WO2001070785A1 - Nouveau polypeptide, serine proteinase humaine atp-dependante 13, et polynucleotide codant pour ce polypeptide - Google Patents

Nouveau polypeptide, serine proteinase humaine atp-dependante 13, et polynucleotide codant pour ce polypeptide Download PDF

Info

Publication number
WO2001070785A1
WO2001070785A1 PCT/CN2001/000239 CN0100239W WO0170785A1 WO 2001070785 A1 WO2001070785 A1 WO 2001070785A1 CN 0100239 W CN0100239 W CN 0100239W WO 0170785 A1 WO0170785 A1 WO 0170785A1
Authority
WO
WIPO (PCT)
Prior art keywords
polypeptide
polynucleotide
dependent serine
human atp
sequence
Prior art date
Application number
PCT/CN2001/000239
Other languages
English (en)
Chinese (zh)
Inventor
Yumin Mao
Yi Xie
Original Assignee
Shanghai Biowindow Gene Development Inc.
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Shanghai Biowindow Gene Development Inc. filed Critical Shanghai Biowindow Gene Development Inc.
Priority to AU2001244056A priority Critical patent/AU2001244056A1/en
Publication of WO2001070785A1 publication Critical patent/WO2001070785A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14—Hydrolases (3)
    • C12N9/48—Hydrolases (3) acting on peptide bonds (3.4)
    • C12N9/50—Proteinases, e.g. Endopeptidases (3.4.21-3.4.25)
    • C12N9/64—Proteinases, e.g. Endopeptidases (3.4.21-3.4.25) derived from animal tissue
    • C12N9/6421—Proteinases, e.g. Endopeptidases (3.4.21-3.4.25) derived from animal tissue from mammals
    • C12N9/6424—Serine endopeptidases (3.4.21)
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C07K16/40—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against enzymes
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/34—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving hydrolase
    • C12Q1/37—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving hydrolase involving peptidase or proteinase
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/569—Immunoassay; Biospecific binding assay; Materials therefor for microorganisms, e.g. protozoa, bacteria, viruses
    • G01N33/56983—Viruses
    • G01N33/56988—HIV or HTLV
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/574—Immunoassay; Biospecific binding assay; Materials therefor for cancer
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2500/00—Screening for compounds of potential therapeutic value

Definitions

  • the present invention belongs to the field of biotechnology. Specifically, the present invention describes a novel polypeptide, human ATP-dependent serine protease 13, and a polynucleotide sequence encoding the polypeptide. The invention also relates to a preparation method and application of the polynucleotide and polypeptide.
  • L0N1 protein In 1998, Barakat S. and others cloned the L0N1 protein from maize, which is a new member of the Lon-type proteolytic enzyme family.
  • the L0N1 protein has high similarity in protein sequence with known bacterial and human Lon proteolytic enzymes, and both have a conserved substrate-binding domain and an ATP-binding domain; and the protein and the Lon protein family
  • the other members have similar biological functions and are closely related to the respiration process of the organism in vivo, which can maintain the integrity of mitochondrial DNA, but is not a component of cytochrome complex [Barakat S., Pearce DA.
  • members of the Lon family of proteolytic enzymes exert their enzymatic activities depending on the energy released by ATP hydrolysis and their serine active sites in the catalytic active center.
  • the N-terminus of the members of the enzyme family contains a conserved ATP-binding domain, which is responsible for binding to ATP in the body to hydrolyze ATP and provide the required energy for the enzyme to function.
  • members of the enzyme family also contain the following conserved consensus sequence fragments:
  • Novel human ATP-dependent serine protease of the invention and L0N1 protein in Zea Mays The hydrolase has 54% identity and 71% similarity at the protein level, and both have an ATP-binding domain and a conserved sequence fragment of the enzyme catalytic activity center; therefore, both are the same as the Lon proteolytic enzyme
  • Members, and have similar biological functions, are related to the occurrence of mitochondrial diseases, metabolic disorders related to energy and material metabolism, and disorders of growth and development in the body.
  • the expression profile of the polypeptide of the present invention is very similar to the expression profile of human ATP-dependent serine proteolytic enzyme 48, so their functions may also be similar.
  • the present invention is named human ATP-dependent serine proteolytic enzyme.
  • the human ATP-dependent serine protease 1 3 protein plays an important role in regulating important functions of the body, such as cell division and embryonic development, and it is believed that a large number of proteins are involved in these regulatory processes. Therefore, the identification of Many human ATP-dependent serine protease 1 3 proteins involved in these processes, especially the amino acid sequence of this protein is identified.
  • the newcomer's ATP-dependent serine proteolytic enzyme 13 gene isolation also provides a basis for research to determine the role of this protein in health and disease states. This protein may form the basis for developing diagnostic and / or therapeutic drugs for diseases, so isolating its coding DNA is important.
  • Another object of the invention is to provide a polynucleotide encoding the polypeptide.
  • Another object of the present invention is to provide a recombinant vector containing a polynucleotide encoding a human ATP-dependent serine proteolytic enzyme 1 3,
  • Another object of the present invention is to provide a method for producing human ATP-dependent serine protease '1 3.
  • Another object of the present invention is to provide an antibody against the polypeptide of the present invention, human ATP-dependent serine proteolytic enzyme 13.
  • Another object of the present invention is to provide mimic compounds, antagonists, agonists, and inhibitors directed to the polypeptide of the present invention, human ATP-dependent serine proteolytic enzyme 13.
  • Another object of the present invention is to provide a diagnostic treatment for human ATP-dependent serine protease 1 3 Methods for abnormally related diseases. Summary of invention
  • the present invention relates to an isolated polypeptide, which is of human origin and comprises: a polypeptide having the amino acid sequence of SEQ ID No. 2, or a conservative variant, biologically active fragment or derivative thereof.
  • the polypeptide is a polypeptide having the amino acid sequence of SEQ ID NO: 2.
  • the invention also relates to an isolated polynucleotide comprising a nucleotide sequence or a variant thereof selected from the group consisting of:
  • sequence of the polynucleotide is one selected from the group consisting of: (a) a sequence having positions 300-650 in SEQ ID NO: 1; and (b) a sequence having 1-1659 in SEQ ID NO: 1 Sequence of bits.
  • the present invention further relates to a vector, particularly an expression vector, containing the polynucleotide of the present invention; a host cell genetically engineered with the vector, including a transformed, transduced or transfected host cell; Host cell and method of preparing the polypeptide of the present invention by recovering the expression product.
  • the invention also relates to an antibody capable of specifically binding to a polypeptide of the invention.
  • the invention also relates to a method for screening compounds that mimic, activate, antagonize or inhibit human ATP-dependent serine proteolytic enzyme 13 protein activity, which comprises utilizing the polypeptide of the invention.
  • the invention also relates to compounds obtained by this method.
  • the present invention also relates to a method for in vitro detection of a disease or disease susceptibility associated with abnormal expression of a human ATP-dependent serine proteolytic enzyme 13 protein, comprising detecting mutations in the polypeptide or a sequence encoding a polynucleotide thereof in a biological sample, Alternatively, the amount or biological activity of a polypeptide of the invention in a biological sample is detected.
  • the invention also relates to a pharmaceutical composition
  • a pharmaceutical composition comprising a polypeptide of the invention or a mimetic thereof, an activator, an antagonist or an inhibitor, and a pharmaceutically acceptable carrier.
  • the present invention also relates to the use of the polypeptide and / or polynucleotide of the present invention in the preparation of a medicament for treating cancer, developmental disease or immune disease or other diseases caused by abnormal expression of human ATP-dependent serine proteolytic enzyme 13 .
  • FIG. 1 is a comparison diagram of gene chip expression profiles of the inventors' ATP-dependent serine proteolytic enzyme 13 and human ATP-dependent serine proteolytic enzyme 48.
  • FIG. The upper graph is a graph of the expression profile of human ATP-dependent serine protease 1 3, and the lower graph is the graph of the expression profile of human ATP-dependent serine protease 48.
  • Figure 2 shows the polyacrylamide gel electrophoresis (SDS-PAGE) of the isolated human ATP-dependent serine proteolytic enzyme 1 3.
  • 1 3 kDa is the molecular weight of the protein.
  • the arrow indicates the isolated protein band.
  • Nucleic acid sequence refers to an oligonucleotide, a nucleotide or a polynucleotide and a fragment or part thereof, and may also refer to a genomic or synthetic DNA or RNA, they can be single-stranded or double-stranded, representing the sense or antisense strand.
  • amino acid sequence refers to an oligopeptide, peptide, polypeptide or protein sequence and fragments or portions thereof.
  • amino acid sequence in the present invention relates to the amino acid sequence of a naturally occurring protein molecule, such "polypeptide” or “protein” does not mean to limit the amino acid sequence to a complete natural amino acid related to the protein molecule .
  • a “variant" of a protein or polynucleotide refers to an amino acid sequence having one or more amino acids or nucleotide changes or a polynucleotide sequence encoding it.
  • the changes may include deletions, insertions or substitutions of amino acids or nucleotides in the amino acid sequence or nucleotide sequence.
  • Variants can have "conservative" changes, in which the amino acid substituted has a structural or chemical property similar to the original amino acid, such as replacing isoleucine with leucine.
  • Variants can also have non-conservative changes, such as replacing glycine with tryptophan.
  • “Deletion” refers to the deletion of one or more amino acids or nucleotides in an amino acid sequence or nucleotide sequence.
  • Insertion means that a change in the amino acid sequence or nucleotide sequence results in an increase in one or more amino acids or nucleotides compared to a molecule that exists in nature.
  • Replacement refers to the replacement of one or more amino acids or nucleotides with different amino acids or nucleotides.
  • Bioactivity refers to a protein that has the structure, regulation, or biochemical function of a natural molecule.
  • immunologically active refers to the ability of natural, recombinant or synthetic proteins and fragments thereof to induce a specific immune response and to bind specific antibodies in a suitable animal or cell.
  • An "agonist” refers to a molecule that, when combined with human ATP-dependent serine proteolytic enzyme 13, can cause the protein to change, thereby regulating the activity of the protein.
  • Agonists can include proteins, nucleic acids, Carbohydrates or any other molecule that can bind human ATP-dependent serine proteolytic enzymes 13.
  • Antagonist refers to a biological or immunological activity that can block or regulate human ATP-dependent serine proteolytic enzyme 13 when combined with human ATP-dependent serine proteolytic enzyme 13 Molecule.
  • Antagonists and inhibitors may include proteins, nucleic acids, carbohydrates or any other molecule that can bind human ATP-dependent serine proteolytic enzymes 13.
  • Regular refers to a change in the function of human ATP-dependent serine protease 1 3, including an increase or decrease in protein activity, a change in binding characteristics, and any other biological properties of human ATP-dependent serine protease 1 3 , Functional or immune properties.
  • Substantially pure means substantially free of other proteins, lipids, carbohydrates or other substances with which it is naturally associated.
  • Those skilled in the art can purify human ATP-dependent serine proteolytic enzymes 13 using standard protein purification techniques.
  • Substantially pure human ATP-dependent serine protease 13 produces a single main band on a non-reducing polyacrylamide gel.
  • the purity of the human ATP-dependent serine protease 13 peptide can be analyzed by amino acid sequence analysis.
  • Complementary refers to the natural binding of polynucleotides by base-pairing under conditions of acceptable salt concentration and temperature.
  • sequence C-T-G-A
  • complementary sequence G-A-C-T.
  • the complementarity between two single-stranded molecules may be partial or complete.
  • the degree of complementarity between nucleic acid strands has a significant effect on the efficiency and strength of hybridization between nucleic acid strands.
  • “Homology” refers to the degree of complementarity and can be partially homologous or completely homologous.
  • Partial homology refers to a partially complementary sequence that at least partially inhibits hybridization of a fully complementary sequence to a target nucleic acid. This inhibition of hybridization can be detected by performing hybridization (Southern imprinting or Nor thern blotting, etc.) under conditions of reduced stringency.
  • Substantially homologous sequences or hybridization probes can compete and inhibit the binding of fully homologous sequences to the target sequence under conditions of reduced stringency. This does not mean that the conditions of reduced stringency allow non-specific binding, because the conditions of reduced stringency require that the two sequences bind to each other as a specific or selective interaction.
  • Percent identity refers to the percentage of sequences that are identical or similar in the comparison of two or more amino acid or nucleic acid sequences. The percent identity can be determined electronically, such as by the MEGALIGN program (La sergene sof twa repackage, DNASTAR, Inc., Mad Son Wis.). The MEGALIGN program can compare two or more sequences based on different methods, such as the Cluster method (Hi gg ins, DG and PM Sharp (1988) Gene 73: 237-244). The Cluster method checks all The distance arranges each group of sequences into clusters. Then the clusters are allocated in pairs or groups. The percent identity between two amino acid sequences such as sequence A and sequence B is calculated by the following formula: Number of residues matching between sequence ⁇ 4 and sequence B
  • the percent identity between nucleic acid sequences can also be determined by Clus ter method or by methods known in the art such as Jotun He in (He in J., (1990) Methods in enzymo logy 183: 625-645).
  • Similarity refers to the degree of identical or conservative substitutions of amino acid residues at corresponding positions in the alignment of amino acid sequences.
  • Amino acids used for conservative substitution for example, negatively charged amino acids may include aspartic acid and glutamic acid; positively charged amino acids may include lysine and arginine; having an uncharged head group is Similar hydrophilic amino acids may include leucine, isoleucine and valine; glycine and alanine; asparagine and glutamine; serine and threonine; phenylalanine and tyrosine.
  • Antisense refers to a nucleotide sequence that is complementary to a particular DNA or RNA sequence.
  • Antisense strand refers to a nucleic acid strand that is complementary to a “sense strand.”
  • Derivative refers to HFP or a chemical modification of its nucleic acid. This chemical modification may be the replacement of a hydrogen atom with an alkyl, acyl or amino group. Nucleic acid derivatives can encode polypeptides that retain the main biological properties of natural molecules.
  • Antibody refers to a complete antibody molecule and its fragments, such as Fa,? (') 2 and? ⁇ It can specifically bind to the epitope of human ATP-dependent serine protease 13.
  • a “humanized antibody” refers to an antibody in which the amino acid sequence of a non-antigen binding region is replaced to become more similar to a human antibody, but still retains the original binding activity.
  • isolated refers to the removal of matter from its original environment (for example, its natural environment if it is naturally occurring).
  • a naturally occurring polynucleotide or polypeptide is not isolated when it is present in a living thing, but the same polynucleotide or polypeptide is separated from some or all of the substances that coexist with it in the natural system.
  • Such a polynucleotide may be part of a vector, or such a polynucleotide or polypeptide may be part of a composition. Since the carrier or composition is not a component of its natural environment, they are still isolated.
  • isolated refers to the separation of a substance from its original environment (if it is a natural substance, the original environment is the natural environment).
  • polynucleotides and polypeptides in a natural state in a living cell are not isolated and purified, but the same polynucleotides or polypeptides are separated and purified if they are separated from other substances in the natural state .
  • isolated human ATP-dependent serine proteolytic enzyme 13 means that human ATP-dependent serine proteolytic enzyme ⁇ is substantially free of other proteins, lipids, carbohydrates, or other substances with which it is naturally associated. Those skilled in the art can purify human ATP-dependent serine protease 13 using standard protein purification techniques. Substantially pure peptides produce a single on a non-reducing polyacrylamide gel The main belt. The purity of the human ATP-dependent serine protease 13 polypeptide can be analyzed by amino acid sequence.
  • the present invention provides a new polypeptide, human ATP-dependent serine proteolytic enzyme 13, which is basically composed of the amino acid sequence shown in SEQ ID NO: 2.
  • the polypeptide of the present invention may be a recombinant polypeptide, a natural polypeptide, or a synthetic polypeptide, and preferably a recombinant polypeptide.
  • the polypeptides of the present invention can be naturally purified products or chemically synthesized products, or can be produced from prokaryotic or eukaryotic hosts (such as bacteria, yeast, higher species, insects, and mammalian cells) using recombinant techniques. Depending on the host used in the recombinant production protocol, the polypeptide of the invention may be glycosylated, or it may be non-glycosylated. Polypeptides of the invention may also include or exclude starting methionine residues.
  • the invention also includes fragments, derivatives, and analogs of human ATP-dependent serine proteolytic enzymes 13.
  • fragment refers to a polypeptide that substantially maintains the same biological function or activity of the human ATP-dependent serine proteolytic enzyme 13 of the present invention.
  • a fragment, derivative or analog of the polypeptide of the present invention may be: U) a type in which one or more amino acid residues are replaced with conservative or non-conservative amino acid residues (preferably conservative amino acid residues), and A substituted amino acid may or may not be encoded by a genetic codon; or (II) a type in which a group on one or more amino acid residues is replaced by another group to include a substituent; or (III) Such a kind, in which the mature polypeptide is fused with another compound (such as a compound that prolongs the half-life of the polypeptide, such as polyethylene glycol); or ( ⁇ ) such a polypeptide sequence in which an additional amino acid sequence is fused into the mature polypeptide (Such as the leader or secretory sequence or the sequence used to purify the polypeptide or protease sequence).
  • another compound such as a compound that prolongs the half-life of the polypeptide, such as polyethylene glycol
  • an additional amino acid sequence is fused into the mature polypeptid
  • the present invention provides an isolated nucleic acid (polynucleotide), which basically consists of a polynucleotide encoding a polypeptide having the amino acid sequence of SEQ ID NO: 2.
  • the polynucleotide sequence of the present invention includes the nucleotide sequence of SEQ ID NO: 1.
  • the polynucleotide of the present invention is found from a cDNA library of human fetal brain tissue. It contains a full-length polynucleotide sequence of 1659 bases, and its open reading frames 300-650 encode 116 amino acids.
  • this polypeptide has a similar expression profile to human ATP-dependent serine protease 48, and it can be inferred that the human ATP-dependent serine protease 13 is similar to human ATP-dependent serine protease 48 Functions.
  • the polynucleotide of the present invention may be in the form of DNA or RNA.
  • DNA forms include cDNA, genomic DNA, or synthetic DNA.
  • DNA can be single-stranded or double-stranded.
  • DNA can be coding or non-coding.
  • the coding region sequence encoding a mature polypeptide may be the same as the coding region sequence shown in SEQ ID NO: 1 or a degenerate variant.
  • "degenerate variant" in the present invention refers to a coding region that encodes a protein or polypeptide having SEQ ID NO: 2 but is identical to the coding region shown in SEQ ID NO: 1 Sequences with different nucleic acid sequences.
  • the polynucleotide encoding the mature polypeptide of SEQ ID NO: 2 includes: only the coding sequence of the mature polypeptide; the coding sequence of the mature polypeptide and various additional coding sequences; the coding sequence of the mature polypeptide (and optional additional coding sequences); Coding sequence.
  • polynucleotide encoding a polypeptide refers to a polynucleotide comprising the polypeptide and a polynucleotide comprising additional coding and / or non-coding sequences.
  • the invention also relates to variants of the polynucleotides described above, which encode polypeptides or fragments, analogs and derivatives of polypeptides having the same amino acid sequence as the invention.
  • Variants of this polynucleotide can be naturally occurring allelic variants or non-naturally occurring variants. These nucleotide variants include substitution variants, deletion variants, and insertion variants.
  • an allelic variant is an alternative form of a polynucleotide that may be a substitution, deletion, or insertion of one or more nucleotides, but does not substantially change the function of the polypeptide it encodes .
  • the invention also relates to a polynucleotide that hybridizes to the sequence described above (having at least 50%, preferably 70% identity, between the two sequences).
  • the present invention particularly relates to polynucleotides that can hybridize to the polynucleotides of the present invention under stringent conditions.
  • “strict conditions” means: (1) hybridization and elution at lower ionic strength and higher temperature, such as 0.2xSSC, 0.1% SDS, 60'C; or (2) Add denaturants during hybridization, such as 50% (v / v) formamide, 0.1% calf serum / 0.1% Fi co ll, 42 ° C, etc .; or (3) only between two sequences Hybridization occurs only when the identity is at least 95%, and more preferably 97%.
  • the polypeptide encoded by the hybridizable polynucleotide has the same biological function and activity as the mature polypeptide shown in SEQ ID NO: 2.
  • nucleic acid fragments that hybridize to the sequences described above.
  • a "nucleic acid fragment” contains at least 10 nucleotides in length, preferably at least 20-30 nucleotides, more preferably at least 50-60 nucleotides, and most preferably at least 100 nuclei. Glycylic acid or more. Nucleic acid fragments can also be used in nucleic acid amplification techniques, such as PCR, to identify and / or isolate polynucleotides encoding human ATP-dependent serine proteolytic enzymes.
  • polypeptides and polynucleotides in the present invention are preferably provided in an isolated form and are more preferably purified to homogeneity.
  • the specific polynucleotide sequence of the present invention encoding human ATP-dependent serine proteolytic enzyme 1 3 can be obtained by various methods.
  • polynucleotides are isolated using hybridization techniques well known in the art. These techniques include, but are not limited to: 1) hybridization of probes to genomic or cDNA libraries to detect homologous polynucleotide sequences, and 2) antibody screening of expression libraries to detect cloned polynucleosides with common structural characteristics Acid fragments.
  • the DNA fragment sequence of the present invention can also be obtained by the following methods: 1) Isolation of double-stranded DM from genome D Sequence; 2) chemically synthesize a DNA sequence to obtain double-stranded DNA of the polypeptide.
  • genomic DNA isolation is the least commonly used. Direct chemical synthesis of DNA sequences is often the method of choice. The more commonly used method is the isolation of cDNA sequences.
  • the standard method for isolating the cD of interest is to isolate mRNA from donor cells that overexpress the gene and perform reverse transcription to form a plasmid or phage cDNA library.
  • mRNA extraction There are many mature methods for mRNA extraction, and kits are also commercially available (Qiagene). Construction of cDNA libraries is also a common method (Sambrook, et al., Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory New York, 1989).
  • Commercially available cDNA libraries are also available, such as different cDNA libraries from Clontech. When polymerase reaction technology is used in combination, even very small expression products can be cloned.
  • genes of the present invention can be selected from these cDNA libraries by conventional methods. These methods include (but are not limited to): (l) DNA-DNA or DNA-RNA hybridization; (2) the presence or absence of marker gene functions; (3) determination of the level of human ATP-dependent serine protease 13 transcripts (4) Detecting protein products expressed by genes through immunological techniques or measuring biological activity. The above methods can be used singly or in combination. z
  • the probe used for hybridization is homologous to any part of the polynucleotide of the present invention, and its length is at least 10 nucleotides, preferably at least 30 nucleotides, more preferably Is at least 50 nucleotides, preferably at least 100 nucleotides.
  • the length of the probe is usually within 2000 nucleotides, preferably within 1000 nucleotides.
  • the probe used here is usually a DNA sequence chemically synthesized based on the gene sequence information of the present invention.
  • the genes or fragments of the present invention can of course be used as probes.
  • DNA probes can be labeled with radioisotopes, luciferin, or enzymes (such as alkaline phosphatase).
  • immunological techniques such as Western blotting, radioimmunoprecipitation, and enzyme-linked immunosorbent assay (ELISA) can be used to detect the protein product expressed by the human ATP-dependent serine proteolytic enzyme 13 gene.
  • ELISA enzyme-linked immunosorbent assay
  • a method using PCR technology to amplify DNA / RNA is preferably used to obtain the gene of the present invention.
  • the RACE method RACE-rapid cDNA end rapid amplification method
  • the primers used for PCR can be appropriately based on the polynucleotide sequence information of the present invention disclosed herein. Select and synthesize using conventional methods.
  • the amplified DNA / RNA fragments can be isolated and purified by conventional methods such as by gel electrophoresis.
  • polynucleotide sequence of the gene of the present invention or various DNA fragments and the like obtained as described above can be determined by a conventional method such as dideoxy chain termination method (Sanger et al. PNAS, 1977, 74: 5463-5467). Such polynucleotide sequences can also be determined using commercial sequencing kits and the like. In order to obtain the full-length cDNA sequence, sequencing must be repeated. Sometimes it is necessary to determine the cDNA sequence of multiple clones before they can be spliced. Long cD sequence.
  • the present invention also relates to a vector comprising a polynucleotide of the present invention, and a host cell that is genetically engineered using the vector of the present invention or directly using a human ATP-dependent serine proteolytic enzyme 13 coding sequence, and the recombinant technology to produce the Polypeptide method.
  • a polynucleotide sequence encoding a human ATP-dependent serine proteolytic enzyme 13 can be inserted into a vector to constitute a recombinant vector containing the polynucleotide of the present invention.
  • vector refers to bacterial plasmids, phages, yeast plasmids, plant cell viruses, mammalian cell viruses such as adenoviruses, retroviruses, or other vectors well known in the art.
  • Vectors suitable for use in the present invention include, but are not limited to: T7 promoter-based expression vectors expressed in bacteria (Rosenberg, et al.
  • pMSXND expression vectors expressed in mammalian cells Lee and Na thans, JBio Chem. 263: 3521, 1988
  • baculovirus-derived vectors expressed in insect cells in short, as long as it can be replicated and stabilized in the host, any plasmid and vector can be used to construct recombinant expression vectors.
  • An important feature of expression vectors is that they usually contain an origin of replication, a promoter, a marker gene, and translational regulatory elements.
  • Methods known to those skilled in the art can be used to construct expression vectors containing D sequences encoding human ATP-dependent serine proteolytic enzymes 13 and appropriate transcriptional / translational regulatory elements. These methods include in vitro recombinant DNA technology, DNA synthesis technology, in vivo recombination technology, etc. (Sambroook, et al. Mo l ecu lar Cloning, a Labora tory Manua l, Co d Spring Harbor Labora tory. New York, 1989).
  • the DNA sequence can be operably linked to an appropriate promoter in an expression vector to guide mRNA synthesis. Representative examples of these promoters are: l ac or trp promoter of E.
  • the expression vector also includes a ribosome binding site and a transcription terminator for translation initiation. Insertion of enhancer sequences into the vector will enhance its transcription in higher eukaryotic cells. Enhancers are cis-acting factors for DNA expression, usually about 10 to 300 base pairs, which act on promoters to enhance gene transcription. Examples include 100 to 270 base pairs of the SV40 enhancer on the late side of the origin of replication, polyoma enhancers and adenovirus enhancers on the late side of the origin of replication.
  • the expression vector preferably contains one or more selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
  • selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
  • GFP fluorescent protein
  • tetracycline or ampicillin resistance for E. coli.
  • a polynucleotide encoding a human ATP-dependent serine proteolytic enzyme 1 3 or a recombinant vector containing the polynucleotide can be transformed or transduced into a host cell to constitute a genetic engineering containing the polynucleotide or the recombinant vector.
  • Host cell refers to a prokaryotic cell, such as a bacterial cell; or a lower eukaryotic cell, such as a yeast cell; or a higher eukaryotic cell, such as a mammalian cell. Representative examples are: E.
  • coli Streptomyces
  • bacterial cells such as Salmonella typhimurium
  • fungal cells such as yeast
  • plant cells such as fly S2 or Sf 9
  • animal cells such as CH0, COS, or Bowes s melanoma cells, etc. .
  • Transformation of a host cell with a DNA sequence according to the present invention or a recombinant vector containing the D sequence can be performed using conventional techniques well known to those skilled in the art.
  • the host is a prokaryote such as E. coli
  • competent cells capable of DNA uptake can be in the exponential growth phase were harvested, treated with CaC l 2 method used in steps well known in the art. The alternative is to use MgC l 2 .
  • transformation can also be performed by electroporation.
  • the following DNA transfection methods can be used: calcium phosphate co-precipitation method, or conventional mechanical methods such as microinjection, electroporation, and liposome packaging.
  • the polynucleotide sequence of the present invention can be used to express or produce recombinant human ATP-dependent serine protease 1 3 (Scence, 1984; 224: 1431). Generally there are the following steps :
  • the medium used in the culture may be selected from various conventional mediums. Culture is performed under conditions suitable for host cell growth. After the host cells have grown to an appropriate cell density, the selected promoter is induced by a suitable method (such as temperature conversion or chemical induction), and the cells are cultured for a period of time.
  • a suitable method such as temperature conversion or chemical induction
  • the recombinant polypeptide may be coated in a cell, expressed on a cell membrane, or secreted outside the cell. If necessary, the recombinant protein can be isolated and purified by various separation methods using its physical, chemical and other properties. These methods are well known to those skilled in the art. These methods include, but are not limited to: conventional renaturation treatment, protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid chromatography (HPLC) and various other liquid chromatography techniques and combinations of these methods.
  • conventional renaturation treatment protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid
  • the polypeptide of the present invention and the antagonists, agonists and inhibitors of the polypeptide can be directly used in the treatment of diseases Treatments, such as malignant tumors, adrenal deficiency, skin diseases, various types of inflammation, HIV infection and immune diseases.
  • Treatments such as malignant tumors, adrenal deficiency, skin diseases, various types of inflammation, HIV infection and immune diseases.
  • Lon-type proteolytic enzyme family catalyze the ATP-dependent degradation of mitochondrial matrix proteins.
  • the Lon protein family is closely related to the respiration process of living organisms. It can maintain the integrity of mitochondrial DNA, but it is not a component of the cytochrome complex. Abnormal expression can lead to abnormal mitochondrial DNA structure, affect respiratory chain function, and cause abnormal metabolism of matter and energy.
  • the abnormal expression of the human ATP-dependent serine proteolytic enzyme of the present invention will produce various diseases, especially mitochondrial diseases, metabolic disorders related to energy and material metabolism, and disorders of growth and development. These diseases include, but are not Limited to:
  • Organic acidemia isovaleric acidemia, propionic acidemia, methylmalonic aciduria, combined carboxylase deficiency, glutaric acid type I, etc.
  • Amino acid metabolism defects phenylketonuria, tyrosine metabolism defects such as albinism, sulfur amino acid metabolism defects, tryptophan metabolism defects such as tryptophanemia, branch amino acid metabolism defects, glycine metabolism defects such as Glycineemia, hypersarcosineemia, proline and hydroxyproline metabolism defects, glutamate metabolism defects, urea cycle metabolism defects, histidine metabolism defects, lysine metabolism defects , And other amino acid metabolism defects.
  • Mucopolysaccharidosis and other marginal diseases Mucopolysaccharidosis type I-VII, Mucopolysaccharidosis marginal diseases such as rheumatoid mucopolysaccharidosis, and mucolipid storage disease.
  • Purine and Pyrimidine Metabolism Defects Abnormal purine metabolism, such as Ray-niney syndrome, xanthineuria, abnormal pyrimidine metabolism, such as orotic aciduria, and adenosine deaminase deficiency.
  • Abnormal lipid metabolism hyperlipoproteinemia, familial hyperct-lipoproteinemia, familial alipoproteinemia, familial hypo-p-lipoproteinemia, familial lecithin-cholesterol acetyltransferase deficiency .
  • Glucose metabolism defects Congenital sugar digestion and absorption defects such as congenital lactose intolerance, hereditary fructose intolerance, monosaccharide metabolism defects such as galactosemia, fructose metabolism defects, glycogen metabolism diseases such as glycogen storage Backlog.
  • Growth and development disorders mental retardation, cerebral palsy, brain development disorders, familial cerebral nucleus dysplasia syndrome, skin, fat and muscular dysplasias such as congenital skin relaxation, premature aging, congenital horn Malformation, various metabolic defects such as various amino acid metabolic defects, stunting, dwarfism, sexual retardation, etc.
  • Congenital malformations spina bifida, craniocerebral fissure, anencephaly malformation, cerebral bulge, foramen malforma, Down syndrome, congenital hydrocephalus, aqueduct malformation, cartilage hypoplasia, dwarfism, spinal epiphyseal dysplasia, Pseudochondral dysplasia, Langer-Giedion syndrome, funnel chest, hypogonadism
  • congenital adrenal hyperplasia, upper urethral fissure, cryptorchidism with short stature syndromes such as Conrad i syndrome and Danbo l tC los s syndrome, congenital glaucoma or cataract, congenital lens abnormality, congenital Small eyelid fissure, retinal dysplasia, congenital optic nerve atrophy, congenital sensorineural hearing loss, cleft foot and hand crack, teratosis, Williams syndrome, Alag ille syndrome, Bayesian syndrome, etc.
  • Abnormal expression of the human ATP-dependent serine proteolytic enzyme of the present invention will also generate certain tumors, certain hereditary, hematological diseases, and immune system diseases.
  • the invention also provides methods for screening compounds to identify agents that increase (agonist) or suppress (antagonist) human ATP-dependent serine proteolytic enzymes.
  • Agonists enhance human ATP-dependent serine proteolytic enzymes 13 to stimulate biological functions such as cell proliferation, while antagonists prevent and treat disorders related to cell proliferation, such as various cancers.
  • mammalian cells or membrane preparations expressing human ATP-dependent serine protease 13 can be cultured with labeled human ATP-dependent serine protease 13 in the presence of drugs. The ability of the drug to increase or block this interaction is then determined.
  • Antagonists of human ATP-dependent serine protease 13 include screened antibodies, compounds, receptor deletions, and the like. Antagonists of human ATP-dependent serine protease 1 3 can bind to human ATP-dependent serine protease 1 3 and eliminate its function, or inhibit the production of the polypeptide, or bind to the active site of the polypeptide such that The polypeptide cannot perform biological functions.
  • human ATP-dependent serine proteolytic enzymes 13 can be added to bioanalytical assays by measuring the effects of compounds on the interaction between human ATP-dependent serine proteolytic enzymes 13 and their receptors. Determine if the compound is an antagonist. Receptor deletions and analogs that act as antagonists can be screened in the same manner as described above for screening compounds.
  • Polypeptide molecules capable of binding to human ATP-dependent serine proteolytic enzymes 13 can be obtained by screening a random peptide library composed of various possible combinations of amino acids bound to a solid phase. In screening, human ATP-dependent serine proteolytic enzyme 13 molecules should generally be labeled.
  • the present invention provides a method for producing antibodies using polypeptides, and fragments, derivatives, analogs or cells thereof as antigens. These antibodies can be polyclonal or monoclonal antibodies.
  • the invention also provides antibodies against human ATP-dependent serine proteolytic enzyme 13 epitopes. These antibodies include (but are not limited to): polyclonal antibodies, monoclonal antibodies, chimeric antibodies, single chain antibodies, Fab fragments, and fragments produced by Fab expression libraries.
  • Polyclonal antibodies can be produced by injecting human ATP-dependent serine protease 13 directly into immunized animals (such as rabbits, mice, rats, etc.).
  • immunized animals such as rabbits, mice, rats, etc.
  • adjuvants can be used to enhance the immune response, including but not limited to 'S adjuvant and so on.
  • Monoclonal preparation of human ATP-dependent serine protease 13 Antibody technologies include, but are not limited to, hybridoma technology (Kohler and Milstein. Nature, 1975, 256: 495-497), triple tumor technology, human B-cell hybridoma technology, and EBV-hybridoma technology.
  • Chimeric antibodies that bind human constant regions and non-human variable regions can be produced using existing techniques (Morrison et al, PNAS, 1985, 81: 6851) and existing techniques for producing single-chain antibodies (US Pat No. .4946778) can also be used to produce single chain antibodies against human ATP-dependent serine protease 13.
  • Antibodies against human ATP-dependent serine protease 13 can be used in immunohistochemical techniques to detect human ATP-dependent serine protease 13 in biopsy specimens.
  • Monoclonal antibodies that bind to human ATP-dependent serine protease 13 can also be labeled with radioisotopes and injected into the body to track their location and distribution.
  • This radiolabeled antibody can be used as a non-invasive diagnostic method to locate tumor cells and determine whether there is metastasis.
  • Antibodies can also be used to design immunotoxins that target a particular part of the body.
  • human ATP-dependent serine proteolytic enzymes 13 High-affinity monoclonal antibodies can covalently bind to bacterial or plant toxins (such as diphtheria toxin, ricin, ormosine, etc.).
  • a common method is to attack the amino group of an antibody with a thiol cross-linking agent such as SPDP and bind the toxin to the antibody through the exchange of disulfide bonds.
  • This hybrid antibody can be used to kill human ATP-dependent serine protease 13 Positive cells.
  • the antibodies of the present invention can be used to treat or prevent diseases related to human ATP-dependent serine protease 13. Administration of an appropriate dose of antibody can stimulate or block the production or activity of human ATP-dependent serine protein hydrolase 13.
  • the invention also relates to a diagnostic test method for quantitative and localized detection of human ATP-dependent serine proteolytic enzyme 13 levels. These tests are well known in the art and include FISH and radioimmunoassays. The levels of human ATP-dependent serine protease 13 detected in the test can be used to explain the importance of human ATP-dependent serine protease 13 in various diseases and to diagnose human ATP-dependent serine protease 13 A working disease.
  • polypeptide of the present invention can also be used for peptide mapping analysis.
  • the polypeptide can be specifically cleaved by physical, chemical or enzymatic analysis, and subjected to one-dimensional or two-dimensional or three-dimensional gel electrophoresis analysis, more preferably mass spectrometry analysis.
  • Polynucleotides encoding human ATP-dependent serine protease 13 can also be used for a variety of therapeutic purposes. Gene therapy techniques can be used to treat abnormal cell proliferation, development, or metabolism caused by the non-expression or abnormal / inactive expression of human ATP-dependent serine protease 13.
  • Recombinant gene therapy vectors (such as viral vectors) can be designed to express variant human ATP-dependent serine protease 13 to inhibit endogenous human ATP-dependent serine protease 13 activity.
  • a variant human ATP-dependent serine protease 13 may be a shortened human ATP-dependent serine protease 13 lacking a signaling domain. Although it can bind to downstream substrates, it lacks signaling activity .
  • recombinant gene therapy vectors can be used to treat diseases caused by abnormal expression or activity of human ATP-dependent serine protease 13.
  • Virus-derived expression vectors such as retrovirus, adenovirus, adenovirus-associated virus, herpes simplex virus, parvovirus, etc. can be used to transfer a polynucleotide encoding human ATP-dependent serine proteolytic enzyme 1 3 into a cell.
  • a method for constructing a recombinant viral vector carrying a polynucleotide encoding a human ATP-dependent serine proteolytic enzyme 13 can be found in the existing literature (Sambrook, eta l.).
  • a recombinant polynucleotide encoding human ATP-dependent serine protease 1 3 can be packaged into liposomes and transferred into cells.
  • Methods for introducing a polynucleotide into a tissue or cell include: directly injecting the polynucleotide into a tissue in vivo; or introducing the polynucleotide into a cell in vitro through a vector (such as a virus, phage, or plasmid), and then transplanting the cell Into the body and so on.
  • a vector such as a virus, phage, or plasmid
  • Oligonucleotides including antisense RNA and DNA
  • ribozymes that inhibit human ATP-dependent serine protease 1 3 mRNA are also within the scope of the present invention.
  • a ribozyme is an enzyme-like RNA molecule that can specifically decompose a specific R. Its mechanism of action is that the ribozyme molecule specifically hybridizes with a complementary target RNA and performs endonucleation.
  • Antisense RNA, DNA, and ribozymes can be obtained using any existing RNA or DNA synthesis technology, such as solid-phase phosphate amide chemical synthesis to synthesize oligonucleotides.
  • Antisense RNA molecules can be obtained by in vitro or in vivo transcription of a DNA sequence encoding the RNA. This DNA sequence has been integrated downstream of the vector's RNA polymerase promoter. In order to increase the stability of the nucleic acid molecule, it can be modified in a variety of ways, such as increasing the sequence length on both sides, and the phosphorothioate or peptide bond instead of the phosphodiester bond is used for the ribonucleoside linkage.
  • the polynucleotide encoding human ATP-dependent serine protease 1 3 can be used for the diagnosis of diseases related to human ATP-dependent serine protease 1 3.
  • the polynucleotide encoding human ATP-dependent serine proteolytic enzyme 13 can be used to detect the expression of human ATP-dependent serine proteolytic enzyme 13 or abnormal expression of human ATP-dependent serine proteolytic enzyme 13 in disease states.
  • a DNA sequence encoding human ATP-dependent serine protease 1 3 can be used to hybridize biopsy specimens to determine the expression of human ATP-dependent serine protease 13.
  • Hybridization techniques include Sou thern blotting, Nor thern blotting, and in situ hybridization.
  • polynucleotides of the present invention can be used as probes to be fixed on a micro array (Mi croar ray) or a DNA chip (also known as a "gene chip") for analyzing differential expression analysis of genes and genetic diagnosis in tissues .
  • a micro array Micro croar ray
  • a DNA chip also known as a "gene chip”
  • Human ATP-dependent serine protease 13 specific primers for RNA-polymerase chain reaction (RT-PCR) in vitro amplification can also detect human ATP-dependent serine protease 13 transcripts.
  • Human ATP-dependent serine protease 1 3 gene can also be used to diagnose human ATP Dependent serine protease 13 related diseases.
  • Human ATP-dependent serine protease 13 mutations include point mutations, translocations, deletions, recombinations, and any other abnormalities compared to the normal wild-type human ATP-dependent serine protease 13 DNA sequence. Mutations can be detected using existing techniques such as Southern blotting, DNA sequence analysis, PCR and in situ hybridization. In addition, mutations may affect protein expression, so Northern blotting and Western blotting can be used to indirectly determine whether a gene is mutated.
  • sequences of the invention are also valuable for chromosome identification. This sequence will specifically target a specific position on a human chromosome and can hybridize to it. Currently, specific sites for each gene on the chromosome need to be identified. Currently, only a few chromosome markers based on actual sequence data (repeating polymorphisms) are available for marking chromosome positions. According to the present invention, in order to associate these sequences with disease-related genes, an important first step is to locate these DNA sequences on a chromosome.
  • PCR primers (preferably 15-35bp) are prepared from the cDNA, and the sequences can be located on the chromosomes. These primers were then used for PCR screening of somatic hybrid cells containing individual human chromosomes. Only those heterozygous cells containing the human gene corresponding to the primer will produce amplified fragments.
  • PCR localization of somatic hybrid cells is a quick way to localize DNA to specific chromosomes.
  • oligonucleotide primers of the present invention in a similar manner, a set of fragments from a specific chromosome or a large number of genomic clones can be used to achieve sublocalization.
  • Other similar strategies that can be used for chromosomal localization include in situ hybridization, chromosome pre-screening with labeled flow sorting, and pre-selection of hybridization to construct chromosome-specific cDNA libraries.
  • Fluorescent in situ hybridization of cDNA clones with metaphase chromosomes allows precise chromosomal localization in one step.
  • FISH Fluorescent in situ hybridization
  • cDNA or genomic sequences between the affected and unaffected individuals need to be determined. If a mutation is observed in some or all diseased individuals and the mutation is not observed in any normal individuals, the mutation may be the cause of the disease. Comparing affected and unaffected individuals usually involves first looking for structural changes in the chromosome, such as deletions or translocations that are visible at the chromosomal level or detectable using cDNA sequence-based PCR. Based on the resolution capabilities of current physical mapping and gene mapping technologies, cDNAs that are accurately mapped to disease-related chromosomal regions can be one of 50 to 500 potentially pathogenic genes (assuming 1 megabase mapping capability and every 20kb corresponds to a gene).
  • the polypeptides, polynucleotides and mimetics, agonists, antagonists and inhibitors of the present invention can be used in combination with a suitable pharmaceutical carrier.
  • suitable pharmaceutical carrier can be water, glucose, ethanol, salts, buffers, glycerol, and combinations thereof.
  • the composition comprises a safe and effective amount of the polypeptide or antagonist, and carriers and excipients which do not affect the effect of the drug. These compositions can be used as drugs for the treatment of diseases.
  • the invention also provides a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the invention.
  • a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the invention.
  • these containers there may be instructional instructions given by government agencies that manufacture, use, or sell pharmaceuticals or biological products, which prompts permission for administration on the human body by government agencies that produce, use, or sell.
  • the polypeptides of the invention can be used in combination with other therapeutic compounds.
  • the pharmaceutical composition can be administered in a convenient manner, such as by a topical, intravenous, intraperitoneal, intramuscular, subcutaneous, intranasal or intradermal route of administration.
  • Human ATP-dependent serine protease 13 is administered in an amount effective to treat and / or prevent a specific indication.
  • the amount and dose range of human ATP-dependent serine protease 13 administered to a patient will depend on many factors, such as the mode of administration, the health conditions of the person to be treated, and the judgment of the diagnostician. Examples
  • Total human fetal brain RNA was extracted by one-step method with guanidine isothiocyanate / phenol / chloroform.
  • Poly (A) mRNA was isolated from total RM using Quik mRNA Isolat ion Kit (product of Qiegene). 2ug poly (A) mRNA is reverse transcribed to form cDNA.
  • the Smart cDNA cloning kit purchased from Clontech was used to insert the cDNA fragments into the multiple cloning site of the pBSK (+) vector (Clontech) to transform DH5 ct. The bacteria formed a cDNA library.
  • the sequences at the 5 'and 3' ends of all clones were determined using Dye terminate cyc le react ion sequencing kit (Perkin-Elmer) and ABI 377 automatic sequencer (Perkin-Elmer).
  • the determined cDNA sequence was compared with an existing public DNA sequence database (Genebank), and it was found that the cDNA sequence of one of the clones 0229E01 was new DNA.
  • a series of primers were synthesized to determine the inserted cDNA fragments of the clone in both directions.
  • Primer2 5'- GCTTCAACAGCAACACCTTTATTA -3 '(SEQ ID NO: 4)
  • Primerl is a forward sequence located at the 5th end of SEQ ID NO: 1, starting at lbp;
  • Primer2 is the 3 'end reverse sequence in SEQ ID NO: 1.
  • Amplification reaction conditions 50 mmol / L KC1, 10 mmol / L Tris-HCl, pH 8.5, 1.5 mmol / L MgCl 2 , 200 ⁇ ol / L dNTP, lOpmol primer, 1U Taq DNA in a 50 ⁇ 1 reaction volume Polymerase (Clontech).
  • the reaction was performed on a PE9600 DNA thermal cycler (Perkin-Elmer) under the following conditions for 25 cycles: 94 ° C 30sec; 55 ° C 30sec; 72 ° C 2min.
  • ⁇ -actin was set as a positive control and template blank was set as a negative control.
  • the amplified product was purified using a QIAGEN kit and ligated to a pCR vector using a TA cloning kit (Invitrogen).
  • the DNA sequence analysis results showed that the DNA sequence of the PCR product was exactly the same as l-1659bp shown in SEQ ID NO: 1.
  • Example 3 Northern blot analysis of human ATP-dependent serine protease 13 gene expression
  • This method involves acid guanidinium thiocyanate phenol-chloroform extraction. That is, the tissue is homogenized with 4M guanidine isothiocyanate-25mM sodium citrate, 0.2M sodium acetate (pH4.0), and 1 time volume of phenol and 1/5 volume of chloroform-isoamyl alcohol (49: 1 ) And centrifuge after mixing. Aspirate the aqueous layer, add isopropanol (0.8 vol) and centrifuge the mixture to obtain RNA precipitate. The resulting RNA pellet was washed with 70% ethanol, dried and dissolved in water.
  • RNA With 20 ⁇ 8 RNA, electrophoresed on containing 20mM 3- (N- morpholino) propanesulfonic acid (pH7.0) 1.2% agarose gel -5raM -ImM EDTA- 2.2M sodium acetate formaldehyde. It was then transferred to a nitrocellulose membrane. Preparation of ct- 32 P dATP with 32 P- DNA probe labeled by the random primer method. The DNA probe used was the human ATP-dependent serine protease 13 coding region sequence (300bp to 650bp) amplified by PCR as shown in FIG. 1.
  • a 32P-labeled probe (about 2 x 10 6 cpm / ml) was hybridized with a nitrocellulose membrane to which RNA was transferred at 42 ° C overnight in a solution containing 50% formamide-25mM H 2 P0 4 (pH7, 4)-5 x SSC-5 x Denhardt's solution and 20 ( ⁇ g / ml salmon sperm DNA. After hybridization, place the filter in 1 x SSC-0. 1 in SDS at 55. C for 30 min. Then, Phosphor Imager was used for analysis and quantification.
  • Example 4 In vitro expression, isolation, and purification of recombinant human ATP-dependent serine proteolytic enzyme 13 According to the sequence of the coding region shown in SEQ ID NO: 1 and FIG. 1, a pair of specific amplification primers were designed. The sequences are as follows:
  • Primer3 5'-CCCCATATGATGGCAAATGACGATTGCAGCATT-3 '(Seq ID No: 5)
  • Primer4 5,-CCCGAATTCCTACGGTCTCTTTTTCCTATGAGC-3, (Seq ID No: 6)
  • the 5' ends of these two primers contain Ndel and EcoRI restriction sites, respectively.
  • the coding sequences of the 5 'and 3' ends of the gene of interest were followed, and the Ndel and EcoRI restriction sites correspond to the selection on the expression vector plasmid pET-28b (+) (Novagen, Cat. No. 69865. 3) Sex endonuclease site.
  • PCR was performed using the PBS-0229E01 plasmid containing the full-length target gene as a template.
  • the PCR reaction conditions were as follows: 10 pg of PBS-0229E01 plasmid in a total volume of 50 ⁇ 1, Primer-3 and Primer-4 primers were 1 Opmol, Advantage polymerase Mix (Clontech) 1 ⁇ 1, respectively. Cycle parameters: 94 ° C 20s, 60 ° C 30s, 68 ° C 2 min, a total of 25 cycles. Ndel and EcoRI were used to double digest the amplified product and plasmid pET-28 (+), respectively, and large fragments were recovered and ligated with T4 ligase.
  • the ligated product was transformed into coliform bacteria DH5 CC using the calcium chloride method, and cultured overnight on LB plates containing kanamycin (final concentration 3 ( ⁇ g / ml)), and positive clones were selected by colony PCR method and sequenced. Positive sequence correct clone (PET-0229E01) was used to transform the recombinant plasmid into E. coli BL21 (DE3) plySs (product of Novagen) by calcium chloride method.
  • NH2-Met-Ala-Asn-Asp-Asp-Cys-Ser-I le-Ala-I le-Lys-I le-Pro-Glu-Asn-C00H SEQ ID NO: 7
  • the polypeptide was coupled to hemocyanin and bovine serum albumin to form a complex, respectively.
  • hemocyanin and bovine serum albumin For methods, see: Avrameas, et al. Immunochemi s try, 1969; 6: 43. Use 4mg of the above hemocyanin polypeptide
  • the complex plus complete Freund's adjuvant was used to immunize rabbits, and after 15 days, the hemocyanin polypeptide complex plus incomplete Freund's adjuvant was used to boost the immunity once.
  • a titer plate coated with a 15 ⁇ 8 / ⁇ 1 bovine serum albumin peptide complex was used as an ELISA to determine the antibody titer in rabbit serum.
  • Total IgG was isolated from antibody-positive rabbit serum using protein A-Sepharose.
  • the peptide was bound to a cyanogen bromide-activated Sepharose4B column, and anti-peptide antibodies were separated from the total IgG by affinity chromatography.
  • the immunoprecipitation method proved that the purified antibody could specifically bind to human ATP-dependent serine protease 13.
  • Suitable oligonucleotide fragments selected from the polynucleotides of the present invention are used as hybridization probes in a variety of ways.
  • the probes can be used to hybridize to the genome or cD library of normal tissues or pathological tissues from different sources to It is determined whether it contains the polynucleotide sequence of the present invention and a homologous polynucleotide sequence is detected.
  • the probe can be used to detect the polynucleotide sequence of the present invention or its homologous polynucleotide sequence in normal tissue or pathology. Whether the expression in tissue cells is abnormal.
  • the purpose of this embodiment is to select a suitable oligonucleotide fragment from the polynucleotide SEQ ID NO: 1 of the present invention as a hybridization probe, and to identify whether some tissues contain the polynucleoside of the present invention by a filter hybridization method.
  • Filter hybridization methods include dot blotting, Southern imprinting, Nor thern blotting, and copying methods. They all use the same steps to fix the polynucleotide sample to be tested on the filter and then hybridize.
  • the sample-immobilized filter is first pre-hybridized with a probe-free hybridization buffer to saturate the non-specific binding site of the sample on the filter with the carrier and the synthesized polymer.
  • the pre-hybridization solution is then replaced with a hybridization buffer containing labeled probes and incubated to hybridize the probes to the target nucleic acid.
  • the unhybridized probes are removed by a series of membrane washing steps.
  • This embodiment uses higher-intensity washing conditions (such as lower salt concentration and higher temperature), so that the hybridization background is reduced and only strong specific signals are retained.
  • the probes used in this embodiment include two types: the first type of probes are oligonucleotide fragments that are completely the same as or complementary to the polynucleotide SEQ ID NO: 1 of the present invention; the second type of probes are partially related to the present invention
  • the polynucleotide SEQ ID NO: 1 is the same or complementary oligonucleotide fragment.
  • the dot blot method is used to fix the sample on the filter membrane. Under the high-intensity washing conditions, the first type of probe and the sample have the strongest hybridization specificity and are retained.
  • oligonucleotide fragments for use as hybridization probes from the polynucleotide SEQ ID NO: 1 of the present invention should follow the following principles and several aspects to be considered:
  • the preferred range of probe size is 18-50 nucleotides
  • GC content is 30% -70%, if it exceeds, non-specific hybridization increases; 3. There should be no complementary regions inside the probe;
  • Those that meet the above conditions can be used as primary selection probes, and then further computer sequence analysis, including the primary selection probe and its source sequence region (ie, SEQ ID NO: 1) and other known genome sequences and their complement For homology comparison of the regions, if the homology with the non-target molecular region is greater than 85% or there are more than 15 consecutive bases, the primary probe should not be used generally;
  • Probe 1 which belongs to the first type of probe, is completely homologous or complementary to the gene fragment of SEQ ID NO: 1 (41Nt):
  • Probe 2 which belongs to the second type of probe, is equivalent to the replacement mutant sequence of the gene fragment of SEQ ID NO: 1 or its complementary fragment (41Nt):
  • PBS phosphate buffered saline
  • step 8-13 are only used when contamination must be removed, otherwise step 14 can be performed directly.
  • NC membranes nitrocellulose membranes
  • Two NC membranes are required for each probe, so that they can be used in the following experimental steps.
  • the film was washed with high-strength conditions and strength conditions, respectively.
  • the 32 P-Probe (the second peak is free ⁇ - 32 P-dATP) is prepared.
  • the sample membrane was placed in a plastic bag, and 3-lOmg pre-hybridization solution (lOxDenhardt-s; 6xSSC, 0.1 mg / ml CT DM (calf thymus DNA)) was added. After sealing the mouth of the bag, shake at 68 ° C for 2 hours.
  • 3-lOmg pre-hybridization solution lOxDenhardt-s; 6xSSC, 0.1 mg / ml CT DM (calf thymus DNA)
  • Gene microarray or gene microarray is a new technology currently being developed by many national laboratories and large pharmaceutical companies. It refers to the orderly and high-density arrangement of a large number of target gene fragments on glass, The data is compared and analyzed on a carrier such as silicon using fluorescence detection and computer software to achieve the purpose of rapid, efficient, and high-throughput analysis of biological information.
  • the polynucleotide of the present invention can be used as target DNA for gene chip technology for high-throughput research of new gene functions; search for and screen new tissue-specific genes, especially new genes related to diseases such as tumors; diagnosis of diseases such as hereditary diseases . The specific method steps have been reported in the literature.
  • a total of 4,000 polynucleotide sequences of various full-length cDNAs are used as target DNA, including the polynucleotide of the present invention. They were amplified by PCR respectively. After purification, the concentration of the amplified product was adjusted to about 500 ng / ul, and spotted on a glass medium using a Cartesian 7500 spotter (purchased from Cartesian Company, USA). The distance between the points is 280 ⁇ . The spotted slides were hydrated and dried, cross-linked in a UV cross-linker, and dried after elution to fix the DNA on the glass slides to prepare chips. The specific method steps have been reported in the literature. The sample post-processing steps in this embodiment are:
  • Total mRNA was extracted from human mixed tissues and specific tissues (or stimulated cell lines) using a one-step method, and the mRNA was purified using Oligotex raRNA Midi Kit (purchased from QiaGen), and separated by reverse transcription.
  • Light test Cy3dUTP (5-Araino-propargyl-2'-deoxyuridine 5'-tr iphate coupled to Cy3 fluorescent dye, purchased from Amersham Phamacia Biotech Company) labeled mRNA of human mixed tissues, using Cy5dUTP (5-Amino-propargy)
  • Cy5dUTP (5-Amino-propargy)
  • the 2'-deoxyuridine 5'-triphate coupled to Cy5 fluorescent dye purchased from Amersham Phamacia Biotech Company, was used to label the mRNA of specific tissues (or stimulated cell lines) of the body, and probes were prepared after purification.
  • Probes from the above two tissues and chips were hybridized in a UniHyb TM Hybridization Solution (purchased from TeleChem) hybridization solution for 16 hours, washed with a washing solution (1 x SSC, 0.2% SDS) at room temperature, and then scanned with ScanArray 3000.
  • the scanner purchased from General Scanning Company, USA
  • the scanned images were analyzed and processed with Imagene software (Biodiscovery, USA) to calculate the Cy3 / Cy5 ratio of each point.
  • the above specific tissues are thymus, testis, muscle, spleen, lung, skin, thyroid, liver, PMA + Ecv304 cell line, PMA-Ecv304 cell line, non-starved L02 cell line, Arsenic stimulated the L02 cell line and prostate tissue for 1 hour. Based on these 13 Cy3 / Cy5 ratios, draw a bar graph ( Figure 1). It can be seen from the figure that the expression profiles of human ATP-dependent serine protease 13 and human ATP-dependent serine protease 48 according to the present invention are very similar.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Immunology (AREA)
  • Organic Chemistry (AREA)
  • Molecular Biology (AREA)
  • Biomedical Technology (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Microbiology (AREA)
  • Hematology (AREA)
  • Medicinal Chemistry (AREA)
  • Genetics & Genomics (AREA)
  • Biotechnology (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Urology & Nephrology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Physics & Mathematics (AREA)
  • Analytical Chemistry (AREA)
  • Pathology (AREA)
  • Cell Biology (AREA)
  • General Engineering & Computer Science (AREA)
  • Food Science & Technology (AREA)
  • General Physics & Mathematics (AREA)
  • Biophysics (AREA)
  • Virology (AREA)
  • Oncology (AREA)
  • Hospice & Palliative Care (AREA)
  • AIDS & HIV (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • Enzymes And Modification Thereof (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Abstract

L'invention concerne un nouveau polypeptide, une sérine protéinase humaine ATP-dépendante 13, et un polynucléotide codant pour ce polypeptide ainsi qu'un procédé d'obtention de ce polypeptide par des techniques recombinantes d'ADN. L'invention concerne en outre les applications de ce polypeptide dans le traitement de maladies, notamment des tumeurs malignes, de l'hémopathie, de l'infection par VIH, de maladies immunitaires et de diverses inflammations. L'invention concerne aussi l'antagoniste agissant contre le polypeptide et son action thérapeutique ainsi que les applications de ce polynucléotide codant pour la sérine protéinase humaine ATP-dépendante 13.
PCT/CN2001/000239 2000-03-10 2001-02-26 Nouveau polypeptide, serine proteinase humaine atp-dependante 13, et polynucleotide codant pour ce polypeptide WO2001070785A1 (fr)

Priority Applications (1)

Application Number Priority Date Filing Date Title
AU2001244056A AU2001244056A1 (en) 2000-03-10 2001-02-26 A novel polypeptide, a human atp-dependent serine protein hydrolase 13 and the polynucleotide encoding the polypeptide

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
CN00111981.8 2000-03-10
CN 00111981 CN1313400A (zh) 2000-03-10 2000-03-10 一种新的多肽——人atp依赖的丝氨酸蛋白水解酶13和编码这种多肽的多核苷酸

Publications (1)

Publication Number Publication Date
WO2001070785A1 true WO2001070785A1 (fr) 2001-09-27

Family

ID=4581877

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/CN2001/000239 WO2001070785A1 (fr) 2000-03-10 2001-02-26 Nouveau polypeptide, serine proteinase humaine atp-dependante 13, et polynucleotide codant pour ce polypeptide

Country Status (3)

Country Link
CN (1) CN1313400A (fr)
AU (1) AU2001244056A1 (fr)
WO (1) WO2001070785A1 (fr)

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
ES2298762T3 (es) 2003-07-04 2008-05-16 Sinorgchem Co., Shandong Proceso para preparar 4-aminodifenilamina.

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
DATABASE EMBL [online] 18 February 2000 (2000-02-18), Database accession no. AL137712 *
DATABASE EMBL [online] 22 October 1999 (1999-10-22), Database accession no. AL109748 *
DATABASE EMBL [online] 9 November 1999 (1999-11-09), Database accession no. AL078614 *
DATABASE GENBANK [online] 8 May 1999 (1999-05-08), Database accession no. AC004527 *

Also Published As

Publication number Publication date
AU2001244056A1 (en) 2001-10-03
CN1313400A (zh) 2001-09-19

Similar Documents

Publication Publication Date Title
WO2001070785A1 (fr) Nouveau polypeptide, serine proteinase humaine atp-dependante 13, et polynucleotide codant pour ce polypeptide
WO2001066707A1 (fr) Nouveau polypeptide, serine protease humaine atp-dependante 11, et polynucleotide codant pour ce polypeptide
WO2001094529A2 (fr) Nouveau polypeptide, serine hydrolase humaine atp-dependante 21, et polynucleotide codant pour ce polypeptide
WO2001087943A1 (fr) Protease a serine 13 atp-dependante, polypeptide humain, et polynucleotide le codant
WO2001072986A1 (fr) Nouveau polypeptide, serine hydrolase humaine atp-dependante 10, et polynucleotide codant pour ce polypeptide
WO2001085923A1 (fr) Nouveau polypeptide, serine hydrolase humaine atp-dependante 9.2, et polynucleotide codant pour ce polypeptide
WO2001075125A1 (fr) Nouveau polypeptide, serine hydrolase humaine atp-dependante 31, et polynucleotide codant pour ce polypeptide
WO2001075085A1 (fr) Nouveau polypeptide, serine hydrolase humaine atp-dependante 11.3, et polynucleotide codant pour ce polypeptide
WO2001073066A1 (fr) Nouveau polypeptide, serine hydrolase atp-dependante humaine 10.1, et polynucleotide codant pour ce polypeptide
WO2001072987A1 (fr) Nouveau polypeptide, serine hydrolase atp-dependante humaine 52, et polynucleotide codant pour ce polypeptide
WO2001046431A1 (fr) Nouveau polypeptide, catalase 10, et polynucleotide codant pour ce polypeptide
WO2001046430A1 (fr) Nouveau polypeptide, peroxydase 12, et polynucleotide codant pour ce polypeptide
WO2001092541A1 (fr) Nouveau polypeptide, catalase 12, et polynucleotide codant ce polypeptide
WO2001094593A1 (fr) Nouveau polypeptide, glycero-3-phosphate deshydrogenase humaine 11, et polynucleotide codant ce polypeptide
WO2001083777A1 (fr) Nouveau polypeptide, serine hydrolase humaine atp-dependante 9.1, et polynucleotide codant pour ce polypeptide
WO2001096576A1 (fr) Nouveau polypeptide, serine hydrolase humaine atp-dependante 10, et polynucleotide codant ce polypeptide
WO2001072988A1 (fr) Nouveau polypeptide, serine hydrolase humaine atp-dependante 11.4, et polynucleotide codant pour ce polypeptide
WO2001075038A2 (fr) Nouveau polypeptide, serine hydrolase humaine 9 atp-dependante, et polynucleotide codant pour ce polypeptide
WO2001072992A1 (fr) Nouveau polypeptide, serine hydrolase humaine atp-dependante 16, et polynucleotide codant pour ce polypeptide
WO2001079508A1 (fr) Nouveau polypeptide, proteine porteuse mitochondriale humaine 18, et polynucleotide codant pour ce polypeptide
WO2001072989A1 (fr) Nouveau polypeptide, serine hydrolase humaine atp-dependante 11, et polynucleotide codant pour ce polypeptide
WO2001090180A1 (fr) Nouveau polypeptide, serine hydrolase humaine atp-dependante 9, et polynucleotide codant ce polypeptide
WO2001094594A1 (fr) Nouveau polypeptide, serine hydrolase humaine atp-dependante 12.2, et polynucleotide codant ce polypeptide
WO2001072990A1 (fr) Nouveau polypeptide, serine hydrolase humaine atp-dependante 12, et polynucleotide codant pour ce polypeptide
WO2001083675A2 (fr) Nouveau polypeptide, serine hydrolase humaine atp-dependante 10.2, et polynucleotide codant pour ce polypeptide

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
122 Ep: pct application non-entry in european phase
NENP Non-entry into the national phase

Ref country code: JP