WO2002020606A1 - A new polypeptide- human hearing defect-related protein 38.39 and the polynucleotde encoding it - Google Patents

Abstract

The present invention discloses a new polypeptide- human hearing defect-related protein 38.39, the polynucleotide encoding it and a method producing the polypeptide by DNA recombinant technology. The present invention further discloses a method of the polypeptide treating various disorders, e.g., presbycusis, non-intergrated hearing defect, congenital deafness, auricle abnormality etc. The present invention also discloses an antagonist of the polypeptide and its therapeutic action. The present invention further disclose the use of the polynucleotide encoding the new human hearing defect-related protein 38.39.

Description

 A new polypeptide-a person with hearing loss-related protein 38.39 and a polynucleotide encoding the polypeptide TECHNICAL FIELD

 The present invention belongs to the field of biotechnology. Specifically, the present invention describes a new polypeptide, a human hearing loss related protein 38.39, and a polynucleotide sequence encoding the polypeptide. The invention also relates to a method and application for preparing such polynucleotides and polypeptides. Background technique

 Senile hearing loss has a high incidence. It is a human disease caused by a combination of environmental and genetic factors. It is not similar to the comprehensive hearing loss phenotype.

 On the human chromosome 7 pl 5 region, the 2-cM region from D7S582 to D7S 179 is related to the autosomal dominant inheritance of DFNA5 hearing impairment. The gene is about 60 kb long and contains 10 exons. The 5 'end of the gene has a non-coding region consisting of 57bp. The upstream of the start codon ATG is purine-position 3, but the downstream +4 position lacks guanine. There is a stop codon before the start codon, and exon 1 is adjacent to the CpG island. The gene contains an open reading frame of 1488bp and encodes a protein of 496 amino acids.

 In 1998, Van Laer L et al. Found an insertion / deletion mutant in the 7th intron of a gene expressed in the cochlea in this region, which does not affect the intron-exon boundary, but within this region Five GGG triplets are lost at the 3 'end of the intron, and this GGG triplet plays an important role in splicing large introns. This mutant caused early termination of translation of the open reading frame. This mutation causes non-comprehensive hearing impairment. [Na t ure Gene t 1 998, 20 (2): 194-1 97]

 The novel polypeptide of the present invention has 35% homology and 54% similarity with the unknown human DFM5 protein at the protein level, and has similar structural characteristics with it, and thus is considered to be a new human DFNA5 protein, named as a peptide, has similar biological functions as known proteins. When it is expressed normally, it can maintain human hearing soundness. If it is overexpressed or gene fragments are lost, it will cause human hearing abnormality or loss, and the gene will be lost. l kb causes DFNA5 disease. In addition, it also plays a role in the diagnosis and treatment of related diseases.

As mentioned above, the human hearing loss related protein 38. 39 protein plays an important role in regulating important functions of the body such as cell division and embryonic development, and it is believed that a large number of proteins are involved in these regulatory processes, so more participation in the field has been identified These processes are related to the 38.39 protein of human hearing loss, and in particular the amino acid sequence of this protein is identified. Isolation of hearing loss-related protein 38. 39 protein encoding genes for newcomers also provides a basis for research to determine the role of this protein in health and disease states. This These proteins may form the basis for the development of diagnostic and / or therapeutic drugs for diseases, so it is important to isolate their coding DNA. Disclosure of invention

 It is an object of the present invention to provide isolated new polypeptides-human hearing loss related protein 38.39 and fragments, analogs and derivatives thereof. '

 Another object of the invention is to provide a polynucleotide encoding the polypeptide.

 Another object of the present invention is to provide a recombinant vector containing a polynucleotide encoding a human hearing loss related protein 38.39.

 Another object of the present invention is to provide a genetically engineered host cell containing a polynucleotide encoding a human hearing loss related protein 38.39.

 Another object of the present invention is to provide a method for producing human hearing loss related protein 38.39.

 Another object of the present invention is to provide an antibody against the polypeptide of the present invention-a human hearing loss related protein 38.39.

 Another object of the present invention is to provide a human hearing loss related protein directed to the polypeptide of the present invention.

38. 39 mimetic compounds, antagonists, agonists, inhibitors.

 Another object of the present invention is to provide a method for diagnosing and treating diseases related to abnormalities in human hearing loss-related protein 38.39.

 The present invention relates to an isolated polypeptide, which is of human origin and comprises: a polypeptide having the amino acid sequence of SEQ ID No. 2, or a conservative variant, biologically active fragment or derivative thereof. Preferably, the polypeptide is a polypeptide having the amino acid sequence of SEQ ID NO: 2.

 The invention also relates to an isolated polynucleotide comprising a nucleotide sequence or a variant thereof selected from the group consisting of:

 (a) a polynucleotide encoding a polypeptide having the amino acid sequence of SEQ ID No. 2;

 (b) a polynucleotide complementary to polynucleotide (a);

 (c) A polynucleotide having at least 70¾ identity to the polynucleotide sequence of (a) or (b).

 More preferably, the sequence of the polynucleotide is one selected from the group consisting of: (a) a sequence of positions 175-1224 in SEQ ID NO: 1; and (b) a sequence of 1-1279 in SEQ ID NO: 1 Sequence of bits.

 The present invention further relates to a vector, particularly an expression vector, containing the polynucleotide of the present invention; a host cell genetically engineered with the vector, including a transformed, transduced or transfected host cell; Host cell and method of preparing the polypeptide of the present invention by recovering the expression product.

The invention also relates to an antibody capable of specifically binding to a polypeptide of the invention. The invention also relates to a screened protein that mimics, activates, antagonizes or inhibits human hearing loss.

38. A method of a 39 protein-active compound comprising utilizing a polypeptide of the invention. The invention also relates to compounds obtained by this method.

 The present invention also relates to a method for in vitro detection of a disease or susceptibility to a disease associated with human hearing loss-related protein 38. 39 protein, which comprises detecting a mutation in the polypeptide or a coding polynucleotide sequence thereof in a biological sample, or Detection of the amount or biological activity of a polypeptide of the invention in a biological sample.

 The invention also relates to a pharmaceutical composition comprising a polypeptide of the invention or a mimetic thereof, an activator, an antagonist or an inhibitor, and a pharmaceutically acceptable carrier.

 The present invention also relates to the use of the polypeptide and / or polynucleotide of the present invention in the preparation of a medicament for treating cancer, developmental disease or immune disease or other diseases caused by abnormal expression of human hearing loss-related proteins 38.39.

 Other aspects of the invention will be apparent to those skilled in the art from the disclosure of the techniques herein.

The following terms used in this specification and claims have the following meanings unless specifically stated otherwise:

 "Nucleic acid sequence" refers to oligonucleotides, nucleotides or polynucleotides and fragments or parts thereof, and can also refer to genomic or synthetic DNA or RNA, which can be single-stranded or double-stranded, representing the sense strand or Antisense strand. Similarly, the term "amino acid sequence" refers to an oligopeptide, peptide, polypeptide or protein sequence and fragments or portions thereof. When the "amino acid sequence" in the present invention relates to the amino acid sequence of a naturally occurring protein molecule, such "polypeptide" or "protein" does not mean to limit the amino acid sequence to a complete natural amino acid related to the protein molecule .

 A "variant" of a protein or polynucleotide refers to an amino acid sequence having one or more amino acids or nucleotide changes or a polynucleotide sequence encoding it. The changes may include deletions, insertions or substitutions of amino acids or nucleotides in the amino acid sequence or nucleotide sequence. Variants can have "conservative" changes, in which the amino acid substituted has a structural or chemical property similar to the original amino acid, such as replacing isoleucine with leucine. Variants can also have non-conservative changes, such as replacing glycine with tryptophan.

 "Deletion" refers to the deletion of one or more amino acids or nucleotides in an amino acid sequence or nucleotide sequence.

 "Insertion" or "addition" refers to an alteration in the amino acid sequence or nucleotide sequence that results in an increase in one or more amino acids or nucleotides compared to a naturally occurring molecule. "Replacement" refers to the replacement of one or more amino acids or nucleotides with different amino acids or nucleotides.

"Biological activity" refers to a protein that has the structure, regulation, or biochemical function of a natural molecule. Similarly, the term "immunologically active" means that natural, recombinant, or synthetic proteins and fragments thereof Ability to induce a specific immune response in a substance or cell and to bind to specific antibodies.

 An "agonist" refers to a molecule that, when combined with human hearing loss-related protein 38.39, causes a change in the protein to regulate the activity of the protein. An agonist may include a protein, a nucleic acid, a carbohydrate, or any other molecule that binds to human hearing loss related protein 38.39.

 An "antagonist" or "inhibitor" refers to a molecule that, when combined with human hearing loss related protein 38.39, can block or regulate the biological or immunological activity of human hearing loss related protein 38.39. Antagonists and inhibitors may include proteins, nucleic acids, carbohydrates or any other molecule that can bind to human hearing loss related protein 38.39.

 "Regulation" refers to a change in the function of human hearing loss-related protein 38.39, including an increase or decrease in protein activity, a change in binding characteristics, and any other biological property, function, or immunity of human hearing loss-related protein 38.39 Change of nature.

 By "substantially pure" is meant substantially free of other proteins, lipids, sugars or other substances with which it is naturally associated. Those skilled in the art can purify human hearing loss related proteins using standard protein purification techniques 38.39. Basically pure human hearing loss related proteins 38. 39 A single main band can be generated on a non-reducing polyacrylamide gel. Human hearing loss related protein 38. 39 The purity of the polypeptide can be analyzed by amino acid sequence.

 "Complementary" or "complementary" refers to the natural binding of polynucleotides by base-pairing under conditions of acceptable salt concentration and temperature. For example, the sequence "C-T-G-A" can be combined with the complementary sequence "G-A-C-T". The complementarity between two single-stranded molecules may be partial or complete. The degree of complementarity between nucleic acid strands has a significant effect on the efficiency and strength of hybridization between nucleic acid strands.

 "Homology" refers to the degree of complementarity and can be partially homologous or completely homologous. "Partial homology" refers to a partially complementary sequence that at least partially inhibits hybridization of a fully complementary sequence to a target nucleic acid. This inhibition of hybridization can be detected by performing hybridization (Southern imprinting or Nor thern blotting, etc.) under conditions of reduced stringency. Substantially homologous sequences or hybridization probes can compete and inhibit the binding of fully homologous sequences to the target sequence under conditions of reduced stringency. This does not mean that conditions with reduced stringency allow non-specific binding, because conditions with reduced stringency require that the two sequences bind to each other as either specific or selective interactions.

 "Percent identity" refers to the percentage of sequences that are the same or similar in a comparison of two or more amino acid or nucleic acid sequences. Percent identity can be determined electronically, such as through the MEGALIGN program

(Las ergene sof tware package, DNASTAR, Inc., Mad is on Wi s.). The MEGALIGN program can compare two or more sequences according to different methods, such as the Cluster method (Higginis, DG and PM Sharp (1988) Gene 73: 237-244). _{0 The} Clus ter method checks all pairs The distance between them arranges the groups of sequences into clusters. The clusters are then assigned in pairs or groups. Two amino acid sequences such as The percent identity between sequence A and sequence B is calculated by:

 Number of residues matching between sequence A and sequence 100 100 Number of residues in sequence A-number of interval residues in sequence A-number of interval residues in sequence B

 The percent identity between nucleic acid sequences can also be determined by the Cluster method or by methods known in the art such as Jotun He in (He in J., (1990) Me thods in emzumo l ogy 183: 625-645) .

 "Similarity" refers to the degree of identical or conservative substitutions of amino acid residues at corresponding positions in the alignment of amino acid sequences. Amino acids used for conservative substitutions, for example, negatively charged amino acids may include aspartic acid and glutamic acid; positively charged amino acids may include lysine and arginine; having an uncharged head group is Similar hydrophilic amino acids may include leucine, isoleucine and valine; glycine and alanine; asparagine and glutamine; serine and threonine; phenylalanine and tyrosine.

 "Antisense" refers to a nucleotide sequence that is complementary to a particular DNA or RNA sequence. "Antisense strand" refers to a nucleic acid strand that is complementary to a "sense strand."

 "Derivative" refers to a chemical modification of HFP or a nucleic acid encoding it. This chemical modification may be a substitution of a hydrogen atom with a fluorenyl, acyl or amino group. Nucleic acid derivatives can encode polypeptides that retain the main biological properties of natural molecules.

"Antibody" refers to a complete antibody molecule and its fragments, such as Fa,? (^) ₂ and? It can specifically bind to the epitope of human hearing loss related protein 38.39.

 A "humanized antibody" refers to an antibody in which the amino acid sequence of a non-antigen binding region is replaced to become more similar to a human antibody, but still retains the original binding activity.

 The term "isolated" refers to the removal of a substance from its original environment (for example, its natural environment if it is naturally occurring). For example, a naturally-occurring polynucleotide or polypeptide is not isolated when it is present in a living thing, but the same polynucleotide or polypeptide is separated from some or all of the substances that coexist with it in the natural system. Such a polynucleotide may be part of a certain vector, or such a polynucleotide or polypeptide may be part of a certain composition. Since the carrier or composition is not part of its natural environment, they are still isolated.

 As used herein, "isolated" refers to the separation of a substance from its original environment (if it is a natural substance, the original environment is the natural environment). For example, in the natural state of living cells, the polynucleotides and polypeptides are not isolated and purified, but the same polynucleotides or polypeptides such as' separated from other substances in the natural state are isolated and purified. of.

As used herein, "isolated human hearing loss related protein 38. 39" refers to human hearing loss related protein 38. 39 which is substantially free of other proteins, lipids, sugars or other substances with which it is naturally associated. This Those skilled in the art can purify human hearing loss related proteins 38. 39 using standard protein purification techniques. Substantially pure polypeptides can produce a single main band on a non-reducing polyacrylamide gel. The purity of the human hearing loss related protein 38. 39 polypeptide can be analyzed by amino acid sequence.

 The present invention provides a new polypeptide, a hearing loss related protein 38.39, which is basically composed of the amino acid sequence shown in SEQ ID NO: 2. The polypeptide of the present invention may be a recombinant polypeptide, a natural polypeptide, or a synthetic polypeptide, and preferably a recombinant polypeptide. The polypeptides of the present invention can be naturally purified products or chemically synthesized products, or can be produced from prokaryotic or eukaryotic hosts (eg, bacteria, yeast, higher plants, insects, and mammalian cells) using recombinant techniques. Depending on the host used in the recombinant production protocol, the polypeptide of the invention may be glycosylated, or it may be non-glycosylated. The polypeptides of the invention may also include or exclude the initial methionine residue.

 The invention also includes fragments, derivatives and analogs of the human hearing loss related protein 38.39. As used in the present invention, the terms "fragment", "derivative" and "analog" refer to a polypeptide that substantially maintains the same biological function or activity of the human hearing loss related protein 38.39 of the present invention. A fragment, derivative or analog of the polypeptide of the present invention may be: (I) a kind in which one or more amino acid residues are substituted with conservative or non-conservative amino acid residues (preferably conservative amino acid residues), and the substitution The amino acid may or may not be encoded by a genetic codon; or (Π) such a type in which one or more amino acid residues are substituted with other groups to include a substituent; or (III) such A type in which a mature polypeptide is fused to another compound (such as a compound that extends the half-life of a polypeptide, such as polyethylene glycol); or (IV) a type of polypeptide sequence in which an additional amino acid sequence is fused into a mature polypeptide ( Such as the leader sequence or secreted sequence or the sequence used to purify this polypeptide or protease sequence) As explained herein, such fragments, derivatives and analogs are considered to be within the knowledge of those skilled in the art.

 The present invention provides an isolated nucleic acid (polynucleotide), which basically consists of a polynucleotide encoding a polypeptide having the amino acid sequence of SEQ ID NO: 2. The polynucleotide sequence of the present invention includes the nucleotide sequence of SEQ ID NO: 1. The polynucleotide of the present invention is found from a CDM library of human fetal brain tissue. It contains a full-length polynucleotide sequence of 1279 bases and its open reading frame of 175-1224 encodes 349 amino acids. According to the amino acid sequence homology comparison, it was found that this polypeptide has 35% homology with human hearing loss related proteins, and it can be deduced that the human hearing loss related proteins 38. 39 have similar structures and functions as human hearing loss related proteins.

The polynucleotide of the present invention may be in the form of DNA or RNA. DNA forms include cDNA, genomic DNA, or synthetic DNA. DM can be single-stranded or double-stranded. The DM can be a coding chain or a non-coding chain. The coding region sequence encoding a mature polypeptide may be the same as the coding region sequence shown in SEQ ID NO: 1 The same or degenerate variants. As used herein, a "degenerate variant" refers to a nucleic acid sequence encoding a protein or polypeptide having SEQ ID NO: 2 but different from the coding region sequence shown in SEQ ID NO: 1 in the present invention.

 The polynucleotide encoding the mature polypeptide of SEQ ID NO: 2 includes: only the coding sequence of the mature polypeptide; the coding sequence of the mature polypeptide and various additional coding sequences; the coding sequence of the mature polypeptide (and optional additional coding sequences); Coding sequence.

 The term "polynucleotide encoding a polypeptide" refers to a polynucleotide comprising the polypeptide and a polynucleotide comprising additional coding and / or non-coding sequences.

 The invention also relates to variants of the polynucleotides described above, which encode polypeptides or fragments, analogs and derivatives of polypeptides having the same amino acid sequence as the invention. Variants of this polynucleotide can be naturally occurring allelic variants or non-naturally occurring variants. These nucleotide variants include substitution variants, deletion variants, and insertion variants. As known in the art, an allelic variant is an alternative form of a polynucleotide that may be a substitution, deletion, or insertion of one or more nucleotides, but does not substantially change the function of the polypeptide it encodes .

 The present invention also relates to a polynucleotide that hybridizes to the sequence described above (having at least 50%, preferably 70% identity, between the two sequences). The present invention particularly relates to polynucleotides that can hybridize to the polynucleotides of the present invention under stringent conditions. In the present invention, "strict conditions" means: (1) hybridization and elution at lower ionic strength and higher temperature, such as 0.2xSSC, 0.1% SDS, 60 ° C; or (2) Add denaturants during hybridization, such as 50% (v / v) formamide, 0.1% calf serum / 0.1% Fi co ll, 42 ° C, etc .; or (3) only between two sequences Hybridization occurs only when the identity is at least 95%, and more preferably 97%. Moreover, the polypeptide encoded by the hybridizable polynucleotide has the same biological function and activity as the mature polypeptide shown in SEQ ID NO: 2.

 The invention also relates to nucleic acid fragments that hybridize to the sequences described above. As used in the present invention, a "nucleic acid fragment" contains at least 10 nucleotides in length, preferably at least 20-30 nucleotides, more preferably 50 to 60 nucleotides, and most preferably at least 100 nuclei. Glycylic acid or more. Nucleic acid fragments can also be used in nucleic acid amplification techniques (such as PCR) to identify and / or isolate polynucleotides encoding human hearing loss related protein 38.39.

 The polypeptides and polynucleotides in the present invention are preferably provided in an isolated form and are more preferably purified to homogeneity. The specific polynucleotide sequence encoding the human hearing loss related protein 38.39 of the present invention can be obtained by various methods. For example, polynucleotides are isolated using hybridization techniques well known in the art. These techniques include, but are not limited to: 1) hybridization of probes to genomic or cDNA libraries to detect homologous polynucleotide sequences, and 2) antibody screening of expression libraries to detect cloned polynucleosides with common structural characteristics Acid fragments.

The DNA fragment sequence of the present invention can also be obtained by the following methods: 1) Isolation of double-stranded DNA from genomic DNA Sequence; 2) chemically synthesize a DNA sequence to obtain double-stranded DNA of the polypeptide.

 Of the methods mentioned above, genomic MA is the least commonly used. Direct chemical synthesis of DNA sequences is often the method of choice. The more commonly used method is the isolation of cDNA sequences. The standard method for isolating cDNA of interest is to isolate mRNA from donor cells that overexpress the gene and perform reverse transcription to form a plasmid or phage cDNA library. There are many mature techniques for extracting mRNA, and kits are also commercially available (Qiagene). The construction of cDNA libraries is also a common method (Sarabrook, et al., Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory. New York, 1989). Commercially available cDNA libraries are also available, such as different cDNA libraries from Clontech. When polymerase reaction technology is used in combination, even very small expression products can be cloned.

 The genes of the present invention can be selected from these cDNA libraries by conventional methods. These methods include (but are not limited to): (l) DNA-DNA or DNA-RNA hybridization; (2) the presence or absence of marker gene functions; (3) measuring the level of transcript 38.39 of human hearing loss-related protein; (4) ) Detection of protein products expressed by genes through immunological techniques or determination of biological activity. The above methods can be used alone or in combination.

 In the method (1), the probe used for hybridization is homologous to any part of the polynucleotide of the present invention, and its length is at least 10 nucleotides, preferably at least 30 nucleotides, more preferably At least 50 nucleotides, preferably at least 100 nucleotides. In addition, the length of the probe is usually within 2000 nucleotides, preferably within 1000 nucleotides. The probe used here is generally a DNA sequence chemically synthesized based on the gene sequence information of the present invention. The genes or fragments of the present invention can of course be used as probes. DM probes can be labeled with radioisotopes, luciferin, or enzymes (such as alkaline phosphatase).

 In the (4) method, the protein product of the 38.39 gene expression of the human hearing loss-related protein can be detected by immunological techniques such as Western blotting, radioimmunoprecipitation, and enzyme-linked immunosorbent assay (ELISA).

 Amplification of DNA / RNA by PCR (Saiki, et al. Science

1985; 230: 1350-1354) are preferred for obtaining the genes of the invention. In particular, when it is difficult to obtain a full-length cDNA from a library, the RACE method (RACE-rapid amplification of cDNA ends) can be preferably used. The primers used for PCR can be appropriately based on the polynucleotide sequence information of the present invention disclosed herein. Select and synthesize using conventional methods. The amplified DNA / RM fragments can be isolated and purified by conventional methods such as by gel electrophoresis.

The polynucleotide sequence of the gene of the present invention or various DNA fragments and the like obtained as described above can be determined by a conventional method such as dideoxy chain termination method (Sanger et al. PNAS, 1977, 74: 5463-5467). Such polynucleotide sequences can also be determined using commercial sequencing kits and the like. In order to obtain the full-length cDN A sequence, sequencing needs to be repeated. Sometimes it is necessary to determine the cDNA sequence of multiple clones in order to splice into a full-length cDNA sequence. The present invention also relates to a vector comprising the polynucleotide of the present invention, and a host cell produced by genetic engineering using the vector of the present invention or directly using a human hearing loss related protein 38.39 coding sequence, and a method for producing the polypeptide of the present invention by recombinant technology. .

 In the present invention, a polynucleotide sequence encoding a human hearing loss related protein 38.39 can be inserted into a vector to constitute a recombinant vector containing the polynucleotide of the present invention. The term "vector" refers to bacterial plasmids, phages, yeast plasmids, plant cell viruses, mammalian cell viruses such as adenoviruses, retroviruses, or other vectors well known in the art. Vectors suitable for use in the present invention include, but are not limited to: a Π promoter-based expression vector expressed in bacteria (Rosenberg, et al. Gene, 1987, 56: 125); a pMSXND expression vector expressed in mammalian cells ( Lee and Nathans, J Bio Chem.

263: 3521, 1988) and baculovirus-derived vectors expressed in insect cells. In short, as long as it can be replicated and stabilized in the host, any plasmid and vector can be used to construct a recombinant expression vector. An important feature of expression vectors is that they usually contain an origin of replication, a promoter, a marker gene, and translational regulatory elements.

 Methods known to those skilled in the art can be used to construct expression vectors containing a DNA sequence encoding human hearing loss related protein 38.39 and appropriate transcriptional / translational regulatory elements. These methods include in vitro recombinant DNA technology, DNA synthesis technology, and in vivo recombination technology (Sambroook, et al. Molecular Cloning, a Laboratory Manual, cold Spring Harbor Laboratory. New York, 1989). The DNA sequence can be operably linked to an appropriate promoter in the expression vector to guide mRNA synthesis. Representative examples of these promoters are: the lac or trp promoter of E. coli; the PL promoter of lambda phage; eukaryotic promoters include the CMV immediate early promoter, the HSV thymidine kinase promoter, the early and late SV40 promoters, Retroviral LTRs and other known promoters that control the expression of genes in prokaryotic or eukaryotic cells or their viruses. The expression vector also includes a ribosome binding site for translation initiation and a transcription terminator. Insertion of enhancer sequences into the vector will enhance its transcription in higher eukaryotic cells. Enhancers are cis-acting factors for DNA expression, usually about 10 to 300 base pairs, which act on promoters to enhance gene transcription. Illustrative examples include SV40 enhancers of 100 to 270 base pairs on the late side of the origin of replication, tumorigenic enhancers on the late side of the origin of replication, and adenoviral enhancers.

 In addition, the expression vector preferably contains one or more selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture. Fluorescent protein (GFP), or tetracycline or ampicillin resistance for E. coli.

Those of ordinary skill in the art will know how to select appropriate vector / transcription control elements (such as promoters, enhancers, etc.) and selectable marker genes. In the present invention, a polynucleotide encoding a human hearing loss related protein 38.39 or a recombinant vector containing the polynucleotide can be transformed or transduced into a host cell to form a genetically engineered host cell containing the polynucleotide or the recombinant vector. . The term "host cell" refers to a prokaryotic cell, such as a bacterial cell; or a lower eukaryotic cell, such as a yeast cell; or a higher eukaryotic cell, such as a mammalian cell. Representative examples are: E. coli, Streptomyces; bacterial cells such as Salmonella typhimurium; fungal cells such as yeast; plant cells; insect cells such as fly S2 or Sf 9; animal cells such as CH0, COS, or Bowes melanoma cells.

Transformation of a host cell with a DNA sequence described in the present invention or a recombinant vector containing the DNA sequence can be performed using conventional techniques well known to those skilled in the art. When the host is a prokaryote such as E. coli, competent cells capable of DNA uptake can be in the exponential growth phase were harvested, treated with CaC l ₂ method used in steps well known in the art. Alternatively, MgCl ₂ is used. If necessary, transformation can also be performed by electroporation. When the host is a eukaryotic organism, the following DNA transfection methods can be used: calcium phosphate co-precipitation method, or conventional mechanical methods such as microinjection, electroporation, and liposome packaging.

 Using conventional recombinant DNA technology, the polynucleotide sequence of the present invention can be used to express or produce a recombinant human hearing loss related protein 38. 39 (Scence, 1984; 224: 1431). Generally there are the following steps:

 (1) using the polynucleotide (or variant) encoding the human hearing loss related protein 38.39 of the present invention, or transforming or transducing a suitable host cell with a recombinant expression vector containing the polynucleotide;

 (2) culturing host cells in a suitable medium;

 (3) Isolate and purify protein from culture medium or cells.

 In step (2), depending on the host cell used, the medium used in the culture may be selected from various conventional mediums. Culture is performed under conditions suitable for host cell growth. After the host cells have grown to an appropriate cell density, the selected promoter is induced by a suitable method (such as temperature conversion or chemical induction), and the cells are cultured for a period of time.

 In step (3), the recombinant polypeptide may be coated in a cell, expressed on a cell membrane, or secreted outside the cell. If desired, recombinant proteins can be separated and purified by various separation methods using their physical, chemical and other properties. These methods are well known to those skilled in the art. These methods include, but are not limited to: conventional renaturation treatment, protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid chromatography (HPLC) and various other liquid chromatography techniques and combinations of these methods. Brief description of the drawings

The following drawings are used to illustrate specific embodiments of the present invention, but not to limit the scope of the claims. Defining the scope of the invention.

 Figure 1 is a comparison diagram of the amino acid sequence homology of the human hearing loss related protein 38.39 and human hearing loss related protein of the present invention. The upper sequence is human hearing loss related protein 38.39, and the lower sequence is human hearing loss related protein. Identical amino acids are represented by single-character amino acids between the two sequences, and similar amino acids are represented by "+".

Figure 2 shows the polyacrylamide gel electrophoresis (SDS-PAGE) of isolated human hearing loss related protein 38.39. 38.3 ⁹ kDa is the molecular weight of the protein. The arrow indicates the isolated protein band. The best way to implement the invention

 The present invention is further described below with reference to specific embodiments. It should be understood that these examples are only used to illustrate the present invention and not to limit the scope of the present invention. In the following examples, the experimental methods without specific conditions are generally performed according to conventional conditions such as those described in Sambrook et al., Molecular Cloning: Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989), or according to the manufacturer Suggested conditions. Example 1: Cloning of Human Hearing Loss Related Protein 38.39

Human fetal brain total A was extracted by one-step method with guanidine isothiocyanate / phenol / chloroform. Poly (A) mRNA was isolated from total RM using Quik mRNA Isolation Kit (Qiegene). 2ug poly (A) niRNA is reverse transcribed to form cDNA. The Smart 00 cDNA cloning kit (purchased from Clontech) was used to insert the 00 fragment into the multiple cloning site of pBSK (+) vector (Clontech) to transform DH5a. The bacteria formed a cDNA library. Dye terminate cycle reaction sequencing kit (Perkin-Elmer) and ABI 377 automatic sequencer (Perkin-Elmer) were used to determine the sequence of all clones and 3 'ends. The determined cDNA sequence was compared with the existing public DNA sequence database (Genebank), and it was found that the cDNA sequence of one of the clones ¹⁴⁷ 03 was new DNA. A series of primers were synthesized to determine the inserted cDNA fragments of the clone in both directions. The results showed that the 1474d03 clone contained a full-length cDNA of 1279bp (as shown in SeqIDN0: 1), and a 1050bp open reading frame (0RF) from 175bp to 1224bp, encoding a new protein (such as Seq ID NO: 2 (Shown). We named this clone pBS-1474d03, and the encoded protein was named human hearing loss related protein 38.39. Example 2: Homologous search of cDNA clones

The sequence of the human hearing loss-related protein 38.39 of the present invention and the protein sequence encoded by the same are used by the Blast program (Basiclocal Alignment search tool) [Altschul, SF et al. J. Mol. Biol. 1990; 215: 403-10], homology search was performed in databases such as Genbank and Swissport. The gene with the highest homology to the human hearing loss related protein 38.39 of the present invention is a known human hearing loss related protein, and its accession number encoded by Genbank is AF073309. The protein homology results are shown in Figure 1. The two are highly homologous, with an identity of 35; similarity of 54%. Example 3: Cloning of a gene encoding human hearing loss related protein 38.39 by RT-PCR

 CDNA was synthesized using fetal brain total RNA as a template and oligo-dT as a primer for reverse transcription reaction. After purification with Qiagene's kit, the following primers were used for PCR amplification:

 Priraerl: 5, one GGAGTCTCCCGGGCCTGGTCCTGA —3, (SEQ ID NO: 3)

 Primer2: 5'- CATAGGCCGAGGCGGCCGACATGT -3 '(SEQ ID NO: 4)

 Primerl is a forward sequence located at the 5th end of SEQ ID NO: 1, starting at lbp;

 Primer2 is the 3 'end reverse sequence in SEQ ID NO: 1.

Amplification reaction conditions: ⁵⁰ μl reaction volume containing ⁵⁰ mniol / L KC1, 10 mmol / L Tris-Cl, (pH8.5), 1.5 mmol / L MgCl ₂ , 200 μ mol / L dNTP, lOpmol primers , 1U Taq DNA polymerase (Clontech). The reaction was performed on a PE9600 DNA thermal cycler (Perkin-Elmer) under the following conditions for 25 cycles: 94 ° C 30sec; 55 ° C 30sec; 72 ° C 2min ₀ β-actin was also set as a positive control during RT-PCR And template blank is negative control. The amplified product was purified using a QIAGEN kit and ligated to a pCR vector (Invitrogen product) using a TA cloning kit. DM sequence analysis results showed that the DNA sequence of the PCR product was identical to l-1279bp shown in SEQ ID NO: 1. Example 4: Northern blot analysis of human hearing loss-related protein 38.39 gene expression:

Total RNA extraction in one step [Anal. Biochem 1987, 162, 156-159] ₀ This method involves acid guanidinium thiocyanate-chloroform extraction. That is, the tissue is homogenized with 4M guanidinium isothiocyanate-25mM sodium citrate, 0.2M sodium acetate (pH4.0), and 1 volume of phenol and 1/5 volume of chloroform-isoamyl alcohol (49: 1 ), Mix and centrifuge. The aqueous layer was aspirated, isopropanol (0.8 vol) was added and the mixture was centrifuged to obtain RNA precipitate. The resulting RNA pellet was washed with 70% ethanol, dried and dissolved in water. Using 20 _{g of} RNA, electrophoresis was performed on a 1.2% agarose gel containing 20 mM 3- (N-morpholino) propanesulfonic acid (pH 7.0)-5 mM sodium acetate-1 mM EDTA-2.2M formaldehyde. It was then transferred to a nitrocellulose membrane. Preparation ³² P- DNA probe labeled with a- ³² P dATP by random priming method. The DNA probe used was the PCR-amplified human hearing loss related protein 38.39 coding region sequence (175bp to 1224bp) shown in FIG. 1. A 32P-labeled probe (about 2 x 10 ⁶ cpm / ml) was hybridized with a nitrocellulose membrane to which RNA was transferred at 42 ° C overnight in a solution containing 50% formamide-25niM KH ₂ P0 ₄ (pH7.4)-5 χ SSC- 5 χ Denhardt's solution and 20 ^ g / ml salmon sperm DNA. After hybridization, place the filter in Wash in 1 x SSC-0.1% SDS at 55 ° C for 30 min. Then, Phosphor Imager was used for analysis and quantification. Example 5: In vitro expression, isolation and purification of recombinant human hearing loss related protein 38.39

 Based on SEQ ID NO: 1 and the coding region sequence shown in Figure 1, a pair of specific amplification primers were designed, the sequence is as follows:

Primer3: 5, _CCCCATATGATGGAACGCTGGAGCTTTGTCAAG- 3, (Seq ID No: 5) Primer4: 5'-CATGGATCCTTATTTCATCCTCTTGTGCCAAAT-3 '(Seq ID No: 6) The 5' ends of these two primers contain Mel and BamHI restriction sites, respectively, which The coding sequences of the 5 'and 3' ends of the gene of interest are respectively followed by Ndel and BamHI restriction sites corresponding to the selective endonucleases on the expression vector plasmid pET-28b (+) (Novagen, Cat. No. 69865.3). Enzyme site. PCR was performed using the pBS-1474d03 plasmid containing the full-length target gene as a template. The PCR reaction conditions were as follows: 10 pg of pBS-1474d03 plasmid, Primer-3, and Primer-4 in a total volume of 50 μ1; ¹ J was 10 pmol; Advantage polymerase Mix (Clontech) 1 μ1. Cycle parameters: 94 ° C 20s, 60 ° C 30s, 68 ° C 2 min, a total of 25 cycles. Ndel and BamHI were used to double-digest the amplified product and plasmid pET-28 (+), respectively, and large fragments were recovered and ligated with T4 ligase. The ligated product was transformed into E. coli DH5α by the calcium chloride method. After being cultured overnight on LB plates containing kanamycin (final concentration 3 (^ g / ml)), positive clones were screened by colony PCR method and sequenced. the positive clones with the correct sequence _(P ET-1474d03) the recombinant plasmid by the calcium chloride method to transform E. coli BL21 (DE3) plySs (Novagen Co.). (final concentration 30 μ g / ml) in a kanamycin-containing LB In the liquid medium, the host bacteria BL21 (pET-1474d03) was cultured at 37 ° C to the logarithmic growth phase, and IPTG was added to a final concentration of 1 ol / L, and the culture was continued for 5 hours. The cells were collected by centrifugation, and broken by ultrasound. The supernatant was collected by centrifugation, and chromatography was performed using His. Bind Quick Cartridge (Novagen) affinity chromatography column capable of binding 6 histidines (6His-Tag) to obtain a purified target protein related to human hearing loss. 38.39. After SDS-PAGE electrophoresis, a single band was obtained at 38.39 kDa (Figure 2). The band was transferred to a PVDF membrane and analyzed by the Edams hydrolysis method at the terminal amino acid sequence. The N-terminal 15 amino acid residues shown in SEQ ID NO: 2 are complete Example 6. Production of antibodies against human hearing loss-related protein 38.39

 Polypeptide specific to 38.39 human hearing loss-related protein was synthesized using a peptide synthesizer (product of PE):

 NH2— Met- Glu—Arg-Trp-Ser- Phe-Val—Lys- Gin- Val-Gly- Asp— Gly-Gly-Arg-

C00H (SEQ ID NO: 7). The polypeptide is coupled to hemocyanin and bovine serum albumin to form a complex, respectively. For methods, see: Avrameas, et al. Immunochemistry, 1969; 6: 43. With 4mg of hemocyanin Peptide complex plus complete Freund's adjuvant was used to immunize rabbits. After 15 days, hemocyanin peptide complex plus incomplete Freund's adjuvant was used to boost immunity once. A titer plate coated with a 15 g / ml bovine serum albumin peptide complex was used as an ELISA to determine antibody titers in rabbit serum. Total IgG was isolated from antibody-positive rabbit serum using protein A-Sepharose. The peptide was bound to a cyanogen bromide-activated Sepharose4B column, and anti-peptide antibodies were separated from the total IgG by affinity chromatography. The immunoprecipitation method proved that the purified antibody could specifically bind to human hearing loss related protein 38.39. Example 7: Use of a polynucleotide fragment of the present invention as a hybridization probe

 Suitable oligonucleotide fragments selected from the polynucleotides of the present invention are used as hybridization probes in a variety of ways. For example, the probes can be used to hybridize to genomic or cDNA libraries of normal tissue or pathological tissue from different sources to It is determined whether it contains the polynucleotide sequence of the present invention and a homologous polynucleotide sequence is detected. Further, the probe can be used to detect the polynucleotide sequence of the present invention or its homologous polynucleotide sequence in normal tissue or pathology. Whether the expression in tissue cells is abnormal.

 The purpose of this embodiment is to select a suitable oligonucleotide fragment from the polynucleotide SEQ ID NO: 1 of the present invention as a hybridization probe, and to identify whether some tissues contain the polynucleoside of the present invention by a filter hybridization method Acid sequence or a homologous polynucleotide sequence thereof. Filter hybridization methods include dot blotting, Southern imprinting, Northern blotting, and copying methods. They all use the same steps to immobilize the polynucleotide sample to be tested on the filter. These same steps are as follows: The sample-immobilized filter is first pre-hybridized with a probe-free hybridization buffer to saturate the non-specific binding site of the sample on the filter with the carrier and the synthesized polymer. The pre-hybridization solution is then replaced with a hybridization buffer containing labeled probes and incubated to hybridize the probes to the target nucleic acid. After the hybridization step, the unhybridized probes are removed by a series of membrane washing steps. This embodiment uses higher-intensity washing conditions (such as lower salt concentration and higher temperature), so that the hybridization background is reduced and only strong specific signals are retained. The probes used in this embodiment include two types: the first type of probes are oligonucleotide fragments that are completely the same as or complementary to the polynucleotide SEQ ID NO: 1 of the present invention; the second type of probes are partially related to the present invention The polynucleotide SEQ ID NO: 1 is the same or complementary oligonucleotide fragment. In this example, the dot blot method is used to fix the sample on the filter membrane. Under the high-intensity washing conditions, the first type of probe and the sample have the strongest hybridization specificity and are retained.

First, the selection of the probe

 The selection of oligonucleotide fragments from the polynucleotide SEQ ID NO: 1 of the present invention for use as hybridization probes should follow the following principles and several aspects to be considered:

 1. The preferred range of probe size is 18-50 nucleotides;

2, GC content is 30% -70%, non-specific hybridization increases when it exceeds; 3. There should be no complementary regions inside the probe;

 4. Those that meet the above conditions can be used as primary selection probes, and then further computer sequence analysis, including the primary selection probe and its source sequence region (ie, SEQ ID NO: 1) and other known genomic sequences and their complements The regions are compared for homology. If the homology with the non-target molecular region is greater than 85% or there are more than 15 consecutive bases, the primary probe should not be used;

 5. Whether the preliminary selection probe is finally selected as a probe with practical application value should be further determined by experiments.

 After completing the above analysis, select and synthesize the following two probes:

 Probe 1 (probel), which belongs to the first type of probe, is completely homologous or complementary to the gene fragment of SEQ ID NO: 1 (41Nt):

 5-TGGAACGCTGGAGCTTTGTCAAGCAAGTTGGAGATGGAGGG-3 '(SEQ ID NO: 8)

 Probe 2 (probe2), which belongs to the second type of probe, is equivalent to the replacement mutant sequence of the gene fragment of SEQ ID NO: 1 or its complementary fragment (41Nt):

 5-TGGAACGCTGGAGCTTTGTCCAGCAAGTTGGAGATGGAGGG-3 '(SEQ ID NO: 9) For other common reagents and their preparation methods that are not listed in the following specific experimental procedures, please refer to the literature: DNA PROBES GH Kel ler; M.M. Manak; Stockton Press, 1989 (USA) and more commonly used molecular cloning laboratory manuals, such as the Guide to Molecular Cloning Experiments (Second Edition 1998) [US] Sambrook et al., Science Press.

 Sample Preparation:

 1.Extract DNA from fresh or frozen tissue

 Steps: 1) Put fresh or freshly thawed normal liver tissue into ice and hold phosphate buffer solution

(PBS). Cut the tissue into small pieces with scissors or a scalpel. Keep tissue moist during operation. 2) Centrifuge the tissue at 1,000 g for 10 minutes. 3) cold homogenization buffer (0.25mol / L sucrose; 25 so ol / L Tris-HCl, pH7.5 ; 25 Implicit ol / LnaCl; 25mmol / L MgCl 2) was suspended precipitates (approximately 1 Oml / g). 4) it is completely broken at 4 ^D C with an electric tissue homogenizer suspension homogenized at full speed, until the tissue. 5) Centrifuge at 1000g for 10 minutes. 6) Resuspend the cell pellet (add 1-5ml per 0.1 g of the original tissue sample), and centrifuge at 1,000 g for 10 minutes. 7) Resuspend the pellet with lysis buffer (1 ml per 0.1 g of the initial tissue sample), and then follow the phenol extraction method below.

 2, DNA phenol extraction method

Steps: 1) Wash the cells with 1-10 ml of cold PBS and centrifuge at 1,000 g for 10 minutes. 2) Resuspend the pelleted cells with cold cell lysate (1 x 10 ⁸ cells / ml) with a minimum of 100 ul of lysis buffer. 3) Add SDS to a final concentration of 1%. If SDS is directly added to the cell pellet before resuspending the cells, the cells may form large clumps that are difficult to break, and reduce the overall yield. This is particularly serious when extracting> 10 ⁷ cells. 4) Add proteinase K to a final concentration of 200ug / ml. 5) Incubate at 50 ° C for 1 hour or shake gently at 37 ° C overnight. 6) Extract with an equal volume of phenol: chloroform: isoamyl alcohol (25: 24: 1) and centrifuge in a small centrifuge tube for 10 minutes. The two should be clearly separated, otherwise centrifuge again. 7) Transfer the water phase to a new tube. 8) Extract with an equal volume of chloroform: isoamyl alcohol (24: 1) and centrifuge for 10 minutes. 9) Transfer the DNA-containing aqueous phase to a new tube. The DNA was then purified and ethanol precipitated.

3. Purification of DNA and ethanol precipitation

Steps: 1) Add 180 vols of 2mol / L sodium acetate and 2 volumes of cold 100% ethanol to the DNA solution and mix. Leave at -20 ° C for 1 hour or overnight. 2) Centrifuge for 10 minutes. 3) Carefully aspirate or pour out the ethanol. 4) Wash the pellet with 500ul of 70% cold ethanol and centrifuge for 5 minutes. 5) Carefully aspirate or pour out the ethanol. Wash the pellet with 500ul of cold ethanol and centrifuge for 5 minutes. 6) Carefully aspirate or pour out the ethanol, then invert on the absorbent paper to drain off the residual ethanol. Air dry for 10-15 minutes to allow the surface ethanol to evaporate. Be careful not to allow the pellet to dry completely, otherwise it will be more difficult to re-dissolve. 7) Resuspend the DM pellet in a small volume of TE or water. Vortex at low speed or blow with a dropper while gradually increasing TE, mix until the DNA is fully lysed, and add approximately 1 ul per 1- 5 x 10 ^δ cells.

 The following steps 8-13 are only used when contamination must be removed, otherwise step 14 can be performed directly.

8) Add RNase A to the DNA solution to a final concentration of 100ug / ral, and incubate at 37 ° C for 30 minutes. 9) Add SDS and protease, the final concentrations are 0.5% and 100ug / ml. Incubate at 37 ° C for 30 minutes. 10) Extract the reaction solution with an equal volume of phenol: chloroform: isoamyl alcohol (25: 24: 1) and centrifuge for 10 minutes. 11) Carefully remove the aqueous phase and re-extract with an equal volume of chloroform: isoamyl alcohol (24: 1) and centrifuge for 10 minutes. 12) Carefully remove the water phase, add 1/10 volume of 2mol / L sodium acetate and 2.5 volumes of cold ethanol, and mix well at -20 ° C for 1 hour. 13) Wash the pellet with 70% ethanol and 100% ethanol, air dry, and resuspend the nucleic acid. The process is the same as steps 3-6. 14) Measure A ₂₆ . And A ₂₈ . To check the purity and yield of DM. 15) Store at -20 ° C after dispensing. Preparation of sample film:

 1) Take 4 x 2 pieces of nitrocellulose membranes (NC membranes) of appropriate size, and gently mark the spotting position and sample number on them with a pencil. Two NC membranes are required for each probe for subsequent experiments. In the step, the film is washed with high-strength conditions and strength conditions, respectively.

 2) Pipette and control 15 microliters each, spot on the sample film, and dry at room temperature.

 3) Place on filter paper impregnated with 0.1 mol / L NaOH, 1.5 mol / L NaCl for 5 minutes (twice), dry and place on filter paper impregnated with 0.5 mol / L Tris-HCl (pH 7.0), 3 mol / L NaCl Allow to dry for 5 minutes (twice).

 4) Clamped in clean filter paper, wrapped in aluminum foil, and dried under vacuum at 60-80 ° C for 2 hours.

Labeling of probes 1) 3 μl Probe (0.1OD / 10 μ 1), add 2 μ IKinase buffer, 8-10 uCi γ- ³² P- dATP + 2U Kinase, to make up to a final volume of 20 μ 1.

 2) Incubate at 37 ° C for 2 hours.

 3) Add 1/5 volume of Bromophenol Blue Indicator (BPB).

 4) Pass through a Sephadex G-50 column.

5) Collect the first peak before ³² P-Probes are washed out (monitorable).

 6) 5 drops / tube, collect 10-15 tubes.

 7) Monitor the amount of isotope with a liquid scintillator

8) were collected after the first peak were combined to ³² P- Probe (second peak to prepare the desired free γ- ³² P - dATP) ₀

 Pre-hybridization

 Place the sample film in a plastic bag, add 3-10 mg of pre-hybridization solution (10xDenhardt's; 6xSSC, 0.1 mg / ml CT DNA (calf thymus DNA).), Seal the bag, and shake at 68 ° C in water. 2 hour.

 Cross

 Cut a corner of the plastic bag, add the prepared probe, seal the bag, and shake at 42 ° C in water overnight. Wash film:

 High-intensity washing film:

 1) Take out the hybridized sample membrane.

 2) 2xSSC, 0.1% SDS, 40. C Wash for 15 minutes (twice).

 3) 0. IxSSC, 0.1% SDS, 40. C Wash for 15 minutes (twice).

 4) In 0.1xSSC, 0.1½SDS, wash at 55 ° C for 30 minutes (twice), and dry at room temperature.

 Low-intensity washing film:

 1) Take out the hybridized sample membrane.

 2) 2xSSC, 0.1% SDS, wash at 37 ° C for 15 minutes (twice).

 3) 0. IxSSC, 0.1% SDS, wash at 37 ° C for 15 minutes (twice).

 4) 0. IxSSC, 0.1% SDS, wash at 40 ° C for 15 minutes (twice), and dry at room temperature.

 X-ray autoradiography:

 -70 ° C, X-ray autoradiography (pressing time depends on the radioactivity of the hybrid spot).

 Experimental results:

The hybridization experiments performed under low-intensity membrane washing conditions showed no significant difference in the radioactive intensity of the above two probes. However, in the hybridization experiments performed under high-intensity membrane washing conditions, the radioactive intensity of probe 1 was significantly stronger. To the radioactive intensity of the hybridization spot of another probe. Therefore, probe 1 can be used for qualitative and quantitative analysis. The presence and differential expression of the polynucleotide of the present invention in different tissues are analyzed. Industrial applicability

 The polypeptides of the present invention, as well as antagonists, agonists and inhibitors of the polypeptides, can be directly used in the treatment of diseases, for example, they can treat malignant tumors, adrenal deficiency, skin diseases, various types of inflammation, HIV infection and immune diseases.

 Senile hearing loss has a high incidence. It is a human disease caused by a combination of environmental and genetic factors. It is not similar to the comprehensive hearing loss phenotype.

 On the human chromosome 7 Pl 5 region, the 2-cM region from D7S582 to D7S 179 is related to the autosomal dominant inheritance of DFNA5 hearing impairment. In 1998, Van Laer L et al. Found an insertion / deletion mutant in the 7th intron of a gene expressed in the cochlea in this region, which does not affect the intron-exon boundary, but within this region Five GGG triplets are lost at the 3 'end of the intron, and this GGG triplet plays an important role in splicing large introns. This mutant causes early termination of translation of the open reading frame. This mutation causes non-comprehensive hearing impairment. [Nature Genet 1998, 20 (2): 194-197] The novel polypeptide of the present invention is highly homologous to the known human DFNA5 protein and has similar structural characteristics to it. When the novel polypeptide of the present invention is normally expressed, it can maintain human hearing soundness. If it is overexpressed or a gene fragment is lost, it will cause human hearing abnormality or loss, especially senile hearing loss.

 It can be seen that the abnormal expression of the human hearing loss-related protein 38.39 of the present invention will cause various diseases, especially human hearing abnormalities or loss. These diseases include but are not limited to: senile hearing loss, non-comprehensive hearing impairment, Congenital deafness, auricle deformity

 The polypeptide of the present invention and the antagonists, agonists and inhibitors of the polypeptide can be directly used in the treatment of diseases, for example, it can treat senile hearing loss, non-comprehensive hearing impairment, congenital deafness, auricle deformity, etc.

 The invention also provides methods for screening compounds to identify agents that increase (agonist) or suppress (antagonist) human hearing loss related protein 38.39. Agonists enhance human hearing loss-related proteins 38. 39 Stimulate biological functions such as cell proliferation, while antagonists prevent and treat disorders related to excessive cell proliferation, such as various cancers. For example, mammalian cells or a membrane preparation expressing a human hearing loss related protein 38.39 can be cultured with the labeled human hearing loss related protein 38.39 in the presence of a drug. The ability of the drug to increase or block this interaction is then measured.

Antagonists of human hearing loss-related protein 38.39 include antibodies, compounds, receptor deletions, and the like that have been screened. Antagonist of human hearing loss related protein 38.39 can bind to human hearing loss related protein 38.39 and eliminate its function, or inhibit the production of the polypeptide, or with the activity of the polypeptide Site binding prevents the polypeptide from performing its biological function.

 When screening compounds as antagonists, human hearing loss related protein 38.39 can be added to the bioanalytical assay, and the compound can be determined by measuring the effect of the compound on the interaction between human hearing loss related protein 38.39 and its receptor. Whether it is an antagonist. Receptor deletions and analogs that act as antagonists can be screened in the same manner as described above for screening compounds. Peptide molecules capable of binding to human hearing loss related proteins 38. 39 can be obtained by screening a random peptide library composed of various possible combinations of amino acids bound to a solid phase. In screening, 38.39 molecules of human hearing loss related proteins should generally be labeled.

 The present invention provides a method for producing antibodies using polypeptides, and fragments, derivatives, analogs or cells thereof as antigens. These antibodies can be polyclonal or monoclonal antibodies. The invention also provides antibodies against the human hearing loss related protein 38.39 epitope. These antibodies include (but are not limited to): polyclonal antibodies, monoclonal antibodies, chimeric antibodies, single chain antibodies, Fab fragments, and fragments produced by Fab expression libraries.

 Polyclonal antibodies can be produced using human hearing loss-related protein 38. 39 by injecting directly into immunized animals (such as rabbits, mice, rats, etc.). A variety of adjuvants can be used to enhance the immune response, including but not limited to Freund's Adjuvant, etc. Techniques for preparing monoclonal antibodies against human hearing loss-related protein 38.39 include, but are not limited to, hybridoma technology (Kohler and Miste in. Nature, 1975, 256: 495-497), triple tumor technology, human beta -Cell hybridoma technology, EBV-hybridoma technology, etc. Chimeric antibodies that bind human constant regions to non-human variable regions can be produced using well-known techniques (Morr i s on e t

al, PNAS, 1985, 81: 6851) 0 Only some technical production of single chain antibodies (US Pa t No. 4946778) can also be used to produce an anti-human protein associated with hearing loss of a single chain antibody 38.39.

 Antibodies against human hearing loss related protein 38. 39 can be used in immunohistochemical techniques to detect human hearing loss related protein 38. 39 in biopsy specimens.

 Monoclonal antibodies that bind to human hearing loss-related protein 38.39 can also be labeled with radioisotopes and injected into the body to track their location and distribution. This radiolabeled antibody can be used as a non-invasive diagnostic method to locate tumor cells and determine whether there is metastasis.

 Antibodies can also be used to design immunotoxins that target a particular part of the body. For example, human hearing loss related proteins 38. 39. High-affinity monoclonal antibodies can covalently bind to bacterial or phytotoxins (such as diphtheria toxin, ricin, ormosine, etc.). A common method is to attack the amino group of an antibody with a thiol cross-linking agent such as SPDP, and bind the toxin to the antibody through the exchange of disulfide bonds. This hybrid antibody can be used to kill human hearing loss related proteins 38. 39 positive Cell.

The antibodies of the present invention can be used to treat or prevent diseases related to human hearing loss-related protein 38.39. Administration of appropriate doses of antibodies can stimulate or block the production of 38.39 protein in human hearing loss or Active.

 The invention also relates to a diagnostic test method for quantifying and localizing 38.39 levels of human hearing loss-related protein. These tests are well known in the art and include FISH assays and radioimmunoassays. The level of human hearing loss-related protein 38.39 detected in the test can be used to explain the importance of human hearing loss-related protein 38.39 in various diseases and to diagnose human hearing loss-related protein 38.39. disease.

 The polypeptide of the present invention can also be used for peptide mapping analysis. For example, the polypeptide can be specifically cleaved by physical, chemical or enzymatic analysis, and subjected to one-dimensional or two-dimensional or three-dimensional gel electrophoresis analysis, and more preferably mass spectrometry analysis.

 Polynucleotides encoding the human hearing loss related protein 38.39 can also be used for a variety of therapeutic purposes. Gene therapy techniques can be used to treat abnormalities in cell proliferation, development, or metabolism caused by human hearing loss-related proteins 38. 39 due to non-expression or abnormal / inactive expression. Recombinant gene therapy vectors (such as viral vectors) can be designed to express variant human hearing loss related proteins 38.39 to inhibit endogenous human hearing loss related proteins 38.39 activity. For example, a mutant human hearing loss-related protein 38.39 may be a shortened human hearing loss-related protein 38.39 that lacks a signaling functional domain. Although it can bind to downstream substrates, it lacks signaling activity. Therefore, recombinant gene therapy vectors can be used to treat diseases caused by abnormal expression or activity of human hearing loss related proteins. Virus-derived expression vectors such as retrovirus, adenovirus, adenovirus-associated virus, herpes simplex virus, parvovirus, etc. can be used to transfer a polynucleotide encoding a human hearing loss related protein 38.39 into a cell. A method for constructing a recombinant viral vector carrying a polynucleotide encoding a human hearing loss related protein 38.39 can be found in existing literature

 (Sambrook, et a l.). In addition, a polynucleotide encoding the human hearing loss related protein 38.39 can be recombinantly packaged into liposomes and transferred into cells.

 Methods for introducing a polynucleotide into a tissue or cell include: directly injecting the polynucleotide into a tissue in vivo; or introducing the polynucleotide into a cell in vitro through a vector (such as a virus, phage, or plasmid), and then transplanting the cell Into the body and so on.

Oligonucleotides (including antisense RNA and DNA) and ribozymes that inhibit 38.39 mRM of human hearing loss related proteins are also within the scope of the present invention. A ribozyme is an enzyme-like RNA molecule that can specifically decompose a specific RNA. Its mechanism of action is that the ribozyme molecule specifically hybridizes with a complementary target RNA for endonucleation. Antisense RM, DNA, and ribozymes can be obtained using any existing RNA or DNA synthesis technology, such as the technology for the synthesis of oligonucleotides by solid-phase phosphoramidite chemical synthesis methods has been widely used. Antisense RM molecules can be obtained by in vitro or in vivo transcription of a DNA sequence encoding the RNA. This DNA sequence is integrated downstream of the vector's RNA polymerase promoter. To increase the stability of nucleic acid molecules, they can be modified in a variety of ways. For example, if the sequence length on both sides is increased, the linkage between ribonucleosides should use phosphorothioate or peptide bonds instead of phosphodiester bonds.

 The polynucleotide encoding the human hearing loss related protein 38.39 can be used for the diagnosis of diseases related to the human hearing loss related protein 38.39. The polynucleotide encoding the human hearing loss related protein 38.39 can be used to detect the expression of the human hearing loss related protein 38.39 or the abnormal expression of the human hearing loss related protein 38.39 in a disease state. For example, the DNA sequence encoding the human hearing loss related protein 38.39 can be used to hybridize biopsy specimens to determine the expression status of the human hearing loss related protein 38.39. Hybridization techniques include Sou thern blotting, Nor thern blotting, in situ hybridization, and the like. These techniques and methods are publicly available and mature, and related kits are available commercially. Part or all of the polynucleotides of the present invention can be used as probes to be fixed on a microarray (Mi croar ray) or a DNA chip (also known as a "gene chip") for analyzing differential expression analysis of genes and genetic diagnosis in tissues . Human hearing loss related protein 38.39 specific primers for RNA-polymerase chain reaction (RT-PCR) in vitro amplification can also detect the human hearing loss related protein 38.39 transcript.

 Detection of human hearing loss-related protein 38.39 mutations can also be used to diagnose human hearing loss-related protein 38.39-related diseases. Human hearing loss-related protein 38.39 mutations include point mutations, translocations, deletions, recombinations, and any other abnormalities compared to normal wild-type human hearing loss-related protein 38.39 DNA sequences. Mutations can be detected using existing techniques such as Southern blotting, DNA sequence analysis, PCR and in situ hybridization. In addition, mutations may affect the expression of proteins, so the Nort Hern blotting and Western blotting can be used to indirectly determine whether there is a mutation in the gene.

 The sequences of the invention are also valuable for chromosome identification. The sequence specifically targets a specific position on a human chromosome and can hybridize to it. Currently, specific sites for each gene on the chromosome need to be identified. Currently, only a few chromosome markers based on actual sequence data (repeating polymorphisms) are available for marking chromosome positions. According to the present invention, in order to associate these sequences with disease-related genes, an important first step is to locate these DM sequences on a chromosome.

 In short, PCR primers (preferably 15-35bp) are prepared from the cDNA, and the sequences can be located on the chromosomes. These primers were then used for PCR screening of somatic hybrid cells containing individual human chromosomes. Only those heterozygous cells containing the human gene corresponding to the primer will produce amplified fragments.

PCR localization of somatic hybrid cells is a quick way to localize DNA to specific chromosomes. Using the oligonucleotide primers of the present invention, by a similar method, a set of fragments from a specific chromosome or a large number of genomic clones can be used to achieve sublocalization. Other similar strategies that can be used for chromosomal localization include in situ hybridization, chromosome pre-screening with labeled flow sorting, and hybrid pre-selection to construct chromosome-specific cDNA libraries. Fluorescent in situ hybridization (FISH) of cDNA clones to metaphase chromosomes allows precise chromosomal localization in one step. For a review of this technique, see Verma et al., Human Chromosomes: a Manu l of Basic Techniques, Pergamon Pres s, New York (1988).

 Once the sequence is located at the exact chromosomal location, the physical location of the sequence on the chromosome can be correlated with the genetic map data. These data can be found in, for example, V. Mckusick, Mendel i an

Inher i tance in Man (available online with Johns Hopkins University Wetch Medica l Library). Linkage analysis can then be used to determine the relationship between genes and diseases that have been mapped to chromosomal regions.

 Next, the difference in cDNA or genomic sequence between the affected and unaffected individuals needs to be determined. If a mutation is observed in some or all diseased individuals and the mutation is not observed in any normal individuals, the mutation may be the cause of the disease. Comparing affected and unaffected individuals usually involves first looking for structural changes in chromosomes, such as deletions or translocations that are visible at the chromosomal level or detectable with cDNA sequence-based PCR. According to the resolution capabilities of current physical mapping and gene mapping technology, the CDM that is accurately mapped to a disease-related chromosomal region can be one of 50 to 500 potentially pathogenic genes (assuming 1 megabase mapping resolution) Capacity and each 20kb corresponds to a gene).

 The polypeptides, polynucleotides and mimetics, agonists, antagonists and inhibitors of the present invention can be used in combination with a suitable pharmaceutical carrier. These carriers can be water, glucose, ethanol, salts, buffers, glycerol, and combinations thereof. The composition comprises a safe and effective amount of the polypeptide or antagonist, and carriers and excipients which do not affect the effect of the drug. These compositions can be used as drugs for the treatment of diseases.

 The invention also provides a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the invention. Along with these containers, there may be instructional instructions given by government agencies that manufacture, use, or sell pharmaceuticals or biological products, which prompts permission for administration on the human body by government agencies that produce, use, or sell. In addition, the polypeptides of the invention can be used in combination with other therapeutic compounds.

 The pharmaceutical composition can be administered in a convenient manner, such as by a topical, intravenous, intraperitoneal, intramuscular, subcutaneous, intranasal or intradermal route of administration. Human hearing loss related proteins 38. 39 are administered in amounts effective to treat and / or prevent specific indications. The amount and range of human hearing loss-related protein 38.39 administered to a patient will depend on many factors, such as the mode of administration, the health conditions of the person to be treated, and the judgment of the diagnostician.

Claims

Claim

1. An isolated polypeptide-human hearing loss related protein 38.39, characterized in that it comprises: a polypeptide having the amino acid sequence shown in SEQ ID NO: 2, or an active fragment, analog, or derivative of a polypeptide thereof.

2. The polypeptide according to claim 1, characterized in that the amino acid sequence of the polypeptide, analog or derivative has at least 95% identity with the amino acid sequence shown in SEQ ID NO: 2.

 3. The polypeptide according to claim 2, characterized in that it comprises a polypeptide having an amino acid sequence shown in SEQ ID NO: 2.

 4. An isolated polynucleotide, characterized in that said polynucleotide comprises one selected from the group consisting of: (a) encoding a polypeptide having an amino acid sequence shown in SEQ ID NO: 2 or a fragment thereof, an analog thereof; Derived

(b) a polynucleotide complementary to polynucleotide (a); or

 (c) A polynucleotide that is at least 70% identical to (a) or (b).

 5. The polynucleotide according to claim 4, wherein the polynucleotide comprises a polynucleotide encoding an amino acid sequence represented by SEQ ID NO: 2.

 6. The polynucleotide according to claim 4, characterized in that the sequence of the polynucleotide comprises the sequence of positions 175-1224 in SEQ ID NO: 1 or the sequence of positions 1-1279 in SEQ ID NO: 1 .

 7. A recombinant vector containing an exogenous polynucleotide, characterized in that it is a recombinant constructed from the polynucleotide according to any one of claims 4 to 6 and a plasmid, virus or carrier expression vector Carrier.

 8. A genetically engineered host cell containing an exogenous polynucleotide, characterized in that it is selected from one of the following host cells:

 (a) a host cell transformed or transduced with the recombinant vector of claim 7; or

 (b) a host cell transformed or transduced with the polynucleotide according to any one of claims 4-6.

 9. A method for preparing a polypeptide having human hearing loss related protein 38.39 activity, characterized in that the method comprises:

 (a) culturing the engineered host cell of claim 8 under the condition of expressing human hearing loss related protein 38.39;

 (b) Isolating a polypeptide with human hearing loss related protein 38.39 activity from the culture.

10. An antibody capable of binding to a polypeptide, characterized in that said antibody is an antibody capable of specifically binding to human hearing loss related protein 38.39.

1 1. A class of compounds that mimic or regulate the activity or expression of a polypeptide, characterized in that they are compounds that mimic, promote, antagonize or inhibit the activity of a human hearing loss related protein 38.39.

 12. The compound according to claim 11, characterized in that it is an antisense sequence of a polynucleotide sequence or a fragment thereof as shown in SEQ ID D NO: 1.

13. A method of using the compound according to claim 11, characterized in that the compound is used for regulating human hearing loss-related protein 38. 39 in vivo and in vitro method.

 14. A method for detecting a disease or susceptibility to a polypeptide related to any one of claims 1-3, characterized in that it comprises detecting the expression level of the polypeptide, or detecting the polypeptide Activity, or detecting a nucleotide variation in a polynucleotide that causes abnormal expression or activity of the polypeptide.

15. Use of the polypeptide according to any one of claims 1-3, characterized in that it is used for screening a mimic, agonist, antagonist or inhibitor of a human hearing loss related protein 38.39; or For identification of peptide fingerprints.

 16. The use of a nucleic acid molecule according to any one of claims 4-6, characterized in that it is used as a primer for a nucleic acid amplification reaction, or as a probe for a hybridization reaction, or used to make a gene Chip or microarray.

 17. Use of a polypeptide, polynucleotide or compound according to any one of claims 1 to 6 and 11, characterized in that the polypeptide, polynucleotide or mimetic, agonist, antagonist The agent or inhibitor is composed of a safe and effective dose with a pharmaceutically acceptable carrier as a pharmaceutical composition for diagnosing or treating a disease associated with human hearing loss-related protein 38.39 abnormality.

18. Use of a polypeptide, polynucleotide or compound according to any one of claims 1 to 6 and 11, characterized in that the polypeptide, polynucleotide or compound is used for the preparation of treatments such as senile hearing Drugs for loss of hearing, non-comprehensive hearing impairment, congenital deafness, auricle deformities.