WO2001072787A1 - A novel polypeptide-human peroxidosome assembly factor 10 and the polynucleotide encoding said polypeptide - Google Patents

Abstract

The invention discloses a new kind of human peroxidosome assembly factor 10 and the polynucleotide encoding said polypeptide and a process for producing the polypeptide by recombinant methods. It also discloses the method of applying the polypeptide for the treatment of various kinds of diseases, such as Zellweger syndrome, infant suprarenal leukodystrophy, infant neurogenic or genetic incoordination, pipecolic acid supervacuus acid disease, other embryonic development diseases, metabolism disorders, different kinds of tumor, inflammation, immune diseases, HIV infection. The antagonist of the polypeptide and therapeutic use of the same is also disclosed. In addition, it refers to the use of polynucleotide encoding said human peroxidosome assembly factor 10.

Description

 A new polypeptide-human peroxisome assembly factor-10 and a polynucleotide encoding the polypeptide TECHNICAL FIELD

 The present invention belongs to the field of biotechnology. Specifically, the present invention describes a new polypeptide, a human peroxisome assembly factor-10, and a polynucleotide sequence encoding the polypeptide. The invention also relates to methods and applications for preparing such polynucleotides and polypeptides. Background technique

Peroxisomes, also called microsomes, are organelles containing one or more oxidases surrounded by a single membrane. Peroxisome is a heterogeneous organelle. The types of enzymes and the functions they perform are different in the cells of different organisms and even in different individuals of single-celled organisms. Peroxisomes in animal cells are in liver cells or kidney cells. It can oxidize and break down toxic components in the blood and play a detoxifying role. For example, almost half of the alcohol consumed is oxidized to acetaldehyde in the peroxisome. of. Peroxisomes often contain two enzymes: one is an oxidase that depends on flavin (FAD), and its role is to oxidize the substrate to form H ₂ 0 ₂ ; the other is catalase, whose content often accounts for over 40% of the total protein content of the oxidant body, its role is to break down H ₂ 0 _{2 to} form water and oxygen. The reactions catalyzed by these two enzymes are tightly coupled to protect cells from H ₂ 0 ₂ poisoning. Peroxisomes can degrade biological macromolecules, eventually producing H ₂ 0 ₂ , and most of these reactions can also be performed in other organelles, and do not produce H ₂ 0 ₂ , so its other function is to decompose fatty acids, etc. High-energy molecules provide thermal energy directly to the cells, without having to obtain thermal energy by hydrolyzing ATP.

 Peroxisome assembly factor-1 (PAF-1) is a membrane integrin of peroxisome, and plays an important role in the assembly of peroxisome. The mammalian peroxisome assembly factor-1 (PAF-1) is highly homologous and both contain two extremely conserved sequences, namely two transmembrane fragments, with seven conserved cystes in the C00H-terminal region. Amino acid residues. The two transmembrane domains of PAF-1 play a role in localizing PAF-1 as a membrane integrin in the peroxisome (Nobuyuki Sh imozawa e t al., Science 255, 1132 (1992)).

The absence or mutation of the peroxisome assembly factor-1 (PAF-1) will affect the peroxisome assembly, and the absence of such normal catalase-containing particles will lead to a variety of metabolic disorders, For example, P-oxidation of peroxidase and defects in plasmalogen biosynthesis, which cause various diseases, such as Zel lweger syndrome, neonatal adrenal white matter dystrophy, polyneuritis hereditary dyskinesia in infants and young children, and hexahydrogen These genes are genetic disorders that require peroxisome assembly. Among them, Zel lweger syndrome is a typical condition caused by PAF-1 deficiency. This disease is A lethal autosomal recessive disease with clinical symptoms of severe neurological abnormalities, various abnormalities, hepatomegaly, and multiple renal cysts (EAC Wiemer et al., Eur. J. Ce ll Biol. 50, 407 (1989) ).

 Gene chip analysis revealed that in the thymus, testis, muscle, spleen, lung, skin, thyroid, liver, PMA + Ecv304 cell line, PMA-Ecv304 cell line, non-starved L02 cell line, arsenic-stimulated L02 In cell lines and prostate tissues, the expression profile of the polypeptide of the present invention is very similar to the expression profile of human peroxisome assembly factor-1, so their functions may also be similar. The invention is named human peroxisome assembly factor-10.

 As mentioned above, the human peroxisome assembly factor-10 protein plays an important role in regulating important functions of the body such as cell division and embryonic development, and it is believed that a large number of proteins are involved in these regulatory processes, so the identification of Many human peroxisome assembly factor-10 proteins are involved in these processes, especially the amino acid sequence of this protein is identified. The isolation of the new human peroxisome assembly factor-10 protein encoding gene also provides a basis for research to determine the role of this protein in health and disease states. This protein may form the basis for the development of diagnostic and / or therapeutic agents for diseases, so it is important to isolate its coding for DM. Disclosure of invention

 It is an object of the present invention to provide an isolated novel polypeptide, human peroxisome assembly factor-10, and fragments, analogs and derivatives thereof.

 Another object of the invention is to provide a polynucleotide encoding the polypeptide.

 Another object of the present invention is to provide a recombinant vector containing a polynucleotide encoding human peroxisome assembly factor-10.

 It is another object of the present invention to provide a genetically engineered host cell containing a polynucleotide encoding human peroxisome assembly factor-10.

 Another object of the present invention is to provide a method for producing human peroxisome assembly factor-10.

 Another object of the present invention is to provide an antibody against the human peroxisome assembly factor-10 of the polypeptide of the present invention.

 Another object of the present invention is to provide mimetic compounds, antagonists, agonists, and inhibitors of the peroxisome assembly factor-10 of the polypeptide of the present invention.

 Another object of the present invention is to provide a method for diagnosing and treating diseases related to abnormalities of human peroxisome assembly factor-10.

The present invention relates to an isolated polypeptide. The polypeptide is of human origin and comprises: SEQ ID No. 2 Amino acid sequence of peptides, or conservative variants, biologically active fragments or derivatives thereof. Preferably, the polypeptide is a polypeptide having the amino acid sequence of SEQ ID NO: 2.

 The invention also relates to an isolated polynucleotide comprising a nucleotide sequence or a variant thereof selected from the group consisting of:

 (a) a polynucleotide encoding a polypeptide having the amino acid sequence of SEQ ID No. 2;

 (b) a polynucleotide complementary to polynucleotide (a);

 (c) A polynucleotide having at least 70% identity to a polynucleotide sequence of (a) or (b).

 More preferably, the sequence of the polynucleotide is one selected from the group consisting of: (a) a sequence having positions 119-397 in SEQ ID NO: 1; and (b) a sequence having 1-2567 in SEQ ID NO: 1 Sequence of bits.

 The present invention further relates to a vector, particularly an expression vector, containing the polynucleotide of the present invention; a host cell genetically engineered with the vector, including a transformed, transduced or transfected host cell; Host cell and method of preparing the polypeptide of the present invention by recovering the expression product.

 The invention also relates to an antibody capable of specifically binding to a polypeptide of the invention.

 The invention also relates to a method for screening compounds that mimic, activate, antagonize or inhibit the activity of the human peroxisome assembly factor-10 protein, which comprises utilizing the polypeptide of the invention. The invention also relates to compounds obtained by this method.

 The invention also relates to a method for in vitro detection of a disease or susceptibility to disease associated with abnormal expression of the human peroxisome assembly factor-10 protein, which comprises detecting a mutation in the polypeptide or a polynucleotide sequence encoding the same in a biological sample. Or detecting the amount or biological activity of a polypeptide of the invention in a biological sample.

 The invention also relates to a pharmaceutical composition comprising a polypeptide of the invention or a mimetic thereof, an activator, an antagonist or an inhibitor, and a pharmaceutically acceptable carrier.

 The present invention also relates to the preparation of the polypeptide and / or polynucleotide of the present invention for the treatment of Ze l lweger syndrome, neonatal adrenal white matter dystrophy, polyneuritis hereditary ataxia in infants and young children, Polyacidemia, other embryonic developmental disorders, growth disorders, substance metabolism disorders, various tumors, inflammation, immune diseases, HIV infection, or other abnormalities due to abnormal expression of human peroxisome assembly factor-10 Use of drugs that cause disease.

 Other aspects of the invention will be apparent to those skilled in the art from the disclosure of the techniques herein.

The following terms used in this specification and claims have the following meanings unless specifically stated: "Nucleic acid sequence" refers to an oligonucleotide, a nucleotide or a polynucleotide and a fragment or part thereof, and may also refer to a genomic or synthetic DNA or RNA, they can be single-stranded or double-stranded, representing the sense or antisense strand. Similarly, the term "amino acid sequence" refers to an oligopeptide, peptide, polypeptide or protein sequence and fragments or portions thereof Minute. When the "amino acid sequence" in the present invention relates to the amino acid sequence of a naturally occurring protein molecule, such "polypeptide" or "protein" does not mean to limit the amino acid sequence to a complete natural amino acid related to the protein molecule .

 A "variant" of a protein or polynucleotide refers to an amino acid sequence having one or more amino acids or nucleotide changes or a polynucleotide sequence encoding it. The changes may include deletions, insertions or substitutions of amino acids or nucleotides in the amino acid sequence or nucleotide sequence. Variants can have "conservative" changes, in which the amino acid substituted has a structural or chemical property similar to the original amino acid, such as replacing isoleucine with leucine. Variants can also have non-conservative changes, such as replacing glycine with tryptophan.

 "Deletion" refers to the deletion of one or more amino acids or nucleotides in an amino acid sequence or nucleotide sequence.

 "Insertion" or "addition" refers to an alteration in the amino acid sequence or nucleotide sequence that results in an increase in one or more amino acids or nucleotides compared to a naturally occurring molecule. "Replacement" refers to the replacement of one or more amino acids or nucleotides with different amino acids or nucleotides.

 "Biological activity" refers to a protein that has the structure, regulation, or biochemical function of a natural molecule. Similarly, the term "immunologically active" refers to the ability of natural, recombinant or synthetic proteins and fragments thereof to induce a specific immune response in appropriate animals or cells and to bind to specific antibodies.

 An "agonist" refers to a molecule that, when combined with human peroxisome assembly factor-10, causes a change in the protein to regulate the activity of the protein. An agonist may include a protein, a nucleic acid, a carbohydrate, or any other molecule that can bind to the human peroxisome assembly factor-10.

 "Antagonist" or "inhibitor" refers to a biological activity or immunity that can block or regulate human peroxisome assembly factor-10 when combined with human peroxisome assembly factor-10. Chemically active molecules. Antagonists and inhibitors may include proteins, nucleic acids, carbohydrates, or any other molecule that can bind to the human peroxisome assembly factor-10.

 "Regulation" refers to a change in the function of human peroxisome assembly factor-10, including an increase or decrease in protein activity, a change in binding characteristics, and any other organism of human peroxisome assembly factor-10 Changes in nature, function, or immunity.

"Substantially pure ¹ 'means substantially free of other proteins, lipids, sugars or other substances with which it is naturally associated. Those skilled in the art can purify human peroxisome assembly factors using standard protein purification techniques- 10. Basically pure human peroxisome assembly factor-10 produces a single main band on a non-reducing polyacrylamide gel. The purity of human peroxisome assembly factor-10 polypeptide can be analyzed by amino acid sequence .

"Complementary" or "complementary" refers to polynucleotides that naturally bind through base-pairing under conditions of acceptable salt concentration and temperature. For example, the sequence "C-TG-A" can be combined with the complementary sequence "GA-CT". The complementarity between two single-stranded molecules may be partial or complete. The degree of complementarity between nucleic acid strands has a significant effect on the efficiency and strength of hybridization between nucleic acid strands.

 "Homology" refers to the degree of complementarity and can be partially homologous or completely homologous. "Partial homology" refers to a partially complementary sequence that at least partially inhibits hybridization of a fully complementary sequence to a target nucleic acid. This inhibition of hybridization can be detected by performing hybridization (Southern imprinting or Nor thern blotting, etc.) under conditions of reduced stringency. Substantially homologous sequences or hybridization probes can compete and inhibit the binding of fully homologous sequences to the target sequence under conditions of reduced stringency. This does not mean that conditions with reduced stringency allow non-specific binding, because conditions with reduced stringency require that the two sequences bind to each other as either specific or selective interactions.

"Percent identity" refers to the percentage of sequences that are identical or similar in the comparison of two or more amino acid or nucleic acid sequences. The percent identity can be determined electronically, such as by the MEGALIGN program (Lasergene sof tware package, DNASTAR, Inc., Madi son Wis.). The MEGALIGN program can compare two or more sequences according to different methods such as the Clus ter method (Higg ins, DG and PM Sharp (1988) Gene 73: 237-244). _{0 The} C lus ter method will check the distance between all pairs by Groups of sequences are arranged in clusters. The clusters are then assigned in pairs or groups. The percent identity between two amino acid sequences such as sequence A and sequence B is calculated by the following formula: The number of matching residues between sequence A and sequence X 100 The number of residues in sequence A-the number of spacer residues in sequence A The number of spacer residues in a sequence B can also be determined by Clus ter method or using methods known in the art such as Jotun Hein. The percent identity between nucleic acid sequences (Hein J., (1990) Methods in emzumology 183: 625-645) „" Similarity "refers to the degree of identical or conservative substitutions of amino acid residues at corresponding positions in the alignment between amino acid sequences. Amino acids used for conservative substitutions, for example, negatively charged amino acids may include aspartic acid and glutamic acid. Amino acids; positively charged amino acids may include lysine and arginine; amino acids with similarly charged head groups that have similar hydrophilicity may include leucine, isoleucine, and valine; glycine And alanine; asparagine and glutamine; serine and threonine; phenylalanine and tyrosine.

 "Antisense" refers to a nucleotide sequence that is complementary to a particular DM or RNA sequence. "Antisense strand" refers to a nucleic acid strand that is complementary to a "sense strand."

"Derivative" refers to a chemical modification of HFP or a nucleic acid encoding it. This chemical modification may be the replacement of a hydrogen atom with an alkyl, acyl or amino group. Nucleic acid derivatives encode major organisms that retain natural molecules Peptides with chemical properties.

"Antibody" refers to a complete antibody molecule and its fragments, such as Fa,? (^ ') ₂ and? , It can specifically bind to the epitope of human peroxisome assembly factor-10.

 A "humanized antibody" refers to an antibody in which the amino acid sequence of a non-antigen binding region is replaced to become more similar to a human antibody, but still retains the original binding activity.

 The term "isolated" refers to the removal of a substance from its original environment (for example, its natural environment if it is naturally occurring). For example, a naturally-occurring polynucleotide or polypeptide is not isolated when it is present in a living thing, but the same polynucleotide or polypeptide is separated from some or all of the substances that coexist with it in the natural system. Such a polynucleotide may be part of a certain vector, or such a polynucleotide or polypeptide may be part of a certain composition. Since the carrier or composition is not part of its natural environment, they are still isolated.

 As used herein, "isolated" refers to the separation of a substance from its original environment (if it is a natural substance, the original environment is the natural environment). For example, polynucleotides and polypeptides in a natural state in a living cell are not isolated and purified, but the same polynucleotides or polypeptides are separated and purified if they are separated from other substances in the natural state .

 As used herein, "isolated human peroxisome assembly factor-10" refers to human peroxisome assembly factor-10, which is substantially free of other proteins, lipids, carbohydrates, or other substances naturally associated with it. Those skilled in the art can purify human peroxisome assembly factors using standard protein purification techniques-

10. Substantially pure polypeptides can produce a single main band on a non-reducing polyacrylamide gel. The purity of the human peroxisome assembly factor-10 polypeptide can be analyzed by amino acid sequence.

 The present invention provides a new polypeptide, human peroxisome assembly factor-10, which is basically composed of the amino acid sequence shown in SEQ ID NO: 2. The polypeptide of the present invention may be a recombinant polypeptide, a natural polypeptide, or a synthetic polypeptide, and preferably a recombinant polypeptide. The polypeptides of the present invention can be naturally purified products, or chemically synthesized products, or can be produced from prokaryotic or eukaryotic hosts (eg, bacteria, yeast, higher plants, insects, and mammalian cells) using recombinant techniques. Depending on the host used in the recombinant production protocol, the polypeptide of the invention may be glycosylated, or it may be non-glycosylated. Polypeptides of the invention may also include or exclude starting methionine residues.

The invention also includes fragments, derivatives and analogs of human peroxisome assembly factor-10. As used in the present invention, the terms "fragment", "derivative" and "analog" refer to a polypeptide that substantially maintains the same biological function or activity of the human peroxisome assembly factor-10 of the present invention. A fragment, derivative or analog of the polypeptide of the present invention may be: (I) a kind in which one or more amino acid residues are substituted with conservative or non-conservative amino acid residues (preferably conservative amino acid residues), and the substitution of The amino acid may or may not be encoded by the genetic code; or (II) such a type in which a group on one or more amino acid residues is substituted by another group to include a substituent; or (III) such a Species, wherein the mature polypeptide is fused with another compound (such as a compound that extends the half-life of the polypeptide, such as polyethylene glycol); or (IV) a polypeptide sequence in which an additional amino acid sequence is fused into a mature polypeptide (such as Leader sequences or secreted sequences or sequences used to purify this polypeptide or protease sequences) As set forth herein, such fragments, derivatives and analogs are considered to be within the knowledge of those skilled in the art.

 The present invention provides an isolated nucleic acid (polynucleotide), which basically consists of a polynucleotide encoding a polypeptide having the amino acid sequence of SEQ ID NO: 2. The polynucleotide sequence of the present invention includes the nucleotide sequence of SEQ ID NO: 1. The polynucleotide of the present invention is found from a cDNA library of human fetal brain tissue. It contains a polynucleotide sequence of 2567 bases in length and its open reading frame 119-397 encodes 92 amino acids. According to the comparison of gene chip expression profiles, it was found that this peptide has a similar expression profile to human peroxisome assembly factor-1, and it can be inferred that the human peroxisome assembly factor-10 has human peroxisome assembly factor -1 similar functionality.

 The polynucleotide of the present invention may be in the form of DM or RNA. DNA forms include cDM, genomic DNA, or synthetic DM. DNA can be single-stranded or double-stranded. DNA can be coding or non-coding. The coding region sequence encoding a mature polypeptide may be the same as the coding region sequence shown in SEQ ID NO: 1 or a degenerate variant. As used herein, a "degenerate variant" refers to a nucleic acid sequence encoding a protein or polypeptide having SEQ ID NO: 2 in the present invention, but which differs from the coding region sequence shown in SEQ ID NO: 1.

 The polynucleotide encoding the mature polypeptide of SEQ ID NO: 2 includes: only the coding sequence of the mature polypeptide; the coding sequence of the mature polypeptide and various additional coding sequences; the coding sequence of the mature polypeptide (and optional additional coding sequences); Coding sequence.

 The term "polynucleotide encoding a polypeptide" refers to a polynucleotide comprising the polypeptide and a polynucleotide comprising additional coding and / or non-coding sequences.

 The invention also relates to variants of the polynucleotides described above, which encode polypeptides or fragments, analogs and derivatives of polypeptides having the same amino acid sequence as the invention. Variants of this polynucleotide can be naturally occurring allelic variants or non-naturally occurring variants. These nucleotide variants include substitution variants, deletion variants, and insertion variants. As known in the art, an allelic variant is an alternative form of a polynucleotide that may be a substitution, deletion, or insertion of one or more nucleotides, but does not substantially change the function of the polypeptide it encodes .

The present invention also relates to a polynucleotide that hybridizes to a sequence described above 50% less, preferably 70% identity). The invention particularly relates to polynucleotides that can hybridize to the polynucleotides of the invention under stringent conditions. In the present invention, "strict conditions" means: a) hybridization and elution at lower ionic strength and higher temperature, such as 0.2xSSC, 0.1% SDS, 60 ° C; or (2) hybridization When using denaturants, such as 50% (v / v) formamide, 0.1% calf serum / 0.1% F i co ll, 42 ° C, etc .; or (3) only between two sequences Hybridization occurs only when the identity is at least 95%, and more preferably 97%. In addition, the polypeptide encoded by the hybridizable polynucleotide has the same biological function and activity as the mature polypeptide shown in SEQ ID NO: 2.

 The invention also relates to nucleic acid fragments that hybridize to the sequences described above. As used herein, a "nucleic acid fragment" contains at least 10 nucleotides in length, preferably at least 20-30 nucleotides, more preferably at least 50-60 nucleotides, most preferably at least 100 nucleotides. Nucleotides or more. Nucleic acid fragments can also be used in nucleic acid amplification techniques (such as PCR) to identify and / or isolate polynucleotide acids encoding human peroxisome assembly factor-10.

 The polypeptides and polynucleotides in the present invention are preferably provided in an isolated form and are more preferably purified to homogeneity. The specific polynucleotide sequence encoding the human peroxisome assembly factor-10 of the present invention can be obtained by various methods. For example, polynucleotides are isolated using hybridization techniques well known in the art. These techniques include, but are not limited to: 1) hybridization of probes to genomic or cDNA libraries to detect homologous polynucleotide sequences, and 2) antibody screening of expression libraries to detect cloned polynucleosides with common structural characteristics Acid fragments.

 The DM fragment sequence of the present invention can also be obtained by the following methods: 1) isolation of double-stranded DNA sequence from genomic DM; '2) chemical synthesis of DNA sequence to obtain double-stranded DNA of said polypeptide.

 Of the methods mentioned above, genomic DNA isolation is the least commonly used. Direct chemical synthesis of DNA sequences is often the method of choice. The more commonly used method is the separation of cDM sequences. The standard method for isolating the cDNA of interest is to isolate mRNA from donor cells that overexpress the gene and perform reverse transcription to form a plasmid or phage cDNA library. There are many mature techniques for extracting mRM, and kits are also commercially available (Qi agene;). And the construction of cDNA libraries is also a common method (Sambrook, et al., Molecular Cloning, A Labora tory Manua, Coll Spring Harbor Labora tory. New York, 1989). Commercially available cDNA libraries are also available, such as different cDNA libraries from Clontech. When polymerase reaction technology is used in combination, even very small expression products can be cloned.

The genes of the present invention can be screened from these CDM libraries by conventional methods. These methods include (but are not limited to): (l) DNA-DNA or DNA-RNA hybridization; (2) the presence or absence of marker gene functions; (3) determination of the transcript of human peroxisome assembly factor-10 Level; (4) detecting protein products of gene expression by immunological techniques or measuring biological activity. The above methods can be used singly or in combination. In the method (1), the probe used for hybridization is homologous to any part of the polynucleotide of the present invention, and its length is at least 10 nucleotides, preferably at least 30 nucleotides, more preferably At least 50 nucleotides, preferably at least 100 nucleotides. In addition, the length of the probe is usually within 2000 nucleotides, preferably within 1000 nucleotides. The probe used herein is generally a DNA sequence chemically synthesized based on the gene sequence information of the present invention. The genes or fragments of the present invention can of course be used as probes. DNA probes can be labeled with radioisotopes, luciferin, or enzymes (such as alkaline phosphatase).

 In the method (4), the protein product of human peroxisome assembly factor-10 gene expression can be detected by immunological techniques such as Western blotting, radioimmunoprecipitation, and enzyme-linked immunosorbent assay (ELISA).

 DNA / RNA Amplification Using PCR Techniques (Saiki, et al. Science

1985; 230: 1350-1354) are preferred for obtaining the genes of the invention. In particular, when it is difficult to obtain full-length cDNA from a library, the RACE method (RACE-cDM terminal rapid amplification method) can be preferably used, and the primers used for PCR can be appropriately based on the polynucleotide sequence information of the present invention disclosed herein. Select and synthesize using conventional methods. The amplified DNA / RNA fragments can be isolated and purified by conventional methods such as by gel electrophoresis.

 The polynucleotide sequence of the gene of the present invention or various DNA fragments and the like obtained as described above can be determined by a conventional method such as dideoxy chain termination method (Sanger et al. PNAS, 1977, 74: 5463-5467). Such polynucleotide sequences can also be determined using commercial sequencing kits and the like. In order to obtain the full-length cDNA sequence, the sequencing must be repeated. Sometimes it is necessary to determine the cDNA sequence of multiple clones in order to splice into a full-length cDNA sequence.

 The present invention also relates to a vector comprising the polynucleotide of the present invention, and a host cell produced by genetic engineering using the vector of the present invention or directly using a human peroxisome assembly factor-10 coding sequence, and recombinant technology to produce the Said method of polypeptide.

In the present invention, a polynucleotide sequence encoding human peroxisome assembly factor-10 can be inserted into a vector to form a recombinant vector containing the polynucleotide of the present invention. The term "vector" refers to bacterial plasmids, phages, yeast plasmids, plant cell viruses, mammalian cell viruses such as adenoviruses, retroviruses, or other vectors well known in the art. Vectors suitable for use in the present invention include, but are not limited to: T7 promoter-based expression vectors expressed in bacteria (Rosenberg, et al. Gene, 1987, 56: 125); pMSXND expression vectors expressed in mammalian cells ( Lee and Nathans, J Bio Chem. 263: 3521, 1988) and baculovirus-derived vectors expressed in insect cells. In short, as long as it can be replicated and stabilized in a host, any plasmid and vector can be used to construct a recombinant expression vector. An important feature of expression vectors is that they usually contain an origin of replication, a promoter, a marker gene, and translational regulatory elements. Methods known to those skilled in the art can be used to construct an assembly factor containing human peroxisome-

10 DNA sequences and expression vectors with appropriate transcriptional / translational regulatory elements. These methods include in vitro shuffling DM technology, DNA synthesis technology, in vivo recombination technology, etc. (Sambroook, et al. Molecular Cloning, a Laboratory Manua l, cold Harbor Labora tory. New York, 1989). The DNA sequence can be operably linked to an appropriate promoter in the expression vector to guide the synthesis of raRNA. Representative examples of these promoters are: E. coli lac or trp promoter; Lambda phage PL promoter; eukaryotic promoter package CMV immediate early promoter, HSV thymidine kinase promoter, early and late SV40 promoter , Retroviral LTRs and other known promoters that control the expression of genes in prokaryotic or eukaryotic cells or their viruses. The expression vector also includes a ribosome binding site for translation initiation and a transcription terminator. Insertion of enhancer sequences into the vector will enhance its transcription in higher eukaryotic cells. Enhancers are cis-acting factors for DNA expression, usually about 10 to 300 base pairs, which act on promoters to enhance gene transcription. Examples include 100 to 270 base pair SV40 enhancers on the late side of the origin of replication, polyoma enhancers and adenovirus enhancers on the late side of the origin of replication.

 In addition, the expression vector preferably contains one or more selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture. Fluorescent protein (GFP), or tetracycline or ampicillin resistance for E. coli.

 Those of ordinary skill in the art will know how to select appropriate vector / transcription control elements (such as promoters, enhancers, etc.) and selectable marker genes.

 In the present invention, a polynucleotide encoding human peroxisome assembly factor-10 or a recombinant vector containing the polynucleotide can be transformed or transduced into a host cell to constitute a genetic engineering containing the polynucleotide or the recombinant vector. Host cell. The term "host cell" refers to a prokaryotic cell, such as a bacterial cell; or a lower eukaryotic cell, such as a yeast cell; or a higher eukaryotic cell, such as a mammalian cell. Representative examples are: Escherichia coli, Streptomyces; bacterial cells such as Salmonella typhimurium; fungal cells such as yeast; plant cells; insect cells such as fly S2 or Sf9; animal cells such as CH0, COS or Bowes melanoma cells.

Transformation of a host cell with a DNA sequence according to the present invention or a recombinant vector containing the DM sequence can be performed using conventional techniques well known to those skilled in the art. When the host is a prokaryote, such as E. coli, competent cells capable of absorbing DNA can be harvested after the exponential growth phase and treated with the CaCl ₂ method. The steps used are well known in the art. The alternative is to use MgC l ₂ . If necessary, transformation can also be performed by electroporation. When the host is a eukaryotic organism, the following DNA transfection methods can be used: calcium phosphate co-precipitation method, or conventional mechanical methods such as microinjection, electroporation, and liposome packaging.

By conventional recombinant DNA technology, the polynucleotide sequence of the present invention can be used for expression or production Recombinant human peroxisome assembly factor-10 (Sc ience, 1984; 224: 1431). Generally there are the following steps:

 (1) using the polynucleotide (or variant) encoding human human peroxisome assembly factor-10 of the present invention, or transforming or transducing a suitable host cell with a recombinant expression vector containing the polynucleotide;

 (2) culturing host cells in a suitable medium;

 (3) Isolate and purify protein from culture medium or cells.

 In step (2), depending on the host cell used, the medium used in the culture may be selected from various conventional mediums. Culture is performed under conditions suitable for host cell growth. After the host cells have grown to an appropriate cell density, the selected promoter is induced by a suitable method (such as temperature conversion or chemical induction), and the cells are cultured for a period of time.

 In step (3), the recombinant polypeptide may be coated in a cell, expressed on a cell membrane, or secreted outside the cell. If desired, recombinant proteins can be separated and purified by various separation methods using their physical, chemical and other properties. These methods are well known to those skilled in the art. These methods include, but are not limited to: conventional renaturation treatment, protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid chromatography (HPLC) and various other liquid chromatography techniques and combinations of these methods. Brief description of the drawings

 The following drawings are used to illustrate specific embodiments of the invention, but not to limit the scope of the invention as defined by the claims.

 Fig. 1 is a comparison diagram of gene chip expression profiles of the inventor's peroxisome assembly factor-10 and the human peroxisome assembly factor-1. The upper graph is a graph of the expression profile of the human peroxisome assembly factor -10, and the lower graph is the graph of the expression profile of the human peroxisome assembly factor -1.

 Figure 2 shows the polyacrylamide gel electrophoresis (SDS-PAGE) of the isolated human peroxisome assembly factor-10. OKDa is the molecular weight of the protein. The arrow indicates the isolated protein band. The best way to implement the invention

The present invention is further described below with reference to specific embodiments. It should be understood that these examples are only used to illustrate the present invention and not to limit the scope of the present invention. The experimental methods without specific conditions in the following examples are generally in accordance with conventional conditions such as those described in Sambrook et al., Molecular Cloning: Laboratory Manual (New York: Cold Harbor Labora tory Pres s, 1989), Or as recommended by the manufacturer. Example 1: Cloning of human peroxisome assembly factor-10

 Human fetal brain total RNA was extracted by one-step method with guanidine isothiocyanate / phenol / chloroform. Poly (A) mRNA was isolated from total RNA using Quik mRNA Isolat ion Kit (product of Qiegene). 2ug poly (A) mRNA is reverse transcribed to form cDNA. The Smart cDNA cloning kit (purchased from Clontech) was used to insert the cDNA fragment into the multiple cloning site of pBSK (+) vector (Clontech) to transform DH5a. The bacteria formed a cDNA library. Dye terminate cycle reaction ion sequencing kit (Perkin-Elmer) and ABI 377 automatic sequencer (Perkin-Elmer) were used to determine the sequences at the 5 'and 3' ends of all clones. The determined cDNA sequence was compared with the existing public DNA sequence database (Genebank), and it was found that the cDNA sequence of one of the clones 0653g05 was new DNA. The inserted cDNA fragment contained in this clone was determined in both directions by synthesizing a series of primers. The results show that the 0653g05 clone contains a full-length cDNA of 2567bp (as shown in Seq ID NO: 1), and has a 279bp open reading frame (0RF) from 119bp to 397bp, encoding a new protein (such as Seq ID NO : Shown in 2). We named this clone pBS-0653g05, and the encoded protein was named human peroxisome assembly factor-10. Example 2: Cloning of a gene encoding human peroxisome assembly factor-10 by RT-PCR

 CDNA was synthesized using fetal brain cell total RNA as a template and ol igo-dT as a primer for reverse transcription reaction. After purification with Qiagene's kit, the following primers were used for PCR amplification:

 Pr imerl: 5'- GGAGGTTCCCACTATGAGCCCGGA -3 '(SEQ ID NO: 3)

 Pr imer2: 5'- TGTAAAATAATGTATTTTTATTCA -3, (SEQ ID NO: 4)

 Primerl is a forward sequence starting at lbp of the 5th end of SEQ ID NO: 1;

 Pr imer2 is the 3'-end reverse sequence in SEQ ID NO: 1.

Amplification conditions: 50 μl of KC1, 10 mmol / L Tris-Cl, (pH 8.5.5), 1.5 μg / 1/1 MgCl ₂ , 200 μ mol in a reaction volume of 50 μ 1 / L dNTP, l Opmol primer, 1U Taq DNA polymerase (Clontech). 25 cycles were performed on a PB9600 DNA thermal cycler (Perkin-Elmer) under the following conditions: 94 ° C 30sec; 55. C 30sec; 72. For C 2min ₀ , β-act in was used as a positive control and template blank was used as a negative control at the same time during RT-PCR. The amplified product was purified using a QIAGEN kit, and ligated to a pCR vector (Invitrogen) using a TA cloning kit. DNA sequence analysis results showed that the DM sequence of the PCR product was exactly the same as that of 1-2567bp shown in SEQ ID NO: 1. Example 3: Northern blot analysis of human peroxisome assembly factor-10 gene expression:

Total RM extraction in one step [Anal. Biochem 1987, 162, 156-159]. This method involves acid guanidinium thiocyanate phenol-chloroform extraction. 4M guanidine isothiocyanate-25mM sodium citrate, 0.2M sodium acetate (pH4.0) Tissues were homogenized, 1 volume of phenol and 1/5 volume of chloroform-isoamyl alcohol (49: 1) were added, mixed and centrifuged. Aspirate the aqueous layer, add isopropanol (0.8 vol) and centrifuge the mixture to obtain RNA precipitate. The resulting RNA pellet was washed with 70% ethanol, dried and dissolved in water. Electrophoresis was performed on a 1.2% agarose gel containing 2 mM μ _§ ΙΜ containing 20 mM 3- (N-morpholino) propanesulfonic acid (pH 7.0)-5 mM sodium acetate-1 mM EDTA-2.2M formaldehyde. It was then transferred to a nitrocellulose membrane. Preparation ³² P- DNA probe labeled with a- ³² P dATP by random priming method. The DNA probe used was the PCR amplified human peroxisome assembly factor-10 coding region sequence (119bp to 397bp) shown in FIG. 1. A 32P-labeled probe (approximately 2 x 10 ⁶ cpm / ml) was hybridized with a nitrocellulose membrane to which RNA was transferred at 42 ° C overnight in a solution containing 50% formamide-25mM KH ₂ P0 ₄ (pH 7.4) -5 x SSC-5 x Denhardt's solution and 200 μg / ml salmon sperm DNA. After hybridization, the filter was washed in 1x SSC-G.1% SDS at 55 ° C for 30 min. Then, Phosphor Imager was used for analysis and quantification.

Example 4: In vitro expression, isolation and purification of recombinant human peroxisome assembly factor-10

 Based on SEQ ID NO: 1 and the coding region sequence shown in Figure 1, a pair of specific amplification primers were designed, the sequence is as follows:

Primer3: 5'- CATGCTAGCATGTGGTACATATACAAAATGGAG -3, (Seq ID No: 5) Primer4: 5'- CCCGAATTCTCAGGAGCAGTCCTCTTTTATTATT -3 '(Seq ID No: 6) The 5' ends of these two primers contain Nhel and EcoRI restriction sites, respectively. The coding sequences of the 5 'and ³ ' ends of the gene of interest are followed, respectively. The Nhel and EcoRI restriction sites correspond to the selectivity within the expression vector plasmid pET-28b (+) (Novagen, Cat. No. 69865.3). Digestion site. The pBS-0653g05 plasmid containing the full-length target gene was used as a template for the PCR reaction. The PCR reaction conditions are as follows: a total volume of 50 μ1 contains 10 pg of pBS-0653g05 plasmid, primers? 1 ^ 11161: -3 and? 1 ^ 1116]: -4 points and 1 | ^ 1, Advantage polymerase Mix (Clontech) 1 μ 1. Cycle parameters: 94.C 20s, 60 ° C 30s, 68 ° C 2 min, a total of 25 Recycling. Digestion of the amplified product and plasmid pET-28 (+) with Nhel and EcoRI, respectively, to recover large fragments and ligate them with T4 ligase. The ligation products were transformed by the calcium chloride method of coliform bacteria DH5 α. After the LB plates containing kanamycin (final concentration 30 μg / ml) were cultured overnight, the positive clones were screened by colony PCR method and sequenced. The positive clones with the correct sequence (pET-0653g05) were selected by calcium chloride method. The recombinant plasmid was transformed into E. coli BL21 (DE3) plySs (product of Novagen). In a LB liquid medium containing kanamycin (final concentration 30 μg / ml), the host strain BL21 (pET-0653g05) was at 37 ° C. Cultivate to the logarithmic growth phase, add IPTG to a final concentration of 1 ol / L, and continue the cultivation for 5 hours. Centrifuge the bacterial cells to collect them by centrifugation, sonicate, and collect the supernatant by centrifugation with 6 histidine (6His-Tag ) Binding affinity chromatography column His. Bind Quick Cartridge (product of Novagen company) The purified human protein peroxisome assembly factor-10 was obtained. After SDS-PAGE electrophoresis, a single band was obtained at lOKDa (Figure 2). The band was transferred to a PVDF membrane using the Edams hydrolysis method. Analysis of the N-terminal amino acid sequence, the 15 amino acids at the N-terminus are shown in SEQ ID NO: 2 The N-terminal 15 amino acid residues are identical.

Example 5 Production of anti-human peroxisome assembly factor-10 antibodies

 A peptide synthesizer (product of PE company) was used to synthesize the following human peroxisome assembly factor-10 specific peptides:

NH2-Met-Trp-Tyr-I le-Tyr-Lys-Met-Glu-Tyr-Tyr-Ser-Ala-Val-Lys-Lys-COOH (SEQ ID NO: 7). The peptide was coupled with hemocyanin and bovine serum albumin to form a complex. For the method, see: Avrameas, et al. Imraunochemis try, 1969; 6: 43 „Immunize with 4mg of the hemocyanin peptide complex and complete Freund's adjuvant. For rabbits, 15 days later, use the hemocyanin peptide complex plus incomplete Freund's adjuvant to boost the immunity once. ELISA Use a titration plate coated with 15 g / ml bovine serum albumin peptide complex for ELISA to determine the antibody in rabbit serum. Isolate total IgG from antibody-positive rabbit serum with protein A-Sepharose. _{Bind the} peptide to a cyanogen bromide-activated _{Sepha r0Se} 4B column and isolate anti-peptide antibodies from the total IgG by affinity chromatography The immunoprecipitation method proved that the purified antibody can specifically bind to human peroxisome assembly factor-10. Example 6: Application of the polynucleotide fragment of the present invention as a hybridization probe

 Suitable oligonucleotide fragments selected from the polynucleotides of the present invention are used as hybridization probes in a variety of ways. For example, the probes can be used to hybridize to genomic or cDNA libraries of normal tissue or pathological tissue from different sources to It is determined whether it contains the polynucleotide sequence of the present invention and a homologous polynucleotide sequence is detected. Further, the probe can be used to detect the polynucleotide sequence of the present invention or its homologous polynucleotide sequence in normal tissue or pathology. Whether the expression in tissue cells is abnormal.

The purpose of this embodiment is to select a suitable oligonucleotide fragment from the polynucleotide SEQ ID NO: 1 of the present invention as a hybridization probe, and to identify whether some tissues contain the polynucleoside of the present invention by a filter hybridization method. Acid sequence or a homologous polynucleotide sequence thereof. Filter hybridization methods include dot blotting, Southern blotting, Northern blotting, and copying methods. They all use the same steps of hybridization after fixing the polynucleotide sample to be tested on the filter. These same steps are as follows: The sample-immobilized filter is first pre-hybridized with a probe-free hybridization buffer, so that the non-specific binding site of the sample on the filter is saturated with the carrier and the synthetic polymer. The pre-hybridization solution is then replaced with a hybridization buffer containing the labeled probe and incubated to hybridize the probe to the target nucleic acid. After the hybridization step, the unhybridized probes are removed by a series of membrane washing steps. This embodiment utilizes higher-intensity washing conditions (such as lower salt concentration and higher temperature) to reduce the hybridization background and retain only strong specific signals. The probes used in this embodiment include two types: the first type of probes are oligonucleotide fragments that are completely the same as or complementary to the polynucleotide SEQ ID NO: 1 of the present invention; the second type of probes are partially related to the present invention The polynucleotide SEQ ID NO: 1 is the same or complementary oligonucleotide fragment. In this embodiment, the dot blot method is used to fix the sample on the filter membrane. Under the high-intensity washing conditions, the first type of probe and the sample have the strongest hybridization specificity and are retained. First, the selection of the probe

 The selection of oligonucleotide fragments for use as hybridization probes from the polynucleotide SEQ ID NO: 1 of the present invention should follow the following principles and several aspects to be considered:

1. The preferred range of probe size is 18-50 nucleotides;

2, GC content is 30% -70%, non-specific hybridization increases when it exceeds;

3. There should be no complementary regions inside the probe;

 4. Those that meet the above conditions can be used as primary selection probes, and then further computer sequence analysis, including the primary selection probe and its source sequence region (ie, SEQ ID NO: 1) and other known genomic sequences and their complements The regions are compared for homology. If the homology with the non-target molecular region is greater than 85% or there are more than 15 consecutive bases, the primary probe should not be used;

 5. Whether the preliminary selection probe is finally selected as a probe with practical application value should be further determined by experiments.

 After completing the above analysis, select and synthesize the following two probes: ''

 Probe 1 (probel), which belongs to the first type of probe, is completely homologous or complementary to the gene fragment of SEQ ID NO: 1 (41Nt):

 5- TGTGGTACATATACAAAATGGAGTACTATTCAGCTGTAAAA -3 '(SEQ ID NO: 8)

 Probe 2 (probe2), which belongs to the second type of probe, is equivalent to the replacement mutant sequence (41Nt) of the gene fragment of SEQ ID NO: 1 or its complementary fragment:

 5'- TGTGGTACATATACAAAATGCAGTACTATTCAGCTGTAAAA -3 '(SEQ ID NO: 9) For other commonly used reagents and their preparation methods not related to the following specific experimental procedures, please refer to the literature: DNA PROBES GH Kel ler; Μ · Μ · Manak; Stockton Press , 1989 (USA) and more commonly used molecular cloning laboratory manuals such as "Molecular Cloning Experiment Guide" U998 2nd Edition. [US] Sambrook et al., Science Press.

 Sample Preparation:

 1.Extract DM from fresh or frozen tissue

 Steps: 1) Put fresh or freshly thawed normal liver tissue on ice and hold phosphate buffered saline

(PBS). Cut the tissue into small pieces with scissors or a scalpel. Keep tissue moist during operation. 2) Centrifuge the tissue at 1000g for 10 minutes. 3) Use cold homogenization buffer (0.25mol / L sucrose; 25 ol / L

Tris-HCl, pH 7.5; 25ramol / LnaCl; 25 saol / L MgCl ₂ ) Suspended precipitate (about 10ml / g). 4) Homogenize the tissue suspension at 4 ° C at full speed with an electric homogenizer until the tissue is completely broken. 5) Centrifuge at 1000g for 10 minutes. 6) Resuspend the cell pellet (1-5ml per 0.1 g of the original tissue sample), and centrifuge at 1,000 g

10 minutes. 7) Resuspend the pellet with lysis buffer (add lral per 0.1 g of the initial tissue sample), and then follow the phenol extraction method below. 2, DNA phenol extraction method

Steps: 1) Wash the cells with 1-10ml cold MS and centrifuge at 1000g for 10 minutes. 2) with cold cell lysate pelleted cells were resuspended (1 X 10 ⁸ cells / ml) Minimum application lOOul lysis buffer. 3) Add SDS to a final concentration of 1%. If SDS is directly added to the cell pellet before resuspending the cells, the cells may form large clumps that are difficult to break, and reduce the overall yield. This is particularly serious when extracting> 10 ⁷ cells. 4) Add proteinase K to a final concentration of 200ug / ml. 5) Incubate at 50 ° C for 1 hour or shake gently at 37 ° C overnight. 6) Extract with an equal volume of phenol: chloroform: isoamyl alcohol (25: 24: 1) and centrifuge in a small centrifuge tube for 10 minutes. The two should be clearly separated, otherwise centrifuge again. 7) Transfer the water phase to a new tube. 8) Extract with an equal volume of chloroform: isoamyl alcohol (24: 1) and centrifuge for 10 minutes. 9) Transfer the aqueous phase containing DM to a new tube. The DNA was then purified and ethanol precipitated.

3. Purification and ethanol precipitation of DM

Steps: 1) Add 1/10 volume of 2mol / L sodium acetate and 2 volumes of cold 100% ethanol to the DNA solution and mix. Leave at -20 ° C for 1 hour or overnight. 2) Centrifuge for 10 minutes. 3) Carefully aspirate or pour out the ethanol. 4) Wash the pellet with 500ul of 70% cold ethanol and centrifuge for 5 minutes. 5) Carefully aspirate or pour out the ethanol. Wash the pellet with 500ul of cold ethanol and centrifuge for 5 minutes. 6) Carefully aspirate or pour out the ethanol, then invert on the absorbent paper to drain off the residual ethanol. Air dry for 10-15 minutes to allow the surface ethanol to evaporate. Be careful not to allow the pellet to dry completely, otherwise it will be more difficult to re-dissolve. 7) Resuspend the pellet in a small volume of TE or water. Vortex at low speed or pipette with suction while gradually increasing TE, mix until the DNA is fully lysed, add approximately 1 ul per 1-5 x lO ⁶ cells extracted.

 The following steps 8-13 are only used when contamination must be removed, otherwise step 14 can be performed directly.

8) Add RNase A to the DNA solution to a final concentration of 100ug / ml, and incubate at 37 ° C for 30 minutes. 9) Add SDS and proteinase K to the final concentration of 0.5% and 100ug / ml. Incubate at 37 ° C for 30 minutes. 10) Extract the reaction solution with an equal volume of phenol: chloroform: isoamyl alcohol (25: 24: 1) and centrifuge for 10 minutes. 11) Carefully remove the aqueous phase and re-extract with an equal volume of chloroform: isoamyl alcohol (24: 1) and centrifuge for 10 minutes. 12) Carefully remove the aqueous phase, add 1/10 volume of 2mol / L sodium acetate and 2.5 volumes of cold ethanol, and mix well at -20 ° C for 1 hour. 13) Wash the pellet with 70% ethanol and 100% ethanol, air dry, and resuspend the nucleic acid. The process is the same as steps 3-6. 14) Determine A ₂₆ . And A ₂₈ . To detect the purity and yield of DNA. 15) Store at -20 ° C after dispensing. Preparation of sample film:

 1) Take 4 x 2 pieces of nitrocellulose membrane (NC membrane) of appropriate size, and mark the spotting position and sample number on it with a pencil. Two NC membranes are needed for each probe for later experiments. In the step, the film is washed with high-strength conditions and strength conditions, respectively.

2) Pipette and control 15 μl each, spot on the sample film, and dry at room temperature. 3) Place on filter paper impregnated with 0.1 mol / L NaOH, 1.5 mol / L NaCl for 5 minutes (twice), dry and place on filter paper impregnated with 0.5 mol / L Tris-HCl (H7.0), 3 mol / L NaCl Allow to dry for 5 minutes (twice).

 4) Clamped in clean filter paper, wrapped in aluminum foil, and dried under vacuum at 60-80 ° C for 2 hours.

 Labeling of probes

1) 3 μl Probe (0.10D / 10 μ 1), add 2 μ IKinase buffer, 8-10 uCi y- ³² P-dATP + 2U Kinase, to make up to a final volume of 20 μ 1.

 2) Incubate at 37 ° C for 2 hours.

 3) Add 1/5 volume of Bromophenol Blue Indicator (BPB).

 4) Pass Sephadex G-50 column.

5) Before the ³² P-Probe is washed out, start collecting the first peak (can be monitored by Monitor).

 6) 5 drops / tube, collect 10-15 tubes.

 7) Monitor the amount of isotope with a liquid scintillator

8) were collected after the first peak were combined to prepare the desired ³² P- Probe (second peak as the free γ_ ³² Ρ- dATP) ₀

 Pre-hybridization

The sample film was placed in a plastic bag pre-hybridization solution was added 3-10m _g (10xDenhardt's;. 6xSSC, 0. lmg / ral CT DNA ( the DNA calf thymus)), after a good seal bag 68. C. Water shake for 2 hours.

 Cross

 Cut a corner of the plastic bag, add the prepared probe, seal the bag, and shake at 42 ° C in water overnight. Wash film:

 High-intensity washing film:

 1) Take out the sample membrane of hybridization.

 2) 2xSSC, 0.1% SDS, 40. C Wash for 15 minutes (twice).

 3) 0.1xSSC, 0.1 SDS, 40. C wash for 15 minutes (twice).

 4) In 0.1xSSC, 0.1¾SDS, wash at 55 ° C for 30 minutes (twice), and dry at room temperature. Low-intensity washing film:

 1) Take out the hybridized sample membrane.

 2) 2xSSC, 0. P / oSDS, 37. C wash for 15 minutes (twice).

 3) In 0.1xSSC, 0.1 SDS, wash at 37 ° C for 15 minutes (twice).

4) Wash in 0.1xSSC, 0.1% SDS at 40 ° C for 15 minutes (twice), and dry at room temperature. X-ray auto-development:

 -70 ° C, X-ray autoradiography (pressing time depends on the radioactivity of the hybrid spot).

 Experimental results:

 The hybridization experiments performed under low-intensity membrane washing conditions showed no significant difference in the radioactive intensity of the above two probes. However, in the hybridization experiments performed under high-intensity membrane washing conditions, the radioactive intensity of probe 1 was significantly stronger than that of hybridization spots. The radioactive intensity of the hybridization spot of the other probe. Therefore, the presence and differential expression of the polynucleotide of the present invention in different tissues can be analyzed qualitatively and quantitatively with the probe 1. Example 7 DNA Microarray

 Gene chip or gene microarray (DM Microarray) is a new technology currently being developed by many national laboratories and large pharmaceutical companies. The data is compared and analyzed on a carrier such as silicon using fluorescence detection and computer software to achieve the purpose of rapid, efficient, and high-throughput analysis of biological information. The polynucleotide of the present invention can be used as target DNA for gene chip technology for high-throughput research of new gene functions; search for and screen new tissue-specific genes, especially new genes related to diseases such as tumors; diagnosis of diseases such as hereditary diseases . The specific method steps have been reported in the literature. For example, refer to the literature DeRi si, JL, Lyer, V. & Brown, P. 0. (1997) Sc ience 278, 680-686. And the literature Hel le, RA, Schema , M., Cha i, A., Shalom, D., (1997) PNAS 94: 2150-2155.

 (A) spotting

 A total of 4,000 polynucleotide sequences of various full-length cDNAs are used as target DNA, including the polynucleotide of the present invention. They were amplified by PCR respectively. After purification, the concentration of the amplified product was adjusted to about 500 ng / ul, and spotted on a glass medium with a Cartesian 7500 spotter (purchased from Cartesian Company, USA). The distance between them is 280 μm. The spotted slides were hydrated, dried, and cross-linked in a UV cross-linking instrument. After elution, the DNA was fixed on the glass slide to prepare a chip. The specific method steps have been variously reported in the literature. The post-spotting processing steps of this embodiment are:

 1. Hydration in a humid environment for 4 hours;

 2. 0.2% SDS was washed for 1 minute;

3. Wash twice with ddH ₂ 0 for 1 minute each time;

4. NaBH _{4 is} blocked for 5 minutes;

 5. 95 ° C water for 2 minutes;

6. 0.2% SDS was washed for 1 minute; 7. Rinse twice with ddH ₂ 0;

8. The air dried, 25 ^D C stored in the dark standby.

 (Two) probe marking

 The total mRNA was extracted from the human mixed tissue and specific tissues (or stimulated cell lines) of the body in one step, and the mRNA was purified using Ol igotex mRNA Midi Kit (purchased from QiaGen). The fluorescent reagent Cy 3dUTP (5-Amino-propargy 1-2 '-deoxyur idine 5'-tr iphate coupled to Cy3 f luorescent dye, purchased from Amersham Phamacia Biotech) was used to label mRNA of human mixed tissue, and the fluorescent reagent Cy5dUTP ( 5- Amino- propargyl- 2 '-deoxyur idine 5' -tr iphate coupled to Cy5 f luorescent dye (purchased from Amersham Phamac ia Biotech) to label the mRNA of specific tissues (or stimulated cell lines) of the body and prepare them after purification Probe. For specific steps and methods, see:

 Schena, M., Sha lon, D., Hel ler, R. (1996) Proc. Nat l. Acad. Sci. USA. Vol. 93: 10614- 10619. Schena, M., Sha lon, Dari., Davi s, RW (1995) Science. 270. (20): 467-480.

(Three) cross

 Combine the probes from the two tissues with the chips at UniHyb ™ Hybr idizat ion

Solut ion (purchased from TeleChem) was used for hybridization for 16 hours, and then washed with a washing solution (1 x SSC, 0.2% SDS) at room temperature, and then scanned with a ScanArray 3000 scanner (purchased from General Scanning, USA). The image was processed by Imagene software (Biodi scovery Company, USA) to calculate the Cy3 / Cy5 ratio of each point.

 The above specific tissues (or stimulated cell lines) are thymus, testis, muscle, spleen, lung, skin, thyroid, liver, PMA + Ecv304 cell line, PMA-Ecv304 cell line, non-starved L02 cell line, Arsenic stimulated the L02 cell line and prostate tissue for 1 hour. Based on these 13 Cy3 / Cy5 ratios, a bar graph is drawn. (figure 1 ) . It can be seen from the figure that the expression profile of human peroxisome assembly factor-10 and human peroxisome assembly factor-1 according to the present invention are very similar. Industrial applicability

 The polypeptide of the present invention and the antagonists, agonists and inhibitors of the polypeptide can be directly used in the treatment of diseases, for example, it can treat malignant tumors, adrenal deficiency, skin diseases, various inflammations, HIV infections and immune diseases, etc. .

Peroxisomes are organelles containing one or more oxidases surrounded by a single membrane. Peroxisomes in animal cells are in liver cells or kidney cells, which can oxidize and break down toxic components in the blood, and play a detoxifying role, such as breaking down alcohol. Peroxisomes can also break down high-energy molecules such as fatty acids. Cells provide heat directly and have an effect on glycogenogenesis. Peroxisome assembly factor-1 (PAF-1) is a membrane integrin of peroxisome, which plays an important role in the assembly process of peroxisome.

 The study found. The absence or mutation of the peroxisome assembly factor-1 (PAF-1) will affect the peroxisome assembly, and the absence of such normal catalase-containing particles will lead to a variety of metabolic disorders, For example, β-oxidation of peroxidase and defects in plasmalogen biosynthesis, which cause various diseases, such as Zel lweger syndrome, neonatal adrenal white matter malnutrition, polyneuritis hereditary dyskinesia in infants and young children, and hexahydrogen These genes are genetic disorders that require peroxisome assembly.

 The expression profile of the polypeptide of the present invention is consistent with the expression profile of human peroxisome assembly factor-1, and the two have similar biological functions. It is involved in lipid metabolism, glycogenogenesis in the body, and is important for detoxification of the body. Its abnormal expression is usually related to some metabolic disorders such as Ze l lweger syndrome, neonatal adrenal white matter dystrophy, polyneuritis hereditary ataxia in infants and young children, hexahydropyridinecarboxylic acid hyperacidemia, And the occurrence of tumors in related tissues is closely related and produces related diseases.

 It can be seen that the abnormal expression of human peroxisome assembly factor-10 of the present invention will produce various diseases, especially Zel lweger syndrome, neonatal adrenal white matter dystrophy, and polyneuropathy in infants and young children. , Hexahydropyridinecarboxylic acid hyperacidemia, other embryonic developmental disorders, disorders of growth and development, disorders of material metabolism, various tumors, inflammation, immune diseases, these diseases include but are not limited to:

 Fetal developmental disorders: congenital abortion, cleft palate, limb loss, limb differentiation disorder, hyaline membrane disease, atelectasis, polycystic kidney, cryptorchidism, congenital inguinal hernia, double uterus, vaginal atresia, hypospadias, androgynous Malformation, Atrial septal defect, Ventricular septal defect, Pulmonary stenosis, Arterial duct occlusion, Neural tube defect, Congenital hydrocephalus, Iris defect, Congenital glaucoma or cataract, Congenital deafness Growth and development disorders: Mental retardation, Brain development disorders, skin, fat and muscular dysplasia, bone and joint dysplasia, various metabolic defects, stunting, dwarfism, Cushing syndrome, sexual retardation

 Material metabolism disorders: isovalerate, propionate, methylmalonic aciduria, combined carboxylase deficiency, glutarate type I, phenylketonuria, albinism, galactosemia, Defective fructose metabolism, glycogen storage disease

Tumors of various tissues: gastric cancer, liver cancer, lung cancer, esophageal cancer, breast cancer, leukemia, lymphoma, thyroid tumor, uterine fibroids, neuroblastoma, astrocytoma, ependymoma, glioblastoma, Neurofibromas, colon cancer, melanoma, bladder cancer, uterine cancer, endometrial cancer, colon cancer, thymic tumor, nasopharyngeal cancer, laryngeal cancer, tracheal tumor, fibroma, fibrosarcoma, lipoma, liposarcoma inflammation: Chronic active hepatitis, sarcoidosis, polymyositis, chronic rhinitis, chronic gastritis, cerebrospinal multiple sclerosis, glomerulonephritis, myocarditis, cardiomyopathy, atherosclerosis, gastric ulcer, cervicitis, various Infectious inflammation

 Immune diseases: Systemic lupus erythematosus, rheumatoid arthritis, bronchial asthma, urticaria, specific dermatitis, post-infection myocarditis, scleroderma, myasthenia gravis, Guillain-Barre syndrome, common variable immunodeficiency disease , Primary B-lymphocyte immunodeficiency disease, Acquired immunodeficiency syndrome

 The polypeptide of the present invention and the antagonists, agonists and inhibitors of the polypeptide can be directly used in the treatment of diseases, for example, it can treat various diseases, especially Zel lweger syndrome, neonatal adrenal white matter malnutrition, and polyneuritis in infants and young children. Sexual hereditary dyskinesias, hexahydropyridinecarboxylic acid hyperacidemia, other embryonic developmental disorders, growth disorders, substance metabolism disorders, various tumors, inflammation, immune diseases, etc. The invention also provides methods for screening compounds to identify agents that increase (agonist) or suppress (antagonist) human peroxisome assembly factor-10. Agonists enhance human peroxisome assembly factor-10 to stimulate biological functions such as cell proliferation, while antagonists prevent and treat disorders related to cell proliferation, such as various cancers. For example, mammalian cells or membrane preparations expressing human peroxisome assembly factor -10 can be cultured together with labeled human peroxisome assembly factor -10 in the presence of drugs. The ability of the drug to increase or block this interaction is then determined.

 Antagonists of human peroxisome assembly factor-10 include antibodies, compounds, receptor deletions, and the like that have been screened. Antagonists of human peroxisome assembly factor-10 can bind to human peroxisome assembly factor-10 and eliminate its function, or inhibit the production of the polypeptide, or bind to the active site of the polypeptide so that The polypeptide cannot perform biological functions.

 When screening compounds as antagonists, human peroxisome assembly factor-10 can be added to bioanalytical assays by determining the compound's effect on the interaction between human peroxisome assembly factor-10 and its receptors. Influence to determine if a compound is an antagonist. Receptor deletions and analogs that act as antagonists can be screened in the same manner as described above for screening compounds. Polypeptide molecules capable of binding to human peroxisome assembly factor-10 can be obtained by screening a random peptide library composed of various possible combinations of amino acids bound to a solid phase. In screening, the human peroxisome assembly factor-10 molecule should generally be labeled.

The present invention provides polypeptides, and fragments, derivatives, analogs or cells thereof as antigens. To produce antibodies. These antibodies can be polyclonal or monoclonal antibodies. The invention also provides antibodies against the human peroxisome assembly factor-10 epitope. These antibodies include (but are not limited to): polyclonal antibodies, monoclonal antibodies, chimeric antibodies, single chain antibodies, Fab fragments, and fragments produced by Fab expression libraries.

 Polyclonal antibodies can be produced by injecting human peroxisome assembly factor-10 directly into immunized animals (such as rabbits, mice, rats, etc.). A variety of adjuvants can be used to enhance the immune response, including but not Limited to Freund's adjuvant and the like. Techniques for preparing monoclonal antibodies to human peroxisome assembly factor-10 include, but are not limited to, hybridoma technology (Kohler and Miles in. Nature, 1975, 256: 495-497), triple tumor technology, human beta -Cell hybridoma technology, EBV-hybridoma technology, etc. Chimeric antibodies that combine human constant regions with non-human variable regions can be produced using existing techniques (Morrison et al, PNAS, 1985, 81: 6851) and existing techniques for producing single-chain antibodies (US Pa t No. 4946778) can also be used to produce single chain antibodies against human peroxisome assembly factor-10.

 Antibodies against human peroxisome assembly factor -10 can be used in immunohistochemistry to detect human peroxisome assembly factor-10 in biopsy specimens.

 Monoclonal antibodies that bind to human peroxisome assembly factor-10 can also be labeled with radioisotopes and injected into the body to track their location and distribution. This radiolabeled antibody can be used as a non-invasive diagnostic method to locate tumor cells and determine whether there is metastasis.

 Antibodies can also be used to design immunotoxins that target a particular part of the body. For example, human peroxisome assembly factor-10 high affinity monoclonal antibodies can covalently bind to bacterial or plant toxins (such as diphtheria toxin, ricin, ormosine, etc.). A common method is to attack the amino group of an antibody with a thiol cross-linking agent such as SPDP and bind the toxin to the antibody through the exchange of disulfide bonds. This hybrid antibody can be used to kill the human peroxisome assembly factor- 10 positive cells.

 The antibodies of the present invention can be used to treat or prevent diseases related to human peroxisome assembly factor-10. Administration of an appropriate dose of antibody can stimulate or block the production or activity of human peroxisome assembly factor-10.

 The invention also relates to a diagnostic test method for quantitative and localized detection of human peroxisome assembly factor-10 levels. These tests are well known in the art and include FISH assays and radioimmunoassays. The level of human peroxisome assembly factor-10 detected in the test can be used to explain the importance of human peroxisome assembly factor-10 in various diseases and to diagnose human peroxisome assembly Factor-10 disease.

The polypeptide of the present invention can also be used for peptide mapping analysis. For example, the polypeptide can be specifically cleaved by physical, chemical or enzymatic analysis, and subjected to one-dimensional or two-dimensional or three-dimensional gel electrophoresis analysis, and more preferably mass spectrometry analysis. Analysis.

 The polynucleotide encoding human peroxisome assembly factor-10 can also be used for a variety of therapeutic purposes. Gene therapy technology can be used to treat abnormal cell proliferation, development, or metabolism caused by the non-expression or abnormal / inactive expression of human peroxisome assembly factor-10. Recombinant gene therapy vectors (such as viral vectors) can be designed to express mutated human peroxisome assembly factor -10 to inhibit endogenous human peroxisome assembly factor -10 activity. For example, a mutated human peroxisome assembly factor-10 may be a shortened human peroxisome assembly factor-10 that lacks a signaling domain, although it can bind to downstream substrates, but Lack of signaling activity. Therefore, the recombinant gene therapy vector can be used for treating diseases caused by abnormal expression or activity of human peroxisome assembly factor-10. Virus-derived expression vectors such as retrovirus, adenovirus, adenovirus-associated virus, herpes simplex virus, parvovirus, etc. can be used to transfer a polynucleotide encoding human peroxisome assembly factor-10 into cells. Methods for constructing recombinant viral vectors carrying a polynucleotide encoding human peroxisome assembly factor-10 can be found in the literature (Sambrook, et al.). In addition, a recombinant polynucleotide encoding human peroxisome assembly factor-10 can be packaged into liposomes and transferred into cells.

 Methods for introducing a polynucleotide into a tissue or cell include: directly injecting the polynucleotide into a tissue in vivo; or introducing the polynucleotide into a cell in vitro through a vector (such as a virus, phage, or plasmid), and then transplanting the cell Into the body and so on.

 Oligonucleotides (including antisense RM and DNA) and ribozymes that inhibit human peroxisome assembly factor-10 mRNA are also within the scope of the present invention. A ribozyme is an enzyme-like RNA molecule that specifically decomposes a specific MA. Its mechanism of action is that the ribozyme molecule specifically hybridizes with a complementary target RM to perform endonucleation. Antisense RNA, DNA, and ribozymes can be obtained using any existing RNA or DNA synthesis technology, such as solid-phase phosphoramidite chemical synthesis to synthesize oligonucleotides. Antisense RNA molecules can be obtained by in vitro or in vivo transcription of a DNA sequence encoding the RNA. This DNA sequence has been integrated downstream of the vector's RNA polymerase promoter. In order to increase the stability of the nucleic acid molecule, it can be modified in a variety of ways, such as increasing the sequence length on both sides, and the linkage between ribonucleosides using phosphate thioester or peptide bonds instead of phosphodiester bonds.

The polynucleotide encoding human peroxisome assembly factor-10 can be used for the diagnosis of diseases related to human peroxisome assembly factor-10. The polynucleotide encoding human peroxisome assembly factor-10 can be used to detect the expression of human peroxisome assembly factor-10 or the abnormality of human peroxisome assembly factor-10 in a disease state. expression. For example, the DM sequence encoding human peroxisome assembly factor-10 can be used to hybridize biopsy specimens to determine the expression of human peroxisome assembly factor-10. Hybridization techniques include Southern blotting, Nor thern blotting, in situ hybridization, and the like. These technical methods Both are publicly available mature technologies and related kits are commercially available. Some or all of the polynucleotides of the present invention can be used as probes to be fixed on a microarray or a DNA chip (also referred to as a "gene chip") for analyzing differential expression analysis and gene diagnosis of genes in tissues. Human peroxisome assembly factor-10 specific primers for RNA-polymerase chain reaction (RT-PCR) in vitro amplification can also detect human peroxisome assembly factor-10 transcription products.

 Detection of mutations in the human peroxisome assembly factor-10 gene can also be used to diagnose human peroxisome assembly factor-10-related diseases. Human peroxisome assembly factor-10 mutations include point mutations, translocations, deletions, recombinations, and any other abnormalities compared to the normal wild-type human peroxisome assembly factor-10 DNA sequence. Mutations can be detected using existing techniques such as Southern blotting, DNA sequence analysis, PCR and in situ hybridization. In addition, mutations may affect protein expression. Therefore, Northern blotting and Western blotting can be used to indirectly determine whether a gene is mutated.

 The sequences of the invention are also valuable for chromosome identification. The sequence specifically targets a specific position on a human chromosome and can hybridize to it. Currently, specific sites for each gene on the chromosome need to be identified. Currently, only a few chromosome markers based on actual sequence data (repeating polymorphisms) are available for marking chromosome positions. According to the present invention, in order to associate these sequences with disease-related genes, an important first step is to locate these DNA sequences on a chromosome.

 In short, PCR primers (preferably 15-35bp) are prepared based on cDNA, and the sequences can be located on chromosomes. These primers were then used for PCR screening of somatic hybrid cells containing individual human chromosomes. Only those heterozygous cells containing the human gene corresponding to the primer will produce amplified fragments.

 PCR localization of somatic hybrid cells is a quick way to localize DNA to specific chromosomes. Using the oligonucleotide primers of the present invention, in a similar manner, a set of fragments from a specific chromosome or a large number of genomic clones can be used to achieve sublocalization. Other similar strategies that can be used for chromosomal localization include in situ hybridization, chromosome pre-screening with labeled flow sorting, and pre-selection of hybridization to construct chromosome-specific cDNA libraries.

 Fluorescent in situ hybridization (FISH) of cDNA clones with metaphase chromosomes allows precise chromosomal localization in one step. For a review of this technique, see Verma et al., Human Chromosomes: a Manua l of Basic Techniques, Pergamon Pres s, New York (1988).

Once the sequence is located at the exact chromosomal location, the physical location of the sequence on the chromosome can be correlated with the genetic map data. These data can be found in, for example, V. Mckusick, Mendeliaia Inheritance in Man (available online with Johns Hopkins University Wetch Medical Library). Linkage analysis can then be used to determine the relationship between genes and diseases that are mapped to chromosomal regions. Next, the CDM or genomic sequence differences between the affected and unaffected individuals need to be determined. If a mutation is observed in some or all diseased individuals and the mutation is not observed in any normal individuals, the mutation may be the cause of the disease. Comparing affected and unaffected individuals usually involves first looking for structural changes in the chromosome, such as deletions or translocations that are visible at the chromosomal level or detectable using cDNA sequence-based PCR. According to the resolution capabilities of current physical mapping and gene mapping technology, the cDNA accurately mapped to the disease-related chromosomal region can be one of 50 to 500 potentially pathogenic genes (assuming 1 megabase mapping) Resolving power and each 20kb corresponds to a gene).

 The polypeptides, polynucleotides and mimetics, agonists, antagonists and inhibitors of the present invention can be used in combination with a suitable pharmaceutical carrier. These carriers can be water, glucose, ethanol, salts, buffers, glycerol, and combinations thereof. The composition comprises a safe and effective amount of the polypeptide or antagonist, and carriers and excipients which do not affect the effect of the drug. These compositions can be used as drugs for the treatment of diseases.

 The invention also provides a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the invention. Along with these containers, there may be instructional instructions given by government agencies that manufacture, use, or sell pharmaceuticals or biological products, which prompts permission for administration on the human body by government agencies that produce, use, or sell. In addition, the polypeptides of the invention can be used in combination with other therapeutic compounds.

 The pharmaceutical composition can be administered in a convenient manner, such as by a topical, intravenous, intraperitoneal, intramuscular, subcutaneous, intranasal or intradermal route of administration. Human peroxisome assembly factor-10 is administered in an amount effective to treat and / or prevent a specific indication. The amount and range of human peroxisome assembly factor-10 to be administered to a patient will depend on many factors, such as the mode of administration, the health conditions of the person to be treated, and the judgment of the diagnostician.

Claims

Claim

1. An isolated polypeptide-human peroxisome assembly factor-10, characterized in that it comprises: a polypeptide having the amino acid sequence shown in SEQ ID NO: 2, or an active fragment, analog, or derivative thereof Thing.

2. The polypeptide according to claim 1, characterized in that the amino acid sequence of the polypeptide, analog or derivative has at least 95% identity with the amino acid sequence shown in SEQ ID NO: 2.

 3. The polypeptide according to claim 2, characterized in that it comprises a polypeptide having the amino acid sequence shown in SEQ ID NO: 2.

 4. An isolated polynucleotide, characterized in that said polynucleotide comprises one selected from the group consisting of: (a) encoding a polypeptide having the amino acid sequence shown in SEQ ID NO: 2 or a fragment thereof, or an analog thereof; Polynucleotides of derivatives;

 (b) a polynucleotide complementary to polynucleotide (a); or

 (c) a polynucleotide that is at least 70% identical to) or (b).

 5. The polynucleotide according to claim 4, wherein the polynucleotide comprises a polynucleotide encoding an amino acid sequence represented by SEQ ID NO: 2. '

 6. The polynucleotide according to claim 4, characterized in that the sequence of the polynucleotide comprises the sequence of positions 119-397 in SEQ ID NO: 1 or the sequence of positions 1-2567 in SEQ ID NO: 1 .

 7. A recombinant vector containing an exogenous polynucleotide, characterized in that it is a recombinant constructed from the polynucleotide according to any one of claims 4 to 6 and a plasmid, virus or vector expression vector Carrier.

 8. A genetically engineered host cell containing an exogenous polynucleotide, characterized in that it is selected from one of the following host cells:

 (a) a host cell transformed or transduced with the recombinant vector of claim 7; or

 (b) a host cell transformed or transduced with the polynucleotide according to any one of claims 4-6.

 9. A method for preparing a polypeptide having human peroxisome assembly factor-10 activity, characterized in that the method includes:

 (a) culturing the engineered host cell according to claim 8 under conditions that express human peroxisome assembly factor-10;

 (b) isolating a polypeptide having human peroxisome assembly factor-10 activity from the culture.

10. An antibody capable of binding to a polypeptide, characterized in that said antibody is an antibody capable of specifically binding to human peroxisome assembly factor-10.

11. A class of compounds that mimic or regulate the activity or expression of a polypeptide, characterized in that they are compounds that mimic, promote, antagonize or inhibit the activity of human peroxisome assembly factor-10.

 12. The compound according to claim 11, characterized in that it is an antisense sequence of a polynucleotide sequence or a fragment thereof as shown in SEQ ID NO: 1.

13. Use of the compound according to claim 11, characterized in that the compound is used for a method for regulating the activity of human peroxisome assembly factor-10 in vivo and in vitro.

 14. A method for detecting a disease or disease susceptibility related to the polypeptide according to any one of claims 1-3, characterized in that it comprises detecting the expression level of the polypeptide, or detecting the polypeptide Or detecting a nucleotide variation in a polynucleotide that causes abnormal expression or activity of the polypeptide.

15. Use of a polypeptide according to any one of claims 1-3, characterized in that it is used for screening mimetics, agonists, antagonists or inhibitors of human peroxisome assembly factor-10; Or used for peptide fingerprint identification.

 16. The use of a nucleic acid molecule according to any one of claims 4-6, characterized in that it is used as a primer for a nucleic acid amplification reaction, or as a probe for a hybridization reaction, or for manufacturing a gene chip Or microarray.

 17. Use of a polypeptide, polynucleotide or compound as claimed in any one of claims 1-6 and 11, characterized in that said polypeptide, polynucleotide or mimetic, agonist, antagonist The agent or inhibitor is composed of a safe and effective dose with a pharmaceutically acceptable carrier as a pharmaceutical composition for diagnosing or treating a disease associated with abnormalities of human peroxisome assembly factor-10.

18. Use of a polypeptide, polynucleotide or compound according to any one of claims 1-6 and 11, characterized in that said polypeptide, polynucleotide or compound is used for preparing for treating malignant tumors, blood, etc. Disease, HIV infection and immune diseases and drugs of various inflammations.