WO2001070794A1 - Nouveau polypeptide, proteine humaine a doigt de zinc 11, et polynucleotide codant pour ce polypeptide - Google Patents

Nouveau polypeptide, proteine humaine a doigt de zinc 11, et polynucleotide codant pour ce polypeptide Download PDF

Info

Publication number
WO2001070794A1
WO2001070794A1 PCT/CN2001/000401 CN0100401W WO0170794A1 WO 2001070794 A1 WO2001070794 A1 WO 2001070794A1 CN 0100401 W CN0100401 W CN 0100401W WO 0170794 A1 WO0170794 A1 WO 0170794A1
Authority
WO
WIPO (PCT)
Prior art keywords
polypeptide
polynucleotide
zinc finger
finger protein
human zinc
Prior art date
Application number
PCT/CN2001/000401
Other languages
English (en)
Chinese (zh)
Inventor
Yumin Mao
Yi Xie
Original Assignee
Shanghai Biowindow Gene Development Inc.
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Shanghai Biowindow Gene Development Inc. filed Critical Shanghai Biowindow Gene Development Inc.
Priority to AU50263/01A priority Critical patent/AU5026301A/en
Publication of WO2001070794A1 publication Critical patent/WO2001070794A1/fr

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/47Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals

Definitions

  • the present invention belongs to the field of biotechnology. Specifically, the present invention describes a novel polypeptide, human zinc finger protein 11, and a polynucleotide sequence encoding the polypeptide. The invention also relates to a preparation method and application of the polynucleotide and polypeptide.
  • Zinc finger protein is a DNA-binding protein, which was first discovered in the amino acid sequence of Xenopus RNA polymerase III-mediated 5S rRNA gene transcription factor TF III A protein. Since then, zinc finger proteins have been expressed in various tissues of different organisms, including hematopoietic cells, brain, nervous system, epidermal tissues, various tissues related to secretion and absorption, and tissues related to tumors and immortal cell lines. Wait. There are two main types of zinc finger structures:
  • the typical zinc finger structure of TFIIIA is Cys-Cys ... H s-H i s arrangement.
  • Zn is combined with Cys-Cys ... Cys-Cys.
  • the general feature is that the amino acid sequence between the internal ligands does not contain conserved tyrosine, phenylalanine, leucine, etc. Sex amino acids, but contains acidic amino acids. It is likely that acidic and basic amino acids form salt bridges rather than forming a hydrophobic region.
  • Zn zinc finger proteins
  • the role of Zn is to bind protein molecules to form the backbone of a finger conformation with DNA.
  • Zinc finger structures are found in many proteins involved in "protein-nucleic acid” and “protein-protein” interactions. Zinc finger protein can bind to double-stranded DM (dsDNA) or single-stranded RNA. Its function is generally related to the regulation of gene expression, and may have the role of transcription factors and signaling factors [Miller, 1985]. Existing research indicates that C 2 H 2 type zinc finger domains play a key role in developmental regulation.
  • dsDNA double-stranded DM
  • RNA single-stranded RNA
  • the human zinc finger protein 11 protein plays an important role in regulating important functions of the body such as cell division and embryonic development, and it is believed that a large number of proteins are involved in these regulatory processes, so there has been a need in the art to identify more of these processes Human zinc finger protein 11 protein, especially the amino acid sequence of this protein is identified. Isolation of the new human zinc finger protein 11 protein encoding gene also provides a basis for research to determine the role of this protein in health and disease states. This protein may form the basis for the development of diagnostic and / or therapeutic drugs for diseases, so isolating its coding DNA is important. Object of the invention
  • Another object of the invention is to provide a polynucleotide encoding the polypeptide.
  • Another object of the present invention is to provide a recombinant vector containing a polynucleotide encoding human zinc finger protein 11.
  • Another object of the present invention is to provide a genetically engineered host cell containing a polynucleotide encoding human zinc finger protein 11.
  • Another object of the present invention is to provide a method for producing human zinc finger protein 11.
  • Another object of the present invention is to provide an antibody against the polypeptide of the present invention, human zinc finger protein 11.
  • Another object of the present invention is to provide mimic compounds, antagonists, agonists, and inhibitors directed to the polypeptide of the present invention, human zinc finger protein 11.
  • Another object of the present invention is to provide a method for diagnosing and treating diseases associated with abnormalities in human zinc finger protein 11. Summary of invention
  • the present invention relates to an isolated polytitanium.
  • the polypeptide is of human origin and comprises: a polypeptide having the amino acid sequence of SEQ ID D. 2, or a conservative variant, biologically active fragment or derivative thereof.
  • the polypeptide is a polypeptide having the amino acid sequence of SEQ ID NO: 2.
  • the invention also relates to an isolated polynucleotide comprising a nucleotide sequence or a variant thereof selected from the group consisting of:
  • sequence of the polynucleotide is one selected from the group consisting of: (a) a sequence having positions 140-448 in SEQ ID NO: 1; and (b) a sequence having 1-2644 in SEQ ID NO: 1 Sequence of bits.
  • the present invention further relates to a vector, particularly an expression vector, containing the polynucleotide of the present invention; a host cell genetically engineered with the vector, including a transformed, transduced or transfected host cell; Host cell and method of preparing the polypeptide of the present invention by recovering the expression product.
  • the invention also relates to an antibody capable of specifically binding to a polypeptide of the invention.
  • the invention also relates to a method for screening compounds that mimic, activate, antagonize or inhibit the activity of human zinc finger protein 11 protein, which comprises utilizing the polypeptide of the invention.
  • the invention also relates to compounds obtained by this method.
  • the invention also relates to a method for in vitro detection of a disease or susceptibility to disease associated with abnormal expression of human zinc finger protein 1 1 protein, comprising detecting a mutation in the polypeptide or a polynucleotide sequence encoding the same in a biological sample, or detecting a biological The amount or biological activity of a polypeptide of the invention in a sample.
  • the invention also relates to a pharmaceutical composition
  • a pharmaceutical composition comprising a polypeptide of the invention or a mimetic thereof, an activator, an antagonist or an inhibitor, and a pharmaceutically acceptable carrier.
  • the present invention also relates to the use of the polypeptide and / or polynucleotide of the present invention in the preparation of a medicament for treating cancer, developmental disease or immune disease or other diseases caused by abnormal expression of human zinc finger protein ⁇ .
  • FIG. 1 is a comparison diagram of gene chip expression profiles of human zinc finger protein 11 and human zinc finger protein 59 according to the present invention.
  • the upper graph is a graph of the expression profile of human zinc finger protein 11 and the lower graph is the graph of the expression profile of human zinc finger protein 59.
  • 1 indicates fetal kidney
  • 2 indicates fetal large intestine
  • 3 indicates fetal small intestine
  • 4 indicates fetal muscle
  • 5 indicates fetal brain
  • 6 indicates fetal bladder
  • 7 indicates unstarved L02
  • 8 indicates L02 +, lhr, As 3+
  • 9 indicates ECV304 PMA-
  • 10 means ECV304 PMA +
  • 11 means fetal liver
  • 12 means normal liver
  • 13 means thyroid
  • 14 means skin
  • 15 means fetal lung
  • 16 means lung
  • 17 means lung cancer
  • 18 means fetal spleen
  • 19 means spleen
  • 20 Indicates prostate
  • 21 indicates fetal heart
  • 22 indicates heart
  • 23 indicates muscle
  • 24 indicates testis
  • 25 indicates fetal thymus
  • 26 indicates thymus.
  • Figure 2 shows the polyacrylamide gel electrophoresis (SDS-PAGE) of human zinc finger protein 11 isolated.
  • llkDa is the molecular weight of the protein.
  • the arrow indicates the isolated protein band.
  • Nucleic acid sequence refers to an oligonucleotide, a nucleotide or a polynucleotide and a fragment or part thereof, and may also refer to a genomic or synthetic DNA or RNA, they can be single-stranded or double-stranded, representing the sense or antisense strand.
  • amino acid sequence refers to an oligopeptide, peptide, polypeptide or protein sequence and fragments or portions thereof.
  • amino acid sequence in the present invention relates to the amino acid sequence of a naturally occurring protein molecule, such "polypeptide” or “protein” does not mean to limit the amino acid sequence to a complete natural amino acid related to the protein molecule .
  • a “variant" of a protein or polynucleotide refers to an amino acid sequence having one or more amino acids or nucleotide changes or a polynucleotide sequence encoding it.
  • the changes may include deletions, insertions or substitutions of amino acids or nucleotides in the amino acid sequence or nucleotide sequence.
  • Variants can have "conservative" changes, in which the amino acid substituted has a structural or chemical property similar to the original amino acid, such as replacing isoleucine with leucine.
  • Variants can also have non-conservative changes, such as replacing glycine with tryptophan.
  • “Deletion” refers to the deletion of one or more amino acids or nucleotides in an amino acid sequence or nucleotide sequence.
  • Insertion means that a change in the amino acid sequence or nucleotide sequence results in an increase in one or more amino acids or nucleotides compared to a molecule that exists in nature.
  • Replacement refers to the replacement of one or more amino acids or nucleotides with different amino acids or nucleotides.
  • Bioactivity refers to a protein that has the structure, regulation, or biochemical function of a natural molecule.
  • immunologically active refers to the ability of natural, recombinant or synthetic proteins and fragments thereof to induce a specific immune response and to bind specific antibodies in a suitable animal or cell.
  • Antagonist means that when bound to human zinc finger protein 11, a protein that causes the protein to change Molecules that regulate the activity of the protein.
  • An agonist may include a protein, a nucleic acid, a carbohydrate, or any other molecule that can bind human zinc finger protein 11.
  • Antagonist refers to a molecule that can block or regulate the biological or immunological activity of human zinc finger protein 11 when combined with human zinc finger protein 11.
  • Antagonists and inhibitors may include proteins, nucleic acids, carbohydrates or any other molecule that can bind human zinc finger protein 11.
  • Regular refers to a change in the function of human zinc finger protein 11, including an increase or decrease in protein activity, a change in binding properties, and any other biological, functional, or immune properties of human zinc finger protein 11.
  • substantially pure means substantially free of other proteins, lipids, carbohydrates or other substances with which it is naturally associated.
  • Those skilled in the art can purify human zinc finger protein 11 using standard protein purification techniques.
  • Substantially pure human zinc finger protein 11 produces a single main band on a non-reducing polyacrylamide gel.
  • the purity of human zinc finger protein 11 polypeptide can be analyzed by amino acid sequence.
  • Complementary refers to natural binding of polynucleotides by base-pairing ⁇ under allowed salt concentration and temperature conditions.
  • sequence "C-T-G-A” can be combined with the complementary sequence "G-A-C-T”.
  • the complementarity between two single-stranded molecules may be partial or complete.
  • the degree of complementarity between nucleic acid strands has a significant effect on the efficiency and strength of hybridization between two nucleic acid strands.
  • “Homology” refers to the degree of complementarity and can be partially homologous or completely homologous.
  • Partial homology refers to a partially complementary sequence that at least partially inhibits hybridization of a fully complementary sequence to a target nucleic acid. Inhibition of such hybridization can be detected by performing hybridization (Southern trace or Northern blot, etc.) under conditions of reduced stringency. Substantially homologous sequences or hybridization probes can compete and inhibit the binding of fully homologous sequences to the target sequence under conditions of reduced stringency. This does not mean that the conditions of reduced stringency allow non-specific binding, because the conditions of reduced stringency require that the two sequences are bound to each other as specific or selective interactions.
  • Percent identity refers to the percentage of sequences that are the same or similar in a comparison of two or more amino acid or nucleic acid sequences. Percent identity can be determined electronically, such as through the MEGALIGN program
  • the MEGALIGN program can compare two or more sequences according to different methods such as the Cluster method (Higgins, D. G. 3 ⁇ 4
  • the Cluster method arranges groups of sequences into clusters by checking the distance between all pairs. The clusters are then assigned in pairs or groups. The percent identity between two amino acid sequences such as sequence A and sequence B is calculated by the following formula:
  • the number of residues between the sequence ⁇ ⁇ and the sequence is 1 ⁇
  • the percent identity between nucleic acid sequences can also be determined by the Cluster method or by methods known in the art such as Jo tun He in (He in J., (1990) Me thods in enzymo l ogy 1 8 3: 625-645 ) 0 "Similarity" refers to the degree of identical or conservative substitutions of amino acid residues at corresponding positions in the alignment of amino acid sequences.
  • Amino acids used for conservative substitution may include aspartic acid and glutamic acid; positively charged amino acids may include lysine and arginine; having an uncharged head group is Similar hydrophilic amino acids may include leucine, isoleucine and valine; glycine and alanine; asparagine and glutamine; serine and threonine; phenylalanine and tyrosine.
  • Antisense refers to a nucleotide sequence that is complementary to a particular DNA or R sequence.
  • Antisense strand refers to a nucleic acid strand that is complementary to a “sense strand.”
  • Derivative refers to HFP or a chemical modification of its nucleic acid. This chemical modification may be the replacement of a hydrogen atom with an alkyl, acyl or amino group. Nucleic acid derivatives can encode polypeptides that retain the main biological properties of natural molecules.
  • Antibody refers to a complete antibody molecule and its fragments, such as Fa,? ( ⁇ ') 2 and? ⁇ It can specifically bind to the epitope of human zinc finger protein 11.
  • a “humanized antibody” refers to an antibody in which the amino acid sequence of a non-antigen binding region is replaced to become more similar to a human antibody, but still retains the original binding activity.
  • isolated refers to the removal of a substance from its original environment (for example, its natural environment if it is naturally occurring).
  • a naturally-occurring polynucleotide or polypeptide is not isolated when it is present in a living thing, but the same polynucleotide or polypeptide is separated from some or all of the substances that coexist with it in the natural system.
  • Such a polynucleotide may be part of a certain vector, or such a polynucleotide or polypeptide may be part of a certain composition. Since the carrier or composition is not part of its natural environment, they are still isolated.
  • isolated refers to the separation of a substance from its original environment (if it is a natural substance, the original environment is the natural environment).
  • polynucleotides and polypeptides in a natural state in a living cell are not isolated and purified, but the same polynucleotides or polypeptides are separated and purified if they are separated from other substances in the natural state .
  • isolated human zinc finger protein ⁇ means that human zinc finger protein 1 1 is substantially free of other proteins, lipids, sugars, or other substances with which it is naturally associated. Those skilled in the art can purify human zinc finger protein 1 1 using standard protein purification techniques. Substantially pure polypeptides produce a single main band on non-reducing polyacrylamide gels. The purity of human zinc finger protein 1 1 polypeptide can be analyzed by amino acid sequence.
  • the present invention provides a new polypeptide, human zinc finger protein 11, which basically consists of the amino acid sequence shown in SEQ ID NO: 2.
  • the polypeptide of the present invention may be a recombinant polypeptide, a natural polypeptide, a synthetic polypeptide, A recombinant polypeptide is preferred.
  • the polypeptides of the present invention can be naturally purified products or chemically synthesized products, or can be produced from prokaryotic or eukaryotic hosts (eg, bacteria, yeast, higher plants, insects, and mammalian cells) using recombinant techniques. Depending on the host used in the recombinant production protocol, the polypeptide of the invention may be glycosylated, or it may be non-glycosylated. Polypeptides of the invention may also include or exclude starting methionine residues.
  • the invention also includes fragments, derivatives and analogs of human zinc finger protein 1 1.
  • fragment refers to a human zinc finger protein that substantially retains the invention
  • a fragment, derivative or analog of the polypeptide of the present invention may be: (I) a kind in which one or more amino acid residues are substituted with conservative or non-conservative amino acid residues (preferably conservative amino acid residues), and the substitution The amino acid may or may not be encoded by a genetic codon; or ( ⁇ ) a type in which a group on one or more amino acid residues is replaced by another group to include a substituent; or ( ⁇ ⁇ ) Such a type in which the mature polypeptide is fused with another compound (such as a compound that prolongs the half-life of the polypeptide, such as polyethylene glycol); or (IV) a type in which the additional amino acid sequence is fused into the mature polypeptide and formed from the polypeptide sequence (Such as the leader or secretory sequence or the sequence used to purify the polypeptide or protease sequence). As set forth herein, such fragments, derivatives and analogs are considered to be within the knowledge of those
  • the present invention provides an isolated nucleic acid (polynucleotide), which basically consists of a polynucleotide encoding a polypeptide having the amino acid sequence of SEQ ID NO: 2.
  • the polynucleotide sequence of the present invention includes the nucleotide sequence of SEQ ID NO: 1.
  • the polynucleotide of the present invention is found from a cDNA library of human fetal brain tissue. It contains a full-length polynucleotide sequence of 2644 bases and its open reading frame of 140-448 encodes 102 amino acids. According to the comparison of gene chip expression profiles, it was found that this polypeptide has a similar expression profile to human zinc finger protein 59, and it can be deduced that the human zinc finger protein 11 has a similar function to human zinc finger protein 59.
  • the polynucleotide of the present invention may be in the form of DNA or RNA.
  • DNA forms include cDNA, genomic DNA, or synthetic DNA.
  • DNA can be single-stranded or double-stranded.
  • DNA can be coding or non-coding.
  • the coding region sequence encoding the mature polypeptide may be the same as the coding region sequence shown in SEQ ID NO: 1 or a degenerate variant.
  • degenerate variant refers to a nucleic acid sequence encoding a protein or polypeptide having SEQ ID NO: 2 but different from the coding region sequence shown in SEQ ID NO: 1 in the present invention.
  • the polynucleotide encoding the mature polypeptide of SEQ ID NO: 2 includes: only the coding sequence of the mature polypeptide; the coding sequence of the mature polypeptide and various additional coding sequences; the coding sequence of the mature polypeptide (and optional additional coding sequences); Coding sequence.
  • polynucleotide encoding a polypeptide is meant to include polynucleotides that encode such polypeptides and polynucleotides that include additional coding and / or noncoding sequences.
  • the invention also relates to variants of the polynucleotides described above, which encode polypeptides or fragments, analogs and derivatives of polypeptides having the same amino acid sequence as the invention. Variants of this polynucleotide may be naturally occurring allelic variants or non-naturally occurring variants. These nucleotide variants include substitution variants, deletion variants, and insertion variants.
  • an allelic variant is an alternative form of a polynucleotide that may be a substitution, deletion, or insertion of one or more nucleotides, but does not substantially change the function of the polypeptide it encodes .
  • the invention also relates to a polynucleotide that hybridizes to the sequence described above (having at least 50%, preferably 70% identity, between the two sequences).
  • the present invention particularly relates to polynucleotides that can hybridize to the polynucleotides of the present invention under stringent conditions.
  • “strict conditions” means: (1) hybridization and elution at lower ionic strength and higher temperature, such as 0.2xSSC, 0.1% SDS, 6 (TC; or (2) added during hybridization Use a denaturant, such as 50% (v / v) formamide, 0.1% calf serum / 0.1% Ficoll, 42 ° C, etc .; or (3) the identity between the two sequences is at least 95% Above, it is more preferable that the hybridization occurs at 97% or more.
  • the polypeptide encoded by the hybridizable polynucleotide has the same biological function and activity as the mature polypeptide shown in SEQ ID NO: 2.
  • nucleic acid fragments that hybridize to the sequences described above.
  • a "nucleic acid fragment” contains at least 10 nucleotides in length, preferably at least 20-30 nucleotides, more preferably at least 50-60 nucleotides, and most preferably at least 100 cores. Glycylic acid or more. Nucleic acid fragments can also be used in nucleic acid amplification techniques (such as PCR) to identify and / or isolate polynucleotides encoding human zinc finger protein 11.
  • polypeptides and polynucleotides in the present invention are preferably provided in an isolated form and are more preferably purified to homogeneity.
  • the specific polynucleotide sequence encoding the human zinc finger protein 11 of the present invention can be obtained by various methods.
  • polynucleotides are isolated using hybridization techniques well known in the art. These techniques include, but are not limited to: 1) hybridization of probes to genomic or cDNA libraries to detect homologous polynucleotide sequences, and 2) antibody screening of expression libraries to detect cloned polynucleosides with common structural characteristics Acid fragments.
  • the DNA fragment sequence of the present invention can also be obtained by the following methods: 1) isolating the double-stranded DNA sequence from the genomic DNA; 2) chemically synthesizing the DNA sequence to obtain the double-stranded DNA of the polypeptide.
  • genomic DNA isolation is the least commonly used. Direct chemical synthesis of DM sequences is often the method of choice. The more commonly used method is the isolation of cDNA sequences.
  • the standard method for isolating cDNA of interest is to isolate niRNA from donor cells that overexpress the gene and perform reverse transcription to form a plasmid or phage cDNA library. There are many mature techniques for extracting mRNA, and kits are also commercially available (Qiagene). Building cDNA libraries is also a common method (Sambrook, et al., Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory. New York, 1989). Commercially available cDNA libraries such as different cDNAs from Clontech library.
  • genes can be screened from these cDNA libraries by conventional methods. These methods include (but are not limited to): (l) DNA-DNA or DNA-RNA hybridization; (2) the presence or absence of marker gene functions; (3) 3 ⁇ 4 the level of transcripts of human zinc finger protein 11; (4) ) Detection of protein products expressed by genes through immunological techniques or determination of biological activity. The above methods can be used singly or in combination.
  • the probe used for hybridization is homologous to any part of the polynucleotide of the present invention, and its length is at least 10 nucleotides, preferably at least 30 nucleotides, more preferably At least 50 nucleotides, preferably at least 100 nucleotides.
  • the length of the probe is usually within 2000 nucleotides, preferably within 1000 nucleotides.
  • the probe used here is usually a DNA sequence chemically synthesized based on the gene sequence information of the present invention.
  • the genes or fragments of the present invention can of course be used as probes.
  • DNA probes can be labeled with radioisotopes, luciferin, or enzymes (such as alkaline phosphatase).
  • immunological techniques such as Western blotting, radioimmunoprecipitation, and enzyme-linked immunosorbent assay (ELISA) can be used to detect the protein product of human zinc finger protein 11 gene expression.
  • ELISA enzyme-linked immunosorbent assay
  • a method using PCR technology to amplify DNA / RNA is preferably used to obtain the gene of the present invention.
  • the RACE method RACE-rapid cDNA end rapid amplification method
  • the primers used for PCR can be appropriately based on the polynucleotide sequence information of the present invention disclosed herein. Select and synthesize using conventional methods.
  • the amplified DM / RNA fragment can be isolated and purified by conventional methods such as by gel electrophoresis.
  • polynucleotide sequence of the gene of the present invention or various DNA fragments and the like obtained as described above can be determined by a conventional method such as dideoxy chain termination method (Sanger et al. PNAS, 1977, 74: 5463-5467). Such polynucleotide sequences can also be determined using commercial sequencing kits and the like. In order to obtain the full-length cDNA sequence, sequencing needs to be repeated. Sometimes it is necessary to determine the cDNA sequence of multiple clones in order to splice into a full-length cDNA sequence.
  • the present invention also relates to a vector comprising a polynucleotide of the present invention, and a host cell produced by genetic engineering using the vector of the present invention or directly using a human zinc finger protein 11 coding sequence, and a method for producing a polypeptide of the present invention by recombinant technology.
  • a polynucleotide sequence encoding human zinc finger protein 11 can be inserted into a vector to constitute a recombinant vector containing the polynucleotide of the present invention.
  • vector refers to bacterial plasmids, phages, yeast plasmids, plant cell viruses, mammalian cell viruses such as adenoviruses, retroviruses, or other vectors well known in the art.
  • Vectors suitable for use in the present invention include, but are not limited to: T7 promoter-based expression vectors expressed in bacteria (Rosenberg, et al.
  • any plasmid and vector can be used to construct a recombinant expression vector.
  • An important feature of expression vectors is that they usually contain an origin of replication, a promoter, a marker gene, and translational regulatory elements.
  • Methods known to those skilled in the art can be used to construct expression vectors containing a DNA sequence encoding human zinc finger protein 11 and appropriate transcriptional / translational regulatory elements. These methods include in vitro recombinant DNA technology, DNA synthesis technology, and in vivo recombination technology (Sambroook, et al. Molecular Cloning, a Laboratory Manual, Cold Spring Harbor Laboratory. New York, 1989).
  • the DNA sequence can be operably linked to an appropriate promoter in an expression vector to guide mRNA synthesis. Representative examples of these promoters are: the lac or trp promoter of E.
  • the expression vector also includes a ribosome binding site for translation initiation, a transcription terminator, and the like. Insertion of enhancer sequences into the vector will enhance its transcription in higher eukaryotic cells. Enhancers are cis-acting factors for DNA expression, usually about 10 to 300 base pairs, which act on promoters to enhance gene transcription. Examples include SV40 enhancers of 100 to 270 base pairs on the late side of the origin of replication, polyoma enhancers on the late side of the origin of replication, and adenovirus enhancers.
  • the expression vector preferably contains one or more selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
  • selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
  • GFP fluorescent protein
  • tetracycline or ampicillin resistance for E. coli.
  • a polynucleotide encoding a human zinc finger protein II or a recombinant vector containing the polynucleotide can be transformed or transduced into a host cell to constitute a genetically engineered host cell containing the polynucleotide or the recombinant vector.
  • the term "host cell” refers to a prokaryotic cell, such as a bacterial cell; or a lower eukaryotic cell, such as a yeast cell; or a higher eukaryotic cell, such as a mammalian cell. Representative examples are: E.
  • coli Streptomyces
  • bacterial cells such as Salmonella typhimurium
  • fungal cells such as yeast
  • plant cells such as insect cells such as Fly S2 or Sf9
  • animal cells such as CH0, COS or Bowes melanoma cells.
  • Transformation of a host cell with a DNA sequence described in the present invention or a recombinant vector containing the DNA sequence can be performed using conventional techniques well known to those skilled in the art.
  • the host is a prokaryote, such as E. coli
  • competent cells capable of absorbing DNA can be harvested after the exponential growth phase and treated with the CaCl 2 method. The steps used are well known in the art. Alternatively, MgCl 2 is used. If required, transformation can also be performed by electroporation Method.
  • the host is a eukaryotic organism, the following DNA transfection methods can be used: calcium phosphate co-precipitation method, or conventional mechanical methods such as microinjection, electroporation, and liposome packaging.
  • the polynucleotide sequence of the present invention can be used to express or produce recombinant human zinc finger protein 1 1 (Scence, 1984; 224: 1431). Generally there are the following steps:
  • the medium used in the culture may be selected from various conventional mediums. Culture is performed under conditions suitable for host cell growth. After the host cells have grown to an appropriate cell density, the selected promoter is induced by a suitable method (such as temperature conversion or chemical induction), and the cells are cultured for a period of time.
  • a suitable method such as temperature conversion or chemical induction
  • the recombinant polypeptide may be coated in a cell, expressed on a cell membrane, or secreted outside the cell. If necessary, the recombinant protein can be isolated and purified by various separation methods using its physical, chemical and other properties. These methods are well known to those skilled in the art. These methods include, but are not limited to: conventional renaturation treatment, protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid chromatography (HPLC) and various other liquid chromatography techniques and combinations of these methods.
  • conventional renaturation treatment protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid
  • polypeptides of the present invention can be directly used in the treatment of diseases, for example, they can treat malignant tumors, adrenal deficiency, skin diseases, various types of inflammation, HIV infection and immune diseases.
  • the human zinc finger protein 1 1 of the present invention can be used to treat or prevent diseases caused by abnormal expression of this protein.
  • diseases include, but are not limited to: developmental disorders; canceration of various tissues, such as leukemia, lymphoma, melanoma, sarcoma, myeloma, teratoma, etc .; adrenal cancer, bladder cancer, bone cancer, bone marrow cancer, brain Cancer, breast cancer, uterine cancer, gallbladder cancer, nerve center cancer, kidney cancer, liver cancer, lung cancer, thyroid cancer, thymus cancer, etc .; various genetic diseases; diseases caused by abnormal cell differentiation and proliferation such as hyperthyroidism, thyroid function Illness, gastritis, colon polyps, gastroduodenal ulcers and other diseases; immune system diseases such as cracked hands, foot problems, and Bayer syndrome.
  • the invention also provides methods for screening compounds to identify agents that increase (agonist) or suppress (antagonist) human zinc finger protein 11.
  • Agonists enhance human zinc finger protein 1 1 to stimulate biological functions such as cell proliferation, while antagonists prevent and treat disorders related to excessive cell proliferation, such as various cancers.
  • mammalian cells or membrane preparations expressing human zinc finger protein 1 1 can be labeled with human zinc finger protein 1 1 in the presence of a drug. Cultivate together. The ability of the drug to increase or block this interaction is then determined.
  • Antagonists of human zinc finger protein 11 include antibodies, compounds, receptor deletions, and the like that have been screened. Antagonists of human zinc finger protein 11 can bind to human zinc finger protein 11 and eliminate its function, or inhibit the production of the polypeptide, or bind to the active site of the polypeptide so that the polypeptide cannot perform biological functions.
  • human zinc finger protein 11 When screening compounds as antagonists, human zinc finger protein 11 can be added to a bioanalytical assay to determine whether a compound is an antagonist by measuring the effect of the compound on the interaction between human zinc finger protein 11 and its receptor. Receptor deletions and analogs that act as antagonists can be screened in the same manner as described above for screening compounds.
  • Polypeptide molecules capable of binding to human zinc finger protein 11 can be obtained by screening a random peptide library composed of various possible combinations of amino acids bound to a solid phase. When screening, human zinc finger protein 11 molecules should generally be labeled.
  • the present invention provides a method for producing antibodies using polypeptides, and fragments, derivatives, analogs or cells thereof as antigens. These antibodies can be polyclonal or monoclonal antibodies.
  • the invention also provides antibodies against human zinc finger protein 11 epitopes. These antibodies include (but are not limited to): polyclonal antibodies, monoclonal antibodies, chimeric antibodies, single chain antibodies, Fab fragments, and fragments generated from Fab expression libraries.
  • Polyclonal antibodies can be produced by injecting human zinc finger protein 11 directly into immunized animals (eg rabbits, mice, rats, etc.).
  • immunized animals eg rabbits, mice, rats, etc.
  • a variety of adjuvants can be used to enhance the immune response, including but not limited to Freund's adjuvant .
  • Techniques for preparing monoclonal antibodies to human zinc finger protein 11 include, but are not limited to, hybridoma technology (Kohler and Milstein. Nature, 1975, 256: 495-497), triple tumor technology, human beta-cell hybridoma technology, and EBV-hybridization. Tumor technology, etc.
  • Chimeric antibodies that bind human constant regions and non-human-derived variable regions can be produced using existing techniques (Morrison et al, PNAS, 1985, 81: 6851).
  • the existing technology for producing single chain antibodies (U.S. Pat No. 4946778) can also be used to produce single chain antibodies against human zinc finger protein 11.
  • Anti-human zinc finger protein 11 antibodies can be used in immunohistochemical techniques to detect human zinc finger protein 11 in biopsy specimens.
  • Monoclonal antibodies that bind to human zinc finger protein 11 can also be labeled with radioisotopes and injected into the body to track their location and distribution. This radiolabeled antibody can be used as a non-invasive diagnostic method to locate tumor cells and determine whether there is metastasis.
  • Antibodies can also be used to design immunotoxins that target a particular part of the body.
  • human zinc finger protein 11 high affinity monoclonal antibodies can covalently bind to bacterial or plant toxins (such as diphtheria toxin, ricin, ormosine, etc.).
  • a common method is to attack the amino group of an antibody with a thiol cross-linking agent such as SPDP and bind the toxin to the antibody through the exchange of disulfide bonds.
  • This hybrid antibody can be used to kill human zinc finger protein 1 1 positive cells.
  • the antibodies in the present invention can be used to treat or prevent diseases related to human zinc finger protein 1 1.
  • Administration of an appropriate amount of antibody can stimulate or block the production or activity of human zinc finger protein 1 1.
  • the invention also relates to a diagnostic test method for quantitatively and locally detecting the level of human zinc finger protein 1 1.
  • tests are well known in the art and include F I SH assays and radioimmunoassays.
  • the level of human zinc finger protein 1 1 detected in the test can be used to explain the importance of human zinc finger protein 1 1 in various diseases and to diagnose diseases where human zinc finger protein 1 1 plays a role.
  • polypeptide of the present invention can also be used for peptide mapping analysis.
  • the polypeptide can be specifically cleaved by physical, chemical or enzymatic analysis, and subjected to one-dimensional or two-dimensional or three-dimensional gel electrophoresis analysis, and more preferably mass spectrometry analysis.
  • Polynucleotides encoding human zinc finger protein 1 1 can also be used for a variety of therapeutic purposes.
  • Gene therapy technology can be used to treat abnormal cell proliferation, development or metabolism caused by the non-expression or abnormal / inactive expression of human zinc finger protein ⁇ .
  • Recombinant gene therapy vectors (such as viral vectors) can be designed to express mutated human zinc finger protein 1 1 to inhibit endogenous human zinc finger protein 1 1 activity.
  • a mutated human zinc finger protein 1 1 may be a shortened human zinc finger protein 1 1 lacking a signaling domain, and although it can bind to a downstream substrate, it lacks signaling activity. Therefore, recombinant gene therapy vectors can be used to treat diseases caused by abnormal expression or activity of human zinc finger protein 1 1.
  • Virus-derived expression vectors such as retrovirus, adenovirus, adenovirus-associated virus, herpes simplex virus, and parvovirus can be used to transfer a polynucleotide encoding human zinc finger protein 1 1 into a cell.
  • Methods for constructing a recombinant viral vector carrying a polynucleotide encoding human zinc finger protein 1 1 can be found in existing literature (Sambrook, et al.).
  • the polynucleotide encoding human zinc finger protein 1 1 can be packaged into liposomes and transferred into cells.
  • Methods for introducing a polynucleotide into a tissue or cell include: directly injecting the polynucleotide into a tissue in vivo; or introducing the polynucleotide into a cell in vitro through a vector (such as a virus, phage, or plasmid), and then transplanting the cell Into the body and so on.
  • a vector such as a virus, phage, or plasmid
  • Oligonucleotides including antisense RNA and DNA
  • ribozymes that inhibit human zinc finger protein 1 1 mRNA are also within the scope of the present invention.
  • a ribozyme is an enzyme-like RNA molecule that can specifically decompose a specific RNA. Its mechanism of action is that the ribozyme molecule specifically hybridizes with a complementary target RNA for endonucleation.
  • Antisense RNA, DNA, and ribozymes can be obtained by any existing RNA or DNA synthesis technology, such as the technology for the synthesis of oligonucleotides by solid-phase phosphoramidite chemical synthesis has been widely used.
  • Antisense RNA molecules can be obtained by in vitro or in vivo transcription of a DNA sequence encoding the RNA. This DNA sequence has been integrated downstream of the RNA polymerase promoter of the vector. In order to increase the stability of a nucleic acid molecule, it can be modified in a variety of ways, such as increasing the sequence length on both sides, and the ribonucleoside linkages should use phosphate thioester or peptide bonds instead of phosphodiester bonds.
  • the polynucleotide encoding human zinc finger protein 11 can be used for the diagnosis of diseases related to human zinc finger protein 11.
  • the polynucleotide encoding human zinc finger protein 11 can be used to detect the expression of human zinc finger protein 11 or the abnormal expression of human zinc finger protein 11 in a disease state.
  • the DM sequence encoding human zinc finger protein 11 can be used to hybridize biopsy specimens to determine the expression of human zinc finger protein 11.
  • Hybridization techniques include Southern blotting, Northern blotting, and in situ hybridization. These techniques and methods are publicly available and mature, and related kits are commercially available.
  • a part or all of the polynucleotides of the present invention can be used as probes to be fixed on a microarray (Microarray) or a DNA chip (also referred to as a "gene chip") for analyzing differential expression analysis and gene diagnosis of genes in tissues.
  • Human zinc finger protein 11 specific primers can also be used to detect human zinc finger protein 11 transcripts by RM-polymerase chain reaction (RT-PCR) in vitro amplification.
  • RT-PCR RM-polymerase chain reaction
  • Detection of mutations in the human zinc finger protein 11 gene can also be used to diagnose human zinc finger protein 11-related diseases.
  • Human zinc finger protein 11 mutations include point mutations, translocations, deletions, recombinations, and any other abnormalities compared to the normal wild type human zinc finger protein 11 DNA sequence. Mutations can be detected using existing techniques such as Southern imprinting, DNA sequence analysis, PCR, and in situ hybridization. In addition, mutations may affect protein expression. Therefore, Northern blotting and Western blotting can be used to indirectly determine whether a gene is mutated.
  • sequences of the invention are also valuable for chromosome identification. This sequence will specifically target a specific position on a human chromosome and can hybridize to it. Currently, specific sites for each gene on the chromosome need to be identified. Currently, only a few chromosome markers based on actual sequence data (repeating polymorphisms) are available for marking chromosome positions. According to the present invention, in order to associate these sequences with disease-related genes, an important first step is to locate these DNA sequences on a chromosome.
  • a PCR primer (preferably 15-35bp) is prepared from the cDNA, and the sequence can be located on the chromosome. These primers were then used for PCR screening of somatic hybrid cells containing individual human chromosomes. Only those heterozygous cells containing the human gene corresponding to the primer will produce amplified fragments.
  • PCR localization of somatic hybrid cells is a quick way to localize DNA to specific chromosomes.
  • oligonucleotide primers of the present invention in a similar manner, a set of fragments from a specific chromosome or a large number of genomic clones can be used to achieve sublocalization.
  • Other similar strategies that can be used for chromosomal localization include in situ hybridization, chromosome pre-screening with labeled flow sorting, and pre-selection of hybridization to construct chromosome-specific cDNA libraries.
  • Fluorescent in situ hybridization of cDNA clones with metaphase chromosomes allows precise chromosomal localization in one step.
  • FISH Fluorescent in situ hybridization
  • the difference in cDNA or genomic sequence between the affected and unaffected individuals needs to be determined. If a mutation is observed in some or all diseased individuals and the mutation is not observed in any normal individuals, the mutation may be the cause of the disease. Comparing affected and unaffected individuals usually involves first looking for structural changes in chromosomes, such as deletions or translocations that are visible at the chromosomal level or detectable with cDNA sequence-based PCR. According to the resolution capabilities of current physical mapping and gene mapping technology, the cDNA accurately mapped to the chromosomal region associated with the disease can be one of 50 to 500 potentially pathogenic genes (assuming 1 megabase mapping resolution) Capacity and each 20kb corresponds to a gene).
  • the polypeptides, polynucleotides and mimetics, agonists, antagonists and inhibitors of the present invention can be used in combination with a suitable pharmaceutical carrier.
  • suitable pharmaceutical carrier can be water, glucose, ethanol, salts, buffers, glycerol, and combinations thereof.
  • the composition comprises a safe and effective amount of the polypeptide or antagonist, and carriers and excipients which do not affect the effect of the drug. These compositions can be used as drugs for the treatment of diseases.
  • the invention also provides a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the invention.
  • a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the invention.
  • these containers there may be instructional instructions given by government agencies that manufacture, use, or sell pharmaceuticals or biological products, which prompts permission for administration on the human body by government agencies that produce, use, or sell.
  • the polypeptides of the invention can be used in combination with other therapeutic compounds.
  • the pharmaceutical composition can be administered in a convenient manner, such as by a topical, intravenous, intraperitoneal, intramuscular, subcutaneous, intranasal or intradermal route of administration.
  • Human zinc finger protein 11 is administered in an amount effective to treat and / or prevent a specific indication.
  • the amount and range of human zinc finger protein 11 administered to a patient will depend on many factors, such as the mode of administration, the health conditions of the person to be treated, and the judgment of the diagnostician. Examples
  • RNA Human fetal brain total RNA was extracted by one-step method with guanidine isothiocyanate / phenol / chloroform.
  • Poly (A) mRNA was isolated from total RNA using the Quik mRNA Isolation Kit (Qiegene). 2ug poly (A) mRNA is reverse transcribed to form cDNA.
  • the Smart cDNA cloning kit purchased from Clontech M ⁇ cDNA fragment was inserted into the multicloning site of pBSK (+) vector (Clontech)) to transform DH5a to form a cDNA library.
  • Dye terminate cycle reaction sequencing kit Perkin-Elmer company
  • ABI 377 automatic sequencer Perkin-Elmer company
  • the determined cDNA sequence and the existing public DM sequence database By comparison, it was found that the cDNA sequence of one of the clones 0612 c 12 was new DNA.
  • a series of primers were synthesized to determine the inserted cDNA fragment of the clone in both directions.
  • CDNA was synthesized using fetal brain total RNA as a template and oligo-dT as a primer for reverse transcription reaction. After purification with Qiagene's kit, the following primers were used for PCR amplification:
  • Primerl 5 — GCGTTATCCTTAAATCAATGTTAC —3 '(SEQ ID NO: 3)
  • Primer2 5'- ATGAACCATTTTTCTGTTCTCTTA -3, (SEQ ID NO: 4)
  • Primerl is a forward sequence starting at lbp of the 5th end of SEQ ID NO: 1;
  • Primer2 is the 3 'end reverse sequence in SEQ ID NO: 1.
  • Amplification conditions 50 ⁇ l / L ⁇ , ⁇ l ol / L Tris-HCl, pH 8.5, 1.5ramol / L MgCl 2 , 200 ⁇ ⁇ 1 / ⁇ dNTP, lOpmol in a reaction volume of 50 ⁇ 1 Primer, 1U Taq DNA polymerase (Clontech).
  • the reaction was performed on a PE9600 DNA thermal cycler (Perkin-Elmer) for 25 cycles under the following conditions: 94. C 30sec; 55. C 30sec; 72 ° C 2min.
  • ⁇ -act in was set as a positive control and template blank was set as a negative control.
  • the amplified product was purified using a QIAGEN kit, and ligated to a pCR vector (Invitrogen product) using a TA cloning kit.
  • the DNA sequence analysis results showed that the DNA sequence of the PCR product was exactly the same as 1-2644bp shown in SEQ ID NO: 1.
  • Example 3 Northern blot analysis of human zinc finger protein 11 gene expression
  • RNA extraction in one step [Anal. Biochem 1987, 162, 156-159] 0
  • This method involves acid guanidinium thiocyanate-chloroform extraction.
  • the tissue was homogenized, 1 volume of phenol and 1/5 volume of chloroform-isoamyl alcohol (49: 1) were added, and the mixture was centrifuged. Aspirate the aqueous layer, add isopropanol (0.8 vol) and centrifuge the mixture to obtain RNA precipitate.
  • the resulting RNA pellet was washed with 70% ethanol, dried and dissolved in water.
  • a 32P-labeled probe (approximately 2 x 10 6 cpm / ml) and RM-transferred nitrocellulose membrane were placed in a solution at 42 ° C. C hybridization overnight, the solution contains 50% formamide-25mM KH 2 P0 4 (pH7.4) -5 ⁇ SSC-5 ⁇ Denhardt's solution and 20 ( ⁇ g / ml salmon sperm DNA. After hybridization, the filter membrane is at 1 x SSC-0.1 ° /. Wash in SDS for 30 min at 55 ° C. Then, analyze and quantify with Phosphor Imager.
  • Example 4 In vitro expression, isolation and purification of recombinant human zinc finger protein 11.
  • Primer3 5,-CCCCATATGATGTGGAATCAATTATTCCTTTAT -3, (Seq ID No: 5)
  • Primer4 5,-CATGGATCCTCAATTCTGGTTTTCACAAAGGGA -3 '(Seq ID No: 6)
  • the 5' ends of these two primers contain Ndel and BamHI restriction sites, respectively.
  • the coding sequences for the 5 'and 3' ends of the gene of interest are followed, respectively.
  • the Ndel and BamHI restriction sites correspond to the selectivity within the expression vector plasmid pET-28b (+) (Novagen, Cat. No. 69865.3). Digestion site.
  • PCR reaction conditions were: 1 in a total volume of 50 ⁇ plasmid pBS- 0612cl2 containing 10pg, primer Primer- 3 and the other points Primer- 4 [J is 10pmol, Advantage polymerase Mix (Clontech Products) 1 ⁇ 1. Cycle parameters: 94 ° C 20s, 60. C 30s, 68 ° C 2 min, a total of 25 cycles. Ndel and BamHI were used to double digest the amplified product and plasmid pET-28 (+), respectively, and large fragments were recovered and ligated with T4 ligase.
  • the ligated product was transformed with colibacillus DH5 ⁇ by the calcium chloride method, and cultured overnight on LB plates containing kanamycin (final concentration 3 (g / ml)), and positive clones were selected by colony PCR method and sequenced.
  • the correct positive clone (PET-0612cl2) was used to transform the recombinant plasmid into E. coli BL21 (DE3) plySs (product of Novagen) by calcium chloride method.
  • polypeptide is coupled to hemocyanin and bovine serum albumin to form a complex, respectively.
  • hemocyanin and bovine serum albumin For methods, see: Avrameas, et al. Immunochemistry, 1969; 6: 43.
  • Suitable oligonucleotide fragments selected from the polynucleotides of the present invention are used as hybridization probes in a variety of ways.
  • the probes can be used to hybridize to genomic or cDNA libraries of normal tissue or pathological tissue from different sources to It is determined whether it contains the polynucleotide sequence of the present invention and a homologous polynucleotide sequence is detected.
  • the probe can be used to detect the polynucleotide sequence of the present invention or its homologous polynucleotide sequence in normal tissue or pathology. Whether the expression in tissue cells is abnormal.
  • the purpose of this embodiment is to select a suitable oligonucleotide fragment from the polynucleotide SEQ ID NO: 1 of the present invention as a hybridization probe, and to identify whether some tissues contain the polynucleoside of the present invention by a filter hybridization method.
  • Filter hybridization methods include dot blotting, Southern blotting, Northern blotting, and copying methods. They all use the same steps of hybridization after fixing the polynucleotide sample to be tested on the filter.
  • the sample-immobilized filter is first pre-hybridized with a probe-free hybridization buffer, so that the non-specific binding site of the sample on the filter is saturated with the carrier and the synthetic polymer.
  • the pre-hybridization solution is then replaced with a hybridization buffer containing the labeled probe and incubated to hybridize the probe to the target nucleic acid.
  • the unhybridized probes are removed by a series of membrane washing steps.
  • This embodiment utilizes higher-intensity washing conditions (such as lower salt concentration and higher temperature) to reduce the hybridization background and retain only strong specific signals.
  • the probes used in this embodiment include two types: the first type of probes are oligonucleotide fragments that are completely the same as or complementary to the polynucleotide SEQ ID NO: 1 of the present invention; A needle is an oligonucleotide fragment that is partially identical or complementary to the polynucleotide SEQ ID NO: 1 of the present invention.
  • the dot blot method is used to fix the sample on the filter membrane. Under the high-intensity washing conditions, the first type of probe and the sample have the strongest hybridization specificity and are retained.
  • oligonucleotide fragments for use as hybridization probes from the polynucleotide SEQ ID NO: 1 of the present invention should follow the following principles and several aspects to be considered:
  • the preferred range of probe size is 18-50 nucleotides
  • Those that meet the above conditions can be used as primary selection probes, and then further computer sequence analysis, including the primary selection probe and its source sequence region (ie, SEQ ID NO: 1) and other known genomic sequences and their complements For homology comparison of the regions, if the homology with the non-target molecular region is greater than 85% or there are more than 15 consecutive bases, the primary probe should not be used generally;
  • Probe 1 which belongs to the first type of probe, is completely homologous or complementary to the gene fragment of SEQ ID NO: 1 (41Nt):
  • Probe 2 which belongs to the second type of probe, is equivalent to the replacement mutation sequence (41Nt) of the gene fragment of SEQ ID NO: 1 or its complementary fragment:
  • PBS phosphate buffered saline
  • step S-13 are only used when contamination must be removed, otherwise step 14 can be performed directly.
  • NC membranes nitrocellulose membranes
  • Gene microarrays or DNA microarrays are new technologies currently being developed by many national laboratories and large pharmaceutical companies. It refers to the orderly and high-density arrangement of large numbers of target gene fragments on glass, The data is compared and analyzed on a carrier such as silicon using fluorescence detection and computer software to achieve the purpose of rapid, efficient, and high-throughput analysis of biological information.
  • the polynucleotide of the present invention can be used as target DNA for gene chip technology for high-throughput research of new gene functions; search for and screen new tissue-specific genes, especially new genes related to diseases such as tumors; diagnosis of diseases such as hereditary diseases .
  • the specific method steps have been reported in the literature. For example, see DeRisi, JL, Lyer, V. & Brown, P.0. (1997) Science 278, 680-686. And He lie, RA, Schema, M., Chai, A., Shalom, D., (1997) PNAS 94: 2150-2155.
  • a total of 4,000 polynucleotide sequences of various full-length cDNAs are used as target DNA, including the polynucleotide of the present invention. They were amplified by PCR respectively. After purification, the concentration of the amplified product was adjusted to about 500 ng / ul, and spotted on a glass medium with a Cartesian 7500 spotting instrument (purchased from Cartesian, USA). The distance is 280 ⁇ ⁇ 1 . The spotted slides were hydrated and dried, cross-linked in a UV cross-linker, and dried after elution to fix the DNA on the glass slide to prepare a chip. The specific method steps have been reported in the literature. The sample post-processing steps in this embodiment are:
  • Total mRNA was extracted from human mixed tissues and specific tissues (or stimulated cell lines) in one step, and the mRNA was purified using Oligotex mR A Midi Kit (purchased from QiaGen).
  • the fluorescent reagent Cy3dUTP was separately reverse-transcribed. (5-Amino-propargyl-2'-deoxyuridine 5'-triphate coupled to Cy3 fluorescent dye, purchased from Amersham Phamacia Biotech).
  • MRNA of human mixed tissue was labeled with Cy5dUTP (5- Amino- propargyl-2'-deoxyuridine) 5 '-triphate coupled to Cy5 fluorescent dye, purchased from Amersham Phamacia Biotech Company, labeled the body's specific tissue (or stimulated cell line) mRNA, and purified the probe to prepare a probe.
  • Cy5dUTP 5- Amino- propargyl-2'-deoxyuridine
  • Cy5 fluorescent dye purchased from Amersham Phamacia Biotech Company
  • the probes from the two types of tissues were hybridized with the chip in a UniHyb TM Hybridization Solution (purchased from TeieChera) for 16 hours, washed with a washing solution (1 x SSC, 0.2% SDS) at room temperature, and then scanned with ScanArray 3000.
  • the scanner purchased from General Scanning Company, USA
  • the scanned image was analyzed and processed with Imagene software (Biodiscovery, USA) to calculate the Cy3 / Cy5 ratio of each point.
  • the above specific tissues are thymus, testis, muscle, spleen, lung, skin, thyroid, liver, PMA + Ecv304 cell line, PMA-Ecv304 cell line, non-starved L02 cell line, L02 cell line stimulated by arsenic for 1 hour, L02 cell line stimulated by arsenic for 6 hours prostate, heart, lung cancer, fetal bladder, fetal small intestine, fetal large intestine, fetal thymus, fetal muscle, fetal liver, fetal kidney, fetal spleen, fetal brain, Fetal lung and fetal heart.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • Zoology (AREA)
  • Genetics & Genomics (AREA)
  • Medicinal Chemistry (AREA)
  • Molecular Biology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Toxicology (AREA)
  • Peptides Or Proteins (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

L'invention concerne un nouveau polypeptide, une protéine humaine à doigt de zinc 11, et un polynucléotide codant pour ce polypeptide ainsi qu'un procédé d'obtention de ce polypeptide par des techniques recombinantes d'ADN. L'invention concerne en outre les applications de ce polypeptide dans le traitement de maladies, notamment des tumeurs malignes, de l'hémopathie, de l'infection par VIH, de maladies immunitaires et de diverses inflammations. L'invention concerne aussi l'antagoniste agissant contre le polypeptide et son action thérapeutique ainsi que les applications de ce polynucléotide codant pour la protéine humaine à doigt de zinc 11.
PCT/CN2001/000401 2000-03-24 2001-03-23 Nouveau polypeptide, proteine humaine a doigt de zinc 11, et polynucleotide codant pour ce polypeptide WO2001070794A1 (fr)

Priority Applications (1)

Application Number Priority Date Filing Date Title
AU50263/01A AU5026301A (en) 2000-03-24 2001-03-23 A novel polypeptide, a human zinc finger protein 11 and the polynucleotide encoding the polypeptide

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
CN00115080.4 2000-03-24
CN 00115080 CN1315343A (zh) 2000-03-24 2000-03-24 一种新的多肽——人锌指蛋白11和编码这种多肽的多核苷酸

Publications (1)

Publication Number Publication Date
WO2001070794A1 true WO2001070794A1 (fr) 2001-09-27

Family

ID=4584549

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/CN2001/000401 WO2001070794A1 (fr) 2000-03-24 2001-03-23 Nouveau polypeptide, proteine humaine a doigt de zinc 11, et polynucleotide codant pour ce polypeptide

Country Status (3)

Country Link
CN (1) CN1315343A (fr)
AU (1) AU5026301A (fr)
WO (1) WO2001070794A1 (fr)

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
BIOCHEM. BIOPHYS. ACTA, vol. 1489, no. 2-3, 23 December 1999 (1999-12-23), pages 405 - 412 *
GENOMICS, vol. 63, no. 3, 1 February 2000 (2000-02-01), pages 384 - 390 *
GENOMICS, vol. 64, no. 1, 15 February 2000 (2000-02-15), pages 114 - 118 *
J. BIOL. CHEM., vol. 264, no. 2, 15 January 1989 (1989-01-15), pages 842 - 847 *

Also Published As

Publication number Publication date
AU5026301A (en) 2001-10-03
CN1315343A (zh) 2001-10-03

Similar Documents

Publication Publication Date Title
WO2001072786A1 (fr) Nouveau polypeptide, facteur d'inhibition tumorale 63, et polynucleotide codant pour ce polypeptide
WO2001079490A1 (fr) Nouveau polypeptide, proteine antigene prostatique specifique membranaire 16, et polynucleotide codant pour ce polypeptide
WO2001083538A1 (fr) Nouveau polypeptide, proteine humaine 36 du gene k-ras, et polynucleotide codant pour ce polypeptide
WO2001070794A1 (fr) Nouveau polypeptide, proteine humaine a doigt de zinc 11, et polynucleotide codant pour ce polypeptide
WO2001072799A1 (fr) Nouveau polypeptide, proteine humaine a doigt de zinc 9, et polynucleotide codant pour ce polypeptide
WO2001070796A1 (fr) Nouveau polypeptide, proteine humaine a doigt de zinc 78, et polynucleotide codant pour ce polypeptide
WO2001085752A1 (fr) Polynucleotide codant un peptide de myosine
WO2001074865A1 (fr) Nouveau polypeptide, proteine a doigt de zinc 10, et polynucleotide codant pour ce polypeptide
WO2001079423A2 (fr) Nouveau polypeptide, proteine humaine bcr 10, et polynucleotide codant pour ce polypeptide
WO2001088158A1 (fr) Nouveau polypeptide, triose phosphate isomerase humaine 10, et polynucleotide codant pour ce polypeptide
WO2001079434A2 (fr) Nouveau polypeptide, signal peptidase humaine 10, et polynucleotide codant pour ce polypeptide
WO2001049726A1 (fr) Nouveau polypeptide, recepteur du peptide natriuretique humain 18, et polynucleotide codant pour ce polypeptide
WO2001068873A1 (fr) Nouveau polypeptide, molecule humaine d'adhesion intercellulaire 12, et polynucleotide codant pour ce polypeptide
WO2001072789A1 (fr) Nouveau polypeptide, proteine humaine a doigt de zinc 10, et polynucleotide codant pour ce polypeptide
WO2001075016A2 (fr) Nouveau polypeptide, tyrosinase humaine 16, et polynucleotide codant pour ce polypeptide
WO2001079432A2 (fr) Nouveau polypeptide, facteur humain de transcription de la differentiation cellulaire 58, et polynucleotide codant pour ce polypeptide
WO2001072803A1 (fr) Nouveau polypeptide, proteine humaine a doigt de zinc 15, et polynucleotide codant pour ce polypeptide
WO2001073012A1 (fr) Nouveau polypeptide, proteine humaine a doigt de zinc 36, et polynucleotide codant pour ce polypeptide
WO2001066580A1 (fr) Nouveau polypeptide, proteine humaine 13 a doigt de zinc, et polynucleotide codant pour ce polypeptide
WO2001090132A1 (fr) Nouveau polypeptide, proteine humaine a doigt de zinc 9, et polynucleotide codant ce polypeptide
WO2001066728A1 (fr) Nouveau polypeptide, proteine humaine 11 du gene de reparation de mesappariement de l'adn, et polynucleotide codant pour ce polypeptide
WO2001074894A1 (fr) Nouveau polypeptide, proteine humaine de regulation 12 de la proteine phosphorylase, et polynucleotide codant pour ce polypeptide
WO2001083676A2 (fr) Nouveau polypeptide, phosphatase humaine 10 fortement striee, et polynucleotide codant pour ce polypeptide
WO2002020575A1 (fr) Nouveau polypeptide, proteine humaine 10 associee aux maladies auto-immunes, et polynucleotide codant ce polypeptide
WO2002026971A1 (fr) Nouveau polypeptide, facteur de transcription humain lcr-f112.1, et polynucleotide codant ce polypeptide

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CO CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
REG Reference to national code

Ref country code: DE

Ref legal event code: 8642

122 Ep: pct application non-entry in european phase
NENP Non-entry into the national phase

Ref country code: JP