WO2001046424A1 - Nouveau polypeptide, deshydrogenase nadh 12, et polynucleotide codant pour ce polypeptide - Google Patents

Nouveau polypeptide, deshydrogenase nadh 12, et polynucleotide codant pour ce polypeptide Download PDF

Info

Publication number
WO2001046424A1
WO2001046424A1 PCT/CN2000/000552 CN0000552W WO0146424A1 WO 2001046424 A1 WO2001046424 A1 WO 2001046424A1 CN 0000552 W CN0000552 W CN 0000552W WO 0146424 A1 WO0146424 A1 WO 0146424A1
Authority
WO
WIPO (PCT)
Prior art keywords
polypeptide
polynucleotide
nadh dehydrogenase
sequence
seq
Prior art date
Application number
PCT/CN2000/000552
Other languages
English (en)
Chinese (zh)
Inventor
Yumin Mao
Yi Xie
Original Assignee
Fudan University
Shanghai Bio Door Gene Technology Ltd.
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Fudan University, Shanghai Bio Door Gene Technology Ltd. filed Critical Fudan University
Priority to AU19826/01A priority Critical patent/AU1982601A/en
Publication of WO2001046424A1 publication Critical patent/WO2001046424A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/0004—Oxidoreductases (1.)
    • C12N9/0012—Oxidoreductases (1.) acting on nitrogen containing compounds as donors (1.4, 1.5, 1.6, 1.7)
    • C12N9/0036—Oxidoreductases (1.) acting on nitrogen containing compounds as donors (1.4, 1.5, 1.6, 1.7) acting on NADH or NADPH (1.6)
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides

Definitions

  • the present invention belongs to the field of biotechnology. Specifically, the present invention describes a new polypeptide ⁇ NADH dehydrogenase 12 and a polynucleotide sequence encoding the polypeptide. The invention also relates to methods and applications for preparing such polynucleotides and polypeptides.
  • the respiratory chain NADH dehydrogenase (also known as coenzyme Q oxidoreductase) is a complex of oligomeric enzymes located on the inner surface of the mitochondrial membrane and also found in chloroplasts and cyanobacteria.
  • the entire DH dehydrogenase complex includes 25-30 peptide subunits, and electrons from NADH pass through this complex to coenzyme ( ⁇ .
  • This 75Kd subunit has three highly conserved regions, which are related to the binding of iron-sulfur protein-.
  • Each of them has three Cys residues, and the sulfhydryl group on it can bind to the iron-containing protein.
  • the electrons are initially accepted by the FMN prosthetic group on NADH dehydrogenase, and then passed to the coenzyme Q through the iron-sulfur complex. It exists in an oxidized state (Fe3 +) or a reduced state (Fe2 +), and is actually an acceptor or donor of electrons.
  • NADH dehydrogenase complex In organisms, respiratory metabolism is an important metabolic process, which ultimately generates ATP through electron transfer and oxidative phosphorylation to meet the cell's need for energy.
  • the first step in electron transfer is through the NADH dehydrogenase complex.
  • certain toxins can cause defects in NADH dehydrogenase, leading to the development of some brain diseases. More common diseases such as Parkinson syndrome. Some people develop this symptom after the age of 40. It is due to the weakened function of the NADH dehydrogenase complex in mitochondria; in addition, low NADH dehydrogenase activity can cause Hunt ington's disease.
  • NADH dehydrogenase 12 protein plays an important role in important functions of the body as described above, and it is believed that a large number of proteins are involved in these regulatory processes, there has been a need in the art to identify more NADH dehydrogenase 12 proteins involved in these processes. In particular, the amino acid sequence of this protein is identified. Isolation of the new NADH dehydrogenase 12 protein encoding gene also provides the basis for research to determine the role of this protein in health and disease states. This protein may form the basis for the development of diagnostic and / or therapeutic drugs for diseases, so it is important to isolate its coding DNA. Object of the invention
  • NADH dehydrogenase 12 It is an object of the present invention to provide an isolated novel polypeptide "NADH dehydrogenase 12 and its fragments, analogs and derivatives.
  • Another object of the invention is to provide a polynucleotide encoding the polypeptide.
  • Another object of the present invention is to provide a recombinant vector containing a polynucleotide encoding a NADH dehydrogenase 12.
  • Another object of the present invention is to provide a method for producing NADH dehydrogenase 12.
  • Another object of the present invention is to provide an antibody against the polypeptide- "ADH dehydrogenase 12 of the present invention.
  • Another object of the present invention is to provide a mimetic compound, an antagonist, against the polypeptide-" NADH dehydrogenase 12 of the present invention, Agonists, inhibitors. *
  • Another object of the present invention is to provide a method for diagnosing and treating diseases associated with abnormalities in NADH dehydrogenase 12.
  • the present invention relates to an isolated polypeptide, which is of human origin and comprises: a polypeptide having the amino acid sequence of SEQ ID No. 2, or a conservative variant, biologically active fragment or derivative thereof.
  • the polypeptide is a polypeptide having the amino acid sequence of SEQ ID NO: 2.
  • the invention also relates to an isolated polynucleotide comprising a nucleotide sequence or a variant thereof selected from the group consisting of:
  • sequence of the polynucleotide is one selected from the group consisting of: (a) a sequence having positions 272-610 in SEQ ID NO: 1; and (b) a sequence having 1-2184 in SEQ ID NO: 1 Sequence of bits.
  • the invention further relates to a vector, in particular an expression vector, containing the polynucleotide of the invention; a host cell genetically engineered with the vector, including a transformed, transduced or transfected host cell; and a method comprising culturing said Host cell and method of preparing the polypeptide of the present invention by recovering the expression product.
  • a vector in particular an expression vector, containing the polynucleotide of the invention
  • a host cell genetically engineered with the vector including a transformed, transduced or transfected host cell
  • a method comprising culturing said Host cell and method of preparing the polypeptide of the present invention by recovering the expression product.
  • the invention also relates to an antibody capable of specifically binding to a polypeptide of the invention.
  • the invention also relates to a method for screening compounds that mimic, activate, antagonize or inhibit the activity of NADH dehydrogenase 12 protein, which comprises utilizing the polypeptide of the invention.
  • the invention also relates to compounds obtained by this method.
  • the invention also relates to a method for in vitro detection of a disease or susceptibility to disease associated with abnormal expression of NADH dehydrogenase 12 protein, which comprises detecting a mutation in the polypeptide or a sequence encoding a polynucleotide thereof in a biological sample, or detecting a biological sample The amount or biological activity of a polypeptide of the invention.
  • the invention also relates to a pharmaceutical composition
  • a pharmaceutical composition comprising a polypeptide of the invention or a mimetic thereof, an activator, an antagonist or an inhibitor, and a pharmaceutically acceptable carrier.
  • the present invention also relates to the use of the polypeptide and / or polynucleotide of the present invention in the preparation of a medicament for treating cancer, developmental disease or immune disease or other diseases caused by abnormal expression of NADH dehydrogenase 12.
  • Fig. 1 is a comparison diagram of amino acid sequence homology of 87 amino acids and domain NADH dehydrogenase characteristic proteins of MDH dehydrogenase 12 of 26-112 of the present invention.
  • the upper sequence is NADH dehydrogenase 12
  • the lower sequence is the characteristic protein domain of NADH dehydrogenase.
  • ⁇ "and”: "" and ".” Indicate that the probability of the same amino acid appearing between two sequences decreases in sequence.
  • Figure 2 shows the polyacrylamide gel electrophoresis (SDS-PAGE) of the isolated NADH dehydrogenase 12.
  • 12KDa is the molecular weight of the protein.
  • the arrow indicates the isolated protein band.
  • Nucleic acid sequence refers to an oligonucleotide, a nucleotide or a polynucleotide and a fragment or part thereof, and may also refer to a genomic or synthetic DNA or R, they can be single-stranded or double-stranded, representing the sense or antisense strand.
  • amino acid sequence refers to an oligopeptide, peptide, polypeptide or protein sequence and fragments or portions thereof.
  • amino acid sequence in the present invention relates to the amino acid sequence of a naturally occurring protein molecule, such "polypeptide” or “protein” does not mean to limit the amino acid sequence to a complete natural amino acid related to the protein molecule .
  • a protein or polynucleotide “variant” refers to an amino acid sequence having one or more amino acids or nucleotide changes or a polynucleotide sequence encoding it. The changes may include deletions, insertions or substitutions of amino acids or nucleotides in the amino acid sequence or nucleotide sequence. Variants can have "conservative" changes in which the substituted amino acid has a structural or chemical property similar to the original amino acid, such as the replacement of isoleucine with leucine. Variants can also have non-conservative changes, such as replacing glycine with tryptophan.
  • “Deletion” refers to the absence of one or more amino acids or nucleotides in an amino acid sequence or nucleotide sequence. Missed.
  • Insertion means that a change in the amino acid sequence or nucleotide sequence results in an increase in one or more amino acids or nucleotides compared to a molecule that exists in nature.
  • Replacement refers to the replacement of one or more amino acids or nucleotides with different amino acids or nucleotides.
  • Bioactivity refers to a protein that has the structure, regulation, or biochemical function of a natural molecule.
  • immunologically active refers to the ability of natural, recombinant or synthetic proteins and fragments thereof to induce a specific immune response and to bind specific antibodies in a suitable animal or cell.
  • An "agonist” refers to a molecule that, when combined with NADH dehydrogenase 12, causes a change in the protein to regulate the activity of the protein.
  • An agonist may include a protein, a nucleic acid, a carbohydrate, or any other molecule that can bind MDH dehydrogenase 12.
  • Antagonist refers to a molecule that, when combined with NADH dehydrogenase 12, can block or regulate the biological or immunological activity of NADH dehydrogenase 12.
  • Antagonists and inhibitors can include proteins, nucleic acids, carbohydrates or any other molecule that can bind NADH dehydrogenase 12.
  • Regular refers to a change in the function of NADH dehydrogenase 12, including an increase or decrease in protein activity, a change in binding characteristics, and any other biological, functional, or immune properties of NADH dehydrogenase 12.
  • Substantially pure means substantially free of other proteins, lipids, sugars or other substances with which it is naturally associated.
  • Those skilled in the art can purify NADH dehydrogenase 12 using standard protein purification techniques. Basically pure NADH dehydrogenase 12 produces a single main band on a non-reducing polyacrylamide gel. The purity of NADH dehydrogenase 12 peptide can be analyzed by amino acid sequence.
  • Complementary refers to the natural binding of polynucleotides by base-pairing under conditions of acceptable salt concentration and temperature.
  • sequence C-T-G-A
  • complementary sequence G-A-C-T
  • the complementarity between two single-stranded molecules can be partial or complete.
  • the degree of complementarity between nucleic acid strands has a significant effect on the efficiency and strength of hybridization between nucleic acid strands.
  • “Homology” refers to the degree of complementarity and can be partially homologous or completely homologous.
  • Partial homology refers to a partially complementary sequence that at least partially inhibits hybridization of a fully complementary sequence to a target nucleic acid. This inhibition of hybridization can be detected by performing hybridization (Southern blotting or Nor thern blotting, etc.) under conditions of reduced stringency.
  • Substantially homologous sequences or hybridization probes can compete and inhibit the binding of completely homologous sequences to the target sequence under conditions of reduced stringency. This does not mean that the conditions of reduced stringency allow non-specific binding, because the conditions of reduced stringency require that the two sequences bind to each other as a specific or selective interaction.
  • Percent identity refers to the percentage of sequences that are identical or similar in the comparison of two or more amino acid or nucleic acid sequences. The percent identity can be determined electronically, such as by the MEGALIGN program (Lasergene sof tware package, DNASTAR, Inc., Mad Son Wi s.) 0 The MEGALIGN program can compare two or more sequences according to different methods such as the Cluster method (Higg ins, DG and PM Sharp (1988)
  • the Clus ter method arranges groups of sequences into clusters by checking the distance between all pairs. The clusters are then assigned in pairs or groups. The percent identity between two amino acid sequences such as sequence A and sequence B is calculated by:
  • the percentage identity Jotun Hein measured between nucleic acid sequences can also Clus ter or a method well known in the art (He in J., (1990) Methods in enzymo logy 183: 625-645) 0
  • Similarity refers to the degree of identical or conservative substitutions of amino acid residues at corresponding positions in the alignment of amino acid sequences.
  • Amino acids used for conservative substitution for example, negatively charged amino acids may include aspartic acid and glutamic acid; positively charged amino acids may include lysine and arginine; having an uncharged head group is Similar hydrophilic amino acids may include leucine, isoleucine and valine; glycine and alanine; asparagine and glutamine; serine and threonine; phenylalanine and tyrosine.
  • Antisense refers to a nucleotide sequence that is complementary to a particular DNA or RNA sequence.
  • the "antisense strand” refers to a nucleic acid strand that is complementary to the “sense strand”.
  • Derivative refers to HFP or a chemical modification of its nucleic acid. This chemical modification may be the replacement of a hydrogen atom with an alkyl, acyl or amino group. Nucleic acid derivatives can encode polypeptides that retain the main biological properties of natural molecules.
  • Antibody refers to a complete antibody molecule and its fragments, such as Fa,? ( ⁇ ) 2 and? It can specifically bind to the epitope of MDH dehydrogenase 12.
  • a “humanized antibody” refers to an antibody in which the amino acid sequence of a non-antigen binding region is replaced to become more similar to a human antibody, but still retains the original binding activity.
  • isolated refers to the removal of matter from its original environment (for example, its natural environment if it is naturally occurring).
  • a naturally occurring polynucleotide or polypeptide is not isolated when it is present in a living animal, but the same polynucleotide or polypeptide is separated from some or all of the substances that coexist in the natural system.
  • Such a polynucleotide may be part of a vector, or such a polynucleotide or polypeptide may be part of a composition. Since the carrier or composition is not part of its natural environment, they are still isolated.
  • isolated refers to the separation of a substance from its original environment (if it is a natural substance, the original environment is the natural environment).
  • polynucleotides and polypeptides in a natural state in a living cell are not isolated and purified, but the same polynucleotides or polypeptides are the same as other substances existing in the natural state. It is separated and purified, and it is isolated and purified.
  • isolated NADH dehydrogenase 12 means that NADH dehydrogenase 12 is substantially free of other proteins, lipids, sugars, or other substances with which it is naturally associated. Those skilled in the art can purify NADH dehydrogenase 12 using standard protein purification techniques. Substantially pure polypeptides can produce a single main band on a non-reducing polyacrylamide gel. The purity of the NADH dehydrogenase 12 polypeptide can be analyzed by amino acid sequence.
  • the present invention provides a new polypeptide, NADH dehydrogenase 12, which basically consists of the amino acid sequence shown in SEQ ID NO: 2.
  • the polypeptide of the present invention may be a recombinant polypeptide, a natural polypeptide, a synthetic polypeptide, and preferably a recombinant polypeptide.
  • the polypeptides of the present invention can be naturally purified products or chemically synthesized products, or can be produced from prokaryotic or eukaryotic hosts (eg, bacteria, yeast, higher plants, insects, and mammalian cells) using recombinant techniques. Depending on the host used in the recombinant production protocol, the polypeptide of the invention may be glycosylated, or it may be non-glycosylated. Polypeptides of the invention may also include or exclude starting methionine residues.
  • the invention also includes fragments, derivatives and analogs of NADH dehydrogenase 12.
  • fragment refers to a polypeptide that substantially maintains the same biological function or activity of the NADH dehydrogenase 12 of the present invention.
  • a fragment, derivative, or analog of the polypeptide of the present invention may be: (I) a kind in which one or more amino acid residues are substituted with conservative or non-conservative amino acid residues (preferably conservative amino acid residues), and the substitution
  • the amino acid may or may not be encoded by a genetic codon; or ( ⁇ ) a type in which a group on one or more amino acid residues is replaced by another group to include a substituent; or ( ⁇ ⁇ )
  • Such a type, in which the mature polypeptide is fused with another compound such as a compound that prolongs the half-life of the polypeptide, such as polyethylene glycol
  • a polypeptide sequence such fragments, derivatives, and analogs are considered to be within the
  • the present invention provides an isolated nucleic acid (polynucleotide), which basically consists of a polynucleotide encoding a polypeptide having the amino acid sequence of SEQ ID NO: 2.
  • the polynucleotide sequence of the present invention includes a nucleotide sequence of SEQ ID NO: 1.
  • the polynucleotide of the present invention is found from a cDNA library of human fetal brain tissue. It contains a polynucleotide sequence with a total length of 2184 bases, and its open reading frame 272-610 encodes 112 amino acids.
  • This peptide has the characteristic sequence of NADH dehydrogenase characteristic protein, and it can be deduced that NADH dehydrogenase 12 has the structure and function represented by NADH dehydrogenase characteristic protein.
  • the polynucleotide of the present invention may be in the form of DM or RNA.
  • DNA forms include cDNA, genomic DNA, or synthetic DNA.
  • DNA can be single-stranded or double-stranded.
  • DNA can be coding or non-coding.
  • the coding region sequence encoding the mature polypeptide may be the same as the coding region sequence shown in SEQ ID NO: 1 or a degenerate variant.
  • "degenerate variant" means in the present invention that the code has A protein or polypeptide of SEQ ID NO: 2 but a nucleic acid sequence different from the coding region sequence shown in SEQ ID NO: 1.
  • the polynucleotide encoding the mature polypeptide of SEQ ID NO: 2 includes: only the coding sequence of the mature polypeptide; the coding sequence of the mature polypeptide and various additional coding sequences; the coding sequence of the mature polypeptide (and optional additional coding sequences); Coding sequence.
  • polynucleotide encoding a polypeptide refers to a polynucleotide that includes the polypeptide and a polynucleotide that includes additional coding and / or non-coding sequences.
  • the invention also relates to variants of the polynucleotides described above, which encode polypeptides or fragments, analogs and derivatives of polypeptides having the same amino acid sequence as the invention.
  • This polynucleotide variant can be a naturally occurring allelic variant or a non-naturally occurring variant.
  • These nucleotide variants include substitution variants, deletion variants, and insertion variants.
  • an allelic variant is an alternative form of a polynucleotide that may be a substitution, deletion, or insertion of one or more nucleotides, but does not substantially change the function of the polypeptide it encodes .
  • the invention also relates to a polynucleotide that hybridizes to the sequence described above (having at least 50%, preferably 70% identity between the two sequences).
  • the present invention particularly relates to polynucleotides that can hybridize to the polynucleotides of the present invention under stringent conditions.
  • "strict conditions” means: (1) hybridization and elution at lower ionic strength and higher temperature, such as 0.2xSSC, 0.1% SDS, 60 ° C; or (2) L ° / ⁇ When hybridizing with a denaturant, such as 50% (v / v) formamide, 0.1% calf serum / 0.1 ° /.
  • hybridizable polynucleotide has the same biological function and activity as the mature polypeptide shown in SEQ ID NO: 2.
  • nucleic acid fragments that hybridize to the sequences described above.
  • a "nucleic acid fragment” contains at least 10 nucleotides in length, preferably at least 20-30 nucleotides, more preferably at least 50-60 nucleotides, and most preferably at least 100 nuclei. Glycylic acid or more. Nucleic acid fragments can also be used in nucleic acid amplification techniques such as PCR to identify and / or isolate polynucleotides encoding MDH dehydrogenase 12.
  • polypeptides and polynucleotides in the present invention are preferably provided in an isolated form and are more preferably purified to homogeneity.
  • the specific polynucleotide sequence encoding NADH dehydrogenase 12 of the present invention can be obtained by various methods.
  • polynucleotides are isolated using hybridization techniques well known in the art. These techniques include, but are not limited to: 1) hybridization of probes to genomic or cDNA libraries to detect homologous polynucleotide sequences, and 2) antibody screening of expression libraries to detect cloned polynucleosides with common structural characteristics Acid fragments.
  • the DNA fragment sequence of the present invention can also be obtained by the following methods: 1) isolating the double-stranded DNA sequence from the genomic DNA; 2) chemically synthesizing the DNA sequence to obtain the double-stranded DNA of the polypeptide.
  • genomic DNA isolation is the least commonly used. Direct chemical synthesis of DNA sequences Is the method of choice.
  • the more commonly used method is the isolation of cDNA sequences.
  • the standard method for isolating the cDNA of interest is to isolate mRNA from donor cells that overexpress the gene and perform reverse transcription to form a plasmid or phage cDNA library.
  • the construction of cDNA libraries is also a common method (Sambrook, et al., Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory. New York, 1989).
  • Commercially available cDNA libraries are also available, such as different cDNA libraries from Clontech. When polymerase reaction technology is used in combination, even very small expression products can be cloned.
  • genes of the present invention can be selected from these cDNA libraries by conventional methods. These methods include (but are not limited to): (l) DNA-DNA or DNA-RNA hybridization; (2) the presence or loss of marker gene function; (3) determination of the level of NADH dehydrogenase 12 transcripts; (4) Detection of gene-expressed protein products by immunological techniques or determination of biological activity. The above methods can be used singly or in combination.
  • the probe used for hybridization is homologous to any part of the polynucleotide of the present invention, and its length is at least 10 nucleotides, preferably at least 30 nucleotides, more preferably At least 50 nucleotides, preferably at least 100 nucleotides.
  • the length of the probe is usually within 2000 nucleotides, preferably within 1000 nucleotides.
  • the probe used here is usually a DNA sequence chemically synthesized based on the gene sequence information of the present invention.
  • the genes or fragments of the present invention can of course be used as probes.
  • DNA probes can be labeled with radioisotopes, luciferin, or enzymes (such as alkaline phosphatase).
  • immunological techniques such as Western blotting, radioimmunoprecipitation, and enzyme-linked immunosorbent assay (ELISA) can be used to detect protein products expressed by the NADH dehydrogenase 12 gene.
  • a method using PCR technology to amplify DNA / RNA is preferably used to obtain the gene of the present invention.
  • the RACE method RACE-rapid cDNA end rapid amplification method
  • the primers used for PCR can be appropriately based on the polynucleotide sequence information of the present invention disclosed herein. Select and synthesize using conventional methods.
  • the amplified DNA / RNA fragments can be isolated and purified by conventional methods such as by gel electrophoresis.
  • polynucleotide sequence of the gene of the present invention or various DNA fragments and the like obtained as described above can be determined by a conventional method such as a dideoxy chain termination method (Sanger et al. PNAS, 1977, 74: 5463-5467). Such polynucleotide sequences can also be determined using commercial sequencing kits and the like. In order to obtain the full-length cDNA sequence, sequencing needs to be repeated. Sometimes it is necessary to determine the cDNA sequence of multiple clones in order to splice into a full-length cDNA sequence.
  • the present invention also relates to a vector comprising the polynucleotide of the present invention, and a host cell that is genetically engineered using the vector of the present invention or directly using the NADH dehydrogenase 12 coding sequence, and a method for producing the polypeptide of the present invention by recombinant technology.
  • a polynucleotide sequence encoding MDH dehydrogenase 12 can be inserted into a vector to constitute a recombinant vector containing the polynucleotide of the present invention.
  • vector refers to bacterial plasmids, phages, yeast plasmids, plant cell viruses, mammalian cell viruses such as adenoviruses, retroviruses, or other vectors well known in the art.
  • Vectors suitable for use in the present invention include, but are not limited to: T7 promoter-based expression vectors (Rosenberg, et al. Gene, 19112, 56: 125) expressed in bacteria; pMSXND expression vectors expressed in mammalian cells ( Lee and Nathans, J Bio Chem. 263: 3521, 1988) and baculovirus-derived vectors expressed in insect cells.
  • any plasmid and vector can be used to construct a recombinant expression vector.
  • An important feature of expression vectors is that they usually contain an origin of replication, a promoter, a marker gene, and translational regulatory elements.
  • Methods known to those skilled in the art can be used to construct expression vectors containing a DNA sequence encoding NADH dehydrogenase 12 and appropriate transcriptional / translational regulatory elements. These methods include in vitro recombinant DM technology, intestinal synthesis technology, in vivo recombination technology, etc. (Sambroook, et al. Molecular Cloning, a Laboratory Manual, Cold Spring Harbor Laboratory. New York, 1989).
  • the DNA sequence can be operably linked to an appropriate promoter in an expression vector to guide mRNA synthesis. Representative examples of these promoters are: the lac or trp promoter of E.
  • the expression vector also includes a ribosome binding site for translation initiation, a transcription terminator, and the like. Insertion of enhancer sequences into the vector will enhance its transcription in higher eukaryotic cells. Enhancers are cis-acting factors expressed by DM, usually about 10 to 300 base pairs, which act on promoters to enhance gene transcription. Examples include SV40 enhancers of 100 to 270 base pairs on the late side of the origin of replication, polyoma enhancers and adenovirus enhancers on the late side of the origin of replication.
  • the expression vector preferably contains one or more selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
  • selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
  • GFP fluorescent protein
  • tetracycline or ampicillin resistance for E. coli.
  • a polynucleotide encoding NADH dehydrogenase 12 or a recombinant vector containing the polynucleotide can be transformed or transduced into a host cell to constitute a genetically engineered host cell containing the polynucleotide or the recombinant vector.
  • host cell refers to a prokaryotic cell, such as a bacterial cell; or a lower eukaryotic cell, such as a yeast cell; or a higher eukaryotic cell, such as a mammalian cell. Representative examples are: E.
  • coli Streptomyces
  • bacterial cells such as Salmonella typhimurium
  • fungal cells such as yeast
  • plant cells insect cells
  • insect cells such as flies S2 or Sf 9
  • animal cells such as CH0, COS or Bowes melanoma cells.
  • Transformation of a host cell with a D sequence according to the present invention or a recombinant vector containing the DNA sequence can be performed using conventional techniques well known to those skilled in the art.
  • the host is a prokaryote such as E. coli
  • competent cells capable of DNA uptake can be in the exponential growth phase were harvested, treated with CaC l 2 method used in steps well known in the art. The alternative is to use MgC l 2 .
  • transformation can also be performed by electroporation.
  • the following DNA transfection methods can be used: calcium phosphate co-precipitation method, or conventional mechanical methods such as microinjection, electroporation, and liposome packaging.
  • the polynucleotide sequence of the present invention can be used to express or produce recombinant NADH dehydrogenase 12 (Science, 1 984; 224: 1431). Generally there are the following steps:
  • the medium used in the culture may be selected from various conventional mediums. Culture is performed under conditions suitable for host cell growth. After the host cells have grown to an appropriate cell density, the selected promoter is induced by a suitable method (such as temperature conversion or chemical induction), and the cells are cultured for a period of time.
  • a suitable method such as temperature conversion or chemical induction
  • the recombinant polypeptide may be coated in a cell, expressed on a cell membrane, or secreted outside the cell. If necessary, the recombinant protein can be isolated and purified by various separation methods using its physical, chemical and other properties. These methods are well known to those skilled in the art. These methods include, but are not limited to: conventional renaturation treatment, protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid chromatography (HPLC) and various other liquid chromatography techniques and combinations of these methods.
  • conventional renaturation treatment protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid
  • polypeptides of the present invention can be directly used in the treatment of diseases, for example, they can be used to treat malignant tumors, adrenal deficiency, skin diseases, various types of inflammation, HIV infection, and immunological diseases.
  • the respiratory chain NADH dehydrogenase is a complex of oligomeric enzymes containing multiple subunits.
  • the 75Kd peptide in the enzyme complex is the largest subunit.
  • respiratory metabolism is an important metabolic process, which ultimately generates ATP through electron transfer and oxidative phosphorylation to meet the cell's need for energy.
  • the first step in electron transfer is through the NADH dehydrogenase complex. To be done.
  • NADH dehydrogenase can cause defects in NADH dehydrogenase, causing some brain diseases.
  • causes more common diseases such as Parkinson syndrome, some people develop this symptom after the age of 40, which is due to the weakened function of the NADH dehydrogenase complex in the mitochondria; in addition, low NADH dehydrogenation Enzyme activity can cause Huntington's disease.
  • the abnormal expression of the specific NADH dehydrogenase 75Kd subunit mot if will cause the function of the polypeptide containing the mot if of the present invention to be abnormal, resulting in abnormal function of the respiratory chain, affecting the metabolism of substances and energy, and Produce related diseases such as Parkinson's Syndrome, Huntington's disease, physical and energy metabolism disorders, growth and development disorders, tumors, etc.
  • the abnormal expression of the NADH dehydrogenase 12 of the present invention will produce various diseases, especially Parkinson's syndrome, Henry's disease, physical and energy metabolic disorders, growth and development disorders, and tumors. These diseases include But not limited to:
  • disorders related to energy and substance metabolism disorders isovaleric acidemia, propionic acidemia, methylmalonic aciduria, combined carboxylase deficiency, glutaric acid type I, phenylketonuria, albinism, color Aminoemia, Glycineemia, Hypersarcosinemia, Defective Metabolism of Glutamate, Metabolism Defective Disease of Urea Cycle, Defective Metabolism of Histidine, Defective Metabolism of Lysine, Mucopolysaccharidosis Type I-VII , Mucolipid storage disease, Ray-niney syndrome, xanthineuria, orotic aciduria, adenine deaminase deficiency, hyperlipoproteinemia, familial hyperalpha-lipoproteinemia, congenital Lactose intolerance, hereditary fructose intolerance, galactosemia, defects in fructose metabolism, glycogen storage disease
  • Growth and development disorders mental retardation, cerebral palsy, brain development disorders, mental retardation, familial cerebral nucleus dysplasia syndrome, strabismus, skin, fat and muscular dysplasia such as congenital skin laxity, premature aging Disease, congenital keratosis, various metabolic defects such as various amino acid metabolic defects, stunting, dwarfism, sexual retardation
  • Tumors of various tissues gastric cancer, liver cancer, lung cancer, esophageal cancer, breast cancer, leukemia, lymphoma, thyroid tumor, uterine fibroids, neuroblastoma, astrocytoma, ependymoma, glioblastoma, Colon cancer, melanoma, adrenal cancer, bladder cancer, bone cancer, osteosarcoma, myeloma, bone marrow cancer, brain cancer, uterine cancer, endometrial cancer, gallbladder cancer, colon cancer, thymic tumor, nasal cavity and sinus tumor, nose Pharyngeal cancer, Laryngeal cancer, Tracheal tumor, Fibroma, Fibrosarcoma, Lipoma, Liposarcoma, Leiomyoma
  • NADH dehydrogenase 12 of the present invention will also produce certain hereditary, hematological and immune system diseases.
  • the polypeptide of the present invention can be directly used for the treatment of diseases, for example, it can treat various diseases, especially Parkinson's syndrome, Hendington's disease, material and energy metabolism disorders , Growth and development disorders, tumors, certain hereditary, hematological and immune system diseases.
  • the invention also provides screening compounds to identify improved (agonist) or repressed (antagonist) NADH removal Method for preparation of catalase 12.
  • Agonists increase biological functions such as NADH dehydrogenase 12 to stimulate cell proliferation, while antagonists prevent and treat disorders related to excessive cell proliferation, such as various cancers.
  • mammalian cells or a membrane preparation expressing NADH dehydrogenase 12 can be cultured together with labeled NADH dehydrogenase 12 in the presence of a drug. The ability of the drug to increase or block this interaction is then determined.
  • Antagonists of NADH dehydrogenase 12 include antibodies, compounds, receptor deletions, and the like that have been screened.
  • An antagonist of NADH dehydrogenase 12 can bind to NADH dehydrogenase 12 and eliminate its function, or inhibit the production of the polypeptide, or bind to the active site of the polypeptide so that the polypeptide cannot perform a biological function.
  • NADH dehydrogenase 12 When screening compounds as antagonists, NADH dehydrogenase 12 can be added to the bioanalytical assay to determine whether the compound is an antagonist by measuring the effect of the compound on the interaction between NADH dehydrogenase 12 and its receptor. Receptor deletions and analogs that act as antagonists can be screened in the same manner as described above for screening compounds.
  • Polypeptide molecules capable of binding to NADH dehydrogenase 12 can be obtained by screening a random peptide library composed of various possible combinations of amino acids bound to a solid phase. When screening, MDH dehydrogenase 12 molecules should generally be labeled.
  • the present invention provides a method for producing antibodies using polypeptides, and fragments, derivatives, analogs or cells thereof as antigens. These antibodies can be polyclonal or monoclonal antibodies.
  • the invention also provides antibodies directed against the NADH dehydrogenase 12 epitope. These antibodies include (but are not limited to): polyclonal antibodies, monoclonal antibodies, chimeric antibodies, single chain antibodies, Fab fragments, and fragments generated from Fab expression libraries.
  • Polyclonal antibodies can be produced by injecting NADH dehydrogenase 12 directly into immunized animals (such as rabbits, mice, rats, etc.).
  • immunized animals such as rabbits, mice, rats, etc.
  • a variety of adjuvants can be used to enhance the immune response, including but not limited to Freund's adjuvant.
  • Techniques for preparing monoclonal antibodies to NADH dehydrogenase 12 include, but are not limited to, hybridoma technology (Kohler and Milstein. Nature, 1975, 256: 495-497), triple tumor technology, human beta-cell hybridoma technology, and EBV-hybridization. Tumor technology, etc.
  • Chimeric antibodies that bind human constant regions and non-human-derived variable regions can be produced using existing techniques (Morrison et al, PNAS, 1985, 81: 6851).
  • the existing technology for producing single-chain antibodies (U.S. Pat No. 4946778) can also be used to produce single-chain antibodies against NADH dehydrogenase 12.
  • Antibodies against NADH dehydrogenase 12 can be used in immunohistochemistry to detect NADH dehydrogenase 12 in biopsy specimens.
  • Monoclonal antibodies that bind to NADH dehydrogenase 12 can also be labeled with radioisotopes and injected into the body to track their location and distribution. This radiolabeled antibody can be used as a non-invasive diagnostic method to locate tumor cells and determine whether there is metastasis.
  • Antibodies can also be used to design immunotoxins that target a particular part of the body.
  • NADH dehydrogenase 12 High-affinity monoclonal antibodies can covalently bind to bacterial or phytotoxins (such as diphtheria toxin, ricin, ormosine, etc.).
  • a common method is to attack the amino group of an antibody with a thiol cross-linking agent such as SPDP and bind the toxin to the antibody through the exchange of disulfide bonds.
  • This hybrid antibody can be used to kill MDH dehydrogenase 12 positive cells.
  • the antibodies of the present invention can be used to treat or prevent diseases related to NADH dehydrogenase 12. Administration of appropriate doses of antibodies can stimulate or block NADH dehydrogenase 12 production or activity.
  • the invention also relates to a diagnostic test method for quantitative and localized detection of NADH dehydrogenase 12 levels.
  • tests are well known in the art and include FISH assays and radioimmunoassays.
  • the levels of NADH dehydrogenase 12 detected in the test can be used to explain the importance of NADH dehydrogenase 12 in various diseases and to diagnose diseases in which NADH dehydrogenase 12 functions.
  • polypeptide of the present invention can also be used for peptide mapping analysis.
  • the polypeptide can be specifically cleaved by physical, chemical or enzymatic analysis, and subjected to one-dimensional or two-dimensional or three-dimensional gel electrophoresis analysis, and more preferably mass spectrometry analysis.
  • the polynucleotide encoding NADH dehydrogenase 12 can also be used for a variety of therapeutic purposes. Gene therapy technology can be used to treat abnormal cell proliferation, development or metabolism caused by the non-expression or abnormal / inactive expression of NADH dehydrogenase 12.
  • Recombinant gene therapy vectors (such as viral vectors) can be designed to express mutated NADH dehydrogenase 12 to inhibit endogenous NADH dehydrogenase 12 activity.
  • a mutated NADH dehydrogenase 12 may be a shortened MDH dehydrogenase 12 lacking a signaling domain. Although it can bind to downstream substrates, it lacks signaling activity.
  • recombinant gene therapy vectors can be used to treat diseases caused by abnormal expression or activity of NADH dehydrogenase 12.
  • Virus-derived expression vectors such as retroviruses, adenoviruses, adenovirus-associated viruses, herpes simplex virus, and parvoviruses can be used to transfer polynucleotides encoding NADH dehydrogenase 12 into cells.
  • a method for constructing a recombinant viral vector carrying a polynucleotide encoding NADH dehydrogenase 12 can be found in the existing literature (Sambrook, et al.).
  • the polynucleotide encoding NADH dehydrogenase 12 can be packaged into liposomes and transferred into cells.
  • Methods for introducing a polynucleotide into a tissue or cell include: directly injecting the polynucleotide into a tissue in vivo; or introducing the polynucleotide into a cell in vitro through a vector (such as a virus, phage, or plasmid), and then transplanting the cell Into the body and so on.
  • a vector such as a virus, phage, or plasmid
  • Oligonucleotides including antisense RNA and DNA
  • ribozymes that inhibit NADH dehydrogenase 12 mRNA are also within the scope of the present invention.
  • a ribozyme is an enzyme-like RNA molecule that specifically decomposes specific RNA. Its mechanism of action is that the ribozyme molecule specifically hybridizes with a complementary target RNA for endonucleation.
  • Antisense RNA, DNA, and ribozymes can be obtained using any existing RM or DNA synthesis technology, such as the technology for the synthesis of oligonucleotides by solid-phase phosphoramidite chemical synthesis has been widely used.
  • Antisense RNA molecule can encode this RNA
  • the DNA sequence is obtained by in vitro or in vivo transcription. This DNA sequence has been integrated downstream of the RNA polymerase promoter of the vector.
  • RNA polymerase promoter of the vector.
  • it can be modified in a variety of ways, such as increasing the sequence length on both sides, and the ribonucleoside linkages should use phosphate thioester or peptide bonds instead of phosphodiester bonds.
  • the polynucleotide encoding DH dehydrogenase 12 can be used for the diagnosis of diseases related to NADH dehydrogenase 12.
  • a polynucleotide encoding NADH dehydrogenase 12 can be used to detect the expression of NADH dehydrogenase 12 or the abnormal expression of NADH dehydrogenase 1 2 in a disease state.
  • the DNA sequence encoding NADH dehydrogenase 1 2 can be used to hybridize biopsy specimens to determine the expression of NADH dehydrogenase 1 2.
  • Hybridization techniques include Sou thern blotting, Northern blotting, and in situ hybridization. These techniques and methods are publicly available and mature, and related kits are commercially available.
  • a part or all of the polynucleotides of the present invention can be used as probes to be fixed on a microarray (Microcroix) or a DNA chip (also known as a "gene chip") for analyzing differential expression analysis of genes in a tissue and genes. diagnosis.
  • NADH dehydrogenase 12 specific primers can also be used to detect the transcription products of NADH dehydrogenase 12 by RM-polymerase chain reaction (RT-PCR) in vitro amplification.
  • NADH dehydrogenase 12 mutations include point mutations, translocations, deletions, recombinations, and any other abnormalities compared to the normal wild-type NADH dehydrogenase 12 DNA sequence. Mutations can be detected using existing techniques such as Southern blotting, DNA sequence analysis, PCR and in situ hybridization. In addition, mutations may affect the expression of proteins, so the Nort Hern blotting and Wet Stern blotting can be used to indirectly determine whether there is a mutation in the gene.
  • sequences of the invention are also valuable for chromosome identification. This sequence will specifically target a specific position on a human chromosome and can hybridize to it. Currently, specific sites for each gene on the chromosome need to be identified. Currently, only a few chromosome markers based on actual sequence data (repeating polymorphisms) are available for marking chromosome positions. According to the present invention, in order to associate these sequences with disease-related genes, an important first step is to locate these DNA sequences on a chromosome.
  • PCR primers (preferably 1 to 35 bp) are prepared based on cDNA, and the sequences can be located on chromosomes. These primers were then used for PCR screening of somatic hybrid cells containing individual human chromosomes. Only those heterozygous cells containing the human gene corresponding to the primer will produce amplified fragments.
  • PCR localization of somatic hybrid cells is a quick way to localize DM to specific chromosomes.
  • oligonucleotide primers of the present invention by a similar method, a set of fragments from a specific chromosome or a large number of genomic clones can be used to achieve sublocalization.
  • Other similar strategies that can be used for chromosomal localization include in situ hybridization, chromosome pre-screening with labeled flow sorting, and hybrid pre-selection to construct chromosome-specific cDNA libraries.
  • Fluorescent in situ hybridization (FISH) of cDNA clones to metaphase chromosomes allows precise chromosomal localization in one step.
  • FISH fluorescent in situ hybridization
  • the physical location of the sequence on the chromosome can be correlated with the genetic map data. These data can be found in V. Mckusick, Mende l ian Inheritance in Man (available online with Johns Hopk ins University Wetch Medical Library). Linkage analysis can then be used to determine the relationship between genes and diseases that have been mapped to chromosomal regions.
  • the difference in cDNA or genomic sequence between the affected and unaffected individuals needs to be determined. If a mutation is observed in some or all diseased individuals and the mutation is not observed in any normal individuals, the mutation may be the cause of the disease. Comparing affected and unaffected individuals usually involves first looking for structural changes in chromosomes, such as deletions or translocations that are visible at the chromosomal level or detectable with cDNA sequence-based PCR. According to the resolution capabilities of current physical mapping and gene mapping technology, the cDNA accurately mapped to the chromosomal region associated with the disease can be one of 50 to 500 potentially pathogenic genes (assuming 1 megabase mapping resolution) Capacity and each 20kb corresponds to a gene).
  • the polypeptides, polynucleotides and mimetics, agonists, antagonists and inhibitors of the present invention can be used in combination with a suitable pharmaceutical carrier.
  • suitable pharmaceutical carrier can be water, glucose, ethanol, salts, buffers, glycerol, and combinations thereof.
  • the composition comprises a safe and effective amount of the polypeptide or antagonist, and carriers and excipients which do not affect the effect of the drug. These compositions can be used as drugs for the treatment of diseases.
  • the invention also provides a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the invention.
  • a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the invention.
  • these containers there may be instructional instructions given by government agencies that manufacture, use, or sell pharmaceuticals or biological products, which prompts permission for administration on the human body by government agencies that produce, use, or sell.
  • the polypeptides of the invention can be used in combination with other therapeutic compounds.
  • the pharmaceutical composition can be administered in a convenient manner, such as by a topical, intravenous, intraperitoneal, intramuscular, subcutaneous, intranasal or intradermal route of administration.
  • NADH dehydrogenase 12 is administered in an amount effective to treat and / or prevent a specific indication.
  • the amount and dosage range of NADH dehydrogenase 12 administered to a patient will depend on many factors, such as the mode of administration, the health conditions of the person to be treated, and the judgment of the diagnostician.
  • Total human fetal brain RNA was extracted by one-step method with guanidine isothiocyanate / phenol / chloroform.
  • Poly (A) mRNA was isolated from total RM using Quik mRNA Isolation Kit (Qiegene). 2ug poly (A) mRNA is reverse transcribed to form cDNA.
  • a Smart cDNA cloning kit (purchased from Clontech) was used to insert the 00 ⁇ fragment into the multiple cloning site of the pBSK (+) vector (Clontech) to transform DH5a. The bacteria formed a cDNA library.
  • Dye terminate cycle react ion sequencing kit Perkin-Eimer
  • ABI 377 automatic sequencer Perkin-Elmer
  • the determined cDNA sequence was compared with the existing public DNA sequence database (Genebank), and it was found that the cDNA sequence of one of the clones 0105g09 was new DNA.
  • a series of primers were synthesized to determine the inserted cDNA fragments of the clone in both directions.
  • the sequence of the MDH dehydrogenase 12 of the present invention and the protein sequence encoded by the MDH dehydrogenase 12 of the present invention were profiled using the GCG profile scan program (Basic local alignment search tool) [Altschul, SF et al. J. Mol. Biol. 1990; 215: 403 -10], performing domain analysis in a database such as prosit.
  • the NADH dehydrogenase 12 of the present invention is homologous with the characteristic protein of the NADH dehydrogenase in the scab domain at 26-112. The result of the homology is shown in FIG. 1 with a homology of 0.29 and a score of 15.39; the threshold is 14.04.
  • Example 3 Cloning of a gene encoding NADH dehydrogenase 12 by RT-PCR
  • CDNA was synthesized using fetal brain total RNA as a template and oligo-dT as a primer for reverse transcription reaction. After purification with Qiagene's kit, the following primers were used for PCR amplification:
  • Primerl 5'- GGAAAAGAAGAGTAAAAAAAGATA—3 '(SEQ ID NO: 3)
  • Primer2 5'- ACGGAGTCTCGCTCTTTCCCCAGG -3 '(SEQ ID NO: 4)
  • Primerl is a forward sequence starting at lbp at the 5 'end of SEQ ID NO: 1;
  • Primer2 is the 3 'end reverse sequence in SEQ ID NO: 1.
  • Amplification reaction conditions 50 mmol / L KC1, 10 mmol / L Tris-HC1, pH 8.5, 1.5 ramol / L MgCl 2 , 20 (mol / L dNTP, lOpmol primer, 1U Taq DM in a reaction volume of 50 ⁇ 1 Polymerase (C 1 on t ech).
  • the reaction was performed on a PE9600 DNA thermal cycler (PerkiniEmer) for 25 cycles under the following conditions: 94. C 30sec; 55 ° C 30sec; 72 ° C 2rain 0
  • set ⁇ -actin as a positive control and template blank as a negative control during RT-PCR.
  • the amplified product was purified using a QIAGEN kit and ligated to a pCR vector (Invitrogen product) using a TA cloning kit.
  • the DNA sequence analysis results showed that the DNA sequence of the PCR product was exactly the same as 1-2184bp shown in SEQ ID NO: 1.
  • Example 4 Northern blot analysis of NADH dehydrogenase 12 gene expression
  • RNA extraction in one step [Anal. Biochem 19112, 162, 156-159] 0
  • This method involves acid guanidinium thiocyanate-chloroform extraction. That is, 4M guanidine isothiocyanate-25mM sodium citrate, 0.2M sodium acetate (pH4.0) were used to uniformly paddle the tissue, and 1 volume of phenol and 1/5 volume of chloroform-isoamyl alcohol (49: 1) were added. ), Mix and centrifuge. The aqueous layer was aspirated, isopropanol (0.8 vol) was added and the mixture was centrifuged to obtain RM precipitate. The resulting RNA was precipitated with 70 ⁇ /. Wash with ethanol, dry and dissolve in water.
  • a 32P-labeled probe (approximately 2 ⁇ 10 6 cpm / ml) and a nitrocellulose membrane to which RNA was transferred were placed in a solution at 42 ° C. C hybridization overnight, the solution contains 50% formamide-25mM KH 2 P0 4 (pH7.4) -5 ⁇ SSC-5 ⁇ Denhardt's solution and 20 ( ⁇ g / ml salmon sperm DNA. After hybridization, the filter membrane is at 1 ⁇ SSC-0.1% SDS was washed at 55 ° C for 30 min. Then, analysis and quantification were performed using Phosphor Imager.
  • Example 5 In vitro expression, isolation and purification of recombinant NADH dehydrogenase 12
  • Primer3 5'- CATGCTAGCATGATAATCAGAAAATTGGCATTTT -3 '(Seq ID No: 5)
  • Primer4 5- CATGGATCCTCATCCTCTCCTTCTGAGAAGATAG -3' (Seq ID No: 6)
  • the 5 'ends of these two primers contain Nhel and BamHI restriction sites, respectively, which The coding sequences of the 5 'and 3' ends of the gene of interest are respectively followed by Nhel and BamHI restriction sites corresponding to the selective endonucleases on the expression vector plasmid pET-28b (+) (Novagen, Cat. No. 69865.3). Enzyme site.
  • the PCR reaction was performed using the pBS-0105g09 plasmid containing the full-length target gene as a template.
  • the PCR reaction conditions are as follows: the total volume of 50 ⁇ 1 contains 10 pg of pBS-0105g09 plasmid, primers? 1 ⁇ 1 ⁇ 1-3 and? 111 ⁇ -4 are 1 ( ⁇ 11101, Advantage polymerase Mix (Clontech)) 1 ⁇ 1. Cycle parameters: 94 ° C 20s, 60 ° C 30s, 68 ° C 2 min, a total of 25 cycles.
  • Use Nhel and BamHI respectively Digestion of the amplified product and plasmid pET-28 (+) Do not recover large fragments and ligate with T4 ligase.
  • the ligation product was transformed into E. coli DH5a by the calcium chloride method, and cultured overnight on LB plates containing kanamycin (final concentration 3 ( ⁇ g / ml)), and positive clones were selected by colony PCR method and sequenced. Positive sequence correct clone (pET-0105g09) was used to transform the recombinant plasmid into E. coli BL21 (DE3) plySs (product of Novagen) by calcium chloride method. Cultured in LB liquid containing kanamycin (final concentration 30 ⁇ 8 / ⁇ 1) In the medium, the host bacteria BL21 (pET-0105g09) was cultured at 37 ° C.
  • NH 2 -Met-I le-I le-Arg-Lys-Leu-Ala-Phe-Cys-Leu-Tyr-Val-Leu-Phe-Ser-COOH SEQ ID NO: 7
  • the polypeptide is coupled to hemocyanin and bovine serum albumin to form a complex.
  • rabbits were immunized with 4 mg of the above-mentioned cyanin polypeptide complex plus complete Freund's adjuvant, and 15 days later, the hemocyanin polypeptide complex plus incomplete Freund's adjuvant was used to boost the immunity once.
  • a titer plate coated with a 15 ⁇ ⁇ A ⁇ 1 bovine serum albumin peptide complex was used as an ELISA to determine the antibody titer in rabbit serum.
  • Total IgG was isolated from antibody-positive rabbit serum using protein A-Sepharose.
  • the peptide was bound to a cyanogen bromide-activated Sepharose4B column, and anti-peptide antibodies were separated from the total IgG by affinity chromatography. Immunoprecipitation demonstrated that the purified antibody specifically binds to NADH dehydrogenase 12.
  • Example 7 Application of the polynucleotide fragment of the present invention as a hybridization probe
  • Suitable oligonucleotide fragments selected from the polynucleotides of the present invention are used as hybridization probes in a variety of ways.
  • the probes can be used to hybridize to genomic or cDNA libraries of normal tissue or pathological tissue from different sources to It is determined whether it contains the polynucleotide sequence of the present invention and a homologous polynucleotide sequence is detected.
  • the probe can be used to detect the polynucleotide sequence of the present invention or its homologous polynucleotide sequence in normal tissue or pathology. Whether the expression in tissue cells is abnormal.
  • the purpose of this embodiment is to select a suitable oligonucleotide fragment from the polynucleotide SEQ ID NO: 1 of the present invention as a hybridization probe, and to identify whether some tissues contain the polynucleoside of the present invention by a filter hybridization method.
  • Filter hybridization methods include dot blotting, Southern blotting Trace method, Nor thern blot method, and copy method, etc., all are used to fix the polynucleotide sample to be tested on the filter membrane and then hybridize using basically the same steps.
  • the sample-immobilized filter is first pre-hybridized with a probe-free hybridization buffer, so that the non-specific binding site of the sample on the filter is saturated with the carrier and the synthetic polymer.
  • the pre-hybridization solution is then replaced with a hybridization buffer containing the labeled probe and incubated to hybridize the probe to the target nucleic acid.
  • the unhybridized probes are removed by a series of membrane washing steps.
  • This embodiment utilizes higher-intensity washing conditions (such as lower salt concentration and higher temperature) to reduce the hybridization background and retain only strong specific signals.
  • the probes used in this embodiment include two types: the first type of probes are oligonucleotide fragments that are completely the same as or complementary to the polynucleotide SEQ ID NO: 1 of the present invention; the second type of probes are partially related to the present invention
  • the polynucleotide SEQ ID NO: 1 is the same or complementary oligonucleotide fragment.
  • the dot blot method is used to fix the sample on the filter membrane. Under the high-intensity washing conditions, the first type of probe and the sample have the strongest hybridization specificity and are retained.
  • oligonucleotide fragments for use as hybridization probes from the polynucleotide SEQ ID NO: 1 of the present invention should follow the following principles and several aspects to be considered:
  • the preferred range of probe size is 18-50 nucleotides
  • the GC content is 30% -70%, and the non-specific hybridization increases when it exceeds;
  • Those that meet the above conditions can be used as primary selection probes, and then further computer sequence analysis, including the primary selection probe and its source sequence region (ie, SEQ ID NO: 1) and other known genomic sequences and their complements The regions are compared for homology. If the homology with the non-target molecular region is greater than 85% or there are more than 15 consecutive bases, the primary probe should not be used;
  • Probe 1 (probel), which belongs to the first type of probe, is completely homologous or complementary to the gene fragment of SEQ ID NO: 1 (41Nt)
  • Probe 2 which belongs to the second type of probe, is equivalent to the replacement mutant sequence of the gene fragment of SEQ ID NO: 1 or its complementary fragment (41Nt):
  • PBS phosphate buffered saline
  • step 8-13 are only used when contamination must be removed, otherwise step 14 can be performed directly.
  • NC membrane nitrocellulose membrane
  • Two NC membranes are required for each probe, so that it can be used in the following experimental steps.
  • the film was washed with high-strength conditions and strength conditions, respectively.
  • 3plProbe (0.1 IOD / ⁇ ), add 2plKinase buffer, 8-10 uCi ⁇ - 32P-dATP + 2U Kinase, to make up to a final volume of 20 ⁇ 1.
  • the sample membrane was placed in a plastic bag, and 3-1 Omg pre-hybridization solution (lOxDenhardt-s; 6xSSC, 0.1 mg / ral CT DNA (calf thymus DNA)) was added. After the bag was sealed, it was shaken in a 68 Q C water bath 2 hour.
  • 3-1 Omg pre-hybridization solution (lOxDenhardt-s; 6xSSC, 0.1 mg / ral CT DNA (calf thymus DNA)
  • Gene chip or DNA microarray is a new technology that many national laboratories and large pharmaceutical companies are currently developing and developing. It refers to the orderly and high-density arrangement of large numbers of target gene fragments on glass, The data is compared and analyzed on a carrier such as silicon using fluorescence detection and computer software to achieve the purpose of rapid, efficient, and high-throughput analysis of biological information.
  • the polynucleotide of the present invention can be used as a target DM for gene chip technology for high-throughput research of new gene functions; searching for and screening new tissue-specific genes, especially new genes related to diseases such as tumors; diagnosis of diseases such as hereditary diseases .
  • the specific method steps have been reported in the literature. For example, see DeRisi, JL, Lyer, V. & Brown, P.0. (1997) Science 278, 680-686. And He lie, RA, Schema, M., Chai, A., Shalom, D., (1997) PNAS 94: 2150-2155.
  • a total of 4,000 polynucleotide sequences of various full-length cDNAs are used as target DNA, including the polynucleotide of the present invention. They were amplified by PCR respectively. After purification, the amplified product was adjusted to a concentration of about 500 ng / ul, and spotted on a glass medium using a Cartesian 7500 spotter (purchased from Cartesian, USA). In essence, the distance between points is 280 ⁇ . The spotted slides were hydrated and dried, cross-linked in a UV cross-linker, and dried after elution to fix the DNA on the glass slide to prepare a chip. The specific method steps have been reported in the literature. The sample post-processing steps in this embodiment are:
  • Total mRNA was extracted from normal liver and liver cancer in one step, and mRNA was purified using Oligotex mRNA Midi Kit (purchased from QiaGen).
  • the fluorescent reagent Cy3dUTP (5-Amino- propargyl-2--deoxyuridine 5'- tr iphate coupled to Cy3 fluorescent dye, purchased from Amersham Phamacia Biotech company) labeled mRNA of normal liver tissue, using the fluorescent reagent Cy5dUTP (5-Amino-propargy 1-2 '-deoxyuri dine 5'-triphate coupled to Cy5 fluorescent dye, purchased (Amersham Phamacia Biotech) was used to label liver cancer tissue mRNA, and the probe was prepared after purification.
  • Cy3dUTP 5-Amino- propargyl-2--deoxyuridine 5'- tr iphate coupled to Cy3 fluorescent dye, purchased from Amersham Phamacia Biotech company
  • Cy5dUTP 5-Amino
  • the probes from the above two tissues were hybridized with the chip in a UniHyb TM Hybridization Solution (purchased from TeleChem) hybridization solution for 16 hours, washed with a washing solution (1 x SSC, 0.2% SDS) at room temperature, and then scanned with ScanArray 3000.
  • Scanner purchased from General Scanning Company, USA
  • the scanned image was analyzed by Iraagene software (Biodiscovery Company, USA), and the Cy3 / Cy5 ratio of each point was calculated.
  • the points with the ratio less than 0.5 and greater than 2 were considered Genes with differential expression.

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Organic Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Molecular Biology (AREA)
  • Microbiology (AREA)
  • Biotechnology (AREA)
  • Biomedical Technology (AREA)
  • Biochemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Enzymes And Modification Thereof (AREA)

Abstract

L'invention concerne un nouveau polypeptide, une déshydrogénase NADH 12, et un polynucléotide codant pour ce polypeptide ainsi qu'un procédé d'obtention de ce polypeptide par des techniques recombinantes d'ADN. L'invention concerne en outre les applications de ce polypeptide dans le traitement de maladies, notamment des tumeurs malignes, de l'hémopathie, de l'infection par VIH, de maladies immunitaires et de diverses inflammations. L'invention concerne aussi l'antagoniste agissant contre le polypeptide et son action thérapeutique ainsi que les applications de ce polynucléotide codant pour la déshydrogénase NADH 12.
PCT/CN2000/000552 1999-12-21 2000-12-11 Nouveau polypeptide, deshydrogenase nadh 12, et polynucleotide codant pour ce polypeptide WO2001046424A1 (fr)

Priority Applications (1)

Application Number Priority Date Filing Date Title
AU19826/01A AU1982601A (en) 1999-12-21 2000-12-11 A novel polypeptide, nadh dehydrogenase 12 and the polynucleotide encoding the polypeptide

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
CN 99125668 CN1300838A (zh) 1999-12-21 1999-12-21 一种新的多肽－nadh脱氢酶12和编码这种多肽的多核苷酸
CN99125668.9 1999-12-21

Publications (1)

Publication Number Publication Date
WO2001046424A1 true WO2001046424A1 (fr) 2001-06-28

Family

ID=5284082

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/CN2000/000552 WO2001046424A1 (fr) 1999-12-21 2000-12-11 Nouveau polypeptide, deshydrogenase nadh 12, et polynucleotide codant pour ce polypeptide

Country Status (3)

Country Link
CN (1) CN1300838A (fr)
AU (1) AU1982601A (fr)
WO (1) WO2001046424A1 (fr)

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
DATABASE GENBANK [online] 1 April 1997 (1997-04-01), Database accession no. AD000092 *
DATABASE GENBANK [online] 23 November 1999 (1999-11-23), accession no. EMBL Database accession no. AL031273 *
DATABASE GENBANK [online] 5 January 1999 (1999-01-05), Database accession no. AC006275 *
GENOME RES., vol. 8, no. 11, November 1998 (1998-11-01), pages 1097 - 1108 *

Also Published As

Publication number Publication date
AU1982601A (en) 2001-07-03
CN1300838A (zh) 2001-06-27

Similar Documents

Publication Publication Date Title
WO2001090169A1 (fr) Nouveau polypeptide, antigene nucleaire de proliferation cellulaire (pcna) 13, et polynucleotide codant ce polypeptide
WO2001048168A1 (fr) Nouveau polypeptide, gamma1-pyroline-5-hydroxy reductase 14, et polynucleotide codant pour ce polypeptide
WO2001046424A1 (fr) Nouveau polypeptide, deshydrogenase nadh 12, et polynucleotide codant pour ce polypeptide
WO2001072815A1 (fr) Nouveau polypeptide, ferredoxine humaine 12, et polynucleotide codant pour ce polypeptide
WO2001053495A1 (fr) Nouveau polypeptide, ferrodexine 10, et polynucleotide codant pour ce polypeptide
WO2001055404A1 (fr) Nouveau polypeptide, alcool deshydrogenase humaine 39, et polynucleotide codant pour ce polypeptide
WO2001046431A1 (fr) Nouveau polypeptide, catalase 10, et polynucleotide codant pour ce polypeptide
WO2001046250A1 (fr) Nouveau polypeptide, triose phosphate isomerase 9, et polynucleotide codant pour ce polypeptide
WO2001096572A1 (fr) Nouveau polypeptide, multi-cuivre oxydase 12, et polynucleotide codant ce polypeptide
WO2001098488A1 (fr) Nouveau polypeptide, sous-unite 24 de flavoproteine humaine, et polynucleotide codant ce polypeptide
WO2001094593A1 (fr) Nouveau polypeptide, glycero-3-phosphate deshydrogenase humaine 11, et polynucleotide codant ce polypeptide
WO2001048001A1 (fr) Nouveau polypeptide, quinone-proteine reductase 7, et polynucleotide codant pour ce polypeptide
WO2001046429A1 (fr) Nouveau polypeptide, deshydrogenase a chaine respiratoire 10 nadh, et polynucleotide codant pour ce polypeptide
WO2001048219A1 (fr) Nouveau polypeptide, proteine de transport phosphorylee 10, et polynucleotide codant pour ce polypeptide
WO2001048012A1 (fr) Nouveau polypeptide, sous-unite i-11 de nadh-deshydrogenase, et polynucleotide codant pour ce polypeptide
WO2001047995A1 (fr) Nouveau polypeptide, dioxygenase humaine 13, et polynucleotide codant pour ce polypeptide
WO2001049853A1 (fr) Phosphoribosyle glycinamide synthase 9 et polynucleotide codant ce polypeptide
WO2001055422A1 (fr) Nouveau polypeptide, proteine 47 de transport de sucre, et polynucleotide codant pour ce polypeptide
WO2001048002A1 (fr) Nouveau polypeptide, cytochrome b12, et polynucleotide codant pour ce polypeptide
WO2001081534A2 (fr) Nouveau polypeptide, oxydoreductase 2fe-2s humaine 12, et polynucleotide codant pour ce polypeptide
WO2001087944A1 (fr) Proteine 10, polypeptide humain caracterise en ce qu'il contient la sequence de la gamma glutamyl transpeptidase, et polynucleotide codant ce polypeptide
WO2001048166A1 (fr) Nouveau polypeptide, ribonucleotide reductase 10, et polynucleotide codant pour ce polypeptide
WO2001047971A1 (fr) Nouveau polypeptide, proteine d'echange anionique 9, et polynucleotide codant pour ce polypeptide
WO2001066701A1 (fr) Nouveau polypeptide, nadh-deshydrogenase humaine 13, et polynucleotide codant pour ce polypeptide
WO2001075024A2 (fr) Nouveau polypeptide, facteur humain 13 associe a nf-e2, et polynucleotide codant pour ce polypeptide

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
REG Reference to national code

Ref country code: DE

Ref legal event code: 8642

122 Ep: pct application non-entry in european phase
NENP Non-entry into the national phase

Ref country code: JP