
- the host is a prokaryote such as E. coli
- competent cells capable of DNA uptake can be in the exponential growth phase were harvested, treated with (1 2 method used in the step are well known in the art. Alternatively, it is a MgCl 2.
- transformation can also be performed by electroporation.
- the host is a eukaryotic organism, the following DM transfection methods can be used: calcium phosphate co-precipitation method, or conventional mechanical methods such as microinjection, electroporation, and liposome packaging Wait.
- the polynucleotide sequence of the present invention can be used to express or produce recombinant human ATP-dependent helicase 31 (Scence, 1984; 224: 1431). Generally there are the following steps:
- the medium used in the culture may be selected from various conventional mediums. Culture is performed under conditions suitable for host cell growth. When the host cell has grown to an appropriate cell density, the selected promoter is induced by a suitable method (such as temperature conversion or chemical induction), and The cells are cultured for a period of time.
- a suitable method such as temperature conversion or chemical induction
- the recombinant polypeptide may be coated in a cell, expressed on a cell membrane, or secreted outside the cell.
- recombinant proteins can be separated and purified by various separation methods using their physical, chemical and other properties. These methods are well known to those skilled in the art. These methods include, but are not limited to: conventional renaturation treatment, protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid chromatography (HPLC) and various other liquid chromatography techniques and combinations of these methods.
- conventional renaturation treatment protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid chromatography
- Fig. 1 is a comparison diagram of the amino acid sequences of functional domains of ATP-dependent helicase family members of the inventors of the present invention and human DEAD / DEAH box ATP-dependent helicases.
- Figure 2 shows the polyacrylamide gel electrophoresis (SDS-PAGE) of isolated human ATP-dependent helicase 31.
- 31KDa is the molecular weight of the protein.
- the arrow indicates the isolated protein band.
- the determined cDNA sequence was compared with the existing public DNA sequence database (Genebank), and it was found that the cDNA sequence of one of the clones 0917b04 was a new DM. Insert a cDNA fragment into the clone by synthesizing a series of primers Segments are measured in both directions. The results show that the full-length cDNA contained in the 0917b04 clone is 1208bp (as shown in Seq ID NO: l), and there is an 840bp open reading frame (0RF) from l ⁇ bp to 997bp, which encodes a new protein (such as Seq ID NO: 2). We named this clone pBS-0917b04 and the encoded protein was named human ATP-dependent helicase 31.
- Example 2 Domain analysis of cDNA clones
- the sequence of the human ATP-dependent helicase 31 and its encoded protein sequence of the present invention were profiled by the GCF prof le scan program (Basiclocal Information search tool) [Al tschul, SF et al. J. Mol. Biol. 1990; 215: 403-10], domain analysis was performed in databases such as Prote.
- the human ATP-dependent helicase 31 of the present invention is homologous to members of the domain human DEAD / DEAH box ATP-dependent helicase family, and the results of the homology are shown in FIG. 1.
- Example 3 Cloning of a gene encoding human ATP-dependent helicase 31 by RT-PCR
- CDNA was synthesized using fetal brain total RNA as a template and ol igo-dT as a primer for reverse transcription reaction. After purification with Qiagene's kit, the following primers were used for PCR amplification:
- Primerl 5'- GGCAGAGGTGTGACGTCATCGCCG -3 '(SEQ ID NO: 3)
- Primer2 5'- ACACAAGCCGGTGATACTTTATTA -3 '(SEQ ID NO: 4)
- Pr imerl is a forward sequence starting at lbp at the 5 ′ end of SEQ ID NO: 1;
- Pr imer2 is the 3'-end reverse sequence in SEQ ID NO: 1.
- Amplification reaction conditions containing 50ramol / L KC1 in a reaction volume of 5 0 ⁇ 1, 10mmol / L Tr i s-
- RNA extraction in one step [Anal. Biochem 1987, 162, 156-159] 0
- This method involves acid guanidinium thiocyanate-chloroform extraction. That is, the tissue was homogenized with 4M guanidine isothiocyanate-25mM sodium citrate, 0.2M sodium acetate (pH4.0), and 1 volume of phenol and 1/5 volume of chloroform-isoamyl alcohol (49: 1), centrifuge after mixing. Aspirate the aqueous layer, add isopropanol (0.8 vol) and centrifuge the mixture to obtain RNA precipitate. Will The resulting RNA was precipitated at 70 ° / °. Wash with ethanol, dry and dissolve in water.
- a 32P-labeled probe (about 2 x 10 6 cpm / ml) was hybridized with a nitrocellulose membrane to which RNA was transferred at 42 ° C overnight in a solution containing 50% formamide-25raM KH 2 P0 4 (pH7.4) -5 x SSC-5 x Denhardt's solution and 20 g / ml salmon sperm DNA. After hybridization, the filter was washed in 1 x SSC-0.1% SDS at 55 ° C for 30 min. Then, Phosphor Imager analysis and quantification.
- Example 5 In vitro expression, isolation and purification of recombinant human ATP-dependent helicase 31
- Primer 3 5'- CCCCATATGATGGCAGACGATCTCGGAGACGAG -3 '(Seq ID No: 5)
- Primer4 5'- CATGGATCCTTAGAAAAGGCCCAGTTTCAAGGA -3' (Seq ID No: 6)
- the 5 'ends of these two primers contain Ndel and BamHI restriction sites, respectively , followeded by the coding sequences of the 5 'and 3' ends of the gene of interest, respectively, and the Ndel and BamHI restriction sites correspond to the selectivity within the expression vector plasmid pET 28b (+) (Novagen, Cat. No. 69865.3). Digestion site.
- the pBS-0917b04 plasmid containing the full-length target gene was used as a template for the PCR reaction.
- the PCR reaction conditions were as follows: a total volume of 50 ⁇ 1 containing 10 pg of pBS-0917b04 plasmid, 3
- the ligation product was transformed into the colibacillus DH5 ⁇ by the calcium chloride method. After being cultured overnight in LB plates containing kanamycin (final concentration 30 ⁇ ⁇ / ⁇ 1), positive clones were selected by colony PCR method and sequenced. A positive clone (pET-0917b04) with the correct sequence was selected, and the recombinant plasmid was transformed into E. coli BL21 (DE3) plySs (product of Novagen) using the calcium chloride method.
- the host bacteria BL21 (pET-0917b04) was cultured at 37 ° C to the logarithmic growth phase, and IPTG was added to a final concentration of 1 ol / L, continue to cultivate for 5 hours.
- the bacteria were collected by centrifugation, and the supernatant was collected by centrifugation. The supernatant was collected by centrifugation.
- the purified human ATP-dependent helicase 31 was purified.
- the following human ATP-dependent helicase 31-specific peptides were synthesized using a peptide synthesizer (product of PE Company): -Gln-Pro-Thr-COOH (SEQ ID NO: 7).
- the polypeptide is coupled to hemocyanin and bovine serum albumin to form a complex, respectively.
- Rabbits were immunized with 4 mg of the hemocyanin peptide complex plus complete Freund's adjuvant, and 15 days later, the hemocyanin peptide complex plus incomplete Freund's adjuvant was used to boost immunity once.
- a titer plate coated with a 15 g / ml bovine serum albumin peptide complex was used as an ELISA to determine antibody titers in rabbit serum.
- Protein A-Sepharose was used to isolate total IgG from antibody-positive rabbit sera.
- the peptide was bound to a cyanogen bromide-activated Sepharose4B column, and anti-peptide antibodies were separated from the total IgG by affinity chromatography. Immunoprecipitation demonstrated that the purified antibody specifically binds to human ATP-dependent helicase 31.
- Example 7 Application of the polynucleotide fragment of the present invention as a hybridization probe
- Suitable oligonucleotide fragments selected from the polynucleotides of the present invention are used as hybridization probes in a variety of ways.
- the probes can be used to hybridize to genomic or cDNA libraries of normal tissue or pathological tissue from different sources to It is determined whether it contains the polynucleotide sequence of the present invention and a homologous polynucleotide sequence is detected.
- the probe can be used to detect the polynucleotide sequence of the present invention or its homologous polynucleotide sequence in normal tissue or pathology. Whether the expression in tissue cells is abnormal.
- the purpose of this embodiment is to select a suitable oligonucleotide fragment from the polynucleotide SEQ ID NO: 1 of the present invention as a hybridization probe, and to identify whether some tissues contain the polynucleoside of the present invention by a filter hybridization method.
- Filter hybridization methods include dot blotting, Southern blotting, Northern blotting, and copying methods. They all use the same steps of hybridization after fixing the polynucleotide sample to be tested on the filter.
- the sample-immobilized filter is first pre-hybridized with a probe-free hybridization buffer, so that the non-specific binding site of the sample on the filter is saturated with the carrier and the synthetic polymer.
- the pre-hybridization solution is then replaced with a hybridization buffer containing the labeled probe and incubated to hybridize the probe to the target nucleic acid.
- the unhybridized probes are removed by a series of membrane washing steps.
- This embodiment utilizes higher-intensity washing conditions (such as lower salt concentration and higher temperature) to reduce the hybridization background and retain only strong specific signals.
- the probes used in this embodiment include two types: the first type of probes are oligonucleotide fragments that are completely the same as or complementary to the polynucleotide SEQ ID NO: 1 of the present invention; the second type of probes are partially related to the present invention
- the polynucleotide SEQ ID NO: 1 is the same or complementary oligonucleotide fragment.
- the dot blot method is used to fix the sample on the filter membrane. Needle-to-sample hybridization has the strongest specificity and is retained.
- oligonucleotide fragments from the polynucleotide SEQ ID NO: 1 of the present invention for use as hybridization probes should follow the following principles and several aspects to be considered:
- the preferred range of probe size is 18-50 nucleotides
- Those that meet the above conditions can be used as primary selection probes, and then further computer sequence analysis, including the primary selection probe and its source sequence region (ie, SEQ ID NO: 1) and other known genomic sequences and their complements The regions are compared for homology. If the homology with the non-target molecular region is greater than 85% or there are more than 15 consecutive bases, the primary probe should not be used;
- Probe 1 which belongs to the first type of probe, is completely homologous or complementary to the gene fragment of SEQ ID NO: 1 (41Nt):
- Probe 1 which belongs to the second type of probe, is equivalent to the replacement mutant sequence of the gene fragment of SEQ ID NO: 1 or its complementary fragment (41Nt):
- PBS phosphate buffered saline
- step 8-13 are only used when contamination must be removed, otherwise step 14 can be performed directly.
- NC membrane nitrocellulose membrane
- Gene chip or DNA microarray is a new technology that many national laboratories and large pharmaceutical companies are currently developing and developing. It refers to the orderly and high-density arrangement of a large number of target gene fragments on glass, The data is compared and analyzed on a carrier such as silicon using fluorescence detection and computer software to achieve the purpose of fast, efficient, and high-throughput analysis of biological information.
- the polynucleotide of the present invention can be used as target DNA for gene chip technology for high-throughput research of new gene functions; search for and screen new tissue-specific genes, especially new genes related to diseases such as tumors; diagnosis of diseases such as hereditary diseases .
- the specific method steps have been reported in the literature. For example, see the literature DeRi si, JL, Lyer, V.
- a total of 4,000 polynucleotide sequences of various full-length cDMs are used as target DNA, including the polynucleotide of the present invention. They were respectively amplified by PCR. After the purified amplified product was purified, the concentration was adjusted to about 500 ng / ul, and spotted on a glass medium with a Cartesian 7500 spotter (purchased from Cartesian Company, USA). The distance between the points is 280 ⁇ ⁇ . The spotted slides were hydrated, dried, and cross-linked in a purple diplomatic coupling instrument. After elution, the DNA was fixed on a glass slide to prepare a chip. The specific method steps have been reported in the literature in various ways. The post-spot processing steps of this embodiment are:
- Total mRNA was extracted from normal liver and liver cancer by one-step method, and the mRNA was purified by Oligotex mRNA Midi Kit (purchased from QiaGen).
- the fluorescent reagent Cy3dUTP (5- Amino-propargy 1-2 ' -deoxyuri dine 5'-tr iphate coupled to Cy3 f luorescent dye (purchased from Amersham Phamacia Biotech) was used to label the mRNA of normal liver tissue
- the fluorescent reagent Cy5dUTP (5-Amino-propargy 1-2 '-deoxyur i dine 5'- tr iphate coupled to Cy5 f luorescent dye (purchased from Amersham Phamacia Biotech) was used to label the liver cancer tissue mRNA, and the probe was prepared after purification.
- the probes from the above two tissues and the chip were respectively hybridized in a UniHyb TM Hybridizat ion Solut ion (purchased from TeleChem) hybridization solution for 16 hours, and washed with a washing solution (lx SSC, 0.2% SDS) at room temperature. Scanning was performed with a ScanArray 3000 scanner (purchased from Genera l Scanning, USA), and the scanned images were analyzed and processed with Imagene software (Biodi scovery, USA) to calculate the Cy3 / Cy5 ratio of each point, which was less than 0. Points greater than 5 are considered to be genes with differential expression.
- polypeptides of the present invention as well as antagonists, agonists and inhibitors of the polypeptides, can be directly used in the treatment of diseases, for example, they can treat malignant tumors, adrenal deficiency, skin diseases, various types of inflammation, HIV infection, and immune diseases.
- ATP-dependent helicases are necessary for nuclear and mitochondrial division, RNA editing, rRNA processing, transcription initiation, nuclear mRNA transport, and mRNA degradation. Helicases are thought to play important roles in cell development and differentiation.
- An ATP-dependent helicase with a characteristic "D-EA-D box" is an important regulator of cell development and differentiation. Mutations in the characteristic DEAD box will result in the inhibition of ATP hydrolysis, thereby affecting the normal physiological function of the helicase.
- the polypeptide of the present invention is a polypeptide containing a DEAD box, which is a characteristic sequence of the ATP-dependent helicase family. Abnormal expression will lead to cell and mitochondrial division, RNA editing, rRNA processing, transcription initiation, nuclear mRM transport and Abnormal functions such as degradation of mRNA can cause abnormal information transmission and produce related diseases.
- the abnormal expression of the human ATP-dependent helicase 31 of the present invention will produce various diseases, especially various tumors, embryonic development disorders, growth and development disorders, and endocrine diseases. These diseases include, but are not limited to:
- Tumors of various tissues stomach cancer, liver cancer, lung cancer, esophageal cancer, breast cancer, leukemia, lymphoma, thyroid tumor, uterine fibroids, neuroblastoma, astrocytoma, ependymoma, glioblastoma, nerve Fibroma, colon cancer, melanoma, adrenal cancer, bladder cancer, bone cancer, osteosarcoma, myeloma, bone marrow cancer, uterine cancer, endometrial cancer, biliary cancer, colon cancer, thymic tumor, nasal and sinus tumors, nose Pharyngeal cancer, Laryngeal cancer, Tracheal tumor, Fibroma, Fibrosarcoma, Lipoma, Liposarcoma, Leiomyoma
- Fetal developmental disorders congenital abortion, cleft palate, limb loss, limb differentiation disorder, hyaline membrane disease, atelectasis, polycystic kidney, cryptorchidism, congenital inguinal hernia, double uterus, vaginal atresia, hypospadias, androgynous Malformation, Atrial septal defect, Ventricular septal defect, Pulmonary stenosis, Arterial duct occlusion, Neural tube defect, Congenital hydrocephalus, Iris defect, Congenital glaucoma or cataract, Congenital deafness
- Growth disorders mental retardation, cerebral palsy, mental retardation, mental retardation, familial cerebellar dysplasia, strabismus, skin, fat, and muscular dysplasias such as congenital skin relaxation, albinism , Alzheimer's disease, congenital keratosis, bone and joint dysplasia diseases such as cartilage dysplasia, epiphyseal dysplasia, metabolic bone disease, various metabolic defects such as various amino acid metabolic defects, dementia, dwarfism Cushing syndrome, sexual retardation
- Endocrine diseases diabetes insipidus, precocious puberty, giant disease and acromegaly, dwarfism, pituitary tumors, simple goiter, thyroiditis, hyperthyroidism, hypothyroidism, hyperparathyroidism, Hypoparathyroidism, Cortisol, Primary Aldosterone, Adrenal Insufficiency, Adrenal Tumor, Diabetes, Insulinoma, Gastrinoma, Ovarian Disease: Premenstrual Tension, Menopausal Syndrome Symptoms, ovarian hypoplasia, amenorrhea, hypogonadism, precocious puberty
- Abnormal expression of the human ATP-dependent helicase 31 of the present invention will also produce certain hereditary, hematological and immune system diseases.
- the polypeptide of the present invention and the antagonists, agonists and inhibitors of the polypeptide can be directly used in the treatment of diseases, for example, it can treat various diseases, especially various tumors, embryonic development disorders, growth and development disorders, endocrine diseases, Certain hereditary, hematological and immune system diseases.
- the invention also provides methods of screening compounds to identify agents that increase (agonist) or suppress (antagonist) human ATP-dependent helicase 31. Agonists enhance human ATP-dependent helicase 31 to stimulate biological functions such as cell proliferation, while antagonists prevent and treat disorders related to cell proliferation, such as various cancers.
- mammalian cells or membrane preparations expressing human ATP-dependent helicase 31 can be cultured with labeled human ATP-dependent helicase 31 in the presence of a drug. The ability of the drug to increase or block this interaction is then determined.
- Antagonists of human ATP-dependent helicase 31 include selected antibodies, compounds, receptor deletions, and the like. Antagonists of human ATP-dependent helicase 31 can bind to and eliminate human ATP-dependent helicase 31, or inhibit the production of the polypeptide, or bind to the active site of the polypeptide so that the polypeptide cannot function biological functions.
- human ATP-dependent helicase 31 When screening compounds as antagonists, human ATP-dependent helicase 31 can be added to a bioanalytical assay, and the compound can be determined by measuring the effect of the compound on the interaction between human ATP-dependent helicase 31 and its receptor. Whether it is an antagonist. Receptor deletions and analogs that act as antagonists can be screened in the same way as for screening compounds described above. Polypeptide molecules capable of binding to human ATP-dependent helicase 31 can be obtained by screening a random peptide library composed of various possible combinations of amino acids bound to a solid phase. In screening, human ATP-dependent helicase 31 molecules should generally be labeled.
- the present invention provides a method for producing antibodies using polypeptides, and fragments, derivatives, analogs or cells thereof as antigens. These antibodies can be polyclonal or monoclonal antibodies.
- the invention also provides antibodies against human ATP-dependent helicase 31 epitopes. These antibodies include (but are not limited to): polyclonal antibodies, monoclonal antibodies, chimeric antibodies, single chain antibodies, Fab fragments, and fragments generated from Fab expression libraries.
- Polyclonal antibodies can be produced by injecting human ATP-dependent helicase 31 directly into immunized animals (such as rabbits, mice, rats, etc.).
- immunized animals such as rabbits, mice, rats, etc.
- adjuvants can be used to enhance the immune response, including but not limited to Freund's Adjuvant, etc.
- Techniques for preparing monoclonal antibodies to human ATP-dependent helicase 31 include, but are not limited to, hybridoma technology (Kohler and Milste in. Nature, 1975, 256: 495-497), triple tumor technology, human beta- Cell hybridoma technology, EBV-hybridoma technology, etc.
- Chimeric antibodies that bind human constant regions to non-human variable regions can be produced using existing techniques (Morrison et al., PNAS, 19 5, 81: 6851).
- the existing technology for producing single chain antibodies (U.S. Pat No. 4946778) can also be used to produce single chain antibodies against human ATP-dependent helicase 31.
- Antibodies against human ATP-dependent helicase 31 can be used in immunohistochemical techniques to detect human ATP-dependent helicase 31 in biopsy specimens. Monoclonal antibodies that bind to human ATP-dependent helicase 31 can also be labeled with radioisotopes and injected into the body to track their location and distribution. This radiolabeled antibody can be used as a non-invasive diagnostic method to locate tumor cells and determine whether there is metastasis.
- Antibodies can also be used to design immunotoxins that target a particular part of the body.
- human ATP-dependent helicase 31 high affinity monoclonal antibodies can covalently bind to bacterial or plant toxins (such as diphtheria toxin, ricin, ormosine, etc.).
- a common method is to attack the amino group of an antibody with a thiol cross-linking agent such as SPDP and bind the toxin to the antibody through the exchange of disulfide bonds.
- This hybrid antibody can be used to kill human ATP-dependent helicase 31 positive Cell.
- the antibodies of the present invention can be used to treat or prevent diseases associated with human ATP-dependent helicase 31.
- Administration of an appropriate dose of antibody can stimulate or block the production or activity of human ATP-dependent helicase 31.
- the invention also relates to a diagnostic test method for quantitative and localized detection of human ATP-dependent helicase 31 levels.
- tests are well known in the art and include FI SH assays and radioimmunoassays.
- the level of human ATP-dependent helicase 31 detected in the test can be used to explain the importance of human ATP-dependent helicase 31 in various diseases and to diagnose the role of human ATP-dependent helicase 31. disease.
- polypeptide of the present invention can also be used for peptide mapping analysis.
- the polypeptide can be specifically cleaved by physical, chemical or enzymatic analysis, and subjected to one-dimensional or two-dimensional or three-dimensional gel electrophoresis analysis, and more preferably mass spectrometry analysis.
- Polynucleotides encoding human ATP-dependent helicase 31 can also be used for a variety of therapeutic purposes. Gene therapy technology can be used to treat abnormal cell proliferation, development, or metabolism caused by the non-expression or abnormal / inactive expression of human ATP-dependent helicase 31.
- Recombinant gene therapy vectors (such as viral vectors) can be designed to express mutated human ATP-dependent helicase 31 to inhibit endogenous human ATP-dependent helicase 31 activity.
- a mutated human ATP-dependent helicase 31 may be a shortened human ATP-dependent helicase 31 that lacks a signaling functional domain. Although it can bind to downstream substrates, it lacks signaling activity.
- the recombinant gene therapy vector can be used for treating diseases caused by abnormal expression or activity of human ATP-dependent helicase 31.
- Virus-derived expression vectors such as retrovirus, adenovirus, adenovirus-associated virus, herpes simplex virus, parvovirus, etc. can be used to transfer a polynucleotide encoding human ATP-dependent helicase 31 into cells.
- Methods for constructing recombinant viral vectors carrying a polynucleotide encoding human ATP-dependent helicase 31 can be found in the existing literature (Sambrook, et al.).
- the polynucleotide encoding human ATP-dependent helicase 31 can be packaged into liposomes and transferred into cells.
- Methods for introducing a polynucleotide into a tissue or cell include: injecting the polynucleotide directly into a tissue in vivo; or introducing the polynucleotide into a cell through a vector (such as a virus, phage, or plasmid) in vitro, The cells are then transplanted into the body and the like.
- a vector such as a virus, phage, or plasmid
- Oligonucleotides including antisense RNA and DNA
- ribozymes that inhibit human ATP-dependent helicase 31 mRNA are also within the scope of the present invention.
- a ribozyme is an enzyme-like RM molecule that can specifically decompose specific RNA. Its mechanism of action is that the ribozyme molecule specifically hybridizes with a complementary target RNA for endonucleation.
- Antisense RM, DNA and ribozymes can be obtained by any existing RM or DNA synthesis technology, such as solid-phase phosphoramidite synthesis of oligonucleotides. Widely used.
- Antisense RNA molecules can be obtained by in vitro or in vivo transcription of DM sequences encoding the RNA.
- This DNA sequence is integrated downstream of the vector's RNA polymerase promoter.
- it can be modified in a variety of ways, such as increasing the sequence length on both sides, and the linkage between ribonucleosides using phosphate thioester or peptide bonds instead of phosphodiester bonds.
- the polynucleotide encoding human ATP-dependent helicase 31 can be used for the diagnosis of diseases related to human ATP-dependent helicase 31.
- the polynucleotide encoding human ATP-dependent helicase 31 can be used to detect the expression of human ATP-dependent helicase 31 or the abnormal expression of human ATP-dependent helicase 31 in a disease state.
- the DNA sequence encoding human ATP-dependent helicase 31 can be used to hybridize biopsy specimens to determine the expression of human ATP-dependent helicase 31.
- Hybridization techniques include Southern blotting, Nor thern blotting, and in situ hybridization. These techniques and methods are publicly available and mature, and related kits are commercially available.
- polynucleotides of the present invention can be used as probes to be fixed on a micro array (Mi croar ray) or a DNA chip (also known as a "gene chip") for analyzing differential expression analysis of genes and genetic diagnosis in tissues .
- Human ATP-dependent helicase 31-specific primers can also be used to detect the transcription products of human ATP-dependent helicase 31 by RNA-polymerase chain reaction (RT-PCR) in vitro amplification.
- RT-PCR RNA-polymerase chain reaction
- Human ATP-dependent helicase 31 mutations include point mutations, translocations, deletions, recombinations, and any other abnormalities compared to the normal wild-type human ATP-dependent helicase 31 DNA sequence. Mutations can be detected using well-known techniques such as Southern blotting, DNA sequence analysis, PCR, and in situ hybridization. In addition, mutations may affect protein expression. Therefore, Nor thern blotting and Western blotting can be used to indirectly determine whether a gene is mutated.
- the sequences of the invention are also valuable for chromosome identification.
- the sequence specifically targets a specific position on a human chromosome and can hybridize to it.
- specific sites for each gene on the chromosome need to be identified.
- only a few chromosome markers based on actual sequence data (repeating polymorphisms) are available for labeling chromosome positions.
- an important first step is to locate these DNA sequences on a chromosome.
- PCR primers preferably 15-35 bp
- PCR localization of somatic hybrid cells is a quick way to localize DM to specific chromosomes.
- oligonucleotide primers of the present invention in a similar manner, a set of fragments from a specific chromosome or a large number of genomic clones can be used to achieve sublocalization.
- Other similar strategies that can be used for chromosomal localization include in situ hybridization, chromosome pre-screening with labeled flow sorting, and hybrid pre-selection to construct chromosome-specific cDM libraries.
- Fluorescent in situ hybridization of cDNA clones with metaphase chromosomes allows precise chromosomal localization in one step.
- FISH Fluorescent in situ hybridization
- the physical location of the sequence on the chromosome can be correlated with the genetic map data. These data can be found in, for example, V. Mckusick, Mendelian Inheritance in Man (available online with Johns Hopkins University Wetch Medical Library). Linkage analysis can then be used to determine the relationship between genes and diseases that have been mapped to chromosomal regions.
- the difference in cDNA or genomic sequence between the affected and unaffected individuals needs to be determined. If a mutation is observed in some or all diseased individuals and the mutation is not observed in any normal individuals, the mutation may be the cause of the disease. Comparing affected and unaffected individuals usually involves first looking for structural changes in chromosomes, such as deletions or translocations that are visible at the chromosomal level or detectable with cDNA sequence-based PCR. According to the resolution capabilities of current physical mapping and gene mapping technology, the cDNA accurately mapped to the chromosomal region associated with the disease can be one of 50 to 500 potentially pathogenic genes (assuming 1 megabase mapping resolution) Capacity and each 20kb corresponds to a gene).
- the polypeptides, polynucleotides and mimetics, agonists, antagonists and inhibitors of the present invention can be used in combination with a suitable pharmaceutical carrier.
- suitable pharmaceutical carrier can be water, glucose, ethanol, salts, buffers, glycerol, and combinations thereof.
- the composition comprises a safe and effective amount of the polypeptide or antagonist, and carriers and excipients which do not affect the effect of the drug. These compositions can be used as drugs for the treatment of diseases.
- the present invention also provides a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the present invention.
- these containers there may be instructional instructions given by government agencies that manufacture, use, or sell pharmaceuticals or biological products, which reminders authorize them to be administered to humans by government agencies that manufacture, use, or sell them.
- the polypeptides of the invention can be used in combination with other therapeutic compounds.
- the pharmaceutical composition can be administered in a convenient manner, such as by a topical, intravenous, intraperitoneal, intramuscular, subcutaneous, intranasal or intradermal route of administration.
- Human ATP-dependent helicase 31 is administered in an amount effective to treat and / or prevent a specific indication. The amount and dose range of human ATP-dependent helicase 31 administered to a patient will depend on many factors, such as the mode of administration, the health conditions of the person to be treated, and the judgment of the diagnostician.
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Molecular Biology (AREA)
- Microbiology (AREA)
- Biotechnology (AREA)
- Biomedical Technology (AREA)
- Biochemistry (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Medicinal Chemistry (AREA)
- Enzymes And Modification Thereof (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
Abstract
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
AU2001231483A AU2001231483A1 (en) | 2000-01-28 | 2001-01-21 | A novel polypeptide-human atp-dependent helicase 31 and the polynucleotide encoding said polypeptide |
Applications Claiming Priority (2)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN 00111601 CN1319661A (zh) | 2000-01-28 | 2000-01-28 | 一种新的多肽——人atp依赖的解螺旋酶31和编码这种多肽的多核苷酸 |
CN00111601.0 | 2000-01-28 |
Publications (1)
Publication Number | Publication Date |
---|---|
WO2001055401A1 true WO2001055401A1 (fr) | 2001-08-02 |
Family
ID=4581510
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
PCT/CN2001/000069 WO2001055401A1 (fr) | 2000-01-28 | 2001-01-21 | Nouveau polypeptide, helicase atp-dependante humaine 31, et polynucleotide codant pour ce polypeptide |
Country Status (3)
Country | Link |
---|---|
CN (1) | CN1319661A (fr) |
AU (1) | AU2001231483A1 (fr) |
WO (1) | WO2001055401A1 (fr) |
Citations (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO1992003479A1 (fr) * | 1990-08-27 | 1992-03-05 | The Rockefeller University | Complexe proteique amorce de replication et ses procedes d'utilisation |
EP0913474A2 (fr) * | 1997-10-28 | 1999-05-06 | Smithkline Beecham Corporation | Dbpa, une hélicase de Staphylococcus aureus |
-
2000
- 2000-01-28 CN CN 00111601 patent/CN1319661A/zh active Pending
-
2001
- 2001-01-21 WO PCT/CN2001/000069 patent/WO2001055401A1/fr active Application Filing
- 2001-01-21 AU AU2001231483A patent/AU2001231483A1/en not_active Abandoned
Patent Citations (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO1992003479A1 (fr) * | 1990-08-27 | 1992-03-05 | The Rockefeller University | Complexe proteique amorce de replication et ses procedes d'utilisation |
EP0913474A2 (fr) * | 1997-10-28 | 1999-05-06 | Smithkline Beecham Corporation | Dbpa, une hélicase de Staphylococcus aureus |
Also Published As
Publication number | Publication date |
---|---|
CN1319661A (zh) | 2001-10-31 |
AU2001231483A1 (en) | 2001-08-07 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
WO2001068684A1 (fr) | Nouveau polypeptide, protocadherine humaine 14, et polynucleotide codant pour ce polypeptide | |
WO2001055401A1 (fr) | Nouveau polypeptide, helicase atp-dependante humaine 31, et polynucleotide codant pour ce polypeptide | |
WO2001072793A1 (fr) | Nouveau polypeptide, proteine humaine de regulation 12 de la proteine hydrolase, et polynucleotide codant pour ce polypeptide | |
WO2001075048A2 (fr) | Nouveau polypeptide, proteine ribosomale humaine s11 23, et polynucleotide codant pour ce polypeptide | |
WO2001070965A1 (fr) | Nouveau polypeptide, facteur humain de regulation de la transcription 15, et polynucleotide codant pour ce polypeptide | |
WO2001081594A1 (fr) | Nouveau polypeptide, proteine pax humaine 17, et polynucleotide codant pour ce polypeptide | |
WO2001098488A1 (fr) | Nouveau polypeptide, sous-unite 24 de flavoproteine humaine, et polynucleotide codant ce polypeptide | |
WO2001083687A2 (fr) | Nouveau polypeptide, proteine pax humaine 23, et polynucleotide codant pour ce polypeptide | |
WO2001094371A1 (fr) | Nouveau polypeptide, proteine ribosomale humaine s4-10, et polynucleotide codant ce polypeptide | |
WO2001074996A2 (fr) | Nouveau polypeptide, c. elegans 52 humain, et polynucléotide codant pour ce polypeptide | |
WO2001055403A1 (fr) | Nouveau polypeptide, helicase humaine c20, et polynucleotide codant pour ce polypeptide | |
WO2001047964A1 (fr) | Nouveau polypeptide, helicase atp-dependante 68, et polynucleotide codant pour ce polypeptide | |
WO2001074893A1 (fr) | Nouveau polypeptide, proteine humaine de regulation de la transcription 11.8, et polynucleotide codant pour ce polypeptide | |
WO2001087967A1 (fr) | Proteine s18-26 ribosomale, polypeptide humain, et polynucleotide la codant | |
WO2001072817A1 (fr) | Nouveau polypeptide, serine hydrolase humaine atp-dependante 11, et polynucleotide codant pour ce polypeptide | |
WO2001048219A1 (fr) | Nouveau polypeptide, proteine de transport phosphorylee 10, et polynucleotide codant pour ce polypeptide | |
WO2001075019A2 (fr) | Nouveau polypeptide, proteine humaine de mutation 11 de l'ataxie-telangiectasie, et polynucleotide codant pour ce polypeptide | |
WO2001090171A1 (fr) | Nouveau polypeptide, proteine humaine ribosomale sii 12, et polynucleotide codant ce polypeptide | |
WO2001072809A1 (fr) | Nouveau polypeptide, facteur humain de transcription de la differentiation cellulaire 9, et polynucleotide codant pour ce polypeptide | |
WO2001047987A1 (fr) | Nouveau polypeptide, gene $g(s)-54, et polynucleotide codant pour ce polypeptide | |
WO2001046241A1 (fr) | Nouveau polypeptide, proteine 12 gvpa, et polynucleotide codant pour ce polypeptide | |
WO2001079436A2 (fr) | Nouveau polypeptide, facteur humain de transcription de la differentiation cellulaire 10, et polynucleotide codant pour ce polypeptide | |
WO2001070784A1 (fr) | Nouveau polypeptide, proteine humaine 17 contenant un domaine de structure chromo, et polynucleotide codant pour ce polypeptide | |
WO2001055184A1 (fr) | Nouveau polypeptide, proteine humaine a doigt de zinc 19, et polynucleotide codant pour ce polypeptide | |
WO2001046242A1 (fr) | NOUVEAU POLYPEPTIDE, GENE σ-54 9, ET POLYNUCLEOTIDE CODANT POUR CE POLYPEPTIDE |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
AK | Designated states |
Kind code of ref document: A1 Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW |
|
AL | Designated countries for regional patents |
Kind code of ref document: A1 Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG |
|
121 | Ep: the epo has been informed by wipo that ep was designated in this application | ||
DFPE | Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101) | ||
REG | Reference to national code |
Ref country code: DE Ref legal event code: 8642 |
|
122 | Ep: pct application non-entry in european phase | ||
NENP | Non-entry into the national phase |
Ref country code: JP |