WO2001055422A1 - Novel polypeptide---sugar transporter protein 47 and polynucleotide encoding it - Google Patents

Abstract

The invention concerns sugar transporter protein 47 and polynucleotide encoding it. The invention also concerns the process of producing the polypeptide by recombinant DNA technique. The methods for treating many diseases e.g. malignant tumor, hemopathy, infection of HIV, immunological diseases and a variety of inflammation utilizing the polypeptide are disclosed. The invention discloses the antagonist against the polypeptide and therapeutics thereof. The invention also discloses the uses of the polynucleotide, which encodes the novel sugar transporter protein 47.

Description

 A new polypeptide, a sugar transporter 47, and a polynucleotide encoding the polypeptide TECHNICAL FIELD

 The present invention belongs to the field of biotechnology. Specifically, the present invention describes a novel polypeptide-to-sugar transporter 47, and a polynucleotide sequence encoding the polypeptide. The invention also relates to methods and applications for preparing such polynucleotides and polypeptides. Background technique

 In the nutritional metabolism of many cells, sugar uptake is the most important. In the past, it was thought that most mammalian tissues, except the liver, could only passively take up glucose through diffusion, relying on concentration differences inside and outside the cell membrane. Proteins that can complete sugar transport have now been found on the membranes of many cells. At the same time, it has also been found that hormones, insulin, etc. can also play a regulatory role. In different tissues, the proteins that complete sugar transport are structurally similar, so they are collectively referred to as the sugar transporter family. In the human body, this sugar transporter protein is encoded by the GLUT1-GLUT7 genes and is widely present in many tissues and cells in the body. In some tissues, sugar transport is under fast or slow hormonal regulation with tissue specificity. For example, when insulin levels increase, muscle tissue and adipose tissue increase significantly. Insulin can increase the liver's utilization of glucose. .

 The complete sugar transporter contains 12 transmembrane regions (M1-Mil), and has two identical conserved G-R- [KR] domains, so it can be inferred that it contains six transmembrane domains during evolution. Membrane proteins are copied. The first G-R- [KR] domain is located between the M2 and M3 transmembrane regions, while the second is located between the M8 and M9 transmembrane regions. There is a large loop structure between the M1 and M2 transmembrane regions, which is a potential N-terminal attachment site for oligosaccharides. In addition, there are also some conservative amino acid residues on the end of the M4 transmembrane region and the circular structure between the M4 and M5 transmembrane regions. The amino acid sequence of the most conserved region on the polypeptide chain is as follows: [LIVMSTAG] ― [LIVMFSAG] —X (2) _ [LIVMSA] — [DE] — X— [LIVMFYWA] — G— R—

[RK] a X (4,6) — [GSTA]. The sugar transporter is a hydrophobic protein, and its structure contains alterable hydrophobic and hydrophilic regions. There is a huge hydrophobic loop between the transmembrane regions M6 and M7.

 The polypeptide of the present invention has the basic structural characteristics of a sugar transporter and belongs to the sugar transporter family. In the body, it controls the control of glucose molecules in and out of the cell to maintain a balanced glucose content inside the cell. The out-of-control function can lead to dysregulation of cell nutrition metabolism, causing abnormalities in many tissues and organs.

As the sugar transporter 47 protein plays an important role in important functions of the body as described above, and it is believed that a large number of proteins are involved in these regulatory processes, there has been a need in the art to identify more sugar transporter 47 proteins involved in these processes, especially Is to identify the amino acid sequence of this protein. New sugar transporter 47 protein The isolation of the coding genes also provides the basis for research to determine the role of the protein in health and disease states. This protein may form the basis for the development of diagnostic and / or therapeutic drugs for diseases, so isolating its coding DNA is very important. Disclosure of invention

 An object of the present invention is to provide an isolated novel polypeptide-sugar transporter 47 and fragments, analogs and derivatives thereof.

 Another object of the invention is to provide a polynucleotide encoding the polypeptide.

 Another object of the present invention is to provide a recombinant vector containing a polynucleotide encoding a sugar transporter 47. It is another object of the present invention to provide a genetically engineered host cell containing a polynucleotide encoding a sugar transporter 47.

 Another object of the present invention is to provide a method for producing a sugar transporter 47.

 Another object of the present invention is to provide an antibody against the polypeptide-sugar transporter 47 of the present invention. Another object of the present invention is to provide mimetic compounds, antagonists, agonists, and inhibitors directed to the polypeptide-monosaccharide transporter 47 of the present invention.

 Another object of the present invention is to provide a method for diagnosing and treating diseases associated with abnormalities in sugar transporter 47.

 The present invention relates to an isolated polypeptide, which is of human origin and comprises: a polypeptide having the amino acid sequence of SEQ ID No. 2, or a conservative variant, biologically active fragment or derivative thereof. Preferably, the polypeptide is a polypeptide having the amino acid sequence of SEQ ID NO: 2.

 The invention also relates to an isolated polynucleotide comprising a nucleotide sequence or a variant thereof selected from the group consisting of:

 (a) a polynucleotide encoding a polypeptide having the amino acid sequence of SEQ ID No. 2;

 (b) a polynucleotide complementary to polynucleotide (a);

 (c) A polynucleotide having at least 70% identity to a polynucleotide sequence of (a) or (b).

 More preferably, the sequence of the polynucleotide is one selected from the group consisting of: (a) a sequence having positions 1 02 to 1 391 in SEQ ID NO: 1; and (b) a sequence having 1 in SEQ ID NO: 1 -235 3-bit sequence.

 The invention further relates to a vector, in particular an expression vector, containing the polynucleotide of the invention; a host cell genetically engineered with the vector, including a transformed, transduced or transfected host cell; and a method comprising culturing said Host cell and method of preparing the polypeptide of the present invention by recovering the expression product.

 The invention also relates to an antibody capable of specifically binding to a polypeptide of the invention.

The invention also relates to a screen for mimicking, activating, antagonizing or inhibiting the activity of the sugar transporter 47 protein. A method of compounds comprising utilizing a polypeptide of the invention. The invention also relates to compounds obtained by this method. The present invention also relates to a method for in vitro detection of a disease or susceptibility to disease associated with abnormal expression of a sugar transporter 47 protein, which comprises detecting a mutation in the polypeptide or a sequence encoding a polynucleotide thereof in a biological sample, or detecting a mutation in a biological sample. The amount or biological activity of a polypeptide of the invention.

 The invention also relates to a pharmaceutical composition comprising a polypeptide of the invention or a mimetic thereof, an activator, an antagonist or an inhibitor, and a pharmaceutically acceptable carrier.

 The present invention also relates to the use of the polypeptide and / or polynucleotide of the present invention in the preparation of a medicament for treating cancer, developmental disease or immune disease or other diseases caused by abnormal expression of sugar transporter 47.

 Other aspects of the invention will be apparent to those skilled in the art from the disclosure of the techniques herein. The following terms used in this specification and claims have the following meanings unless specifically stated: "Nucleic acid sequence" refers to an oligonucleotide, a nucleotide or a polynucleotide and a fragment or part thereof, and may also refer to a genomic or synthetic DNA or RNA, they can be single-stranded or double-stranded, representing the sense or antisense strand. Similarly, the term "amino acid sequence" refers to an oligopeptide, peptide, polypeptide or protein sequence and fragments or portions thereof. When the "amino acid sequence" in the present invention relates to the amino acid sequence of a naturally occurring protein molecule, such "polypeptide" or "protein" does not mean to limit the amino acid sequence to a complete natural amino acid related to the protein molecule .

 A protein or polynucleotide "variant" refers to an amino acid sequence having one or more amino acids or nucleotide changes or a polynucleotide sequence encoding it. The changes may include deletions, insertions or substitutions of amino acids or nucleotides in the amino acid sequence or nucleotide sequence. Variants can have "conservative" changes in which the substituted amino acid has a structural or chemical property similar to the original amino acid, such as the replacement of isoleucine with leucine. Variants can also have non-conservative changes, such as replacing glycine with tryptophan.

 "Deletion" refers to the deletion of one or more amino acids or nucleotides in an amino acid sequence or nucleotide sequence.

 "Insertion" or "addition" means that a change in the amino acid sequence or nucleotide sequence results in an increase in one or more amino acids or nucleotides compared to a molecule that exists in nature. "Replacement" refers to the replacement of one or more amino acids or nucleotides with different amino acids or nucleotides.

 "Biological activity" refers to a protein that has the structure, regulation, or biochemical function of a natural molecule. Similarly, the term "immunologically active" refers to the ability of natural, recombinant or synthetic proteins and fragments thereof to induce a specific immune response in appropriate animals or cells and to bind to specific antibodies.

"Agonist" refers to a protein that, when combined with sugar transporter 47, Molecules that are active in this protein. An agonist may include a protein, a nucleic acid, a carbohydrate, or any other molecule that can bind the sugar transporter 47.

 An "antagonist" or "inhibitor" refers to a molecule that, when combined with sugar transporter 47, can block or regulate the biological or immunological activity of sugar transporter 47. Antagonists and inhibitors may include proteins, nucleic acids, carbohydrates, or any other molecule that can bind sugar transporter 47.

 "Regulation" refers to a change in the function of sugar transporter 47, including an increase or decrease in protein activity, a change in binding properties, and any other biological, functional, or immune properties of sugar transporter 47.

 By "substantially pure" is meant substantially free of other proteins, lipids, sugars or other substances with which it is naturally associated. Those skilled in the art can purify sugar transporter 47 using standard protein purification techniques. The substantially pure sugar transporter 47 produces a single main band on a non-reducing polyacrylamide gel. The purity of the sugar transporter 47 polypeptide can be analyzed by amino acid sequence.

 "Complementary" or "complementary" refers to the natural binding of a nucleotide by base-pairing under conditions of acceptable salt concentration and temperature. For example, the sequence "C-T-G-A" can be combined with the complementary sequence "G-A-C-T". The complementarity between two single-stranded molecules may be partial or complete. The degree of complementarity between nucleic acid strands has a significant effect on the efficiency and strength of hybridization between nucleic acid strands.

 "Homology" refers to the degree of complementarity and can be partially homologous or completely homologous. "Partial homology" refers to a partially complementary sequence that at least partially inhibits hybridization of a fully complementary sequence to a target nucleic acid. This inhibition of hybridization can be detected by performing hybridization (Southern blotting or Nor thern blotting, etc.) under conditions of reduced stringency. Substantially homologous sequences or hybridization probes can compete and inhibit the binding of completely homologous sequences to the target sequence under conditions of reduced stringency. This does not mean that the conditions of reduced stringency allow non-specific binding, because the conditions of reduced stringency require that the two sequences bind to each other specifically or selectively.

 "Percent identity" refers to the percentage of sequences that are the same or similar in the comparison of two or more amino acid or nucleic acid sequences. The percent identity can be determined electronically, such as by the MEGALIGN program (Lasergene sof tware package, DNASTAR, Inc., Mad Son Wis.). The MEGALIGN program can compare two or more sequences according to different methods such as the Cluster method (Higgins, D. G. and P. M. Sharp (1988) Gene 73: 237-244). The Cl uster method arranges groups of sequences into clusters by checking the distance between all pairs. The clusters are then assigned in pairs or groups. The percent identity between two amino acid sequences such as sequence A and sequence B is calculated by:

 Number of matching residues between sequence A and sequence X 100

(Number of residues in sequence A-number of spacer residues in sequence A-number of spacer residues in sequence B) The percent identity between nucleic acid sequences can also be determined by the Cluster method or by methods known in the art such as Jotun He in (He in L, (1990) Methods in emzumo ogy 183: 625-645).

 "Similarity" refers to the degree of identical or conservative substitutions of amino acid residues at corresponding positions in the alignment of amino acid sequences. Amino acids used for conservative substitutions, for example, negatively charged amino acids may include aspartic acid and glutamic acid; positively charged amino acids may include lysine and arginine; having an uncharged head group is Similar hydrophilic amino acids may include leucine, isoleucine and valine; glycine and alanine; asparagine and glutamine; serine and threonine; phenylalanine and tyrosine.

 "Antisense" refers to a nucleotide sequence that is complementary to a particular DNA or RNA sequence. "Antisense strand" refers to a nucleic acid strand that is complementary to the "sense strand".

 "Derivative" refers to a chemical modification of HFP or a nucleic acid encoding it. Such a chemical modification may be a substitution of a hydrogen atom with a fluorenyl group, an acyl group or an amino group. Nucleic acid derivatives can encode polypeptides that retain the main biological characteristics of natural molecules.

"Antibody" refers to a complete antibody molecule and its fragments, such as Fa,? (^) ₂ and? It can specifically bind to the epitope of sugar transporter 47.

 A "humanized antibody" refers to an antibody in which the amino acid sequence of a non-antigen binding region is replaced to become more similar to a human antibody, but still retains the original binding activity.

 The term "isolated" refers to the removal of a substance from its original environment (for example, its natural environment if it occurs naturally). For example, a naturally occurring polynucleotide or polypeptide is not isolated when it is present in a living animal, but the same polynucleotide or polypeptide is separated from some or all of the substances that coexist with it in the natural system. Such a polynucleotide may be part of a vector, or such a polynucleotide or polypeptide may be part of a composition. Since the carrier or composition is not part of its natural environment, they are still isolated.

 As used herein, "isolated" refers to the separation of a substance from its original environment (if it is a natural substance, the original environment is the natural environment). For example, polynucleotides and polypeptides in a natural state in a living cell are not isolated and purified, but the same polynucleotides or polypeptides are separated and purified if they are separated from other substances existing in the natural state. .

 As used herein, "isolated sugar transporter 47" means that sugar transporter 47 is substantially free of other proteins, lipids, sugars, or other substances with which it is naturally associated. Those skilled in the art can purify sugar transporter 47 using standard protein purification techniques. Substantially pure polypeptides can produce a single main band on a non-reducing polyacrylamide gel. The purity of the sugar transporter 47 polypeptide can be analyzed by amino acid sequence.

The present invention provides a new polypeptide _ _ sugar transporter 47, which basically consists of the amino acid sequence shown in SEQ ID NO: 2. The polypeptide of the present invention may be a recombinant polypeptide, a natural polypeptide, a synthetic polypeptide, A recombinant polypeptide is preferred. The polypeptides of the present invention can be naturally purified products or chemically synthesized products, or can be produced from prokaryotic or eukaryotic hosts (eg, bacteria, yeast, higher plants, insects, and mammalian cells) using recombinant techniques. Depending on the host used in the recombinant production protocol, the polypeptide of the invention may be glycosylated, or it may be non-glycosylated. Polypeptides of the invention may also include or exclude starting methionine residues.

 The invention also includes fragments, derivatives and analogs of the sugar transporter 47. As used herein, the terms "fragment", "derivative" and "analog" refer to a polypeptide that substantially retains the same biological function or activity of the sugar transporter 47 of the present invention. A fragment, derivative or analog of the polypeptide of the present invention may be: U) a type in which one or more amino acid residues are substituted with conservative or non-conservative amino acid residues (preferably conservative amino acid residues), and the substituted The amino acid may or may not be encoded by the genetic code; or (Π) such that one or more of the amino acid residues is substituted by another group to include a substituent; or (Π Ι) A type in which a mature polypeptide is fused with another compound (such as a compound that prolongs the half-life of the polypeptide, such as polyethylene glycol); or (IV) a type of polypeptide sequence in which an additional amino acid sequence is fused into a mature polypeptide ( Such as the leader sequence or secreted sequence or the sequence used to purify this polypeptide or protease sequence) As explained herein, such fragments, derivatives and analogs are considered to be within the knowledge of those skilled in the art.

 The present invention provides an isolated nucleic acid (polynucleotide), which basically consists of a polynucleotide encoding a polypeptide having the amino acid sequence of SEQ ID NO: 2. The polynucleotide sequence of the present invention includes the nucleotide sequence of SEQ ID NO: 1. The polynucleotide of the present invention is found from a cDNA library of human fetal brain tissue. It contains a total nucleotide sequence of 2353 bases and its open reading frame of 102-1391 encodes 429 amino acids. This polypeptide has the characteristic sequence of the sugar transporter family, and it can be deduced that the sugar transporter 47 has the structure and function represented by the sugar transporter family.

 The polynucleotide of the present invention may be in the form of DNA or RNA. DM forms include cDNA, genomic DNA or synthetic DNA. DNA can be single-stranded or double-stranded. The DM can be a coding chain or a non-coding chain. The coding region sequence encoding a mature polypeptide may be the same as the coding region sequence shown in SEQ ID NO: 1 or a degenerate variant. As used herein, a "degenerate variant" refers to a nucleic acid sequence encoding a protein or polypeptide having SEQ ID NO: 2 but different from the coding region sequence shown in SEQ ID NO: 1 in the present invention.

 The polynucleotide encoding the mature polypeptide of SEQ ID NO: 2 includes: only the coding sequence of the mature polypeptide; the coding sequence of the mature polypeptide and various additional coding sequences; the coding sequence of the mature polypeptide (and optional additional coding sequences); Coding sequence.

The term "polynucleotide encoding a polypeptide" is meant to include polynucleotides that encode such polypeptides and polynucleotides that include additional coding and / or noncoding sequences. The invention also relates to variants of the polynucleotides described above, which encode polypeptides or fragments, analogs and derivatives of polypeptides having the same amino acid sequence as the invention. Variants of this polynucleotide may be naturally occurring allelic variants or non-naturally occurring variants. These nucleotide variants include substitution variants, deletion variants, and insertion variants. As known in the art, an allelic variant is an alternative form of a polynucleotide that may be a substitution, deletion, or insertion of one or more nucleotides, but does not substantially change the function of the polypeptide it encodes .

 The invention also relates to a polynucleotide that hybridizes to the sequence described above (with at least two sequences between

50%, preferably 70% identity). The present invention particularly relates to polynucleotides that can hybridize to the polynucleotides of the present invention under stringent conditions. In the present invention, "strict conditions" means: (1) hybridization and elution at lower ionic strength and higher temperature, such as 0.2xSSC, 0.1% SDS, 6G ° C; or (2) added during hybridization Use a denaturant, such as 50 ° /. (V / v) formamide, 0.1% calf serum / 0.1% Ficoll, 42 ° C, etc .; or (3) only the identity between the two sequences is at least 95%, and more preferably 97% Only when the above hybridization occurs. In addition, the polypeptide encoded by the hybridizable polynucleotide has the same biological function and activity as the mature polypeptide shown in SEQ ID NO: 2.

 The invention also relates to nucleic acid fragments that hybridize to the sequences described above. As used herein, a "nucleic acid fragment" contains at least 10 nucleotides in length, preferably at least 20-30 nucleotides, more preferably at least 50-60 nucleotides, and most preferably at least 100 nuclei. Glycylic acid or more. Nucleic acid fragments can also be used in nucleic acid amplification techniques such as PCR to identify and / or isolate polynucleotides encoding sugar transporter 47.

 The polypeptides and polynucleotides in the present invention are preferably provided in an isolated form and are more preferably purified to homogeneity. The specific polynucleotide sequence encoding the sugar transporter 47 of the present invention can be obtained by various methods. For example, polynucleotides are isolated using hybridization techniques well known in the art. These techniques include, but are not limited to: 1) hybridization of probes to genomic or cDNA libraries to detect homologous polynucleotide sequences, and 2) antibody screening of expression libraries to detect cloned polynucleosides with common structural characteristics Acid fragments.

 The DNA fragment sequence of the present invention can also be obtained by the following methods: 1) isolating the double-stranded DNA sequence from the DM of the genome; 2) chemically synthesizing the DNA sequence to obtain the double-stranded DNA of the polypeptide.

Of the methods mentioned above, genomic DM is the least commonly used. Direct chemical synthesis of DNA sequences is often the method of choice. The more commonly used method is the isolation of cDNA sequences. The standard method for isolating cDNA of interest is to isolate mRNA from donor cells that overexpress the gene and perform reverse transcription to form a plasmid or phage cDNA library. There are many mature techniques for extracting mRNA, and kits are also commercially available (Qiagene). CDNA library is constructed in a conventional method (Sambrook, et al., Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory. New York, 1989) 0 may be obtained commercially available cDNA library such as cDNA library from Clontech is different. When polymerase reaction technology is used in combination, even very small expression products can be cloned. These genes can be screened from these cDNA libraries by conventional methods. These methods include (but are not limited to): (l) DNA-DNA or DM-RNA hybridization; (2) the presence or absence of a marker gene function; (3) determination of the level of the transcript of sugar transporter 47; (4) by Immunological techniques or assays for biological activity to detect gene-expressed protein products. The above methods can be used singly or in combination.

 In the method (1), the probe used for hybridization is homologous to any part of the polynucleotide of the present invention, and its length is at least 10 nucleotides, preferably at least 30 nucleotides, more preferably At least 50 nucleotides, preferably at least 100 nucleotides. In addition, the length of the probe is usually within 2000 nucleotides, preferably within 1000 nucleotides. The probe used here is generally a DNA sequence chemically synthesized based on the gene sequence information of the present invention. The genes or fragments of the present invention can of course be used as probes. DNA probes can be labeled with radioisotopes, luciferin, or enzymes (such as alkaline phosphatase).

 In the (4) method, the protein product for detecting the expression of the sugar transporter 47 gene can be detected by immunological techniques such as Western blotting, radioimmunoprecipitation, and enzyme-linked immunosorbent assay (ELISA).

 A method using DNA technology to amplify DNA / RNA (Saiki, et al. Science 1985; 230: 1350-1354) is preferably used to obtain the gene of the present invention. In particular, when it is difficult to obtain a full-length cDNA from a library, the RACE method (RACE-Rapid Amplification of cDNA Ends) can be preferably used. The primers used for PCR can be appropriately based on the polynucleotide sequence information of the present invention disclosed herein. Select and synthesize using conventional methods. The amplified DNA / RNA fragments can be isolated and purified by conventional methods such as by gel electrophoresis.

 The polynucleotide sequence of the gene of the present invention or various DNA fragments and the like obtained as described above can be determined by a conventional method such as dideoxy chain termination method (Sanger et al. PNAS, 1977, 74: 5463-5467). Such polynucleotide sequences can also be determined using commercial sequencing kits and the like. In order to obtain the full-length cDNA sequence, the sequencing must be repeated. Sometimes it is necessary to determine the cDNA sequence of multiple clones in order to splice into a full-length cDNA sequence.

 The present invention also relates to a vector comprising a polynucleotide of the present invention, a host cell genetically engineered using the vector of the present invention or directly using a sugar transporter 47 coding sequence, and a method for producing a polypeptide of the present invention by recombinant technology.

In the present invention, the polynucleotide sequence encoding the sugar transporter 47 can be inserted into a vector to constitute a recombinant vector containing the polynucleotide of the present invention. The term "vector" refers to bacterial plasmids, phages, yeast plasmids, plant cell viruses, mammalian cell viruses such as adenoviruses, retroviruses, or other vectors well known in the art. Vectors suitable for use in the present invention include, but are not limited to: T7 promoter-based expression vectors (Rosenberg, et al. Gene, 1987, 56: 125) expressed in bacteria; pMSXND expression vectors expressed in mammalian cells ( Lee and Nathans, J Bio Chem. 263: 3521, 1988) and baculovirus-derived vectors expressed in insect cells. In short, as long as it can replicate and Stable, any plasmid and vector can be used to construct recombinant expression vectors. An important feature of expression vectors is that they usually contain an origin of replication, a promoter, a marker gene, and translational regulatory elements.

 Methods known to those skilled in the art can be used to construct expression vectors containing a DM sequence encoding the sugar transporter 47 and appropriate transcriptional / translational regulatory elements. These methods include in vitro recombinant DNA technology, DNA synthesis technology, in vivo recombination technology, etc. (Sambroook, e. T. A. Mo l ecu l a r C l on ing, a Labora tory Manua l, co l d Harbor Labora tory. New York, 1989). The DNAcl sequence can be operably linked to a suitable promoter of an expression vector to guide mRNA synthesis. Representative examples of these promoters are: the l ac or trp promoter of E. coli; the PL promoter of lambda phage; eukaryotic promoters include the CMV immediate early promoter, the HSV thymidine kinase promoter, and the early and late SV40 promoters Promoters, retroviral LTRs, and other known promoters that control gene expression in prokaryotic or eukaryotic cells or their viruses. The expression vector also includes a ribosome binding site for translation initiation, a transcription terminator, and the like. Insertion of an enhancer sequence into the vector will enhance its transcription in higher eukaryotic cells. Enhancers are cis-acting factors for DNA expression, usually about 10 to 300 base pairs, which act on promoters to enhance gene transcription. Illustrative examples include SV40 enhancers of 100 to 270 base pairs on the late side of the origin of replication, polytumor enhancers on the late side of the origin of replication, and adenoviral enhancers.

 In addition, the expression vector preferably contains one or more selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture. Fluorescent protein (GFP), or tetracycline or ampicillin resistance for E. coli.

 Those skilled in the art will know how to select appropriate vector / transcription control elements (such as promoter, enhancer, etc.) and selectable marker genes.

 In the present invention, a polynucleotide encoding a sugar transporter 47 or a recombinant vector containing the polynucleotide can be transformed or transduced into a host cell to form a genetically engineered host cell containing the polynucleotide or the recombinant vector. The term "host cell" refers to a prokaryotic cell, such as a bacterial cell; or a lower eukaryotic cell, such as a yeast cell; or a higher eukaryotic cell, such as a mammalian cell. Representative examples are: Escherichia coli, Streptomyces; bacterial cells such as Salmonella typhimurium; fungal cells such as yeast; plant cells; insect cells such as fly S2 or Sf 9; animal cells such as CH0, COS or Bowes melanoma cells.

Transformation of a host cell with a DNA sequence according to the present invention or a recombinant vector containing the DM sequence can be performed using conventional techniques well known to those skilled in the art. ¾ competent cells such as Escherichia coli host is a prokaryote, DNA uptake can be harvested after exponential growth phase, treated with CaC l ₂ method used in the step are well known in the art. The alternative is to use MgC l ₂ . If necessary, transformation can also be performed by electroporation. ¾ The host is a eukaryotic organism, and the following DNA transfection methods can be selected: calcium phosphate co-precipitation method, Or conventional mechanical methods such as microinjection, electroporation, liposome packaging, etc.

 By conventional recombinant DNA technology, the polynucleotide sequence of the present invention can be used to express or produce a recombinant sugar transporter 47 (Science, 1 984; 224: 14 31). Generally there are the following steps:

(1) using the polynucleotide (or variant) encoding human sugar transporter 47 of the present invention, or transforming or transducing a suitable host cell with a recombinant expression vector containing the polynucleotide;

 (2) culturing host cells in a suitable medium;

 (3) Isolate and purify protein from culture medium or cells.

 In step (2), depending on the host cell used, the medium used in the culture may be selected from various conventional mediums. Culture is performed under conditions suitable for host cell growth. After the host cells have grown to an appropriate cell density, the selected promoter is induced by a suitable method (such as temperature conversion or chemical induction), and the cells are cultured for a period of time.

 In step (3), the recombinant polypeptide may be coated in a cell, expressed on a cell membrane, or secreted outside the cell. If desired, recombinant proteins can be separated and purified by various separation methods using their physical, chemical and other properties. These methods are well known to those skilled in the art. These methods include, but are not limited to: conventional renaturation treatment, protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid chromatography (HPLC) and various other liquid chromatography techniques and combinations of these methods. Brief description of the drawings

 The following drawings are used to illustrate specific embodiments of the invention, but not to limit the scope of the invention as defined by the claims.

 Figure 1 is a comparison of the amino acid sequences of the sugar transporter 47 and the functional domains of the sugar transporter family of the present invention.

 Figure 2 shows the polyacrylamide gel electrophoresis (SDS-PAGE) of the isolated sugar transporter 47. 47KDa is the molecular weight of the protein. The arrow indicates the isolated protein band. The best way to implement the invention

The present invention is further described below with reference to specific embodiments. It should be understood that these examples are only used to illustrate the present invention and not to limit the scope of the present invention. The experimental methods in the following examples are not marked with specific conditions, usually according to conventional conditions such as those described in Sambrook et al., Molecular Cloning: Laboratory Manual (New York: Cold Spr ing Harbor Labora tory Pres s, 1989) , Or as recommended by the manufacturer. Example 1: Cloning of sugar transporter 47

 Human fetal brain total RNA was extracted by one-step method with guanidine isothiocyanate / phenol / chloroform. Using Quik mRNA Isolation Kit

(Qiegene product) Isolate poly (A) mRNA from total RNA. 2ug poly (A) mRNA is reverse transcribed to form cDNA. Use Smart cDNA Cloning Kit (purchased from Clontech). The 0 fragment was inserted into the multi-cloning site of pBSK (+) vector (Clontech), and transformed into DH5a. The bacteria formed a cDNA library. Dye terminate cycle react ion sequencing kit (Perkin-Elmer) and ABI 377 automatic sequencer (Perkin-Elmer) were used to determine the sequences at the 5 'and 3' ends of all clones. The determined cDNA sequence was compared with the existing public DM sequence database (Genebank), and it was found that the cDNA sequence of one of the clones 0861d08 was new DNA. The inserted cDNA fragments contained in this clone were determined in both directions by synthesizing a series of primers. The results show that the 0861d08 clone contains a full-length cDNA of 2353bp (as shown in Seq IDN0: 1), and has a 1290bp open reading frame (0RF) from 102bp to 1391bp, encoding a new protein (such as Seq ID NO: 2). We named this clone pBS-0861d08 and the encoded protein was named sugar transporter 47. Example 2: Domain analysis of cDNA clones

 The sequence of the sugar transporter 47 of the present invention and the protein sequence encoded by the same are used in a profile scan program (Basiclocal Alignment search tool) in GCG [Altschul, SF et al. J. Mol. Biol. 1990; 215: 403-10 ], Perform domain analysis in databases such as prote. The sugar transporter 47 of the present invention is homologous to the domain sugar transporter family, and the homology results are shown in FIG. 1. Example 3: Cloning of the gene encoding sugar transporter 47 by RT-PCR

 CDNA was synthesized using fetal brain total RNA as a template and oligo-dT as a primer.

After purification of Qiagene's kit, PCR amplification was performed with the following primers:

 Priraerl: 5'- GGAGTCATGTGACCGCCGTCTTGA -3 '(SEQ ID NO: 3)

 Primer2: 5'- TGTGCAGTGTTTTAATTTATCCAT -3 '(SEQ ID NO: 4)

 Primerl is a forward sequence starting at lbp of the 5th end of SEQ ID NO: 1;

 Primer2 is the 3 'end reverse sequence in SEQ ID NO: 1.

Amplification conditions: 50 mmol / L C1, 10 mmol / L Tris-Cl, (pH 8.5), 1.5 mmol / L MgCl ₂ , 200 μ mol / L dNTP, lOpmol primers in a 50 μ 1 reaction volume, 1U of Taq DM polymerase (Clontech). The reaction was performed on a PE9600 DM thermal cycler (Perkin-Elmer) under the following conditions for 25 cycles: 94 ° C 30sec; 55 ° C 30sec; 72 ° C 2min. During RT-PCR, set β-act in as a positive control and template blank as a negative control. Amplification products were purified using QIAGEN kits and TA The cloning kit was ligated to a pCR vector (Invitrogen). The DNA sequence analysis results showed that the DNA sequence of the PCR product was exactly the same as that of 1-2353bp shown in SEQ ID NO: 1. Example 4: Northern blot analysis of the expression of the sugar transporter 47 gene:

Total RNA extraction in one step [Anal. Biochem 1987, 162, 156-159] ₀ This method involves acid guanidinium thiocyanate-chloroform extraction. That is, the tissue was homogenized with 4M guanidine isothiocyanate-25mM sodium citrate, 0.2M sodium acetate ( _P 4.0), and 1 volume of phenol and 1/5 volume of chloroform-isoamyl alcohol (49: 1) Centrifuge after mixing. Aspirate the aqueous layer, add isopropanol (0.8 vol) and centrifuge the mixture to obtain RNA precipitate. The resulting RNA pellet was washed with 70% ethanol, dried and dissolved in water. Using 20 _M g RNA, electrophoresis was performed on a 1.2% agarose gel containing 20 mM 3- (N-morpholino) propanesulfonic acid (pH 7.0)-5 mM sodium acetate-ImM EDTA-2.2M formaldehyde. It was then transferred to a nitrocellulose membrane. Preparation ³² P- DNA probe labeled with a- ³² P dATP by random priming method. The DM probe used was the PCR-amplified sugar transporter 47 coding region sequence (102bp to 1391bp) shown in FIG. 1. The 32P- labeled probe (about _{^{2x l0 6 c P m / ml}} ) and RNA was transferred to a nitrocellulose membrane overnight at 42 ° C in a hybridization solution, the solution comprising 50% formamide - 25mM H ₂ P0 ₄ (pH7.4) -5 x SSC-5 x Denhardt's solution and 200 g / ml salmon sperm DNA. After hybridization, the filter was washed in 1 x SSC-0.1% SDS at 55 ° C for 30 min. Then, Phosphor Imager was used for analysis and quantification. Example 5: In vitro expression, isolation and purification of recombinant sugar transporter 47

The SEQ ID N0: 1 and the coding sequence shown in Figure 1, a pair of designing specific amplification primers, sequence bad J ¹ below:

Priraer3: 5'- CATGCTAGCATGGAGGAGGAGGATGAGGAAGCG -3 '(Seq ID No: 5) Primer 4: 5'- CATGGATCCCTAAGAAACACAGGCAATGAAGAA -3' (Seq ID No: 6) These two primers contain Nhel and BamHI restriction sites, respectively , Followed by the coding sequences of the 5 'and 3' ends of the gene of interest, respectively, and the Nhel and BamHI restriction sites correspond to the selectivity within the expression vector plasmid pET 28b (+) (Novagen, Cat. No. 69865.3). Digestion site. The PCR reaction was performed using pBS-0861d08 plasmid containing the full-length target gene as a template. The PCR reaction conditions are as follows: a total volume of 50 μl contains 10 pg of pBS-0861d08 plasmid, primers Primer-3 and Primer-4, and ¹ J is lOpmol, Advantage polymerase Mix (Clontech) 1 μ1. Cycle parameters: 94. C 20s, 60 ° C 30s, 68 ° C 2 min, a total of 25 cycles. Nhel and BamHI were used to double-digest the amplified product and plasmid pET-28 (+), respectively, and large fragments were recovered and ligated with T4 ligase. The ligation product was transformed into E. coli DH5CX using the calcium chloride method. After being cultured overnight on an LB plate containing kanamycin (final concentration 30 g / ml), positive clones were selected by colony PCR method and sequenced. Select positive clones with the correct sequence (pET-0861d08) to transform the recombinant plasmid into the large intestine by calcium chloride method Bacillus BL21 (DE3) p lySs (product of Novagen). In LB liquid medium containing kanamycin (final concentration 30 μg / ml), the host strain BL21 (pET-0861d08) was cultured at 37 ° C to the logarithmic growth phase, and IPTG was added to the final concentration lmmo l / L , Continue to cultivate for 5 hours. The bacteria were collected by centrifugation, and the supernatant was collected by centrifugation, and the supernatant was collected by centrifugation. An affinity chromatography column His s. Bind Qu ck Car tr idge (Novagen company) capable of binding to 6 histidines (6His-Tag) was collected. Product) was chromatographed to obtain the purified protein sugar transporter 47. After SDS-PAGE electrophoresis, a single band was obtained at 47 KDa (Figure 2). The band was transferred to a PVDF membrane and the N-terminal amino acid sequence was analyzed by Edams hydrolysis method. As a result, the 15 amino acids at the N-terminus were identical to the 15 amino acid residues at the N-terminus shown in SEQ ID NO: 2. Example 6 Production of Anti-Glucose Transporter 47 Antibody

 Polypeptide synthesizer (product of PE company) was used to synthesize the following polypeptides specific for sugar transporter 47:

 NH2-Met-G 1 uG 1 uG 1 υ-Asp-G 1 uG 1 uA 1 a-Arg-A 1 a-Leu- Leu- A la-G ly-G l y- C00H (SEQ ID NO: 7) . The polypeptide is coupled to hemocyanin and bovine serum albumin to form a complex, respectively. For the method, see: Avraraeas, et al. I. Unochemi stry, 1969; 6: 43. Rabbits were immunized with 4 mg of the hemocyanin peptide complex plus complete Freund's adjuvant, and 15 days later, the hemocyanin peptide complex plus incomplete Freund's adjuvant was used to boost immunity once. A titer plate coated with 15 μg / ml bovine serum albumin peptide complex was used as an ELISA to determine the antibody titer in rabbit serum. Protein A-Sepharose was used to isolate total IgG from antibody-positive rabbit sera. The peptide was bound to a cyanogen bromide-activated Sepharose4B column, and anti-peptide antibodies were separated from the total IgG by affinity chromatography. Immunoprecipitation demonstrated that the purified antibody specifically binds to sugar transporter 47. Example 7: Application of the polynucleotide fragment of the present invention as a hybridization probe

 Suitable oligonucleotide fragments selected from the polynucleotides of the present invention are used as hybridization probes in a variety of ways. For example, the probes can be used to hybridize to genomic or cDNA libraries of normal tissue or pathological tissue from different sources to It is determined whether it contains the polynucleotide sequence of the present invention and a homologous polynucleotide sequence is detected. Further, the probe can be used to detect the polynucleotide sequence of the present invention or its homologous polynucleotide sequence in normal tissue or pathology. Whether the expression in tissue cells is abnormal.

The purpose of this embodiment is to select a suitable oligonucleotide fragment from the polynucleotide SEQ ID NO: 1 of the present invention as a hybridization probe, and to identify whether some tissues contain the polynucleoside of the present invention by a filter hybridization method. Acid sequence or a homologous polynucleotide sequence thereof. 'Filter hybridization methods include dot blotting, Sou thern blotting, Nor thern blotting, and copying methods, etc., all of which are used to fix the polynucleotide sample to be tested on the filter and then hybridize using substantially the same steps. These same steps are: The sample-immobilized filter is first pre-hybridized with a probe-free hybridization buffer so that the non-specific binding site of the sample on the filter is loaded And synthetic polymers. The pre-hybridization solution is then replaced with a hybridization buffer containing the labeled probe and incubated to hybridize the probe to the target nucleic acid. After the hybridization step, the unhybridized probes are removed by a series of membrane washing steps. This embodiment utilizes higher-intensity washing conditions (such as lower salt concentration and higher temperature) to reduce the hybridization background and retain only strong specific signals. The probes used in this embodiment include two types: the first type of probes are oligonucleotide fragments that are completely the same as or complementary to the polynucleotide SEQ ID NO: 1 of the present invention; the second type of probes are partially related to the present invention The polynucleotide SEQ ID NO: 1 is the same or complementary oligonucleotide fragment. In this embodiment, the dot blot method is used to fix the sample on the filter membrane. Under the high-intensity washing conditions, the first type of probe and the sample have the strongest hybridization specificity and are retained.

First, the selection of the probe

 The selection of oligonucleotide fragments for use as hybridization probes from the polynucleotide SEQ ID NO: 1 of the present invention should follow the following principles and several aspects to be considered:

 1. The preferred range of probe size is 18-50 nucleotides;

 2.GC content is 30% -70%, non-specific hybridization increases when it exceeds;

 3, there should be no complementary regions inside the probe;

4. Those that meet the above conditions can be used as primary selection probes, and then further computer sequence analysis, including the primary selection probe and its source sequence region (ie, SEQ ID NO: 1) and other known genomic sequences and their complements The regions are compared for homology. If the homology with the non-target molecular region is greater than 85% or there are more than 15 consecutive bases, the primary probe should not be used;

5. Whether the preliminary selection probe is finally selected as a probe with practical application value should be further determined by experiments.

 After completing the above analysis, select and synthesize the following two probes:

 Probe 1 (probel), which belongs to the first type of probe, is completely homologous or complementary to the gene fragment of SEQ ID NO: 1 (41Nt):

 5'- TGGAGGAGGAGGATGAGGAAGCGCGGGCGCTCCTGGCAGGC -3 '(SEQ ID NO: 8) Probe 2 (probe2), which belongs to the second type of probe, is equivalent to the replacement mutant sequence of the gene fragment of SEQ ID NO: 1 or its complementary fragment (41Nt):

 5'- TGGAGGAGGAGGATGAGGAACCGCGGGCGCTCCTGGCAGGC -3 '(SEQ ID NO: 9) For other commonly used reagents and their preparation methods that are not listed in the following specific experimental steps, please refer to the literature: DNA PROBES GH Keller; MM Manak; S tockton Pres s , 1989 (USA) and more commonly used molecular cloning laboratory manuals such as the "Molecular Cloning Experiment Guide" U 998 Second Edition. [US] Sambrook et al., Science Press.

 Sample Preparation:

1.Extract DNA from fresh or frozen tissue Steps: 1) Place fresh or freshly thawed normal liver tissue in a plate immersed in ice and filled with phosphate buffered saline (PBS). Cut the tissue into small pieces with scissors or a scalpel. Tissue should be kept moist during operation. 2) Centrifuge the tissue at 1,000 g for 10 minutes. 3) cold homogenization buffer (0.25mol / L sucrose; 25mmol / L Tris-HCl, pH7.5; 25mmol / LnaCl; 25mmol / L MgCl 2) was suspended precipitate (about lOml / g). 4) Homogenize the tissue suspension at 4 ° C at full speed with an electric homogenizer until the tissue is completely broken. 5) Centrifuge at 1000g for 10 minutes. 6) Resuspend the cell pellet (1-5 ml per 0.1 g of the initial tissue sample), and centrifuge at 1,000 g for 10 minutes. 7) Resuspend the pellet with lysis buffer (1 ml per 0.1 g of the initial tissue sample), and then follow the phenol extraction method below.

 2, DNA phenol extraction method

Steps: 1) Wash cells with 1-10 ml of cold PBS and centrifuge at 1000g for 10 minutes. 2) Resuspend the pelleted cells with cold cell lysate (lx 10 ⁸ cells / ml). Use a minimum of 100ul lysis buffer. 3) Add SDS to a final concentration of 1%. If SDS is added directly to the cell pellet before resuspending the cells, the cells may form large clumps that are difficult to break, and reduce the overall yield. This is particularly serious when extracting> 10 ⁷ cells. 4) Add proteinase K to a final concentration of 200ug / ml. 5) Incubate at 50 ° C for 1 hour or at 37 ° C. C gently shake overnight. 6) Extract with an equal volume of phenol: chloroform: isoamyl alcohol (25: 24: 1) and centrifuge in a small centrifuge tube for 10 minutes. The two should be clearly separated, otherwise centrifuge again. 7) Transfer the water phase to a new tube. 8) Extract with an equal volume of chloroform: isoamyl alcohol (24: 1) and centrifuge for 10 minutes. 9) Transfer the DNA-containing aqueous phase to a new tube. The DNA was then purified and ethanol precipitated.

 3, DNA purification and ethanol precipitation

Steps: 1) Add 1/10 volume of 2mol / L sodium acetate and 2 volumes of cold 100% ethanol to the DNA solution and mix. At -20. C Let stand for 1 hour or overnight. 2) Centrifuge for 10 minutes. 3) Carefully aspirate or pour out the ethanol. 4) Wash the pellet with 500ul of 70% cold ethanol and centrifuge for 5 minutes. 5) Carefully aspirate or pour out the ethanol. Wash the pellet with 500ul of cold ethanol and centrifuge for 5 minutes. 6) Carefully aspirate or pour out the ethanol, then invert on the absorbent paper to drain off the residual ethanol. Air dry for 10-15 minutes to allow the surface ethanol to evaporate. Be careful not to allow the pellet to dry completely, otherwise it will be more difficult to re-dissolve. 7) Resuspend the DNA pellet in a small volume of TE or water. Vortex at low speed or suck with a dropper, and gradually increase TE, mix until the DNA is fully dissolved, and add approximately 1 ul for each 1- 5 x 10 ^δ cells extracted.

 The following steps 8-13 are only used when contamination must be removed, otherwise step 14 can be performed directly.

8) Add RNase A to the DNA solution to a final concentration of 100ug / ml, and incubate at 37 ° C for 30 minutes. 9) Add SDS and proteinase K to the final concentration of 0.5% and 100ug / ml. 37. C was held for 30 minutes. 10) Extract the reaction solution with an equal volume of phenol: chloroform: isoamyl alcohol (25: 24: 1) and centrifuge for 10 minutes. 11) Carefully remove the aqueous phase and re-extract with an equal volume of chloroform: isoamyl alcohol (24: 1) and centrifuge for 10 minutes. 12) Carefully remove the aqueous phase, add 1/10 volume of 2mol / L sodium acetate and 2.5 volumes of cold ethanol, and mix well at -20 ° C for 1 hour. 13) Wash the pellet with 70% ethanol and 100% ethanol, air dry, and resuspend the nucleic acid. The process is the same as steps 3-6. 14) Measure A ₂₆ . And A ₂₈ . To detect the purity and yield of DNA. 15) Store at -20 ° C after dispensing. Preparation of sample film:

 1) Take 4 x 2 pieces of nitrocellulose membranes (NC membranes) of appropriate size, and mark the spotting position and sample number on it with a pencil. Two NC membranes are required for each probe, so that it can be used in the following experimental steps. The film was washed with high-strength conditions and strength conditions, respectively.

 2) Pipette and control 15 microliters each, spot on the sample film, and dry at room temperature.

 3) Place on filter paper impregnated with 0.1 mol / L NaOH, 1.5 mol / L NaCl for 5 minutes (twice), dry and place on filter paper impregnated with 0.5 mol / L Tris-HCl (pH 7.0), 3 mol / L NaCl Allow to dry for 5 minutes (twice).

 4) Clamped in clean filter paper, wrapped in aluminum foil, and dried under vacuum at 60-80 ° C for 2 hours.

 Labeling of probes

1) 3 μl Probe (0.1 IOD / Ιθμ 1), add 2 μ I inase buffer, 8-10 uCi γ- ³² P- dATP + 2U Kinase, to make up to a final volume of 20 μ 1.

 2) Incubate at 37 ° C for 2 hours.

 3) Add 1/5 volume of Bromophenol Blue Indicator (BPB).

 4) Pass through a Sephadex G-50 column.

5) Collect the first peak before ³² P-Probes are washed out (monitorable).

 6) 5 drops / tube, collect 10-15 tubes.

 7) Monitor the amount of isotope with a liquid scintillator

8) After combining the collection solutions of the first peak, the ³² P-Probe (the second peak is free γ- ³² P-dATP) is prepared.

 Pre-hybridization

 The sample membrane was placed in a plastic bag, and 3- 10 mg of prehybridization solution (10xDenhardt's; 6xSSC, 0. lrag / ml was added).

CT DNA (calf thymus DNA). ) After sealing the bag, shake at 68 ° C for 2 hours.

 Cross

 Cut a corner of the plastic bag, add the prepared probe, seal the bag, and shake it at 42 ° C in a water bath overnight. Wash film:

 High-intensity washing film:

 1) Take out the hybridized sample membrane.

2) 2xSSC, 0.1% SDS, wash at 40 ° C for 15 minutes (twice). 3) Wash in 0.1 x SSC, 0.1% SDS for 15 minutes at 40 ° C (twice).

 4) Wash in 0.1 x SSC, 0.1% SDS at 55 ° C for 30 minutes (twice), and dry at room temperature.

 Low-intensity washing film:

 1) Take out the hybridized sample membrane.

 2) 2xSSC, 0.1% SDS, wash at 37 ° C for 15 minutes (twice).

3) 0.1 x SSC, 0.1 ° /. Wash in SDS for 15 minutes at 37 ^Q C (twice).

 4) 0.1 x SSC, 0.1% SDS, wash at 40 ° C for 15 minutes (twice), and dry at room temperature.

 X-ray autoradiography:

 -0 ° C, X-ray autoradiography (press time depends on the radioactivity of the hybrid spot).

 Experimental results:

 釆 The hybridization experiments performed under low-intensity membrane washing conditions did not differ significantly in the radioactivity of the above two probe hybrid spots; while the hybridization experiments performed under high-intensity membrane washing conditions, the radioactive intensity of hybridization spots of probe 1 was obvious Stronger in radioactivity than the hybridization spot of another probe. Therefore, the presence and differential expression of the polynucleotide of the present invention in different tissues can be analyzed qualitatively and quantitatively with the probe 1. Industrial applicability

 The polypeptides of the present invention, as well as antagonists, agonists and inhibitors of the polypeptides, can be directly used in the treatment of diseases, for example, they can treat malignant tumors, adrenal deficiency, skin diseases, various types of inflammation, HIV infection, and immune diseases.

 The sugar transporter family is found on the membranes of many cells and they are able to complete sugar transport. At the same time, the glycotransporter family is regulated by hormones such as insulin. In some tissues, sugar transport is under fast or slow hormonal regulation with tissue specificity. For example, when insulin levels increase, muscle tissue and adipose tissue increase significantly. Insulin can increase the liver's utilization of glucose. .

 Characteristic sequences of the sugar transporter family are necessary for its biological activity.

 The polypeptide of the present invention is a polypeptide containing a characteristic sequence of the sugar transporter family. Abnormal expression of the polypeptide will cause abnormal glucose molecules in and out of the cell to affect the internal and external glucose balance of the cell, thereby dysregulating the nutritional metabolism of cells and causing related diseases. .

 It can be seen that the abnormal expression of the sugar transporter 47 of the present invention will produce various diseases, especially disorders of glucose metabolism. These diseases include, but are not limited to: diabetes, diabetes-related diseases, organic acidemia such as propionic acidemia, Isovaleric acid, glutaric acid type I

Abnormal expression of the sugar transporter 47 of the present invention will also cause certain hereditary, immune system diseases and the like. The polypeptide of the present invention and the antagonists, agonists and inhibitors of the polypeptide can be directly used in the treatment of diseases, For example, it can treat various diseases, especially disorders of glucose metabolism, certain hereditary, immune system diseases, etc. The invention also provides methods for screening compounds to identify agents that increase (agonist) or suppress (antagonist) the sugar transporter ⁴ 7. Agonists enhance biological functions such as sugar transporter 47 to stimulate cell proliferation, while antagonists prevent and treat disorders related to cell proliferation, such as various cancers. For example, mammalian cells or membrane preparations expressing sugar transporter 47 can be cultured with labeled sugar transporter 47 in the presence of a drug. The ability of the drug to increase or block this interaction is then determined.

 Antagonists of sugar transporter 47 include antibodies, compounds, receptor deletions, and the like that have been screened. Antagonists of sugar transporter 47 can bind to sugar transporter 47 and eliminate its function, or inhibit the production of the polypeptide, or bind to the active site of the polypeptide so that the polypeptide cannot perform biological functions.

 When screening compounds as antagonists, sugar transporter 47 can be added to a bioanalytical assay to determine whether the compound is an antagonist by measuring the effect of the compound on the interaction between sugar transporter 47 and its receptor. Receptor deletions and analogs that act as antagonists can be screened in the same manner as described above for screening compounds. Polypeptide molecules capable of binding to sugar transporter 47 can be obtained by screening a random peptide library composed of various possible combinations of amino acids bound to a solid phase. When screening, the 47 molecules of sugar transporter protein should generally be labeled.

 The present invention provides a method for producing antibodies using polypeptides, and fragments, derivatives, analogs or cells thereof as antigens. These antibodies can be polyclonal or monoclonal antibodies. The invention also provides antibodies directed against a sugar transporter 47 epitope. These antibodies include (but are not limited to): polyclonal antibodies, monoclonal antibodies, chimeric antibodies, single chain antibodies, Fab fragments, and fragments produced by Fab expression libraries.

Polyclonal antibodies can be produced by injecting sugar transporter 47 directly into immunized animals (such as rabbits, mice, rats, etc.). A variety of adjuvants can be used to enhance the immune response, including but not limited to Freund's adjuvant. Techniques for preparing monoclonal antibodies to sugar transporter 47 include, but are not limited to, hybridoma technology (Kohler and Milstein. Nature, 1 975, 256: 495-497), triple tumor technology, human beta-cell hybridization Tumor technology, EBV-hybridoma technology, etc. The chimeric antibody variable region and a human constant region of non-human origin in combination produce the available prior art (Mor ri son etal, PNAS, 1985, 81: 6851) 0 only some technical production of single chain antibodies (US Pa t No. 4946778) can also be used to produce single chain antibodies against sugar transporter 47.

 Antibodies against sugar transporter 47 can be used in immunohistochemistry to detect sugar transporter 47 in biopsy specimens.

 Monoclonal antibodies that bind to sugar transporter 47 can also be labeled with radioisotopes and injected into the body to track their location and distribution. This radiolabeled antibody can be used as a non-invasive diagnostic method to locate tumor cells and determine whether there is metastasis.

Antibodies can also be used to design immunotoxins that target a particular part of the body. High sugar transporter 47 Affinity monoclonal antibodies can covalently bind to bacterial or phytotoxins (such as diphtheria toxin, ricin, ormosine, etc.). A common method is to attack the amino group of an antibody with a thiol cross-linking agent such as SPDP and bind the toxin to the antibody through the exchange of disulfide bonds. This hybrid antibody can be used to kill sugar transporter 47 positive cells.

 The antibodies of the present invention can be used to treat or prevent diseases related to sugar transporter 47. Administration of an appropriate dose of antibody can stimulate or block the production or activity of sugar transporter 47.

 The invention also relates to a diagnostic test method for quantitative and localized detection of sugar transporter 47 levels. These tests are well known in the art and include FISH assays and radioimmunoassays. Sugar transporter 47 levels measured in the test can be used to explain the importance of sugar transporter 47 in various diseases and to diagnose diseases in which sugar transporter 47 functions.

 The polypeptide of the present invention can also be used for peptide mapping analysis. For example, the polypeptide can be specifically cleaved by physical, chemical or enzymatic analysis, and subjected to one-dimensional or two-dimensional or three-dimensional gel electrophoresis analysis, and more preferably mass spectrometry analysis.

Polynucleotides encoding sugar transporter 47 can also be used for a variety of therapeutic purposes. Gene therapy techniques can be used to treat abnormal cell proliferation, development, or metabolism caused by the non-expression or abnormal / inactive expression of sugar transporter 47. Recombinant gene therapy vectors (such as viral vectors) can be designed to express mutated sugar transporter 47 to inhibit endogenous sugar transporter 47 activity. For example, a variant sugar transporter 47 may be a shortened sugar transporter 47 that lacks a signaling domain. Although it can bind to downstream substrates, it lacks signaling activity. Therefore, recombinant gene therapy vectors can be used to treat diseases caused by abnormal expression or activity of sugar transporter 47. Virus-derived expression vectors such as retrovirus, adenovirus, adenovirus-associated virus, herpes simplex virus, parvovirus, etc. can be used to transfer a polynucleotide encoding a sugar transporter 47 into a cell. A method for constructing a recombinant viral vector carrying a polynucleotide encoding a sugar transporter 47 can be found in the existing literature (Sambrook, et al.). ₀ Another recombinant polynucleotide encoding a sugar transporter 47 can be packaged and transferred into liposomes. Into the cell.

 Methods for introducing a polynucleotide into a tissue or cell include: directly injecting the polynucleotide into a tissue in vivo; or introducing the polynucleotide into a cell in vitro through a vector (such as a virus, phage, or plasmid), and then transplanting the cell Into the body and so on.

Oligonucleotides (including antisense RNA and DNA) and ribozymes that inhibit the sugar transporter 47 mRNA are also within the scope of the present invention. A ribozyme is an enzyme-like RNA molecule that specifically decomposes specific RNA. Its mechanism of action is that the ribozyme molecule specifically hybridizes with a complementary target RNA for endonucleation. Antisense RM, DNA, and ribozymes can be obtained using any existing RNA or DNA synthesis technology, such as solid-phase phosphate amide chemical synthesis to synthesize oligonucleotides. Antisense RNA molecules can pass through the DNA encoding the RNA The sequences are obtained by in vitro or in vivo transcription. This DNA sequence has been integrated downstream of the vector's RNA polymerase promoter. In order to increase the stability of a nucleic acid molecule, it can be modified in a variety of ways, such as increasing the sequence length on both sides, and the ribonucleoside linkages should use phosphate thioester or peptide bonds instead of phosphodiester bonds.

 Polynucleotides encoding sugar transporter 47 are useful in the diagnosis of diseases related to sugar transporter 47. The polynucleotide encoding sugar transporter 47 can be used to detect the expression of sugar transporter 47 or the abnormal expression of sugar transporter 47 in a disease state. For example, the DNA sequence encoding sugar transporter 47 can be used to hybridize biopsy specimens to determine the expression of sugar transporter 47. Hybridization techniques include Sout hern blotting, Nor t hern blotting, and in situ hybridization. These techniques and methods are publicly available and mature, and related kits are commercially available. A part or all of the polynucleotides of the present invention can be used as probes to be fixed on a microarray (M i croa rr ay) or a DNA chip (also known as a "gene chip") for analyzing differential expression analysis of genes in tissues Genetic diagnosis. Transcription products of sugar transporter 47 can also be detected by RNA-polymerase chain reaction (RT-PCR) in vitro amplification using sugar transporter 47-specific primers.

 Detecting mutations in the sugar transporter 47 gene can also be used to diagnose sugar transporter 47-related diseases. Sugar transporter 47 mutations include point mutations, translocations, deletions, recombinations, and any other abnormalities compared to the normal wild-type sugar transporter 47 DNA sequence. Mutations can be detected using existing techniques such as Southern blotting, DNA sequence analysis, PCR and in situ hybridization. In addition, the mutation may affect the expression of the protein, so the Nort Hern blotting and Western blotting can be used to indirectly determine whether the gene is mutated.

 The sequences of the invention are also valuable for chromosome identification. The sequence specifically targets a specific position on a human chromosome and can hybridize to it. Currently, specific sites for each gene on the chromosome need to be identified. Currently, only a few chromosome markers based on actual sequence data (repeating polymorphisms) are available for marking chromosome positions. According to the present invention, in order to associate these sequences with disease-related genes, the important first step is to locate these DNA sequences on the chromosome

 In short, PCR primers (preferably 1 to 35 bp) are prepared based on cDM, and the sequences can be located on chromosomes. These primers were then used for PCR screening of somatic hybrid cells containing individual human chromosomes. Only those heterozygous cells containing the human gene corresponding to the primer will produce amplified fragments.

 PCR localization of somatic hybrid cells is a quick way to localize DNA to specific chromosomes. Using the oligonucleotide primers of the present invention, in a similar manner, a set of fragments from a specific chromosome or a large number of genomic clones can be used to achieve sublocalization. Other similar strategies that can be used for chromosomal localization include in situ hybridization, chromosome pre-screening with labeled flow sorting, and pre-selection of hybridization to construct chromosome-specific cDNA libraries.

Fluorescent in situ hybridization (FI SH) of cDM clones with metaphase chromosomes allows precise chromosomal localization in one step. For a review of this technique, see Verma et al., Human Chromos ome s: a Manual of Basic Techniques, Pergamon Press, New York (1988). Once the sequence is located at the exact chromosomal location, the physical location of the sequence on the chromosome can be correlated with the genetic map data. These data can be found in, for example, V. Mckusick, Mendel ian Inheritance in Man (available online with Johns Hopkins University Welch Medical Library). Linkage analysis can then be used to determine the relationship between genes and diseases that have been mapped to chromosomal regions.

 Next, the difference in cDM or genomic sequence between the affected and unaffected individuals needs to be determined. If a mutation is observed in some or all diseased individuals and the mutation is not observed in any normal individuals, the mutation may be the cause of the disease. Comparing affected and unaffected individuals usually involves first looking for structural changes in chromosomes, such as deletions or translocations that are visible at the chromosomal level or detectable with cDNA sequence-based PCR. According to the resolution capabilities of current physical mapping and gene mapping technology, the cDNA accurately mapped to the chromosomal region associated with the disease can be one of 50 to 500 potentially pathogenic genes (assuming 1 megabase mapping resolution) Capacity and each 20kb corresponds to a gene).

 The polypeptides, polynucleotides and mimetics, agonists, antagonists and inhibitors of the present invention can be used in combination with a suitable pharmaceutical carrier. These carriers can be water, glucose, ethanol, salts, buffers, glycerol, and combinations thereof. The composition comprises a safe and effective amount of the polypeptide or antagonist, and carriers and excipients which do not affect the effect of the drug. These compositions can be used as drugs for the treatment of diseases.

 The invention also provides a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the invention. Along with these containers, there may be instructional instructions given by government agencies that manufacture, use, or sell pharmaceuticals or biological products, which prompts permission for administration on the human body by government agencies that produce, use, or sell. In addition, the polypeptides of the invention can be used in combination with other therapeutic compounds.

The pharmaceutical composition can be administered in a convenient manner, such as by a topical, intravenous, intraperitoneal, intramuscular, subcutaneous, intranasal or intradermal route of administration. Glucose transporter 47 is administered in an amount effective to treat and / or prevent a particular indication. The amount and range of sugar transporters 47 administered to a patient will depend on many factors, such as the mode of administration, the health conditions of the person to be treated, and the judgment of the diagnostician.

Claims

 1. An isolated polypeptide-sugar transporter 47, characterized in that it comprises: a polypeptide having the amino acid sequence shown in SEQ ID NO: 2, or an active fragment, analog, or derivative thereof.

 2. The polypeptide according to claim 1, wherein the amino acid sequence of the polypeptide, analog or derivative has at least 95% identity with the amino acid sequence shown in SEQ ID NO: 2.

 3. The polypeptide according to claim 2, characterized in that it comprises a polypeptide having the amino acid sequence shown in SEQ ID NO: 2.

 4. An isolated polynucleotide, characterized in that said polynucleotide comprises one selected from the group consisting of:

(a) a polynucleotide encoding a polypeptide having the amino acid sequence shown in SEQ ID NO: 2 or a fragment, analog, or derivative thereof;

 (b) a polynucleotide complementary to polynucleotide (a); or

 (c) A polynucleotide that is at least 70% identical to (a) or (b).

 5. The polynucleotide according to claim 4, wherein the polynucleotide comprises a polynucleotide encoding an amino acid sequence represented by SEQ ID NO: 2.

 6. The polynucleotide according to claim 4, characterized in that the sequence of the polynucleotide comprises a sequence of positions 1 02-1391 in SEQ ID NO: 1 or a sequence of positions 1 to 2353 in SEQ ID NO: 1. sequence.

 7. A recombination vector containing an exogenous polynucleotide, characterized in that it is a recombination constructed by the polynucleotide according to any one of claims 4-6 and a plasmid, virus or a carrier expression vector Carrier.

8. A genetically engineered host cell containing an exogenous polynucleotide, characterized in that it is selected from one of the following host cells:

 (a) a host cell transformed or transduced with the recombinant vector of claim 7; or

 (b) a host cell transformed or transduced with a polynucleotide according to any one of claims 4-6.

9. A method for preparing a polypeptide having a sugar transporter 47 activity, characterized in that the method includes:

(a) culturing the engineered host cell according to claim 8 under the condition of expressing a sugar transporter 47;

(b) Isolating a polypeptide having sugar transporter 47 activity from the culture.

 10. An antibody capable of binding to a polypeptide, characterized in that said antibody is an antibody capable of specifically binding to a sugar transporter 47.

 11. A class of compounds that mimic or regulate the activity or expression of a polypeptide, characterized in that they are compounds that mimic, promote, antagonize or inhibit the activity of sugar transporter 47.

12. The compound according to claim 11, characterized in that it is an antisense sequence of a polynucleotide sequence or a fragment thereof as shown in SEQ ID NO: 1.

13. An application of the compound according to claim 1, characterized in that the compound is used for a method for regulating the activity of glycotransporter 47 in vivo and in vitro.

 14. A method for detecting a disease or susceptibility to a disease associated with a polypeptide according to any one of claims 1-3, characterized in that it comprises detecting the expression level of the polypeptide, or detecting the activity of the polypeptide Or detecting a nucleotide variation in a polynucleotide that causes abnormal expression or activity of the polypeptide.

 15. Use of a polypeptide according to any one of claims 1-3, characterized in that it is used for screening mimetics, agonists, antagonists or inhibitors of sugar transporter 47; or for peptide fingerprinting Identification.

 16. The use of a nucleic acid molecule according to any one of claims 4-6, characterized in that it is used as a primer for a nucleic acid amplification reaction, or as a probe for a hybridization reaction, or for manufacturing a gene chip Or microarray.

 Π, Use of a polypeptide, polynucleotide or compound according to any one of claims 1-6 and Π, characterized in that said polypeptide, polynucleotide or mimetic, agonist, antagonist is used Or the inhibitor is composed of a safe and effective dose with a pharmaceutically acceptable carrier as a pharmaceutical composition for diagnosing or treating a disease associated with abnormality of sugar transporter 47.

 18. The use of a polypeptide, polynucleotide or compound according to any one of claims 1-6 and 11, characterized in that the polypeptide, polynucleotide or compound is used for preparing for treating malignant tumors, blood, etc. Disease, HIV infection and immune diseases and drugs of various inflammations.