WO2001047982A1 - Nouveau polypeptide, support mitochondrial 30, et polynucleotide codant pour ce polypeptide - Google Patents

Nouveau polypeptide, support mitochondrial 30, et polynucleotide codant pour ce polypeptide Download PDF

Info

Publication number
WO2001047982A1
WO2001047982A1 PCT/CN2000/000516 CN0000516W WO0147982A1 WO 2001047982 A1 WO2001047982 A1 WO 2001047982A1 CN 0000516 W CN0000516 W CN 0000516W WO 0147982 A1 WO0147982 A1 WO 0147982A1
Authority
WO
WIPO (PCT)
Prior art keywords
polypeptide
polynucleotide
mitochondrial
sequence
vector
Prior art date
Application number
PCT/CN2000/000516
Other languages
English (en)
Chinese (zh)
Inventor
Yumin Mao
Yi Xie
Original Assignee
Bioroad Gene Development Ltd. Shanghai
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Bioroad Gene Development Ltd. Shanghai filed Critical Bioroad Gene Development Ltd. Shanghai
Priority to AU16897/01A priority Critical patent/AU1689701A/en
Publication of WO2001047982A1 publication Critical patent/WO2001047982A1/fr

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/47Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00Medicinal preparations containing peptides

Definitions

  • the present invention belongs to the field of biotechnology. Specifically, the present invention describes a new polypeptide, a mitochondrial vector 30, and a polynucleotide sequence encoding the polypeptide. The invention also relates to methods and applications for preparing such polynucleotides and polypeptides. Background technique
  • the members of this family are composed of three repeated sequences in tandem, each repeating about 100 amino acid residues, which contains two putative ⁇ -transmembrane helixes, both of which are hydrophobic and extended by one
  • the hydrophilic regions (A, B, and C) are separated, and the three tandem repeats are connected by shorter hydrophilic amino acid sequences ('and b').
  • the main structural model of this protein family is as follows: The N- and C-terminus of the polypeptide chain are exposed on the same side of the membrane, and three long hydrophilic fragments, B, C) are located on one side of the membrane (opposite the N- and C-termini) ), Two short hydrophilic fragments a 'and b' are on the other side.
  • the mitochondrial carrier 30 protein plays an important role in important functions of the body as described above, and it is believed that a large number of proteins are involved in these regulatory processes, there has been a need in the art to identify more mitochondrial carrier 30 proteins involved in these processes, especially to identify Amino acid sequence of several proteins.
  • the isolation of the new mitochondrial vector 3 ⁇ protein-coding gene also provides a basis for research to determine the role of the protein in health and disease states. This protein may form the basis for the development of diagnostic and / or therapeutic drugs for diseases, so the isolation of its coding DNA is very important. Disclosure of invention It is an object of the present invention to provide an isolated new polypeptide, a mitochondrial carrier 30, and fragments, analogs and derivatives thereof.
  • Another object of the invention is to provide a polynucleotide encoding the polypeptide.
  • Another object of the present invention is to provide a recombinant vector containing a polynucleotide encoding a mitochondrial vector 30.
  • Another object of the present invention is to provide a genetically engineered host cell comprising a polynucleotide encoding a mitochondrial vector 30.
  • Another object of the present invention is to provide a method for producing a mitochondrial carrier 30.
  • Another object of the present invention is to provide antibodies against the polypeptide-to-mitochondrial carrier 30 of the present invention.
  • Another object of the present invention is to provide mimetic compounds, antagonists, agonists, and inhibitors of the polypeptide-to-mitochondrial carrier 30 of the present invention.
  • Another object of the present invention is to provide a method for diagnosing and treating diseases associated with abnormalities of the mitochondrial carrier 30.
  • the present invention relates to an isolated polypeptide, which is of human origin, and includes: a polypeptide having the amino acid sequence of SEQ ID No. 2, Or a conservative variant, biologically active fragment or derivative thereof.
  • the polypeptide is a polypeptide having the amino acid sequence of SEQ ID NO: 2.
  • the invention also relates to an isolated polynucleotide comprising a nucleotide sequence or a variant thereof selected from the group consisting of:
  • sequence of the polynucleotide is one selected from the group consisting of: (a) a sequence having positions 17 to 841 in SEQ ID NO: 1; and (b) a sequence having positions 1 to 11 in SEQ ID NO: 1 A sequence of 10 bits.
  • the invention further relates to a vector, in particular an expression vector, containing the polynucleotide of the invention; a host cell genetically engineered with the vector, including a transformed, transduced or transfected host cell; and a method comprising culturing said Host cell and method of preparing the polypeptide of the present invention by recovering the expression product.
  • a vector in particular an expression vector, containing the polynucleotide of the invention
  • a host cell genetically engineered with the vector including a transformed, transduced or transfected host cell
  • a method comprising culturing said Host cell and method of preparing the polypeptide of the present invention by recovering the expression product.
  • the invention also relates to an antibody capable of specifically binding to a polypeptide of the invention.
  • the invention also relates to a method for screening compounds that mimic, activate, antagonize or inhibit the activity of the mitochondrial carrier 30 protein, which comprises utilizing a polypeptide of the invention.
  • the present invention also relates to a compound obtained by the method.
  • the present invention also relates to a method for detecting a disease or disease susceptibility related to abnormal expression of a mitochondrial carrier 30 protein in vitro, comprising detecting the polypeptide or a polynucleotide sequence encoding the same in a biological sample Mutations, or the amount or biological activity of a polypeptide of the invention in a biological sample.
  • the invention also relates to a pharmaceutical composition
  • a pharmaceutical composition comprising a polypeptide of the invention or a mimetic thereof, an activator, an antagonist or an inhibitor, and a pharmaceutically acceptable carrier.
  • the present invention also relates to the use of the polypeptide and / or polynucleotide of the present invention in the preparation of a medicament for treating cancer, developmental disease or immune disease or other diseases caused by abnormal expression of mitochondrial vector 30.
  • Nucleic acid sequence refers to an oligonucleotide, a nucleotide or a polynucleotide and a fragment or part thereof, and may also refer to a genomic or synthetic DNA or RNA, they can be single-stranded or double-stranded, representing the sense or antisense strand.
  • amino acid sequence refers to an oligopeptide, peptide, polypeptide or protein sequence and fragments or portions thereof.
  • amino acid sequence in the present invention relates to the amino acid sequence of a naturally occurring protein molecule, such "polypeptide” or “protein” does not mean to limit the amino acid sequence to a complete natural amino acid related to the protein molecule .
  • a protein or polynucleotide “variant” refers to an amino acid sequence having one or more amino acid or nucleotide changes or a polynucleotide sequence encoding it. The changes may include deletions, insertions or substitutions of amino acids or nucleotides in the amino acid sequence or nucleotide sequence. Variants can have "conservative" changes in which the substituted amino acid has a structural or chemical property similar to the original amino acid, such as the replacement of isoleucine with leucine. Variants can also have non-conservative changes, such as replacing glycine with tryptophan.
  • “Deletion” refers to the deletion of one or more amino acids or nucleotides in an amino acid sequence or nucleotide sequence.
  • Insertion refers to an alteration in the amino acid sequence or nucleotide sequence that results in an increase in one or more amino acids or nucleotides compared to a naturally occurring molecule.
  • Replacement refers to the replacement of one or more amino acids or nucleotides with different amino acids or nucleotides.
  • Bioactivity refers to proteins with the structural, regulatory, or biochemical functions of natural molecules.
  • immunological activity refers to natural, recombinant, or synthetic proteins and fragments thereof that induce specific Immune response and ability to bind specific antibodies.
  • An "agonist” refers to a molecule that, when combined with a mitochondrial carrier 30, can cause the protein to change, thereby regulating the activity of the protein.
  • An agonist may include a protein, a nucleic acid, a carbohydrate or any other molecule that can bind to the mitochondrial carrier 30.
  • Antagonist refers to a molecule that can block or regulate the biological or immunological activity of the mitochondrial carrier 30 when combined with the mitochondrial carrier 30.
  • Antagonists and inhibitors may include proteins, nucleic acids, carbohydrates, or any other molecule that can bind to the mitochondrial carrier 30.
  • Regular refers to a change in the function of the mitochondrial carrier 30, including an increase or decrease in protein activity, Changes in binding properties and any other biological, functional or immune properties of the mitochondrial carrier 30.
  • Substantially pure ' means substantially free of other proteins, lipids, sugars or other substances with which it is naturally associated.
  • Those skilled in the art can purify the mitochondrial carrier 30 using standard protein purification techniques. Essentially pure mitochondria Carrier 30 can generate a single main band on a non-reducing polyacrylamide gel. The purity of mitochondrial carrier 30 polypeptide can be analyzed by amino acid sequence.
  • Complementary refers to the natural binding of a nucleotide by base-pairing under conditions of acceptable salt concentration and temperature.
  • sequence "C-T-G-A” can be combined with the complementary sequence "G-A-C-T”.
  • the complementarity between two single-stranded molecules may be partial or complete.
  • the degree of complementarity between nucleic acid strands has a significant effect on the efficiency and strength of hybridization between nucleic acid strands.
  • “Homology” refers to the degree of complementarity and can be partially homologous or completely homologous.
  • Partial homology refers to a partially complementary sequence that at least partially inhibits hybridization of a fully complementary sequence to a target nucleic acid. This inhibition of hybridization can be detected by performing hybridization (Southern blotting or Nor thern blotting, etc.) under conditions of reduced stringency.
  • Substantially homologous sequences or hybridization probes can compete and inhibit the binding of completely homologous sequences to the target sequence under conditions of reduced stringency. This does not mean that the conditions of reduced stringency allow non-specific binding, because the conditions of reduced stringency require that the two sequences bind to each other specifically or selectively.
  • Percent identity refers to the percentage of sequences that are the same or similar in the comparison of two or more amino acid or nucleic acid sequences. The percent identity can be determined electronically, such as by the MEGALIGN program (Lasergene sof tware package, DNASTAR, Inc., Mad Son Wis.). The MEGALIGN program can compare two or more sequences (Higg ins, I). G. and P. M. Sharp (1988) Gene 73: 237-244) according to different methods such as the Cluster method. The Cluster method arranges groups of sequences into clusters by checking the distance between all pairs, and then assigns the clusters in pairs or groups. The percent identity between two amino acid sequences such as sequence A and sequence B is calculated by the following formula: The number of matching residues between sequence A and sequence B
  • the percent identity between nucleic acid sequences can also be determined by the Cluster method or by methods known in the art such as Jotun He in (He in J., (1990) Methods in emzumo logy 183: 625-645),
  • Similarity refers to the degree of identical or conservative substitutions of amino acid residues at corresponding positions in the alignment of amino acid sequences.
  • Amino acids used for conservative substitutions for example, negatively charged amino acids may include aspartic acid and glutamic acid; positively charged amino acids may include lysine and arginine; having an uncharged head
  • Amino acids with similar hydrophilic groups may include leucine, isoleucine and valine; glycine and alanine; asparagine and glutamine; serine and threonine; phenylalanine and casein Amino acid.
  • Antisense refers to a nucleotide sequence that is complementary to a specific DNA or F (NA sequence.
  • Antisense strand refers to a nucleic acid strand that is complementary to a “sense strand.”
  • Derivative refers to a chemical modification of HFP or a nucleic acid encoding it. Such a chemical modification may be the replacement of a hydrogen atom with an alkyl group, an acyl group or an amino group. Nucleic acid derivatives can encode polypeptides that retain the main biological characteristics of natural molecules.
  • Antibody refers to a complete antibody molecule and its fragments, such as Fa,? ( ⁇ ') 2 and? ⁇ It can specifically bind to the epitope of mitochondrial carrier 30.
  • a “humanized antibody” refers to an antibody in which the amino acid sequence of a non-antigen binding region is replaced to become more similar to a human antibody, but still retains the original binding activity.
  • isolated refers to the removal of a substance from its original environment (for example, its natural environment if it occurs naturally).
  • a naturally occurring polynucleotide or polypeptide is not isolated when it is present in a living animal, but the same polynucleotide or polypeptide is separated from some or all of the substances that coexist with it in the natural system.
  • Such a polynucleotide may be part of a vector, or such a polynucleotide or polypeptide may be part of a composition. Since the carrier or composition is not part of its natural environment, they are still isolated.
  • isolated refers to the separation of a substance from its original environment (if it is a natural substance, the original environment is the natural environment).
  • polynucleotides and polypeptides in a natural state in a living cell are not isolated and purified, but the same polynucleotides or polypeptides are separated and purified if they are separated from other substances existing in the natural state. .
  • isolated mitochondrial carrier 30 means that the mitochondrial carrier 30 is substantially free of other proteins, lipids, sugars, or other substances with which it is naturally associated. Those skilled in the art can purify the mitochondrial carrier 30 using standard protein purification techniques. Substantially pure polypeptides can produce a single main band on a non-reducing polyacrylamide gel. The purity of the mitochondrial carrier 30 polypeptide can be analyzed by amino acid sequence.
  • the present invention provides a novel polypeptide mitochondrial vector 30, which is basically composed of the amino acid sequence shown in SEQ II) NO: 2.
  • the polypeptide of the present invention may be a recombinant polypeptide, a natural polypeptide, or a synthetic polypeptide, and preferably a recombinant polypeptide.
  • the polypeptides of the present invention can be naturally purified products or chemically synthesized products, or can be produced from prokaryotic or eukaryotic hosts (eg, bacteria, yeast, higher plants, insects, and mammalian cells) using recombinant techniques. According to the host used in the recombinant production scheme, the polypeptide of the present invention may be glycosylated or may be non-glycosylated.
  • the polypeptide of the present invention may also include or not include the initial methionine residue
  • the invention also includes fragments, derivatives and analogs of the mitochondrial vector 30.
  • fragment refers to a polypeptide that substantially maintains the same biological function or activity of the mitochondrial carrier 30 of the present invention.
  • a fragment, derivative or analog of the polypeptide of the present invention may be: (I) a kind in which one or more amino acid residues are substituted with conservative or non-conservative amino acid residues (preferably conservative amino acid residues), and the substitution
  • the amino acid may or may not be encoded by a genetic codon; or ( ⁇ ) such a type in which a group on one or more amino acid residues is substituted by another group to include a substituent; or UII) such a Species, wherein the mature polypeptide is fused with another compound (such as a compound that extends the half-life of the polypeptide, such as polyethylene glycol); or (IV) a polypeptide sequence in which an additional amino acid sequence is fused into a mature polypeptide (such as Leader sequences or secreted sequences or sequences used to purify this polypeptide or protease sequences)
  • an additional amino acid sequence is fused into a mature polypeptide (such as Leader sequences or secreted sequences or sequences used
  • the present invention provides an isolated nucleic acid (polynucleotide), which basically consists of a polynucleotide encoding a polypeptide having the amino acid sequence of SEQ: NO: 2.
  • the polynucleotide sequence of the present invention includes the nucleotide sequence of SEQ ID NO: 1.
  • the polynucleotide of the present invention is found from a cDNA library of human fetal brain tissue. It contains a full-length polynucleotide sequence of 1110 bases, and its open reading frame (17-841) encodes 274 amino acids.
  • This polypeptide has the characteristic sequence of a mitochondrial vector. It can be inferred that the mitochondrial vector 30 is represented by a mitochondrial vector Structure and function.
  • the polynucleotide of the present invention may be in the form of DNA or RNA.
  • DNA forms include cDNA, genomic DNA, or synthetic DNA.
  • DNA can be single-stranded or double-stranded.
  • DM can be coded or uncoded.
  • the coding region sequence encoding a mature polypeptide may be the same as the coding region sequence shown in SEQ ID NO: 1 or a degenerate variant.
  • "degenerate variant" in the present invention refers to a nucleic acid sequence encoding a protein or polypeptide having SEQ ID NO: 2 but different from the coding region sequence shown in SEQ ID NO: 1.
  • the polynucleotide encoding the mature polypeptide of SEQ ID NO: 2 includes: only the coding sequence of the mature polypeptide; the coding sequence of the mature polypeptide and various additional coding sequences; the coding sequence of the mature polypeptide (and optional additional coding sequences); Coding sequence.
  • polynucleotide encoding a polypeptide refers to a polynucleotide that includes the polypeptide and a polynucleotide that includes additional coding and / or non-coding sequences.
  • the invention also relates to variants of the polynucleotides described above, which encode polypeptides or fragments, analogs and derivatives of polypeptides having the same amino acid sequence as the invention.
  • Variants of this polynucleotide may be naturally occurring allelic variants or non-naturally occurring variants. These nucleotide variants include substitution variants, deletion variants, and insertion variants.
  • an allelic variant is a replacement form of a polynucleotide that may be a substitution, deletion, or insertion of one or more nucleotides, but does not substantially change its editing The function of the polypeptide.
  • the invention also relates to a polynucleotide that hybridizes to the sequence described above (having at least 50%, preferably 70% identity between the two sequences).
  • the present invention particularly relates to polynucleotides that can hybridize to the polynucleotides of the present invention under stringent conditions.
  • “strict conditions” means: (1) hybridization and elution at lower ionic strength and higher temperature, such as 0.2xSSC, 0.1% SDS, 6 (TC; or (2) added during hybridization) Use a denaturant, such as 50% (v / v) formamide, 0.1% calf serum / 0.1% Ficoll, 42 ° C, etc .; or (3) the identity between the two sequences is at least 95% Above, it is more preferable that the hybridization occurs at 97% or more.
  • the polypeptide encoded by the hybridizable polynucleotide has the same biological function and activity as the mature polypeptide shown in SEQ ID NO: 2.
  • nucleic acid fragments that hybridize to the sequences described above.
  • a "nucleic acid fragment” contains at least 10 nucleotides in length, preferably at least 20-30 nucleotides, more preferably at least 50-60 nucleotides, and most preferably at least 100 cores. Glycylic acid or more. Nucleic acid fragments can also be used in nucleic acid amplification techniques such as PCR to identify and / or isolate polynucleotides encoding the mitochondrial vector 30.
  • polypeptides and polynucleotides in the present invention are preferably provided in an isolated form and are more preferably purified to homogeneity.
  • the specific polynucleotide sequence encoding the mitochondrial vector 30 of the present invention can be obtained by various methods.
  • polynucleotides are isolated using hybridization techniques well known in the art. These techniques include, but are not limited to: 1) hybridization of probes to genomic or cDNA libraries to detect homologous polynucleotide sequences, and 2) antibody screening of expression libraries to detect cloned polynucleosides with common structural characteristics Acid fragments.
  • the DNA fragment sequence of the present invention can also be obtained by the following methods: 1) isolating the double-stranded DNA sequence from the genomic DNA; 2) chemically synthesizing the DNA sequence to obtain the double-stranded DNA of the polypeptide.
  • genomic DNA isolation is the least commonly used. Direct chemical synthesis of DNA sequences is often the method of choice. The more commonly used method is the isolation of cDNA sequences.
  • the standard method for isolating the cDNA of interest is to isolate mRNA from donor cells that overexpress the gene and perform reverse transcription to form a plasmid or phage cDNA library. There are many mature techniques for extracting mRNA, and kits are also commercially available (Qiagene).
  • the construction of cDNA libraries is also a common method (Sambrook, et al., Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory. New York, 1989).
  • Commercially available cDNA libraries are also available, such as different cDNA libraries from Clontech. When polymerase reaction technology is used in combination, even very few expression products can be cloned.
  • genes of the present invention can be selected from these cDNA libraries by conventional methods. These methods include (but are not limited to): (l) DNA-DNA or DNA-RM hybridization; (2) the presence or loss of marker gene function; (3) measuring the level of mitochondrial vector 30 transcripts; (4) by immunization Technology or measurement of biological activity to detect gene-expressed protein products. The above methods can be used singly or in combination.
  • the probe used for hybridization is the same as any part of the polynucleotide of the present invention.
  • the source has a length of at least 10 nucleotides, preferably at least 30 nucleotides, more preferably at least 50 nucleotides, and most preferably at least 100 nucleotides.
  • the length of the probe is usually within 2000 nucleotides, preferably within 1000 nucleotides.
  • the probe used herein is generally a DNA sequence chemically synthesized based on the gene sequence information of the present invention.
  • the genes or fragments of the present invention can of course be used as probes.
  • DNA probes can be labeled with radioisotopes, luciferin, or enzymes (such as alkaline phosphatase).
  • immunological techniques such as Western blotting, radioimmunoprecipitation, and enzyme-linked immunosorbent assay (ELISA) can be used to detect protein products expressed by the mitochondrial vector 30 gene.
  • ELISA enzyme-linked immunosorbent assay
  • a method of applying a PCR technique to amplify DNA / RNA is preferably used to obtain the gene of the present invention.
  • the RACE method RACE-Rapid Amplification of cDNA Ends
  • the primers used for PCR can be appropriately based on the polynucleotide sequence information of the present invention disclosed herein. Select and synthesize using conventional methods.
  • the amplified DNA / RNA fragments can be isolated and purified by conventional methods such as by gel electrophoresis.
  • the polynucleotide sequence of the gene of the present invention or various DNA fragments and the like obtained as described above can be determined by conventional methods such as dideoxy chain termination method (Sanger et al. PNAS, 1977, 74: 5463-5467). Acid sequencing can also be performed using commercial sequencing kits and the like. In order to obtain the full-length cDNA sequence, the sequencing must be repeated. Sometimes it is necessary to determine the cDNA sequence of multiple clones in order to splice into a full-length cDNA sequence.
  • the present invention also relates to a vector comprising the polynucleotide of the present invention, and a host cell genetically engineered using the vector of the present invention or directly using the mitochondrial vector 30 coding sequence, and a method for producing the polypeptide of the present invention by recombinant technology.
  • the polynucleotide sequence encoding the mitochondrial vector 30 may be inserted into the vector to constitute a recombinant vector containing the polynucleotide of the present invention.
  • vector refers to bacterial plasmids, phages, yeast plasmids, plant cell viruses, mammalian cell viruses such as adenoviruses, retroviruses, or other vectors well known in the art.
  • Vectors suitable for use in the present invention include, but are not limited to: T7 promoter-based expression vectors (Rosenberg, et al.
  • any plasmid and vector can be used to construct a recombinant expression vector.
  • An important feature of expression vectors is that they usually contain an origin of replication, a promoter, a marker gene, and translational regulatory elements.
  • Methods well known to those skilled in the art can be used to construct expression vectors containing a DNA sequence encoding a mitochondrial vector 30 and appropriate transcriptional / translational regulatory elements. These methods include in vitro recombinant DNA technology, DNA synthesis technology, and in vivo recombination technology (Sambroook, et al. Molecular Cloning, a Labora tory Manua 1, cold Spr ing Harbor Labora tory. New York, 1989).
  • the DNA sequence can be operably linked to an appropriate promoter in an expression vector to guide mRNA synthesis. Representative examples of these promoters are: the l ac or trp promoter of E.
  • the expression vector also includes a ribosome binding site and a transcription terminator for translation initiation. Insertion of enhancer sequences into the vector will enhance its transcription in higher eukaryotic cells. Enhancers are cis-acting factors for DNA expression, usually about 10 to 300 base pairs, which act on promoters to enhance gene transcription. Illustrative examples include SV40 enhancers of 100 to 270 base pairs on the late side of the origin of replication, polyoma enhancers on the late side of the origin of replication, and adenoviral enhancers.
  • the expression vector preferably contains one or more selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
  • selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
  • GFP fluorescent protein
  • tetracycline or ampicillin resistance for E. coli.
  • the polynucleotide encoding the mitochondrial vector 30 or a recombinant vector containing the polynucleotide can be transformed or transduced into a host cell to constitute a genetically engineered host cell containing the polynucleotide or the recombinant vector.
  • host cell refers to a prokaryotic cell, such as a bacterial cell; or a lower eukaryotic cell, such as a yeast cell; or a higher eukaryotic cell, such as a mammalian cell.
  • Escherichia coli, Streptomyces bacterial cells such as Salmonella typhimurium
  • fungal cells such as yeast
  • plant cells insect cells
  • fly S2 or Sf 9 animal cells
  • animal cells such as CH0, COS or Bowes melanoma cells.
  • Transformation of a host cell with a DNA sequence described in the present invention or a recombinant vector containing the DNA sequence can be performed using conventional techniques well known to those skilled in the art.
  • the host is a prokaryote such as E. coli
  • competent cells capable of absorbing DNA can be harvested after the exponential growth phase and treated with CaC I.
  • the steps used are well known in the art.
  • the alternative is to use MgC l 2 .
  • transformation can also be performed by electroporation.
  • the following DNA transfection methods can be used: calcium phosphate co-precipitation method, or conventional mechanical methods such as microinjection, electroporation, and liposome packaging.
  • the polynucleotide sequence of the present invention can be used to express or produce a recombinant mitochondrial vector 30 (Sc ience, 1984; 224: 1431). In general, there are the following steps:
  • the medium used in the culture may be selected from various conventional mediums. Culture is performed under conditions suitable for host cell growth. After the host cells have grown to an appropriate cell density, the selected promoter is induced by a suitable method (such as temperature conversion or chemical induction), and the cells are cultured for a period of time.
  • a suitable method such as temperature conversion or chemical induction
  • the recombinant polypeptide may be coated in a cell, expressed on a cell membrane, or secreted outside the cell.
  • recombinant proteins can be separated and purified by various separation methods using their physical, chemical and other properties. These methods are well known to those skilled in the art. These methods include, but are not limited to: conventional renaturation treatment, protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid chromatography (HPLC) and various other liquid chromatography techniques and combinations of these methods.
  • conventional renaturation treatment protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid chromatography
  • Fig. 1 is a comparison diagram of homology of the amino acid sequence of a total of 50 amino acids in the mitochondrial vector 30 of the present invention from 6 to 56 and the amino acid sequence of the mitochondrial vector domain.
  • the upper sequence is the mitochondrial vector 30, and the lower sequence is the mitochondrial vector domain.
  • Figure 2 shows the polyacrylamide gel electrophoresis (SDS-PAGE) of the isolated mitochondrial carrier 30.
  • 30kl) a is the molecular weight of the protein.
  • the arrow indicates the isolated protein band.
  • RNA from human fetal brain was extracted by guanidine isothiocyanate / phenol / chloroform method.
  • Poly (A) raRNA was isolated from total RNA using Quik mRNA Isolation Kit (Qiegene). 2ug poly (A) mRNA is reverse transcribed CDNA is formed. Use Smart cDM Cloning Kit (purchased from Clontech). The 0 fragment was inserted into the multicloning site of pBSK (+) vector (Clontech), and transformed into DH5 ⁇ to form a cDNA library.
  • Dye terminate cycle react ion sequencing kit Perkin-Elmer
  • ABI 377 automatic sequencer Perkin-Elmer
  • the determined cDNA sequence was compared with the existing public DNA sequence database (Genebank), and it was found that the cDNA sequence of one of the clones 0640D02 was new DNA.
  • a series of primers were synthesized to determine the inserted cDNA fragments of the clone in both directions.
  • the sequence of the mitochondrial vector 30 of the present invention and the protein sequence encoded by the mitochondrial vector 30 of the present invention were analyzed by the profile scan program (Basiclocal Alignment search tool) in GCG [Altschul, SF et a 1. J. Mol. Biol. 1990; 215: 403-10 ], Perform domain analysis in databases such as prosite.
  • the mitochondrial vector 30 of the present invention is homologous with the domain mitochondrial vector at 6-56. The results of the homology are shown in Fig. 1. The homology rate is 15% and the score is 7.84. The threshold value is 5.80.
  • Example 3 Cloning of a gene encoding mitochondrial vector 30 by RT-PCR
  • CDNA was synthesized using fetal brain cell total RNA as a template and oligo-dT as a primer for reverse transcription reaction.
  • PCR amplification was performed with the following primers:
  • Primerl 5'- GGAGGTCTGAGCGACCATGGACC -3 '(SEQ ID NO: 3)
  • Primer 2 5,-GATTACCAAACTTATTTATTAAG -3, (SEQ ID NO: 4)
  • Primerl is a forward sequence starting at lbp of the 5th end of SEQ ID NO: 1;
  • Primer 2 is the 3 'end reverse sequence in SEQ ID NO: 1.
  • Amplification reaction conditions 50 mmol / L KC1, 10 ⁇ l / L Ti-is-CI, (pH8.5), 1.5 mmol / L MgCl 2 , 200 ⁇ mol / L dNTP in a reaction volume of 50 ⁇ 1 , lOpmol primer, 1U Taq DNA polymerase (Clontech Molex product).
  • the reaction was performed on a PE9600 DNA thermal cycler (Perkin-Elmer) under the following conditions for 25 cycles: 94 ° C 30sec; 55 ° C 30sec; 72. C 2min.
  • ⁇ _ac tin was set as a positive control and template blank was set as a negative control.
  • the amplified product was purified using a QIAGEN kit and ligated to a pCR vector (Invitrogen product) using a TA cloning kit.
  • the DNA sequence analysis results showed that the DNA sequence of the PCR product was exactly the same as the 1-ll110bp shown in SEQ ID NO: 1.
  • Example 4 Northern blot analysis of mitochondrial vector 30 gene expression:
  • RNA extraction in one step [Anal. Biochem 1987, 162, 156-159] 0
  • This method involves acid guanidinium thiocyanate-chloroform extraction. I.e. with 4M guanidine isothiocyanate - 25mM sodium citrate, 0.2M sodium acetate (P H4.0) of the tissue was homogenized, 1 volume of phenol and 1/5 volume of chloroform - isoamyl alcohol (49: 1) Centrifuge after mixing. Aspirate the aqueous layer, add isopropanol (0.8 vol) and centrifuge the mixture to obtain RNA precipitate. The resulting RNA pellet was washed with 70% ethanol, dried and dissolved in water.
  • a 32P-labeled probe (approximately 2 ⁇ 10 6 cpm / ml) and a nitrocellulose membrane to which RNA was transferred were placed in a solution at 42 ° C. C hybridization overnight, the solution contains 50% formamide-25mM KH 2 P0 4 (pH7.4) -5 x SSC-5 x Denhardt's solution and 200 g / ml salmon sperm DNA. After hybridization, the filters were washed in 1 x SSC-0.1% SI) S at 55 ° C for 30 min. Then, Phosphor Imager was used for analysis and quantification.
  • Example 5 In vitro expression, isolation and purification of recombinant mitochondrial vector 30
  • Primer3 5'- CATGCTAGCATGGACCGGCCGGGGTTCGTGGCAG-3, (Seq ID No: 5)
  • Primer4 5'- CCCGAATTCTCAAGGACTCTTTCTGCCAACTTC -3, (Seq ID No: 6)
  • the 5 'ends of these two primers contain Nhel and EcoRI restriction sites, respectively.
  • the following are the coding sequences of the 5 'and 3' ends of the gene of interest, respectively.
  • the Nhel and EcoRI restriction sites correspond to the selectivity on the expression vector plasmid P ET-28b (+) (Novagen, Cat. No. 69865.3). Endonuclease site.
  • PCR was performed using pBS-0640D02 plasmid containing the full-length target gene as a template.
  • the PCR reaction conditions were as follows: a total volume of 50 ⁇ 1, containing 10 pg of P BS-0640D02 plasmid, Pr imer-3 and Primer_4 points, and 1 J for lpmol, Advantage polymerase Mix
  • Polypeptide synthesizer (product of PE company) was used to synthesize the following mitochondrial carrier 30-specific peptides:
  • the polypeptide is coupled with hemocyanin and bovine serum albumin to form a complex, respectively.
  • hemocyanin and bovine serum albumin for the method, please refer to:
  • Example 7 Use of a polynucleotide fragment of the present invention as a hybridization probe
  • Suitable oligonucleotide fragments selected from the polynucleotides of the present invention are used as hybridization probes in a variety of ways.
  • the probes can be used to hybridize to genomic or cDNA libraries of normal tissue or pathological tissue from different sources to It is determined whether it contains the polynucleotide sequence of the present invention and a homologous polynucleotide sequence is detected.
  • the probe can be used to detect the polynucleotide sequence of the present invention or its homologous polynucleotide sequence in normal tissue or pathology. Whether the expression in tissue cells is abnormal.
  • the purpose of this embodiment is to select a suitable oligonucleotide fragment from the polynucleotide SEQ ID NO: 1 of the present invention as a hybridization probe, and to identify whether some tissues contain the polynucleoside of the present invention by a filter hybridization method.
  • Filter hybridization methods include dot blotting, Southern blotting, Northern blotting, and copying methods. They all use the same steps of hybridization after fixing the polynucleotide sample to be tested on the filter.
  • the sample-immobilized filter is first pre-hybridized with a probe-free hybridization buffer, so that the non-specific binding site of the sample on the filter is saturated with the carrier and the synthetic polymer.
  • the pre-hybridization solution is then replaced with a hybridization buffer containing the labeled probe and incubated to hybridize the probe to the target nucleic acid.
  • the unhybridized probes are removed by a series of membrane washes. Off.
  • This embodiment utilizes higher-intensity washing conditions (such as lower salt concentration and higher temperature) to reduce the hybridization background and retain only strong specific signals.
  • the probes used in this embodiment include two types: the first type of probes are oligonucleotide fragments that are completely the same as or complementary to the polynucleotide SEQ ID NO: 1 of the present invention; the second type of probes are partially related to the present invention
  • the polynucleotide SEQ ID NO: 1 is the same or complementary oligonucleotide fragment.
  • the dot blot method is used to fix the sample on the filter membrane. Under the high-intensity washing conditions, the first type of probe and the sample have the strongest hybridization specificity and are retained.
  • oligonucleotide fragments for use as hybridization probes from the polynucleotide SEQ ID NO: 1 of the present invention should follow the following principles and several aspects to be considered:
  • the preferred range of probe size is 18-50 nucleotides
  • Those that meet the above conditions can be used as primary selection probes, and then further computer sequence analysis, including the primary selection probe and its source sequence region (ie, SEQ ID NO: 1) and other known genomic sequences and their complements The regions are compared for homology. If the homology with the non-target molecular region is greater than 85% or there are more than 15 consecutive bases, the primary probe should not be used;
  • Probe 1 (probel), which belongs to the first type of probe, is completely homologous or complementary to the gene fragment of SEQ ID NO: 1 (41Nt)
  • Probe 2 which belongs to the second type of probe, is equivalent to the replacement mutant sequence of the gene fragment of SEQ ID NO: 1 or its complementary fragment (41Nt):
  • PBS phosphate buffered saline
  • step 8-13 are only used when contamination must be removed, otherwise step 14 can be performed directly.
  • NC membranes nitrocellulose membranes
  • Two NC membranes are required for each probe, so that it can be used in the following experimental steps.
  • the film was washed with high-strength conditions and strength conditions, respectively.
  • the 32 P-Probe (the second peak is free ⁇ - 32P -dATP) is prepared.
  • Gene microarrays or DNA microarrays are new technologies currently being developed by many national laboratories and large pharmaceutical companies. It refers to the orderly and high-density arrangement of a large number of target gene fragments on glass, The data is compared and analyzed on a carrier such as silicon using fluorescence detection and computer software to achieve the purpose of rapid, efficient, and high-throughput analysis of biological information.
  • the polynucleotide of the present invention can be used as target DNA for gene chip technology for high-throughput research of new gene functions; search for and screen new tissue-specific genes, especially new genes related to diseases such as tumors; diagnosis of diseases such as hereditary diseases .
  • the specific method steps have been reported in the literature. For example, see the literature DeRi si, JL, Lyer, V.
  • a total of 4,000 polynucleotide sequences of various full-length cDNAs are used as target DNA, including the polynucleotides of the present invention. They were respectively amplified by PCR. After purification, the concentration of the amplified product was adjusted to about 500 ng / ul, and spotted on a glass medium using a Cartesian 7500 spotter (purchased from Cartesian, USA). The distance between the points is 280 ⁇ m. The spotted slides were hydrated, dried, and cross-linked in a UV cross-linker. After elution, the slides were fixed to fix the DM on the glass slides to prepare chips. The specific method steps have been variously reported in the literature. The post-spot processing steps of this embodiment are: 1. Hydration in a humid environment for 4 hours;
  • Total mRNA was extracted from normal liver and liver cancer by a single method, and mRNA was purified using Oligotex mRNA Midi Kit (purchased from QiaGen).
  • the fluorescent reagent Cy3dUTP (5- Amino- propargy 1-2 '-deoxyur i dine 5'-tr iphate coupled to Cy3 fluorescent dye (purchased from Amersham Phamacia Biotech) to mark the mRNA of liver tissue
  • the fluorescent reagent Cy5dUTP (5-Amino-propargy 1-2 '-deoxyur i dine 5--tr iphate coupled to Cy5 fluorescent dye (purchased from Amersham Phamacia Biotech) was used to label liver cancer tissue mRNA, and the probe was prepared after purification. Specific steps and methods
  • Probes from the above two types of tissues and chips were hybridized in a UniHyb TM Hybridization Solution (purchased from TeleChem) hybridization solution for 16 hours, washed with a washing solution (1> SSC, 0.2 SDS) at room temperature and scanned with ScanArray 3000. Instrument (purchased from General Scanning Company, USA) for scanning, and the scanned images were analyzed and processed with Imagene software (Biodiscovery Company, USA), and the Cy3 / Cy5 ratio of each point was calculated. The points whose ratio was less than 0.5 or greater than 2 were considered Genes with differential expression.
  • polypeptide of the present invention and the antagonists, agonists and inhibitors of the polypeptide can be directly used in the treatment of diseases, For example, it can treat malignant tumors, adrenal deficiency, skin diseases, various types of inflammation, HIV infection and immune diseases.
  • Mitochondria have the function of converting respiratory energy into chemical osmotic energy and chemical energy. Mitochondria perform their compartmentalized energy exchange function, which requires continuous metabolic transport between the two membranes of the mitochondria, a transporter protein that passes through the outer membrane, and a series of carrier protein-mediated inner membrane transport. Mitochondrial carrier protein family includes ADP, ATP carrier protein, 2-oxoglutarate / malate carrier protein (0GCP), phosphate carrier protein, brown fat uncoupling protein, tricarboxylic acid carrier protein (or citric acid carrier protein) ), Exophthalmic goiter carrier protein (GDC), etc. Therefore, the abnormal expression of mitochondrial carrier protein will cause abnormal metabolism of body substances (mainly sugars, fats, sterols and amino acids) and energy, and may cause growth and development disorders.
  • body substances mainly sugars, fats, sterols and amino acids
  • the abnormal expression of the mitochondrial vector 30 of the present invention will produce various diseases, especially metabolic disorders related to energy and material metabolism, and disorders of growth and development. These diseases include, but are not limited to: organic acidemia: Valeric acidemia, propionic acidemia, methylmalonic aciduria, combined carboxylase deficiency, glutaric acid type I
  • Amino acid metabolism defects phenylketonuria, tyrosine metabolism defects such as albinism, sulfur amino acid metabolism defects, tryptophan metabolism defects such as tryptophanemia, branch amino acid metabolism defects, glycine metabolism defects such as Glycineemia, Hypersarcosineemia, Proline and Hydroxyproline Metabolism Defects, Glutamate Metabolism Defects, Urea Cycle Metabolism Defects, Histidine Metabolism Defects, Lysine Metabolism Defects , And other amino acid metabolism defects.
  • Mucopolysaccharidosis and other marginal diseases Mucopolysaccharidosis types I to VII. Mucopolysaccharidosis borderline diseases such as rheumatoid mucopolysaccharidosis and mucolipid storage disease.
  • Purine and Pyrimidine Metabolism Defects Abnormal purine metabolisms such as Ray-niney syndrome, xanthineuria, and abnormal pyrimidine metabolisms such as orotic aciduria and adenosine deaminase deficiency.
  • Abnormal lipid metabolism hyperlipoproteinemia, familial hyperalpha-lipoproteinemia, familial non-beta-lipoproteinemia, familial hypo-beta-lipoproteinemia, familial lecithin-cholesterol acetyltransferase Deficiency
  • Glucose metabolism defects Congenital sugar digestion and absorption defects such as congenital lactose intolerance, hereditary fructose intolerance, monosaccharide metabolism defects such as galactosemia, fructose metabolism defects, glycogen metabolism diseases such as glycogen storage Backlog.
  • Growth and development disorders mental retardation, cerebral palsy, brain development disorders, familial cerebral nucleus dysplasia syndrome, skin, fat and muscular dysplasias such as congenital skin relaxation, premature aging, congenital horn Poor metabolism, various metabolic defects such as various amino acid metabolic defects, stunting, dwarfism, sexual retardation
  • Congenital malformations spina bifida, craniocerebral fissure, anencephaly malformation, cerebral bulge, foramen malforma, Down syndrome, congenital hydrocephalus, aqueduct malformation, cartilage hypoplasia, dwarfism, spinal epiphyseal dysplasia, Pseudochondral dysplasia, Langer-G i ed i on syndrome, funnel chest, gonad hypoplasia, congenital Adrenal hyperplasia, upper urethra, short stature syndromes such as Conradi and Danbolt-Closs syndrome, congenital glaucoma or cataract, congenital lens position abnormality, congenital blepharoplasia, retinal dysplasia, congenital Optic Nerve Atrophy, Congenital Sensorineural Hearing Loss, Split Hand, Split Foot, Teratosis, Williams Syndrome, Alagille Syndrome, Bezier Syndrome
  • the invention also provides methods for screening compounds to identify agents that enhance (agonist) or suppress (antagonist) mitochondrial carrier 30.
  • Agonists enhance biological functions such as mitochondrial carrier 30 to stimulate cell proliferation, while antagonists prevent and treat disorders related to excessive cell proliferation, such as various cancers.
  • mammalian cells or a membrane preparation expressing the mitochondrial vector 30 can be cultured with the labeled mitochondrial vector 30 in the presence of a drug. The ability of the drug to increase or block this interaction is then determined.
  • Antagonists of the mitochondrial carrier 30 include antibodies, compounds, receptor deletions, and the like that have been screened. Antagonists of the mitochondrial carrier 30 can bind to the mitochondrial carrier 30 and eliminate its function, or inhibit the production of the polypeptide, or bind to the active site of the polypeptide so that the polypeptide cannot function biologically .. in screening as an antagonist
  • the mitochondrial carrier 30 can be added to a bioanalytical assay, and the effect of the compound on the interaction between the mitochondrial carrier 30 and its receptor can be determined to determine whether the compound is an antagonist.
  • peptides that can act as antagonists of receptor deletions and analogues that can bind to mitochondrial carrier 30 can be screened.
  • Peptide library When screening, generally 30 molecules of mitochondrial carrier should be labeled.
  • the present invention provides methods for producing antibodies using polypeptides, and fragments, derivatives, analogs or cells thereof as antigens. These antibodies may be polyclonal antibodies or monoclonal antibodies.
  • the invention also provides antibodies against the mitochondrial carrier 30 epitope. These antibodies include (but are not limited to): polyclonal antibodies, monoclonal antibodies, chimeric antibodies, single chain antibodies, Fab fragments, and fragments produced by Fab expression libraries.
  • Polyclonal antibodies can be produced by injecting mitochondrial carrier 30 directly into immunized animals (such as home immunity, mice, rats, etc.).
  • immunized animals such as home immunity, mice, rats, etc.
  • a variety of adjuvants can be used to enhance the immune response, including but not limited to Freund's adjuvant.
  • Techniques for preparing monoclonal antibodies against mitochondrial carrier 30 include, but are not limited to, hybridoma technology (Kohler and Milstein. Nature, 1975, 256: 495-497), triple tumor technology, human beta-cell hybridoma technology, and EBV-hybridoma technology. Wait.
  • Antibodies against mitochondrial carrier 3 ⁇ can be used in immunohistochemical techniques to detect mitochondrial carrier 30 in biopsy specimens.
  • Monoclonal antibodies bound to mitochondrial carrier 30 can also be labeled with radioisotopes. Track its location and distribution. This radiolabeled antibody can be used as a non-invasive diagnostic method to locate tumor cells and determine whether there is metastasis.
  • Antibodies can also be used to design immunotoxins in a particular part of the needle.
  • Such as mitochondrial carrier 30 high affinity monoclonal antibodies can be covalently bound to bacterial or plant toxins (such as diphtheria toxin, ricin, ormosine, etc.).
  • a common method is to attack the amino group of the antibody with a thiol cross-linking agent such as SPDP and bind the toxin to the antibody through the exchange of disulfide bonds.
  • This hybrid antibody can be used to kill 30 positive cells of the mitochondrial carrier.
  • the antibodies in the present invention can be used to treat or prevent diseases related to the mitochondrial carrier 30.
  • Administration of an appropriate amount of antibody can stimulate or block the production or activity of mitochondrial carrier 30.
  • the invention also relates to a diagnostic test method for quantitative and localized detection of mitochondrial carrier 30 levels. These tests are well known in the art and include FI SH assays and radioimmunoassays.
  • the level of mitochondrial carrier 30 detected in the test can be used to explain the importance of mitochondrial carrier 30 in various diseases and to diagnose diseases in which mitochondrial carrier 30 plays a role.
  • polypeptide of the present invention can also be used for peptide mapping analysis.
  • the polypeptide can be specifically cleaved by physical, chemical or enzymatic analysis, and subjected to one-dimensional or two-dimensional or three-dimensional gel electrophoresis analysis, and more preferably mass spectrometry analysis.
  • the polynucleotide encoding the mitochondrial vector 30 can also be used for a variety of therapeutic purposes. Gene therapy techniques can be used to treat abnormalities in cell proliferation, development, or metabolism caused by the non-expression or abnormal / inactive expression of mitochondrial vector 30.
  • Recombinant gene therapy vectors (such as viral vectors) can be designed to express mutated mitochondrial vector 30 to inhibit endogenous mitochondrial vector 30 activity.
  • a mutated mitochondrial carrier 30 may be a shortened mitochondrial carrier 30 lacking a signaling domain, and although it can bind to a downstream substrate, it lacks signaling activity. Therefore, the recombinant gene therapy vector can be used for treating diseases caused by abnormal expression or activity of the mitochondrial vector 30.
  • Virus-derived expression vectors such as retrovirus, adenovirus, adenovirus-associated virus, herpes simplex virus, parvovirus and the like can be used to transfer the polynucleotide encoding the mitochondrial vector 30 into the cell.
  • Methods for constructing recombinant viral vectors carrying a polynucleotide encoding a mitochondrial vector 30 can be found in existing literature (Sambrook, et al.).
  • the polynucleotide encoding the mitochondrial vector 3 3 can be packaged into liposomes and transferred into cells.
  • Methods for introducing a polynucleotide into a tissue or cell include: directly injecting the polynucleotide into a tissue in vivo; or introducing the polynucleotide into a cell in vitro through a vector (such as a virus, phage, or plasmid), and then transplanting the cell Into the body, etc.
  • a vector such as a virus, phage, or plasmid
  • Oligonucleotides including antisense RNA and DNA
  • ribozymes that inhibit mitochondrial vector 30 mRNA are also within the scope of the present invention.
  • a ribozyme is an enzyme-like RNA molecule that specifically breaks down specific RNAs. The mechanism is that the ribozyme molecule specifically hybridizes with a complementary target RNA and performs endonucleation.
  • Antisense RNA, DNA, and ribozymes can be obtained by any existing RNA or DNA synthesis technology, such as the technology for the synthesis of oligonucleotides by solid-phase phosphoramidite chemical synthesis has been widely used.
  • Antisense RNA molecules can be obtained by in vitro or in vivo transcription of a DNA sequence encoding the RNA.
  • This DNA sequence has been integrated downstream of the vector's RNA polymerase promoter.
  • it can be modified in a variety of ways, such as increasing the sequence length on both sides, and the ribonucleoside linkages should use phosphate thioester or peptide bonds instead of phosphodiester bonds.
  • the polynucleotide encoding the mitochondrial vector 30 can be used for the diagnosis of diseases related to the mitochondrial vector 30.
  • the polynucleotide encoding the mitochondrial vector 30 can be used to detect the expression of the mitochondrial vector 30 or the abnormal expression of the mitochondrial vector 30 in a disease state.
  • the DNA sequence encoding the mitochondrial vector 30 can be used to hybridize biopsy specimens to determine the expression status of the mitochondrial vector 30.
  • Hybridization techniques include Sou thern blotting, Northern blotting, and in situ hybridization. These techniques and methods are publicly available and mature, and related kits are commercially available.
  • Part or all of the polynucleotides of the present invention can be used as probes to be fixed on a micro array (Mic roar ray) or a DNA chip (also known as a "gene chip") for analyzing differential expression analysis of genes and genes in tissues diagnosis.
  • RNA-polymerase chain reaction (RT-PCR) in vitro amplification using mitochondrial vector 30-specific primers can also detect transcripts of mitochondrial vector 30.
  • Mitochondrial vector 30 mutations include point mutations, translocations, deletions, recombinations, and any other abnormalities compared to normal wild-type mitochondrial vector 30 DNA sequences. Mutations can be detected using existing techniques such as Southern blotting, 1) NA sequence analysis, PCR and in situ hybridization. In addition, the mutation may affect the expression of the protein, so the Nort Hern blotting and Western blotting can be used to indirectly determine whether the gene is mutated.
  • the sequences of the invention are also valuable for chromosome identification.
  • the sequence specifically targets a specific position on a human chromosome and can hybridize to it.
  • the specific locus of each gene on the chromosome needs to be identified.
  • an important first step is to locate these DNA sequences on a chromosome.
  • PCR primers (preferably 1 5-35 bp) are prepared based on cDNA, and the sequences can be mapped on chromosomes. Then, these primers are used for PCR screening of somatic hybrid cells containing individual human chromosomes ... only Hybrid cells that contain human genes corresponding to the primers will produce amplified fragments.
  • PCR localization of somatic hybrid cells is a quick way to localize DNA to specific chromosomes.
  • oligonucleotide primers of the present invention by a similar method, a set of fragments from a specific chromosome or a large number of genomic clones can be used to achieve sublocalization.
  • Other similar strategies that can be used for chromosomal localization include in situ hybridization, pre-screening of chromosomes using labeled flow sorting, and pre-selection of crosses to construct chromosome-specific c recommended library.
  • Fluorescent in situ hybridization of cDNA clones with metaphase chromosomes allows precise chromosomal localization in a single step.
  • FISH Fluorescent in situ hybridization
  • the physical location of the sequence on the chromosome can be correlated with the genetic map data. These data can be found in, for example, V. Mckusick, Mendel ian Inheritance in Man (available online with Johns Hopkins University Welch Medical Library). Linkage analysis can then be used to determine the relationship between genes and diseases that have been mapped to chromosomal regions.
  • the difference in cDNA or genomic sequence between the affected and unaffected individuals needs to be determined. If a mutation is observed in some or all diseased individuals and the mutation is not observed in any normal individuals, the mutation may be the cause of the disease. Comparing diseased and diseased individuals usually involves first looking for structural changes in chromosomes, such as deletions or translocations that are visible at the chromosomal level or detectable with cDNA sequence-based PCR. According to the resolution capabilities of current physical mapping and gene mapping technology, the cDNA accurately mapped to the chromosomal region associated with the disease can be one of 50 to 500 potentially pathogenic genes (assuming 1 megabase mapping resolution) Capacity and each 20kb corresponds to a gene).
  • the polypeptides, polynucleotides and mimetics, agonists, antagonists and inhibitors of the present invention can be used in combination with a suitable pharmaceutical carrier.
  • suitable pharmaceutical carrier can be water, glucose, ethanol, salts, buffers, glycerol, and combinations thereof.
  • the composition comprises a safe and effective amount of the polypeptide or antagonist, and carriers and excipients which do not affect the effect of the drug. These compositions can be used as drugs for the treatment of diseases.
  • the invention also provides a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the invention.
  • a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the invention.
  • these containers there may be instructional instructions given by government agencies that manufacture, use, or sell pharmaceuticals or biological products, which prompts permission for administration on the human body by government agencies that produce, use, or sell.
  • the polypeptides of the invention can be used in combination with other therapeutic compounds.
  • the pharmaceutical composition can be administered in a convenient manner, such as by a topical, intravenous, intraperitoneal, intramuscular, subcutaneous, intranasal or intradermal route of administration.
  • the mitochondrial carrier 30 is administered in an amount effective to treat and / or prevent a specific indication.
  • the amount and dosage range of the mitochondrial carrier 30 administered to a patient will depend on many factors, such as the mode of administration, the health conditions of the person to be treated, and the judgment of the diagnostician.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • Zoology (AREA)
  • Genetics & Genomics (AREA)
  • Medicinal Chemistry (AREA)
  • Molecular Biology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Toxicology (AREA)
  • Peptides Or Proteins (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

L'invention concerne un nouveau polypeptide, un support mitochondrial 30, et un polynucléotide codant pour ce polypeptide ainsi qu'un procédé d'obtention de ce polypeptide par des techniques recombinantes d'ADN. L'invention concerne en outre les applications de ce polypeptide dans le traitement de maladies, notamment des tumeurs malignes, de l'hémopathie, de l'infection par VIH, de maladies immunitaires et de diverses inflammations. L'invention concerne aussi l'antagoniste agissant contre le polypeptide et son action thérapeutique ainsi que les applications de ce polynucléotide codant pour le support mitochondrial 30.
PCT/CN2000/000516 1999-11-30 2000-11-27 Nouveau polypeptide, support mitochondrial 30, et polynucleotide codant pour ce polypeptide WO2001047982A1 (fr)

Priority Applications (1)

Application Number Priority Date Filing Date Title
AU16897/01A AU1689701A (en) 1999-11-30 2000-11-27 A novel polypeptide-mitochondrial carrier 30 and the polynucleotide encoding thesame

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
CN99124165.7 1999-11-30
CN 99124165 CN1297895A (zh) 1999-11-30 1999-11-30 一种新的多肽——线粒体载体30和编码这种多肽的多核苷酸

Publications (1)

Publication Number Publication Date
WO2001047982A1 true WO2001047982A1 (fr) 2001-07-05

Family

ID=5283255

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/CN2000/000516 WO2001047982A1 (fr) 1999-11-30 2000-11-27 Nouveau polypeptide, support mitochondrial 30, et polynucleotide codant pour ce polypeptide

Country Status (3)

Country Link
CN (1) CN1297895A (fr)
AU (1) AU1689701A (fr)
WO (1) WO2001047982A1 (fr)

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
J. BIOENERG. BIOMEMBR., vol. 25, no. 5, October 1993 (1993-10-01), pages 435 - 446 *
J. BIOL. CHEM., vol. 273, no. 51, 18 December 1998 (1998-12-18), pages 34611 - 34615 *
J. XI'AN MEDICAL UNIV., vol. 17, no. 2, June 1996 (1996-06-01), pages 260 - 261 *

Also Published As

Publication number Publication date
AU1689701A (en) 2001-07-09
CN1297895A (zh) 2001-06-06

Similar Documents

Publication Publication Date Title
WO2001066707A1 (fr) Nouveau polypeptide, serine protease humaine atp-dependante 11, et polynucleotide codant pour ce polypeptide
WO2001047982A1 (fr) Nouveau polypeptide, support mitochondrial 30, et polynucleotide codant pour ce polypeptide
WO2001046409A1 (fr) Nouveau polypeptide, proteine ribosomale s7 9, et polynucleotide codant pour ce polypeptide
WO2001049724A1 (fr) Nouveau polypeptide, proteine lissencephale humaine 43, et polynucleotide codant pour ce polypeptide
WO2001075085A1 (fr) Nouveau polypeptide, serine hydrolase humaine atp-dependante 11.3, et polynucleotide codant pour ce polypeptide
WO2001081594A1 (fr) Nouveau polypeptide, proteine pax humaine 17, et polynucleotide codant pour ce polypeptide
WO2001079434A2 (fr) Nouveau polypeptide, signal peptidase humaine 10, et polynucleotide codant pour ce polypeptide
WO2001072986A1 (fr) Nouveau polypeptide, serine hydrolase humaine atp-dependante 10, et polynucleotide codant pour ce polypeptide
WO2001062782A1 (fr) Nouveau polypeptide, famille proteique 11 de la rhodopsine, et polynucleotide codant pour ce polypeptide
WO2001066770A1 (fr) Nouveau polypeptide, signal peptidase humaine 15, et polynucleotide codant pour ce polypeptide
WO2001053492A1 (fr) Nouveau polypeptide, s-adenosylmethionine synthetase 31, et polynucleotide codant pour ce polypeptide
WO2001072987A1 (fr) Nouveau polypeptide, serine hydrolase atp-dependante humaine 52, et polynucleotide codant pour ce polypeptide
WO2001075125A1 (fr) Nouveau polypeptide, serine hydrolase humaine atp-dependante 31, et polynucleotide codant pour ce polypeptide
WO2001072796A1 (fr) Nouveau polypeptide, facteur humain de transcription de la differentiation cellulaire 11, et polynucleotide codant pour ce polypeptide
WO2001040289A1 (fr) Nouveau polypeptide, support mitochondrial 12, et polynucleotide codant pour ce polypeptide
WO2001048194A1 (fr) Nouveau polypeptide, proteine ribosomale s18 13, et polynucleotide codant pour ce polypeptide
WO2001081386A1 (fr) Nouveau polypeptide, proteine pax humaine 12.5, et polynucleotide codant pour ce polypeptide
WO2001048198A1 (fr) Nouveau polypeptide, proteine ribosomale s4 8, et polynucleotide codant pour ce polypeptide
WO2001072817A1 (fr) Nouveau polypeptide, serine hydrolase humaine atp-dependante 11, et polynucleotide codant pour ce polypeptide
WO2001072990A1 (fr) Nouveau polypeptide, serine hydrolase humaine atp-dependante 12, et polynucleotide codant pour ce polypeptide
WO2001072992A1 (fr) Nouveau polypeptide, serine hydrolase humaine atp-dependante 16, et polynucleotide codant pour ce polypeptide
WO2001064732A1 (fr) Nouveau polypeptide, facteur humain associe a la retrotransposition 14, et polynucleotide codant pour ce polypeptide
WO2001047964A1 (fr) Nouveau polypeptide, helicase atp-dependante 68, et polynucleotide codant pour ce polypeptide
WO2001047993A1 (fr) Nouveau polypeptide, proteine d'echange anionique 9, et polynucleotide codant pour ce polypeptide
WO2001055401A1 (fr) Nouveau polypeptide, helicase atp-dependante humaine 31, et polynucleotide codant pour ce polypeptide

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
REG Reference to national code

Ref country code: DE

Ref legal event code: 8642

122 Ep: pct application non-entry in european phase
NENP Non-entry into the national phase

Ref country code: JP