WO2001068693A1 - Nouveau polypeptide, proteine humaine de reception cannabinoide 7, et polynucleotide codant pour ce polypeptide - Google Patents

Nouveau polypeptide, proteine humaine de reception cannabinoide 7, et polynucleotide codant pour ce polypeptide Download PDF

Info

Publication number
WO2001068693A1
WO2001068693A1 PCT/CN2001/000235 CN0100235W WO0168693A1 WO 2001068693 A1 WO2001068693 A1 WO 2001068693A1 CN 0100235 W CN0100235 W CN 0100235W WO 0168693 A1 WO0168693 A1 WO 0168693A1
Authority
WO
WIPO (PCT)
Prior art keywords
polypeptide
polynucleotide
receptor protein
human
cannabinol receptor
Prior art date
Application number
PCT/CN2001/000235
Other languages
English (en)
Chinese (zh)
Other versions
WO2001068693A8 (fr
Inventor
Yumin Mao
Yi Xie
Original Assignee
Shanghai Biowindow Gene Development Inc.
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Shanghai Biowindow Gene Development Inc. filed Critical Shanghai Biowindow Gene Development Inc.
Priority to AU42249/01A priority Critical patent/AU4224901A/en
Publication of WO2001068693A1 publication Critical patent/WO2001068693A1/fr
Publication of WO2001068693A8 publication Critical patent/WO2001068693A8/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/705—Receptors; Cell surface antigens; Cell surface determinants
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides

Definitions

  • the present invention belongs to the field of biotechnology. Specifically, the present invention describes a novel polypeptide, human cannabinol receptor protein 7, and a polynucleotide sequence encoding the polypeptide. The invention also relates to a preparation method and application of the polynucleotide and polypeptide.
  • Cannabinol receptor protein is a protein receptor widely present in the body, and it is expressed in the brain, heart, lung, prostate, ovary and other tissues of the organism.
  • the central cannabinol receptor protein is expressed in the human central nervous system, brain, heart, prostate, testis and other tissues; while the cannabinol receptor protein is not expressed in the central nervous system, it is in the immune system. Have higher expression.
  • the central cannabinol receptor protein mainly mediates the pharmacological activity of cannabis in the body, and its abnormal expression will directly affect the function of cannabis in the body, thereby triggering various related neurological disorders, such as Forette syndrome, compulsive behavior Disorders, Parkinson's syndrome, Alzheimer's disease, etc .; Cannabinol receptor protein is highly expressed in the immune system of the organism, and this protein works in concert with pertussis toxin-sensitive GTP binding protein to regulate the gland The activity of glycosyl cyclases, in turn, regulates various related immune system responses.
  • These domains are The central region where the receptor binds to related proteins to exert its activity in vivo. Mutations or abnormal expression of specific amino acid sites in these domains will lead to abnormal effects of receptor proteins, which are usually closely related to the occurrence of some nervous system disorders and immune system diseases in the body. It can be known from the above that the cannabinol receptor protein is involved in regulating a variety of important nervous system and immune system development and action processes in the body.
  • the central cannabinol receptor mainly plays an important regulatory role in the development process of the nervous system. Cannabinol receptors play an important role in the immune system. Mutation or abnormal expression of the central cannabinol receptor will usually lead to abnormal development and function of the nervous system in the body, which is usually closely related to the occurrence of various related nervous system disorders.
  • the protein can also be used to diagnose and treat various related diseases.
  • the expression profile of the polypeptides of the present invention is very similar to the expression profile of the human central cannabinol receptor, so their functions may also be similar.
  • the present invention is named human cannabinol receptor protein 7.
  • the human cannabinol receptor protein 7 protein plays an important role in regulating important functions of the body such as cell division and embryonic development, and it is believed that a large number of proteins are involved in these regulatory processes. Therefore, there has been a need in the art to identify more involved in these Process the human cannabinol receptor protein 7 protein, specifically identifying the amino acid sequence of this protein. Isolation of the new human cannabinol receptor protein 7 protein encoding gene also provides a basis for research to determine the role of this protein in health and disease states. This protein may form the basis for developing diagnostic and / or therapeutic drugs for the disease, so isolating its coding DNA is important. Object of the invention
  • Another object of the invention is to provide a polynucleotide encoding the polypeptide.
  • Another object of the present invention is to provide a genetically engineered host cell containing a polynucleotide encoding a human cannabinol receptor protein 7.
  • Another object of the present invention is to provide a method for producing human cannabinol receptor protein 7.
  • Another object of the present invention is to provide an antibody against the polypeptide of the present invention, human cannabinol receptor protein 7.
  • Another object of the present invention is to provide mimic compounds, antagonists, agonists, and inhibitors directed to the polypeptide of the present invention, human cannabinol receptor protein 7.
  • Another object of the present invention is to provide diagnosis and treatment of diseases related to abnormalities of human cannabinoid receptor protein 7. Disease method. Summary of invention
  • the present invention relates to an isolated polypeptide, which is of human origin, and includes: a polypeptide having the amino acid sequence of SEQ ID D. 2, or a conservative variant, biologically active fragment, or derivative thereof.
  • the polypeptide is a polypeptide having the amino acid sequence of SEQ ID NO: 2.
  • the invention also relates to an isolated polynucleotide comprising a nucleotide sequence or a variant thereof selected from the group consisting of:
  • sequence of the polynucleotide is one selected from the group consisting of: (a) a sequence of positions 1 338-1 to 532 in SEQ ID NO: 1; and (b) a sequence of 1 in SEQ ID NO: 1 -1734-bit sequence.
  • the present invention further relates to a vector, particularly an expression vector, containing the polynucleotide of the present invention; a host cell genetically engineered with the vector, including a transformed, transduced or transfected host cell; Host cell and method of preparing the polypeptide of the present invention by recovering the expression product.
  • the invention also relates to an antibody capable of specifically binding to a polypeptide of the invention.
  • the present invention also relates to a method for screening compounds that mimic, activate, antagonize or inhibit human cannabinol receptor protein 7 protein activity, which comprises utilizing the polypeptide of the present invention.
  • the invention also relates to compounds obtained by this method.
  • the present invention also relates to a method for detecting a disease or disease susceptibility related to abnormal expression of human cannabinol receptor protein 7 protein in vitro, which comprises detecting a mutation in the polypeptide or a polynucleotide sequence encoding the same in a biological sample, or detecting The amount or biological activity of a polypeptide of the invention in a biological sample.
  • the invention also relates to a pharmaceutical composition
  • a pharmaceutical composition comprising a polypeptide of the invention or a mimetic thereof, an activator, an antagonist or an inhibitor, and a pharmaceutically acceptable carrier.
  • the present invention also relates to the preparation of the polypeptide and / or polynucleotide of the present invention for the treatment of neuropsychiatric disorders, immune diseases, development disorders, inflammation, various tumors, HIV infection, etc., especially for the treatment of psychoactive Use of drugs for mental disorders or other diseases caused by abnormal expression of human cannabinoid receptor protein 7.
  • Fig. 1 is a comparison diagram of gene chip expression profiles of human cannabinol receptor protein 7 and human central cannabinol receptor of the present invention.
  • the upper graph is a graph of the expression profile of the human cannabinol receptor protein 7, and the lower graph is the graph of the expression profile of the human central cannabinol receptor.
  • Figure 2 is a polyacrylamide gel electrophoresis image (SDS-PAGE) of human cannabinol receptor protein 7 isolated.
  • 7KDa is the molecular weight of the protein.
  • the arrow indicates the isolated protein band.
  • Nucleic acid sequence refers to an oligonucleotide, a nucleotide or a polynucleotide and a fragment or part thereof, and may also refer to a genomic or synthetic DNA or RNA, they can be single-stranded or double-stranded, representing the sense or antisense strand.
  • amino acid sequence refers to an oligopeptide, peptide, polypeptide or protein sequence and fragments or portions thereof.
  • amino acid sequence in the present invention relates to the amino acid sequence of a naturally occurring protein molecule, such "polypeptide” or “protein” does not mean to limit the amino acid sequence to a complete natural amino acid related to the protein molecule .
  • a “variant" of a protein or polynucleotide refers to an amino acid sequence having one or more amino acids or nucleotide changes or a polynucleotide sequence encoding it.
  • the changes may include deletions, insertions or substitutions of amino acids or nucleotides in the amino acid sequence or nucleotide sequence.
  • Variants can have "conservative" changes, in which the amino acid substituted has a structural or chemical property similar to the original amino acid, such as replacing isoleucine with leucine.
  • Variants can also have non-conservative changes, such as replacing glycine with tryptophan.
  • “Deletion” refers to the deletion of one or more amino acids or nucleotides in an amino acid sequence or nucleotide sequence.
  • Insertion means that a change in the amino acid sequence or nucleotide sequence results in an increase in one or more amino acids or nucleotides compared to a molecule that exists in nature.
  • Replacement refers to the replacement of one or more amino acids or nucleotides with different amino acids or nucleotides.
  • Bioactivity refers to a protein that has the structure, regulation, or biochemical function of a natural molecule.
  • immunologically active refers to the ability of natural, recombinant or synthetic proteins and fragments thereof to induce a specific immune response and to bind specific antibodies in a suitable animal or cell.
  • An "agonist” refers to a molecule that, when bound to human cannabinol receptor protein 7, can cause the protein to change, thereby regulating the activity of the protein.
  • Agonists can include proteins, nucleic acids, carbohydrates Or any other molecule that can bind human cannabinol receptor protein 7.
  • Antagonist refers to a molecule that, when combined with human cannabinol receptor protein 7, can block or regulate the biological or immunological activity of human cannabinol receptor protein 7.
  • Antagonists and inhibitors may include proteins, nucleic acids, carbohydrates or any other molecule that can bind human cannabinol receptor protein 7.
  • Regular refers to a change in the function of human cannabinol receptor protein 7, including an increase or decrease in protein activity, a change in binding properties, and any other biological, functional, or immune properties of human cannabinol receptor protein 7. change.
  • Those skilled in the art can purify human cannabinol receptor protein 7 using standard protein purification techniques. Basic The pure human cannabinol receptor protein 7 can generate a single main band on a non-reducing polyacrylamide gel. The purity of the human cannabinol receptor protein 7 polypeptide can be analyzed by amino acid sequence.
  • Complementary refers to the natural binding of polynucleotides by base-pairing under conditions of acceptable salt concentration and temperature.
  • sequence C-T-G-A
  • complementary sequence G-A-C-T.
  • the complementarity between two single-stranded molecules may be partial or complete.
  • the degree of complementarity between nucleic acid strands has a significant effect on the efficiency and strength of hybridization between nucleic acid strands.
  • “Homology” refers to the degree of complementarity and can be partially homologous or completely homologous.
  • Partial homology refers to a partially complementary sequence that at least partially inhibits hybridization of a fully complementary sequence to a target nucleic acid. This inhibition of hybridization can be detected by performing hybridization (Southern imprinting or Northern blotting, etc.) under conditions of reduced stringency. Substantially homologous sequences or hybridization probes can compete and inhibit the binding of fully homologous sequences to the target sequence under conditions of reduced stringency. This does not mean that the conditions of reduced stringency allow non-specific binding, because the conditions of reduced stringency require that the two sequences bind to each other as a specific or selective interaction.
  • Percent identity refers to the percentage of sequences that are the same or similar in a comparison of two or more amino acid or nucleic acid sequences. Percent identity can be determined electronically, such as through the MEGALIGN program
  • the MEGALIGN program can compare two or more sequences (Higgins, D. G., and
  • the Cluster method arranges groups of sequences into clusters by checking the distance between all pairs. The clusters are then assigned in pairs or groups. The percent identity between two amino acid sequences such as sequence A and sequence B is calculated by the following formula:
  • the percent identity between nucleic acid sequences can also be determined by the Cluster method or by methods known in the art such as Jotun He in (He in J., (1990) Me thods in enzymo l ogy 183: 625- 645) .
  • Similarity refers to the degree of identical or conservative substitutions of amino acid residues at corresponding positions in the alignment of amino acid sequences.
  • Amino acids used for conservative substitution for example, negatively charged amino acids may include aspartic acid and glutamic acid; positively charged amino acids may include lysine and arginine; having an uncharged head group is Similar hydrophilic amino acids may include leucine, isoleucine and valine; glycine and alanine; asparagine and glutamine; serine and threonine; phenylalanine and tyrosine.
  • Antisense refers to a nucleotide sequence that is complementary to a particular DM or RNA sequence.
  • Antisense strand refers to a nucleic acid strand that is complementary to a “sense strand.”
  • Derivative refers to HFP or a chemical modification of its nucleic acid. This chemical modification may be the replacement of a hydrogen atom with an alkyl, acyl or amino group. Nucleic acid derivatives can encode polypeptides that retain the main biological properties of natural molecules.
  • Antibody refers to a complete antibody molecule and its fragments, such as Fa,? ( ⁇ ') 2 and? It can specifically bind to the epitope of human cannabinol receptor protein 7.
  • a “humanized antibody” refers to an antibody in which the amino acid sequence of a non-antigen binding region is replaced to become more similar to a human antibody, but still retains the original binding activity.
  • isolated refers to the removal of matter from its original environment (for example, its natural environment if it is naturally occurring).
  • a naturally occurring polynucleotide or polypeptide is not isolated when it is present in a living thing, but the same polynucleotide or polypeptide is separated from some or all of the substances that coexist with it in the natural system.
  • Such a polynucleotide may be part of a vector, or such a polynucleotide or polypeptide may be part of a composition. Since the carrier or composition is not a component of its natural environment, they are still isolated.
  • isolated refers to the separation of a substance from its original environment (if it is a natural substance, the original environment is the natural environment).
  • polynucleotides and polypeptides in a natural state in a living cell are not isolated and purified, but the same polynucleotides or polypeptides are separated and purified if they are separated from other substances in the natural state .
  • isolated human cannabinol receptor protein 7 means that human cannabinol receptor protein 7 is substantially free of other proteins, lipids, sugars, or other substances with which it is naturally associated. Those skilled in the art can purify human cannabinol receptor protein 7 using standard protein purification techniques. Substantially pure polypeptides can produce a single main band on a non-reducing polyacrylamide gel. The purity of the human cannabinol receptor protein 7 peptide can be analyzed by amino acid sequence.
  • the present invention provides a new polypeptide, human cannabinol receptor protein 7, which is basically composed of SEQ ID NO: 2
  • the amino acid sequence shown is composed.
  • the polypeptide of the present invention may be a recombinant polypeptide, a natural polypeptide, a synthetic polypeptide, and preferably a recombinant polypeptide.
  • the polypeptide of the present invention may be a naturally purified product, or a chemically synthesized product, or may be produced from a prokaryotic or eukaryotic host (for example, bacteria, yeast, higher plants, nymphs, and mammalian cells) using recombinant technology.
  • the polypeptide of the invention may be glycosylated, or it may be non-glycosylated.
  • Polypeptides of the invention may also include or exclude starting methionine residues.
  • the invention also includes fragments, derivatives and analogs of human cannabinol receptor protein 7.
  • fragment refers to a polypeptide that substantially retains the same biological function or activity of the human cannabinol receptor protein 7 of the present invention.
  • a fragment, derivative or analog of the polypeptide of the present invention may be: (I) a kind in which one or more amino acid residues are substituted with conservative or non-conservative amino acid residues (preferably conservative amino acid residues), and the substitution
  • the amino acid may or may not be encoded by the genetic code; or (II) such a type in which a group on one or more amino acid residues is substituted by other groups to include a substituent; or (III) such A type in which a mature polypeptide is fused to another compound (such as a compound that prolongs the half-life of the polypeptide, such as polyethylene glycol); or a UV), a polypeptide sequence in which an additional amino acid sequence is fused into a mature polypeptide (such as Leader sequence or secretory sequence or the sequence or protease sequence used to purify this polypeptide).
  • the present invention provides an isolated nucleic acid (polynucleotide), which basically consists of a polynucleotide encoding a polypeptide having the amino acid sequence of SEQ ID NO: 2.
  • the polynucleotide sequence of the present invention includes the nucleotide sequence of SEQ ID NO: 1.
  • the polynucleotide of the present invention is found from a cDNA library of human fetal brain tissue. It contains a full-length polynucleotide sequence of 34 bases, and its open reading frame 1338-1532 encodes 64 amino acids.
  • this polypeptide has a similar expression profile to the human central cannabinol receptor, and it can be deduced that the human cannabinol receptor protein 7 has a similar function to the human central cannabinol receptor.
  • the polynucleotide of the present invention may be in the form of DNA or RNA.
  • DNA forms include cDNA, genomic DNA, or synthetic DNA.
  • DNA can be single-stranded or double-stranded.
  • DNA can be coding or non-coding.
  • the coding region sequence encoding the mature polypeptide may be the same as the coding region sequence shown in SEQ ID NO: 1 or a degenerate variant.
  • a "degenerate variant" refers to a nucleic acid sequence encoding a protein or polypeptide having SEQ ID NO: 2 but different from the coding region sequence shown in SEQ ID NO: 1 in the present invention.
  • the polynucleotide encoding the mature polypeptide of SEQ ID NO: 2 includes: only the coding sequence of the mature polypeptide; the coding sequence of the mature polypeptide and various additional coding sequences; the coding sequence of the mature polypeptide (and optional additional coding sequences); Coding sequence.
  • the term "polynucleotide encoding a polypeptide" is meant to include polynucleotides that encode such polypeptides and polynucleotides that include additional coding and / or noncoding sequences.
  • the invention also relates to variants of the polynucleotides described above, which encode polypeptides or fragments, analogs and derivatives of polypeptides having the same amino acid sequence as the invention.
  • Variants of this polynucleotide can be naturally occurring allelic variants or non-naturally occurring variants. These nucleotide variants include substitution variants, deletion variants, and insertion variants.
  • an allelic variant is an alternative form of a polynucleotide that may be a substitution, deletion, or insertion of one or more nucleotides, but does not substantially change the function of the polypeptide it encodes .
  • the invention also relates to a polynucleotide that hybridizes to the sequence described above (having at least 50%, preferably 70% identity, between the two sequences).
  • the present invention particularly relates to polynucleotides that can hybridize to the polynucleotides of the present invention under stringent conditions.
  • "strict conditions” means: (1) hybridization and elution at lower ionic strength and higher temperature, such as 0.2 xSSC, 0.1% SDS, 6 (TC; or (2) ) Add a denaturant during hybridization, such as 50% (v / v) formamide, ⁇ 0.1% calf serum / 0.1% F i co ll, 42 ° C, etc .; or (3) only in two Hybridization occurs only when the sequence identity is at least 95%, and more preferably 97%, and the polypeptide encoded by the hybridizable polynucleotide has the same biology as the mature polypeptide shown in SEQ ID NO: 2 Function and activity.
  • nucleic acid fragments that hybridize to the sequences described above.
  • a "nucleic acid fragment” contains at least 10 nucleotides in length, preferably at least 20-30 nucleotides, more preferably at least 50-60 nucleotides, most preferably at least 100 nucleotides. Nucleotides or more. Nucleic acid fragments can also be used in nucleic acid amplification techniques, such as PCR, to identify and / or isolate polynucleotides encoding human cannabinol receptor protein 7.
  • polypeptides and polynucleotides in the present invention are preferably provided in an isolated form and are more preferably purified to homogeneity.
  • the specific polynucleotide sequence encoding the human cannabinol receptor protein 7 of the present invention can be obtained by various methods.
  • polynucleotides are isolated using hybridization techniques well known in the art. These techniques include, but are not limited to: 1) hybridization of probes to genomic or cDNA libraries to detect homologous polynucleotide sequences, and 2) antibody screening of expression libraries to detect cloned polynucleosides with common structural characteristics Acid fragments.
  • the DNA fragment sequence of the present invention can also be obtained by the following methods: 1) separating a double-stranded DNA sequence from genomic DNA; 2) chemically synthesizing a DM sequence to obtain the double-stranded DM of the polypeptide.
  • genomic DNA isolation is the least commonly used. Direct chemical synthesis of DNA sequences is often the method of choice. The more commonly used method is the separation of the CDM sequences.
  • the standard method for isolating the cDNA of interest is to isolate mRNA from donor cells that overexpress the gene and perform reverse transcription to form a plasmid or phage cDNA library. There are many mature techniques for extracting mRNA, and kits are also commercially available (Q i agene).
  • the construction of cDNA libraries is also a common method (Sambrook, et al., Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory. New York, 1989).
  • Commercially available cDNA libraries are also available, such as different cDNA libraries from Clontech. When polymerase reaction technology is used in combination, even very small expression products can be cloned.
  • genes of the present invention can be selected from these cDNA libraries by conventional methods. These methods include (but are not limited to): (1) DM-DNA or DM-RNA hybridization; (2) the presence or loss of marker gene function; (3) measuring the level of the transcript of human cannabinol receptor protein 7; ( 4) Detecting gene-expressed protein products by immunological techniques or by measuring biological activity. The above methods can be used singly or in combination.
  • the probe used for hybridization is homologous to any part of the polynucleotide of the present invention, and its length is at least 10 nucleotides, preferably at least 30 nucleotides, more preferably At least 50 nucleotides, preferably at least 100 nucleotides.
  • the length of the probe is usually within 2000 nucleotides, preferably within 1000 nucleotides.
  • the probe used here is usually a DNA sequence chemically synthesized based on the gene sequence information of the present invention.
  • the genes or fragments of the present invention can of course be used as probes.
  • DNA probes can be labeled with radioisotopes, luciferin, or enzymes (such as alkaline phosphatase).
  • immunological techniques such as Western blotting, radioimmunoprecipitation, and enzyme-linked immunosorbent assay (ELISA) can be used to detect the protein product expressed by the human cannabinol receptor protein 7 gene.
  • ELISA enzyme-linked immunosorbent assay
  • a method using DNA technology to amplify DNA / RNA is preferably used to obtain the gene of the present invention.
  • the RACE method RACE-rapid amplification of cDNA ends
  • the primers used for PCR can be appropriately based on the polynucleotide sequence information of the present invention disclosed herein. Select and synthesize using conventional methods.
  • the amplified DNA / RNA fragments can be isolated and purified by conventional methods such as by gel electrophoresis.
  • polynucleotide sequence of the gene of the present invention or various DNA fragments and the like obtained as described above can be measured by a conventional method such as dideoxy chain termination method (Sanger et al. PNAS, 1977, 74: 5463-5467). Such polynucleotide sequences can also be determined using commercial sequencing kits and the like. In order to obtain the full-length cDNA sequence, sequencing needs to be repeated. Sometimes it is necessary to determine the cDNA sequence of multiple clones in order to splice into a full-length cDNA sequence.
  • the present invention also relates to a vector comprising the polynucleotide of the present invention, and a host cell that is genetically engineered using the vector of the present invention or directly using the human cannabinol receptor protein 7 coding sequence, and a recombinant technology to produce the polypeptide of the present invention method.
  • a polynucleotide sequence encoding the human cannabinol receptor protein 7 can be inserted into a vector to constitute a recombinant vector containing the polynucleotide of the present invention.
  • vector refers to bacterial plasmids, phages, yeast plasmids, plant cell viruses, mammalian cell viruses such as adenoviruses, retroviruses, or other vectors well known in the art.
  • Vectors suitable for use in the present invention include, but are not limited to: groups expressed in bacteria Expression vectors for the T7 promoter (Rosenberg, et al.
  • any plasmid and vector can be used to construct a recombinant expression vector.
  • An important feature of expression vectors is that they usually contain an origin of replication, a promoter, a marker gene, and translational regulatory elements.
  • Methods well known to those skilled in the art can be used to construct expression vectors containing DM sequences encoding human cannabinol receptor protein 7 and appropriate transcription / translation regulatory elements. These methods include in vitro recombinant DNA technology, DNA synthesis technology, and in vivo recombination technology (Sambroook, et al. Molecular Cloning, a Laboratory Manual, Cold Spring Harbor Laboratory. New York, 1989).
  • the DNA sequence can be operably linked to an appropriate promoter in an expression vector to guide mRNA synthesis. Representative examples of these promoters are: the lac or trp promoter of E.
  • the expression vector also includes a ribosome binding site and a transcription terminator for translation initiation. Insertion of enhancer sequences into the vector will enhance its transcription in higher eukaryotic cells. Enhancers are cis-acting factors for DNA expression, usually about 10 to 300 base pairs, which act on promoters to enhance gene transcription. Illustrative examples include SV40 enhancers from 100 to 270 base pairs on the late side of the origin of replication, polyoma enhancers on the late side of the origin of replication, and adenovirus enhancers.
  • the expression vector preferably contains one or more selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
  • selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
  • GFP fluorescent protein
  • tetracycline or ampicillin resistance for E. coli.
  • a polynucleotide encoding a human cannabinol receptor protein 7 or a recombinant vector containing the polynucleotide can be transformed or transduced into a host cell to constitute a genetically engineered host cell containing the polynucleotide or the recombinant vector.
  • the term "host cell” refers to a prokaryotic cell, such as a bacterial cell; or a lower eukaryotic cell, such as a yeast cell; or a higher eukaryotic cell, such as a mammalian cell. Representative examples are: E.
  • coli Streptomyces
  • bacterial cells such as Salmonella typhimurium
  • fungal cells such as yeast
  • plant cells such as insect cells such as Fly S2 or Sf9
  • animal cells such as CH0, COS or Bowes melanoma cells.
  • Transforming a host cell with the DNA sequence of the present invention or a recombinant vector containing the DNA sequence may This is done using conventional techniques well known to those skilled in the art.
  • the host is a prokaryote such as E. coli
  • competent cells capable of absorbing DNA can be harvested after exponential growth and used.
  • & Treatment 1 2
  • steps well known in the art with alternative MgC l 2 is a method, if desired, may be converted electroporation
  • the host is a eukaryote, can be selected as follows...
  • DNA transfection methods calcium phosphate co-precipitation, or conventional mechanical methods such as microinjection, electroporation, and liposome packaging.
  • the polynucleotide sequence of the present invention can be used to express or produce recombinant human cannabinol receptor protein 7 (Scence, 1984; 224: 1431). Generally, the following steps are taken:
  • the medium used in the culture may be selected from various conventional mediums. Culture is performed under conditions suitable for host cell growth. After the host cells have grown to an appropriate cell density, the selected promoter is induced by a suitable method (such as temperature conversion or chemical induction), and the cells are cultured for a period of time.
  • a suitable method such as temperature conversion or chemical induction
  • the recombinant polypeptide may be coated in a cell, expressed on a cell membrane, or secreted outside the cell. If necessary, the recombinant protein can be isolated and purified by various separation methods using its physical, chemical and other properties. These methods are well known to those skilled in the art. These methods include, but are not limited to: conventional renaturation treatment, protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid chromatography (HPLC) and various other liquid chromatography techniques and combinations of these methods.
  • conventional renaturation treatment protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid
  • polypeptide of the present invention and the antagonists, agonists and inhibitors of the polypeptide can be directly used in the treatment of diseases, for example, it can treat malignant tumors, adrenal deficiency, skin diseases, various inflammations, H IV infections and immunological diseases.
  • cannabinol receptor proteins There are two types of cannabinol receptor proteins, the central cannabinol receptor and the cannabis alcohol receptor, which are widely present in the body.
  • the cannabinol receptor protein is expressed in human central nervous system, brain, heart, prostate, testis and other tissues; while the cannabinol receptor protein is not expressed in the central nervous system, it is relatively more in the immune system. High expression. Both play important intermediary regulatory roles in the development and action of the above-mentioned various tissues, respectively.
  • the central cannabinol receptor protein mainly mediates the pharmacological activity of cannabis in the body, and its abnormal expression will directly affect the function of cannabis in the body, thereby triggering various related nervous system disorders.
  • Diseases such as Touette's syndrome, obsessive-compulsive behavior disorder, Parkinson's syndrome, Alzheimer's disease, etc .
  • the cannabinol receptor protein is highly expressed in the immune system of the body. Binding proteins act synergistically to regulate the activity of adenylate cyclase in the body, and in turn regulate various related immune system responses. The mutation or abnormal expression of this protein will directly lead to the normal progress of some immune system reactions in the body, and then cause various related immune system disorders and inflammatory reactions in various tissues and cells.
  • the expression profile of the polypeptide of the present invention is consistent with the expression profile of the human cannabinol receptor protein, and both have similar biological functions. It mainly mediates the pharmacological activity of cannabis in the body and is important for the regulation of neurotransmitters. In addition, it is also important for the regulation of the body's immune system and for the regulation of growth and development. Its abnormal expression is closely related to the occurrence of the pathological process of the above-mentioned tissue system, and produces related diseases.
  • abnormal expression of the human cannabinol receptor protein 7 of the present invention will produce various diseases, especially neuropsychiatric disorders, immune diseases, embryonic development disorders, growth disorders, inflammation, and various tumors. These diseases include, but are not limited to:
  • Neuropsychiatric disorders Alzheimer's disease, Parkinson's disease, chorea, depression, amnesia, Huntington's disease, epilepsy, migraine, multiple sclerosis, schizophrenia, depression, neurasthenia, nerves Muscle disease, neurocutaneous syndrome, trigeminal neuralgia, facial paralysis
  • Immune diseases Systemic lupus erythematosus, rheumatoid arthritis, bronchial asthma, urticaria, specific dermatitis, post-infection myocarditis, scleroderma, myasthenia gravis, Guillain-Barre syndrome, common variable immunodeficiency disease , Primary B-lymphocyte immunodeficiency disease, Acquired immunodeficiency syndrome
  • Fetal developmental disorders neural tube insufficiency, brain developmental abnormalities, neuronal migration disorders, congenital abortion, cleft palate, limb absentness, limb differentiation disorders, atrial septal defect, neural tube defects, congenital hydrocephalus, congenital glaucoma Or cataract, congenital deafness
  • Growth and development disorders mental retardation, brain development disorders, skin, fat and muscular dysplasia, bone and joint dysplasia, various metabolic deficiencies, stunting, dwarfism, Cushing syndrome, Sexual retardation
  • Tumors of various tissues neuroblastoma, astrocytoma, ependymoma, glioblastoma, neurofibromatosis, gastric cancer, liver cancer, lung cancer, esophageal cancer, breast cancer, leukemia, lymphoma, thyroid tumor, uterus Myoma
  • Inflammation chronic active hepatitis, sarcoidosis, polymyositis, chronic rhinitis, chronic gastritis, cerebrospinal multiple sclerosis, glomerulonephritis, myocarditis, cardiomyopathy, atherosclerosis, gastric ulcer, cervicitis, Various infectious inflammations Abnormal expression of the human cannabinol receptor protein 7 of the present invention may also cause certain genetic diseases and the like.
  • the polypeptide of the present invention and the antagonists, agonists and inhibitors of the polypeptide can be directly used in the treatment of diseases, for example, it can treat various diseases, especially neuropsychiatric disorders, immune diseases, embryonic development disorders, growth and development disorders. Disease, inflammation, various tumors, certain hereditary diseases, etc.
  • the polypeptide of the present invention and the antagonists, agonists and inhibitors of the polypeptide can be directly used for the treatment of mental disorders caused by psychoactive drugs,
  • the invention also provides methods for screening compounds to identify agents that increase (agonist) or suppress (antagonist) human cannabinol receptor protein 7.
  • Agonists enhance biological functions such as human cannabinol receptor protein 7 to stimulate cell proliferation, while antagonists prevent and treat disorders related to cell proliferation, such as various cancers.
  • mammalian cells or membrane preparations expressing human cannabinol receptor protein 7 can be cultured together with labeled human cannabinol receptor protein 7 in the presence of drugs. The ability of the drug to increase or block this interaction is then determined.
  • Antagonists of human cannabinol receptor protein 7 include antibodies, compounds, receptor deletions, and the like that have been screened. Antagonists of human cannabinol receptor protein 7 can bind to human cannabinol receptor protein 7 and eliminate its function, or inhibit the production of the polypeptide, or bind to the active site of the polypeptide so that the polypeptide cannot exert its biology Features.
  • human cannabinol receptor protein 7 can be added to bioanalytical assays to determine whether a compound is a compound by measuring its effect on the interaction between human cannabinol receptor protein 7 and its receptor. Antagonist. Receptor deletions and analogs that function as antagonists can be screened in the same manner as described above for screening compounds.
  • Polypeptide molecules capable of binding to human cannabinol receptor protein 7 can be obtained by screening a random peptide library composed of various possible combinations of amino acids bound to a solid phase. In screening, the human cannabinol receptor protein 7 molecule should generally be labeled.
  • the present invention provides a method for producing antibodies using polypeptides, and fragments, derivatives, analogs or cells thereof as antigens. These antibodies can be polyclonal or monoclonal antibodies.
  • the invention also provides antibodies against the human cannabinol receptor protein 7 epitope. These antibodies include (but are not limited to): polyclonal antibodies, monoclonal antibodies, chimeric antibodies, single chain antibodies, Fab fragments, and fragments generated from Fab expression libraries.
  • Polyclonal antibodies can be produced by injecting human cannabinol receptor protein 7 directly into immunized animals (such as rabbits, mice, rats, etc.).
  • immunized animals such as rabbits, mice, rats, etc.
  • a variety of adjuvants can be used to enhance the immune response, including but not limited to Freund's Agent.
  • Techniques for preparing monoclonal antibodies to human cannabinol receptor protein 7 include, but are not limited to, hybridoma technology (Kohler and Miste in. Nature, 1975, 256: 495-497), triple tumor technology, human beta cells Hybridoma technology, EBV-hybridoma technology, etc.
  • Chimeric antibodies that bind human constant regions and non-human-derived variable regions can be produced using existing techniques (Morri et al, PNAS, 1985, 81: 6851). And already The technology for producing single chain antibodies (US Pat No. 4946778) can also be used to produce single chain antibodies against human cannabinol receptor protein 7.
  • Antibodies to human cannabinol receptor protein 7 can be used in immunohistochemical techniques to detect human cannabinol receptor protein 7 in biopsy specimens.
  • Monoclonal antibodies that bind to human cannabinol receptor protein 7 can also be labeled with radioisotopes and injected into the body to track their location and distribution. This radiolabeled antibody can be used as a non-invasive diagnostic method to locate tumor cells and determine whether there is metastasis.
  • Antibodies can also be used to design immunotoxins that target a particular part of the body.
  • human cannabinol receptor protein 7 high affinity monoclonal antibodies can covalently bind to bacterial or plant toxins (such as diphtheria toxin, ricin, ormosine, etc.).
  • a common method is to attack the amino group of an antibody with a thiol cross-linking agent such as SPDP and bind the toxin to the antibody through the exchange of disulfide bonds.
  • This hybrid antibody can be used to kill human cannabinol receptor protein 7 positive cell.
  • the antibodies in the present invention can be used to treat or prevent diseases related to human cannabinol receptor protein 7.
  • Administration of an appropriate dose of the antibody can stimulate or block the production or activity of human cannabinol receptor protein 7.
  • the invention also relates to a diagnostic test method for quantitative and localized detection of human cannabinol receptor protein 7 levels.
  • tests are well known in the art and include FISH assays and radioimmunoassays.
  • the levels of human cannabinol receptor protein 7 detected in the test can be used to explain the importance of human cannabinol receptor protein 7 in various diseases and to diagnose diseases in which human cannabinol receptor protein 7 plays a role.
  • polypeptide of the present invention can also be used for peptide mapping analysis.
  • the polypeptide can be specifically cleaved by physical, chemical or enzymatic analysis, and subjected to one-dimensional or two-dimensional or three-dimensional gel electrophoresis analysis, more preferably mass spectrometry analysis.
  • human cannabinol receptor protein 7 can also be used for a variety of therapeutic purposes. Gene therapy technology can be used to treat abnormal cell proliferation, development or metabolism caused by the non-expression or abnormal / inactive expression of human cannabinoid receptor protein 7.
  • Recombinant gene therapy vectors (such as viral vectors) can be designed to express mutated human cannabinol receptor protein 7 to inhibit endogenous human cannabinol receptor protein 7 activity.
  • a mutated human cannabinol receptor protein 7 may be a shortened human cannabinol receptor protein 7, which lacks a signaling domain. Although it can bind to a downstream substrate, it lacks signaling activity.
  • recombinant gene therapy vectors can be used to treat diseases caused by abnormal expression or activity of human cannabinoid receptor protein 7.
  • Virus-derived expression vectors such as retrovirus, adenovirus, adenovirus-associated virus, herpes simplex virus, parvovirus, etc. can be used to transfer a polynucleotide encoding human cannabinol receptor protein 7 into cells. Construction method of carrying human cannabinoid receptor protein encoding polynucleotide of 7 recombinant viral vectors have been found in the literature (Sambr 0 ok, etal.) .
  • a recombinant polynucleotide encoding human cannabinol receptor protein 7 can be packaged into liposomes and transferred into cells.
  • Methods for introducing a polynucleotide into a tissue or cell include: directly injecting the polynucleotide into a tissue in vivo; or introducing the polynucleotide into a cell in vitro through a vector (such as a virus, phage, or plasmid), and then transplanting the cell Into the body and so on.
  • Oligonucleotides including antisense RNA and DNA
  • ribozymes that inhibit human cannabinol receptor protein 7 mRNA are also within the scope of the present invention.
  • a ribozyme is an enzyme-like RNA molecule that can specifically decompose specific RNA. Its mechanism of action is that the ribozyme molecule specifically hybridizes with a complementary target RNA for endonucleation.
  • Antisense RM, DM, and ribozymes can be obtained by any existing RNA or DNA synthesis technology, such as solid phase phosphoramidite chemical synthesis technology for oligonucleotide synthesis has been widely used.
  • Antisense RM molecules can be obtained by in vitro or in vivo transcription of a DNA sequence encoding the RNA. This DNA sequence has been integrated downstream of the RNA polymerase promoter of the vector. In order to increase the stability of the nucleic acid molecule, it can be modified in a variety of ways, such as increasing the sequence length on both sides, and the linkage between ribonucleosides using phosphorothioate or peptide bonds instead of phosphodiester bonds.
  • the polynucleotide encoding human cannabinol receptor protein 7 can be used for the diagnosis of diseases related to human cannabinol receptor protein 7.
  • the polynucleotide encoding human cannabinol receptor protein 7 can be used to detect the expression of human cannabinol receptor protein 7 or the abnormal expression of human cannabinol receptor protein 7 in a disease state.
  • a DNA sequence encoding human hemp alcohol receptor protein 7 can be used to hybridize biopsy specimens to determine the expression of human cannabinol receptor protein 7.
  • Hybridization techniques include Sout hern blotting, Nor thern blotting, and in situ hybridization. These techniques and methods are publicly available and mature, and related kits are commercially available.
  • a part or all of the polynucleotides of the present invention can be used as probes to be fixed on a micro array or a DNA chip (also called a "gene chip") for analyzing differential expression analysis and gene diagnosis of genes in tissues.
  • Human cannabinol receptor protein 7 specific primers for RNA-polymerase chain reaction (RT-PCR) in vitro amplification can also detect human cannabinol receptor protein 7 transcripts.
  • Human cannabinol receptor protein 7 mutations include point mutations, translocations, deletions, recombinations, and any other abnormalities compared to the normal wild-type human cannabinol receptor protein 7 DNA sequence. Mutations can be detected using existing techniques such as Sou thern blotting, DNA sequence analysis, PCR and in situ hybridization. In addition, mutations may affect protein expression. Therefore, Nor thern blotting and Western blotting can be used to indirectly determine whether a gene is mutated.
  • sequences of the invention are also valuable for chromosome identification. This sequence will specifically target a specific position on a human chromosome and can hybridize to it. Currently, specific sites for each gene on the chromosome need to be identified. Currently, only a few chromosome markers based on actual sequence data (repeating polymorphisms) are available for labeling chromosome positions. According to the present invention, in order to associate these sequences with disease-related genes, it The important first step is to locate these DNA sequences on the chromosome.
  • the PCR primers (preferably 15-35bp) are prepared based on the cDNA, and the sequences can be located on the chromosomes. These primers were then used for PCR screening of somatic hybrid cells containing individual human chromosomes. Only those heterozygous cells containing the human gene corresponding to the primer will produce amplified fragments.
  • PCR localization of somatic hybrid cells is a quick way to localize DNA to specific chromosomes.
  • oligonucleotide primers of the present invention in a similar manner, a set of fragments from a specific chromosome or a large number of genomic clones can be used to achieve sublocalization.
  • Other similar strategies that can be used for chromosomal localization include in situ hybridization, chromosome pre-screening with labeled flow sorting, and pre-selection of hybridization to construct chromosome-specific cDNA libraries.
  • Fluorescent in situ hybridization of cDNA clones with metaphase chromosomes allows precise chromosomal localization in one step.
  • FISH Fluorescent in situ hybridization
  • the difference in cDNA or genomic sequence between the affected and unaffected individuals needs to be determined. If a mutation is observed in some or all diseased individuals and the mutation is not observed in any normal individuals, the mutation may be the cause of the disease. Comparing affected and unaffected individuals usually involves first looking for structural changes in chromosomes, such as deletions or translocations that are visible at the chromosomal level or detectable with cDNA sequence-based PCR. According to the resolution capabilities of current physical mapping and gene mapping technology, the cDNA accurately mapped to the chromosomal region associated with the disease can be one of 50 to 500 potentially pathogenic genes (assuming 1 megabase mapping resolution) Capacity and each 20kb corresponds to a gene).
  • the polypeptides, polynucleotides and mimetics, agonists, antagonists and inhibitors of the present invention can be used in combination with a suitable pharmaceutical carrier.
  • suitable pharmaceutical carrier can be water, glucose, ethanol, salts, buffers, glycerol, and combinations thereof.
  • the composition comprises a safe and effective amount of the polypeptide or antagonist, and carriers and excipients which do not affect the effect of the drug. These compositions can be used as drugs for the treatment of diseases.
  • the present invention also provides a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the present invention.
  • a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the present invention.
  • these containers there may be instructional instructions given by government agencies that manufacture, use, or sell pharmaceuticals or biological products, which reminders authorize them to be administered to humans by government agencies that manufacture, use, or sell them.
  • the polypeptides of the invention can be combined with other Of therapeutic compounds.
  • the pharmaceutical composition can be administered in a convenient manner, such as by a topical, intravenous, intraperitoneal, intramuscular, subcutaneous, intranasal or intradermal route of administration.
  • Human cannabinol receptor protein 7 is administered in an amount effective to treat and / or prevent a specific indication.
  • the amount and dosage range of human cannabinol receptor protein 7 administered to a patient will depend on many factors, such as the mode of administration, the health conditions of the person to be treated, and the judgment of the diagnostician. Examples
  • Total RM of human fetal brain was extracted by one step method with guanidine isothiocyanate / phenol / chloroform.
  • Poly (A) mRNA was isolated from total RM using Quik mRNA I solat ion Kit (product of Qiegene). 2ug poly (A) mRNA is reverse transcribed to form cDNA.
  • the Smart cDNA Cloning Kit purchased from Clontech was used to insert the CDM fragment into the multiple cloning site of pBSK (+) vector (Clontech) to transform DH5a. The bacteria formed a cDNA library.
  • the sequences at the 5 'and 3' ends of all clones were determined using Dye terminate cyc le react ion sequencing kit (Perkin-Elmer) and ABI 377 automatic sequencer (Perkin-Elmer).
  • the determined cDNA sequence was compared with an existing public DM sequence database (Genebank), and it was found that the cDNA sequence of one of the clones 0 2 63 ⁇ 2 was a new DM.
  • a series of primers were synthesized to determine the inserted cDNA fragments of the clone in both directions.
  • CDNA was synthesized using fetal brain total RNA as a template and ol i go-dT as a primer for reverse transcription reaction. After purification with Qiagene's kit, PCR was performed using the following primers:
  • Pr imerl 5,-CAAGTTTTCCTGAAGCACAGGAGC —3, (SEQ ID NO: 3)
  • Pr imer2 5'- TTTACACAGACTTTATTTTTCACC -3 '(SEQ ID NO: 4)
  • Pr imer l is a forward sequence located at the 5th end of SEQ ID NO: 1, starting at lbp; Primer2 is the 3 'end reverse sequence in SEQ ID NO: 1.
  • Amplification conditions 50 mmol / L KC1, 10 ol / L Tris-HCl, pH 8.5, 1.5 mraol / L MgCl 2 , 200 ⁇ 1 / L dNTP, lOpmol primer, 1U Taq in a reaction volume of 50 ⁇ 1 DNA polymerase (Clontech).
  • the reaction was performed on a PE9600 DNA thermal cycler (Perkin-Elmer) for 25 cycles under the following conditions: 94 C 30sec; 55 C 30sec; 72 ° C 2min.
  • ⁇ -actin was set as a positive control and template blank was set as a negative control.
  • the amplified product was purified using a QIAGEN kit, and ligated to a pCR vector (Invitrogen product) using a TA cloning kit.
  • the DNA sequence analysis results showed that the DNA sequence of the PCR product was exactly the same as that of 1 to 1734bp shown in SEQ ID NO: 1.
  • Example 3 Northern blot analysis of human cannabinol receptor protein 7 gene expression
  • RNA extraction in one step [Anal. Biochem 1987, 162, 156-159] 0
  • This method involves acid guanidinium thiocyanate-chloroform extraction. That is, the tissue is homogenized with 4M guanidine isothiocyanate-25mM sodium citrate, 0.2M sodium acetate (pH4.0), and 1 volume of phenol and 1/5 volume of chloroform-isoamyl alcohol (49: 1 ), Mix and centrifuge. Aspirate the aqueous layer, add isopropanol (0.8 vol) and centrifuge the mixture to obtain RNA precipitate. The obtained RM precipitate was washed with 70% ethanol, dried and dissolved in water.
  • a 32P-labeled probe (about 2 x 10 6 cpm / ml) was hybridized with a nitrocellulose membrane to which RNA was transferred at 42 ° C overnight in a solution containing 501 ⁇ 2 formamide-25mM KH 2 P0 4 ( pH7.4)-5 ⁇ SSC-5 ⁇ Denhardt's solution and 20 ⁇ g / ml salmon sperm DNA. After hybridization, the filter was washed in lx SSC-0.1 ° /. SDS at 55 ° C for 30 minutes. Then, use Analysis and quantification by Phosphor Imager.
  • Example 4 In vitro expression, isolation and purification of recombinant human cannabinol receptor protein 7.
  • Primer3 5'- CCCCATATGATGGTGTCAGGTGGAGAACAGAGC -3 (Seq ID No: 5)
  • Primer4 5'- CATGGATCCTTACATCATGGAGTGTGGAGAGGG -3 '(Seq ID No: 6)
  • the 5' ends of these two primers contain Ndel and BamHI restriction sites, respectively.
  • the latter are the coding sequences of the 5 'and 3' ends of the gene of interest, respectively.
  • the Ndel and BamHI restriction sites correspond to the selectivity on the expression vector plasmid pET-28b (+) (Novagen, Cat. No. 69865. 3). Endonuclease site.
  • the PCR reaction was performed using the pBS-0263fl2 plasmid containing the full-length target gene as a template.
  • the PCR reaction conditions are: total volume 50 ⁇ 1 Containing plasmid pBS- 0263f 12 10pg, primer Pr imer- 3 and Pr imer- 4 are l Opmol, Advantage polymerase Mix (Clontech Products) 1 ⁇ 1.
  • Cycle parameters 94. C 20s, 60. C 30s, 68. C 2 min, a total of 25 cycles.
  • Ndel and BamHI were used to double digest the amplified product and plasmid pET-28 (+), respectively, and large fragments were recovered and ligated with T4 ligase. The ligated product was transformed into E.
  • the following peptides specific to human cannabinol receptor protein 7 were synthesized using a peptide synthesizer (product of PE company): NH2-Met-Va l-Ser-Gly-Gly-Glu-Gln-Ser-Asn-Leu-Pro-Ser -Glu-Gly-Asp-C00H (SEQ ID NO: 7).
  • the polypeptide is coupled to hemocyanin and bovine serum albumin to form a complex, respectively.
  • Suitable oligonucleotide fragments selected from the polynucleotides of the present invention are used as hybridization probes in a variety of ways.
  • the probes can be used to hybridize to genomic or cDNA libraries of normal tissue or pathological tissue from different sources to It is determined whether it contains the polynucleotide sequence of the present invention and a homologous polynucleotide sequence is detected.
  • the probe can be used to detect the polynucleotide sequence of the present invention or its homologous polynucleotide sequence in normal tissue or pathology. Whether the expression in tissue cells is abnormal.
  • the purpose of this embodiment is to select a suitable oligonucleotide fragment from the polynucleotide SEQ ID NO: 1 of the present invention as a hybridization probe, and to identify whether some tissues contain the polynucleoside of the present invention by a filter hybridization method.
  • Filter hybridization methods include dot blotting, Southern imprinting, Nor thern blotting, and copying methods. They all use the same steps to fix the polynucleotide sample to be tested on the filter and then hybridize.
  • the sample-immobilized filter is first pre-hybridized with a probe-free hybridization buffer to saturate the non-specific binding site of the sample on the filter with the carrier and the synthesized polymer.
  • the pre-hybridization solution is then replaced with a hybridization buffer containing labeled probes and incubated to hybridize the probes to the target nucleic acid.
  • the unhybridized probes are removed by a series of membrane washing steps.
  • This embodiment uses higher-intensity washing conditions (such as lower salt concentration and higher temperature) to reduce the hybridization background and retain only strong specific signals.
  • the probes used in this embodiment include two types: the first type of probes are oligonucleotide fragments that are completely the same as or complementary to the polynucleotide SEQ ID NO: 1 of the present invention; the second type of probes are partially related to the present invention
  • the polynucleotide SEQ ID NO: 1 is the same or complementary oligonucleotide fragment.
  • the dot blot method is used to fix the sample on the filter membrane. Under the high-intensity washing conditions, the first type of probe and the sample have the strongest hybridization specificity and are retained.
  • oligonucleotide fragments for use as hybridization probes from the polynucleotide SEQ ID NO: 1 of the present invention should follow the following principles and several aspects to be considered:
  • the preferred range of probe size is 18-50 nucleotides
  • GC content is 30 /. -70%, non-specific hybridization increases
  • Those that meet the above conditions can be used as primary selection probes, and then further computer sequence analysis, including the primary selection probe and its source sequence region (ie, SEQ ID NO: 1) and other known genomic sequences and their complements For homology comparison of the regions, if the homology with the non-target molecular region is greater than 85% or there are more than 15 consecutive bases, the primary probe should not be used generally;
  • Probe 1 which belongs to the first type of probe, is completely homologous or complementary to the gene fragment of SEQ ID NO: 1 (41Nt):
  • Probe 2 which belongs to the second type of probe, is equivalent to the gene fragment of SEQ ID NO: 1 or its Complementary Mutation Sequence of Complementary Fragment (41Nt):
  • PBS phosphate buffered saline
  • step 8-13 are only used when contamination must be removed, otherwise step 14 can be performed directly.
  • NC membrane nitrocellulose membrane
  • the sample membrane was placed in a plastic bag, and 3- 10 mg of prehybridization solution (10xDenhardt's; 6xSSC, 0.1 mg / ml CT DM (calf thymus DM)) was added. After sealing the mouth of the bag, shake at 68 ° C for 2 hours.
  • prehybridization solution 10xDenhardt's; 6xSSC, 0.1 mg / ml CT DM (calf thymus DM)
  • Gene chip or DNA microarray is a new technology that many national laboratories and large pharmaceutical companies are currently developing and developing. It refers to the orderly and high-density arrangement of large numbers of target gene fragments on glass, The data is compared and analyzed on a carrier such as silicon using fluorescence detection and computer software to achieve the purpose of rapid, efficient, and high-throughput analysis of biological information.
  • the polynucleotide of the present invention can be used as target DNA for gene chip technology for high-throughput research of new gene functions; finding and screening for tissue specificity New genes, especially those related to diseases such as tumors; Diagnosis of diseases, such as hereditary diseases.
  • the specific method steps have been reported in the literature. For example, see DeRisi, JL, Lyer, V. & Brown, P.0. (1997) Science 278, 680-686. And Helle, RA, Schema, M. ., Chai, A., Shalom, D., (1997) PNAS 94: 2150-2155.
  • a total of 4,000 polynucleotide sequences of various full-length cDMs are used as target DMs, including the polynucleotides of the present invention. They were amplified by PCR respectively. After purification, the concentration of the amplified product was adjusted to about 500 ng / ul, and spotted on a glass medium with a Cartesian 7500 spotter (purchased from Cartesian Company, USA), between the points The distance is 280 ⁇ . The spotted slides were hydrated and dried, cross-linked in a UV cross-linker, and dried after elution to fix the DNA on the glass slides to prepare chips. The specific method steps have been reported in the literature. The sample post-processing steps in this embodiment are:
  • the above specific tissues are thymus, testis, muscle, spleen, lung, skin, thyroid, liver, PMA + Ecv304 cell line, PMA-Ecv304 cell line, non-starved L02 cell line, Arsenic stimulated the L02 cell line and prostate tissue for 1 hour. Based on these 13 Cy3 / Cy5 ratios, draw a bar graph ( Figure 1). It can be seen from the figure that the expression profiles of human cannabinol receptor protein 7 and human central cannabinol receptor according to the present invention are very similar.

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Biochemistry (AREA)
  • Genetics & Genomics (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Toxicology (AREA)
  • Immunology (AREA)
  • Biophysics (AREA)
  • General Health & Medical Sciences (AREA)
  • Zoology (AREA)
  • Medicinal Chemistry (AREA)
  • Molecular Biology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Cell Biology (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Peptides Or Proteins (AREA)

Abstract

L'invention concerne un nouveau polypeptide, une protéine humaine de réception cannabinoïde 7, et un polynucléotide codant pour ce polypeptide ainsi qu'un procédé d'obtention de ce polypeptide par des techniques recombinantes d'ADN. L'invention concerne en outre les applications de ce polypeptide dans le traitement de maladies, notamment des troubles neuropsychiques, des maladies immunes, des troubles du développement, des inflammations, de toutes sortes de tumeurs malignes, de l'infection par VIH et surtout des troubles psychiques pouvant être traités par des médicaments associés actifs. L'invention concerne aussi l'antagoniste agissant contre le polypeptide et son action thérapeutique ainsi que les applications de ce polynucléotide codant pour la protéine humaine de réception cannabinoïde 7.
PCT/CN2001/000235 2000-03-15 2001-02-26 Nouveau polypeptide, proteine humaine de reception cannabinoide 7, et polynucleotide codant pour ce polypeptide WO2001068693A1 (fr)

Priority Applications (1)

Application Number Priority Date Filing Date Title
AU42249/01A AU4224901A (en) 2000-03-15 2001-02-26 A novel polypeptide, human cannabinoid receptor protein 7 and the polynucleotideencoding thereof

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
CN 00114904 CN1313321A (zh) 2000-03-15 2000-03-15 一种新的多肽——人大麻醇受体蛋白7和编码这种多肽的多核苷酸
CN00114904.0 2000-03-15

Publications (2)

Publication Number Publication Date
WO2001068693A1 true WO2001068693A1 (fr) 2001-09-20
WO2001068693A8 WO2001068693A8 (fr) 2001-11-01

Family

ID=4584379

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/CN2001/000235 WO2001068693A1 (fr) 2000-03-15 2001-02-26 Nouveau polypeptide, proteine humaine de reception cannabinoide 7, et polynucleotide codant pour ce polypeptide

Country Status (3)

Country Link
CN (1) CN1313321A (fr)
AU (1) AU4224901A (fr)
WO (1) WO2001068693A1 (fr)

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
D. GADZICKI ET AL.: "A frequent polymorphism in the coding exon of the human cannabinoid receptor (CNR1) gene", MOL. CELL PROBES, vol. 13, no. 4, August 1999 (1999-08-01), pages 321 - 323 *
M. BOUABOULA ET AL.: "Stimulation of cannabinoid receptor CB1 induces krox-24 expression in human astrocytoma cells", J. BIOL. CHEM., vol. 270, no. 23, 9 June 1995 (1995-06-09), pages 13973 - 13980 *

Also Published As

Publication number Publication date
AU4224901A (en) 2001-09-24
WO2001068693A8 (fr) 2001-11-01
CN1313321A (zh) 2001-09-19

Similar Documents

Publication Publication Date Title
WO2001072786A1 (fr) Nouveau polypeptide, facteur d'inhibition tumorale 63, et polynucleotide codant pour ce polypeptide
WO2001083688A2 (fr) Nouveau polypeptide, sous-unite humaine 13 phosphatidylinositol-4-phosphate-5-kinase ii beta, et polynucleotide codant pour ce polypeptide
WO2001074888A1 (fr) Nouveau polypeptide, $g(b)-preprotachykinine humaine 9, et polynucleotide codant pour ce polypeptide
WO2001083538A1 (fr) Nouveau polypeptide, proteine humaine 36 du gene k-ras, et polynucleotide codant pour ce polypeptide
WO2001088084A2 (fr) Nouveau polypeptide, superoxyde dismutase 11, et polynucleotide codant pour ce polypeptide
WO2001068693A1 (fr) Nouveau polypeptide, proteine humaine de reception cannabinoide 7, et polynucleotide codant pour ce polypeptide
WO2001068873A1 (fr) Nouveau polypeptide, molecule humaine d'adhesion intercellulaire 12, et polynucleotide codant pour ce polypeptide
WO2001064721A1 (fr) Nouveau polypeptide, adenosine triphosphatase 30, et polynucleotide codant pour ce polypeptide
WO2001079423A2 (fr) Nouveau polypeptide, proteine humaine bcr 10, et polynucleotide codant pour ce polypeptide
WO2001072801A1 (fr) Nouveau polypeptide, proteine ribosomale humaine s11 12, et polynucleotide codant pour ce polypeptide
WO2001083679A2 (fr) Nouveau polypeptide, recepteur central humain de cannabinoide 9, et polynucleotide codant pour ce polypeptide
WO2001079432A2 (fr) Nouveau polypeptide, facteur humain de transcription de la differentiation cellulaire 58, et polynucleotide codant pour ce polypeptide
WO2001068874A1 (fr) Nouveau polypeptide, polypeptide humain d'activation endotheliale ii-62, et polynucleotide codant pour ce polypeptide
WO2001074997A2 (fr) Nouveau polypeptide, proteine humaine de reception cannabinoide 11, et polynucleotide codant pour ce polypeptide
WO2001087950A1 (fr) Nouveau polypeptide, recepteur cannabinoide humain 11, et polynucleotide codant pour ce polypeptide
WO2001079439A2 (fr) Nouveau polypeptide, proteine humaine de reception cannabinoide 19, et un polynucleotide codant pour ce polypeptide
WO2001079491A1 (fr) Nouveau polypeptide, canal ionique humain 12 pour le chlore, et polynucleotide codant pour ce polypeptide
WO2001070983A1 (fr) Nouveau polypeptide, proteine antigene prostatique specifique membranaire 9, et polynucleotide codant pour ce polypeptide
WO2001073061A1 (fr) Nouveau polypeptide, proteine humaine 22 du retinoblastome, et polynucleotide codant pour ce polypeptide
WO2001075024A2 (fr) Nouveau polypeptide, facteur humain 13 associe a nf-e2, et polynucleotide codant pour ce polypeptide
WO2001072789A1 (fr) Nouveau polypeptide, proteine humaine a doigt de zinc 10, et polynucleotide codant pour ce polypeptide
WO2001079425A2 (fr) Nouveau polypeptide, canal ionique humain 10 pour le chlore, et polynucleotide codant pour ce polypeptide
WO2001072792A1 (fr) Nouveau polypeptide, proteine humaine 13 analogue a l'ubiquitine, et polynucleotide codant pour ce polypeptide
WO2001075002A2 (fr) Nouveau polypeptide, gène de regulation du cycle cellulaire humain 28, et polynucléotide codant pour ce polypeptide
WO2001081537A2 (fr) Nouveau polypeptide, sous-unite 49 humaine du facteur c(a1) 37kd de replication de l'adn, et polynucleotide codant pour ce polypeptide

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG

AK Designated states

Kind code of ref document: C1

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW

AL Designated countries for regional patents

Kind code of ref document: C1

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG

CFP Corrected version of a pamphlet front page

Free format text: UNDER (57) PUBLISHED ABSTRACT IN ENGLISH REPLACED BY CORRECT ABSTRACT

121 Ep: the epo has been informed by wipo that ep was designated in this application
REG Reference to national code

Ref country code: DE

Ref legal event code: 8642

122 Ep: pct application non-entry in european phase
NENP Non-entry into the national phase

Ref country code: JP