WO2001083678A2 - A novel polypeptide, homo uridylic acid kinase 13 and polynucleotide encoding said polypeptide - Google Patents

Abstract

The invention discloses a new kind of polypeptide - HOMO uridylic acid kinase 13 and polynucleotide encoding said polypeptide and a process for producing said polypeptide by DNA recombinant methods. It also discloses the method of applying the polypeptide for the treatment of various kinds of diseases, such as barrenness, cyesis pathology, brepho-dysplasia, dysgenopathy, some cancer and inherited disease, antagonist and the therapeutic use of the polypeptide is also disclosed. In addition, it refers to the use of polynucleotide encoding said HOMO uridylic acid kinase 13.

Description

 A New Polypeptide-Human Genosine Kinase 13 and Polynucleotide Encoding This Polypeptide

 The present invention belongs to the field of biotechnology. Specifically, the present invention describes a new polypeptide, Λ-uridine kinase 13, and a polynucleotide sequence encoding the polypeptide. The invention also relates to a method and application for preparing the polynucleotide and polypeptide. Chiropractic background

 Sexual reproduction is a more advanced breeding method in the long-term evolution history of organisms than asexual reproduction. Through the fusion of male and female gametes, the genetic material of parents from different genetic backgrounds is mixed, which not only stabilizes heredity, but also adds many new mutations, which greatly enhances the ability of the organism to adapt to the ever-changing environment. Normal somatic cells from both sides of the mother-in-law produce sperm and eggs with half the number of chromosomes through a special bead mitosis, that is, meiosis. When the sperm and eggs are fused, they form cells with normal chromosomes. Stabilized the genetics of the organism. Meiosis is a DNA replication followed by two cell divisions to halve the gamete's chromosome. Studies have found that the process of meiosis in living cells involves the combined action of many different proteins.

 People have cloned a variety of genes related to spermatogenesis and testicular tissue development, such as genes encoding TCP20 protein, cdcl 0 / swi6-related protein, and uridine kinase protein. All of these proteins are highly expressed in the testis tissue and spermatogenesis of the organism. During spermatogenesis, these proteins regulate adult spermatocytes to form mature sperm through meiosis. In 1996, Kouichi et al. Cloned three human testis-specific genes from humans, which respectively encode molecular chaperone complex subunits, cell cycle regulatory proteins, and proteins similar to mouse uridine kinase. These three proteins are also highly expressed in human testis tissues and play an important regulatory role in the formation of mature sperm [Koui chi Ozaki, Tamotsu Kuroki et al., 1996, Genomi cs, 36: 316-319].

It was found that the protein sequences of uridine kinase from all different sources have high homology, especially the C-terminus of these proteins is highly homologous. The C-terminus may be a catalytic center for protein kinase activity. Mutations or abnormal expression in this region will directly affect the catalytic activity of the enzyme in the body. The protein kinase binds to the energy molecule ATP in the body to catalyze the phosphorylation of uridine to form a dinucleotide molecule. The protein structure of the enzyme contains 10 conserved amino acid residue sites, Argl 38, Leul 39, Phel40, Val l41, Aspl42, Argl51, Argl 52, Val l 53, Leul 54 and Argl 55. These ten are conserved The amino acid residues are the sites where the enzyme binds to ATP. Mutations at these sites will cause the enzyme to fail to bind to ATP, and then affect the role of the enzyme in the organism. It can be known from the above that uridine kinase is involved in regulating the development of testicular tissue and the formation of mature sperm in vivo. This protein is similar to other testis development-related proteins. It regulates the maturation of germ cells in vivo by regulating the normal progress of meiosis in spermatocytes. The mutation or abnormal expression of this protein will lead to the formation of mature germ cells in the organism, and then cause various related diseases. This protein is usually closely related to the occurrence of some male infertility, reproductive system dysplasia, and tumors and cancers in related tissues. The protein can also be used for the diagnosis and treatment of various diseases mentioned above.

 Gene chip analysis revealed that in the thymus, testis, muscle, spleen, lung, skin, thyroid, liver, PMA + Ecv304 cell line, PMA-Ecv304 cell line, non-starved L02 cell line, arsenic stimulated L02 for 1 hour L02 cell line stimulated by arsenic for 6 hours prostate, heart, lung cancer, fetal bladder, fetal small intestine, fetal large intestine, fetal thymus, fetal muscle, fetal liver, fetal kidney, fetal spleen, fetal brain, fetal lung, and fetal heart The expression profile of the polypeptide of the present invention is very similar to the expression profile of human uridine kinase, so the functions of the two may also be similar. The present invention is named human uridine kinase 1 3.

 As mentioned above, the human uridine kinase 1 3 protein plays an important role in regulating important functions of the body, such as cell division and embryonic development, and it is believed that a large number of proteins are involved in these regulatory processes, so there has been a need in the art to identify more involved in these Process of the human uridine kinase 1 3 protein, especially the amino acid sequence of this protein is identified. The isolation of new human uridine kinase 1 3 protein-coding genes also provides a basis for research to determine the role of the protein in health and disease states. This protein may form the basis for the development of diagnostic and / or therapeutic drugs for diseases, so it is important to isolate its coding for DM. Object of the invention

 It is an object of the present invention to provide an isolated novel polypeptide, human uridine kinase 13 and fragments, analogs and derivatives thereof.

 Another object of the invention is to provide a polynucleotide encoding the polypeptide.

 Another object of the present invention is to provide a recombinant vector containing a polynucleotide encoding human uridine kinase 1 3.

 Another object of the present invention is to provide a genetically engineered host cell containing a polynucleotide encoding human uridine kinase 1 3.

 Another object of the present invention is to provide a method for producing human uridine kinase 13.

 Another object of the present invention is to provide an antibody against the polypeptide of the present invention, human uridine kinase 1 3.

Another object of the present invention is to provide mimic compounds, antagonists, agonists, and inhibitors against the polypeptide of the present invention, human uridine kinase 13. Another object of the present invention is to provide a method for diagnosing and treating diseases associated with abnormalities of human uridine kinase 13. Summary of invention

 The present invention relates to an isolated polypeptide, which is of human origin and comprises: a polypeptide having the amino acid sequence of SEQ ID No. 2, or a conservative variant, biologically active fragment or derivative thereof. Preferably, the polypeptide is a polypeptide having the amino acid sequence of SEQ ID NO: 2.

 The invention also relates to an isolated polynucleotide comprising a nucleotide sequence or a variant thereof selected from the group consisting of:

 (a) a polynucleotide encoding a polypeptide having the amino acid sequence of SEQ ID No. 2;

 (b) a polynucleotide complementary to polynucleotide (a);

 The polynucleotide sequences of (c) and (a) or (b) have at least 70 »/. Identical polynucleotides.

 More preferably, the sequence of the polynucleotide is one selected from the group consisting of: (a) a sequence having positions 166-513 in SEQ ID NO: 1; and (b) a sequence having 1-1272 in SEQ ID NO: 1 Sequence of bits.

 The present invention further relates to a vector, particularly an expression vector, containing the polynucleotide of the present invention; a host cell genetically engineered with the vector, including a transformed, transduced or transfected host cell; Host cell and method of preparing the polypeptide of the present invention by recovering the expression product.

 The invention also relates to an antibody capable of specifically binding to a polypeptide of the invention.

 The invention also relates to a method for screening compounds that mimic, activate, antagonize or inhibit the activity of human uridine kinase 13 protein, which comprises utilizing the polypeptide of the invention. The invention also relates to compounds obtained by this method.

 The invention also relates to a method for detecting a disease or disease susceptibility related to abnormal expression of human uridine kinase 13 protein in vitro, which comprises detecting a mutation in the polypeptide or a polynucleotide sequence encoding the same in a biological sample, or detecting a biological The amount or biological activity of a polypeptide of the invention in a sample.

 The invention also relates to a pharmaceutical composition comprising a polypeptide of the invention or a mimetic thereof, an activator, an antagonist or an inhibitor, and a pharmaceutically acceptable carrier.

 The present invention also relates to the polypeptides and / or polynucleotides of the present invention being prepared for the treatment of infertility, pregnancy pathology, embryonic disorders, growth disorders, certain tumors, certain hereditary diseases or other causes Use of a medicine for diseases caused by abnormal expression of human uridine kinase 13.

Other aspects of the invention will be apparent to those skilled in the art from the disclosure of the techniques herein. BRIEF DESCRIPTION OF THE DRAWINGS

 The following drawings are used to illustrate specific embodiments of the invention, but not to limit the scope of the invention as defined by the claims.

FIG. 1 is a comparison diagram of gene chip expression profiles of human uridine kinase 13 and human uridine kinase of the present invention. The upper graph is a graph of the expression profile of human uridine kinase 13 and the lower graph is a graph of the expression profile of human uridine kinase 13. Among them, 1 indicates fetal kidney, 2 indicates fetal large intestine, 3 indicates fetal small intestine, 4 indicates fetal muscle, 5 indicates fetal brain, 6 indicates fetal bladder, 7 indicates unstarved L02, 8 indicates L02 +, lhr, As ³⁺ , and 9 indicates ECV304 PMA-, 10 means ECV304 PMA +, 11 means fetal liver, 12 means normal liver, 13 means thyroid, 14 means skin, 15 means fetal lung, 16 means lung, 17 means lung cancer, 18 means fetal spleen, 19 means spleen, 20 Indicates the prostate, 21 indicates the fetal heart, 22 indicates the heart, 23 indicates muscle, 24 indicates testes, 25 indicates fetal thymus, and 26 indicates thymus.

FIG. 2 is a polyacrylamide gel electrophoresis image (SDS-PAGB) of the isolated human uridine kinase 13. 13] H) _a is the molecular weight of the protein. The arrow indicates the isolated protein band. Summary of the invention

 The following terms used in this specification and claims have the following meanings unless specifically stated: "Nucleic acid sequence" refers to an oligonucleotide, a nucleotide or a polynucleotide and a fragment or part thereof, and may also refer to a genomic or synthetic MA or RNA, they can be single-stranded or double-stranded, representing the sense or antisense strand. Similarly, the term "amino acid sequence" refers to an oligopeptide, peptide, polypeptide or protein sequence and fragments or portions thereof. When the "amino acid sequence" in the present invention relates to the amino acid sequence of a naturally occurring protein molecule, such "polypeptide" or "protein" does not mean to limit the amino acid sequence to a complete natural amino acid related to the protein molecule .

 A "variant" of a protein or polynucleotide refers to an amino acid sequence having one or more amino acids or nucleotide changes or a polynucleotide sequence encoding it. The alterations' may include deletions, insertions or substitutions of amino acids or nucleotides in the amino acid sequence or nucleotide sequence. Variants can have "conservative" changes, in which the amino acid substituted has a structural or chemical property similar to the original amino acid, such as replacing isoleucine with leucine. Variants can also have non-conservative changes, such as replacing glycine with tryptophan.

 "Deletion" refers to the deletion of one or more amino acids or nucleotides in an amino acid sequence or nucleotide sequence.

"Insertion" or "addition" refers to an alteration in the amino acid sequence or nucleotide sequence that results in an increase in one or more amino acids or nucleotides compared to a naturally occurring molecule. "Replacement" refers to the replacement of one or more amino acids or nucleotides with different amino acids or nucleotides. "Biological activity" refers to a protein that has the structure, regulation, or biochemical function of a natural molecule. Similarly, the term "immunologically active" refers to the ability of natural, recombinant, or synthetic proteins and fragments thereof to induce a specific immune response and to bind specific antibodies in a suitable animal or cell.

 An "agonist" refers to a molecule that, when combined with human uridine kinase 13, causes a change in the protein and thereby regulates the activity of the protein. An agonist may include a protein, a nucleic acid, a carbohydrate, or any other molecule that binds human uridine kinase 13.

 An "antagonist" or "inhibitor" refers to a molecule that can block or regulate the biological or immunological activity of human uridine kinase 13 when combined with human cononyl kinase 13. Antagonists and inhibitors may include proteins, nucleic acids, carbohydrates or any other molecule that can bind human uridine kinase 13.

 "Regulation" refers to a change in the function of human uridine kinase 13, including an increase or decrease in protein activity, a change in binding characteristics, and any other biological, functional, or immune properties of human uridine kinase 13.

 "Substantially pure" means substantially free of other proteins, lipids, sugars or other substances with which it is naturally associated. Those skilled in the art can purify human uridine kinase 13 using standard protein purification techniques. Basically pure human uridine kinase 13 produces a single main band on a non-reducing polyacrylamide gel. The purity of the human uridine kinase 13 polypeptide can be analyzed by amino acid sequence.

 "Complementary" or "complementary" refers to the natural binding of polynucleotides by base-pairing under conditions of acceptable salt concentration and temperature. For example, the sequence "C-T-G-A" can be combined with the complementary sequence "G-A-C-T". The complementarity between two single-stranded molecules may be partial or complete. The degree of complementarity between nucleic acid strands has a significant effect on the efficiency and strength of hybridization between nucleic acid strands.

 "Homology" refers to the degree of complementarity and can be partially homologous or completely homologous. "Partial homology" refers to a partially complementary sequence that at least partially inhibits hybridization of a fully complementary sequence to a target nucleic acid. This inhibition of hybridization can be detected by performing hybridization (Southern imprinting or Northern blotting, etc.) under conditions of reduced stringency. Substantially homologous sequences or hybridization probes can compete and inhibit the binding of fully homologous sequences to target sequences under conditions of reduced stringency. This does not mean that the conditions of reduced stringency allow non-specific binding, because the conditions of reduced stringency require that the two sequences bind to each other as a specific or selective interaction.

"Percent identity" refers to the percentage of sequences that are identical or similar in the comparison of two or more amino acid or nucleic acid sequences. The percent identity can be determined electronically, such as by the MEGALIGN program (Lasergene sof tware package, DNASTAR, Inc., Madi son Wis.). The MEGALIGN program can compare two or more sequences based on different methods such as the Clus ter method (Higgins, DG and PM Sharp (1988) Gene 73: 237-244). _{0 The} Clus ter method checks all The distances arrange the groups of sequences into clusters. The clusters are then assigned in pairs or groups. The percent identity between two amino acid sequences such as sequence A and sequence B is calculated by the following formula:

 Number of residues between sequence and sequence

Number of residues in sequence ^-Number of spaced residues in sequence ^ Number of spaced residues in sequence ^X

The percent identity between nucleic acid sequences can also be determined by the Clus ter method or by methods known in the art such as: Totun He in (He in J., (1990) Methods in enzyraology 183: 625-645) ₀

"Similarity" refers to the degree of identical or conservative substitutions of amino acid residues at corresponding positions in the alignment of amino acid sequences. Amino acids used for conservative substitution, for example, negatively charged amino acids may include aspartic acid and glutamic acid; positively charged amino acids may include lysine and arginine; having an uncharged head group is Similar hydrophilic amino acids may include leucine, isoleucine and valine; glycine and alanine; asparagine and glutamine; serine and threonine; phenylalanine and tyrosine.

 "Antisense" refers to a nucleotide sequence that is complementary to a particular DNA or RNA sequence. "Antisense strand" means a nucleic acid strand that is complementary to a "sense strand."

 "Derivative" refers to HFP or a chemical modification of its nucleic acid. This chemical modification may be a substitution of a hydrogen atom with a fluorenyl, acyl or amino group. Nucleic acid derivatives can encode polypeptides that retain the main biological properties of natural molecules.

"Antibody" refers to a complete antibody molecule and its fragments, such as Fa,? ( _¾ 1) ') ₂ and?, Which specifically bind to the epitope of human uridine kinase 13.

 A "humanized antibody" refers to an antibody in which the amino acid sequence of a non-antigen binding region is replaced to become more similar to a human antibody, but still retains the original binding activity.

 The term "isolated" refers to the removal of a substance from its original environment (for example, its natural environment if it is naturally occurring). For example, a naturally-occurring polynucleotide or polypeptide is not isolated when it is present in a living thing, but the same polynucleotide or polypeptide is separated from some or all of the substances that coexist with it in the natural system. Such a polynucleotide may be part of a certain vector, or such a polynucleotide or polypeptide may be part of a certain composition. Since the carrier or composition is not part of its natural environment, they are still isolated.

 As used herein, "isolated" refers to the separation of a substance from its original environment (if it is a natural substance, the original environment is the natural environment). For example, polynucleotides and polypeptides in a natural state in a living cell are not isolated and purified, but the same polynucleotides or polypeptides are separated and purified if they are separated from other substances in the natural state .

As used herein, "isolated human uridine kinase 13" means that human uridine kinase 13 is substantially free of other proteins, lipids, sugars, or other substances with which it is naturally associated. Those skilled in the art can use Human uridine kinase 13 was purified using standard protein purification techniques. Substantially pure polypeptides can produce a single main band on a non-reducing polyacrylamide gel. The purity of the human uridine kinase 13 polypeptide can be analyzed by amino acid sequence. .

 The present invention provides a new polypeptide, human uridine kinase 13, which basically consists of the amino acid sequence shown in SEQ ID NO: 2. The polypeptide of the present invention may be a recombinant polypeptide, a natural polypeptide, or a synthetic polypeptide, and preferably a recombinant polypeptide. The polypeptides of the present invention can be naturally purified products or chemically synthesized products, or can be produced from prokaryotic or eukaryotic hosts (eg, bacteria, yeast, higher plants, insects, and mammalian cells) using recombinant techniques. Depending on the host used in the recombinant production protocol, the polypeptide of the invention may be glycosylated, or it may be non-glycosylated. Polypeptides of the invention may also include or exclude initial methionine residues.

 The invention also includes fragments, derivatives and analogs of human uridine kinase 13. As used herein, the terms "fragment", "derivative" and "analog" refer to a polypeptide that substantially maintains the same biological function or activity of the human uridine kinase 13 of the present invention. A fragment, derivative or analog of the polypeptide of the present invention may be: (I) a kind in which one or more amino acid residues are substituted with conservative or non-conservative amino acid residues (preferably conservative amino acid residues), and the substitution The amino acid may or may not be encoded by a genetic codon; or (II) a type in which a group on one or more amino acid residues is replaced by another group to include a substituent; or (Π Ι) Such a polypeptide sequence in which the mature polypeptide is fused with another compound (such as a compound that prolongs the half-life of the polypeptide, such as polyethylene glycol); or (IV) a polypeptide sequence in which an additional amino acid sequence is fused into the mature polypeptide (Such as the leader or secretory sequence or the sequence used to purify the polypeptide or protease sequence). As explained herein, such fragments, derivatives, and analogs are considered to be within the knowledge of those skilled in the art.

 The present invention provides an isolated nucleic acid (polynucleotide), which basically consists of a polynucleotide encoding a polypeptide having the amino acid sequence of SEQ ID NO: 2. The polynucleotide sequence of the present invention includes the nucleotide sequence of SEQ ID NO: 1. The polynucleotide of the present invention is found from a cMA library of human fetal brain tissue. It contains a full-length polynucleotide sequence of 1272 bases, and its open reading frames 166-513 encode 115 amino acids. According to the comparison of gene chip expression profiles, it was found that this polypeptide has a similar expression profile to human uridine kinase, and it can be deduced that the human uridine kinase 13 has a similar function to human uridine kinase.

The polynucleotide of the present invention may be in the form of DNA or RM. DNA forms include cDNA, genomic DM, or synthetic DM. DNA can be single-stranded or double-stranded. DNA can be coding or non-coding. The coding region sequence encoding a mature polypeptide may be the same as the coding region sequence shown in SEQ ID NO: 1 or a degenerate variant. As used herein, a "degenerate variant" refers to a nucleic acid sequence encoding a protein or polypeptide having SEQ ID NO: 2 but different from the coding region sequence shown in SEQ ID NO: 1 in the present invention. The polynucleotide encoding the mature polypeptide of SEQ ID NO: 2 includes: only the coding sequence of the mature polypeptide; the coding sequence of the mature polypeptide and various additional coding sequences; the coding sequence of the mature polypeptide (and optional additional coding sequences); Coding sequence.

 The term "polynucleotide encoding a polypeptide" refers to a polynucleotide comprising the polypeptide and a polynucleotide comprising additional coding and / or non-coding sequences.

 The present invention also relates to variants of the polynucleotides described above, which encode fragments, analogs and derivatives of polypeptides or poly'peptides having the same amino acid sequence as the present invention. Variants of this polynucleotide can be naturally occurring allelic variants or non-naturally occurring variants. These nucleotide variants include substitution variants, deletion variants, and insertion variants. As known in the art, an allelic variant is an alternative form of a polynucleotide that may be a substitution, deletion, or insertion of one or more nucleotides, but does not substantially change the function of the polypeptide it encodes .

 The present invention also relates to a polynucleotide that hybridizes to the sequence described above (having at least 50%, preferably 70% identity, between the two sequences). The present invention particularly relates to polynucleotides that can hybridize to the polynucleotides of the present invention under stringent conditions. In the present invention, "strict conditions" means: (1) hybridization and elution at lower ionic strength and higher temperature, such as 0.2xSSC, 0.1% SDS, 60 ° C; or (2) A denaturant was added during hybridization, such as 50% (v / v) formamide, 0.1% calf serum / 0.1 ° /. F i co l l, 42 ° C, etc .; or (3) hybridization occurs only when the identity between the two sequences is at least 95% or more, and more preferably 97% or more. In addition, the polypeptide encoded by the hybridizable polynucleotide has the same biological function and activity as the mature polypeptide shown in SEQ ID NO: 2.

 The invention also relates to nucleic acid fragments that hybridize to the sequences described above. As used in the present invention, a "nucleic acid fragment" contains at least 10 nucleotides in length, preferably at least 20-30 nucleotides, more preferably at least 50-60 nucleotides, and most preferably at least 100 nuclei. Glycylic acid or more. Nucleic acid fragments can also be used in nucleic acid amplification techniques (such as PCR) to identify and / or isolate polynucleotides encoding human uridine kinase 13.

 The polypeptides and polynucleotides in the present invention are preferably provided in an isolated form and are more preferably purified to homogeneity. The specific polynucleotide sequence encoding the human uridine kinase 13 of the present invention can be obtained by various methods. For example, polynucleotides are isolated using hybridization techniques well known in the art. These techniques include, but are not limited to: 1) hybridization of probes to genomic or cDNA libraries to detect homologous polynucleotide sequences, and 2) antibody screening of expression libraries to detect cloned polynucleosides with common structural characteristics Acid fragments.

 The DM fragment sequence of the present invention can also be obtained by the following methods: 1) separating the double-stranded DM sequence from the genomic DNA; 2) chemically synthesizing the DM sequence to obtain the double-stranded DNA of the polypeptide.

Of the methods mentioned above, genomic DM is the least commonly used. Direct chemical synthesis of DM sequences is often the method of choice. The more commonly used method is the isolation of cDNA sequences. Isolate cDNA of interest The standard method is to isolate mRNA from donor cells that overexpress the gene and perform reverse transcription to form a plasmid or phage cDNA library. There are many mature techniques for extracting mRM, and kits are also commercially available (Qiagene). The construction of cDNA libraries is also a common method (Sambrook, et al., Molecular Cloning, A Laboratory Manua, Cold Spruing Harbor Laboratory. New York, 1989). Commercially available cDNA libraries are also available, such as different cDNA libraries from Clontech. When polymerase reaction technology is used in combination, even very small expression products can be cloned.

 The genes of the present invention can be selected from these cDNA libraries by conventional methods. These methods include (but are not limited to): (l) DNA-DM or DM-RNA hybridization; (2) the presence or absence of marker gene functions; (3) determining the level of human uridine kinase 13 transcripts; (4) ) Detection of protein products expressed by genes through immunological techniques or determination of biological activity. The above methods can be used singly or in combination.

 In the method (1), the probe used for hybridization is homologous to any part of the polynucleotide of the present invention, and its length is at least 10 nucleotides, preferably at least 30 nucleotides, more preferably At least 50 nucleotides, preferably at least 100 nucleotides. In addition, the length of the probe is usually within 2000 nucleotides, preferably within 1000 nucleotides. The probe used herein is usually a DM sequence chemically synthesized based on the gene sequence information of the present invention. The genes or fragments of the present invention can of course be used as probes. DNA probes can be labeled with radioisotopes, luciferin, or enzymes (such as alkaline phosphatase).

 In the method (4), immunological techniques such as Western blotting, radioimmunoprecipitation, and enzyme-linked immunosorbent assay (ELISA) can be used to detect the protein product of human uridine kinase 13 gene expression.

 A method (Saiki, et al. Science 1985; 230: 1350-1354) using PCR technology to amplify DNA / RNA is preferably used to obtain the gene of the present invention. Especially when it is difficult to obtain full-length cDNA from the library, the RACE method (RACE-cDNA terminal rapid amplification method) can be preferably used. The primers for PCR can be appropriately based on the polynucleotide sequence information of the present invention disclosed herein Select and synthesize using conventional methods. The amplified DM / RM fragment can be isolated and purified by conventional methods such as by gel electrophoresis.

 The polynucleotide sequence of the gene of the present invention or various DNA fragments and the like obtained as described above can be determined by a conventional method such as dideoxy chain termination method (Sanger et al. PNAS, 1977, 74: 5463-5467). Such polynucleotide sequences can also be determined using commercial sequencing kits and the like. In order to obtain the full-length cDNA sequence, sequencing needs to be repeated. Sometimes it is necessary to determine the cDNA sequence of multiple clones in order to splice into a full-length cDM sequence.

 The present invention also relates to a vector comprising a polynucleotide of the present invention, and a host cell produced by genetic engineering using the vector of the present invention or directly using a human uridine kinase 13 coding sequence, and a method for producing a polypeptide of the present invention by recombinant technology. .

In the present invention, a polynucleotide sequence encoding human uridine kinase 13 can be inserted into a vector to construct Into a recombinant vector containing the polynucleotide of the present invention. The term "vector" refers to bacterial plasmids, phages, yeast plasmids, plant cell viruses, mammalian cell viruses such as adenoviruses, retroviruses, or other vectors well known in the art. Vectors suitable for use in the present invention include, but are not limited to:

T7 promoter expression vector (Rosenberg, et al. Gene, 1987, 56: 125); pMSXND expression vector expressed in mammalian cells (Lee and Nathans, J Bio Chem. 263: 3521, 1988) and in insects A baculovirus-derived vector expressed in cells. In short, as long as it can be replicated and stabilized in the host, any plasmid and vector can be used to construct a recombinant expression vector. An important feature of expression vectors is that they usually contain origins of replication, promoters, marker genes, and translational regulatory elements.

 Methods known to those skilled in the art can be used to construct expression vectors containing a DNA sequence encoding human uridine kinase 13 and appropriate transcriptional / translational regulatory elements. These methods include in vitro recombinant DM technology, DNA synthesis technology, in vivo recombination technology, etc. (Sambroook, et al. Molecular Cloning, a Laboratory Manual, Colling Harbor Laboratory. New York, 1989). The DNA sequence can be operably linked to an appropriate promoter in an expression vector to guide mRNA synthesis. Representative examples of these promoters are: the lac or trp promoter of E. coli; the PL promoter of lambda phage; eukaryotic promoters include the CMV immediate early promoter, the HSV thymidine kinase promoter, the early and late SV40 promoters, Retroviral LTRs and other known promoters that control the expression of genes in prokaryotic or eukaryotic cells or their viruses. The expression vector also includes a ribosome binding site for translation initiation, a transcription terminator, and the like. Insertion of enhancer sequences into the vector will enhance its transcription in higher eukaryotic cells. Enhancers are cis-acting factors for DNA expression, usually about 10 to 300 base pairs, which act on promoters to enhance gene transcription. Examples include SV40 enhancers of 100 to 270 base pairs on the late side of the origin of replication, polyoma enhancers and adenovirus enhancers on the late side of the origin of replication.

 In addition, the expression vector preferably contains one or more selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture. Fluorescent protein (GFP), or tetracycline or ampicillin resistance for E. coli.

 Those of ordinary skill in the art will know how to select appropriate vector / transcription control elements (such as promoters, enhancers, etc.) and selectable marker genes.

In the present invention, a polynucleotide encoding human uridine kinase 13 or a recombinant vector containing the polynucleotide can be transformed or transduced into a host cell to constitute a genetically engineered host cell containing the polynucleotide or the recombinant vector. The term "host cell" refers to a prokaryotic cell, such as a bacterial cell; or a lower eukaryotic cell, such as a yeast cell; or a higher eukaryotic cell, such as a mammalian cell. Representative examples are: E. coli, Streptomyces; 'bacterial cells such as Salmonella typhimurium; fungal cells such as yeast; plant cells; insect cells Cells if fly S2 or Sf 9; animal cells such as CH0, COS or Bowes melanoma cells.

Transformation of a host cell with a DNA sequence according to the present invention or a recombinant vector containing the DNA sequence can be performed using conventional techniques well known to those skilled in the art. When the host is a prokaryote such as E. coli, competent cells capable of absorbing DM can be harvested and used after exponential growth. Treatment & _012, procedure used are well known in the art. Alternatively, MgCl ₂ is used. If necessary, transformation can also be performed by electroporation. When the host is a eukaryote, the following DNA transfection methods can be used: calcium phosphate co-precipitation method, or conventional mechanical methods such as microinjection, electroporation, and ¹ liposome packaging.

 The polynucleotide sequence of the present invention can be used to express or produce recombinant human uridine kinase 13 by conventional recombinant DM technology (Science, 1984; 224: 1431). Generally there are the following steps:

(1) transforming or transducing a suitable host cell with the polynucleotide (or variant) encoding human human uridine kinase 13 · of the present invention, or with a recombinant expression vector containing the polynucleotide;

 (2) culturing host cells in a suitable medium;

 (3) Isolate and purify protein from culture medium or cells.

 In step (2), depending on the host cell used, the medium used in the culture may be selected from various conventional mediums. Culture is performed under conditions suitable for host cell growth. After the host cells have grown to an appropriate cell density, the selected promoter is induced by a suitable method (such as temperature conversion or chemical induction), and the cells are cultured for a period of time.

In step (3), the recombinant polypeptide may be coated in a cell, expressed on a cell membrane, or secreted outside the cell. If desired, recombinant proteins can be isolated and purified by various separation methods using their physical, chemical, and other properties. These methods are well known in the art ^; These methods include, but are not limited to: conventional renaturation treatment, protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid chromatography (HPLC) and various other liquid chromatography techniques and combinations of these methods.

 The polypeptide of the present invention and the antagonists, agonists and inhibitors of the polypeptide can be directly used in the treatment of diseases, for example, it can treat malignant tumors, adrenal deficiency, skin diseases, various inflammations, HIV infections and immune diseases.

 Studies have found that human meiocytes undergo meiosis in the process of forming mature sperm, and uridine kinase and related proteins such as proteins encoding TCP20 and cdcl 0 / swi 6 are involved in sperm formation and testicular tissue development. These proteins regulate the production of mature sperm.

 Uridine kinase may also have corresponding regulatory effects in the growth and development of organisms.

Mutations in the conserved amino acid residues at the C-terminus of the protein sequence of uridine kinase will cause the enzyme to fail to bind to ATP, and then affect the role of the enzyme in the organism. It can be known from the above that glycosyl kinases are involved in regulating the development of testicular tissues and the formation of mature sperm in vivo. This protein is similar to other testis development-related proteins. It regulates the maturation of germ cells in vivo by regulating the normal progress of meiosis in spermatocytes. The mutation or abnormal expression of this protein will lead to the formation of mature germ cells in the organism, and then cause various related diseases. This protein is usually closely related to the occurrence of some male infertility, reproductive system dysplasia, and tumors and cancers in related tissues. The protein can also be used for the diagnosis and treatment of various diseases mentioned above.

 The expression profile of the polypeptide of the present invention is consistent with the expression profile of human uridine kinase, and both have similar biological functions. It mainly regulates the growth and development of some tissues in the body, especially the formation of mature germ cells. Its abnormal expression is usually closely related to embryonic developmental disorders, growth and development disorders, certain tumors, and inflammation, and related diseases.

 It can be seen that the abnormal expression of human uridine kinase 13 of the present invention will produce various diseases, especially infertility, pregnancy pathology, embryonic developmental disorders, growth disorders, and certain tumors. These diseases include but not limited to:

 Pregnancy pathology: congenital abortion, intrauterine growth retardation, premature birth

 Fetal developmental disorders: cleft palate, lack of limbs, limb differentiation disorder, atrial septal defect, neural tube defect, congenital hydrocephalus, congenital glaucoma or cataract, congenital deafness

 Growth and development disorders: mental retardation, brain development disorders, skin, fat and muscular dysplasia, bone and joint dysplasia, various metabolic deficiencies, stunting, dwarfism, Cushing syndrome, Sexual retardation

 Certain tumors: spermatoma, testicular stromal cell tumor

 Abnormal expression of the human uridine kinase 13 of the present invention may also cause certain genetic diseases and the like.

 The polypeptide of the present invention and the antagonists, agonists and inhibitors of the polypeptide can be directly used in the treatment of diseases, for example, it can treat various diseases, especially infertility, pregnancy pathology, embryonic development disorders, and growth disorders. , Certain tumors, certain hereditary diseases, etc.

 The invention also provides methods for screening compounds to identify agents that increase (agonist) or suppress (antagonist) human uridine kinase 13. Agonists enhance biological functions such as human uridine kinase 13 to stimulate cell proliferation, while antagonists prevent and treat disorders related to excessive cell proliferation such as various cancers. For example, mammalian cells or membrane preparations expressing human uridine kinase 13 can be cultured with labeled human uridine kinase 13 in the presence of a drug. The ability of the drug to increase or block this interaction is then determined.

Antagonists of human uridine kinase 13 include antibodies, compounds, receptor deletions, and the like that have been screened. Antagonists of human uridine kinase 13 can bind to human uridine kinase 13 and eliminate its function, or inhibit the production of the polypeptide, or bind to the active site of the polypeptide so that the polypeptide cannot function biologically. Learn function.

 When screening compounds as antagonists, human uridine kinase 13 can be added to the bioanalytical assay to determine whether the compound is an antagonist by measuring the effect of the compound on the interaction between human uridine kinase 13 and its receptor . Receptor deletions and analogs that act as antagonists can be screened in the same manner as described above for screening compounds. Polypeptide molecules capable of binding to human uridine kinase 13 can be obtained by screening a random peptide library composed of various possible combinations of amino acids bound to a solid phase. When screening, the human uridine kinase 13 molecule should generally be labeled.

 The present invention provides a method for producing antibodies using polypeptides, and fragments, derivatives, analogs or cells thereof as antigens. These antibodies can be polyclonal or monoclonal antibodies. The invention also provides antibodies against human uridine kinase 13 epitopes. These antibodies include (but are not limited to): Doklon antibodies, monoclonal antibodies, chimeric antibodies, single-chain antibodies, Fab fragments, and fragments from Fab expression libraries.

 Polyclonal antibodies can be produced by injecting human uridine kinase 13 directly into immunized animals (such as rabbits, mice, rats, etc.). A variety of adjuvants can be used to enhance the immune response, including but not limited to Freund's adjuvant. Wait. Techniques for preparing monoclonal antibodies to human uridine kinase 13 include, but are not limited to, hybridoma technology (Kohl er and Mistein. Nature, 1975, 256: 495-497), triple tumor technology, human beta-cell hybridoma technology , EBV-hybridoma technology, etc. Chimeric antibodies that combine human constant regions with non-human-derived variable regions can be produced using known techniques (Morrison et al., PNAS, 1985, 81: 6851). The unique technology for producing single-chain antibodies (U.S. Pat No. 4946778) can also be used to produce single-chain antibodies against human uridine kinase 13.

 Antibodies against human uridine kinase 13 can be used in immunohistochemistry to detect human uridine kinase 13 in biopsy specimens.

 Monoclonal antibodies that bind to human uridine kinase 13 can also be labeled with radioisotopes and injected into the body to track their location and distribution. This radiolabeled antibody can be used as a non-invasive diagnostic method to locate tumor cells and determine whether there is metastasis.

 Antibodies can also be used to design immunotoxins that target a particular part of the body. For example, human uridine kinase 13 high-affinity monoclonal antibodies can covalently bind to bacterial or plant toxins (such as diphtheria toxin, ricin, ormosine, etc.). A common method is to attack the amino group of an antibody with a thiol cross-linking agent such as SPDP and bind the toxin to the antibody through the exchange of disulfide bonds. This hybrid antibody can be used to kill human uridine kinase 13 positive cells .

The antibodies of the present invention can be used to treat or prevent diseases related to human uridine kinase 13. Administration of an appropriate dose of the antibody can stimulate or block the production or activity of human uridine kinase 13. The invention also relates to a diagnostic test method for quantitative and localized detection of human uridine kinase 13 levels. These tests are well known in the art and include FISH assays and radioimmunoassays. The levels of human uridine kinase 13 detected in the test can be used to explain the importance of human uridine kinase 13 in various diseases and to diagnose diseases in which human uridine kinase 13 plays a role. ·

 The polypeptide of the present invention can also be used for peptide mapping analysis. For example, the polypeptide can be specifically cleaved by physical, chemical or enzymatic analysis, and subjected to one-dimensional or two-dimensional or three-dimensional gel electrophoresis analysis, and more preferably mass spectrometry analysis.

 The polynucleotide encoding human uridine kinase 13 can also be used for a variety of therapeutic purposes. Gene therapy technology can be used to treat abnormal cell proliferation, development or metabolism caused by the non-expression or abnormal / inactive expression of human uridine kinase 13. Recombinant gene therapy vectors (such as viral vectors) can be designed to express mutated human uridine kinase 13 to inhibit endogenous human uridine kinase 13 activity. For example, a mutated human uridine kinase 13 may be a shortened human uridine kinase 13 lacking a signaling domain, and although it can bind to a downstream substrate, it lacks signaling activity. Therefore, the recombinant gene therapy vector can be used for treating diseases caused by abnormal expression or activity of human uridine kinase 13. Expression vectors derived from viruses such as retroviruses, adenoviruses, adenovirus-associated viruses, herpes simplex virus, parvoviruses, and the like can be used to transfer polynucleotides encoding human uridine kinase 1 3 into cells. A method for constructing a recombinant viral vector carrying a polynucleotide encoding human uridine kinase 13 can be found in the existing literature (Sambrook, et al.). Alternatively, a recombinant polynucleotide encoding human uridine kinase 13 can be packaged into liposomes and transferred into cells.

 Methods for introducing a polynucleotide into a tissue or cell include: directly injecting the polynucleotide into a tissue in vivo; or introducing the polynucleotide into a cell in vitro through a vector (such as a virus, phage, or plasmid), and then transplanting the cell Into the body and so on.

 Oligonucleotides (including antisense RNA and DNA) and ribozymes that inhibit human uridine kinase 13 mRNA are also within the scope of the present invention. A ribozyme is an enzyme-like RNA molecule that specifically decomposes specific RNA. Its mechanism of action is that the ribozyme molecule specifically hybridizes with a complementary target RNA for endonucleation. Antisense RNA, DM, and ribozymes can be obtained using any existing RNA or DM synthesis techniques, such as solid-phase phosphate amide chemical synthesis to synthesize oligonucleotides. Antisense RNA molecules can be obtained by in vitro or in vivo transcription of a DNA sequence encoding the MA. This DNA sequence has been integrated downstream of the RNA polymerase promoter of the vector. In order to increase the stability of the nucleic acid molecule, it can be modified in a variety of ways, such as increasing the sequence length on both sides, and the linkage between ribonucleosides using phosphorothioate or peptide bonds instead of phosphodiester bonds.

Polynucleotide encoding human uridine kinase 13 can be used for diseases related to human uridine kinase 13 Diagnosis. The polynucleotide encoding human uridine kinase 13 can be used to detect the expression of human uridine kinase 13 or the abnormal expression of human uridine kinase 13 in a disease state. For example, a DNA sequence encoding human uridine kinase 13 can be used to hybridize biopsy specimens to determine the expression of human uridine kinase 13. Hybridization techniques include Southern blotting, Northern blotting, and in situ hybridization. These techniques and methods are publicly available and mature, and related kits are commercially available. A part or all of the polynucleotides of the present invention can be used as probes to be fixed on a microarray (Microarray) or a DM chip (also known as a "gene chip") for analyzing differential expression analysis and gene diagnosis of genes in tissues. Human uridine kinase 13 specific primers can also be used to detect human uridine kinase 13 transcripts by RNA-polymerase chain reaction (RT-PCR) in vitro amplification.

 Detection of mutations in the human uridine kinase 13 gene can also be used to diagnose human uridine kinase 13-related diseases. Human uridine kinase 13 mutations include point mutations, translocations, deletions, recombinations, and any other abnormalities compared to normal wild-type human uridine kinase 13 DM sequences. Mutations can be detected using existing techniques such as Southern blotting, DNA sequence analysis, PCR and in situ hybridization. In addition, mutations may affect protein expression, so Northern blotting and Western blotting can be used to indirectly determine whether a gene is mutated.

 The sequences of the invention are also valuable for chromosome identification. This sequence will specifically target a specific position on a human chromosome and can hybridize to it. Currently, specific sites for each gene on the chromosome need to be identified. Currently, only a few chromosome markers based on actual sequence data (repeating polymorphisms) are available for marking chromosome positions. According to the present invention, in order to associate these sequences with disease-related genes, an important first step is to locate these DM sequences on a chromosome.

 In short, PCR primers (preferably 15-35bp) are prepared according to cDM, and the sequences can be located on chromosomes. These primers were then used for PCR screening of somatic hybrid cells containing individual human chromosomes. Only those heterozygous cells containing the human gene corresponding to the primer will produce amplified fragments.

 PCR localization of somatic hybrid cells is a quick way to localize DNA to specific chromosomes. Using the oligonucleotide primers of the present invention, in a similar manner, a set of fragments from a specific chromosome or a large number of genomic clones can be used to achieve sublocalization. Other similar strategies that can be used for chromosomal localization include in situ hybridization, chromosome pre-screening with labeled flow sorting, and pre-selection of hybridization to construct chromosome-specific cDNA libraries.

 Fluorescent in situ hybridization (FISH) of cDM clones with metaphase chromosomes allows precise chromosomal localization in one step. For a review of this technique, see Verma et al., Human Chromosomes: a Manual of Basic Techniques, Pergamon Pres s, New York (1988).

Once the sequence is located at the exact chromosomal location, the physical location of the sequence on the chromosome can be correlated with the genetic map data. These data can be found in V. Mckusick, Mendelian ian Inher i tance in Man (available online with Johns Hopkins University Welch Medical Library). Linkage analysis can then be used to determine the relationship between genes and diseases that are mapped to chromosomal regions.

 Next, the difference in cDNA or genomic sequence between the affected and unaffected individuals needs to be determined. If a mutation is observed in some or all diseased individuals and the mutation is not observed in any normal individuals, the mutation may be the cause of the disease. Comparing affected and unaffected individuals usually involves first looking for structural changes in the chromosomes, such as deletions or translocations that are visible at the chromosomal level or detectable with cDM sequence-based PCR. According to the resolution capabilities of current physical mapping and gene mapping technology, the CDM that is accurately mapped to a disease-related chromosomal region can be one of 50 to 500 potentially pathogenic genes (assuming 1 megabase mapping resolution) Capacity and each 20kb corresponds to a gene).

 The polypeptides, polynucleotides and mimetics, agonists, antagonists and inhibitors of the present invention can be used in combination with a suitable pharmaceutical carrier. These carriers can be water, glucose, ethanol, salts, buffers, glycerol, and combinations thereof. The composition comprises a safe and effective amount of the polypeptide or antagonist, and carriers and excipients which do not affect the effect of the drug. These compositions can be used as drugs for the treatment of diseases.

 The invention also provides a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the invention. Along with these containers, there may be instructional instructions given by government agencies that manufacture, use, or sell pharmaceuticals or biological products, which prompts permission for administration on the human body by government agencies that produce, use, or sell. In addition, the polypeptides of the invention can be used in combination with other therapeutic compounds.

 The pharmaceutical composition can be administered in a convenient manner, such as by a topical, intravenous, intraperitoneal, intramuscular, subcutaneous, intranasal or intradermal route of administration. Human uridine kinase 13 is administered in an amount effective to treat and / or prevent a specific indication. The amount and range of human uridine kinase 13 administered to a patient will depend on many factors, such as the mode of administration, the health conditions of the person to be treated, and the judgment of the diagnostician. Examples

 The present invention is further described below with reference to specific embodiments. It should be understood that these examples are only used to illustrate the present invention and not to limit the scope of the present invention. In the following examples, the experimental methods that specify the specific conditions are generally performed according to conventional conditions, such as those described in Sambrook et al., Molecular Cloning: Laboratory Manual (New York: Cold Harbor Harbor Laboratory Pres s, 1989), Or as recommended by the manufacturer.

 Example 1 Cloning of human uridine kinase 13

Total RM of human fetal brain was extracted by one step method with guanidine isothiocyanate / phenol / chloroform. Quik mRNA Isolat ion Ki t (Qiegene) Isolate poly (A) mRNA from total RNA. 2ug poly (A) mRNA is reverse transcribed to form cDNA. A Smart cDM cloning kit (purchased from Clontech) was used to insert the cDNA fragment into the multiple cloning site of the pBSK (+) vector (Clontech) to transform DH5α to form a cDNA library. Dye terminate cycle react ion sequencing kit (Perkin-Elmer) and ABI 377 automatic sequencer (Perkin-Eltner) were used to determine the sequences at the 5 'and 3' ends of all clones. The determined cDNA sequence was compared with the existing public DM sequence database (Genebank), and it was found that the cDNA sequence of one of the clones 0333f 02 was new DNA. A series of primers were synthesized to determine the inserted cDNA fragments of the clone in both directions. The results showed that clones contained full length cDNA 0333f 02 is l ² 72bp (eg N0 Seq ID: l shown), from 166bp to 513bp with an open reading frame of 348bp (ORF), encoding a novel protein (e.g. Seq ID NO: 2). We named this clone pBS-0333f 02 and the encoded protein was named human uridine kinase 13. Example 2 Cloning of a gene encoding human uridine kinase 13 by RT-PCR

 CDNA was synthesized using fetal brain cell total RNA as a template and ol igo-dT as a primer for reverse transcription reaction. After purification using the Q i a gene kit, the following primers were used for PCR amplification:

 Pr imer 1: 5, — — GGAGCAGATGCACCGATGGACTTG—3, (SEQ ID NO: 3)

 Primer2: 5'- TTTTAGTAAAATCTGAGATTGTAC -3 '(SEQ ID NO: 4)

 Primerl is a forward sequence located at the 5th end of SEQ ID NO: 1, starting at lbp;

 Primer2 is the 3, terminal reverse sequence of SEQ ID NO: 1.

Amplification conditions: 50 μl reaction volume containing 50 mraol / L KCl, lOramol / L Tri s-HCl pH 8.5, 1.5 mg / L MgCl ₂ , 20 (^ mol / L dNTP, lOpmol primer, 1U Taq DM polymerase (Clontech). The reaction was performed on a PE9600 DM thermal cycler (Perkin-Elmer) under the following conditions for 25 cycles: 94 ° C 30sec; 55 ° C 30sec; 72 ° C 2min. At RT- During PCR, β-act in was used as a positive control and template blank was used as a negative control. Amplification products were purified using QIAGEN's kit, and TA cloning kit was used to connect to the PCR vector (Invi trogen's product). DM sequence analysis results The DNA sequence of the PCR product in Table 1 is identical to that of 1 to 1272 bp shown in SEQ ID NO: 1. Example 3 Northern blot analysis of human uridine kinase 13 gene expression

Total RNA extraction in one step [Anal. Biochem 1987, 162, 156-159] This method includes acid guanidinium thiocyanate phenol-chloroform extraction. 4M guanidinium isothiocyanate-25 mM sodium citrate, 0.2M sodium acetate _(P H4, 0) of the tissue was homogenized, 1 volume of phenol and 1/5 volume of chloroform - isoamyl alcohol. (49: 1), mixed with the water absorbing layer centrifugation, isopropanol was added (0.8 vol) and centrifuge the mixture to obtain RM pellet. The obtained RM precipitate was washed with 70% ethanol, dried and dissolved in water. Using 2 g RNA, performed on a 1.2% agarose gel containing 20 mM 3- (N-morpholino) propanesulfonic acid (H7. 0) -5raM sodium acetate-ImM EDTA-2. 2M formaldehyde electrophoresis then transferred to nitrocellulose by a -. ³² P dATP Preparation ^{32 Ρ-} DNA probe labeled by the random primer DNA probes Method used is shown in Figure 1 PCR amplified human uridine acid. Sequence of the kinase 13 coding region (166bp to 513bp). A 32P-labeled probe (about 2 x 10 ⁶ cpm / ral) was hybridized with a nitrocellulose membrane to which RNA was transferred in a solution at 42 ° C overnight. The solution Contains 50% formamide-25raM KH ₂ P0 ₄ (pH7. 4) -5 x SSC-5 x Denhardt's solution and 20 (^ g / ml salmon sperm DNA. After hybridization, the filter is placed at 1 x SSC-0 Wash in 1% SDS at 55 ° C for 30 min. Then, use Phosphor Imager for analysis and quantification. Example 4 In vitro expression, isolation and purification of recombinant human uridine kinase 13

 Based on SEQ ID NO: 1 and the coding region sequence shown in Figure 1, a pair of specific amplification primers were designed, the sequence is as follows:

Pr iraer3: 5'- CCCCATATGATGGAAGCTGAGGAATGTGGACAC -3, (Seq ID No: 5) Pr imer4: 5'- CATGGATCCTTAGAACCTAGCACAAGGTAAATG -3, (Seq ID No: 6) These two primers contain Ndel and BamHI digestion sites respectively Points, followed by the coding sequences of the 5 'and 3' ends of the gene of interest, respectively. The Ndel and BamHI restriction sites correspond to the expression vector plasmid pET-28b (+) (Novagen, Cat. No. 69865. 3) Selective endonuclease site. The PCR reaction was performed using the pBS-0333f 02 plasmid containing the full-length target gene as a template. The PCR reaction conditions were as follows: a total volume of 50 μ1 containing 10 pg of pBS- 0333f 02 plasmid, primers Primer-3 and Primer-4 were 1 Opmol, Advantage polymerase Mix (Clontech) 1 μ1, respectively. Cycle parameters: 94 ° C 20s, 60 ° C 30s, 68 ° C 2 min, a total of 25 cycles. Ndel and BamHI were used to double-digest the amplified product and plasmid pET-28 (+), respectively, and large fragments were recovered and ligated with T4 ligase. The ligation product was transformed into E. coli DH5a by the calcium chloride method. After being cultured overnight on LB plates containing kanamycin (final concentration 3 (g / ml)), positive clones were screened by colony PCR method and sequenced. The correct positive clone (pET-0333f 02) was used to transform the recombinant plasmid into E. coli BL21 (DE3) plySs (product of Novagen) by calcium chloride method. In LB liquid medium containing kanamycin (final concentration 30 μιη1) The host strain BL21 (pET-0333f 02) was cultured at 37 ° C. to the logarithmic growth phase, IPTG was added to a final concentration of 1 μl / L, and the culture was continued for 5 hours. The bacteria were collected by centrifugation, and the bacteria were collected by centrifugation and collected by centrifugation. Chromatography, using an affinity chromatography column His s. Bind Quick Cartr idge (product of Novagen) capable of binding 6 histidines (6His-Tag) to obtain purified human uridine kinase 13. After SDS-PAGE electrophoresis, a single band was obtained at 13 KDa (Figure 2). The band was transferred to a PVDF membrane and analyzed by N-terminal amino acid sequence using the Edams hydrolysis method. The result was 15 N-terminal amino acids Completed with 15 N-terminal amino acid residues shown in SEQ ID NO: 2 the same. Example 5 Production of anti-human uridine kinase 13 antibodies

A peptide synthesizer (product of PE company) was used to synthesize the following human uridine kinase 13-specific peptides: NH2-Met-G 1 uA 1 a— G 1 uG 1 u-Cy s-Gly-His-I l e- Arg-P r o-Leu-Ly s -G 1 u-Pro-COOH (SEQ ID NO: 7). The polypeptide is coupled to hemocyanin and bovine serum albumin to form a complex, respectively. For methods, see: Avrameas, et al. Immunochemis try, 1969; 6: 43. Rabbits were immunized with 4 mg of the hemocyanin polypeptide complex plus complete Freund's adjuvant, and 15 days later, the hemocyanin polypeptide complex plus incomplete Freund's adjuvant was used to boost immunity once. A titer plate coated with a 15 μ _§ / π1 bovine serum albumin peptide complex was used as an ELISA to determine the antibody titer in rabbit serum. Total IgG was isolated from antibody-positive rabbit serum using protein A-Sepharose. The peptide was bound to a cyanogen bromide-activated Sepha _{r0 Se} 4B column, and the anti-peptide antibody was separated from the total IgG by affinity chromatography. The immunoprecipitation method proved that the purified antibody could specifically bind to human uridine kinase 13. Example 6 Application of the polynucleotide fragment of the present invention as a hybridization probe

 The suitable oligonucleotide fragments selected from the polynucleotides of the present invention are used as hybridization probes in various aspects. For example, the probes can be used to hybridize to the genome or CDM library of normal tissue or pathological tissue from different sources to It is determined whether it contains the polynucleotide sequence of the present invention and a homologous polynucleotide sequence is detected. Further, the probe can be used to detect the polynucleotide sequence of the present invention or its homologous polynucleotide sequence in normal tissue or pathology. Whether the expression in tissue cells is abnormal.

The purpose of this embodiment is to select a suitable oligonucleotide fragment from the polynucleotide SEQ ID NO: 1 of the present invention as a hybridization probe, and to identify whether some tissues contain the polynucleoside of the present invention by using a filter hybridization method. Acid sequence or a homologous polynucleotide sequence thereof. Filter hybridization methods include dot blotting, Southern blotting, Northern blotting, and copying methods. They all use the same steps of hybridization after fixing the polynucleotide sample to be tested on the filter. These same steps are as follows: The sample-immobilized filter is first pre-hybridized with a probe-free hybridization buffer, so that the non-specific binding site of the sample on the filter is saturated with the carrier and the synthetic polymer. The pre-hybridization solution is then replaced with a hybridization buffer containing the labeled probe and incubated to hybridize the probe to the target nucleic acid. After the hybridization step, the unhybridized probes are removed by a series of membrane washing steps. This embodiment utilizes higher-intensity washing conditions (such as lower salt concentration and higher temperature) to reduce the hybridization background and retain only strong specific signals. The probes used in this embodiment include two types: the first type of probes are oligonucleotide fragments that are completely the same as or complementary to the polynucleotide SEQ ID NO: 1 of the present invention; the second type of probes are partially related to the present invention The polynucleotide SEQ ID NO: 1 is the same or complementary oligonucleotide fragment. In this embodiment, the dot blot method is used to fix the sample on the filter membrane. Under the high-intensity washing conditions, the first type of probe and the sample have the strongest hybridization specificity and are retained. I. Selection of Probe

 The selection of oligonucleotide fragments from the polynucleotide SEQ ID NO: 1 of the present invention for use as hybridization probes should follow the following principles and several aspects to be considered:

 1. The preferred range of probe size is 18-50 nucleotides;

 2, GC content is 30% -70 »/. If it exceeds, non-specific hybridization increases;

 3. There should be no complementary regions inside the probe;

 4. Those that meet the above conditions can be used as primary selection probes, and then further computer sequence analysis, including the primary selection probe and its source sequence region (ie, SEQ ID NO: 1) and other known genomic sequences and their complements For homology comparison of regions, if the homology with the non-target molecular region is greater than 85% or there are more than 15 consecutive bases, the primary probe should not be used generally;

 5. Whether the preliminary selection probe is finally selected as a probe with practical application value should be further determined by experiments.

 After completing the above analysis, select and synthesize the following two probes:

 Probe 1 (probel), which belongs to the first type of probe, is completely homologous or complementary to the gene fragment of SEQ ID NO: 1 (41Nt):

5'- TGGAAGCTGAGGAATGTGGACACATCCGGCCCTTGAAAGAA -3 '(SBQ ID NO: 8) Probe 2 (probe ² ), which belongs to the second type of probe, is equivalent to the replacement mutant sequence of the gene fragment of SEQ ID NO: 1 or its complementary fragment (41Nt) :

 5'- TGGAAGCTGAGGAATGTGGACACATCCGGCCCTTGAAAGAA -3 '(SEQ ID NO: 9) For other commonly used reagents and their preparation methods not related to the following specific experimental procedures, please refer to the literature: DNA PROBES G. Η · Keller; Stockton Press, 1989 (USA) and more commonly used molecular cloning laboratory manuals such as "Molecular Cloning Laboratory Guide" (Second Edition 1998) [US] Sambrook et al., Science Press.

 Sample Preparation:

 1. Extract DNA from fresh or frozen tissue

Steps: 1) Place fresh or freshly thawed normal liver tissue in a plate immersed in ice and filled with phosphate buffered saline (PBS). Cut the tissue into small pieces with scissors or a scalpel. Tissue should be kept moist during operation. 2) Centrifuge the tissue at 1,000 g for 10 minutes. 3) Suspend the precipitate (about 10 ml / g) with cold homogenization buffer (0.25 mol / L sucrose; 25 mmol / L Tris-HCl, pH 7.5; 25 mmol / L NaCl; 25 mmol / L MgCl ₂ ). 4) at 4. C Use an electric homogenizer to homogenize the tissue suspension at full speed until the tissue is completely broken. 5) Centrifuge at 1000g for 10 minutes. 6) Resuspend the cell pellet (l-5ral per 0.1 g of the initial tissue sample), and centrifuge at 1000g for 10 minutes. 7) Resuspend the pellet with lysis buffer (add 1 ml per 0.1 g of the original tissue sample), then connect the following 2, DNA phenol extraction method

Steps: 1) Wash cells with 1-10 ml of cold PBS and centrifuge at 1000 g for 10 minutes. 2) Resuspend the pelleted cells with cold cell lysate (1 x ^{10 8} cells / ml) and apply a minimum of 100 ul of lysis buffer. 3) Add SDS to a final concentration of 1%. If SDS 'is directly added to the cell pellet before resuspending the cells, the cells may form large clumps that are difficult to break, and reduce the overall yield. This is particularly serious when extracting> 10 ⁷ cells. 4) Add proteinase K to a final concentration of 200ug / ffll. 5) Incubate at 50 ° C for 1 hour or shake gently at 37 ° C overnight. 6) Extract with an equal volume of phenol: chloroform: isoamyl alcohol (25: 24: 1) and centrifuge in a small centrifuge tube for 10 minutes. The two should be clearly separated, otherwise centrifuge again. 7) Transfer the water phase to a new tube. 8) Extract with an equal volume of chloroform: isoamyl alcohol (24: 1) and centrifuge for 10 minutes. 9) Transfer the DNA-containing aqueous phase to a new tube. Purification of DM and ethanol precipitation were then performed.

 3, DNA purification and ethanol precipitation

'Steps: 1) Add 1/10 volume of 2mol / L sodium acetate and 2 volumes of cold 100% ethanol to the DNA solution and mix. At -20. C. Leave for 1 hour or overnight. 2) Centrifuge for 10 minutes. 3) Carefully aspirate or pour out the ethanol. 4) Wash the pellet with 500ul of 70% cold ethanol and centrifuge for 5 minutes. 5) Carefully aspirate or pour out the ethanol. Wash the pellet with 500ul of cold ethanol and centrifuge for 5 minutes. 6) Carefully aspirate or pour out the ethanol, then invert on the absorbent paper to drain off the residual ethanol. Air dry for 10-15 minutes to allow the surface ethanol to evaporate. Be careful not to allow the pellet to dry completely, otherwise it will be more difficult to re-dissolve. 7) Resuspend the DM pellet in a small volume of TE or water. Vortex at low speed or suck with a pipette while gradually increasing TE, mix until DM is fully dissolved, and add approximately 1 ul per 1-5 x 10 ^δ cells extracted.

 The following steps 8-13 are only used when contamination must be removed, otherwise step 14 can be performed directly.

8) Add RMase A to the DNA solution to a final concentration of 100ug / ml, and incubate at 37 ° C for 30 minutes. 9) Add SDS and protease to the final concentration of 0.5% and 100ug / ml. Incubate at 37 ° C for 30 minutes. 10) Extract the reaction solution with an equal volume of phenol: chloroform: isoamyl alcohol (25: 24: 1) and centrifuge for 10 minutes. 11) Carefully remove the aqueous phase and re-extract with an equal volume of chloroform: isoamyl alcohol (24: 1) and centrifuge for 10 minutes. 12) Carefully remove the water phase, add 180 vols of 2raol / L sodium acetate and 2.5 vols of cold ethanol, and mix well-20. C for 1 hour. 13) Use 70% ethanol and 100 ° /. Wash the pellet with ethanol, air dry, and resuspend the nucleic acid. The process is the same as steps 3-6. 14) Determine A ₂₆ . And A _28Q to check the purity and yield of DM. 15) Store at -20 ° C after dispensing.

 Preparation of sample film:

• 1) Take 4 x 2 pieces of nitrocellulose membrane (NC membrane) of appropriate size, and mark the spotting position and sample number on it with a pencil. Two NC membranes are required for each probe so that In the experimental steps, the film was washed with high-strength conditions and strength conditions, respectively. 2) Pipette and control 15 μl each, spot on the sample film, and dry at room temperature.

 3) Place on filter paper infiltrated with 0.1 lraol / L NaOH, 1.5 mol / L NaCl for 5 minutes (twice), dry and place in 0.5 mol / L Tris-HCl (H7.0), 3 mol / L NaCl filter paper for 5 minutes (twice) and allowed to dry.

4) Clamped in clean filter paper, wrapped in aluminum foil, and dried under vacuum at 60-80 ^Q C for 2 hours.

 Labeling of probes

1) 3μ1 Probe (0.1OD / Ιθμΐ), add 2μ1 Kinase buffer, 8-10 uCi γ- ³² P-dATP + 2U Kinase to make up to a final volume of 20μ1. ·

 2) Incubate at 37 "C for 2 hours.

 3) Add 1/5 volume of Bromophenol Blue Indicator (BPB).

 4) Pass through a Sephadex G-50 column.

5) Before the ³² P-Probe is washed out, start collecting the first peak (can be monitored by Monitor).

 6) 5 drops / tube, collect 10-15 tubes.

 7) Monitor the amount of isotope with a liquid scintillator

8) After the collection solution of the first peak is combined, the P-Probe to be prepared (the second peak is free γ ^- 32P-dATP).

 Pre-hybridization

 The sample membrane was placed in a plastic bag, and 3-10 mg of prehybridization solution (lOxDenhardt's; 6xSSC, 0.1 mg / ml CT DNA (calf thymus DNA)) was added. After sealing the mouth of the bag, shake at 68 ° C for 2 hours.

 Cross

 Cut a corner of the plastic bag, add the prepared probe, seal the bag, and shake at 42 ° C in water overnight. Wash film:

 High-intensity washing film:

 1) Take out the hybridized sample membrane.

 2) 2xSSC, 0.1 »Medium, 40. C wash for 15 minutes (twice).

 3) Wash in 0.1xSSC, 0.1% SDS for 15 minutes at 40 ° C (twice).

 4) Wash in 0.1xSSC, 0.1% SDS at 55 ° C for 30 minutes (twice), and dry at room temperature. Low-intensity washing film:

 1) Take out the hybridized sample membrane.

 2) 2xSSC, 0.1% SDS, wash at 37 ° C for 15 minutes (twice).

3) Wash in 0.1xSSC, 0.1% SDS for 15 minutes at 37 ° C (twice). 4) Wash in 0.1xSSC, 0.1% SDS at 40 ° C for 15 minutes (twice), and dry at room temperature. X-ray autoradiography:

 -70 ° C, X-ray autoradiography (pressing time depends on the radioactivity of the hybrid spot).

 Experimental results:,

 The hybridization experiments performed under low-intensity membrane washing conditions showed no significant difference in the radioactive intensity of the above two probes. However, in the hybridization experiments performed under high-intensity membrane washing conditions, the radioactive intensity of probe 1 was significantly stronger than that of hybridization spots. The radioactive intensity of the hybridization spot of the other probe. Therefore, the presence and differential expression of the polynucleotide of the present invention in different tissues can be analyzed qualitatively and quantitatively with the probe 1. Example 7 DNA Microarray

 Gene chip or DNA microarray is a new technology that many national laboratories and large pharmaceutical companies are currently developing and developing. It refers to the orderly and high-density arrangement of a large number of target gene fragments on glass, The data is compared and analyzed on a carrier such as silicon using fluorescence detection and computer software to achieve the purpose of fast, efficient, and high-throughput analysis of biological information. The polynucleotide of the present invention can be used as target DNA for gene chip technology for high-throughput research of new gene functions; search for and screen new tissue-specific genes, especially new genes related to diseases such as tumors; diagnosis of diseases such as hereditary diseases . The specific method steps have been reported in the literature. For example, refer to the literature DeRis i, JL, Lyer, V. & Brown, P. 0. (1997) Science 278, 680-686. And the literature Hel le, RA, Schema , M., Chai, A., Shalom, D., (1997) PNAS 94: 2150-2155.

 (A) spotting

 A total of 4,000 polynucleotide sequences of various full-length cDMs are used as target DNA, including the polynucleotide of the present invention. They were respectively amplified by PCR, and the concentration of the amplified product was adjusted to about 500ng / ul after purification. The spots were spotted on a glass medium with a Cartesian 7500 spotter (purchased from Cartesian Company, USA). The distance between them is 280 μm. The spotted slides were hydrated and dried, cross-linked in a UV cross-linker, and dried after elution to fix the DNA on the glass slides to prepare chips. The specific method steps have been reported in the literature. The sample post-processing steps in this embodiment are:

 1. Hydration in a humid environment for 4 hours;

 2. 0.2% SDS was washed for 1 minute;

 3. dd 0 wash twice, 1 minute each time;

4. NaBH _{4 is} blocked for 5 minutes;

5. 95 ° C water for 2 minutes; 6. 0.2% SDS was washed for 1 minute;

7. Rinse twice with ddH ₂ 0;

 8. Dry and store at 25 ° C in the dark for future use.

 (Two) probe marking

 Total mRNA was extracted from human mixed tissues and specific tissues (or stimulated cell lines) in one step, and the mRNA was purified with Oligotex mRNA Midi Ki t (purchased from QiaGen). Cy3dUTP (5-Amino-propargyl-2'-deoxyuridine 5--triphate coupled to Cy3 f luorescent dye, purchased from Amershara Phamacia Biotech) was used to label the raRNA of human mixed tissue, and the fluorescent reagent Cy5dUTP (5-Amino- propargyl-2 ' -deoxyuridine 5'-triphate coupled to Cy5 fluorescent dye, purchased from Amersham Phamacia Biotech Company, labeled the specific tissue (or stimulated cell line) mR of the body, and the probe was prepared after purification. For specific steps and methods, see:

 Schena, M., Shalon, D., Heller, R. (1996) Proc. Natl. Acad. Sci. USA. Vol. 93: 10614-10619. Schena, M., Shalon, Dari., Davi s, RW (1995) Sc ience. 270 (20): 467-480.

 (Three) cross

 The probes from the two tissues were hybridized with the chip in a UniHyb ™ Hybridization Solution (purchased from TeleChem) hybridization solution for 16 hours, and washed with a washing solution (1 SSC, 0.2% SDS) at room temperature. Scanning was then performed with a ScanArray 3000 scanner (purchased from General Scanning, USA). The scanned images were analyzed and processed with Imagene software (Biodiscovery, USA) to calculate the Cy3 / Cy5 ratio of each point.

 The above specific tissues (or stimulated cell lines) are thymus, testis, muscle, spleen, lung, skin, thyroid, liver, PMA + Ecv304 cell line, PMA-Ecv304 cell line, non-starved L02 cell line, L02 cell line stimulated by arsenic for 1 hour, L02 cell line stimulated by arsenic for 6 hours prostate, heart, lung cancer, fetal bladder, fetal small intestine, fetal large intestine, fetal thymus, fetal muscle, fetal liver, fetal kidney, fetal spleen, fetal brain, Fetal lung and fetal heart. Draw a graph based on these 26 Cy3 / Cy5 ratios (Figure 1). It can be seen from the figure that the expression profiles of human uridine kinase 13 and human uridine kinase according to the present invention are very similar.

Claims

Rights request

1. An isolated polypeptide-human uridine kinase 13, characterized in that it comprises: a polypeptide having the amino acid sequence shown in SEQ ID NO: 2, or an active fragment, analog, or derivative thereof.

 2. The polypeptide according to claim 1, characterized in that the amino acid sequence of the polypeptide, analog or derivative has at least 95% identity with the amino acid sequence shown in SEQ ID NO: 2.

 3. The polypeptide according to claim 2, further comprising a polypeptide having the amino acid sequence shown in SEQ ID NO: 2.

 4. An isolated polynucleotide, characterized in that said polynucleotide comprises one selected from the group consisting of:

 (a) a polynucleotide encoding a polypeptide having an amino acid sequence shown in SEQ ID NO: 2 or a fragment, analog, or derivative thereof;

 (b) a polynucleotide complementary to polynucleotide (a); or

 (c) A polynucleotide that is at least 70% identical to (a) or (b).

 5. The polynucleotide according to claim 4, wherein the polynucleotide comprises a polynucleotide encoding an amino acid sequence represented by SEQ ID NO: 2.

 6. The polynucleotide according to claim 4, characterized in that the sequence of the polynucleotide comprises a sequence at positions 166-51 in SEQ ID NO: 1 or positions 1-1272 in SEQ ID NO: 1. sequence.

 7. A recombinant vector containing an exogenous polynucleotide, characterized in that it is a recombinant constructed from the polynucleotide according to any one of claims 4 to 6 and a plasmid, virus or vector expression vector Carrier.

 8. A genetically engineered host cell containing an exogenous polynucleotide, characterized in that it is selected from one of the following host cells:

 (a) a host cell transformed or transduced with the recombinant vector of claim 7; or

 (b) a host cell transformed or transduced with a polynucleotide according to any one of claims 4-6. '

 9. A method for preparing a polypeptide having human uridine kinase 13 activity, characterized in that the method includes:

 (a) culturing the engineered host cell according to claim 8 under the condition of expressing human uridine kinase 13;

 (b) Isolating a polypeptide having human uridine kinase 13 activity from the culture.

10. An antibody capable of binding to a polypeptide, characterized in that the antibody is capable of binding to human uridine kinase 13 Specific binding antibodies.

 11. A class of compounds that mimic or regulate the activity or expression of a polypeptide, characterized in that they are compounds that mimic, promote, antagonize or inhibit the activity of human uridine kinase 13.

 12. The compound according to claim 11, characterized in that it is an antisense sequence of a polynucleotide sequence or a fragment thereof as shown in SEQ ID NO: 1.

 13. The use of the compound according to claim 11, characterized in that the compound is used for a method for regulating the activity of human uridine kinase 13 in vivo and in vitro.

 14. A method for detecting a disease or disease susceptibility related to the polypeptide according to any one of claims 1-3, characterized in that it comprises detecting the expression amount of the polypeptide, or detecting the polypeptide Activity, or detecting a nucleotide variation in a polynucleotide that causes abnormal expression or activity of the polypeptide.

 15. The use of the polypeptide according to any one of claims 1-3, characterized in that it is used for screening a mimetic, agonist, antagonist or inhibitor of human uridine kinase 13; or Identification of peptide fingerprints.

 16. The use of a nucleic acid molecule according to any one of claims 4-6, characterized in that it is used as a primer for a nucleic acid amplification reaction, or as a probe for a hybridization reaction, or used to make a gene Chip or microarray.

 17. The use of the polypeptide, polynucleotide or compound according to any one of claims 1-6 and 11, characterized in that the polypeptide, polynucleotide or mimetic, agonist, The antagonist or inhibitor is composed of a safe and effective dose with a pharmaceutically acceptable carrier as a pharmaceutical composition for diagnosing or treating a disease associated with human uridine kinase 13 abnormality.

 18. The application of any one of claims 1-6 and 11, the application of the polypeptide, polynucleotide or compound described in claim 1, which is characterized in that the polypeptide, polynucleotide or compound is used to prepare for the treatment of malignant tumors. Drugs for blood diseases, HIV infection and immune diseases and various types of inflammation.