WO2001075051A2 - A novel polypeptide, a human stroma antigen 3 protein 17 and the polynucleotide encoding the polypeptide - Google Patents
A novel polypeptide, a human stroma antigen 3 protein 17 and the polynucleotide encoding the polypeptide Download PDFInfo
- Publication number
- WO2001075051A2 WO2001075051A2 PCT/CN2001/000496 CN0100496W WO0175051A2 WO 2001075051 A2 WO2001075051 A2 WO 2001075051A2 CN 0100496 W CN0100496 W CN 0100496W WO 0175051 A2 WO0175051 A2 WO 0175051A2
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- polypeptide
- protein
- polynucleotide
- human matrix
- matrix antigen
- Prior art date
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/52—Cytokines; Lymphokines; Interferons
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
Definitions
- the present invention belongs to the field of biotechnology. Specifically, the present invention describes a novel polypeptide, human matrix antigen 3 protein 17 and a polynucleotide sequence encoding the polypeptide. The invention also relates to a preparation method and application of the polynucleotide and the polypeptide.
- Meiosis is a special type of mitosis.
- Spermatogonial or oogonium cells undergo one DNA synthesis, two consecutive cell divisions, and finally form four sperm or one egg.
- the chromosome multiple is halved to n.
- sperm-egg fusion 2 ⁇ cells are formed.
- the characteristic of meiosis is that there is a long first meiosis interval, and the elderly can reach decades.
- fine-line agglutination homologous chromosomes in even-line phase pair, recognize each other, and join together through associations to form bivalents.
- the formation of association complexes plays a key role.
- the chromosomes associated with each other have four chromatids, called tetrads.
- the thick-line chromosomes are significantly shortened, and homologous chromosomes exchange DNA fragments through synaptic complexes and recombination knots.
- the terminal chromosomes are further agglutinated and crossed to the ends, which is called termination.
- Matrix antigen 3 (STAG 3) is a new gene encoding a protein that participates in chromosome pairing during meiosis. It encodes a matrix antigen 3 protein that is a nuclear protein.
- the human matrix antigen 3 protein is located on human chromosome 4, Described next to the site of Wi lli ams-Beu ren syndrome on chromosome 4, the deletion of this chromosome can cause diseases such as Wi 1 1 ams-Beuren syndrome.
- the new matrix antigen 3 protein of the present invention and the human matrix antigen 3 protein have 851 ⁇ 2 identity and 90% similarity at the protein level, and have similar biological functions.
- the molecular weight is 17, so it is named human matrix antigen 3 Protein 1 7.
- Abnormal expression of this protein will cause abnormal chromosome pairing during meiosis, thereby causing chromosomal deletion or mutation associated with it, and causing diseases such as Wi l l ams-Beuren syndrome.
- human matrix antigen 3 protein 17 protein plays an important role in regulating important functions of the body such as cell division and embryonic development, and it is believed that a large number of proteins are involved in these regulatory processes. There is a continuing need in the art to identify more human matrix antigen 3 protein 17 proteins involved in these processes, and in particular the amino acid sequence of such proteins.
- the isolation of the new human matrix antigen 3 protein 17 protein encoding gene also provides a basis for the study to determine the role of this protein in health and disease states. This protein may form the basis for the development of diagnostic and / or therapeutic drugs for diseases, so it is important to isolate its coding DNA.
- An object of the present invention is to provide an isolated novel polypeptide, human matrix antigen 3 protein 17 and fragments, analogs and derivatives thereof.
- Another object of the invention is to provide a polynucleotide encoding the polypeptide.
- Another object of the present invention is to provide a recombinant vector containing a polynucleotide encoding a human matrix antigen 3 protein 17.
- Another object of the present invention is to provide a genetically engineered host cell containing a polynucleotide encoding a human matrix antigen 3 protein 17.
- Another object of the present invention is to provide a method for producing human matrix antigen 3 protein 17.
- Another object of the present invention is to provide antibodies against the human matrix antigen 3 protein 17 of the polypeptide of the present invention.
- Another object of the present invention is to provide mimic compounds, antagonists, agonists, and inhibitors against the polypeptide of the present invention, human matrix antigen 3 protein 17.
- Another object of the present invention is to provide a method for diagnosing and treating diseases associated with abnormalities of human matrix antigen 3 protein 17. Fat. Mingzhe. To
- the present invention relates to an isolated polypeptide, which is of human origin, and includes: a polypeptide having the amino acid sequence of SEQ ID D. 2, or a conservative variant, biologically active fragment, or derivative thereof.
- the polypeptide is a polypeptide having the amino acid sequence of SEQ ID NO: 2.
- the invention also relates to an isolated polynucleotide comprising a nucleotide sequence or a variant thereof selected from the group consisting of:
- the sequence of the polynucleotide is one selected from the group consisting of: (a) a sequence having positions 239-691 in SEQ ID NO: 1; and (b) a sequence having positions 1-980 in SEQ ID NO: 1 Sequence of bits.
- the invention further relates to a vector, in particular an expression vector, containing the polynucleotide of the invention; a host cell genetically engineered with the vector, including a transformed, transduced or transfected host cell; and a method comprising culturing said Host cell and method of preparing the polypeptide of the present invention by recovering the expression product.
- the invention also relates to an antibody capable of specifically binding to a polypeptide of the invention.
- the invention also relates to a method for screening compounds that mimic, activate, antagonize or inhibit the activity of human matrix antigen 3 protein 17 protein, which comprises using the polypeptide of the invention.
- the invention also relates to compounds obtained by this method.
- the invention also relates to a method for detecting a disease or disease susceptibility related to abnormal expression of human matrix antigen 3 protein 17 protein in vitro, which comprises detecting a mutation in the polypeptide or a polynucleotide sequence encoding the same in a biological sample, or detecting The amount or biological activity of a polypeptide of the invention in a biological sample.
- the invention also relates to a pharmaceutical composition
- a pharmaceutical composition comprising a polypeptide of the invention or a mimetic thereof, an activator, an antagonist or an inhibitor, and a pharmaceutically acceptable carrier.
- the present invention also relates to the use of the polypeptide and / or polynucleotide of the present invention for the preparation of a medicament for treating cancer, developmental disease or immune disease or other diseases caused by abnormal expression of human matrix antigen 3 protein 17.
- Fig. 1 is a comparison diagram of amino acid sequence homology of human matrix antigen 3 protein 17 and human matrix antigen 3 protein of the present invention.
- the upper sequence is human matrix antigen 3 protein 17 and the lower sequence is human matrix antigen 3 protein.
- Identical amino acids are represented by single-character amino acids between the two sequences, and similar amino acids are represented by "+”.
- Figure 2 is a polyacrylamide gel electrophoresis image (SDS-PAGE) of human matrix antigen 3 protein 17 isolated.
- UKDa is the molecular weight of the protein.
- the arrow indicates the isolated protein band.
- Nucleic acid sequence refers to an oligonucleotide, a nucleotide or a polynucleotide and a fragment or part thereof, and may also refer to a genomic or synthetic DNA or RM, they can be single-stranded or double-stranded, representing the sense or antisense strand.
- amino acid sequence refers to an oligopeptide, peptide, polypeptide or protein sequence and fragments or portions thereof Minute.
- amino acid sequence in the present invention relates to the amino acid sequence of a naturally occurring protein molecule, such "polypeptide” or “protein” does not mean to limit the amino acid sequence to a complete natural amino acid related to the protein molecule .
- a “variant" of a protein or polynucleotide refers to an amino acid sequence having one or more amino acids or nucleotide changes or a polynucleotide sequence encoding it.
- the changes may include deletions, insertions or substitutions of amino acids or nucleotides in the amino acid sequence or nucleotide sequence.
- Variants can have "conservative" changes, in which the amino acid substituted has a structural or chemical property similar to the original amino acid, such as replacing isoleucine with leucine.
- Variants can also have non-conservative changes, such as replacing glycine with tryptophan.
- “Deletion” refers to the deletion of one or more amino acids or nucleotides in an amino acid sequence or nucleotide sequence.
- Insertion means that a change in the amino acid sequence or nucleotide sequence results in an increase in one or more amino acids or nucleotides compared to a molecule that exists in nature.
- Replacement refers to the replacement of one or more amino acids or nucleotides with different amino acids or nucleotides.
- Bioactivity refers to a protein that has the structure, regulation, or biochemical function of a natural molecule.
- immunologically active refers to the ability of natural, recombinant or synthetic proteins and fragments thereof to induce a specific immune response and to bind specific antibodies in a suitable animal or cell.
- An "agonist” refers to a molecule that, when bound to human matrix antigen 3 protein 17, causes a change in the protein to regulate the activity of the protein.
- An agonist may include a protein, a nucleic acid, a carbohydrate, or any other molecule that binds human matrix antigen 3 protein 17.
- Antagonist refers to a molecule that can block or regulate the biological or immunological activity of human matrix antigen 3 protein 17 when combined with human matrix antigen 3 protein 17.
- Antagonists and inhibitors can include proteins, nucleic acids, carbohydrates or any other molecule that can bind to human matrix antigen 3 protein 17.
- Regular refers to a change in the function of human matrix antigen 3 protein 17, including an increase or decrease in protein activity, a change in binding characteristics, and any other biological, functional, or immune properties of human matrix antigen 3 protein 17.
- substantially pure means substantially free of other proteins, lipids, sugars or other substances with which it is naturally associated.
- Those skilled in the art can purify human matrix antigen 3 protein 17 using standard protein purification techniques.
- Substantially pure human matrix antigen 3 protein 17 produces a single main band on a non-reducing polyacrylamide gel.
- the purity of human matrix antigen 3 protein 17 polypeptide can be analyzed by amino acid sequence.
- Complementary refers to polynucleotides that naturally bind through base-pairing under conditions of acceptable salt concentration and temperature.
- sequence "CTG-A” can be combined with the complementary sequence "GA-C-T”.
- the complementarity between two single-stranded molecules may be partial or complete.
- the degree of complementarity between nucleic acid strands has a significant effect on the efficiency and strength of hybridization between nucleic acid strands.
- “Homology” refers to the degree of complementarity and can be partially homologous or completely homologous.
- Partial homology refers to a partially complementary sequence that at least partially inhibits hybridization of a fully complementary sequence to a target nucleic acid. This inhibition of hybridization can be detected by performing hybridization (Southern imprinting or Nor thern blotting, etc.) under conditions of reduced stringency.
- Substantially homologous sequences or hybridization probes can compete and inhibit the binding of fully homologous sequences to the target sequence under conditions of reduced stringency. This does not mean that the conditions of reduced stringency allow non-specific binding, because the conditions of reduced stringency require that the two sequences bind to each other as a specific or selective interaction.
- Percent identity refers to the percentage of sequences that are identical or similar in the comparison of two or more amino acid or nucleic acid sequences. The percent identity can be determined electronically, such as by the MEGALIGN program (Lasergene sof tware package, DNASTAR, Inc., Mad Son Wis.). The MEGALIGN program can compare two or more sequences according to different methods, such as the Clus ter method (Higgins, DG and PM Sharp (1988) Gene 73: 237-244). 0 The Clus ter method checks all pairs The distances of each group are arranged into clusters. The clusters are then assigned in pairs or groups. The percent identity between two amino acid sequences, such as sequence A and sequence B, is calculated by the MEGALIGN program (Lasergene sof tware package, DNASTAR, Inc., Mad Son Wis.). The MEGALIGN program can compare two or more sequences according to different methods, such as the Clus ter method (Higgins, DG and PM Sharp (1988) Gene 73: 2
- the number of residues in sequence ⁇ 4-the number of spacer residues in sequence ⁇ -the number of spacer residues X in sequence 3 can also be determined by the Cluster method or by methods known in the art such as Jotun He in Percentage (He in L, (1990) Methods in emzumo logy 183: 625-645) 0
- Similarity refers to the degree of identical or conservative substitutions of amino acid residues at corresponding positions in the alignment of amino acid sequences.
- Amino acids used for conservative substitution for example, negatively charged amino acids may include aspartic acid and glutamic acid; positively charged amino acids may include lysine and arginine; having an uncharged head group is Similar hydrophilic amino acids may include leucine, isoleucine and valine; glycine and alanine; asparagine and glutamine; serine and threonine; phenylalanine and tyrosine.
- Antisense refers to a nucleotide sequence that is complementary to a particular DNA or RNA sequence.
- Antisense strand refers to a nucleic acid strand that is complementary to a “sense strand.”
- Derivative refers to HFP or a chemical modification of its nucleic acid. This chemical modification may be the replacement of a hydrogen atom with an alkyl, acyl or amino group. Nucleic acid derivatives can encode polypeptides that retain the main biological properties of natural molecules.
- Antibody refers to a complete antibody molecule and its fragments, such as Fa,? ( ⁇ ') 2 and? , which can be specific Antigenic determinants that sexually bind to human matrix antigen 3 protein 17.
- a “humanized antibody” refers to an antibody in which the amino acid sequence of a non-antigen binding region is replaced to become more similar to a human antibody, but still retains the original binding activity.
- isolated refers to the removal of a substance from its original environment (for example, its natural environment if it is naturally occurring).
- a naturally-occurring polynucleotide or polypeptide is not isolated when it is present in a living thing, but the same polynucleotide or polypeptide is separated from some or all of the substances that coexist with it in the natural system.
- Such a polynucleotide may be part of a certain vector, or such a polynucleotide or polypeptide may be part of a certain composition. Since the carrier or composition is not part of its natural environment, they are still isolated.
- isolated refers to the separation of a substance from its original environment (if it is a natural substance, the original environment is the natural environment).
- polynucleotides and polypeptides in a natural state in a living cell are not isolated and purified, but the same polynucleotides or polypeptides are separated and purified if they are separated from other substances in the natural state .
- isolated human matrix antigen 3 protein 17 means that human matrix antigen 3 protein 17 is substantially free of other proteins, lipids, sugars, or other substances with which it is naturally associated. Those skilled in the art can purify human matrix antigen 3 protein 17 using standard protein purification techniques. Substantially pure polypeptides can produce a single main band on a non-reducing polyacrylamide gel. The purity of the human matrix antigen 3 protein 17 peptide can be analyzed by amino acid sequence.
- the present invention provides a new polypeptide, human matrix antigen 3 protein 17, which basically consists of the amino acid sequence shown in SEQ ID NO: 2.
- the polypeptide of the present invention may be a recombinant polypeptide, a natural polypeptide, or a synthetic polypeptide, and preferably a recombinant polypeptide.
- the polypeptides of the invention can be naturally purified products, or chemically synthesized products, or can be produced from prokaryotic or eukaryotic hosts (eg, bacteria, yeast, higher plants, insects, and mammalian cells) using recombinant techniques.
- polypeptide of the invention may be glycosylated, or it may be non-glycosylated.
- the polypeptides of the invention may also include or exclude the initial methionine residue.
- the invention also includes fragments, derivatives and analogs of human matrix antigen 3 protein 17.
- fragment refers to a polypeptide that substantially maintains the same biological function or activity of the human matrix antigen 3 protein 17 of the present invention.
- a fragment, derivative or analog of the polypeptide of the present invention may be: (I) a kind in which one or more amino acid residues are substituted with conservative or non-conservative amino acid residues (preferably conservative amino acid residues), and the substitution
- the amino acid may or may not be encoded by a genetic codon; or ( ⁇ ) a type in which a group on one or more amino acid residues is replaced by another group to include a substituent; or ( ⁇ ⁇ )
- Such a kind of The mature polypeptide is fused with another compound (such as a compound that prolongs the half-life of the polypeptide, such as polyethylene glycol); or (IV) such a polypeptide sequence (such as a leader sequence) formed by fusing an additional amino acid sequence into a mature polypeptide Or secreted sequences or sequences used to purify this polypeptide or protease sequences).
- another compound such as a compound that prolongs the half-life of the polypeptide, such as polyethylene glycol
- the present invention provides an isolated nucleic acid (polynucleotide), which basically consists of a polynucleotide encoding a polypeptide having the amino acid sequence of SEQ ID NO: 2.
- the polynucleotide sequence of the present invention includes the nucleotide sequence of SEQ ID NO: 1.
- the polynucleotide of the present invention is found from a cDNA library of human fetal brain tissue. It contains a full-length polynucleotide sequence of 980 bases, and its open reading frame 2 39-691 encodes 150 amino acids. According to the amino acid sequence homology comparison, it was found that this polypeptide has 85% homology with human matrix antigen 3 protein, and it can be deduced that the human matrix antigen 3 protein 17 has similar structure and function to human matrix antigen 3 protein.
- the polynucleotide of the present invention may be in the form of DNA or RM.
- DM forms include cDNA, genomic DNA, or synthetic DNA.
- DNA can be single-stranded or double-stranded.
- DM can be coded or non-coded.
- the coding region sequence encoding the mature polypeptide may be the same as the coding region sequence shown in SEQ ID NO: 1 or a degenerate variant.
- a "degenerate variant" refers to a nucleic acid sequence encoding a protein or polypeptide having SEQ ID NO: 2 but different from the coding region sequence shown in SEQ ID NO: 1 in the present invention.
- the polynucleotide encoding the mature polypeptide of SEQ ID NO: 2 includes: only the coding sequence of the mature polypeptide; the coding sequence of the mature polypeptide and various additional coding sequences; the coding sequence of the mature polypeptide (and optional additional coding sequences); Coding sequence.
- polynucleotide encoding a polypeptide refers to a polynucleotide comprising the polypeptide and a polynucleotide comprising additional coding and / or non-coding sequences.
- the invention also relates to variants of the polynucleotides described above, which encode polypeptides or fragments, analogs and derivatives of polypeptides having the same amino acid sequence as the invention.
- Variants of this polynucleotide can be naturally occurring allelic variants or non-naturally occurring variants. These nucleotide variants include substitution variants, deletion variants, and insertion variants.
- an allelic variant is an alternative form of a polynucleotide that may be a substitution, deletion, or insertion of one or more nucleotides, but does not substantially change the function of the polypeptide it encodes .
- the invention also relates to a polynucleotide that hybridizes to the sequence described above (having at least 50%, preferably 70% identity between the two sequences).
- the invention particularly relates to polynucleotides that can hybridize to the polynucleotides of the invention under stringent conditions.
- “strict conditions” means: (1) in the lower Hybridization and elution at ionic strength and higher temperature, such as 0.2xSSC, 0.1% SDS, 6 (TC; or (2) hybridization with a denaturant, such as 501 ⁇ 2 (v / v) formamide, 0.1% calf Serum / 0.1% Ficoll, 42 ° C, etc .; or (3) hybridization occurs only when the identity between the two sequences is at least 95% or more, and more preferably 97% or more.
- the polypeptide encoded by the glycoside has the same biological function and activity as the mature polypeptide shown in SEQ ID NO: 2.
- nucleic acid fragments that hybridize to the sequences described above.
- a "nucleic acid fragment” contains at least 10 nucleotides in length, preferably at least 20-30 nucleotides, more preferably at least 50-60 nucleotides, and most preferably at least 100 cores. Glycylic acid or more. Nucleic acid fragments can also be used in nucleic acid amplification techniques (such as PCR) to identify and / or isolate polynucleotides encoding human matrix antigen 3 protein 17.
- polypeptides and polynucleotides in the present invention are preferably provided in an isolated form and are more preferably purified to homogeneity.
- the specific polynucleotide sequence encoding the human matrix antigen 3 protein 17 of the present invention can be obtained by various methods.
- polynucleotides are isolated using hybridization techniques well known in the art. These techniques include, but are not limited to: 1) hybridization of probes to genomic or cDNA libraries to detect homologous polynucleotide sequences, and 2) antibody screening of expression libraries to detect cloned polynucleosides with common structural characteristics Acid fragments.
- the DNA fragment sequence of the present invention can also be obtained by the following methods: 1) isolating the double-stranded DM sequence from the DM of the genome; 2) chemically synthesizing the DM sequence to obtain the double-stranded DNA of the polypeptide.
- genomic DNA isolation is the least commonly used. Direct chemical synthesis of DM sequences is often the method of choice.
- the more commonly used method is the isolation of cDNA sequences.
- the standard method for isolating the cDNA of interest is to isolate mRNA from donor cells that overexpress the gene and perform reverse transcription to form a plasmid or phage cDNA library.
- Various methods have been used to extract mRNA, and kits are also commercially available (Qiagene).
- the construction of cDNA libraries is also a common method (Sambrook, et al., Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory. New York, 1989).
- Commercially available cDNA libraries are also available, such as different cDNA libraries from Clontech. When polymerase reaction technology is used in combination, even very small expression products can be cloned.
- genes of the present invention can be selected from these cDNA libraries by conventional methods. These methods include (but are not limited to): (l) DNA-DNA or DNA-RNA hybridization; (2) the presence or absence of marker gene functions; (3) measuring the level of human matrix antigen 3 protein 17 transcripts; (4) ) Detection of protein products expressed by genes through immunological techniques or determination of biological activity. The above methods can be used singly or in combination.
- the probe used for hybridization is homologous to any part of the polynucleotide of the present invention, and its length is at least 10 nucleotides, preferably at least 30 nucleotides, more preferably At least 50 nucleotides, preferably at least 100 nucleotides.
- the length of the probe is usually within 2000 nucleotides, preferably within 1000 nucleotides.
- the probes used here are typically the genes of the invention Sequence information is based on chemically synthesized DNA sequences. The genes or fragments of the present invention can of course be used as probes.
- DM probes can be labeled with radioisotopes, luciferin, or enzymes (such as alkaline phosphatase).
- immunohistochemical techniques such as Western blotting, radioimmunoprecipitation, and enzyme-linked immunosorbent assay (ELISA) can be used to detect protein products expressed by the human matrix antigen 3 protein 17 gene.
- ELISA enzyme-linked immunosorbent assay
- a method of applying a PCR technique to amplify DNA / RNA is preferably used to obtain the gene of the present invention.
- the RACE method RACE-rapid cDNA end rapid amplification method
- the primers used for PCR can be appropriately based on the polynucleotide sequence information of the present invention disclosed herein. Select and synthesize using conventional methods.
- the amplified DNA / RNA fragments can be isolated and purified by conventional methods such as by gel electrophoresis.
- polynucleotide sequence of the gene of the present invention or various DM fragments and the like obtained as described above can be measured by a conventional method such as dideoxy chain termination method (Sanger et al. PNAS, 1977, 74: 5463-5467). Such polynucleotide sequences can also be determined using commercial sequencing kits and the like. In order to obtain the full-length cDNA sequence, sequencing needs to be repeated. Sometimes it is necessary to determine the cDNA sequence of multiple clones in order to splice into a full-length cDNA sequence.
- the present invention also relates to a vector comprising a polynucleotide of the present invention, and a host cell produced by genetic engineering using the vector of the present invention or directly using a human matrix antigen 3 protein 17 coding sequence, and a method for producing a polypeptide of the present invention by recombinant technology. .
- a polynucleotide sequence encoding the human matrix antigen 3 protein 17 can be inserted into a vector to constitute a recombinant vector containing the polynucleotide of the present invention.
- vector refers to bacterial plasmids, phages, yeast plasmids, plant cell viruses, mammalian cell viruses such as adenoviruses, retroviruses or other vectors well known in the art.
- Vectors suitable for use in the present invention include, but are not limited to: T7 promoter-based expression vectors expressed in bacteria (Rosenberg, et al.
- any plasmid and vector can be used to construct a recombinant expression vector.
- An important feature of expression vectors is that they usually contain an origin of replication, a promoter, a marker gene, and translational regulatory elements.
- Methods known to those skilled in the art can be used to construct expression vectors containing DM sequences encoding human matrix antigen 3 protein 17 and appropriate transcriptional / translational regulatory elements. These methods include in vitro recombinant DNA technology, DNA synthesis technology, and in vivo recombination technology (Sambroook, et al. Molecular Cloning, a Laboratory Manual, Cold Spring Harbor Laboratory. New York, 1989).
- the DNA sequence can be operably linked to an appropriate promoter in an expression vector to guide mRNA synthesis. Representative examples of these promoters are: l ac or trp promoter of E.
- the expression vector also includes a ribosome binding site and a transcription terminator for translation initiation. Insertion of enhancer sequences into the vector will enhance its transcription in higher eukaryotic cells. Enhancers are cis-acting factors for DNA expression, usually about 10 to 300 base pairs, which act on promoters to enhance gene transcription. Illustrative examples include SV40 enhancers from 100 to 270 base pairs on the late side of the origin of replication, polyoma enhancers on the late side of the origin of replication, and adenovirus enhancers.
- the expression vector preferably contains one or more selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
- selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
- GFP fluorescent protein
- tetracycline or ampicillin resistance for E. coli.
- a polynucleotide encoding human matrix antigen 3 protein 17 or a recombinant vector containing the polynucleotide can be transformed or transduced into a host cell to constitute a genetically engineered host cell containing the polynucleotide or a recombinant vector.
- the term "host cell” refers to a prokaryotic cell, such as a bacterial cell; or a lower eukaryotic cell, such as a yeast cell; or a higher eukaryotic cell, such as a mammalian cell. Representative examples are: E.
- coli Streptomyces
- bacterial cells such as Salmonella typhimurium
- fungal cells such as yeast
- plant cells such as fly S2 or Sf 9
- animal cells such as CH0, COS or Bowes melanoma cells.
- Transformation of a host cell with a DNA sequence described in the present invention or a recombinant vector containing the DNA sequence can be performed using conventional techniques well known to those skilled in the art.
- the host is a prokaryote such as E. coli
- competent cells capable of DNA uptake can be in the exponential growth phase were harvested, treated with (Method 12, using the procedure well known in the art.
- Alternative is MgC l 2.
- transformation can also be performed by electroporation.
- the following DNA transfection methods can be used: calcium phosphate co-precipitation method, or conventional mechanical methods such as microinjection, electroporation, and liposomes Packaging, etc.
- polynucleotide sequence of the present invention can be used to express or produce recombinant human matrix antigen 3 protein 17 (Scence, 1984; 224: 1431). Generally, the following steps are taken:
- the medium used in the culture may be selected from various conventional mediums. Culture is performed under conditions suitable for host cell growth. After the host cells have grown to an appropriate cell density, the selected promoter is induced by a suitable method (such as temperature conversion or chemical induction), and the cells are cultured for a period of time.
- a suitable method such as temperature conversion or chemical induction
- the recombinant polypeptide may be coated in a cell, expressed on a cell membrane, or secreted outside the cell. If necessary, the recombinant protein can be isolated and purified by various separation methods using its physical, chemical and other properties. These methods are well known to those skilled in the art. These methods include, but are not limited to: conventional renaturation treatment, protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid chromatography (HPLC) and various other liquid chromatography techniques and combinations of these methods.
- conventional renaturation treatment protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid
- polypeptides of the present invention as well as antagonists, agonists and inhibitors of the polypeptides, can be directly used in the treatment of diseases, for example, they can treat malignant tumors, adrenal deficiency, skin diseases, various types of inflammation, HIV infection, and immune diseases.
- Matrix antigen 3 STAG3 is a new gene encoding a protein that participates in chromosome pairing during meiosis. It encodes a matrix antigen 3 protein that is a nuclear protein. Deletion of this chromosome will cause diseases such as Williams-Beuren syndrome .
- the new matrix antigen 3 protein and the human matrix antigen 3 protein of the present invention have 85% identity and 90% similarity at the protein level, and have similar biological functions. Its molecular weight is 17, so it is named human matrix antigen 3 Protein 17. Abnormal expression of this protein will cause abnormal chromosome pairing during meiosis, thereby causing chromosomal deletions or mutations associated with it, and causing diseases such as Williams-Beuren syndrome.
- the polypeptide of the present invention and the human matrix antigen 3 protein are homologous proteins and contain characteristic sequences of the human matrix antigen 3 protein family, and both have similar biological functions. It is more specifically involved in the meiotic process, and its abnormal expression is usually closely related to the occurrence of some chromosome diseases, chromosome break syndromes, embryonic development disorders, infertility, immune diseases and other diseases, and produce related diseases.
- the abnormal expression of the human matrix antigen 3 protein 17 of the present invention will produce various diseases, especially Williams-Beuren syndrome, chromosomal disease, chromosome break syndrome, embryonic developmental disorders, infertility, immune diseases, These diseases include, but are not limited to:
- Chromosome disease Klinefelter syndrome, XYY syndrome, XX male syndrome, XXX female Syndrome, Turner syndrome, Trisomy 21, Meow syndrome, Trisomy 13, Trisomy 18, Fragile X syndrome, Chromosome break syndrome, and other chromosome structures and numbers Abnormal symptoms.
- Chromosome rupture syndrome telangiectasia, Bloom syndrome, xeroderma pigmentosa, Fanconi anemia
- Fetal developmental disorders congenital abortion, cleft palate, limb loss, limb differentiation disorder, atrial septal defect, neural tube defect, congenital hydrocephalus, congenital glaucoma or cataract, congenital deafness
- Immune diseases Systemic lupus erythematosus, rheumatoid arthritis, bronchial asthma, urticaria, specific dermatitis, post-infection myocarditis, scleroderma, myasthenia gravis, Guillain-Barre syndrome, common variable immunodeficiency disease , Primary B-lymphocyte immunodeficiency disease, Acquired immunodeficiency syndrome
- Abnormal expression of the human matrix antigen 3 protein 17 of the present invention will also cause certain hereditary, hematological diseases and the like.
- the polypeptide of the present invention and the antagonists, agonists and inhibitors of the polypeptide can be directly used in the treatment of diseases, for example, it can treat various diseases, especially Wi ll iams-Beuren syndrome, chromosome disease, chromosome break syndrome, embryo development Disorders, infertility, immune diseases, some hereditary, blood diseases, etc.
- the invention also provides methods for screening compounds to identify agents that increase (agonist) or suppress (antagonist) human matrix antigen 3 protein 17.
- Agonists enhance human matrix antigen 3 protein 17 to stimulate cell proliferation and other biological functions, while antagonists prevent and treat disorders related to excessive cell proliferation, such as various cancers.
- mammalian cells or a membrane preparation expressing human matrix antigen 3 protein 17 can be cultured together with labeled human matrix antigen 3 protein 17 in the presence of a drug. The ability of the drug to increase or block this interaction is then determined.
- Antagonists of human matrix antigen 3 protein 17 include antibodies, compounds, receptor deletions, and the like that have been screened. Antagonists of human matrix antigen 3 protein 17 can bind to human matrix antigen 3 protein 17 and eliminate its function, or inhibit the production of the polypeptide, or bind to the active site of the polypeptide so that the polypeptide cannot perform biological functions.
- human matrix antigen 3 protein 17 can be added to the bioanalytical assay to determine whether the compound is an antagonist by measuring the effect of the compound on the interaction between human matrix antigen 3 protein 17 and its receptor .
- Receptor deletions and analogs that act as antagonists can be screened in the same manner as described above for screening compounds.
- Polypeptide molecules capable of binding to human matrix antigen 3 protein 17 can be obtained by screening random peptide libraries composed of various possible combinations of amino acids bound to a solid phase. In screening, the human matrix antigen 3 protein 17 molecule should generally be labeled.
- the present invention provides a method for producing an antibody using a polypeptide, a fragment, a derivative, an analog thereof, or a cell thereof as an antigen.
- antibodies can be polyclonal or monoclonal antibodies.
- the invention also provides antibodies against human matrix antigen 3 protein 17 epitopes. These antibodies include (but are not limited to): polyclonal antibodies, monoclonal antibodies, chimeric antibodies, single chain antibodies, Fab fragments, and fragments produced by Fab expression libraries.
- Polyclonal antibodies can be produced by injecting human matrix antigen 3 protein 17 directly into immunized animals (such as rabbits, mice, rats, etc.). Various adjuvants can be used to enhance the immune response, including but not limited to Freund's adjuvant. Wait. Techniques for preparing monoclonal antibodies to human matrix antigen 3 protein 17 include, but are not limited to, hybridoma technology (Kohler and Milstein. Nature, 1975, 256: 495-497), triple tumor technology, human beta-cell hybridoma technology, and EBV- Hybridoma technology, etc. Chimeric antibodies combining human constant regions and non-human variable regions can be produced using existing techniques (Morrison et al, PNAS, 1985, 81: 6851). 0 Existing techniques for producing single-chain antibodies (US Pat No. .4946778) can also be used to produce single chain antibodies against human matrix antigen 3 protein 17.
- Antibodies against human matrix antigen 3 protein 17 can be used in immunohistochemical techniques to detect human matrix antigen 3 protein 17 in biopsy specimens.
- Monoclonal antibodies that bind to human matrix antigen 3 protein 17 can also be labeled with radioisotopes and injected into the body to track their location and distribution. This radiolabeled antibody can be used as a non-invasive diagnostic method to locate tumor cells and determine whether there is metastasis.
- Antibodies can also be used to design immunotoxins that target a particular part of the body.
- human matrix antigen 3 protein 17 high affinity monoclonal antibodies can covalently bind to bacterial or plant toxins (such as diphtheria toxin, ricin, ormosine, etc.).
- a common method is to attack the amino group of an antibody with a thiol cross-linking agent such as SPDP and bind the toxin to the antibody through the exchange of disulfide bonds.
- This hybrid antibody can be used to kill human matrix antigen 3 protein 17 positive cells .
- the antibodies of the present invention can be used to treat or prevent diseases related to human matrix antigen 3 protein 17.
- Administration of an appropriate dose of antibody can stimulate or block the production or activity of human matrix antigen 3 protein 17.
- the invention also relates to a diagnostic test method for quantitative and localized detection of human matrix antigen 3 protein 17 levels.
- tests are well known in the art and include FISH assays and radioimmunoassays.
- the level of human matrix antigen 3 protein 17 detected in the test can be used to explain the importance of human matrix antigen 3 protein II in various diseases and to diagnose diseases in which human matrix antigen 3 protein 17 plays a role.
- the polypeptide of the present invention can also be used for peptide mapping analysis.
- the polypeptide can be specifically cleaved by physical, chemical or enzymatic analysis, and subjected to one-dimensional or two-dimensional or three-dimensional gel electrophoresis analysis, and more preferably mass spectrometry analysis.
- Polynucleotides encoding human matrix antigen 3 protein 17 can also be used for a variety of therapeutic purposes.
- Gene therapy technology can be used to treat abnormal cell proliferation, development, or metabolism caused by the non-expression or abnormal / inactive expression of human matrix antigen 3 protein 17.
- Recombinant gene therapy vectors (such as viral vectors) can be designed to express mutated human matrix antigen 3 protein 17 to inhibit endogenous human matrix antigen 3 protein 17 activity.
- a mutated human matrix antigen 3 protein 17 may be a shortened human matrix antigen 3 protein 17 that lacks a signaling domain, and although it can bind to a downstream substrate, it lacks signaling activity. Therefore, recombinant gene therapy vectors can be used to treat diseases caused by abnormal expression or activity of human matrix antigen 3 protein 17.
- Virus-derived expression vectors such as retrovirus, adenovirus, adenovirus-associated virus, herpes simplex virus, parvovirus, etc. can be used to transfer a polynucleotide encoding human matrix antigen 3 protein 17 into a cell.
- a method for constructing a recombinant viral vector carrying a polynucleotide encoding a human matrix antigen 3 protein 17 can be found in the existing literature (Sambrook, etal.).
- the recombinant polynucleotide encoding human matrix antigen 3 protein 17 can be packaged into liposomes and transferred into cells.
- Methods for introducing a polynucleotide into a tissue or cell include: directly injecting the polynucleotide into a tissue in vivo; or introducing the polynucleotide into a cell in vitro through a vector (such as a virus, phage, or plasmid), and then transplanting the cell Into the body and so on.
- a vector such as a virus, phage, or plasmid
- Oligonucleotides including antisense RNA and DNA
- ribozymes that inhibit human matrix antigen 3 protein 17 mRNA are also within the scope of the present invention.
- a ribozyme is an enzyme-like RNA molecule that can specifically decompose specific RNA. Its mechanism of action is that the ribozyme molecule specifically hybridizes with a complementary target RNA for endonucleation.
- Antisense RNA, DNA, and ribozymes can be obtained using any existing RNA or DNA synthesis technology, such as solid-phase phosphoramidite chemical synthesis to synthesize oligonucleotides.
- Antisense RNA molecules can be obtained by in vitro or in vivo transcription of DM sequences encoding the RNA.
- This DNA sequence has been integrated downstream of the RNA polymerase promoter of the vector.
- it can be modified in a variety of ways, such as increasing the sequence length on both sides, and the linkage between ribonucleosides using phosphorothioate or peptide bonds instead of phosphodiester bonds.
- the polynucleotide encoding human matrix antigen 3 protein 17 can be used for the diagnosis of diseases related to human matrix antigen 3 protein 17.
- the polynucleotide encoding human matrix antigen 3 protein 17 can be used to detect the expression of human matrix antigen 3 protein 17 or the abnormal expression of human matrix antigen 3 protein 17 in a disease state.
- a DNA sequence encoding human matrix antigen 3 protein 17 can be used to hybridize biopsy specimens to determine the expression of human matrix antigen 3 protein 17.
- Hybridization techniques include Sout hern blotting, Nor thern blotting, in situ hybridization, and the like. These techniques and methods are publicly available and mature, and related kits are commercially available.
- polynucleotides of the present invention can be used as probes to be fixed on a micro-array (Mi croar ray) or a DNA chip (also known as a "gene chip") for analyzing the difference of genes in tissues. Heterologous analysis and genetic diagnosis. Human matrix antigen 3 protein 17 specific primers for RNA-polymerase chain reaction (RT-PCR) in vitro amplification can also detect human matrix antigen 3 protein 17 transcription products.
- RT-PCR RNA-polymerase chain reaction
- Human matrix antigen 3 protein 17 mutations include point mutations, translocations, deletions, recombinations, and any other abnormalities compared to the normal wild type human matrix antigen 3 protein 17 DNA sequence. Mutations can be detected using existing techniques such as Southern blotting, DM sequence analysis, PCR and in situ hybridization. In addition, mutations may affect protein expression. Therefore, Northern blotting and Western blotting can be used to indirectly determine whether a gene is mutated.
- sequences of the invention are also valuable for chromosome identification. This sequence will specifically target a specific position on a human chromosome and can hybridize to it. Currently, the specific loci of each gene on the chromosome need to be identified. Currently, only a few chromosome markers based on actual sequence data (repeating polymorphisms) can be used to mark chromosome locations. According to the present invention, in order to associate these sequences with disease-related genes, an important first step is to locate these DNA sequences on a chromosome.
- PCR primers (preferably 15-35bp) are prepared according to cDM, and the sequences can be located on chromosomes. These primers were then used for PCR screening of somatic hybrid cells containing individual human chromosomes. Only those hybrid cells that contain the human gene corresponding to the primer will produce amplified fragments.
- PCR localization of somatic hybrid cells is a quick way to localize DNA to specific chromosomes.
- oligonucleotide primers of the present invention by a similar method, a set of fragments from a specific chromosome or a large number of genomic clones can be used to achieve sublocalization.
- Other similar strategies that can be used for chromosomal localization include in situ hybridization, chromosome pre-screening with labeled flow sorting, and hybrid pre-selection to construct chromosome-specific cDNA libraries.
- Fluorescent in situ hybridization of cDNA clones with metaphase chromosomes allows precise chromosomal localization in one step.
- FISH Fluorescent in situ hybridization
- the CDM or genomic sequence differences between the affected and unaffected individuals need to be determined. If a mutation is observed in some or all diseased individuals and the mutation is not observed in any normal individuals, the mutation may be the cause of the disease. Comparing affected and unaffected individuals usually involves first finding Structural changes in the chromosome, such as deletions or translocations that are visible from the chromosome level or detectable with cDNA sequence-based PCR. According to the resolution capabilities of current physical mapping and gene mapping technology, the cDNA accurately mapped to the disease-related chromosomal region can be one of 50 to 500 potentially pathogenic genes (assuming 1 megabase mapping resolution) Capacity and each 20kb corresponds to a gene).
- the polypeptides, polynucleotides and mimetics, agonists, antagonists and inhibitors of the present invention can be used in combination with a suitable pharmaceutical carrier.
- suitable pharmaceutical carrier can be water, glucose, ethanol, salts, buffers, glycerol, and combinations thereof.
- the composition comprises a safe and effective amount of the polypeptide or antagonist, and carriers and excipients which do not affect the effect of the drug. These compositions can be used as drugs for the treatment of diseases.
- the invention also provides a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the invention.
- a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the invention.
- these containers there may be instructional instructions given by government agencies that manufacture, use, or sell pharmaceuticals or biological products, which prompts permission for administration on the human body by government agencies that produce, use, or sell.
- the polypeptides of the invention can be used in combination with other therapeutic compounds.
- the pharmaceutical composition can be administered in a convenient manner, such as by a topical, intravenous, intraperitoneal, intramuscular, subcutaneous, intranasal or intradermal route of administration.
- Human matrix antigen 3 protein 17 is administered in an amount effective to treat and / or prevent a specific indication.
- the amount and range of human matrix antigen 3 protein 17 administered to a patient will depend on many factors, such as the mode of administration, the health conditions of the person to be treated, and the judgment of the diagnostician. Examples
- Human fetal brain total MA was extracted by one-step method with guanidine isothiocyanate / phenol / chloroform.
- Poly (A) mRNA was isolated from total RNA using Quik mRNA I solat ion Kit (product of Qiegene). 2ug poly (A) mRNA is reverse transcribed to form cDNA.
- a Smart cDNA cloning kit (purchased from Clontech) was used to insert the cDNA fragment into the multiple cloning site of the pBSK (+) vector (Clontech) to transform DH5a. The bacteria formed a cDNA library.
- the sequences at the 5 'and 3' ends of all clones were determined using Dye terminate cyc le react ion sequencing kit (Perkin-Elmer) and ABI 377 automatic sequencer (Perkin-Elmer). The determined cDNA sequence was compared with the existing public DM sequence database (Genebank), and one of the clones was found. The CDM sequence of 0465hl 0 is new DNA. A series of primers were synthesized to determine the inserted cDNA fragments of the clone in both directions.
- the 0465M 0 clone contained a full-length cDNA of 980bp (as shown in Seq ID N0: 1), and a 453bp open reading frame (0RF) from 239bp to 691bp, encoding a new protein (such as Seq ID NO: 2).
- This clone pBS-0465hl O was named human matrix antigen 3 protein 17.
- Example 2 Homologous search of cDNA clones
- the sequence of the human matrix antigen 3 protein 17 of the present invention and the protein sequence encoded by the same were applied to the Blas t program (Basiclocal alignment search tool) [Altschul, SF et al. J. Mol. Biol. 1990; 215: 403-10] , Perform homology search in databases such as Genbank, Swissport, etc.
- the gene most homologous to the human matrix antigen 3 protein 17 of the present invention is a known human matrix antigen 3 protein, and its accession number to Genbank is AJ007798.
- the protein homology results are shown in Figure 1. The two are highly homologous, with an identity of 851 ⁇ 2; the similarity is 90%.
- Example 3 Cloning of a gene encoding human matrix antigen 3 protein 17 by RT-PCR
- CDNA was synthesized using fetal brain total RNA as a template and ol igo-dT as a primer for reverse transcription reaction. After purification with Qiagene's kit, the following primers were used for PCR amplification:
- Primerl 5'- GACAAGGGAGATGTCCGCCCCCAG -3, (SEQ ID NO: 3)
- Pr imer2 5'- TCTTTTATGGACATCTGTTGCCCA -3 '(SEQ ID NO: 4)
- Pr imerl is a forward sequence located at the 5th end of SEQ ID NO: 1, starting at lbp;
- Pr imer2 is the 3, terminal reverse sequence of SEQ ID NO: 1.
- Amplification reaction conditions 50 mmol / L KC1, 10 mmol / L Tri s-HCl, pH 8.5, 1. 5 ramol / L MgCl 2 , 200 ⁇ mol / L dNTP, 1 Opmol primer, 1U in a 50 ⁇ 1 reaction volume Taq DNA polymerase (Clontech).
- the reaction was performed on a PE9600 DNA thermal cycler (Perkin-Elmer) for 25 cycles under the following conditions: 94. C 30sec; 55. C 30sec; 72 ° C 2min.
- ⁇ -act in was set as a positive control and template blank was set as a negative control.
- the amplified product was purified using a QIAGEN kit and ligated to a pCR vector (Invitrogen) using a TA cloning kit.
- the DNA sequence analysis results showed that the DNA sequence of the PCR product was exactly the same as 1-980bp shown in SEQ ID NO: 1.
- Example 4 Northern blot analysis of human matrix antigen 3 protein 17 gene expression
- RNA extraction in one step [Ana l. Biochem 1987, 162, 156-159] 0
- This method involves acid guanidinium thiocyanate-chloroform extraction. I.e. with 4M guanidinium isothiocyanate -25mM sodium citrate, 0. 2M sodium acetate (P H4. 0)
- the tissue was homogenized, 1 volume of phenol and 1/5 volume of chloroform-isoamyl alcohol (49: 1) were added, and the mixture was centrifuged.
- the aqueous layer was aspirated, isopropanol (0.8 vol) was added and the mixture was centrifuged to obtain RM precipitate.
- the resulting RNA pellet was washed with 70% ethanol, dried and dissolved in water.
- a 32P-labeled probe (about 2 x 10 6 cpm / ml) was hybridized with a nitrocellulose membrane to which RNA was transferred at 42 ° C overnight in a solution containing 50% formamide-25mM KH 2 P0 4 (pH7.4)-5 x SSC-5 x Denhardt's solution and 20 (g / ml salmon sperm DNA. After hybridization, the filter was washed in lx SSC-0.1% SDS at 55 ° C for 30 min. Then, Phosphor Imager Analysis and quantification Example 5 In vitro expression, isolation and purification of recombinant human matrix antigen 3 protein 17
- Primer 3 5,-CCCCATATGATGAGTGGCTGGATAGCTACAAGC -3, (Seq ID No: 5)
- Primer 4 5,-CATGGATCCTTAATGCAGCTCTTTGTGTTTCTC -3, (Seq ID No: 6)
- the 5 'ends of these two primers contain Ndel and BamHI restriction sites, respectively , followeded by the coding sequences of the 5 'and 3' ends of the gene of interest, respectively, and the Ndel and BamHI restriction sites correspond to the selection on the expression vector plasmid P ET-28b (+) (Novagen, Cat. No. 69865.3) Sex endonuclease site.
- the pBS-0465hlO plasmid containing the full-length target gene was used as a template for the PCR reaction.
- the PCR reaction conditions were as follows: 10 pg of pBS-0465hlO plasmid in a total volume of 50 ⁇ 1, Primer-3 and Primer-4 primers were lpmol, Advantage polymerase Mix (Clontech) 1 ⁇ 1, respectively. Cycle parameters: 94 ° C 20s, 60 ° C 30s, 68. C 2 min, a total of 25 cycles. Ndel and BamHI were used to double-digest the amplified product and plasmid pET-28 (+), respectively, and large fragments were recovered and ligated with T4 ligase.
- the ligated product was transformed into the colibacillus DH5 C by the calcium chloride method. After being cultured overnight in LB plates containing kanamycin (final concentration 30 ⁇ 8 / ⁇ 1), positive clones were selected by colony PCR method and sequenced. A positive clone (pET-0465hlO) with the correct sequence was selected, and the recombinant plasmid was transformed into E. coli BL21 (DE3) plySs (product of Novagen) by the calcium chloride method.
- the following peptides specific for human matrix antigen 3 protein 17 were synthesized using a peptide synthesizer (product of PE): NH2-Met-Ser-Gly-Trp-I le-Ala-Thr-Ser-Lys-Thr-Arg-Met- Gln-Asp-Phe- C00H (SEQ ID NO: 7).
- the polypeptide was coupled to hemocyanin and bovine serum albumin to form a complex, respectively.
- the suitable oligonucleotide fragments selected from the polynucleotides of the present invention are used as hybridization probes in various aspects.
- the probes can be used to hybridize to the genome or CDM library of normal tissue or pathological tissue from different sources to It is determined whether it contains the polynucleotide sequence of the present invention and a homologous polynucleotide sequence is detected.
- the probe can be used to detect the polynucleotide sequence of the present invention or its homologous polynucleotide sequence in normal tissues or Whether the expression in tissue cells is abnormal.
- the purpose of this embodiment is to select a suitable oligonucleotide fragment from the polynucleotide SEQ ID NO: 1 of the present invention as a hybridization probe, and to identify whether some tissues contain the polynucleoside of the present invention by a filter hybridization method.
- Filter hybridization methods include dot blotting, Southern blotting, Northern blotting, and copying methods. They are all used to fix the polynucleotide sample to be tested on the filter and then hybridize using basically the same steps.
- the sample-immobilized filter is first pre-hybridized with a probe-free hybridization buffer, so that the non-specific binding site of the sample on the filter is saturated with the carrier and the synthetic polymer.
- the pre-hybridization solution is then replaced with a hybridization buffer containing the labeled probe and incubated to hybridize the probe to the target nucleic acid.
- the unhybridized probes are removed by a series of membrane washing steps.
- This embodiment utilizes higher-intensity washing conditions (such as lower salt concentration and higher temperature) to reduce the hybridization background and retain only strong specific signals.
- the probes selected in this embodiment include two types: the first type of probes are oligonucleotide fragments that are completely identical or complementary to the polynucleotide SEQ ID NO: 1 of the present invention;
- the second type of probe is an oligonucleotide fragment which is partially identical or complementary to the polynucleotide SEQ ID NO: 1 of the present invention.
- the dot blot method is used to fix the sample on the filter membrane. Under the high-intensity washing conditions, the first type of probe and the sample have the strongest hybridization specificity and are retained.
- the preferred range of probe size is 18-50 nucleotides
- Those that meet the above conditions can be used as primary selection probes, and then further computer sequence analysis, including the primary selection probe and its source sequence region (ie, SEQ ID NO: 1) and other known genomic sequences and their complements The regions are compared for homology. If the homology with the non-target molecule region is greater than 85% or there are more than 15 consecutive bases, the primary probe should not be used in general;
- Probe 1 which belongs to the first type of probe, is completely homologous or complementary to the gene fragment of SEQ ID NO: 1 (41Nt):
- Probe 2 which belongs to the second type of probe, is equivalent to the replacement mutant sequence of the gene fragment of SEQ ID NO: 1 or its complementary fragment (41Nt):
- PBS phosphate buffered saline
- step 8-13 are only used when contamination must be removed, otherwise step 14 can be performed directly.
- NC membrane nitrocellulose membrane
- the sample membrane was placed in a plastic bag, and 3-1 Omg pre-hybridization solution (lOxDenhardt's; 6xSSC, 0.1 mg / ml CT DNA (calf thymus D)) was added. After sealing the mouth of the bag, shake at 68 ° C for 2 hours.
- 3-1 Omg pre-hybridization solution (lOxDenhardt's; 6xSSC, 0.1 mg / ml CT DNA (calf thymus D)
Landscapes
- Chemical & Material Sciences (AREA)
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- General Health & Medical Sciences (AREA)
- Molecular Biology (AREA)
- Biochemistry (AREA)
- Biophysics (AREA)
- Zoology (AREA)
- Genetics & Genomics (AREA)
- Medicinal Chemistry (AREA)
- Gastroenterology & Hepatology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Toxicology (AREA)
- Peptides Or Proteins (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
Description
Claims
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
AU73769/01A AU7376901A (en) | 2000-03-27 | 2001-03-26 | A novel polypeptide, human protein 17 stag3 (stromal antigene) and the polynucleotide encoding the polypeptide |
Applications Claiming Priority (2)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN 00115144 CN1315371A (en) | 2000-03-27 | 2000-03-27 | Polypeptide-human matrix antigen 3 protein 17 and polynucleotide for coding it |
CN00115144.4 | 2000-03-27 |
Publications (2)
Publication Number | Publication Date |
---|---|
WO2001075051A2 true WO2001075051A2 (en) | 2001-10-11 |
WO2001075051A3 WO2001075051A3 (en) | 2002-04-18 |
Family
ID=4584613
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
PCT/CN2001/000496 WO2001075051A2 (en) | 2000-03-27 | 2001-03-26 | A novel polypeptide, a human stroma antigen 3 protein 17 and the polynucleotide encoding the polypeptide |
Country Status (3)
Country | Link |
---|---|
CN (1) | CN1315371A (en) |
AU (1) | AU7376901A (en) |
WO (1) | WO2001075051A2 (en) |
-
2000
- 2000-03-27 CN CN 00115144 patent/CN1315371A/en active Pending
-
2001
- 2001-03-26 WO PCT/CN2001/000496 patent/WO2001075051A2/en active Application Filing
- 2001-03-26 AU AU73769/01A patent/AU7376901A/en not_active Abandoned
Non-Patent Citations (4)
Title |
---|
DATABASE GENBANK [Online] 06 March 1996 NICOLAIDES N.C. ET AL. Database accession no. (U24169) * |
DATABASE GENBANK [Online] 26 October 1999 PEZZI N. ET AL. Retrieved from EMBL Database accession no. (AJ007798) * |
DATABASE GENBANK [Online] 27 October 1999 PEZZI N. ET AL. Retrieved from EMBL Database accession no. (AJ005678) * |
MENG X. ET AL. GENOMICS vol. 52, no. 2, 01 September 1998, pages 130 - 137 * |
Also Published As
Publication number | Publication date |
---|---|
AU7376901A (en) | 2001-10-15 |
CN1315371A (en) | 2001-10-03 |
WO2001075051A3 (en) | 2002-04-18 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
WO2001055189A1 (en) | A NOVEL POLYPEPTIDE, SECp43, 32 THAT ASSOCIATES SPECIFICALLY WITH HUMAN SELECNOCYSTEINE tRNA AND THE POLYNUCLEOTIDE ENCODING THEREOF | |
WO2001083780A1 (en) | A novel polypeptide, a human methylthioadenosine phosphorylase 37 and the polynucleotide encoding the polypeptide | |
WO2001068684A1 (en) | A novel polypeptide-human protocadherins 14 and the polynucleotide encoding said polypeptide | |
WO2001088084A2 (en) | A novel polypeptide, a superoxide dismutase 11 and the polynucleotide encoding the polypeptide | |
WO2001066730A1 (en) | A novel polypeptide, a human rs3 protein 12 and the polynucleotide encoding the polypeptide | |
WO2001075051A2 (en) | A novel polypeptide, a human stroma antigen 3 protein 17 and the polynucleotide encoding the polypeptide | |
WO2001070965A1 (en) | A novel polypeptide, a human regulatory transcription factor 15 and the polynucleotide encoding the polypeptide | |
WO2001072790A1 (en) | A novel polypeptide, a human l1 factor p40 protein 12 and the polynucleotide encoding the polypeptide | |
WO2002026810A1 (en) | A novel polypeptide - protein p125-77.22 and a polynucleotide encoding the same | |
WO2001092329A1 (en) | A NOVEL POLYPEPTIDE - α-SUBUNIT 9.9 OF ATP SYNTHASE AND A POLYNUCLEOTIDE ENCODING THE SAME | |
WO2001046409A1 (en) | A novel polypeptide- ribosome s7 protein 9 and the polynucleotide encoding said polypeptide | |
WO2001046437A1 (en) | Novel polypeptide - eukaryotic rna-binding redion rnp-1-21 and polynucleotide encoding it | |
WO2001070956A1 (en) | A novel polypeptide, a human dna mismatch repair protein 8 and the polynucleotide encoding the polypeptide | |
WO2001075048A2 (en) | A novel polypeptide, human ribosomal protein s11 23 and the polynucleotide encoding the polypeptide | |
WO2001075101A1 (en) | A novel polypeptide- human transcription regulator 8 and the polynucleotide encoding said polypeptide | |
WO2002006470A1 (en) | A novel polypeptide, a human myoglobulin ixa11.88 and the polynucleotide encoding the polypeptide | |
WO2001083678A2 (en) | A novel polypeptide, homo uridylic acid kinase 13 and polynucleotide encoding said polypeptide | |
WO2001048199A1 (en) | A novel polypeptide, a ribosomal protein s10 14 and the polynucleotide encoding the polypeptide | |
WO2001073061A1 (en) | Novel polypeptide - a human retinoblastoma protein 22 and polynucleotide encoding it | |
WO2001075018A2 (en) | A novel polypeptide, a human regulation factor of transcription 31 and the polynucleotide encoding the polypeptide | |
WO2001073069A1 (en) | Novel polypeptide-a human tumor related nucleoprotein 12 and polynucleotide encoding it | |
WO2001090171A1 (en) | A novel polypeptide-human robosomal sii protein 12 and the polynucleotide encoding said polypeptide | |
WO2001048197A1 (en) | A novel polypeptide, a ribosomal protein s5 8 and the polynucleotide encoding the polypeptide | |
WO2001083539A1 (en) | A novel polypeptide, a mitotic kinase ask1-26 and the polynucleotide encoding the polypeptide | |
WO2001081537A2 (en) | A NOVEL POLYPEPTIDE, DNA REPLICATION FACTOR C(A1) 37Kd HUMAN SUB-UNIT 49, AND THE POLYNUCLEOTIDE ENCODING THE POLYPEPTIDE |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
AK | Designated states |
Kind code of ref document: A2 Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CO CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW |
|
AL | Designated countries for regional patents |
Kind code of ref document: A2 Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG |
|
121 | Ep: the epo has been informed by wipo that ep was designated in this application | ||
AK | Designated states |
Kind code of ref document: A3 Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CO CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW |
|
AL | Designated countries for regional patents |
Kind code of ref document: A3 Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG |
|
REG | Reference to national code |
Ref country code: DE Ref legal event code: 8642 |
|
122 | Ep: pct application non-entry in european phase | ||
NENP | Non-entry into the national phase in: |
Ref country code: JP |