WO2001075025A2 - Nouveau polypeptide, thyroglobuline humaine 9, et polynucleotide codant pour ce polypeptide - Google Patents

Nouveau polypeptide, thyroglobuline humaine 9, et polynucleotide codant pour ce polypeptide Download PDF

Info

Publication number
WO2001075025A2
WO2001075025A2 PCT/CN2001/000374 CN0100374W WO0175025A2 WO 2001075025 A2 WO2001075025 A2 WO 2001075025A2 CN 0100374 W CN0100374 W CN 0100374W WO 0175025 A2 WO0175025 A2 WO 0175025A2
Authority
WO
WIPO (PCT)
Prior art keywords
polypeptide
polynucleotide
human thyroglobulin
sequence
seq
Prior art date
Application number
PCT/CN2001/000374
Other languages
English (en)
Chinese (zh)
Other versions
WO2001075025A3 (fr
Inventor
Yumin Mao
Yi Xie
Original Assignee
Biowindow Gene Development Inc. Shanghai
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Biowindow Gene Development Inc. Shanghai filed Critical Biowindow Gene Development Inc. Shanghai
Priority to AU56054/01A priority Critical patent/AU5605401A/en
Publication of WO2001075025A2 publication Critical patent/WO2001075025A2/fr
Publication of WO2001075025A3 publication Critical patent/WO2001075025A3/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/705—Receptors; Cell surface antigens; Cell surface determinants
    • C07K14/71—Receptors; Cell surface antigens; Cell surface determinants for growth factors; for growth regulators
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P37/00—Drugs for immunological or allergic disorders

Definitions

  • the present invention belongs to the field of biotechnology. Specifically, the present invention describes a novel polypeptide, namely human thyroglobulin 9, and a polynucleotide sequence encoding the polypeptide. The invention also relates to a method and application for preparing the polynucleotide and polypeptide. Background technique
  • Thyroglobulin is a glycoprotein produced by the thyroid gland, acting as a source of the active hormones L-thyroxine and triiodothyronine, which supports the synthesis and storage of thyroid hormones. These hormones are formed from the iodinated tyrosine portion of thyroglobulin and are released into the blood by the protease interpretation of thyroglobulin.
  • Thyroglobulin (TG) contains endogenous triiodothyronine (T.3. Subunit) and tetraiodothyronine (T.4. Subunit) residues. Internal peptides linked at specific positions on the polypeptide chain.
  • TG is produced by the thyroid gland and then transported to the cystic cavity, where it matures from iodination of several tyrosine residues with some iodine tyrosine residues. Then, through endocytosis, molecules are sucked into the thyroid gland, where they undergo selective division in the lysosome, and then release thyroid hormones and complete the remaining molecular degradation (Y. Malthiery et al., Eur. J. Biochem. 165 , 491 (1987)).
  • the structure of human thyroglobulin is related to the specific fixation of iodine, a product of functional thyroid hormones. At its amino terminus, 70% of the sequences have three types of repeating units. These three types of repeating regions have homology. There are 18 repeats in total, and four tyrosine residues form formazan.
  • Receptor Site with Triiodothyronine The remaining 30% of the proteins lack repeat units, but share high homology with acetylcholinesterase from California Electron. Synthetic sites of thyroid hormones are clustered at opposite ends of the protein, while glycosylation sites are scattered on the polypeptide chain (M. Henry et al., Eur. J. I Bandunol. 1992. 22: 315).
  • Thyroglobulin can be used to treat diseases related to hypothyroidism, such as drowsiness, myxedema, and common, primary, secondary, and third-stage hypothyroidism (S. Lissitzky, Pharmacol. Ther. B 2 219 (1976)).
  • diseases related to hypothyroidism such as drowsiness, myxedema, and common, primary, secondary, and third-stage hypothyroidism (S. Lissitzky, Pharmacol. Ther. B 2 219 (1976)).
  • the immunodominant region of human thyroxine protein is located in the central part of the molecule, and the epitope of its monoclonal antibody is an effective probe for diagnosing autoimmune thyroid disease.
  • human thyroglobulin 9 protein plays an important role in regulating important functions of the body such as cell division and embryo development, and it is believed that a large number of proteins are involved in these regulatory processes, so it has been necessary to identify more involved in these processes Human thyroglobulin 9 protein, especially the amino acid sequence of this protein. Isolation of the novel human thyroglobulin 9 protein encoding gene also provides a basis for research to determine the role of this protein in health and disease states. This protein may form the basis for developing disease and / or therapeutic drugs, so isolating its coding DNA is important. Disclosure of invention
  • Another object of the invention is to provide a polynucleotide encoding the polypeptide.
  • Another object of the invention is to provide a genetically engineered host cell containing a polynucleotide encoding human thyroglobulin 9.
  • Another object of the present invention is to provide a method for producing human thyroglobulin 9.
  • Another object of the present invention is to provide an antibody against the polypeptide of the present invention-human thyroglobulin 9.
  • Another object of the present invention is to provide mimic compounds, antagonists, agonists, and inhibitors directed to the polypeptide of the present invention-human thyroglobulin 9.
  • Another object of the present invention is to provide a method for diagnosing and treating diseases associated with abnormalities of human thyroglobulin 9.
  • the present invention relates to an isolated polypeptide, which is of human origin, and includes: a polypeptide having the amino acid sequence of SEQ ID D. 2, or a conservative variant, biologically active fragment, or derivative thereof.
  • the polypeptide is a polypeptide having the amino acid sequence of SEQ ID D0: 2.
  • the invention also relates to an isolated polynucleotide comprising a nucleotide sequence or a variant thereof selected from the group consisting of: (a) a polynucleotide encoding a polypeptide having the amino acid sequence of SEQ ID No. 2;
  • sequence of the polynucleotide is one selected from the group consisting of: (a) a sequence having positions 1268-151 in SEQ ID NO: 1; and (b) having a sequence in SEQ ID NO: 1 in 1- 2263-bit sequence.
  • the present invention further relates to a vector, particularly an expression vector, containing the polynucleotide of the present invention; a host cell genetically engineered with the vector, including a transformed, transduced or transfected host cell; Host cell and method of preparing the polypeptide of the present invention by recovering the expression product.
  • the invention also relates to an antibody capable of specifically binding to a polypeptide of the invention.
  • the invention also relates to a method for screening compounds that mimic, activate, antagonize or inhibit the activity of human thyroglobulin 9 protein, which comprises utilizing the polypeptide of the invention.
  • the invention also relates to compounds obtained by this method.
  • the present invention also relates to a method for detecting a disease or susceptibility to disease associated with abnormal expression of human thyroglobulin 9 protein in vitro, which comprises detecting a mutation in the polypeptide or a coding polynucleotide sequence thereof in a biological sample, or detecting a biological sample.
  • the amount or biological activity of a polypeptide of the invention comprises detecting a mutation in the polypeptide or a coding polynucleotide sequence thereof in a biological sample, or detecting a biological sample.
  • the invention also relates to a pharmaceutical composition
  • a pharmaceutical composition comprising a polypeptide of the invention or a mimetic thereof, an activator, an antagonist or an inhibitor, and a pharmaceutically acceptable carrier.
  • the present invention also relates to the preparation of the polypeptide and / or polynucleotide of the present invention for the treatment of various thyroid diseases, malignant tumors, blood diseases, developmental disorders, HIV infection and immune diseases and various inflammations or other diseases Use of a medicine for diseases caused by abnormal expression of protein 9.
  • Nucleic acid sequence refers to an oligonucleotide, a nucleotide or a polynucleotide and a fragment or part thereof, and may also refer to a genomic or synthetic DNA or RNA, they can be single-stranded or double-stranded, representing the sense or antisense strand.
  • amino acid sequence refers to an oligopeptide, peptide, polypeptide or protein sequence and fragments or portions thereof.
  • amino acid sequence in the present invention relates to the amino acid sequence of a naturally occurring protein molecule, such "polypeptide” or “protein” does not mean to limit the amino acid sequence to a complete natural amino acid related to the protein molecule .
  • a protein or polynucleotide “variant” refers to an amino acid sequence having one or more amino acids or nucleotide changes, or a polynucleotide sequence encoding it.
  • the changes may include deletions, insertions or substitutions of amino acids or nucleotides in the amino acid sequence or nucleotide sequence.
  • Variants can have "conservative" changes, which The amino acid substituted in the amino acid has a structural or chemical property similar to that of the original amino acid, such as replacing isoleucine with leucine.
  • Variants can also have non-conservative changes, such as replacing glycine with tryptophan.
  • “Deletion” refers to the deletion of one or more amino acids or nucleotides in an amino acid sequence or nucleotide sequence.
  • Insertion refers to an alteration in the amino acid sequence or nucleotide sequence that results in an increase in one or more amino acids or nucleotides compared to a naturally occurring molecule.
  • Replacement refers to the replacement of one or more amino acids or nucleotides with different amino acids or nucleotides.
  • Bioactivity refers to a protein that has the structure, regulation, or biochemical function of a natural molecule.
  • immunologically active refers to the ability of natural, recombinant or synthetic proteins and fragments thereof to induce a specific immune response in appropriate animals or cells and to bind to specific antibodies.
  • An "agonist” refers to a molecule that, when combined with human thyroglobulin 9, can cause the protein to change, thereby regulating the activity of the protein.
  • An agonist may include a protein, a nucleic acid, a carbohydrate, or any other molecule that binds human thyroglobulin-9.
  • Antagonist refers to a molecule that, when combined with human thyroglobulin 9, can block or regulate the biological or immunological activity of human thyroglobulin 9.
  • Antagonists and inhibitors may include proteins, nucleic acids, carbohydrates or any other molecule that binds human thyroglobulin 9.
  • “Regulation” refers to a change in the function of human thyroglobulin 9, including an increase or decrease in protein activity, a change in binding properties, and any other biological, functional, or immunological changes in human thyroglobulin 9.
  • Substantially pure ' 1 means essentially free of other proteins, lipids, sugars or other substances with which it is naturally associated.
  • Those skilled in the art can purify human thyroglobulin 9 using standard protein purification techniques. Essentially pure Human thyroglobulin 9 can generate a single main band on a non-reducing polyacrylamide gel. The purity of human thyroglobulin 9 polypeptide can be analyzed by amino acid sequence.
  • Complementary refers to the natural binding of polynucleotides by base-pairing under conditions of acceptable salt concentration and temperature.
  • sequence C-T-G-A
  • complementary sequence G-A-C-T.
  • the complementarity between two single-stranded molecules may be partial or complete.
  • the degree of complementarity between nucleic acid strands has a significant effect on the efficiency and strength of hybridization between nucleic acid strands.
  • “Homology” refers to the degree of complementarity and can be partially homologous or completely homologous.
  • Partial homology refers to a partially complementary sequence that at least partially inhibits hybridization of a fully complementary sequence to a target nucleic acid. The inhibition of such hybridization can be detected by performing hybridization (Sou thern blotting or Nor thern blotting, etc.) under conditions of reduced stringency.
  • Substantially homologous sequences or hybridization probes can compete and inhibit the binding of completely homologous sequences to the target sequence under conditions of reduced stringency. This does not mean strict Conditions with reduced sex allow non-specific binding because conditions with reduced stringency require that the two sequences bind to each other as a specific or selective interaction.
  • Percent identity refers to the percentage of sequences that are identical or similar in the comparison of two or more amino acid or nucleic acid sequences. The percent identity can be determined electronically, such as by the MEGALIGN program (Lasergene sof tware package, DNASTAR, Inc., Mad Son Wis.). The MEGALIGN program can compare two or more sequences according to different methods, such as the Clus ter method (Higgins, DG and PM Sharp (1988) Gene 73: 237-244). The Cluster method arranges groups of sequences into clusters by checking the distance between all pairs. The clusters are then assigned in pairs or groups.
  • the percent identity between two amino acid sequences such as sequence A and sequence B is calculated by the following formula: The number of matching residues between sequence A and sequence X 100 The number of residues in sequence A-the number of spacer residues in sequence A The number of spacer residues in a sequence B can also be determined by Cluster method or using methods known in the art, such as Jotun He in (%), the percent identity between nucleic acid sequences (He in J., (1990) Methods in emzumo logy 183: 625-645) 0 "Similarity" refers to the degree of identical or conservative substitutions of amino acid residues at corresponding positions in the alignment of amino acid sequences.
  • Amino acids used for conservative substitutions may include aspartic acid and glutamic acid; positively charged amino acids may include lysine and arginine; having an uncharged head group is Similar hydrophilic amino acids may include leucine, isoleucine and valine; glycine and alanine; asparagine and glutamine; serine and threonine; phenylalanine and tyrosine.
  • Antisense refers to a nucleotide sequence that is complementary to a particular DNA or RNA sequence.
  • Antisense strand refers to a nucleic acid strand that is complementary to a “sense strand.”
  • Derivative refers to a chemical modification of HFP or a nucleic acid encoding it. This chemical modification may be the replacement of a hydrogen atom with an alkyl, acyl or amino group. Nucleic acid derivatives can encode polypeptides that retain the main biological properties of natural molecules.
  • Antibody refers to a complete antibody molecule and its fragments, such as Fa,? ( ⁇ ') 2 and? It can specifically bind to the epitope of human thyroglobulin 9.
  • a “humanized antibody” refers to an antibody in which the amino acid sequence of a non-antigen binding region is replaced to become more similar to a human antibody, but still retains the original binding activity.
  • isolated refers to the removal of a substance from its original environment (for example, its natural environment if it occurs naturally).
  • a naturally occurring polynucleotide or polypeptide exists in a living animal. It is not isolated, but the same polynucleotide or polypeptide is separated from some or all of the substances that coexist with it in the natural system.
  • Such a polynucleotide may be part of a certain vector, or such a polynucleotide or polypeptide may be part of a certain composition. Since the carrier or composition is not a component of its natural environment, they are still isolated.
  • isolated refers to the separation of a substance from its original environment (if it is a natural substance, the original environment is the natural environment).
  • polynucleotides and polypeptides in a natural state in a living cell are not isolated and purified, but the same polynucleotides or polypeptides are separated and purified if they are separated from other substances in the natural state .
  • isolated human thyroglobulin 9 means that human thyroglobulin 9 is substantially free of other proteins, lipids, sugars, or other substances with which it is naturally associated. Those skilled in the art can purify human thyroglobulin 9 using standard protein purification techniques. Substantially pure polypeptides can produce a single main band on a non-reducing polyacrylamide gel. The purity of the human thyroglobulin 9 peptide can be analyzed by amino acid sequence.
  • the present invention provides a new polypeptide, human thyroglobulin 9, which basically consists of the amino acid sequence shown in SEQ ID NO: 2.
  • the polypeptide of the present invention may be a recombinant polypeptide, a natural polypeptide, or a synthetic polypeptide, and preferably a recombinant polypeptide.
  • the polypeptides of the present invention can be naturally purified products or chemically synthesized products, or can be produced from prokaryotic or eukaryotic hosts (eg, bacteria, yeast, higher plants, insects, and mammalian cells) using recombinant techniques. Depending on the host used in the recombinant production protocol, the polypeptide of the invention may be glycosylated, or it may be non-glycosylated. Polypeptides of the invention may also include or exclude starting methionine residues.
  • the invention also includes fragments, derivatives and analogs of human thyroglobulin 9.
  • fragment refers to a polypeptide that substantially retains the same biological function or activity of the human thyroglobulin 9 of the present invention.
  • a fragment, derivative or analog of the polypeptide of the present invention may be: (I) a kind in which one or more amino acid residues are substituted with conservative or non-conservative amino acid residues (preferably conservative amino acid residues), and the substitution
  • the amino acid may or may not be encoded by a genetic codon; or ( ⁇ ) a type in which a group on one or more amino acid residues is replaced by another group to include a substituent; or ( ⁇ ⁇ )
  • Such that the mature polypeptide is fused to another compound (such as a compound that extends the half-life of the polypeptide, such as polyethylene glycol); or
  • polypeptide sequence such as a leader sequence or a secreted sequence or a sequence used to purify this polypeptide or a protease sequence
  • a polypeptide sequence formed by fusion of an additional amino acid sequence into a mature polypeptide, as described herein, such that Fragments, derivatives and analogs are considered to be within the knowledge of those skilled in the art.
  • the present invention provides an isolated nucleic acid (polynucleotide), which basically consists of a polynucleotide encoding a polypeptide having the amino acid sequence of SEQ ID NO: 2.
  • the polynucleotide sequence of the present invention includes SEQ ID NO: 1 Nucleotide sequence.
  • the polynucleotide of the present invention is found from a cDNA library of human fetal brain tissue. It contains a polynucleotide sequence of 2263 bases in length and its open reading frame 1268-1513 encodes 81 amino acids.
  • this peptide has a similar expression profile to human thyroglobulin, and it can be inferred that the human thyroglobulin 9 has similar functions to human thyroglobulin.
  • the polynucleotide of the present invention may be in the form of DNA or RNA.
  • DNA forms include cDNA, genomic DNA, or synthetic DNA.
  • DNA can be single-stranded or double-stranded.
  • DNA can be coding or non-coding.
  • the coding region sequence encoding a mature polypeptide may be the same as the coding region sequence shown in SEQ ID NO: 1 or a degenerate variant.
  • a "degenerate variant" refers to a nucleic acid sequence encoding a protein or polypeptide having SEQ ID NO: 2 in the present invention, but which differs from the coding region sequence shown in SEQ ID NO: 1.
  • the polynucleotide encoding the mature polypeptide of SEQ ID NO: 2 includes: only the coding sequence of the mature polypeptide; the coding sequence of the mature polypeptide and various additional coding sequences; the coding sequence of the mature polypeptide (and optional additional coding sequences); Coding sequence.
  • polynucleotide encoding a polypeptide refers to a polynucleotide comprising the polypeptide and a polynucleotide comprising additional coding and / or non-coding sequences.
  • the invention also relates to variants of the polynucleotides described above, which encode polypeptides or fragments, analogs and derivatives of polypeptides having the same amino acid sequence as the invention.
  • Variants of this polynucleotide can be naturally occurring allelic variants or non-naturally occurring variants. These nucleotide variants include substitution variants, deletion variants, and insertion variants.
  • an allelic variant is an alternative form of a polynucleotide that may be a substitution, deletion, or insertion of one or more nucleotides, but does not substantially change the function of the polypeptide it encodes .
  • the invention also relates to a polynucleotide that hybridizes to the sequence described above (having at least 50%, preferably 70% identity, between the two sequences).
  • the present invention particularly relates to polynucleotides that can hybridize to the polynucleotides of the present invention under stringent conditions.
  • "strict conditions” means: (1) hybridization and elution at lower ionic strength and higher temperature, such as 0.2xSSC, 0.1% SDS, 60 ° C; or (2) A denaturant was added during hybridization, such as 50% (v / v) formamide, 0.1% calf serum / 0.1% F i co ll, 42.
  • hybridizable polynucleotide has the same biological function and activity as the mature polypeptide shown in SEQ ID NO: 2.
  • nucleic acid fragments that hybridize to the sequences described above.
  • a "nucleic acid fragment” contains at least 10 nucleotides in length, preferably at least 20-30 nucleotides, more preferably at least 50-60 nucleotides, most preferably at least 100 nucleotides. Nucleotides or more. Nucleic acid fragments can also be used for nucleic acid amplification Amplification techniques, such as PCR, to identify and / or isolate polynucleotides encoding human thyroglobulin 9.
  • the polypeptides and polynucleotides in the present invention are preferably provided in an isolated form and are more preferably purified to homogeneity.
  • polynucleotide sequence encoding the human thyroglobulin 9 of the present invention can be obtained by various methods.
  • polynucleotides are isolated using hybridization techniques well known in the art. These techniques include, but are not limited to: 1) hybridization of probes to genomic or cDNA libraries to detect homologous polynucleotide sequences, and 2) antibody screening of expression libraries to detect cloned polynucleosides with common structural characteristics Acid fragments.
  • the DNA fragment sequence of the present invention can also be obtained by the following methods: 1) isolating the double-stranded medical sequence from the genomic DNA; 2) chemically synthesizing the DNA sequence to obtain the double-stranded DNA of the polypeptide.
  • genomic DNA isolation is the least commonly used. Direct chemical synthesis of DM sequences is often the method of choice.
  • the more commonly used method is the isolation of cDNA sequences.
  • the standard method for isolating the cDNA of interest is to isolate mRNA from donor cells that overexpress the gene and perform reverse transcription to form a plasmid or phage cDNA library.
  • the construction of cDNA libraries is also a common method (Sambrook, et al., Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory. New York, 1989).
  • Commercially available cDNA libraries are also available, such as different cDNA libraries from Clontech. When polymerase reaction technology is used in combination, even very small expression products can be cloned.
  • genes of the present invention can be selected from these cDNA libraries by conventional methods. These methods include (but are not limited to): (l) DNA-DM or DNA-RNA hybridization; (2) the presence or absence of marker gene functions; (3) measuring the level of human thyroglobulin 9 transcripts; (4) Detection of gene-expressed protein products by immunological techniques or determination of biological activity. The above methods can be used singly or in combination.
  • the probe used for hybridization is homologous to any part of the polynucleotide of the present invention, and its length is at least 10 nucleotides, preferably at least 30 nucleotides, more preferably At least 50 nucleotides, preferably at least 100 nucleotides.
  • the length of the probe is usually within 2000 nucleotides, preferably within 1000 nucleotides.
  • the probe used here is generally a DNA sequence chemically synthesized based on the gene sequence information of the present invention.
  • the genes or fragments of the present invention can of course be used as probes.
  • DNA probes can be labeled with radioisotopes, luciferin, or enzymes (such as alkaline phosphatase).
  • the protein product of human thyroglobulin 9 gene expression can be detected by immunological techniques such as Western blotting, radioimmunoprecipitation, and enzyme-linked immunosorbent assay (ELISA).
  • immunological techniques such as Western blotting, radioimmunoprecipitation, and enzyme-linked immunosorbent assay (ELISA).
  • a method of amplifying DNA / RNA by PCR is preferably used to obtain the gene of the present invention.
  • the RACE method RACE-rapid amplification of cDNA ends
  • the primers used for PCR may be appropriately based on the polynucleotide sequence information of the present invention disclosed herein.
  • the amplified DNA / RNA fragments can be isolated and purified by conventional methods such as by gel electrophoresis.
  • polynucleotide sequence of the gene of the present invention or various DM fragments and the like obtained as described above can be determined by a conventional method such as dideoxy chain termination method (Sanger et al. PNAS, 1977, 74: 5463-5467). Such polynucleotide sequences can also be determined using commercial sequencing kits and the like. In order to obtain the full-length cDNA sequence, sequencing must be repeated. Sometimes it is necessary to determine the cDNA sequence of multiple clones in order to splice into a full-length cDNA sequence.
  • the present invention also relates to a vector comprising a polynucleotide of the present invention, and a host cell genetically engineered using the vector of the present invention or directly using a human thyroglobulin 9 coding sequence, and a method for producing a polypeptide of the present invention by recombinant technology.
  • a polynucleotide sequence encoding human thyroglobulin 9 may be inserted into a vector to form a recombinant vector containing the polynucleotide of the present invention.
  • vector refers to bacterial plasmids, bacteriophages, yeast plasmids, plant cell viruses, mammalian cell viruses such as adenoviruses, retroviruses or other vectors well known in the art.
  • Vectors suitable for use in the present invention include, but are not limited to: T7 promoter-based expression vectors expressed in bacteria (Rosenberg, et al.
  • pMSXND expression vectors expressed in mammalian cells Lee and Na thans, JBio Chem. 263: 3521, 1988
  • baculovirus-derived vectors expressed in insect cells in short, as long as it can be replicated and stabilized in the host, any plasmid and vector can be used to construct a recombinant expression vector.
  • An important feature of expression vectors is that they usually contain origins of replication, promoters, marker genes, and translational regulatory elements.
  • Methods known to those skilled in the art can be used to construct expression vectors containing a DNA sequence encoding human thyroglobulin 9 and appropriate transcriptional / translational regulatory elements. These methods include in vitro recombinant DNA technology, DNA synthesis technology, and in vivo recombination technology (Sambroook, et al. Mo l ecu l ar C l on ing, a Labora t ory Manua l, co ld Spr ing Harbor Laboratory. New York, 1989 ).
  • the DNA sequence can be operably linked to an appropriate promoter in an expression vector to guide mRNA synthesis. Representative examples of these promoters are: the l ac or trp promoter of E.
  • the expression vector also includes a ribosome binding site and a transcription terminator for translation initiation. Insertion of enhancer sequences into the vector will enhance its transcription in higher eukaryotic cells. Enhancers are cis-acting factors for DNA expression, usually about 10 to 300 base pairs, which act on promoters to enhance gene transcription.
  • Illustrative examples include SV40 enhancers from 100 to 270 base pairs on the late side of the origin of replication, polyoma enhancers on the late side of the origin of replication, and adenovirus enhancers.
  • the expression vector preferably contains one or more selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture. Fluorescent protein (GFP), or tetracycline or ampicillin resistance for E. coli.
  • a polynucleotide encoding human thyroglobulin 9 or a recombinant vector containing the polynucleotide can be transformed or transduced into a host cell to constitute a genetically engineered host cell containing the polynucleotide or the recombinant vector.
  • the term "host cell” refers to a prokaryotic cell, such as a bacterial cell; or a lower eukaryotic cell, such as a yeast cell; or a higher eukaryotic cell, such as a mammalian cell. Representative examples are: E.
  • coli Streptomyces
  • bacterial cells such as Salmonella typhimurium
  • fungal cells such as yeast
  • plant cells such as fly S2 or Sf 9
  • animal cells such as C'H0, COS, or Bowes s melanoma Cells etc.
  • Transformation of a host cell with a DNA sequence described in the present invention or a recombinant vector containing the DNA sequence can be performed using conventional techniques well known to those skilled in the art.
  • the host is a prokaryote such as E. coli
  • competent cells capable of absorbing DNA can be harvested after the exponential growth phase and treated with the C'aC 12 method. The steps used are well known in the art. The alternative is to use MgC l 2 .
  • transformation can also be performed by electroporation.
  • the host is a eukaryotic organism, the following DM transfection methods can be used: calcium phosphate co-precipitation method, or conventional mechanical methods such as microinjection, electroporation, and liposome packaging.
  • the polynucleotide sequence of the present invention can be used to express or produce recombinant human thyroglobulin 9 (Scence, 1 984; 224: 1431). Generally, there are the following steps: (1) Use the polynucleotide (or variant) encoding human human thyroglobulin 9 of the present invention, or transform or transduce a suitable recombinant expression vector containing the polynucleotide Host cell
  • the medium used in the culture may be selected from various conventional mediums. Culture is performed under conditions suitable for host cell growth. After the host cells have grown to an appropriate cell density, the selected promoter is induced by a suitable method (such as temperature conversion or chemical induction), and the cells are cultured for a period of time.
  • a suitable method such as temperature conversion or chemical induction
  • the recombinant polypeptide may be coated in a cell, expressed on a cell membrane, or secreted outside the cell.
  • recombinant proteins can be isolated and purified by various separation methods using their physical, chemical, and other properties. These methods are well known to those skilled in the art. These methods include, but are not limited to: conventional renaturation treatment, protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high Performance liquid chromatography (HPLC) and various other liquid chromatography techniques and combinations of these methods.
  • conventional renaturation treatment protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high Performance liquid chromat
  • FIG. 1 is a comparison diagram of gene chip expression profiles of human thyroglobulin 9 and human thyroglobulin of the present invention.
  • the upper graph is a graph of the expression profile of human thyroglobulin 9
  • the lower graph is the graph of the expression profile of human thyroglobulin.
  • 1 indicates fetal kidney
  • 2 indicates fetal large intestine
  • 3 indicates fetal small intestine
  • 4 indicates fetal muscle
  • 5 indicates fetal brain
  • 6 indicates fetal bladder
  • 7 indicates non-starved L02
  • 8 indicates L02 +, lhr, As 3+
  • 9 indicates ECV304 PMA-
  • 10 means ECV304 PMA +
  • 11 means fetal liver
  • 12 means normal liver
  • 13 means thyroid
  • 14 means skin
  • 15 means fetal lung
  • 16 means lung
  • 17 means lung cancer
  • 18 means fetal spleen
  • 19 means spleen
  • 20 Indicates prostate
  • 21 indicates fetal heart
  • 22 indicates heart
  • 23 indicates muscle
  • 24 indicates testis
  • 25 indicates fetal thymus
  • 26 indicates thymus.
  • Figure 2 shows the polyacrylamide gel electrophoresis (SDS-PAGE) of human thyroglobulin 9 isolated.
  • 9KI) a is the molecular weight of the protein.
  • the arrow indicates the isolated protein band.
  • Total human fetal brain RNA was extracted by one-step method with guanidine isothiocyanate / phenol / chloroform.
  • MRNA is formed by reverse transcription cDNA Quik mRNA Isolation Kit (Qiegene Co.) isolated from the total RNA poly (A) mRNA 0 2ug poly ( A) used.
  • the Smart cDNA cloning kit (purchased from C ontech) was used to insert the cDNA fragment into the multiple cloning site of the pBSK (+) vector (Clontech) to transform DH5 ⁇ , and the bacteria formed a cDNA library.
  • Dye terminate cycle reaction sequencing kit Perkin-Elmer
  • ABI 377 automatic sequencer Perkin-Elmer
  • the determined cDNA sequence was compared with an existing public DNA sequence database (Genebank), and it was found that the cDNA sequence of one of the clones 0761b02 was new DNA.
  • a series of primers were synthesized to determine the inserted cDNA fragments of the clone in both directions.
  • CDNA was synthesized using fetal brain total RNA as a template and oligo-dT as a primer for reverse transcription reaction. After purification using Qiagene's kit, the following primers were used for PCR amplification:
  • Primerl 5'- ATCTTATAAAAAGAGGTTTAAGGG -3 '(SEQ ID NO: 3)
  • Primer2 5'- ACAGGGTCTCACTCTGTCACCCAG -3 '(SEQ ID NO: 4)
  • Primerl is a forward sequence starting at lbp of the 5th end of SEQ ID NO: 1;
  • Primer2 is the 3 'end reverse sequence in SEQ ID NO: 1.
  • Amplification conditions 50 mmol / L KC1, 10 mmol / L Tris-Cl, (pH 8.5), 1.5 mmol / L MgCl 2 , 200 ⁇ mol / L dNTP, lOpmol primers in a 50 ⁇ 1 reaction volume, 1U of Taq I) NA polymerase (Clontech).
  • the reaction was performed on a PE9600 DNA thermal cycler (Perkin-Elmer) under the following conditions for 25 cycles: 94 ° C 30sec; 55 ° C 30sec; 72 ° C 2min.
  • RT-PCR set ⁇ -act in as a positive control and template blank as a negative control.
  • the amplified product was purified using a QIAGEN kit, and ligated to a pCR vector (Invitrogen product) using a TA cloning kit.
  • the DNA sequence analysis results showed that the DNA sequence of the PCR product was exactly the same as that of 1 to 2263bp shown in SEQ ID NO: 1.
  • Example 3 Northern blot analysis of human thyroglobulin 9 gene expression:
  • This method involves acid guanidinium thiocyanate-chloroform extraction. That is, the tissue is homogenized with 4M guanidinium isothiocyanate-25mM sodium citrate, 0.2M sodium acetate (pH4.0), and 1 volume of phenol and 1/5 volume of chloroform-isoamyl alcohol (49: 1 ) And centrifuge after mixing. Aspirate the aqueous layer, add isopropanol (0.8 vol) and centrifuge the mixture to obtain RNA precipitate. The resulting RNA pellet was washed with 70% ethanol, dried and dissolved in water.
  • RNA was synthesized by electrophoresis on a 1.2% agarose gel containing 20 mM 3- (N-morpholino) propanesulfonic acid (pH 7.0)-5 mM sodium acetate-1 mM EDTA-2.2M formaldehyde. It was then transferred to a nitrocellulose membrane.
  • the DNA probe used was the PCR amplified human thyroglobulin 9 coding region sequence (1268b P to 1513bp) shown in FIG. 1.
  • the 32P- labeled probes (about 2 x l0 6 cpm / ml) and RNA was transferred to nitrocellulose membrane 42 in a solution. C hybridization overnight, the solution contains 50% formamide-25 mM KH 2 PO 4 (pH 7.4)-5 X SSC-5 X Denhardt's solution and 200 g / ml salmon sperm DNA. After hybridization, the filter was placed at 1 x SSC-0.1 ° /. 55 in SDS. C Wash for 30 minutes. Then, Phosphor Imager was used for analysis and quantification.
  • Example 4 In vitro expression, isolation and purification of recombinant human thyroglobulin 9
  • Primer3 5-CATGCTAGCATGAACTGTCATAATCTTGGCCAG -3 (Seq ID No: 5)
  • Primer4 5'- CATGGATCCTCACTGCAACCTCCATCCTTGGGA -3 '(Seq ID No: 6)
  • the 5' ends of these two primers contain Nhel and BamHI digestion sites, respectively, followed by the coding sequences of the 5 'and 3' ends of the target gene, respectively.
  • the Nhe I and BamH I restriction sites correspond to the selective endonuclease sites on the expression vector plasmid pET-28b (+) (Novagen, Cat. No. 69865.3).
  • PCR was performed using the pBS-0761b02 plasmid containing the full-length target gene as a template.
  • the PCR reaction conditions were as follows: a total volume of 50 ⁇ 1 containing 10 pg of pBS-0761b02 plasmid, primers Primer-3 and Primer- 4 points; and j is lOpmol Advantage polymerase Mix (Clontecli) 1 ⁇ 1. Cycle parameters: 94 C 20s, 60 ° C 30s, 68 C 2 min, a total of 25 cycles. Nhel and BamHI were used to double digest the amplified product and plasmid pET-28 (+), respectively, and large fragments were recovered and ligated with T4 ligase. The ligated product was transformed into coliform bacteria DH5 ⁇ using the calcium chloride method.
  • the host strain BL21 (pET-0761b02) was cultured at 37 C to the logarithmic growth phase, IPTG was added to the final concentration lramol / L, and the culture was continued for 5 The cells were collected by centrifugation, sonicated, and the supernatant was collected by centrifugation. Chromatography was performed using an His. Bind Quick Cartridge (Novagen) affinity chromatography column capable of binding to 6 histidines (6His-Tag). The purified target protein, human thyroglobulin 9, was obtained. After SDS-PAGE electrophoresis, a single band was obtained at 9KI) a ( Figure 2).
  • the polypeptide is coupled to hemocyanin and bovine serum albumin to form a complex.
  • hemocyanin and bovine serum albumin For methods, see: Avrameas, et al. Imni chemistry, 1969; 6: 43. Rabbits were immunized with 1 ⁇ 2g of the above hemocyanin multipeptide complex plus complete Freund's adjuvant, and 15 days later the hemocyanin polypeptide complex plus incomplete Freund's adjuvant was used to boost immunity once. A 15 g / ml bovine serum albumin peptide complex-coated titer plate was used for ELISA. Determine the antibody titer in the serum. Protein A-Sepharose was used to isolate total IgG from antibody-positive home-immunized serum.
  • Example 6 Application of the polynucleotide fragment of the present invention as a hybridization probe
  • Suitable oligonucleotide fragments selected from the polynucleotides of the present invention are used as hybridization probes in a variety of ways.
  • the probes can be used to hybridize to genomic or cDNA libraries of normal tissue or pathological tissue from different sources to It is identified whether it contains the polynucleotide sequence of the present invention and a homologous polynucleotide sequence is detected.
  • the probe can also be used to detect the polynucleotide sequence of the present invention or its homologous polynucleotide sequence in normal tissues or Whether the expression in pathological tissue cells is abnormal.
  • the purpose of this embodiment is to select a suitable oligonucleotide fragment from the polynucleotide SEQ ID NO: 1 of the present invention as a hybridization probe, and to identify whether some tissues contain the polynucleoside of the present invention by a filter hybridization method.
  • Filter hybridization methods include dot blotting, Southern imprinting, Northern blotting, and copying methods. They all use the same basic hybridization method after fixing the polynucleotide sample to be tested on the filter.
  • the sample-immobilized filter is first pre-hybridized with a probe-free hybridization buffer to saturate the non-specific binding site of the sample on the filter with the carrier and the synthesized polymer.
  • the pre-hybridization solution is then replaced with a hybridization buffer containing labeled probes and incubated to hybridize the probes to the target nucleic acid.
  • unhybridized probes are removed by a series of membrane washes.
  • This embodiment uses higher-intensity washing conditions (such as lower salt concentration and higher temperature) to reduce the hybridization background and retain only strong specific signals.
  • the probes used in this embodiment include two types: the first type of probes are oligonucleotide fragments that are completely the same as or complementary to the polynucleotide SEQ ID NO: 1 of the present invention; the second type of probes are partially related to the present invention
  • the polynucleotide SEQ ID NO: 1 is the same or complementary oligonucleotide fragment.
  • the dot blot method is used to fix the sample on the filter membrane. Under the high-intensity washing conditions, the first type of probe and the sample have the strongest hybridization specificity and are retained.
  • oligonucleotide fragments for use as hybridization probes from the polynucleotide SEQ ID NO: 1 of the present invention should follow the following principles and several aspects to be considered:
  • the preferred range of probe size is 18-50 nucleotides
  • the GC content is 30% -70%, and the non-specific hybridization increases when it exceeds;
  • Those that meet the above conditions can be used as primary selection probes, and then further computer sequence analysis, including the primary selection probe and its source sequence region (ie, SEQ ID NO: 1) and other known genomic sequences Compare its homology with its complementary region. If the homology with the non-target molecular region is greater than 85% or there are more than 15 consecutive bases, the primary probe should not be used in general;
  • Probe 1 which belongs to the first type of probe, is completely homologous or complementary to the gene fragment of SEQ ID NO: 1 (41Nt):
  • Probe 2 (probe2), which belongs to the second type of probe, is equivalent to the replacement mutant sequence of the gene fragment of SEQ ID NO: 1 or its complementary fragment (41Nt):
  • step 8-13 are only used when contamination must be removed, otherwise step 14 can be performed directly.
  • NC membranes nitrocellulose membranes
  • probe 1 can be used to qualitatively and quantitatively analyze the presence and differential expression of the polynucleotide of the present invention in different tissues.
  • Gene chip or DNA microarray is a new technology that many national laboratories and large pharmaceutical companies are currently developing and developing. It refers to the orderly and high-density arrangement of large numbers of target gene fragments on glass, The data is compared and analyzed on a carrier such as silicon using fluorescence detection and computer software to achieve the purpose of rapid, efficient, and high-throughput analysis of biological information.
  • the polynucleotide of the present invention can be used as target DNA for gene chip technology for high-throughput research on the function of new genes; search for and screen new tissue-specific genes, especially diseases related genes such as tumors; diagnosis of diseases such as heredity disease.
  • the specific method steps have been reported in the literature. For example, see DeRisi, JL, Lyer, V. & Brown, PO (1997) Science 278, 680-686. And Helle, RA, Schema, M., Chai, A., Shalom, D., (1997) PNAS 94: 2150-2155.
  • a total of 4,000 polynucleotide sequences of various full-length cDNAs are used as target DNA, including the polynucleotide of the present invention. They were amplified by PCR respectively. After purification, the concentration of the amplified product was adjusted to about 500 ng / ul, and spotted on a glass medium with a Cartesian 7500 spotting instrument (purchased from Cartesian, USA). The distance is 280 ⁇ m. The spotted slides were hydrated, dried, and cross-linked in a UV cross-linking instrument. After elution, the DNA was fixed on the glass slide to prepare a chip. The specific method steps have been variously reported in the literature. The post-spotting processing steps of this embodiment are:
  • Total raRNA was extracted from human mixed tissues and specific tissues (or stimulated cell lines) in one step, and mRNA was purified using Oligotex mRNA Midi Kit (purchased from QiaGen).
  • the fluorescent reagent Cy3dUTP 5-Amino-propargyl- 2'- deoxyuridine 5--trip ate coupled to Cy3 fluorescent dye (purchased from Amersham Phamacia Biotech) was used to label the mRNA of human mixed tissue
  • the fluorescent reagent Cy5dUTP (5- Amino-propargy 2'- deoxyuridine 5'-triphate coupled to Cy5 fluorescent dye, purchased from Amersham Phamacia Biotech, was used to label the mRNA of specific tissues (or stimulated cell lines) of the body, and the probe was prepared after purification.
  • Cy3dUTP 5-Amino-propargyl- 2'- deoxyuridine 5--trip ate coupled to Cy3 fluorescent dye (purchased from Amersham Phamacia Biotech) was used to label
  • the probes from the two types of tissues and the chips were hybridized in a UniHyb TM Hybridization Solution (purchased from TeleChem) hybridization solution for 16 hours, washed with a washing solution (1 x SSC, 0.2% SDS) at room temperature, and then scanned with ScanArray 3000.
  • the scanner purchased from General Scanning Company, USA
  • the scanned image was analyzed and processed with Imagene software (Biodiscovery Company, USA) to calculate the Cy3 / Cy5 ratio of each point.
  • the above specific tissues are thymus, testis, muscle, spleen, lung, skin, thyroid, liver, PMA + Ecv304 cell line, PMA-Ecv304 cell line, non-starved L02 cell line, L02 cell line stimulated by arsenic for 1 hour, L02 cell line stimulated by arsenic for 6 hours prostate, heart, lung cancer, fetal bladder, fetal small intestine, fetal large intestine, fetal thymus, fetal muscle, fetal liver, fetal kidney, fetal spleen, fetal brain, Fetal lung and fetal heart.
  • polypeptide of the present invention and the antagonists, agonists and inhibitors of the polypeptide can be directly used in the treatment of diseases, for example, it can treat malignant tumors, adrenal deficiency, skin diseases, various inflammations, HIV infections and immune diseases.
  • Thyroglobulin acts on the active hormones levothyroxine and triiodothyronine, and supports the synthesis and storage of thyroid hormones. Thyroglobulin has been tested in the treatment of diseases related to hypothyroidism, such as minor illness, myxedema, and common, primary, secondary, and third-stage hypothyroidism.
  • the expression profile of the polypeptide of the present invention is consistent with the expression profile of human thyroglobulin (TG), and both have similar biological functions. It is mainly involved in regulating the synthesis, storage and release of thyroid hormones in the body, regulating the concentration of thyroid hormones in the blood, and then acting on the body's metabolism. Its abnormal expression is usually closely related to the pathogenesis of thyroid tissue and produces related diseases.
  • TG human thyroglobulin
  • human thyroglobulin 9 of the present invention will produce various diseases, especially various thyroid diseases, embryonic developmental disorders, growth and development disorders, various tumors, inflammation, Immune diseases, including but not limited to:
  • Thyroid disease goiter malformation, simple goiter, thyroiditis, hyperthyroidism, hypothyroidism
  • Fetal developmental disorders congenital abortion, cleft palate, limb loss, limb differentiation disorder, atrial septal defect, neural tube defect, congenital hydrocephalus, congenital glaucoma or cataract, congenital deafness
  • Growth and development disorders stunting, mental retardation, brain development disorders, skin, fat, and muscular dysplasia, bone and joint dysplasia, various metabolic defects, dwarfism, Cushing's syndrome Sexual retardation
  • Tumors of various tissues thyroid cancer, thyroid adenoma, breast cancer, leukemia, lymphoma, uterine fibroids, neuroblastoma, astrocytoma, ependymoma, bladder cancer, uterine cancer, endometrial cancer, Colon cancer
  • Inflammation chronic active hepatitis, sarcoidosis, polymyositis, chronic rhinitis, chronic gastritis, cerebrospinal multiple sclerosis, glomerulonephritis, myocarditis, cardiomyopathy, atherosclerosis, gastric ulcer, cervicitis, Various infectious inflammations
  • Immune diseases systemic lupus erythematosus, rheumatoid arthritis, bronchial asthma, urticaria, specific dermatitis, post-infection myocarditis, scleroderma, common variable immunodeficiency disease, acquired immunodeficiency syndrome
  • the abnormal expression of human thyroglobulin 9 of the present invention will also produce certain hereditary, hematological diseases and the like.
  • the polypeptide of the present invention and the antagonists, agonists and inhibitors of the polypeptide can be directly used in the treatment of diseases, for example, it can treat various diseases, especially various thyroid diseases, embryonic developmental disorders, growth and development disorders, various Tumor, inflammation, immune disease, some hereditary, hematological diseases, etc.
  • the invention also provides methods for screening compounds to identify agents that increase (agonist) or suppress (antagonist) human thyroglobulin 9.
  • Agonists enhance human thyroglobulin 9 to stimulate biological functions such as cell proliferation, while antagonists prevent and treat disorders related to excessive cell proliferation, such as various cancers.
  • mammalian cells or a membrane preparation expressing human thyroglobulin 9 can be cultured with labeled human thyroglobulin 9 in the presence of a drug. The ability of the drug to increase or block this interaction is then determined.
  • Antagonists of human thyroglobulin 9 include antibodies, compounds, receptor deletions, and analogs that have been screened. Antagonists of human thyroglobulin 9 can bind to human thyroglobulin 9 and eliminate its function, or inhibit the production of the polypeptide, or bind to the active site of the polypeptide so that the polypeptide cannot perform biological functions.
  • human thyroglobulin 9 When screening compounds as antagonists, human thyroglobulin 9 can be added to bioanalytical assays to determine the effect of compounds on the interaction between human thyroglobulin 9 and its receptors. Determine whether the compound is an antagonist. Receptor deletions and analogs that act as antagonists can be screened in the same manner as described above for screening compounds. Polypeptide molecules capable of binding to human thyroglobulin 9 can be obtained by screening a random peptide library composed of various possible combinations of amino acids bound to a solid phase. During screening, human thyroglobulin 9 molecules should generally be labeled.
  • the present invention provides a method for producing antibodies using polypeptides, and fragments, derivatives, analogs or cells thereof as antigens. These antibodies can be polyclonal or monoclonal antibodies.
  • the present invention also provides antibodies against human thyroglobulin 9 epitopes. These antibodies include (but are not limited to): Doklon antibodies, monoclonal antibodies, chimeric antibodies, single-chain antibodies, Fab fragments, and fragments from Fab expression libraries.
  • Polyclonal antibodies can be produced by injecting human thyroglobulin 9 directly into immunized animals (such as home immunity, mice, rats, etc.).
  • immunized animals such as home immunity, mice, rats, etc.
  • adjuvants can be used to enhance the immune response, including but not limited to Freund's adjuvant.
  • Techniques for preparing monoclonal antibodies to human thyroglobulin 9 include, but are not limited to, hybridoma technology (Kohler and Mistein. Nature, 1975, 256: 495-497), triple tumor technology, human B-cells Hybridoma technology, EBV-hybridoma technology, etc.
  • Chimeric antibodies that bind human constant regions to non-human variable regions can be produced using existing techniques (Morrison et al., PNAS, 1985, 81: 6851).
  • the existing technology for producing single-chain antibodies (U.S. Pat No. 4946778) can also be used to produce single-chain antibodies against human thyroglobul
  • Anti-human thyroglobulin 9 antibodies can be used in immunohistochemical techniques to detect human thyroglobulin 9 in biopsy specimens.
  • Monoclonal antibodies that bind to human thyroglobulin 9 can also be labeled with radioisotopes and injected into the body to track their location and distribution. This radiolabeled antibody can be used as a non-invasive diagnostic method to locate tumor cells and determine whether there is metastasis.
  • Antibodies can also be used to design immunotoxins that target a particular part of the body.
  • human thyroglobulin high affinity monoclonal antibodies can covalently bind to bacterial or plant toxins (such as diphtheria toxin, ricin, ormosine, etc.).
  • a common method is to attack the amino group of an antibody with a thiol cross-linking agent such as SPDP and bind the toxin to the antibody through the exchange of disulfide bonds.
  • This hybrid antibody can be used to kill human thyroglobulin 9 positive cells.
  • the antibodies of the present invention can be used to treat or prevent diseases related to human thyroglobulin 9.
  • Administration of an appropriate dose of antibody can stimulate or block the production or activity of human thyroglobulin 9.
  • the invention also relates to a diagnostic test method for quantitative and localized detection of human thyroglobulin 9 levels.
  • tests are well known in the art and include FISH assays and radioimmunoassays.
  • the level of human thyroglobulin 9 detected in the test can be used to explain the importance of human thyroglobulin 9 in various diseases sexual and diagnostic diseases for which human thyroglobulin 9 plays a role.
  • polypeptide of the present invention can also be used for peptide mapping analysis.
  • the polypeptide can be specifically cleaved by physical, chemical or enzymatic analysis, and subjected to one-dimensional or two-dimensional or three-dimensional gel electrophoresis analysis, and more preferably mass spectrometry analysis.
  • the polynucleotide encoding human thyroglobulin 9 can also be used for a variety of therapeutic purposes.
  • Gene therapy technology can be used to treat abnormal cell proliferation, development or metabolism caused by the non-expression or abnormal / inactive expression of human thyroglobulin 9.
  • Recombinant gene therapy vectors (such as viral vectors) can be designed to express mutated human thyroglobulin 9 to inhibit endogenous human thyroglobulin 9 activity.
  • a mutated human thyroglobulin 9 may be shortened human thyroglobulin 9 lacking a signaling domain. Although it can bind to downstream substrates, it lacks signaling activity.
  • recombinant gene therapy vectors can be used to treat diseases caused by abnormal expression or activity of human thyroglobulin 9.
  • Expression vectors derived from viruses such as retrovirus, adenovirus, adenovirus-associated virus, herpes simplex virus, parvovirus, etc. can be used to transfer a polynucleotide encoding human thyroglobulin 9 into cells.
  • viruses such as retrovirus, adenovirus, adenovirus-associated virus, herpes simplex virus, parvovirus, etc.
  • viruses such as retrovirus, adenovirus, adenovirus-associated virus, herpes simplex virus, parvovirus, etc.
  • a method of constructing a recombinant viral vector carrying a polynucleotide encoding human thyroglobulin 9 can be found in the existing literature (Sambrook, et al.).
  • Methods for introducing a polynucleotide into a tissue or cell include: directly injecting the polynucleotide into a tissue in vivo; or introducing the polynucleotide into a cell in vitro through a vector (such as a virus, phage, or plasmid), and then transplanting the cell Into the body and so on.
  • a vector such as a virus, phage, or plasmid
  • Oligonucleotides including antisense RNA and DNA
  • ribozymes that inhibit human thyroglobulin 9 mRNA are also within the scope of the present invention.
  • a ribozyme is an enzyme-like RNA molecule that can specifically decompose specific RNA. Its mechanism of action is that the ribozyme molecule specifically hybridizes with a complementary target RNA for endonucleation.
  • Antisense RNA, DNA, and ribozymes can be obtained using any existing RNA or DNA synthesis technology, such as solid-phase phosphoramidation synthesis of oligonucleotides.
  • Antisense RNA molecules can be obtained by in vitro or in vivo transcription of a DNA sequence encoding the RNA.
  • This DNA sequence has been integrated downstream of the vector's RNA polymerase promoter.
  • it can be modified in a variety of ways, such as increasing the sequence length on both sides, and the linkage between ribonucleosides using phosphate thioester or peptide bonds instead of phosphodiester bonds.
  • the polynucleotide encoding human thyroglobulin 9 can be used for the diagnosis of diseases related to human thyroglobulin 9.
  • a polynucleotide encoding human thyroglobulin 9 can be used to detect the expression of human thyroglobulin 9 or the abnormal expression of human thyroglobulin 9 in a disease state.
  • Human thyroglobulin Hybridization techniques include Southern blotting, Northern blotting, in situ hybridization, and the like. These techniques and methods are publicly available and mature, and related kits are commercially available.
  • polynucleotides of the present invention can be used as probes to be fixed on a microarray or a DNA chip (also referred to as a "gene chip") for analyzing differential expression analysis and gene diagnosis of genes in tissue.
  • a microarray or a DNA chip also referred to as a "gene chip”
  • Human thyroglobulin 9 specific primers for RNA-polymerase chain reaction (RT-PCR) in vitro amplification can also detect human thyroglobulin 9 transcripts.
  • Detection of mutations in the human thyroglobulin 9 gene can also be used to diagnose human thyroglobulin 9-related diseases.
  • Human thyroglobulin 9 mutations include point mutations, translocations, deletions, recombinations, and any other abnormalities compared to normal wild-type human thyroglobulin 9 DNA sequences. Mutations can be detected using existing techniques such as Southern blotting, DNA sequence analysis, PCR and in situ hybridization. In addition, mutations may affect protein expression. Therefore, Nor thern blotting and Western blotting can be used to indirectly determine whether a gene is mutated.
  • the sequences of the invention are also valuable for chromosome identification.
  • the sequence specifically targets a specific position on a human chromosome and can hybridize to it.
  • specific sites for each gene on the chromosome need to be identified.
  • only a few chromosome markers based on actual sequence data are available for marking chromosome positions.
  • an important first step is to locate these DNA sequences on a chromosome.
  • PCR primers (preferably 15-35bp) are prepared based on cDNA, and the sequences can be located on chromosomes. These primers were then used for PCR screening of somatic hybrid cells containing individual human chromosomes. Only those heterozygous cells containing the human gene corresponding to the primer will produce amplified fragments.
  • the somatic hybrid cell PCR mapping method is a fast method for locating DNA to a specific chromosome.
  • oligonucleotide primers of the present invention by a similar method, a group of fragments from a specific chromosome or a large number of genomic clones can be used to achieve sub- Positioning.
  • Other similar strategies that can be used for chromosomal localization include in situ hybridization, chromosome pre-screening with labeled flow sorting, and pre-selection of hybridization to construct chromosome-specific cDNA libraries.
  • Fluorescent in situ hybridization of cDNA clones with metaphase chromosomes allows precise chromosomal localization in one step.
  • FISH Fluorescent in situ hybridization
  • the physical location of the sequence on the chromosome can be correlated with the genetic map data. These data can be found in, for example, V. Mckus ck, Mende l ian Inher i tance in Man (available online with Johns Hopkins University Welch Med ica l L brary). Linkage analysis can then be used to determine if genes and genes have been mapped to chromosomal regions 7 The relationship between diseases.
  • the difference in cDM or genomic sequence between the affected and unaffected individuals needs to be determined. If a mutation is observed in some or all diseased individuals and the mutation is not observed in any normal individuals, the mutation may be the cause of the disease. Comparing affected and unaffected individuals usually involves first looking for structural changes in chromosomes, such as deletions or translocations that are visible at the chromosomal level or detectable with cDNA sequence-based PCR. According to the resolution capabilities of current physical mapping and gene mapping technology, the cDNA accurately mapped to the chromosomal region associated with the disease can be one of 50 to 500 potentially pathogenic genes (assuming 1 megabase mapping resolution Capacity and each 20kb corresponds to a gene).
  • the polypeptides, polynucleotides and mimetics, agonists, antagonists and inhibitors of the present invention can be used in combination with a suitable pharmaceutical carrier.
  • suitable pharmaceutical carrier can be water, glucose, ethanol, salts, buffers, glycerol, and combinations thereof.
  • the composition comprises a safe and effective amount of the polypeptide or antagonist, and carriers and excipients which do not affect the effect of the drug. These compositions can be used as drugs for the treatment of diseases.
  • the invention also provides a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the invention.
  • a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the invention.
  • these containers there may be instructional instructions given by government agencies that manufacture, use, or sell pharmaceuticals or biological products, which prompts permission for administration on the human body by government agencies that produce, use, or sell.
  • the polypeptides of the invention can be used in combination with other therapeutic compounds.
  • the pharmaceutical composition can be administered in a convenient manner, such as by a topical, intravenous, intraperitoneal, intramuscular, subcutaneous, intranasal or intradermal route of administration.
  • Human thyroglobulin 9 is administered in an amount effective to treat and / or prevent a specific indication.
  • the amount and range of human thyroglobulin 9 administered to a patient will depend on many factors, such as the mode of administration, the health conditions of the person to be treated, and the judgment of the diagnostician.

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • General Chemical & Material Sciences (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Animal Behavior & Ethology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Immunology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biophysics (AREA)
  • Cell Biology (AREA)
  • Toxicology (AREA)
  • Zoology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Biochemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Genetics & Genomics (AREA)
  • Molecular Biology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Peptides Or Proteins (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)

Abstract

L'invention concerne un nouveau polypeptide, une thyroglobuline humaine 9, et un polynucléotide codant pour ce polypeptide ainsi qu'un procédé d'obtention de ce polypeptide par des techniques recombinantes d'ADN. L'invention concerne en outre les applications de ce polypeptide dans le traitement de maladies, notamment de maladies thyroïdiennes, des tumeurs malignes, de l'hémopathie, des troubles du développement, de l'infection par VIH, de maladies immunitaires et de diverses inflammations. L'invention concerne aussi l'antagoniste agissant contre le polypeptide et son action thérapeutique ainsi que les applications de ce polynucléotide codant pour la thyroglobuline humaine 9.
PCT/CN2001/000374 2000-03-22 2001-03-19 Nouveau polypeptide, thyroglobuline humaine 9, et polynucleotide codant pour ce polypeptide WO2001075025A2 (fr)

Priority Applications (1)

Application Number Priority Date Filing Date Title
AU56054/01A AU5605401A (en) 2000-03-22 2001-03-19 A novel polypeptide, human thyroglobuline 9 and the polynuceotide encoding the polypeptide

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
CN00115018A CN1314377A (zh) 2000-03-22 2000-03-22 一种新的多肽——人甲状腺球蛋白9和编码这种多肽的多核苷酸
CN00115018.9 2000-03-22

Publications (2)

Publication Number Publication Date
WO2001075025A2 true WO2001075025A2 (fr) 2001-10-11
WO2001075025A3 WO2001075025A3 (fr) 2002-03-07

Family

ID=4584489

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/CN2001/000374 WO2001075025A2 (fr) 2000-03-22 2001-03-19 Nouveau polypeptide, thyroglobuline humaine 9, et polynucleotide codant pour ce polypeptide

Country Status (3)

Country Link
CN (1) CN1314377A (fr)
AU (1) AU5605401A (fr)
WO (1) WO2001075025A2 (fr)

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
CLAVERIE J.M. AND MAKALOWSKI W.: 'Alu alert' NATURE vol. 371, no. 6500, 1994, page 752 *
DI LAURO R. ET AL.: 'The sequence of 967 amino acids at the carboxyl-end of rat thyroglobulin. Location and surroundings of two thyroxine-forming sites' EUR. J. BIOCHEM. vol. 148, no. 1, 1985, pages 7 - 11 *
KIM P.S. ET AL.: 'A single amino acid change in the acetylcholinesterase-like domain of thyroglobulin causes congenital goiter with hypothyroidism in the cog/cog mouse: a model of human endoplasmic reticulum storage diseases' PROC. NATL. ACAD. SCI. USA vol. 95, no. 17, 1998, pages 9909 - 9913 *

Also Published As

Publication number Publication date
CN1314377A (zh) 2001-09-26
AU5605401A (en) 2001-10-15
WO2001075025A3 (fr) 2002-03-07

Similar Documents

Publication Publication Date Title
WO2001072786A1 (fr) Nouveau polypeptide, facteur d'inhibition tumorale 63, et polynucleotide codant pour ce polypeptide
WO2001083688A2 (fr) Nouveau polypeptide, sous-unite humaine 13 phosphatidylinositol-4-phosphate-5-kinase ii beta, et polynucleotide codant pour ce polypeptide
WO2001075025A2 (fr) Nouveau polypeptide, thyroglobuline humaine 9, et polynucleotide codant pour ce polypeptide
WO2001074869A1 (fr) Nouveau polypeptide, proteine humaine de choc thermique 15, et polynucleotide codant pour ce polypeptide
WO2001088084A2 (fr) Nouveau polypeptide, superoxyde dismutase 11, et polynucleotide codant pour ce polypeptide
WO2001083743A1 (fr) Polypeptide sous-unite 11 d'adducine alpha de globule rouge humain et polynucleotide codant pour ce polypeptide
WO2001075054A2 (fr) Nouveau polypeptide, facteur humain de regulation 30 de la transcription de la microglobuline, et polynucleotide codant pour ce polypeptide
WO2001072801A1 (fr) Nouveau polypeptide, proteine ribosomale humaine s11 12, et polynucleotide codant pour ce polypeptide
WO2001068873A1 (fr) Nouveau polypeptide, molecule humaine d'adhesion intercellulaire 12, et polynucleotide codant pour ce polypeptide
WO2001085752A1 (fr) Polynucleotide codant un peptide de myosine
WO2001072790A1 (fr) Nouveau polypeptide, proteine humaine p40 12 de facteur l1, et polynucleotide codant pour ce polypeptide
WO2001064721A1 (fr) Nouveau polypeptide, adenosine triphosphatase 30, et polynucleotide codant pour ce polypeptide
WO2001079423A2 (fr) Nouveau polypeptide, proteine humaine bcr 10, et polynucleotide codant pour ce polypeptide
WO2001070965A1 (fr) Nouveau polypeptide, facteur humain de regulation de la transcription 15, et polynucleotide codant pour ce polypeptide
WO2001078755A2 (fr) Nouveau polypeptide, proteine humaine de mutation 9 de l'ataxie-telangiectasie, et polynucleotide codant pour ce polypeptide
WO2001072821A1 (fr) Nouveau polypeptide, thyroglobuline humaine 12, et polynucleotide codant pour ce polypeptide
WO2001074887A1 (fr) Nouveau polypeptide, proteine humaine 9 humsiah, et polynucleotide codant pour ce polypeptide
WO2001068692A1 (fr) Nouveau polypeptide, proteine humaine conjuguee du cancer de la retine 9, et polynucleotide codant pour ce polypeptide
WO2001075019A2 (fr) Nouveau polypeptide, proteine humaine de mutation 11 de l'ataxie-telangiectasie, et polynucleotide codant pour ce polypeptide
WO2001088151A1 (fr) Facteur 30 de regulation de transcription de microglobuline, polypeptide humain, et polynucleotide le codant
WO2001088154A1 (fr) Nouveau polypeptide, facteur humain de regulation 17 de la transcription de la microglobuline, et polynucleotide codant pour ce polypeptide
WO2001040295A1 (fr) Nouveau polypeptide, proteine humaine 48 a doigt de zinc, et polynucleotide codant pour ce polypeptide
WO2001068693A1 (fr) Nouveau polypeptide, proteine humaine de reception cannabinoide 7, et polynucleotide codant pour ce polypeptide
WO2001075029A2 (fr) Nouveau polypeptide, facteur humain 11 associe a nf-e2, et polynucleotide codant pour ce polypeptide
WO2001071000A1 (fr) Nouveau polypeptide, znt-1-22, et polynucleotide codant pour ce polypeptide

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A2

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CO CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW

AL Designated countries for regional patents

Kind code of ref document: A2

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
AK Designated states

Kind code of ref document: A3

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CO CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW

AL Designated countries for regional patents

Kind code of ref document: A3

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG

122 Ep: pct application non-entry in european phase
NENP Non-entry into the national phase in:

Ref country code: JP