WO2001055374A1 - Nouveau polypeptide, sequence 71 de multirepetition de la leucine, et polynucleotide codant pour ce polypeptide - Google Patents
Nouveau polypeptide, sequence 71 de multirepetition de la leucine, et polynucleotide codant pour ce polypeptide Download PDFInfo
- Publication number
- WO2001055374A1 WO2001055374A1 PCT/CN2001/000045 CN0100045W WO0155374A1 WO 2001055374 A1 WO2001055374 A1 WO 2001055374A1 CN 0100045 W CN0100045 W CN 0100045W WO 0155374 A1 WO0155374 A1 WO 0155374A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- polypeptide
- sequence
- polynucleotide
- leucine
- seq
- Prior art date
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
- C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
Definitions
- the present invention belongs to the field of biotechnology. Specifically, the present invention describes a new polypeptide, a leucine multiple repeat sequence 71, and a polynucleotide sequence encoding the polypeptide. The invention also relates to a preparation method and application of the polynucleotide and polypeptide. Background technique
- a leucine repeat is a template with a short sequence in a protein that has a different function and location in the cell. These repeats are often involved in protein-to-protein reactions.
- Each leucine repeat sequence consists of one P- ⁇ unit. These units are arranged to form a parallel P-sheet layer, and one side is exposed in the solvent to form an extended non-spherical structure. Due to this unique structure, it usually has a strong protein-protein reaction.
- the leucine repeats are often flanked by cysteine or asparagine-rich regions, and there are also conservative conservative aliphatic and aromatic amino acids, sometimes glycine and proline.
- the hydrophobic consensus residues at the carboxy-terminal portion of the repeat usually contain 3, 4 or 7 residues.
- This sequence is a binding domain of a protein to a cell regulatory factor, and the protein inhibits the activity of the regulatory factor through its binding to the cell regulatory factor.
- a protein having this sequence usually has a signal transduction effect and sometimes interacts with a protein that causes a pathological response.
- this sequence is contained in the RNase inhibitory factor.
- This factor is a cytoplasmic protein that tightly binds and inhibits the pancreatic RNase superfamily.
- the parallel ⁇ sheet and P ⁇ loop form the RNase binding domain and RNase. Surface binding is involved in the regulation of RNA renewal in mammalian cells and plays a role in angiogenesis.
- leucine repeat sequence of a protein in the human body is mutated multiple times, it will cause various degrees of Bernard-Soul ier disease, which is a bleeding disorder.
- a single leucine-rich template in the human type I immunodeficiency virus Rev protein was found to be the virus's transactivation domain.
- the polypeptide of the present invention contains a template of a leucine multiple repeat sequence, and the polypeptide and its antagonist, agonist and inhibitor can be used to diagnose and prevent various degrees of Bernard-Soul ier disease and diseases related to RNA renewal angiogenesis , And diseases caused by human type I immunodeficiency virus.
- the leucine multiple repeat sequence 71 protein plays an important role in important functions in the body, and it is believed that a large number of proteins are involved in these regulatory processes, so the art has always needed to identify more leucines involved in these processes. Sequence 71 protein was repeated multiple times, especially the amino acid sequence of this protein was identified. Isolation of the novel leucine 71 repeat protein 71 gene also provides a basis for research to determine the role of this protein in health and disease states. This protein may form the basis for developing diagnostic and / or therapeutic drugs for diseases, so It is important to separate its coded DM. Disclosure of invention
- Another object of the invention is to provide a polynucleotide encoding the polypeptide.
- Another object of the present invention is to provide a recombinant vector containing a polynucleotide encoding a leucine multiple repeat sequence 71.
- Another object of the present invention is to provide a genetically engineered host cell containing a polynucleotide encoding a leucine multiple repeat sequence 71.
- Another object of the present invention is to provide a method for producing a leucine multiple repeat sequence 71.
- Another object of the present invention is to provide an antibody against the polypeptide of the present invention, a leucine multiple repeat sequence 71.
- Another object of the present invention is to provide mimic compounds, antagonists, agonists, and inhibitors for the leucine multiple repeat sequence 71 of the polypeptide of the present invention.
- Another object of the present invention is to provide a method for diagnosing and treating a disease associated with abnormalities in the leucine multiple repeat sequence 71.
- the present invention relates to an isolated polypeptide, which is of human origin and comprises: a polypeptide having the amino acid sequence of SEQ ID No. 2, or a conservative variant, biologically active fragment or derivative thereof.
- the polypeptide is a polypeptide having the amino acid sequence of SEQ ID NO: 2.
- the invention also relates to an isolated polynucleotide comprising a nucleotide sequence or a variant thereof selected from the group consisting of:
- sequence of the polynucleotide is one selected from the group consisting of: (a) a sequence having positions 20-1963 in SEQ ID NO: 1; and (b) a sequence having 1-2316 in SEQ ID NO: 1 Sequence of bits.
- the invention further relates to a vector, in particular an expression vector, containing the polynucleotide of the invention; a host cell genetically engineered with the vector, including a transformed, transduced or transfected host cell; and a method comprising culturing said Host cell and method of preparing the polypeptide of the present invention by recovering the expression product.
- a vector in particular an expression vector, containing the polynucleotide of the invention
- a host cell genetically engineered with the vector including a transformed, transduced or transfected host cell
- a method comprising culturing said Host cell and method of preparing the polypeptide of the present invention by recovering the expression product.
- the invention also relates to an antibody capable of specifically binding to a polypeptide of the invention.
- the invention also relates to a screen that simulates, activates, antagonizes or inhibits multiple repeats of leucine 71 protein.
- a method of white-active compounds comprising utilizing a polypeptide of the invention.
- the invention also relates to compounds obtained by this method.
- the invention also relates to a method for in vitro detection of a disease or susceptibility to disease associated with abnormal expression of the leucine multiple repeat sequence 71 protein, which comprises detecting a mutation in the polypeptide or a polynucleotide sequence encoding the same in a biological sample, or Detection of the amount or biological activity of a polypeptide of the invention in a biological sample.
- the invention also relates to a pharmaceutical composition
- a pharmaceutical composition comprising a polypeptide of the invention or a mimetic thereof, an activator, an antagonist or an inhibitor, and a pharmaceutically acceptable carrier.
- the present invention also relates to the use of the polypeptide and / or polynucleotide of the present invention in the preparation of a medicament for treating cancer, developmental disease or immune disease, or other diseases caused by abnormal expression of leucine multiple repeats 71.
- Nucleic acid sequence refers to an oligonucleotide, a nucleotide or a polynucleotide and a fragment or part thereof, and may also refer to a genomic or synthetic DNA or RNA, they can be single-stranded or double-stranded, representing the sense or antisense strand.
- amino acid sequence refers to an oligopeptide, peptide, polypeptide or protein sequence and fragments or portions thereof.
- amino acid sequence in the present invention relates to the amino acid sequence of a naturally occurring protein molecule, such "polypeptide” or “protein” does not mean to limit the amino acid sequence to a complete natural amino acid related to the protein molecule .
- a protein or polynucleotide “variant” refers to an amino acid sequence having one or more amino acids or nucleotide changes or a polynucleotide sequence encoding it. The changes may include deletions, insertions or substitutions of amino acids or nucleotides in the amino acid sequence or nucleotide sequence. Variants can have "conservative" changes in which the substituted amino acid has a structural or chemical property similar to the original amino acid, such as the replacement of isoleucine with leucine. Variants can also have non-conservative changes, such as replacing glycine with tryptophan.
- “Deletion” refers to the deletion of one or more amino acids or nucleotides in an amino acid sequence or nucleotide sequence.
- Insertion means that a change in the amino acid sequence or nucleotide sequence results in an increase in one or more amino acids or nucleotides compared to a molecule that exists in nature.
- Replacement refers to the replacement of one or more amino acids or nucleotides with different amino acids or nucleotides.
- Bio activity refers to a protein that has the structure, regulation, or biochemical function of a natural molecule.
- immunologically active means that natural, recombinant, or synthetic proteins and fragments thereof Ability to induce a specific immune response in a substance or cell and to bind to specific antibodies.
- An "agonist” refers to a molecule that, when combined with multiple repeats of leucine 71, causes the protein to change, thereby regulating the activity of the protein.
- An agonist may include a protein, a nucleic acid, a carbohydrate, or any other molecule that can bind leucine multiple repeats 71.
- Antagonist refers to a molecule that can block or regulate the biological or immunological activity of leucine repeat 71 when combined with leucine repeat 71.
- Antagonists and inhibitors may include proteins, nucleic acids, carbohydrates, or any other molecule that can bind leucine multiple repeats 71.
- Regular refers to a change in the function of multiple repeats of leucine 71, including an increase or decrease in protein activity, changes in binding characteristics, and any other biological properties, functions, or immunity of multiple repeats of leucine 71 Change of nature.
- substantially pure is meant substantially free of other proteins, lipids, sugars or other substances with which it is naturally associated.
- Those skilled in the art can purify leucine multiple repeats 71 using standard protein purification techniques. Substantially pure leucine repeats 71 multiple times on a non-reducing polyacrylamide gel to produce a single main band.
- the leucine repeat sequence 71 The purity of the polypeptide can be analyzed by amino acid sequence.
- Complementary refers to the natural binding of a nucleotide by base-pairing under conditions of acceptable salt concentration and temperature.
- sequence "C-T-G-A” can be combined with the complementary sequence "G-A-C-T”.
- the complementarity between two single-stranded molecules may be partial or complete.
- the degree of complementarity between nucleic acid strands has a significant effect on the efficiency and strength of hybridization between nucleic acid strands.
- “Homology” refers to the degree of complementarity and can be partially homologous or completely homologous.
- Partial homology refers to a partially complementary sequence that at least partially inhibits hybridization of a fully complementary sequence to a target nucleic acid. This inhibition of hybridization can be detected by performing hybridization (Southern blotting or Nor thern blotting, etc.) under conditions of reduced stringency.
- Substantially homologous sequences or hybridization probes can compete and inhibit the binding of completely homologous sequences to the target sequence under conditions of reduced stringency. This does not mean that the conditions of reduced stringency allow non-specific binding, because the conditions of reduced stringency require that the two sequences bind to each other specifically or selectively.
- Percent identity refers to the percentage of sequences that are identical or similar in the comparison of two or more amino acid or nucleic acid sequences. The percent identity can be determined electronically, such as through the MEGALIGN program (Lasergene sof tware package, DNASTAR, Inc., Madi son Wis.). 0 The MEGALIGN program can compare two or more sequences according to different methods, such as the Cluster method. (Higgins, DGPM Sharp (1988) Gene 73: 237-244) 0 Cluster method arranges each group of sequences into clusters by checking the distance between all pairs. The clusters are then assigned in pairs or groups. Percent identity between two amino acid sequences such as sequence A and sequence B The 1 00045 score is calculated by-.
- the percent identity between nucleic acid sequences can also be determined by the Cluster method or by methods known in the art such as Jotun He in (He in J., (1990) Methods in emzumo logy 183: 625-645).
- Similarity refers to the degree of identical or conservative substitutions of amino acid residues at corresponding positions in the alignment of amino acid sequences.
- Amino acids used for conservative substitutions for example, negatively charged amino acids may include aspartic acid and glutamic acid; positively charged amino acids may include lysine and arginine; having an uncharged head group is Similar hydrophilic amino acids may include leucine, isoleucine and valine; glycine and alanine; asparagine and glutamine; serine and threonine; phenylalanine and tyrosine.
- Antisense refers to a nucleotide sequence that is complementary to a particular DM or RNA sequence.
- Antisense strand refers to a nucleic acid strand that is complementary to the “sense strand”.
- Derivative refers to a chemical modification of HFP or a nucleic acid encoding it. Such a chemical modification may be the replacement of a hydrogen atom with an alkyl group, an acyl group or an amino group. Nucleic acid derivatives can encode polypeptides that retain the main biological characteristics of natural molecules.
- Antibody refers to a complete antibody molecule and its fragments, such as Fa,? ( ⁇ ') 2 and?, which can specifically bind to the epitope of the leucine multiple repeat sequence 71.
- a “humanized antibody” refers to an antibody in which the amino acid sequence of a non-antigen binding region is replaced to become more similar to a human antibody, but still retains the original binding activity.
- isolated refers to the removal of a substance from its original environment (for example, its natural environment if it occurs naturally).
- a naturally occurring polynucleotide or polypeptide is not isolated when it is present in a living animal, but the same polynucleotide or polypeptide is separated from some or all of the substances that coexist with it in the natural system.
- Such a polynucleotide may be part of a vector, or such a polynucleotide or polypeptide may be part of a composition. Since the carrier or composition is not part of its natural environment, they are still isolated.
- isolated refers to the separation of a substance from its original environment (if it is a natural substance, the original environment is the natural environment).
- polynucleotides and polypeptides in a natural state in a living cell are not isolated and purified, but the same polynucleotides or polypeptides are separated and purified if they are separated from other substances existing in the natural state. .
- isolated leucine multiple repeat 71 means that leucine multiple repeat 71 is substantially free of other proteins, lipids, carbohydrates, or other substances with which it is naturally associated.
- Technology in the field A person can use a standard protein purification technique to purify leucine multiple repeats71.
- Substantially pure polypeptides can produce a single main band on a non-reducing polyacrylamide gel.
- the purity of the leucine repeat sequence 71 polypeptide can be analyzed by amino acid sequence.
- the present invention provides a new polypeptide, a leucine multiple repeat sequence 71, which is basically composed of the amino acid sequence shown in SEQ ID NO: 2.
- the polypeptide of the present invention may be a recombinant polypeptide, a natural polypeptide, or a synthetic polypeptide, and preferably a recombinant polypeptide.
- the polypeptides of the invention can be naturally purified products, or chemically synthesized products, or produced using recombinant techniques from prokaryotic or eukaryotic hosts (e.g., bacteria, yeast, higher plants, insects, and mammalian cells). Depending on the host used in the recombinant production protocol, the polypeptide of the invention may be glycosylated, or it may be non-glycosylated. Polypeptides of the invention may also include or exclude starting methionine residues.
- the present invention also includes fragments, derivatives and analogs of the leucine multiple repeat sequence 71.
- fragment refers to a polypeptide that substantially retains the same biological function or activity of the leucine repeat sequence 71 of the present invention.
- a fragment, derivative or analog of the polypeptide of the present invention may be: (I) a kind in which one or more amino acid residues are substituted with conservative or non-conservative amino acid residues (preferably conservative amino acid residues), and the substitution
- the amino acid may or may not be encoded by a genetic codon; or ( ⁇ ) a type in which a group on one or more amino acid residues is replaced by another group to include a substituent; or ( ⁇ )
- Such a polypeptide sequence in which the mature polypeptide is fused with another compound such as a compound that prolongs the half-life of the polypeptide, such as polyethylene glycol
- a polypeptide sequence in which an additional amino acid sequence is fused into the mature polypeptide (Such as a leader sequence or a secreted sequence or a sequence used to purify this polypeptide or a protease sequence)
- such fragments, derivatives, and analogs are considered to be within the knowledge of those skilled in the art.
- the present invention provides an isolated nucleic acid (polynucleotide), which basically consists of a polynucleotide encoding a polypeptide having the amino acid sequence of SEQ ID NO: 2.
- the polynucleotide sequence of the present invention includes the nucleotide sequence of SEQ ID NO: 1.
- the polynucleotide of the present invention is found from a cDNA library of human fetal brain tissue. It contains a polynucleotide sequence with a total length of 2316 bases, and its open reading frame (20-1963) encodes 647 amino acids.
- This peptide has a leucine repeating characteristic sequence. It can be deduced that the leucine repeating characteristic sequence 71 has the structure and function represented by the leucine repeating characteristic sequence.
- the polynucleotide of the present invention may be in the form of DNA or RNA.
- DNA forms include cDNA, genomic DNA, or synthetic DNA.
- DNA can be single-stranded or double-stranded.
- DNA can be coding or non-coding.
- the coding region sequence encoding the mature polypeptide may be the same as the coding region sequence shown in SEQ ID NO: 1 or a degenerate variant.
- a "degenerate variant" refers to a nucleic acid sequence encoding a protein or polypeptide having SEQ ID NO: 2 but different from the coding region sequence shown in SEQ ID NO: 1 in the present invention.
- the polynucleotide encoding the mature polypeptide of SEQ ID NO: 2 includes: only the coding sequence of the mature polypeptide; the coding sequence of the mature polypeptide and various additional coding sequences; the coding sequence of the mature polypeptide (and optional additional coding sequences); Coding sequence.
- polynucleotide encoding a polypeptide refers to a polynucleotide that includes the polypeptide and a polynucleotide that includes additional coding and / or non-coding sequences.
- the invention also relates to variants of the polynucleotides described above, which encode polypeptides or fragments, analogs and derivatives of polypeptides having the same amino acid sequence as the invention.
- This polynucleotide variant can be a naturally occurring allelic variant or a non-naturally occurring variant.
- These nucleotide variants include substitution variants, deletion variants, and insertion variants.
- an allelic variant is an alternative form of a polynucleotide that may be a substitution, deletion, or insertion of one or more nucleotides, but does not substantially change the function of the polypeptide it encodes .
- the invention also relates to a polynucleotide that hybridizes to the sequence described above (having at least 50%, preferably 70% identity between the two sequences).
- the present invention particularly relates to polynucleotides that can hybridize to the polynucleotides of the present invention under stringent conditions.
- "strict conditions” means: (1) hybridization and elution at lower ionic strength and higher temperature, such as 0.2xSSC, 0.1 ° /. SDS, 60 ° C; or (2) adding a denaturant during hybridization, such as 50% (v / v) formamide, 0.1% calf serum / 0.
- Hybridization occurs only when the identity between the two sequences is at least 95%, and more preferably 97%.
- the polypeptide encoded by the hybridizable polynucleotide has the same biological function and activity as the mature polypeptide shown in SEQ ID NO: 2.
- nucleic acid fragments that hybridize to the sequences described above.
- a "nucleic acid fragment” contains at least 10 nucleotides in length, preferably at least 20-30 nucleotides, more preferably at least 50-60 nucleotides, and most preferably at least 100 cores. Glycylic acid or more. Nucleic acid fragments can also be used in nucleic acid amplification techniques, such as PCR, to identify and / or isolate polynucleotides encoding multiple repeats of leucine 71.
- polypeptides and polynucleotides in the present invention are preferably provided in an isolated form and are more preferably purified to homogeneity.
- the specific polynucleotide sequence encoding the leucine multiple repeat sequence 71 of the present invention can be obtained by various methods.
- polynucleotides are isolated using hybridization techniques well known in the art. These techniques include, but are not limited to: 1) hybridization of probes to genomic or cDNA libraries to detect homologous polynucleotide sequences, and 2) antibody screening of expression libraries to detect cloned polynucleosides with common structural characteristics Acid fragments.
- the DNA fragment sequence of the present invention can also be obtained by the following methods: 1) isolating the double-stranded DNA sequence from the genomic DNA; 2) chemically synthesizing the DNA sequence to obtain the double-stranded DM of the polypeptide.
- genomic DNA isolation is the least commonly used. Direct chemical synthesis of DNA sequences is often the method of choice. The more commonly used method is the isolation of cDNA sequences.
- the standard method for isolating cDNA of interest is to isolate mRNA from donor cells that overexpress the gene and perform reverse transcription to form a plasmid or Phage cDNA library. There are many mature techniques for extracting niRNA, and kits are also commercially available (Qiagene). CDM libraries are also commonly used (Sambrook, et al., Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory. New York, 1989). Commercially available cDNA libraries are also available, such as different cDNA libraries from Clontech. When polymerase reaction technology is used in combination, even very small expression products can be cloned.
- the genes of the present invention can be selected from these cDNA libraries by conventional methods. These methods include (but are not limited to): (l) DNA-DNA or DNA-RNA hybridization; (2) the presence or absence of a marker gene function; (3) the determination of the transcript level of the leucine multiple repeat sequence 71; (4) Detecting the protein product of gene expression by immunological technology or measuring biological activity. The above methods can be used singly or in combination.
- the probe used for hybridization is homologous to any part of the polynucleotide of the present invention, and its length is at least 10 nucleotides, preferably at least 30 nucleotides, more preferably At least 50 nucleotides, preferably at least 100 nucleotides.
- the length of the probe is usually within 2000 nucleotides, preferably within 1000 nucleotides.
- the probe used here is generally a DNA sequence chemically synthesized based on the gene sequence information of the present invention.
- the genes or fragments of the present invention can of course be used as probes.
- DNA probes can be labeled with radioisotopes, luciferin, or enzymes (such as alkaline phosphatase).
- immunological techniques such as Western blotting, radioimmunoprecipitation, and enzyme-linked immunosorbent assay (ELISA) can be used to detect protein products expressed by the leucine multiple repeat sequence 71 gene.
- a method of applying the PCR technique to amplify DM / RNA is preferably used to obtain the gene of the present invention.
- the RACE method RACE-Rapid Amplification of cDNA Ends
- the primers used for PCR can be appropriately based on the polynucleotide sequence information of the present invention disclosed herein. Select and synthesize using conventional methods.
- the amplified DNA / RNA fragments can be isolated and purified by conventional methods such as by gel electrophoresis.
- polynucleotide sequence of the gene of the present invention or various DNA fragments and the like obtained as described above can be determined by a conventional method such as dideoxy chain termination method (Sanger et al. PNAS, 1977, 74: 5463-5467). Such polynucleotide sequences can also be determined using commercial sequencing kits and the like. In order to obtain the full-length cDNA sequence, the sequencing must be repeated. Sometimes it is necessary to determine the cDNA sequence of multiple clones in order to splice into a full-length cDNA sequence.
- the present invention also relates to a vector comprising the polynucleotide of the present invention, and a host cell produced by genetic engineering using the vector of the present invention or directly using a leucine multiple repeat sequence 71 coding sequence, and the recombinant technology to produce the described Polypeptide method.
- a polynucleotide sequence encoding the leucine multiple repeat sequence 71 can be inserted into a vector to constitute a recombinant vector containing the polynucleotide of the present invention.
- carrier refers to a substance known in the art. Bacterial plasmids, phages, yeast plasmids, plant cell viruses, mammalian cell viruses such as adenoviruses, retroviruses or other vectors. Vectors suitable for use in the present invention include, but are not limited to: T7 promoter-based expression vectors expressed in bacteria (Rosenberg, et al.
- any plasmid and vector can be used to construct a recombinant expression vector.
- An important feature of expression vectors is that they usually contain an origin of replication, a promoter, a marker gene, and translational regulatory elements.
- Methods well known to those skilled in the art can be used to construct expression vectors containing a DNA sequence encoding a leucine multiple repeat sequence 71 and appropriate transcription / translation regulatory elements. These methods include in vitro recombinant DNA technology, leg synthesis technology, and in vivo recombination technology (Sambroook, et al. Molecular Cloning, a Laboratory Manual, cold Spring Harbor Laboratory. New York, 1989).
- the DNA sequence can be operably linked to an appropriate promoter in an expression vector to guide mRNA synthesis. Representative examples of these promoters are: the lac or trp promoter of E.
- the expression vector also includes a ribosome binding site for translation initiation and a transcription terminator. Insertion of enhancer sequences into the vector will enhance its transcription in higher eukaryotic cells. Enhancers are cis-acting factors for DNA expression, usually about 10 to 300 base pairs, which act on promoters to enhance gene transcription. Illustrative examples include SV40 enhancers of 100 to 270 base pairs on the late side of the origin of replication, polyoma enhancers on the late side of the origin of replication, and adenovirus enhancers.
- the expression vector preferably contains one or more selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
- selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
- GFP fluorescent protein
- tetracycline or ampicillin resistance for E. coli.
- a polynucleotide encoding a leucine multiple repeat sequence 71 or a recombinant vector containing the polynucleotide can be transformed or transduced into a host cell to form a genetically engineered host cell containing the polynucleotide or the recombinant vector .
- the term "host cell” refers to a prokaryotic cell, such as a bacterial cell; or a lower eukaryotic cell, such as a yeast cell; or a higher eukaryotic cell, such as a mammalian cell. Representative examples are: E.
- Transformation of a host cell with a DNA sequence described in the present invention or a recombinant vector containing the DNA sequence can be performed using conventional techniques well known to those skilled in the art.
- the host is a prokaryote such as E. coli
- competent cells capable of DNA uptake can be in the exponential growth phase were harvested, treated with (Method 12, using the procedure well known in the art.
- Alternative is MgC l 2.
- transformation can also be performed by electroporation.
- the following DNA transfection methods can be used: calcium phosphate co-precipitation method, or conventional mechanical methods such as microinjection, electroporation, and liposomes Packaging, etc.
- the polynucleotide sequence of the present invention can be used to express or produce a recombinant leucine multiple repeat sequence 71 (Scence, 1984; 224: 1431). Generally there are the following steps:
- the medium used in the culture may be selected from various conventional mediums. Culture is performed under conditions suitable for host cell growth. After the host cells have grown to an appropriate cell density, the selected promoter is induced by a suitable method (such as temperature conversion or chemical induction), and the cells are cultured for a period of time.
- a suitable method such as temperature conversion or chemical induction
- the recombinant polypeptide may be coated in a cell, expressed on a cell membrane, or secreted outside the cell.
- recombinant proteins can be separated and purified by various separation methods using their physical, chemical and other properties. These methods are well known to those skilled in the art. These methods include, but are not limited to: conventional renaturation treatment, protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid chromatography (HPLC) and various other liquid chromatography techniques and combinations of these methods.
- conventional renaturation treatment protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid chromatography
- Figure 1 is a comparison diagram of the amino acid sequences of the leucine multiple repeat sequence 71 and the leucine multiple repeat characteristic sequence of the present invention.
- FIG. 2 is a polyacrylamide gel electrophoresis diagram (SDS-PAGE) of an isolated leucine multiple repeat sequence 71.
- FIG. 71 KDa is the molecular weight of the protein. The arrow indicates the isolated protein band. The best way to implement the invention
- the determined cDNA sequence was compared with the existing public DM sequence database (Genebank), and it was found that the cDNA sequence of one of the clones 0465el 0 was new DNA.
- the inserted cDNA fragments contained in this clone were determined in both directions by synthesizing a series of primers.
- the results show that the 0465el 0 clone contains a full-length cDNA of 2316bp (as shown in Seq ID N0: 1), and has a 1944bp open reading frame (0RF) from 20bp to 1963bp, encoding a new protein (such as Seq ID NO: 2).
- This clone pBS-0465el O and the encoded protein was named leucine multiple repeat sequence 71.
- Example 2 Domain analysis of cDNA clones
- the sequence of the leucine repeat sequence 71 of the present invention and the protein sequence encoded by the leucine repeat sequence 71 of the present invention were performed using a profiling program (Basicloca l Al ignment search tool) in GCG [Al tschul, SF et a l. J. Mol. Bio l. 1990; 215: 403-10], domain analysis was performed in a database such as Prote.
- the leucine multiple repeat sequence 71 of the present invention is homologous with the domain leucine multiple repeat characteristic sequence. The results of the homology are shown in FIG. 1.
- Example 3 Cloning of a gene encoding a leucine multiple repeat sequence 71 by RT-PCR
- CDNA was synthesized using fetal brain cell total RNA as a template and ol igo-dT as a primer for reverse transcription reaction. After purification using Qiagene's kit, the following primers were used for PCR amplification: Primerl: 5'- GGAGGGCTCCGTTTGAAACATGGC -3 '(SEQ ID NO: 3) Primer 2: 5'- AGAAAATTATTTTCTTTAATTATC -3' (SEQ ID NO: 4)
- Primerl is a forward sequence starting at lbp of the 5th end of SEQ ID NO: 1;
- Primer2 is the 3 'end reverse sequence in SEQ ID NO: 1.
- Amplification conditions 50 ⁇ l of KC1, 10 mmol / L Tris- in a reaction volume of 50 ⁇ 1
- RNA extraction in one step [Anal. Biochem 1987, 162, 156-159] rempliThis method involves acid guanidinium thiocyanate phenol-chloroform extraction. 4M guanidine isothiocyanate-25mM sodium citrate, 0.2M acetic acid Sodium (pH 4.0) was used to homogenize the tissue, 1 volume of phenol and 1/5 volume of chloroform-isoamyl alcohol (49: 1) were added, and the mixture was centrifuged. The aqueous phase layer was aspirated and isopropyl alcohol (0.8 Volume) and the mixture was centrifuged to obtain an RNA pellet. The resulting RNA pellet was washed with 70% ethanol, dried and dissolved in water.
- RNA probe was the PCR-amplified leucine multiple repeat sequence 71 coding region sequence (20bp to 1963bp) shown in Figure 1. A 32P-labeled probe (about 2 x 10 6 cpm) was used.
- Primer3 5'- CCCCATATGATGGCGCGGGCTGGCCCTCGGCTG -3 '(Seq ID No: 5)
- Primer4 5'- CATGGATCCTCAGCAGGCCTGGCAGCCTCCATG -3 '(Seq ID No: 6)
- the 5' ends of these two primers contain Ndel and BamHI digestion sites, respectively, and the 5 'end of the target gene And the 3 'end coding sequence, the Ndel and BamHI restriction sites correspond to the selective endonuclease sites on the expression vector plasmid P ET28b (+) (Novagen, Cat. No. 69865.3).
- the PCR reaction was performed using pBS-0465el0 plasmid containing the full-length target gene as a template.
- the PCR reaction conditions were as follows: a total volume of 50 ⁇ 1 containing 10 pg of pBS-0465el0 plasmid, primers Primer-3 and Primer-4, and “J” was 10 mol, Advantage polymerase Mix (Clontech) 1 ⁇ 1. Cycle parameters: 94. C 20s, 60 ° C 30s, 68 ° C 2 min, a total of 25 cycles. Ndel and BamHI were used to double digest the amplified product and plasmid pET-28 (+), respectively, and large fragments were recovered and ligated with T4 ligase. The ligation product was transformed by the calcium chloride method of coliform bacteria DH5 alpha, containing kanamycin
- a peptide synthesizer (product of PE company) was used to synthesize the following leucine multiple repeat 71 specific peptides:
- NH2-Met-Ala-Arg-Ala-Gly-Pro-Arg-Leu-Val-Leu-Ser-Glu-Glu-Ala-Val-C00H (SEQ ID NO: 7).
- the polypeptide is coupled to hemocyanin and bovine serum albumin to form a complex, respectively.
- hemocyanin and bovine serum albumin For methods, see: Avrameas, et al. Immunochemistry, 1969; 6: 43. Rabbits were immunized with 4 mg of the hemocyanin peptide complex plus complete Freund's adjuvant, and 15 days later, the hemocyanin peptide complex plus incomplete Freund's adjuvant was used to boost immunity once.
- oligonucleotide fragments from the polynucleotides of the present invention for use as hybridization probes. Uses: if the probe can be used to hybridize to the genomic or cDNA library of normal tissue or pathological tissue from different sources to identify whether it contains the polynucleotide sequence of the present invention and detect a homologous polynucleotide sequence, it can further be used The probe detects whether the polynucleotide sequence of the present invention or a homologous polynucleotide sequence thereof is abnormally expressed in cells of normal tissue or pathological tissue.
- the purpose of this embodiment is to select a suitable oligonucleotide fragment from the polynucleotide SEQ ID NO: 1 of the present invention as a hybridization probe, and to identify whether some tissues contain the 'multicore of the present invention' by using a membrane hybridization method.
- Filter hybridization methods include dot blotting, Southern imprinting, Nor thern blotting, and copying methods. They all use the same steps to fix the polynucleotide sample to be tested on the filter and then hybridize.
- the sample-immobilized filter is first pre-hybridized with a probe-free hybridization buffer to saturate the non-specific binding site of the sample on the filter with the carrier and the synthesized polymer.
- the pre-hybridization solution is then replaced with a hybridization buffer containing labeled probes and incubated to hybridize the probes to the target nucleic acid.
- the unhybridized probes are removed by a series of membrane washing steps.
- This embodiment uses higher-intensity washing conditions (such as lower salt concentration and higher temperature), so that the hybridization background is reduced and only strong specific signals are retained.
- the probes used in this embodiment include two types: the first type of probes are oligonucleotide fragments that are completely the same as or complementary to the polynucleotide SEQ ID NO: 1 of the present invention; the second type of probes are partially related to the present invention
- the polynucleotide SEQ ID NO: 1 is the same or complementary oligonucleotide fragment.
- the dot blot method is used to fix the sample on the filter membrane. Under the high-intensity washing conditions, the first type of probe and the sample have the strongest hybridization specificity and are retained.
- oligonucleotide fragments from the polynucleotide SEQ ID NO: 1 of the present invention for use as hybridization probes should follow the following principles and several aspects to be considered:
- the preferred range of probe size is 18-50 nucleotides
- Those that meet the above conditions can be used as primary selection probes, and then further computer sequence analysis, including the primary selection probe and its source sequence region (ie, SEQ ID NO: 1) and other known genomic sequences and their complements The regions are compared for homology. If the homology with the non-target molecular region is greater than 85% or there are more than 15 consecutive bases, the primary probe should not be used;
- Probe 1 (probel), which belongs to the first type of probe, is completely homologous or complementary to the gene fragment of SEQ ID NO: 1 (41Nt): 5'- TGGCGCGGGCTGGCCCTCGGCTGGTGCTGAGCGAGGAGGCG -3 '(SEQ ID NO: 8)
- Probe 2 (probe2), which belongs to the second type of probe, is equivalent to the replacement mutant sequence of the gene fragment of SEQ ID NO: 1 or its complementary fragment (41Nt):
- PBS phosphate buffered saline
- step 8-13 are only used when contamination must be removed, otherwise step 14 can be performed directly.
- NC membranes nitrocellulose membranes
- Two NC membranes are required for each probe for subsequent experiments.
- the film is washed with high-strength conditions and strength conditions, respectively.
- Gene chip or DNA microarray is a new technology that many national laboratories and large pharmaceutical companies are currently developing and developing. It refers to the orderly and high-density arrangement of a large number of target gene fragments on slopes. , Silicon and other carriers, and then use fluorescence detection and computer software to compare and analyze the data, in order to achieve the purpose of rapid, efficient, high-throughput analysis of biological information.
- the polynucleotide of the present invention can be used as a target DM for gene chip technology for high-throughput research of new gene functions; searching for and screening new tissue-specific genes, especially new genes related to diseases such as tumors; diagnosis of diseases such as hereditary diseases .
- a total of 4,000 polynucleotide sequences of various full-length cDNAs are used as the target DM, including the polynucleotide of the present invention. They were amplified by PCR respectively. After purification, the amplified product was adjusted to a concentration of about 500 ng / ul, and spotted on a glass medium using a Cartesian 7500 spotter (purchased from Cartesian, USA). The distance is 280 ⁇ . The spotted slides were hydrated, dried, and cross-linked in a purple diplomatic coupling instrument. After elution, the DNA was fixed on a glass slide to prepare a chip. The specific method steps have been reported in the literature in various ways. The post-spot processing steps of this embodiment are:
- the probes from the above two tissues and the chip were respectively hybridized in a UniHyb TM Hybridization Solution (purchased from TeleChem) hybridization solution for 16 hours, and the washing solution (1 ⁇ SSC, 0.2% SDS) After washing, scan with a ScanArray 3000 scanner (purchased from Genera Scanning, USA). The scanned images are analyzed by Imagene software (Biodi scovery, USA), and the data of each point are calculated.
- the ratio of Cy3 / Cy5 the ratio of which is less than 0.5 and greater than 2 is considered to be a gene with differential expression.
- polypeptides of the present invention as well as antagonists, agonists and inhibitors of the polypeptides, can be directly used in the treatment of diseases, for example, they can treat malignant tumors, adrenal deficiency, skin diseases, various types of inflammation, HIV infection, and immune diseases.
- the leucine multiple repeat sequence acts as a binding domain between a protein and a cell regulatory factor.
- the protein inhibits the activity of the regulatory factor through its binding to the cell regulatory factor.
- the protein with this sequence usually has a signal transduction effect, and sometimes causes pathological reactions Protein interaction.
- this sequence is contained in the RNase inhibitory factor, which is a cytoplasmic protein that tightly binds and inhibits the pancreatic RNase superfamily, participates in the regulation of RNA renewal in mammalian cells, and plays a role in angiogenesis.
- Polypeptides containing multiple leucine repeats are characterized by multiple leucine repeats that are necessary for their biological activity.
- the polypeptide of the present invention is a polypeptide containing a characteristic leucine multiple repeat sequence, whose abnormal expression will cause abnormal inhibition of the activity of cell regulatory factors, abnormal inhibition of the pancreatic RNase superfamily, and may cause angiogenesis and type I immune response In the abnormal role, and related diseases.
- the abnormal expression of the leucine multiple repeat sequence 71 of the present invention will produce various diseases, especially Bernard-Soul ier disease, vascular disease, type I immune disease, and various tumors. These diseases include but are not Limited to:
- Vascular diseases atherosclerosis, vasculitis, hemangiomas, hemangioendothelioma
- Type I immune disease bronchial asthma, aspirin asthma, allergic rhinitis, allergic bronchopulmonary aspergillosis, allergic pneumonia, pulmonary eosinophilia, diffuse pulmonary interstitial fibrosis, nodules Disease, urticaria, atopic dermatitis
- Tumors of various tissues stomach cancer, liver cancer, lung cancer, esophageal cancer, breast cancer, leukemia, lymphoma, thyroid tumor, uterine fibroids, neuroblastoma, astrocytoma, ependymoma, glioblastoma, nerve Fibroma, colon cancer, melanoma, adrenal cancer, bladder cancer, bone cancer, osteosarcoma, myeloma, bone marrow cancer, uterine cancer, endometrial cancer, gallbladder cancer, colon cancer, thymic tumor, nasal and sinus tumors, nose Pharyngeal cancer, Laryngeal cancer, Tracheal tumor, Fibroma, Fi
- the abnormal expression of the leucine multiple repeat sequence 71 of the present invention will also cause certain hereditary, hematological diseases and the like.
- the polypeptide of the present invention and the antagonists, agonists and inhibitors of the polypeptide can be directly used in the treatment of diseases, for example, it can treat various diseases, especially Bernard-Souier disease, vascular disease, type I immune disease, each Tumors, certain hereditary, hematological diseases, etc.
- the invention also provides methods for screening compounds to identify agents that increase (agonist) or suppress (antagonist) the leucine multiple repeat sequence 71. Agonists increase multiple repeats of leucine 71 to stimulate biological functions such as cell proliferation, while antagonists prevent and treat disorders related to excessive cell proliferation, such as various cancers.
- mammalian cells or a membrane preparation expressing a leucine multiple repeat sequence 71 can be cultured together with a labeled leucine multiple repeat sequence 71 in the presence of a drug. The ability of the drug to increase or suppress this interaction is then determined.
- Antagonists of the leucine multiple repeat sequence 71 include antibodies, compounds, receptor deletions, and the like that have been screened. Antagonists of leucine repeat 71 can bind to leucine repeat 71 and eliminate its function, or inhibit the production of the polypeptide, or bind to the active site of the polypeptide so that the polypeptide cannot function biological functions.
- the leucine multiple repeat sequence 71 can be added to the bioanalytical assay, and the compound can be determined by measuring the effect of the compound on the interaction between the leucine multiple repeat sequence 71 and its receptor. Whether it is an antagonist. Receptor deletions and analogs that act as antagonists can be screened in the same way as for screening compounds described above.
- Polypeptide molecules capable of binding to multiple repeats of leucine 71 can be obtained by screening a random peptide library composed of various possible combinations of amino acids bound to a solid phase. During screening, 71 molecules of leucine multiple repeats should generally be labeled.
- the present invention provides a method for producing an antibody using a polypeptide, a fragment, a derivative, an analog thereof, or a cell thereof as an antigen.
- These antibodies can be polyclonal or monoclonal antibodies.
- the invention also provides antibodies against the leucine multiple repeat sequence 71 epitope. These antibodies include (but are not limited to): polyclonal antibodies, monoclonal antibodies, chimeric antibodies, single chain antibodies, Fab fragments, and fragments produced by Fab expression libraries.
- Polyclonal antibodies can be produced by repeating the leucine repeat sequence 71 directly by immunizing animals (such as rabbits, mice, rats, etc.).
- a variety of adjuvants can be used to enhance the immune response, including but not limited to Freund's Adjuvant, etc.
- Techniques for preparing monoclonal antibodies to the leucine multiple repeat sequence 71 include, but are not limited to, hybridoma technology (Kohler and Milstein. Nature, 1975, 256: 495-497), triple tumor technology, human beta cell hybridoma technology, EBV-hybridoma technology, etc. Chimeric antibodies that bind human constant regions and non-human-derived variable regions can be produced using existing techniques (Morrison et al, PNAS, 1985, 81: 6851). The existing technology for producing single chain antibodies (US Pat No. 4946778) can also be used to produce single chain antibodies against leucine multiple repeats 71.
- Antibodies to leucine multiple repeat 71 can be used in immunohistochemical techniques to detect leucine multiple repeat 71 in biopsy specimens.
- Monoclonal antibodies that bind to multiple repeats of leucine 71 can also be labeled with radioisotopes and injected into the body to track their location and distribution. This radiolabeled antibody can be used as a non-invasive diagnostic method to locate tumor cells and determine whether there is metastasis.
- Antibodies can also be used to design immunotoxins that target a particular part of the body. For example, leucine repeats sequence 71.
- High affinity monoclonal antibodies can covalently bind to bacterial or plant toxins (such as diphtheria toxin, ricin, ormosine, etc.).
- a common method is to attack the amino group of the antibody with a thiol cross-linking agent such as SPDP and bind the toxin to the antibody through the exchange of disulfide bonds.
- This hybrid antibody can be used to kill leucine multiple repeats of 71 positive Cell.
- the antibodies of the present invention can be used to treat or prevent diseases related to the leucine multiple repeat sequence 71.
- Administration of an appropriate dose of the antibody can stimulate or block the production or activity of the leucine repeat 71.
- the invention also relates to a diagnostic test method for quantitative and localized detection of the level of leucine multiple repeats 71.
- tests are well known in the art and include FISH assays and radioimmunoassays.
- the level of leucine repeat 71 detected in the test can be used to explain the importance of leucine repeat 71 in various diseases and to diagnose the role of leucine repeat 71 disease.
- polypeptide of the present invention can also be used for peptide mapping analysis.
- the polypeptide can be specifically cleaved by physical, chemical or enzymatic analysis, and subjected to one-dimensional or two-dimensional or three-dimensional gel electrophoresis analysis, and more preferably mass spectrometry analysis.
- the polynucleotide encoding the leucine multiple repeat sequence 71 can also be used for a variety of therapeutic purposes.
- Gene therapy technology can be used to treat abnormal cell proliferation, development or metabolism caused by the non-expression or abnormal / inactive expression of leucine multiple repeat sequence 71.
- Recombinant gene therapy vectors (such as viral vectors) can be designed to express variant leucine multiple repeats 71 to inhibit endogenous leucine multiple repeats 71 activity.
- a mutated leucine multiple repeat sequence 71 may be shortened and missing signal transmission.
- the leucine repeating sequence 71 of the lead domain although it can bind to downstream substrates, lacks signal transduction activity.
- the recombinant gene therapy vector can be used to treat diseases caused by leucine multiple repeat sequence 71 expression or abnormal activity.
- Virus-derived expression vectors such as retrovirus, adenovirus, adenovirus-associated virus, herpes simplex virus, parvovirus, etc. can be used to transfer a polynucleotide encoding a leucine multiple repeat sequence 71 into a cell.
- a method for constructing a recombinant viral vector carrying a polynucleotide encoding a leucine multiple repeat sequence 71 can be found in the existing literature (Sambrook, etal.).
- a polynucleotide encoding a leucine multiple repeat sequence 71 can be packaged into liposomes and transferred into cells.
- Methods for introducing a polynucleotide into a tissue or cell include: directly injecting the polynucleotide into a tissue in vivo; or introducing the polynucleotide into a cell in vitro through a vector (such as a virus, phage, or plasmid), and then transplanting the cell Into the body and so on.
- a vector such as a virus, phage, or plasmid
- Oligonucleotides including antisense RNA and DNA
- ribozymes that inhibit multiple repeats of leucine 71 mRNA are also within the scope of the present invention.
- a ribozyme is an enzyme-like RNA molecule that specifically decomposes specific RNA. Its mechanism of action is that the ribozyme molecule specifically hybridizes with a complementary target RNA for endonucleation.
- Antisense RNA, DNA, and ribozymes can be obtained using any existing RNA or DNA synthesis technology, such as solid-phase phosphoramidite chemical synthesis to synthesize oligonucleotides.
- Antisense RNA molecules can be obtained by in vitro or in vivo transcription of a DNA sequence encoding the RNA.
- This DNA sequence has been integrated downstream of the vector's RNA polymerase promoter.
- it can be modified in a variety of ways, such as increasing the sequence length on both sides, and the linkage between ribonucleosides using phosphate thioester or peptide bonds instead of phosphodiester bonds.
- the polynucleotide encoding the leucine repeat 71 is useful for the diagnosis of diseases related to the leucine repeat 7 1.
- the polynucleotide encoding the leucine multiple repeat sequence 71 can be used to detect the expression of the leucine multiple repeat sequence 71 or the abnormal expression of the leucine multiple repeat sequence 71 in a disease state.
- the DM sequence encoding the leucine multiple repeat sequence 71 can be used to hybridize biopsy specimens to determine the expression status of the leucine multiple repeat sequence 7 1.
- Hybridization techniques include Sou thern blotting, Northern blotting, and in situ hybridization. These techniques and methods are publicly available and mature, and the relevant kits are commercially available.
- a part or all of the polynucleotide of the present invention can be used as a probe to be fixed on a microarray (Microray) or a DM chip (also known as a "gene chip"), and used to analyze differential expression analysis of genes in tissues and Genetic diagnosis.
- Leucine multiple repeats 71 specific primers for RNA-polymerase chain reaction (RT-PCR) in vitro amplification can also detect the leucine multiple repeats 71 transcription products.
- Leuine Multiple Repeats 71 Mutated Forms Included With Normal Wild Type Leucine Multiple repeats 71 DNA sequences compared to point mutations, translocations, deletions, recombinations and any other abnormalities. Mutations can be detected using existing techniques such as Southern blotting, DNA sequence analysis, PCR and in situ hybridization. In addition, mutations may affect the expression of proteins. Therefore, Northern blotting and Western blotting can be used to indirectly determine whether a gene is mutated.
- the sequences of the invention are also valuable for chromosome identification.
- the sequence specifically targets a specific position on a human chromosome and can hybridize to it.
- specific sites for each gene on the chromosome need to be identified.
- only a few chromosome markers based on actual sequence data are available for marking chromosome positions.
- an important first step is to locate these DNA sequences on a chromosome.
- the PCR primers (preferably 15-35bp) are prepared based on the cDNA, and the sequences can be located on the chromosomes. These primers were then used for PCR screening of somatic hybrid cells containing individual human chromosomes. Only those heterozygous cells containing the human gene corresponding to the primer will produce amplified fragments.
- PCR localization of somatic hybrid cells is a quick way to localize DNA to specific chromosomes.
- oligonucleotide primers of the present invention in a similar manner, a set of fragments from a specific chromosome or a large number of genomic clones can be used to achieve sublocalization.
- Other similar strategies that can be used for chromosomal localization include in situ hybridization, chromosome pre-screening with labeled flow sorting, and pre-selection of hybridization to construct chromosome-specific cDNA libraries.
- Fluorescent in situ hybridization of cDNA clones with metaphase chromosomes allows precise chromosomal localization in one step.
- FISH Fluorescent in situ hybridization
- the physical location of the sequence on the chromosome can be correlated with the genetic map data. These data can be found in, for example, V. Mckusick, Mendel ian Inheritance in Man (available online with Johns Hopkins University Welch Medical Library). Linkage analysis can then be used to determine the relationship between genes and diseases that have been mapped to chromosomal regions.
- the differences in cDNA or genomic sequences between the affected and unaffected individuals need to be determined. If a mutation is observed in some or all diseased individuals and the mutation is not observed in any normal individuals, the mutation may be the cause of the disease. Comparing affected and unaffected individuals usually involves first looking for structural changes in the chromosome, such as deletions or translocations that are visible at the chromosomal level or detectable using cDNA sequence-based PCR. According to the resolution capabilities of current physical mapping and gene mapping technology, the cDNA accurately mapped to the chromosomal region associated with the disease can be one of 50 to 500 potentially pathogenic genes (assuming 1 megabase mapping resolution) Capacity and each 20kb corresponds to a gene).
- the polypeptides, polynucleotides and mimetics, agonists, antagonists and inhibitors of the present invention can be used in combination with a suitable pharmaceutical carrier.
- suitable pharmaceutical carrier can be water, glucose, ethanol, salts, buffers, glycerol, and combinations thereof.
- the composition comprises a safe and effective amount of the polypeptide or antagonist, and carriers and excipients that do not affect the effect of the drug. These compositions can be used as drugs for the treatment of diseases.
- the invention also provides a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the invention.
- a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the invention.
- these containers there may be instructional instructions given by government agencies that manufacture, use, or sell pharmaceuticals or biological products, which prompts permission for administration on the human body by government agencies that produce, use, or sell.
- the polypeptides of the invention can be used in combination with other therapeutic compounds.
- the pharmaceutical composition can be administered in a convenient manner, such as by a topical, intravenous, intraperitoneal, intramuscular, subcutaneous, intranasal or intradermal route of administration.
- the leucine repeat sequence 71 is administered in an amount effective to treat and / or prevent a specific indication.
- the amount and range of leucine repeats 71 administered to a patient will depend on many factors, such as the mode of administration, the health conditions of the person to be treated, and the judgment of the diagnostician.
Landscapes
- Chemical & Material Sciences (AREA)
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- General Health & Medical Sciences (AREA)
- Gastroenterology & Hepatology (AREA)
- Biochemistry (AREA)
- Biophysics (AREA)
- Zoology (AREA)
- Genetics & Genomics (AREA)
- Medicinal Chemistry (AREA)
- Molecular Biology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Toxicology (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Peptides Or Proteins (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
Abstract
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
AU29981/01A AU2998101A (en) | 2000-01-26 | 2001-01-15 | A novel polypeptide, a leucine multirepeating sequence 71 and the polynucleotideencoding the polypeptide |
Applications Claiming Priority (2)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN 00111505 CN1306975A (zh) | 2000-01-26 | 2000-01-26 | 一种新的多肽——亮氨酸多次重复序列71和编码这种多肽的多核苷酸 |
CN00111505.7 | 2000-01-26 |
Publications (1)
Publication Number | Publication Date |
---|---|
WO2001055374A1 true WO2001055374A1 (fr) | 2001-08-02 |
Family
ID=4581415
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
PCT/CN2001/000045 WO2001055374A1 (fr) | 2000-01-26 | 2001-01-15 | Nouveau polypeptide, sequence 71 de multirepetition de la leucine, et polynucleotide codant pour ce polypeptide |
Country Status (3)
Country | Link |
---|---|
CN (1) | CN1306975A (fr) |
AU (1) | AU2998101A (fr) |
WO (1) | WO2001055374A1 (fr) |
Families Citing this family (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN108721646B (zh) * | 2017-04-17 | 2021-10-01 | 中山大学 | 一种抑制病毒感染的方法及抗病毒药物 |
-
2000
- 2000-01-26 CN CN 00111505 patent/CN1306975A/zh active Pending
-
2001
- 2001-01-15 AU AU29981/01A patent/AU2998101A/en not_active Abandoned
- 2001-01-15 WO PCT/CN2001/000045 patent/WO2001055374A1/fr active Application Filing
Non-Patent Citations (4)
Title |
---|
DATABASE GENBANK [online] 18 July 1999 (1999-07-18), Database accession no. AF126036 * |
DATABASE GENBANK [online] 23 November 1999 (1999-11-23), accession no. EMBL Database accession no. AL078584 * |
DATABASE GENBANK [online] 28 January 1999 (1999-01-28), Database accession no. AF035412 * |
DATABASE GENBANK [online] 28 January 1999 (1999-01-28), Database accession no. U82796 * |
Also Published As
Publication number | Publication date |
---|---|
CN1306975A (zh) | 2001-08-08 |
AU2998101A (en) | 2001-08-07 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
WO2001068689A1 (fr) | Nouveau polypeptide, 1alpha sous-unite 13 humaine du facteur adaptatif de l'hypoxie, et polynucleotide codant pour ce polypeptide | |
WO2001079490A1 (fr) | Nouveau polypeptide, proteine antigene prostatique specifique membranaire 16, et polynucleotide codant pour ce polypeptide | |
WO2001055374A1 (fr) | Nouveau polypeptide, sequence 71 de multirepetition de la leucine, et polynucleotide codant pour ce polypeptide | |
WO2001053495A1 (fr) | Nouveau polypeptide, ferrodexine 10, et polynucleotide codant pour ce polypeptide | |
WO2001066730A1 (fr) | Nouveau polypeptide, proteine humaine rs3 12, et polynucleotide codant pour ce polypeptide | |
WO2001046240A1 (fr) | Nouveau polypeptide, mariner transposase 19 humaine, et polynucleotide codant pour ce polypeptide | |
WO2001085752A1 (fr) | Polynucleotide codant un peptide de myosine | |
WO2001070796A1 (fr) | Nouveau polypeptide, proteine humaine a doigt de zinc 78, et polynucleotide codant pour ce polypeptide | |
WO2001075023A2 (fr) | Nouveau polypeptide, phosphatidylinositol-3 (ptdins 3) kinase humaine 9, et polynucleotide codant pour ce polypeptide | |
WO2001075048A2 (fr) | Nouveau polypeptide, proteine ribosomale humaine s11 23, et polynucleotide codant pour ce polypeptide | |
WO2001079432A2 (fr) | Nouveau polypeptide, facteur humain de transcription de la differentiation cellulaire 58, et polynucleotide codant pour ce polypeptide | |
WO2001053499A1 (fr) | Nouveau polypeptide, proteine nucleolaire humaine 18 de proliferation cellulaire, et polynucleotide codant pour ce polypeptide | |
WO2001073061A1 (fr) | Nouveau polypeptide, proteine humaine 22 du retinoblastome, et polynucleotide codant pour ce polypeptide | |
WO2001075029A2 (fr) | Nouveau polypeptide, facteur humain 11 associe a nf-e2, et polynucleotide codant pour ce polypeptide | |
WO2001040295A1 (fr) | Nouveau polypeptide, proteine humaine 48 a doigt de zinc, et polynucleotide codant pour ce polypeptide | |
WO2001048218A1 (fr) | Nouveau polypeptide, proteine muts 13, et polynucleotide codant pour ce polypeptide | |
WO2001090171A1 (fr) | Nouveau polypeptide, proteine humaine ribosomale sii 12, et polynucleotide codant ce polypeptide | |
WO2001066580A1 (fr) | Nouveau polypeptide, proteine humaine 13 a doigt de zinc, et polynucleotide codant pour ce polypeptide | |
WO2001073008A1 (fr) | Nouveau polypeptide, nucleoproteine humaine 13 associee aux tumeurs, et polynucleotide codant pour ce polypeptide | |
WO2001066576A1 (fr) | Nouveau polypeptide, glycoproteine amyloidogenique humaine 11, et polynucleotide codant pour ce polypeptide | |
WO2001055384A1 (fr) | Nouveau polypeptide, regulateur humain 30 de formation d'actine, et polynucleotide codant pour ce polypeptide | |
WO2001066728A1 (fr) | Nouveau polypeptide, proteine humaine 11 du gene de reparation de mesappariement de l'adn, et polynucleotide codant pour ce polypeptide | |
WO2001075024A2 (fr) | Nouveau polypeptide, facteur humain 13 associe a nf-e2, et polynucleotide codant pour ce polypeptide | |
WO2001083728A1 (fr) | Nouveau polypeptide, proteine humaine de transport d'acides amines excitateurs 9, et polynucleotide codant pour ce polypeptide | |
WO2001074995A2 (fr) | Nouveau polypeptide, protéine humaine de mutation 15 de l'ataxie telangiectasie, et de polynucléotide codant pour ce polypeptide |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
AK | Designated states |
Kind code of ref document: A1 Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW |
|
AL | Designated countries for regional patents |
Kind code of ref document: A1 Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG |
|
121 | Ep: the epo has been informed by wipo that ep was designated in this application | ||
REG | Reference to national code |
Ref country code: DE Ref legal event code: 8642 |
|
122 | Ep: pct application non-entry in european phase | ||
NENP | Non-entry into the national phase |
Ref country code: JP |