WO2001072988A1 - Nouveau polypeptide, serine hydrolase humaine atp-dependante 11.4, et polynucleotide codant pour ce polypeptide - Google Patents

Nouveau polypeptide, serine hydrolase humaine atp-dependante 11.4, et polynucleotide codant pour ce polypeptide Download PDF

Info

Publication number
WO2001072988A1
WO2001072988A1 PCT/CN2001/000457 CN0100457W WO0172988A1 WO 2001072988 A1 WO2001072988 A1 WO 2001072988A1 CN 0100457 W CN0100457 W CN 0100457W WO 0172988 A1 WO0172988 A1 WO 0172988A1
Authority
WO
WIPO (PCT)
Prior art keywords
polypeptide
polynucleotide
dependent serine
human atp
sequence
Prior art date
Application number
PCT/CN2001/000457
Other languages
English (en)
Chinese (zh)
Inventor
Yumin Mao
Yi Xie
Original Assignee
Shanghai Biowindow Gene Development Inc.
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Shanghai Biowindow Gene Development Inc. filed Critical Shanghai Biowindow Gene Development Inc.
Priority to AU56082/01A priority Critical patent/AU5608201A/en
Publication of WO2001072988A1 publication Critical patent/WO2001072988A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14—Hydrolases (3)
    • C12N9/48—Hydrolases (3) acting on peptide bonds (3.4)
    • C12N9/50—Proteinases, e.g. Endopeptidases (3.4.21-3.4.25)
    • C12N9/64—Proteinases, e.g. Endopeptidases (3.4.21-3.4.25) derived from animal tissue
    • C12N9/6421—Proteinases, e.g. Endopeptidases (3.4.21-3.4.25) derived from animal tissue from mammals
    • C12N9/6424—Serine endopeptidases (3.4.21)
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P3/00—Drugs for disorders of the metabolism
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P37/00—Drugs for immunological or allergic disorders
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P7/00—Drugs for disorders of the blood or the extracellular fluid
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides

Definitions

  • the present invention belongs to the field of biotechnology. Specifically, the present invention describes a novel polypeptide, human ATP-dependent serine proteolytic enzyme 11.4, and a polynucleotide sequence encoding the polypeptide. The invention also relates to a preparation method and application of the polynucleotide and polypeptide.
  • L0N1 protein In 1998, Barakat S. et al. Cloned the L0N1 protein from maize, which is a new member of the Lon-type proteolytic enzyme family.
  • the L0N1 protein has high similarity in protein sequence with known bacterial and human Lon proteolytic enzymes, and both have a conserved substrate-binding domain and an ATP-binding domain; and the protein and the Lon protein family
  • the other members have similar biological functions and are closely related to the biological respiration process in the body, which can maintain the integrity of mitochondrial DNA, but is not a component of the cytochrome complex [Barakat S., Pearce DA. Et al, 1998, Plant Mol Biol, 37:.
  • Lon protease family members in vivo has a broad biological functions, abnormal expression of which will result in abnormalities induced mitochondrial DNA structure and Affects the function of the respiratory chain, leading to abnormal metabolism of matter and energy.
  • the N-terminus of members of the enzyme family contains a conserved ATP-binding domain that is responsible for binding to ATP in the body to hydrolyze ATP and provide the energy required for the enzyme to function; in addition, the enzyme family The members also contain the following conservative consensus sequence fragments:
  • DG- [PD] -SA- [GS]-[LIVMCA]-[TA]-[LIVM] (where S is the active serine site);
  • S is the active serine site;
  • the sequence fragment is the catalytic active center of the enzyme, and it plays a normal physiological function in the process of the enzyme Plays an important role. Mutations in this sequence will affect the catalytic activity of the enzyme in the organism.
  • the human ATP-dependent serine protease 1 1.4 protein plays an important role in regulating important functions of the body such as cell division and embryo development, and it is believed that a large number of proteins are involved in these regulatory processes, so there has been a need in the art. Identification of more human ATP-dependent serine protease 1 1.4 proteins involved in these processes, especially the amino acid sequence of this protein. The newcomer's ATP-dependent serine protease 1 1. 4
  • the isolation of the protein-coding genes also provides the basis for research to determine the role of this protein in health and disease states. This protein may form the basis for the development of diagnostic and / or therapeutic drugs for diseases, so isolating its coding DNA is important. Object of the invention
  • Another object of the invention is to provide a polynucleotide encoding the polypeptide.
  • Another object of the present invention is to provide a recombinant vector containing a polynucleotide encoding a human ATP-dependent serine proteolytic enzyme 1 1.4.
  • Another object of the present invention is to provide a genetically engineered host cell comprising a polynucleotide encoding a human ATP-dependent serine proteolytic enzyme 1 1.4.
  • Another object of the present invention is to provide a method for producing human ATP-dependent serine proteolytic enzyme 1 1.4.
  • Another object of the present invention is to provide an antibody against the polypeptide of the present invention, human ATP-dependent serine proteolytic enzyme 1 1.4.
  • Another object of the present invention is to provide mimic compounds, antagonists, agonists, and inhibitors against the polypeptide of the present invention, human ATP-dependent serine proteolytic enzyme 11.4.
  • Another object of the present invention is to provide a method for diagnosing and treating diseases associated with abnormalities in human ATP-dependent serine protease 11.4. Summary of invention
  • the present invention relates to an isolated polypeptide, which is of human origin, and includes: a polypeptide having the amino acid sequence of SEQ ID D. 2, or a conservative variant, biologically active fragment, or derivative thereof.
  • the polypeptide is a polypeptide having the amino acid sequence of SEQ ID NO: 2.
  • the invention also relates to an isolated polynucleotide comprising a nucleotide sequence or a variant thereof selected from the group consisting of:
  • sequence of the polynucleotide is one selected from the group consisting of: (a) a sequence having positions 1018-1329 in SEQ ID NO: 1; and (b) a sequence having 1-2770 in SEQ ID NO: 1 Sequence of bits.
  • the present invention further relates to a vector, particularly an expression vector, containing the polynucleotide of the present invention; a host cell genetically engineered with the vector, including a transformed, transduced or transfected host cell; Host cell and method of preparing the polypeptide of the present invention by recovering the expression product.
  • the invention also relates to an antibody capable of specifically binding to a polypeptide of the invention.
  • the invention also relates to a method for screening compounds that mimic, activate, antagonize or inhibit human ATP-dependent serine proteolytic enzyme 11.4 protein activity, which comprises utilizing the polypeptide of the invention.
  • the invention also relates to compounds obtained by this method.
  • the present invention also relates to a method for in vitro detection of a disease or susceptibility to disease associated with abnormal expression of a human ATP-dependent serine proteolytic enzyme 11.4 protein, comprising detecting mutations in the polypeptide or a sequence encoding a polynucleotide thereof in a biological sample, Alternatively, the amount or biological activity of a polypeptide of the invention in a biological sample is detected.
  • the invention also relates to a pharmaceutical composition
  • a pharmaceutical composition comprising a polypeptide of the invention or a mimetic thereof, an activator, an antagonist or an inhibitor, and a pharmaceutically acceptable carrier.
  • the present invention also relates to the preparation of a polypeptide and / or polynucleotide of the present invention for the treatment of ⁇ cancer, developmental disease or immune disease ⁇ or other drugs caused by abnormal expression of human ATP-dependent serine proteolytic enzyme 11.4. use.
  • FIG. 1 is a comparison diagram of gene chip expression profiles of the ATP-dependent serine proteolytic enzyme 11.4 and ATP-dependent serine proteolytic enzyme of the present inventor.
  • the upper graph is a graph of the expression profile of human ATP-dependent serine protease 11.4, and the lower sequence is the graph of the expression profile of ATP-dependent serine protease.
  • 1 indicates fetal kidney
  • 2 indicates fetal large intestine
  • 3 indicates fetal small intestine
  • 4 indicates fetal muscle
  • 5 indicates fetal brain
  • 6 indicates fetal bladder
  • 7 indicates unstarved L02
  • 8 indicates L02 +, lhr, As 3+
  • 9 indicates ECV304 PMA-
  • 10 means ECV304 PMA +
  • 11 means fetal liver
  • 12 means normal liver
  • 13 means thyroid
  • 14 means skin
  • 15 means fetal lung
  • 16 means lung
  • 17 means lung cancer
  • 18 means fetal spleen
  • 19 means spleen
  • 20 Indicates prostate
  • 21 indicates fetal heart
  • 22 indicates heart
  • 23 indicates muscle
  • 24 indicates testis
  • 25 indicates fetal thymus
  • 26 indicates thymus.
  • Figure 2 shows the polyacrylamide gel electrophoresis of isolated human ATP-dependent serine proteolytic enzyme 11.4.
  • Swimming diagram SDS-PAGE
  • l lkDa is the molecular weight of the protein.
  • the arrow indicates the isolated protein band.
  • Nucleic acid sequence refers to an oligonucleotide, a nucleotide or a polynucleotide and a fragment or part thereof, and may also refer to a genomic or synthetic DNA or RNA, they can be single-stranded or double-stranded, representing the sense or antisense strand.
  • amino acid sequence refers to an oligopeptide, peptide, polypeptide or protein sequence and fragments or portions thereof.
  • amino acid sequence in the present invention relates to the amino acid sequence of a naturally occurring protein molecule, such "polypeptide” or “protein” does not mean to limit the amino acid sequence to a complete natural amino acid related to the protein molecule .
  • a “variant" of a protein or polynucleotide refers to an amino acid sequence having one or more amino acids or nucleotide changes or a polynucleotide sequence encoding it.
  • the changes may include deletions, insertions or substitutions of amino acids or nucleotides in the amino acid sequence or nucleotide sequence.
  • Variants can have "conservative" changes, in which the amino acid substituted has a structural or chemical property similar to the original amino acid, such as replacing isoleucine with leucine.
  • Variants can also have non-conservative changes, such as replacing glycine with tryptophan.
  • “Deletion” refers to the deletion of one or more amino acids or nucleotides in an amino acid sequence or nucleotide sequence.
  • Insertion means that a change in the amino acid sequence or nucleotide sequence results in an increase in one or more amino acids or nucleotides compared to a molecule that exists in nature.
  • Replacement refers to the replacement of one or more amino acids or nucleotides with different amino acids or nucleotides.
  • Bioactivity refers to a protein that has the structure, regulation, or biochemical function of a natural molecule.
  • immunologically active refers to the ability of natural, recombinant or synthetic proteins and fragments thereof to induce a specific immune response and to bind specific antibodies in a suitable animal or cell.
  • An "agonist” refers to a molecule that, when combined with human ATP-dependent serine proteolytic enzymes 1.1, can cause the protein to change and thereby regulate the activity of the protein.
  • An agonist may include a protein, a nucleic acid, a carbohydrate, or any other molecule that binds human ATP-dependent serine proteolytic enzymes 1.1.
  • Antagonist refers to a biological activity that blocks or regulates human ATP-dependent serine proteolytic enzyme 11.4 when bound to human ATP-dependent serine proteolytic enzyme 11.4 or Immunologically active molecules.
  • Antagonists and inhibitors can include proteins, nucleic acids, carbohydrates, or any other molecule that can bind human ATP-dependent serine proteolytic enzymes 1.1.
  • Regular refers to a change in the function of human ATP-dependent serine protease 11.4, including an increase or decrease in protein activity, a change in binding properties, and any other human ATP-dependent serine protease 11.4 Changes in biological, functional, or immune properties.
  • substantially pure means substantially free of other proteins, lipids, sugars or other substances with which it is naturally associated.
  • Those skilled in the art can purify human ATP-dependent serine eggs using standard protein purification techniques.
  • Shuihuhu enzyme 11.4. 3 ⁇ 4 Originally pure human ATP-dependent serine proteolytic enzyme 11.4 can produce a single main band on a non-reducing polyacrylamide gel. The purity of human ATP-dependent serine protease 11.4 polypeptide can be analyzed by amino acid sequence.
  • Complementary refers to the natural binding of polynucleotides by base-pairing under conditions of acceptable salt concentration and temperature.
  • sequence C-T-G-A
  • complementary sequence G-A-C-T.
  • the complementarity between two single-stranded molecules may be partial or complete.
  • the degree of complementarity between nucleic acid strands has a significant effect on the efficiency and strength of hybridization between nucleic acid strands.
  • “Homology” refers to the degree of complementarity and can be partially homologous or completely homologous.
  • Partial homology refers to a partially complementary sequence that at least partially inhibits hybridization of a fully complementary sequence to a target nucleic acid. This inhibition of hybridization can be detected by performing hybridization (Southern imprinting or Nor thern blotting, etc.) under conditions of reduced stringency.
  • Substantially homologous sequences or hybridization probes can compete and inhibit the binding of fully homologous sequences to the target sequence under conditions of reduced stringency. This does not mean that the conditions of reduced stringency allow non-specific binding, because the conditions of reduced stringency require that the two sequences bind to each other as a specific or selective interaction.
  • Percent identity refers to the percentage of sequences that are the same or similar in a comparison of two or more amino acid or nucleic acid sequences. The percent identity can be determined electronically, such as through the MEGALIGN program (Lasergene sof tware package, DNASTAR, Inc., Mad Son Wis.). The MEGALIGN program can compare two or more sequences (Higgins, DG and PM Sharp (1988) Gene 73: 237-244) according to different methods such as Cluster method. The distance between them arranges each group of sequences into clusters. Then the clusters are allocated in pairs or groups. The percent identity between two amino acid sequences such as sequence A and sequence B is calculated by the following formula:
  • the percent identity between nucleic acid sequences can also be determined by the Cluster method or by methods known in the art such as Jotun He in (He in J., (1990) Me thods in enzyraol ogy 183: 625-645). 0
  • Similarity refers to the degree of identical or conservative substitutions of amino acid residues at corresponding positions in the alignment of amino acid sequences.
  • Amino acids used for conservative substitution for example, negatively charged amino acids may include aspartic acid and glutamic acid; positively charged amino acids may include lysine and arginine; having an uncharged head group is Similar hydrophilic amino acids may include leucine, isoleucine and valine; glycine and alanine; asparagine and glutamine; serine and threonine; phenylalanine and tyrosine.
  • Antisense refers to a nucleotide sequence that is complementary to a particular DM or RNA sequence.
  • Antisense strand refers to a nucleic acid strand that is complementary to a “sense strand.”
  • Derivative refers to HFP or a chemical modification of its nucleic acid. This chemical modification may be the replacement of a hydrogen atom with an alkyl, acyl or amino group. Nucleic acid derivatives can encode polypeptides that retain the main biological properties of natural molecules.
  • Antibody refers to a complete antibody molecule and its fragments, such as Fa,? ( ⁇ ') 2 and? It can specifically bind to the human ATP-dependent serine protease 11.4 epitope.
  • a “humanized antibody” refers to an antibody in which the amino acid sequence of a non-antigen binding region is replaced to become more similar to a human antibody, but still retains the original binding activity.
  • isolated refers to the removal of a substance from its original environment (for example, its natural environment if it is naturally occurring).
  • a naturally-occurring polynucleotide or polypeptide is not isolated when it is present in a living thing, but the same polynucleotide or polypeptide is separated from some or all of the substances that coexist with it in the natural system.
  • Such a polynucleotide may be part of a certain vector, or such a polynucleotide or polypeptide may be part of a certain composition. Since the carrier or composition is not part of its natural environment, they are still isolated.
  • isolated refers to the separation of a substance from its original environment (if it is a natural substance, the original environment is the natural environment).
  • polynucleotides and polypeptides in the natural state of living cells are not isolated and purified, but the same polynucleotides or polypeptides are separated and purified if they are separated from other substances existing in the natural state> .
  • isolated human ATP-dependent serine proteolytic enzyme 11.4" refers to human ATP-dependent serine proteolytic enzyme 11.4 that is substantially free of other proteins, lipids, carbohydrates, or others that are naturally associated with it. substance. Those skilled in the art can purify human ATP-dependent serine proteolytic enzymes 11.4 using standard protein purification techniques. Substantially pure peptides can produce a single main band on a non-reducing polyacrylamide gel. Human ATP-dependent serine proteolytic enzyme 11.4 The purity of the peptide can be analyzed by amino acid sequence.
  • the present invention provides a new polypeptide, human ATP-dependent serine proteolytic enzyme 11.4, which basically consists of the amino acid sequence shown in SEQ ID NO: 2.
  • the polypeptide of the present invention may be a recombinant polypeptide, a natural polypeptide, or a synthetic polypeptide, and preferably a recombinant polypeptide.
  • the polypeptides of the present invention can be naturally purified products or chemically synthesized products, or can be produced from prokaryotic or eukaryotic hosts (eg, bacteria, yeast, higher plants, insects, and mammalian cells) using recombinant techniques.
  • polypeptide of the invention may be glycosylated, or it may be non-glycosylated.
  • the polypeptides of the invention may also include or exclude the initial methionine residue.
  • the invention also includes fragments, derivatives, and analogs of human ATP-dependent serine proteolytic enzyme 11.4.
  • fragment refers to a polypeptide that substantially maintains the same biological function or activity of the human ATP-dependent serine proteolytic enzyme 11.4 of the present invention.
  • a fragment, derivative or analog of the polypeptide of the present invention may be: (I) a kind in which one or more amino acid residues are substituted with conservative or non-conservative amino acid residues (preferably conservative amino acid residues), and the substitution
  • the amino acid may or may not be encoded by the genetic code; or (II) such a type in which a group on one or more amino acid residues is substituted by other groups to include a substituent; or (III) such One in which the mature polypeptide is combined with another compound (such as Aging compounds, such as polyethylene glycol), or (IV) a polypeptide sequence (such as a leader sequence or secretory sequence or a sequence used to purify the polypeptide) in which an additional amino acid sequence is fused into a mature polypeptide Or proteinogen sequence).
  • a polypeptide sequence such as a leader sequence or secretory sequence or a sequence used to purify the polypeptide in which an additional amino acid sequence is fused into a mature polypeptide Or proteinogen sequence.
  • the present invention provides an isolated nucleic acid (polynucleotide), which basically consists of a polynucleotide encoding a polypeptide having the amino acid sequence of SEQ ID NO: 2.
  • the polynucleotide sequence of the present invention includes the nucleotide sequence of SEQ ID NO: 1.
  • the polynucleotide of the present invention is found from a cDNA library of human fetal brain tissue. It contains a full-length polynucleotide sequence of 2770 bases, and its open reading frame 1 018-1 329 encodes 103 amino acids.
  • this polypeptide has a similar expression profile with ATP-dependent serine protease, and it can be inferred that the human ATP-dependent serine protease 11.4 has similar functions as ATP-dependent serine protease .
  • the polynucleotide of the present invention may be in the form of DNA or RNA.
  • DNA forms include cDNA, genomic DNA, or synthetic DNA.
  • DNA can be single-stranded or double-stranded.
  • DNA can be coding or non-coding.
  • the coding region sequence encoding the mature polypeptide may be the same as the coding region sequence shown in SEQ ID NO: 1 or a degenerate variant.
  • a "degenerate variant" refers to a nucleic acid sequence encoding a protein or polypeptide having SEQ ID NO: 2 but different from the coding region sequence shown in SEQ ID NO: 1 in the present invention.
  • the polynucleotide encoding the mature polypeptide of SEQ ID NO: 2 includes: only the coding sequence of the mature polypeptide; the coding sequence of the mature polypeptide and various additional coding sequences; the coding sequence of the mature polypeptide (and optional additional coding sequences); Coding sequence.
  • polynucleotide encoding a polypeptide refers to a polynucleotide comprising the polypeptide and a polynucleotide comprising additional coding and / or non-coding sequences.
  • the invention also relates to variants of the polynucleotides described above, which encode polypeptides or fragments, analogs and derivatives of polypeptides having the same amino acid sequence as the invention.
  • Variants of this polynucleotide can be naturally occurring allelic variants or non-naturally occurring variants. These nucleotide variants include substitution variants, deletion variants, and insertion variants.
  • an allelic variant is an alternative form of a polynucleotide that may be a substitution, deletion, or insertion of one or more nucleotides, but does not substantially change the function of the polypeptide it encodes .
  • the invention also relates to a polynucleotide that hybridizes to the sequence described above (having at least 50%, preferably 70% identity between the two sequences).
  • the invention particularly relates to polynucleotides that can hybridize to the polynucleotides of the invention under stringent conditions.
  • “strict conditions” means: (1) hybridization and elution at lower ionic strength and higher temperature, such as 0.2xSSC, 0.1% SDS, 6 (TC; or (2) Add a denaturant during hybridization, such as 50% (v / v) formamide, 0.1% calf serum / 0.1% F i co ll, 42 ° C, etc .; or (3) only between the two sequences
  • the hybridization occurs only when the identity between the nucleotides is at least 95%, and more preferably 97%.
  • the polypeptide encoded by the hybridizable polynucleotide has a mature polypeptide as shown in SEQ ID NO: 2 Same biological function and activity.
  • nucleic acid fragments that hybridize to the sequences described above.
  • a "nucleic acid fragment” contains at least 10 nucleotides in length, preferably at least 20-30 nucleotides, more preferably at least 50-60 nucleotides, and most preferably at least 100 cores. Glycylic acid or more. Nucleic acid fragments can also be used in nucleic acid amplification techniques such as PCR to identify and / or isolate polynucleotides encoding human ATP-dependent serine proteolytic enzymes 11.4.
  • polypeptides and polynucleotides in the present invention are preferably provided in an isolated form and are more preferably purified to homogeneity.
  • the specific polynucleotide sequence encoding the human ATP-dependent serine proteolytic enzyme 11.4 of the present invention can be obtained by various methods.
  • polynucleotides are isolated using hybridization techniques well known in the art. These techniques include, but are not limited to: 1) hybridization of probes to genomic or cDNA libraries to detect homologous polynucleotide sequences, and 2) antibody screening of expression libraries to detect cloned polynucleosides with common structural characteristics Acid fragments.
  • the DM fragment sequence of the present invention can also be obtained by the following methods: 1) isolating the double-stranded DNA sequence from the genomic DNA; 2) chemically synthesizing the DNA sequence to obtain the double-stranded DNA of the polypeptide.
  • genomic DNA isolation is the least commonly used. Direct chemical synthesis of DNA sequences is often the method of choice. The more commonly used method is the isolation of cDNA sequences.
  • the standard method for isolating the cDNA of interest is to isolate mRNA from donor cells that overexpress the gene and perform reverse transcription to form a plasmid or phage cDNA library.
  • mRNA extraction There are many mature techniques for mRNA extraction, and kits are also commercially available (Qiagene).
  • the construction of cDNA libraries is also a common method (Sambrook, et al., Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory. New York, 1989).
  • Commercially available cDNA libraries are also available, such as different cDNA libraries from Clontech. When polymerase reaction technology is used in combination, even very small expression products can be cloned.
  • genes of the present invention can be selected from these cDNA libraries by conventional methods. These methods include (but are not limited to): (l) DNA-DNA or DM-RNA hybridization; (2) the presence or absence of marker gene functions; (3) determination of the level of transcripts of human ATP-dependent serine protease 11.4 (4) Detecting protein products expressed by genes through immunological techniques or measuring biological activity. The above methods can be used singly or in combination.
  • the probe used for hybridization is homologous to any part of the polynucleotide of the present invention, and has a length of at least 10 nucleotides, preferably at least 30 nucleotides, more preferably At least 50 nucleotides, preferably at least 100 nucleotides.
  • the length of the probe is usually within 2000 nucleotides, preferably within 1000 nucleotides.
  • the probe used here is usually a DNA sequence chemically synthesized based on the gene sequence information of the present invention.
  • the genes or fragments of the present invention can of course be used as probes.
  • DNA probes can be labeled with radioisotopes, luciferin, or enzymes (such as alkaline phosphatase).
  • the protein product of human ATP-dependent serine protease 11.4 gene expression can be detected by immunological techniques such as Western blotting, radioimmunoprecipitation, and enzyme-linked immunosorbent assay. Method (ELISA) and so on.
  • immunological techniques such as Western blotting, radioimmunoprecipitation, and enzyme-linked immunosorbent assay. Method (ELISA) and so on.
  • a method using PCR technology to amplify DNA / RNA is preferably used to obtain the gene of the present invention.
  • the RACE method RACE-rapid amplification of cDNA ends
  • the primers used for PCR can be appropriately based on the polynucleotide sequence information of the present invention disclosed herein. Select and synthesize using conventional methods.
  • the amplified DM / RNA fragment can be isolated and purified by conventional methods such as by gel electrophoresis.
  • polynucleotide sequence of the gene of the present invention or various DNA fragments and the like obtained as described above can be measured by a conventional method such as dideoxy chain termination method (Sanger et al. PNAS, 1977, 74: 5463-5467). Such polynucleotide sequences can also be determined using commercial sequencing kits and the like. In order to obtain the full-length cDNA sequence, sequencing needs to be repeated. Sometimes it is necessary to determine the cDNA sequence of multiple clones in order to splice into a full-length cDNA sequence.
  • the present invention also relates to a vector comprising the polynucleotide of the present invention, and a host cell that is genetically engineered using the vector of the present invention or directly using a human ATP-dependent serine proteolytic enzyme 11.4 coding sequence, and the recombinant technology to produce the described Polypeptide method.
  • a polynucleotide sequence encoding a human ATP-dependent serine proteolytic enzyme 11.4 can be inserted into a vector to constitute a recombinant vector containing the polynucleotide of the present invention.
  • vector refers to bacterial plasmids, phages, yeast plasmids, plant cell viruses, mammalian cell viruses such as adenoviruses, retroviruses, or other vectors well known in the art.
  • Vectors suitable for use in the present invention include, but are not limited to: T7 promoter-based expression vectors (Rosenberg, et al.
  • any plasmid and vector can be used to construct recombinant expression vectors.
  • An important feature of expression vectors is that they usually contain an origin of replication, a promoter, a marker gene, and translational regulatory elements.
  • Methods known to those skilled in the art can be used to construct expression vectors containing a DNA sequence encoding human ATP-dependent serine proteolytic enzyme 11.4 and appropriate transcription / translation regulatory elements. These methods include in vitro recombinant DNA technology, DM synthesis technology, and in vivo recombination technology (Sambroook, et al. Molecular Cloning, a Laboratory Manual, Cold Spring Harbor Laboratory. New York, 1989).
  • the DNA sequence can be operably linked to an appropriate promoter in an expression vector to guide mRNA synthesis. Representative examples of these promoters are: the lac or trp promoter of E.
  • the expression vector also includes a ribosome binding site and a transcription terminator for translation initiation. Insertion of enhancer sequences into the vector will enhance its transcription in higher eukaryotic cells. Enhancers are cis-acting factors expressed by DM. Often about 10 to 300 base pairs, which act on a promoter to enhance gene transcription. Illustrative examples include SV40 enhancers of 100 to 270 base pairs on the late side of the origin of replication, polyoma enhancers on the late side of the origin of replication, and adenoviral enhancers.
  • the expression vector preferably contains one or more selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
  • selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
  • GFP fluorescent protein
  • tetracycline or ampicillin resistance for E. coli.
  • a polynucleotide encoding human ATP-dependent serine proteolytic enzyme 11.4 or a recombinant vector containing the polynucleotide can be transformed or transduced into a host cell to form a genetically engineered host containing the polynucleotide or the recombinant vector.
  • the term "host cell” refers to a prokaryotic cell, such as a bacterial cell; or a lower eukaryotic cell, such as a yeast cell; or a higher eukaryotic cell, such as a mammalian cell.
  • Escherichia coli, Streptomyces bacterial cells such as Salmonella typhimurium
  • fungal cells such as yeast
  • plant cells insect cells
  • fly S2 or Sf9 animal cells
  • animal cells such as CH0, COS or Bowes melanoma cells.
  • Transformation of a host cell with a DNA sequence according to the present invention or a recombinant vector containing the DM sequence can be performed using conventional techniques well known to those skilled in the art.
  • the host is a prokaryote such as E. coli
  • competent cells capable of DNA uptake can be in the exponential growth phase were harvested, treated with (1 2 method used in the step are well known in the art. Alternatively, it is a MgCl 2. If If necessary, transformation can also be performed by electroporation.
  • the host is a eukaryotic organism, the following DNA transfection methods can be used: calcium phosphate co-precipitation method, or conventional mechanical methods such as microinjection, electroporation, and liposome packaging Wait.
  • the polynucleotide sequence of the present invention can be used to express or produce recombinant human ATP-dependent serine protease 11.4 (Science, 1984; 224: 1431). Generally speaking, there are the following steps:
  • polynucleotide (or variant) of the invention encoding human human ATP-dependent serine proteolytic enzyme 11.4, or transforming or transducing a suitable host cell with a recombinant expression vector containing the polynucleotide;
  • the medium used in the culture may be selected from various conventional mediums. Culture is performed under conditions suitable for host cell growth. After the host cells have grown to an appropriate cell density, the selected promoter is induced by a suitable method (such as temperature conversion or chemical induction), and the cells are cultured for a period of time.
  • a suitable method such as temperature conversion or chemical induction
  • the recombinant polypeptide may be coated in a cell, expressed on a cell membrane, or secreted outside the cell.
  • Physical, chemical, and other properties can be used for various separation methods if required Isolation and purification of recombinant proteins. These methods are well known to those skilled in the art. These methods include, but are not limited to: conventional renaturation treatment, protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid chromatography (HPLC) and various other liquid chromatography techniques and combinations of these methods.
  • the polypeptide of the present invention and the antagonists, agonists and inhibitors of the polypeptide can be directly used in the treatment of diseases, for example, it can treat mitochondrial disease, metabolic disorders related to energy and substance metabolism, disorders of growth and development, and congenital malformations. Some tumors, some hereditary, hematological diseases and immune system diseases.
  • Lon-type proteolytic enzyme family catalyze the ATP-dependent degradation of mitochondrial matrix proteins.
  • the Lon protein family is closely related to the respiration process of living organisms. It can maintain the integrity of mitochondrial DM, but it is not a component of the cytochrome complex. Its abnormal expression can cause abnormal mitochondrial DNA structure and affect the function of the respiratory chain, leading to abnormal metabolism of matter and energy.
  • the abnormal expression of the human ATP-dependent serine proteolytic enzyme of the present invention will produce various diseases, especially mitochondrial diseases, metabolic disorders related to energy and material metabolism, and disorders of growth and development. These diseases include, but are not Limited to:
  • Organic acidemia isovaleric acidemia, propionic acidemia, methylmalonic aciduria, combined carboxylase deficiency, glutaric acid type I, etc.
  • Amino acid metabolism defects phenylketonuria, tyrosine metabolism defects such as albinism, sulfur amino acid metabolism defects, tryptophan metabolism defects such as tryptophanemia, branch amino acid metabolism defects, glycine metabolism defects such as Glycineemia, hypersarcosineemia, proline and hydroxyproline metabolism defects, glutamate metabolism defects, urea cycle metabolism defects, histidine metabolism defects, lysine metabolism defects , And other amino acid metabolism defects.
  • Mucopolysaccharidosis and other marginal diseases Mucopolysaccharidosis I to ⁇ , marginal diseases of mucopolysaccharidosis such as rheumatoid mucopolysaccharidosis and mucolipid storage disease.
  • Purine and Pyrimidine Metabolism Defects Abnormal purine metabolism, such as Ray-niney syndrome, xanthineuria, abnormal pyrimidine metabolism, such as orotic aciduria, and adenosine deaminase deficiency.
  • Abnormal lipid metabolism hyperlipoproteinemia, familial hyperalpha-lipoproteinemia, familial non-beta-lipoproteinemia, familial hypo-beta-lipoproteinemia, familial lecithin-cholesterol acetyltransferase Deficiency.
  • Glucose metabolism defects Congenital sugar digestion and absorption defects such as congenital lactose intolerance, hereditary fructose intolerance, monosaccharide metabolism defects such as galactosemia, fructose metabolism defects, glycogen metabolism diseases such as glycogen storage Backlog.
  • Growth and development disorders mental retardation, cerebral palsy, brain development disorders, familial cerebral nucleus dysplasia, skin, fat and muscular dysplasia such as congenital skin relaxation, premature senility, congenital horn Malformation, various metabolic defects such as various amino acid metabolic defects, stunting, dwarfism, sexual retardation, etc.
  • Congenital malformations spina bifida, craniocerebral fissure, anencephaly deformity, cerebral bulge, foramen malforma, Down syndrome, congenital hydrocephalus, aqueduct malformation, dwarfism of cartilage hypoplasia, spinal epiphyseal dysplasia, Pseudochondral dysplasia, Langer-Giedion syndrome, funnel chest, gonad hypoplasia, congenital adrenal hyperplasia, upper urethra, cryptorchidism, short stature syndrome such as Conrad i syndrome and Danbo l tC los s Syndrome, congenital glaucoma or cataract, congenital lens abnormality, congenital blepharoplasia, retinal dysplasia, congenital optic nerve atrophy, congenital sensorineural hearing loss, cracked hands and feet, teratosis, Wi lli ams Syndrome, Al ag ille Syndrome, Bezier Syndrome, etc.
  • Abnormal expression of the human ATP-dependent serine proteolytic enzyme of the present invention will also generate certain tumors, certain hereditary, hematological diseases, and immune system diseases.
  • the polypeptide of the present invention and the antagonists, agonists and inhibitors of the polypeptide can be directly used in the treatment of diseases, for example, it can treat various diseases, especially mitochondrial disease, metabolic disorders related to energy and material metabolism, and growth and development disorders. Diseases, congenital malformations, certain tumors, certain hereditary, hematological and immune system diseases, etc.
  • the invention also provides methods for screening compounds to identify agents that increase (agonist) or suppress (antagonist) human ATP-dependent serine proteolytic enzymes 11.4.
  • Agonists enhance human ATP-dependent serine proteolytic enzymes 11.4 Stimulate biological functions such as cell proliferation, while antagonists prevent and treat disorders related to cell proliferation, such as various cancers.
  • a mammalian cell or a membrane preparation expressing human ATP-dependent serine proteolytic enzyme 11.4 can be cultured with labeled human ATP-dependent serine proteolytic enzyme 11.4 in the presence of a drug. The ability of the drug to increase or block this interaction is then determined.
  • Antagonists of human ATP-dependent serine protease 11.4 include screened antibodies, compounds, receptor deletions, and the like. Antagonist of human ATP-dependent serine protease 11.4 can bind to human ATP-dependent serine protease 11.4 and eliminate its function, or inhibit the production of the polypeptide, or with the active site of the polypeptide Binding prevents the polypeptide from functioning biologically.
  • human ATP-dependent serine proteolytic enzymes 11.4 can be added to the bioanalytical assay, and by measuring the compounds against human ATP-dependent serine proteolytic enzymes 11.4 and their receptors, Effect to determine whether a compound is an antagonist. In the same manner as described above for the screening of compounds, it is possible to screen for receptor deletions and analogs that act as antagonists.
  • Peptide molecules capable of binding to human ATP-dependent serine proteolytic enzymes 11.4 can be obtained by screening a random peptide library composed of various possible combinations of amino acids bound to a solid phase. When screening, human ATP-dependent serine proteolytic enzyme molecules should generally be labeled.
  • the present invention provides a method for producing an antibody using a polypeptide, a fragment, a derivative, an analog thereof, or a cell thereof as an antigen.
  • These antibodies can be polyclonal or monoclonal antibodies.
  • the invention also provides antibodies against human ATP-dependent serine proteolytic enzyme 11.4 epitopes. These antibodies include (but are not limited to): polyclonal antibodies, monoclonal antibodies, chimeric antibodies, single chain antibodies, Fab fragments and Fab expression library generated fragments.
  • Polyclonal antibodies can be produced by injecting human ATP-dependent serine proteolytic enzymes 11.4 directly into immunized animals (such as rabbits, mice, rats, etc.).
  • immunized animals such as rabbits, mice, rats, etc.
  • a variety of adjuvants can be used to enhance the immune response, including but not limited to 'S adjuvant and so on.
  • Techniques for preparing monoclonal antibodies to human ATP-dependent serine proteolytic enzyme 11.4 include, but are not limited to, hybridoma technology (Kohler and Milstein. Nature, 1975, 256: 495-497), triple tumor technology, human beta-cell hybridoma technology , EBV-hybridoma technology, etc.
  • Chimeric antibodies that bind human constant regions to non-human variable regions can be produced using existing techniques (Morrison et al, PNAS, 1985, 81: 6851).
  • the existing technology for producing single-chain antibodies U.S. Pat No. 4946778, can also be used to produce single-chain antibodies against human ATP-dependent serine protease 11.4.
  • Antibodies against human ATP-dependent serine protease 11.4 can be used in immunohistochemistry to detect human ATP-dependent serine protease 11.4 in biopsy specimens.
  • Monoclonal antibodies that bind to human ATP-dependent serine proteolytic enzyme 11.4 can also be labeled with radioisotopes and injected into the body to track their location and distribution. This radiolabeled antibody can be used as a non-invasive diagnostic method to locate tumor cells and determine whether there is metastasis.
  • Antibodies can also be used to design immunotoxins that target a particular part of the body.
  • human ATP-dependent serine proteolytic enzymes 11.4 High-affinity monoclonal antibodies can covalently bind to bacterial or plant toxins (such as diphtheria toxin, ricin, ormosine, etc.).
  • a common method is to attack the amino group of an antibody with a thiol crosslinker such as SPDP and bind the toxin to the antibody through the exchange of disulfide bonds.
  • This hybrid antibody can be used to kill human ATP-dependent serine protease 11.4 Positive cells.
  • the antibodies of the present invention can be used to treat or prevent diseases related to human ATP-dependent serine proteolytic enzyme 11.4. Administration of appropriate doses of antibodies can stimulate or block the production or activity of human ATP-dependent serine protein hydrolase 11.4.
  • the invention also relates to a diagnostic test method for quantitative and localized detection of human ATP-dependent serine proteolytic enzyme 11.4 levels.
  • tests are well known in the art and include FISH assays and radioimmunoassays.
  • the level of human ATP-dependent serine protease 11.4 detected in the test can be used to explain the importance of human ATP-dependent serine protease 11.4 in various diseases and to diagnose human ATP-dependent serine protease 11 . Diseases at work.
  • polypeptide of the present invention can also be used for peptide mapping analysis.
  • the polypeptide can be specifically cleaved by physical, chemical or enzymatic analysis, and subjected to one-dimensional or two-dimensional or three-dimensional gel electrophoresis analysis, and more preferably mass spectrometry analysis.
  • the polynucleotide encoding human ATP-dependent serine proteolytic enzyme 11.4 can also be used for a variety of therapeutic purposes.
  • Gene therapy technology can be used to treat abnormal cell proliferation, development, or metabolism caused by the non-expression or abnormal / inactive expression of human ATP-dependent serine protease 11.4.
  • Recombinant gene therapy vectors (such as viral vectors) can be designed to express mutated human ATP-dependent serine protease 11.4 to inhibit endogenous human ATP-dependent serine protease 11.4 activity.
  • one This variant human ATP-dependent serine protease 11.4 can be a shortened human ATP-dependent serine protease 11.4 that lacks a signaling functional domain.
  • recombinant gene therapy vectors can be used to treat diseases caused by abnormal expression or activity of human ATP-dependent serine protease 11.4.
  • Virus-derived expression vectors such as retrovirus, adenovirus, adenovirus-associated virus, herpes simplex virus, parvovirus, etc. can be used to transfer a polynucleotide encoding human ATP-dependent serine proteolytic enzyme ⁇ .4 into a cell.
  • a method for constructing a recombinant viral vector carrying a polynucleotide encoding a human ATP-dependent serine protease III.4 can be found in the existing literature (Sambrook, et al.).
  • a recombinant polynucleotide encoding human ATP-dependent serine protease 11.4 can be packaged into liposomes and transferred into cells.
  • Methods for introducing a polynucleotide into a tissue or cell include: directly injecting the polynucleotide into a tissue in vivo; or introducing the polynucleotide into a cell in vitro through a vector (such as a virus, phage, or plasmid), and then transplanting the cell Into the body and so on.
  • a vector such as a virus, phage, or plasmid
  • Oligonucleotides including antisense RNA and DNA
  • ribozymes that inhibit human ATP-dependent serine protease 11.4 mRNA are also within the scope of the present invention.
  • a ribozyme is an enzyme-like RNA molecule that can specifically decompose specific RNA. Its mechanism of action is that the ribozyme molecule specifically hybridizes with a complementary target RNA and performs endonucleation.
  • Antisense RNA, DNA, and ribozymes can be obtained using any existing RNA or DNA synthesis technology, such as solid-phase phosphate amide chemical synthesis to synthesize oligonucleotides.
  • Antisense RNA molecules can be obtained by in vitro or in vivo transcription of a DNA sequence encoding the RNA. This DNA sequence has been integrated downstream of the vector's RNA polymerase promoter. In order to increase the stability of the nucleic acid molecule, it can be modified in a variety of ways, such as increasing the sequence length on both sides, and the phosphorothioate or peptide bond instead of the phosphodiester bond is used for the ribonucleoside linkage.
  • the polynucleotide encoding human ATP-dependent serine protease 11.4 can be used for the diagnosis of diseases related to human ATP-dependent serine protease 11.4.
  • a polynucleotide encoding human ATP-dependent serine proteolytic enzyme 11.4 can be used to detect the expression of human ATP-dependent serine proteolytic enzyme 11.4 or the abnormal expression of human ATP-dependent serine proteolytic enzyme 11.4 in disease states.
  • a DNA sequence encoding human ATP-dependent serine protease 11.4 can be used to hybridize biopsy specimens to determine the expression of human ATP-dependent serine protease 11.4.
  • Hybridization techniques include Southern blotting, Northern blotting, and in situ hybridization.
  • polynucleotides of the present invention can be used as probes to be fixed on a microarray or a DNA chip (also referred to as a "gene chip") for analyzing differential expression analysis and gene diagnosis of genes in tissues.
  • Human ATP-dependent serine proteolytic enzyme 11.4 specific primers for RNA-polymerase chain reaction (RT-PCR) in vitro amplification can also detect human ATP-dependent serine proteolytic enzyme 11.4 transcripts.
  • Detection of mutations in the human ATP-dependent serine protease 11.4 gene can also be used to diagnose human ATP-dependent serine protease 11.4 related diseases.
  • Human ATP-dependent serine protease 11.4 Mutations include point mutations, translocations, deletions, recombinations, and any other abnormalities compared to normal wild-type human ATP-dependent serine protease 11.4 DNA sequences. Mutations can be detected using existing techniques such as Sou thern blotting, DNA sequence analysis, PCR and in situ hybridization. In addition, mutations may affect protein expression. Therefore, Nor thern blotting and Western blotting can be used to indirectly determine whether a gene is mutated.
  • sequences of the invention are also valuable for chromosome identification. This sequence will specifically target a specific position on a human chromosome and can hybridize to it. Currently, specific sites for each gene on the chromosome need to be identified. Currently, only a few chromosome markers based on actual sequence data (repeating polymorphisms) are available for marking chromosome positions. According to the present invention, in order to associate these sequences with disease-related genes, an important first step is to locate these DNA sequences on a chromosome.
  • PCR primers (preferably 15-35bp) are prepared based on cDNA, and the sequences can be located on chromosomes. These primers were then used for PCR screening of somatic hybrid cells containing individual human chromosomes. Only those heterozygous cells containing the human gene corresponding to the primer will produce amplified fragments.
  • PCR localization of somatic hybrid cells is a quick way to localize DNA to specific chromosomes.
  • oligonucleotide primers of the present invention in a similar manner, a set of fragments from a specific chromosome or a large number of genomic clones can be used to achieve sublocalization.
  • Other similar strategies that can be used for chromosomal localization include in situ hybridization, chromosome pre-screening with labeled flow sorting, and pre-selection of hybridization to construct chromosome-specific cDNA libraries.
  • Fluorescent in situ hybridization of cDNA clones with metaphase chromosomes allows precise chromosomal localization in one step.
  • FISH Fluorescent in situ hybridization
  • the difference in cDNA or genomic sequence between the affected and unaffected individuals needs to be determined. If a mutation is observed in some or all diseased individuals and the mutation is not observed in any normal individuals, the mutation may be the cause of the disease. Comparing affected and unaffected individuals usually involves first looking for structural changes in chromosomes, such as deletions or translocations that are visible at the chromosomal level or detectable with cDNA sequence-based PCR. According to the resolution capabilities of current physical mapping and gene mapping technology, the cDNA accurately mapped to the chromosomal region associated with the disease can be one of 50 to 500 potentially pathogenic genes (assuming 1 megabase mapping resolution) Capacity and each 20kb corresponds to a gene).
  • the polypeptides, polynucleotides and mimetics, agonists, antagonists and inhibitors of the present invention can be used in combination with a suitable pharmaceutical carrier.
  • suitable pharmaceutical carrier can be water, glucose, ethanol, salts, buffers Liquid, glycerin and their combinations.
  • the composition comprises a safe and effective amount of the polypeptide or antagonist, and carriers and excipients that do not affect the effect of the drug. These compositions can be used as drugs for the treatment of diseases.
  • the invention also provides a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the invention.
  • a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the invention.
  • these containers there may be instructional instructions given by government agencies that manufacture, use, or sell pharmaceuticals or biological products, which prompts permission for administration on the human body by government agencies that produce, use, or sell.
  • the polypeptides of the invention can be used in combination with other therapeutic compounds.
  • the pharmaceutical composition can be administered in a convenient manner, such as by a topical, intravenous, intraperitoneal, intramuscular, subcutaneous, intranasal or intradermal route of administration.
  • Human ATP-dependent serine proteolytic enzymes 11.4 are administered in amounts effective to treat and / or prevent specific indications.
  • the amount and range of human ATP-dependent serine proteolytic enzymes 11.4 administered to a patient will depend on many factors, such as the mode of administration, the health conditions of the person to be treated, and the judgment of the diagnostician. Examples
  • Total human fetal brain RNA was extracted by one-step method with guanidine isothiocyanate / phenol / chloroform.
  • Poly (A) mRNA was isolated from total RNA using Quik mRNA I solat ion Ki t (product of Qiegene). 2ug poly (A) mRM forms cDNA by reverse transcription. Use Smart cDM Cloning Kit (purchased from Clontech). The 0 fragment was inserted into the multiple cloning site of the pBSK (+) vector (Clontech), and transformed into DH5 ⁇ . The bacteria formed a CDM library.
  • the sequences at the 5 'and 3' ends of all clones were determined using Dye termina te cyc le react ion sequencing kit (Perkin-Elmer) and ABI 377 automatic sequencer (Perkin-Elmer).
  • the determined cDNA sequence was compared with the existing public DM sequence database (Genebank), and it was found that the cDNA sequence of one of the clones 0196C10 was a new DM.
  • a series of primers were synthesized to determine the inserted cDNA fragments of the clone in both directions.
  • RNA of fetal brain cells was used as a template, and ol-igo-dT was used as a primer for reverse transcription reaction to synthesize cDM.
  • PCR amplification was performed with the following primers:
  • Primerl 5'- AGAAAAAAGAAACTAACATTAATT -3 '(SEQ ID NO: 3)
  • Priraer2 5'- CAACCACAAAACTCAACTTTCCAA -3 '(SEQ ID NO: 4)
  • Primerl is a forward sequence starting at lbp of the 5th end of SEQ ID NO: 1;
  • Primer2 is the 3 'end reverse sequence in SEQ ID NO: 1.
  • Conditions for the amplification reaction 50 mmol / L of KC1, 10 ramol / L Tris-HCl, pH 8.5, 1.5 mmol / L MgCl 2 , 20 ( ⁇ raol / L dNTP, lOpmol primer, 1U Taq in a reaction volume of 50 ⁇ 1 DNA polymerase (Clontech).
  • the reaction was performed on a PE9600 DNA thermal cycler (Perkin-Elmer) for 25 cycles under the following conditions: 94. C 30sec; 55 ° C 30 sec; 72 ° C 2min 0 at RT- During PCR, p-actin was used as a positive control and template blank was used as a negative control.
  • Amplification products were purified using a QIAGEN kit and TA cloning kits were connected to a pCR vector (Invitrogen). DNA sequence analysis results showed that PCR The DNA sequence of the product is exactly the same as 1- 2770bp shown in SEQ ID NO: 1.
  • Example 3 Northern blot analysis of human ATP-dependent serine proteolytic enzyme 11.4 gene expression The total RM was extracted in one step [Anal. Biochem 1987, 162,156-159]. This method involves acid guanidinium thiocyanate phenol-chloroform extraction. That is, the tissue is homogenized with 4M guanidine isothiocyanate-25mM sodium citrate, 0.2M sodium acetate (pH4.0), and 1 is added.
  • the DNA probe used was the PCR amplified human ATP-dependent serine protease 11.4 coding region sequence (10185 to 132 shown in Figure 1).
  • ⁇ 32P-labeled probe (about 2 x 10 6 cpm / ml) was hybridized with a nitrocellulose membrane to which RNA was transferred at 42 ° C overnight in a solution containing 50% formamide-25mM KH 2 P0 4 (pH7.4) -5 X SSC-5 X Denhardt's solution and 20 ( ⁇ g / ml salmon sperm DNA. After hybridization, the filter was washed in 1 X SSC-0.1% SDS at 55 ° C for 30 minutes. Then , Phosphor Imager was used for analysis and straightening.
  • Example 4 In vitro expression, isolation and purification of recombinant human ATP-dependent serine proteolytic enzyme 11.4 Based on the sequence of the coding region shown in SEQ ID NO: 1 and Figure 1, a pair of specific amplification primers were designed, the sequence is as follows:
  • Primer3 5'- CATGCTAGCATGATTGCTGGATCACACTGTAGT-3 '(Seq ID No:)
  • Primer4 5'- CATGGATCCTTAATGGGCAAAATACCTGAATAG-3' (Seq ID No: 6)
  • the 5 'ends of these two primers contain Nhel and BamHI restriction sites, respectively.
  • the coding sequences of the 5 'and 3' ends of the gene of interest are respectively followed by Nhel and BamHI restriction sites corresponding to the expression vector plasmid pET- Selective endonuclease site on 28b (+) (Novagen, Cat. No. 69865. 3).
  • the PCR reaction was performed using the pBS-0196C10 plasmid containing the full-length target gene as a template.
  • the PCR reaction conditions were as follows: a total volume of 50 ⁇ 1 containing 10 PBS-0196C10 plasmid, Primer-3 and Primer-4 primers were 1 Opmol, Advantage polymerase Mix (Clontech) 1 ⁇ 1, respectively. Cycle parameters: 94. C 20s, 60. C 30s, 68 ° C 2 rain, 25 cycles. Ndel and BamHI were used to double-digest the amplified product and plasmid pET-28 (+), respectively, and large fragments were recovered and ligated with T4 ligase.
  • the ligation product was transformed into coliform bacteria DH5 CC using the calcium chloride method. After being cultured overnight on LB plates containing kanamycin (final concentration 3 (Vg / ml)), positive clones were selected by colony PCR method and sequenced. The correct positive clone (PET-0196C10) was used to transform the recombinant plasmid into E. coli BL21 (DE3) plySs (product of Novagen) by calcium chloride method.
  • a peptide synthesizer (product of PE company) was used to synthesize the following human ATP-dependent serine protease 11.4 specific peptides:
  • Suitable oligonucleotide fragments selected from the polynucleotides of the present invention are used as hybridization probes in a variety of ways.
  • the probes can be used to hybridize to genomic or cDNA libraries of normal tissue or pathological tissue from different sources to It is determined whether it contains the polynucleotide sequence of the present invention and a homologous polynucleotide sequence is detected.
  • the probe can be used to detect the polynucleotide sequence of the present invention or its homologous polynucleotide sequence in normal tissue or pathology. Whether the expression in tissue cells is abnormal.
  • the purpose of this embodiment is to select a suitable oligonucleotide fragment from the polynucleotide SEQ ID NO: 1 of the present invention as a hybridization probe, and to identify whether some tissues contain the polynucleoside of the present invention by a filter hybridization method.
  • Filter hybridization methods include dot blotting, Southern imprinting, Nor thern blotting, and copying methods. They all use the same steps to fix the polynucleotide sample to be tested on the filter and then hybridize.
  • the sample-immobilized filter is first pre-hybridized with a probe-free hybridization buffer to saturate the non-specific binding site of the sample on the filter with the carrier and the synthesized polymer.
  • the pre-hybridization solution is then replaced with a hybridization buffer containing labeled probes and incubated to hybridize the probes to the target nucleic acid.
  • the unhybridized probes are removed by a series of membrane washing steps.
  • This embodiment uses higher-intensity washing conditions (such as lower salt concentration and higher temperature) to reduce the hybridization background and retain only strong specific signals.
  • the probes used in this embodiment include two types: the first type of probes are oligonucleotide fragments that are completely the same as or complementary to the polynucleotide SEQ ID NO: 1 of the present invention; the second type of probes are partially related to the present invention
  • the polynucleotide SEQ ID NO: 1 is the same or complementary oligonucleotide fragment.
  • the dot blot method is used to fix the sample on the filter membrane. Under the high-intensity washing conditions, the first type of probe and the sample have the strongest hybridization specificity and are retained.
  • oligonucleotide fragments for use as hybridization probes from the polynucleotide SEQ ID NO: 1 of the present invention should follow the following principles and several aspects to be considered:
  • the preferred range of probe size is 18-50 nucleotides
  • the GC content is 30% -70%, and the non-specific hybridization increases when it exceeds;
  • Those that meet the above conditions can be used as primary selection probes, and then further computer sequence analysis, including the primary selection probe and its source sequence region (ie, SEQ ID NO: 1) and other known genomic sequences and their complements For homology comparison of the regions, if the homology with the non-target molecular region is greater than 85% or there are more than 15 consecutive bases, the primary probe should not be used generally;
  • Probe 1 which belongs to the first type of probe, is completely homologous or complementary to the gene fragment of SEQ ID NO: 1 (41Nt):
  • Probe 2 which belongs to the second type of probe, is equivalent to the replacement mutant sequence of the gene fragment of SEQ ID NO: 1 or its complementary fragment (41Nt) :
  • PBS phosphate buffered saline
  • step 8-13 are only used when contamination must be removed, otherwise step 14 can be performed directly.
  • NC membranes nitrocellulose membranes
  • Two NC membranes are required for each probe, so that it can be used in the following experimental steps.
  • the film was washed with high-strength conditions and strength conditions, respectively.
  • Gene chip or gene micro-matrix (DM Mi croarray) is a new technology currently being developed by many national laboratories and large pharmaceutical companies. It refers to the orderly and high-density arrangement of a large number of target gene fragments on glass. , Silicon and other carriers, and then use fluorescence detection and computer software to compare and analyze the data, in order to achieve the purpose of rapid, efficient, high-throughput analysis of biological information.
  • the polynucleotide of the present invention can be used as a target DM for gene chip technology for high-throughput research of new gene functions; searching for and screening new tissue-specific genes, especially new genes related to diseases such as tumors; diagnosis of diseases such as hereditary diseases . The specific method steps have been reported in the literature.
  • a total of 4,000 polynucleotide sequences of various full-length cDNAs are used as target DMs, including the polynucleotides of the present invention. They were respectively amplified by PCR, and the concentration of the amplified product was adjusted to about 500 ng / ul after purification, and spotted on a glass medium using a Cartesian 7500 spotter (purchased from Cartesian Company, USA). The distance from the point is 280 P m. The spotted slides were hydrated and dried, cross-linked in a UV cross-linker, and dried after elution to fix the DNA on the glass slide to prepare a chip. The specific method steps have been reported in the literature. The sample post-processing steps in this embodiment are:
  • Total mRNA was extracted from human mixed tissues and specific tissues (or stimulated cell lines) in one step, and the mRNA was purified with Oligotex mRNA Midi Kit (purchased from QiaGen).
  • Photo reagent Cy3dUTP (5-Amino-propa rgy 1-2 '-deoxyuri dine 5'-tr iphate coupled to Cy3 fluorescent dye, purchased from Amersham Phamacia Biotech) was used to label the mRNA of human mixed tissue, and the fluorescent reagent Cy5dUTP (5-Amino — Propargyl- 2'— deoxyuridine 5 '-triphate coupled to Cy5 fluorescent dye, purchased from Amersham Phamacia Biotech Company, labeled the body's specific tissue (or stimulated cell line) mRNA, and purified the probe to prepare a probe.
  • Probes from the two types of tissues and chips were hybridized in a UniHyb TM Hybridization Solution (purchased from TeleChem) hybridization solution for 16 hours, washed with a wash solution (1 x SSC, 0.2% SDS) at room temperature, and then scanned with ScanArray 3000 The scanner (purchased from General Scanning Company, USA) was used for scanning. The scanned images were analyzed and processed with Imagene software (Biodiscovery, USA) to calculate the Cy3 / Cy5 ratio of each point.
  • the above specific tissues are thymus, testis, muscle, spleen, lung, skin, thyroid, liver, PMA + Ecv304 cell line, PMA-Ecv304 cell line, non-starved L02 cell line, L02 cell line stimulated by arsenic for 1 hour, L02 cell line stimulated by arsenic for 6 hours prostate, heart, lung cancer, fetal bladder, fetal small intestine, fetal large intestine, fetal thymus, fetal muscle, fetal liver, fetal kidney, fetal spleen, fetal brain, Fetal lung and fetal heart.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Organic Chemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Medicinal Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Animal Behavior & Ethology (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Zoology (AREA)
  • Genetics & Genomics (AREA)
  • Hematology (AREA)
  • Biomedical Technology (AREA)
  • Wood Science & Technology (AREA)
  • Diabetes (AREA)
  • Microbiology (AREA)
  • Biotechnology (AREA)
  • Molecular Biology (AREA)
  • Immunology (AREA)
  • Biochemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • Obesity (AREA)
  • Enzymes And Modification Thereof (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Abstract

L'invention concerne un nouveau polypeptide, une sérine hydrolase humaine ATP-dépendante 11.4, et un polynucléotide codant pour ce polypeptide ainsi qu'un procédé d'obtention de ce polypeptide par des techniques recombinantes d'ADN. L'invention concerne en outre les applications de ce polypeptide dans le traitement de maladies, notamment des maladies mitochondriales, des maladies liées aux troubles du métabolisme de l'énergie et des substances, des troubles du développement et de la croissance, des malformations congénitales, de certaines tumeurs, de certaines maladies héréditaires, de l'hémopathie et de maladies immunitaires. L'invention concerne aussi l'antagoniste agissant contre le polypeptide et son action thérapeutique ainsi que les applications de ce polynucléotide codant pour la sérine hydrolase humaine ATP-dépendante 11.4.
PCT/CN2001/000457 2000-03-28 2001-03-26 Nouveau polypeptide, serine hydrolase humaine atp-dependante 11.4, et polynucleotide codant pour ce polypeptide WO2001072988A1 (fr)

Priority Applications (1)

Application Number Priority Date Filing Date Title
AU56082/01A AU5608201A (en) 2000-03-28 2001-03-26 A new polypeptide-human atp-dependent serine protease 11.4 and the polynucleotide encoding it

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
CN00115247A CN1315568A (zh) 2000-03-28 2000-03-28 一种新的多肽——人atp依赖的丝氨酸蛋白水解酶11.4和编码这种多肽的多核苷酸
CN00115247.5 2000-03-28

Publications (1)

Publication Number Publication Date
WO2001072988A1 true WO2001072988A1 (fr) 2001-10-04

Family

ID=4584715

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/CN2001/000457 WO2001072988A1 (fr) 2000-03-28 2001-03-26 Nouveau polypeptide, serine hydrolase humaine atp-dependante 11.4, et polynucleotide codant pour ce polypeptide

Country Status (3)

Country Link
CN (1) CN1315568A (fr)
AU (1) AU5608201A (fr)
WO (1) WO2001072988A1 (fr)

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1999063073A1 (fr) * 1998-05-21 1999-12-09 The Trustees Of Columbia University In The City Of New York Pak4 un nouveau gene codant pour une serine/threonine kinase
US6013464A (en) * 1995-01-06 2000-01-11 Onyx Pharmaceuticals, Inc. Human PAK65

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6013464A (en) * 1995-01-06 2000-01-11 Onyx Pharmaceuticals, Inc. Human PAK65
WO1999063073A1 (fr) * 1998-05-21 1999-12-09 The Trustees Of Columbia University In The City Of New York Pak4 un nouveau gene codant pour une serine/threonine kinase

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
DATABASE GENBANK [online] 29 October 1999 (1999-10-29), "Homo sapiens 12q seeder BAC RP11-202H2 complete sequences", Database accession no. AC010196 *

Also Published As

Publication number Publication date
AU5608201A (en) 2001-10-08
CN1315568A (zh) 2001-10-03

Similar Documents

Publication Publication Date Title
WO2001094529A2 (fr) Nouveau polypeptide, serine hydrolase humaine atp-dependante 21, et polynucleotide codant pour ce polypeptide
WO2001094406A1 (fr) Nouveau polypeptide, dihydropyridine-acide dicarboxylique deshydrogenase 21, et polynucleotide codant ce polypeptide
WO2001072988A1 (fr) Nouveau polypeptide, serine hydrolase humaine atp-dependante 11.4, et polynucleotide codant pour ce polypeptide
WO2001087943A1 (fr) Protease a serine 13 atp-dependante, polypeptide humain, et polynucleotide le codant
WO2001072986A1 (fr) Nouveau polypeptide, serine hydrolase humaine atp-dependante 10, et polynucleotide codant pour ce polypeptide
WO2001070785A1 (fr) Nouveau polypeptide, serine proteinase humaine atp-dependante 13, et polynucleotide codant pour ce polypeptide
WO2001075085A1 (fr) Nouveau polypeptide, serine hydrolase humaine atp-dependante 11.3, et polynucleotide codant pour ce polypeptide
WO2001085923A1 (fr) Nouveau polypeptide, serine hydrolase humaine atp-dependante 9.2, et polynucleotide codant pour ce polypeptide
WO2001075125A1 (fr) Nouveau polypeptide, serine hydrolase humaine atp-dependante 31, et polynucleotide codant pour ce polypeptide
WO2001072987A1 (fr) Nouveau polypeptide, serine hydrolase atp-dependante humaine 52, et polynucleotide codant pour ce polypeptide
WO2001092541A1 (fr) Nouveau polypeptide, catalase 12, et polynucleotide codant ce polypeptide
WO2001083777A1 (fr) Nouveau polypeptide, serine hydrolase humaine atp-dependante 9.1, et polynucleotide codant pour ce polypeptide
WO2001094594A1 (fr) Nouveau polypeptide, serine hydrolase humaine atp-dependante 12.2, et polynucleotide codant ce polypeptide
WO2001073066A1 (fr) Nouveau polypeptide, serine hydrolase atp-dependante humaine 10.1, et polynucleotide codant pour ce polypeptide
WO2001096576A1 (fr) Nouveau polypeptide, serine hydrolase humaine atp-dependante 10, et polynucleotide codant ce polypeptide
WO2001090180A1 (fr) Nouveau polypeptide, serine hydrolase humaine atp-dependante 9, et polynucleotide codant ce polypeptide
WO2001079508A1 (fr) Nouveau polypeptide, proteine porteuse mitochondriale humaine 18, et polynucleotide codant pour ce polypeptide
WO2001087974A1 (fr) Nouveau polypeptide, serine hydrolase humaine atp-dependante 35, et polynucleotide codant pour ce polypeptide
WO2001075038A2 (fr) Nouveau polypeptide, serine hydrolase humaine 9 atp-dependante, et polynucleotide codant pour ce polypeptide
WO2001072991A1 (fr) Nouveau polypeptide, serine hydrolase humaine atp-dependante 9.8, et polynucleotide codant pour ce polypeptide
WO2001072992A1 (fr) Nouveau polypeptide, serine hydrolase humaine atp-dependante 16, et polynucleotide codant pour ce polypeptide
WO2001048219A1 (fr) Nouveau polypeptide, proteine de transport phosphorylee 10, et polynucleotide codant pour ce polypeptide
WO2001090171A1 (fr) Nouveau polypeptide, proteine humaine ribosomale sii 12, et polynucleotide codant ce polypeptide
WO2001088111A1 (fr) Deshydrogenase 50, polypeptide humain, et polynucleotide la codant
WO2001075027A2 (fr) Nouveau polypeptide, helicase humaine 13, et polynucleotide codant pour ce polypeptide

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CO CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
REG Reference to national code

Ref country code: DE

Ref legal event code: 8642

122 Ep: pct application non-entry in european phase
NENP Non-entry into the national phase

Ref country code: JP