WO2001083540A1 - A novel polypeptide-kiaa0883-44 and the polynucleotide encoding said polypeptide - Google Patents

Abstract

The invention disclosed a new kind of KIAA0883-44 and the polynucleotide encoding said polypeptide and a process for producing the polypeptide by recombinant methods. It also disclosed the method of applying the polypeptide for the treatment of various kinds of diseases, such as cancer, hemopathy, development disease, HIV infection, immune disease and inflammation. The antagonist of the polypeptide and therapeutic use of the same is also disclosed. In addition, it refers to the use of polynucleotide encoding said KIAA0883-44.

Description

 A new peptide I ~ KIAA0883-44 and a polynucleotide encoding this polypeptide

 The present invention belongs to the field of biotechnology. Specifically, the present invention describes a new polypeptide, KIAA0883-44, and a polynucleotide sequence encoding the polypeptide. The invention also relates to a preparation method and application of the polynucleotide and polypeptide. Background

 "As part of a cDM scheme to infer the coding sequence of undetermined human genes, we recently identified a series of 100 cDM clones of different sizes cloned from a human brain cDNA library, and predicted the coding sequences of the corresponding genes. , Named KIAA0919 to KIAA1018. The sequence of these clones indicates that the average size of all introns and the corresponding open reading frame size are 4.9kb and 2.6kb (882 amino acid residues). Analysis by computer data shows that this 87 genes in 100 clones have high homology with known genes. 53% of the genes (46 genes) encode proteins that interact with cell signals / cells, cell structure / motion, and nucleic acids. These genes are expressed in 10 human tissues, 8 brain regions (tonsils, corpus callosum, cerebellum, caudate nucleus, hippocampus, thalamic nucleus, thalamus, substantia nigra), spinal cord, fetal brain and fetal liver [Takahi ro Nagase, Ken-ichi Ishikawa et al., 1999, DNA Research., 6, 63-70].

 In the study of these genes, we paid particular attention to those genes that encode large proteins, which may play an important role in mammals [Ohara, 0., Nagase, T., I shikawa, KI et a l , 1997, DNA Research., 4, 53-59] [Nagase, T, Ishikawa, KI, Suyama, M, et al. 1998, DNA Research., 5, 355-364]. It is worth noting that in addition to being expressed in 10 human tissues, these large proteins are also expressed in various parts of the human central nervous system and fetal brain, which indicates that they play an important role in the human nervous system. .

 In polyacrylamide gel electrophoresis with sodium dodecanesulfonate, these large proteins have a molecular weight of approximately 50 kDa. Among them, the KIAA0883 gene has a cD size of about 4.3 kb, and its corresponding open reading frame is about 364 amino acid residues. Its repeating sequence includes Alu, LI, MER, and MIR. The termination password in the box is located in the upstream region of the first ATG password, and follows the Kozak rule [Kozak, M. 1996, Mammal ian Genome, 7, 563-574].

As mentioned above, the function of KIAA0883 protein is related to cell signalling / communication, cell structure / movement, and nucleic acid control. It is expressed in 10 human tissues and 8 brain regions, spinal cord, fetal brain, and fetal liver. The polypeptide of the present inventor has 41% homology and 64% homology with the KIAA0883 protein at the protein level, and has several conservative amino acid points of such proteins. Based on the above points, the new gene identified in the present invention is a gene encoding the KIAA0883 protein similar to the gene named KIAA0883-44, and it is inferred that the protein is similar to the KIAA0883 protein and has similar biological functions.

 As mentioned above, KIAA0883-44 protein plays an important role in regulating important functions of the body such as cell division and embryo development, and it is believed that a large number of proteins are involved in these regulatory processes, so there has been a need in the art to identify more KIAA0883 involved in these processes- 44 proteins, especially the amino acid sequence of this protein. The isolation of the new KIAA0883-44 protein encoding gene also provides the basis for research to determine the role of this protein in health and disease states. This protein may form the basis for the development of diagnostic and / or therapeutic drugs for diseases, so it is important to isolate its coding for DM. Object of the invention

 It is an object of the present invention to provide an isolated new polypeptide "KIAA0883-44 and fragments thereof,

'Another object of the present invention is to provide a polynucleotide encoding the polypeptide.

 Another object of the present invention is to provide a recombinant vector comprising a polynucleotide encoding ΠAA0883-44.

 Another object of the present invention is to provide a genetically engineered host cell containing a polynucleotide encoding ΠAA0883-44.

 Another object of the present invention is to provide a method for producing ΠAA0883-44.

 Another object of the present invention is to provide an antibody against the polypeptide ~~ IAA0883-44 of the present invention. Another object of the present invention is to provide mimic compounds, antagonists, agonists, and inhibitors directed to the polypeptide of the present invention KIAA0883-44.

 Another object of the present invention is to provide a method for diagnosing and treating diseases related to abnormalities of KIAA0883-44. Summary of invention

 The present invention relates to an isolated polypeptide, which is of human origin and comprises: a polypeptide having the amino acid sequence of SEQ ID No. 2, or a conservative variant, biologically active fragment or derivative thereof. Preferably, the polypeptide is a polypeptide having the amino acid sequence of SEQ ID NO: 2.

The invention also relates to an isolated polynucleotide comprising a nucleotide sequence or a variant thereof selected from the group consisting of: (a) a polynucleotide encoding a polypeptide having the amino acid sequence of SEQ ID No. 2;

 (b) a polynucleotide complementary to polynucleotide (a);

 (c) A polynucleotide having at least 70% identity to a polynucleotide sequence of (a) or (b).

 More preferably, the sequence of the polynucleotide is one selected from the group consisting of: (a) a sequence having positions 747-1958 in SEQ ID NO: 1; and (b) a sequence having positions 1-2472 in SEQ ID NO: 1 Sequence of bits.

 The present invention further relates to a vector, particularly an expression vector, containing the polynucleotide of the present invention; a host cell genetically engineered with the vector, including a transformed, transduced or transfected host cell; Host cell and method of preparing the polypeptide of the present invention by recovering the expression product.

 The invention also relates to an antibody capable of specifically binding to a polypeptide of the invention.

 The present invention also relates to a method for screening compounds that mimic, activate, antagonize or inhibit the activity of ΠAA0883-44 protein, which comprises using the polypeptide of the present invention. The invention also relates to compounds obtained by this method.

 The invention also relates to a method for in vitro detection of a disease or susceptibility to disease associated with abnormal expression of KIAA0883- 44 protein, which comprises detecting a mutation in the polypeptide or a polynucleotide sequence encoding the same in a biological sample, or detecting the mutation in the biological sample. The amount or biological activity of the polypeptide of the invention.

 The invention also relates to a pharmaceutical composition comprising a polypeptide of the invention or a mimetic thereof, an activator, an antagonist or an inhibitor, and a pharmaceutically acceptable carrier.

 The present invention also relates to the use of the polypeptide and / or polynucleotide of the present invention in the preparation of a medicament for treating cancer, developmental disease or immune disease or other diseases caused by the abnormal expression of KIAA0883-44.

 Other aspects of the invention will be apparent to those skilled in the art from the disclosure of the techniques herein. BRIEF DESCRIPTION OF THE DRAWINGS

 The following drawings are used to illustrate specific embodiments of the invention, but not to limit the scope of the invention as defined by the claims.

 FIG. 1 is a comparison diagram of amino acid sequence homology of the ΠAAAA3-43-4 and KIAA0883 proteins of the present invention. The upper sequence is KIAA0883-44, and the lower sequence is KIAA0883 protein. Identical amino acids are represented by single-character amino acids between the two sequences, and similar amino acids are represented by "+".

Figure 2 shows the polyacrylamide gel electrophoresis (SDS-PAGE) of the isolated KIAA0883-44. 44KDa is the molecular weight of the protein. The arrow indicates the isolated protein band. Summary of the invention

 The following terms used in this specification and claims have the following meanings unless specifically stated: "Nucleic acid sequence" refers to an oligonucleotide, a nucleotide or a polynucleotide and a fragment or part thereof, and may also refer to a genomic or synthetic DNA or RNA, they can be single-stranded or double-stranded, representing the sense or antisense strand. Similarly, the term "amino acid sequence" refers to an oligopeptide, peptide, polypeptide or protein sequence and fragments or portions thereof. When the "amino acid sequence" in the present invention relates to the amino acid sequence of a naturally occurring protein molecule, such "polypeptide" or "protein" does not mean to limit the amino acid sequence to a complete natural amino acid related to the protein molecule . '

 A "variant" of a protein or polynucleotide refers to an amino acid sequence having one or more amino acids or nucleotide changes or a polynucleotide sequence encoding it. The changes may include deletions, insertions or substitutions of amino acids or nucleotides in the amino acid sequence or nucleotide sequence. Variants can have "conservative" changes, in which the amino acid substituted has a structural or chemical property similar to the original amino acid, such as replacing isoleucine with leucine. Variants can also have non-conservative changes, such as replacing glycine with tryptophan.

 "Deletion" refers to the deletion of one or more amino acids or nucleotides in an amino acid sequence or nucleotide sequence.

 "Insertion" or "addition" means that a change in the amino acid sequence or nucleotide sequence results in an increase in one or more amino acids or nucleotides compared to a molecule that exists in nature. "Replacement" refers to the replacement of one or more amino acids or nucleotides with different amino acids or nucleotides.

 "Biological activity" refers to a protein that has the structure, regulation, or biochemical function of a natural molecule. Similarly, the term "immunologically active" refers to the ability of natural, recombinant or synthetic proteins and fragments thereof to induce a specific immune response and to bind specific antibodies in a suitable animal or cell.

 An "agonist" refers to a molecule that, when combined with ΠAA883-44, causes a change in the protein to regulate the activity of the protein. An agonist may include a protein, a nucleic acid, a carbohydrate, or any other molecule that can bind to KIAA0883-44.

 An "antagonist" or "inhibitor" refers to a molecule that blocks or regulates the biological or immunological activity of KIAA0883-44 when combined with ΠAA0883-44. Antagonists and inhibitors may include proteins, nucleic acids, carbohydrates or any other molecule that can bind KIAA0883-44.

 "Regulation" refers to a change in the function of KIAA0883-44, including an increase or decrease in protein activity, a change in binding properties, and any other biological, functional, or immune properties of KIAA0883-44.

"Substantially pure" means substantially free of other proteins, lipids, sugars or other substances with which it is naturally associated. Those skilled in the art can purify KIAA0883-44 using standard protein purification techniques. Basically pure KIAA0883-44 produces a single main band on a non-reducing polyacrylamide gel. The purity of KIAA0883- 44 polypeptide can be analyzed by amino acid sequence.

 "Complementary" or "complementary" refers to the natural binding of polynucleotides by base-pairing under conditions of acceptable salt concentration and temperature. For example, the sequence "C-T-G-A" can be combined with the complementary sequence "G-A-C-T". The complementarity between two single-stranded molecules may be partial or complete. The degree of complementarity between nucleic acid strands has a significant effect on the efficiency and strength of hybridization between nucleic acid strands.

 "Homology" refers to the degree of complementarity and can be partially homologous or completely homologous. "Partial homology" refers to a partially complementary sequence that at least partially inhibits hybridization of a fully complementary sequence to a target nucleic acid. This inhibition of hybridization can be detected by performing hybridization (Southern imprinting or Nor thern blotting, etc.) under conditions of reduced stringency. Substantially homologous sequences or hybridization probes can compete and inhibit the binding of fully homologous sequences to the target sequence under conditions of reduced stringency. This does not mean that the conditions of reduced stringency allow non-specific binding, because the conditions of reduced stringency require that the two sequences bind to each other as a specific or selective interaction.

 "Percent identity" refers to the percentage of sequences that are the same or similar in a comparison of two or more amino acid or nucleic acid sequences. Percent identity can be determined electronically, such as through the MEGALIGN program

(Lasergene sof tware package, DNASTAR, Inc., Madi son Wi s.). The MEGALIGN program can compare two or more sequences (Higgins, D. G. and

P. M. Sharp (1988) Gene 73: 237-244). The Clus ter method arranges groups of sequences into clusters by checking the distance between all pairs. The clusters are then assigned in pairs or groups. The percent identity between two amino acid sequences such as sequence A and sequence B is calculated by the following formula:

 Number of residues between sequence and sequence

Residues sequences - sequences spacer residues - the sequence of residues ^X interval S

Can also Clus ter or a method well known in the art such as the Jotun Hein measuring the percentage identity between nucleic acid sequences (Hein L, (1990) Methods in enzymology 183: 625-645) 0

"Similarity" refers to the degree of identical or conservative substitutions of amino acid residues at corresponding positions in the alignment of amino acid sequences. Amino acids used for conservative substitution, for example, negatively charged amino acids may include aspartic acid and glutamic acid; positively charged amino acids may include lysine and arginine; having an uncharged head group is Similar hydrophilic amino acids may include leucine, isoleucine and valine; glycine and alanine; asparagine and glutamine; serine and threonine; phenylalanine and tyrosine.

 "Antisense" refers to a nucleotide sequence that is complementary to a particular DNA or RNA sequence. "Antisense strand" refers to a nucleic acid strand that is complementary to a "sense strand."

"Derivative" refers to HFP or a chemical modification of its nucleic acid. This chemical modification can be Replace a hydrogen atom with an alkyl, acyl or amino group. Nucleic acid derivatives can encode polypeptides that retain the main biological properties of natural molecules.

"Antibody" refers to a complete antibody molecule and its fragments, such as Fa,? (') ₂ and? , It can specifically bind to the epitope of ΠΑΑ0883-44.

 A "humanized antibody" refers to an antibody in which the amino acid sequence of a non-antigen binding region is replaced to become more similar to a human antibody, but still retains the original binding activity.

 The term "isolated" refers to the removal of a substance from its original environment (for example, its natural environment if it is naturally occurring). For example, a naturally-occurring polynucleotide or polypeptide is not isolated when it is present in a living thing, but the same polynucleotide or polypeptide is separated from some or all of the substances that coexist with it in the natural system. Such a polynucleotide may be part of a certain vector, or such a polynucleotide or polypeptide may be part of a certain composition. Since the carrier or composition is not part of its natural environment, they are still isolated.

 As used herein, "isolated" refers to the separation of a substance from its original environment (if it is a natural substance, the original environment is the natural environment). For example, polynucleotides and polypeptides in a natural state in a living cell are not isolated and purified, but the same polynucleotides or polypeptides are separated and purified if they are separated from other substances in the natural state .

 As used herein, "isolated KIAA0883-44" means that KIAA0883-44 is substantially free of other proteins, lipids, sugars, or other substances with which it is naturally associated. Those skilled in the art can purify ΠΑΑ0883- 44 using standard protein purification techniques. Substantially pure polypeptides can produce a single main band on a non-reducing polyacrylamide gel. The purity of ΠAA0883- 44 polypeptide can be analyzed by amino acid sequence.

 The present invention provides a new polypeptide "KIAA0883-44", which is basically composed of the amino acid sequence shown in SEQ ID NO: 2. The polypeptide of the present invention may be a recombinant polypeptide, a natural polypeptide, a synthetic polypeptide, preferably recombinant Polypeptides. Polypeptides of the invention can be naturally purified products or chemically synthesized products, or can be produced from prokaryotic or eukaryotic hosts (eg, bacteria, yeast, higher plants, insects, and mammalian cells) using recombinant techniques. According to For the host used in the recombinant production scheme, the polypeptide of the present invention may be glycosylated or may be non-glycosylated. The polypeptide of the present invention may also include or exclude the initial methionine residue.

The invention also includes fragments, derivatives and analogs of KIAA0883-44. As used in the present invention, the terms "fragment", "derivative" and "analog" refer to a polypeptide that substantially maintains the same biological function or activity of KIAA0883-44 of the present invention. A fragment, derivative or analog of the polypeptide of the present invention may be: (I) a type in which one or more amino acid residues are substituted with conservative or non-conservative amino acid residues (preferably conservative amino acid residues), and the substitution The amino acid may or may not be encoded by the genetic code; or (Π) such a group in which one or more amino acid residues Substituting by other groups to include substituents; or (III) such that the mature polypeptide is fused with another compound (such as a compound that extends the half-life of the polypeptide, such as polyethylene glycol); or (IV) such a, A polypeptide sequence (such as a leader sequence or a secreted sequence or a sequence used to purify this polypeptide or a protease sequence) formed by fused additional amino acid sequences into a mature polypeptide. As set forth herein, such fragments, derivatives and analogs are considered to be within the knowledge of those skilled in the art.

 The present invention provides an isolated nucleic acid (polynucleotide), which basically consists of a polynucleotide encoding a polypeptide having the amino acid sequence of SEQ ID NO: 2. The polynucleotide sequence of the present invention includes the nucleotide sequence of SEQ ID NO: 1. The polynucleotide of the present invention is found from a CDM library of human fetal brain tissue. It contains a polynucleotide sequence of 2472 bases in length and its open reading frame 747-1958 encodes 403 amino acids. Based on the amino acid sequence homology comparison, it was found that this peptide has 41% homology with the KIAA0883 protein, and it can be deduced that the KIAA0883-44 has a similar structure and function to the KIAA0883 protein.

 The polynucleotide of the present invention may be in the form of DNA or RNA. DNA forms include cDNA, genomic DM, or synthetic DM. DNA can be single-stranded or double-stranded. DNA can be coding or non-coding. The coding region sequence encoding a mature polypeptide may be the same as the coding region sequence shown in SEQ ID NO: 1 or a degenerate variant. As used herein, a "degenerate variant" refers to a nucleic acid sequence encoding a protein or polypeptide having SEQ ID NO: 2 but different from the coding region sequence shown in SEQ ID NO: 1 in the present invention.

 The polynucleotide encoding the mature polypeptide of SEQ ID NO: 2 includes: only the coding sequence of the mature polypeptide; the coding sequence of the mature polypeptide and various additional coding sequences; the coding sequence of the mature polypeptide (and optional additional coding sequences); Coding sequence.

 The term "polynucleotide encoding a polypeptide" refers to a polynucleotide comprising the polypeptide and a polynucleotide comprising additional coding and / or non-coding sequences.

 The invention also relates to variants of the polynucleotides described above, which encode polypeptides or fragments, analogs and derivatives of polypeptides having the same amino acid sequence as the invention. Variants of this polynucleotide can be naturally occurring allelic variants or non-naturally occurring variants. These nucleotide variants include substitution variants, deletion variants, and insertion variants. As known in the art, an allelic variant is an alternative form of a polynucleotide that may be a substitution, deletion, or insertion of one or more nucleotides, but does not substantially change the function of the polypeptide it encodes .

The invention also relates to a polynucleotide that hybridizes to the sequence described above (having at least 50%, preferably 70% identity between the two sequences). The invention particularly relates to polynucleotides that can hybridize to the polynucleotides of the invention under stringent conditions. In the present invention, "strict conditions" means: (1) hybridization and elution at lower ionic strength and higher temperature, such as 0.2xSSC, 0.1% SDS, 60 ° C; or (2) Cross When using a denaturant, such as 50 ° /. (V / v) formamide, 0.1% calf serum / 0.1% Ficol l, 42 ° C, etc .; or (3) only the identity between the two sequences is at least 95% or better, preferably Hybridization occurs only when it is above 97%. In addition, the polypeptide encoded by the hybridizable polynucleotide has the same biological function and activity as the mature polypeptide shown in SEQ ID NO: 2.

 The invention also relates to nucleic acid fragments that hybridize to the sequences described above. As used in the present invention, a "nucleic acid fragment" contains at least 10 nucleotides in length, preferably at least 20-30 nucleotides, more preferably at least 50-60 nucleotides, and most preferably at least 100 nuclei. Glycylic acid or more. Nucleic acid fragments can also be used in nucleic acid amplification techniques, such as PCR, to identify and / or isolate polynucleotides encoding KIAA0883-44.

 The polypeptides and polynucleotides in the present invention are preferably provided in an isolated form and are more preferably purified to homogeneity. The specific polynucleotide sequence encoding the KIAA0883-44 of the present invention can be obtained by various methods. For example, polynucleotides are isolated using hybridization techniques well known in the art. These techniques include, but are not limited to: 1) hybridization of probes to genomic or cDNA libraries to detect homologous polynucleotide sequences, and 2) antibody screening of expression libraries to detect cloned polynucleosides with common structural characteristics Acid fragments.

 The DNA fragment sequence of the present invention can also be obtained by the following methods: 1) isolating the double-stranded DNA sequence from the genomic DNA; 2) chemically synthesizing the DNA sequence to obtain the double-stranded DM of the polypeptide.

 Of the methods mentioned above, genomic DNA isolation is the least commonly used. Direct chemical synthesis of DNA sequences is often the method of choice. The more commonly used method is the separation of cDM sequences. The standard method for isolating the cDNA of interest is to isolate mRNA from donor cells that overexpress the gene and perform reverse transcription to form a plasmid or phage cDNA library. Various methods have been used to extract mRNA, and kits are also commercially available (Qiagene). The construction of a CDM library is also a common method (Sambrook, et al., Molecular Cloning, A Laboratory Manua, Cold Spring Harbor Laboratory. New York, 1989). Commercially available cDNA libraries are also available, such as different cDNA libraries from Clontech. When polymerase reaction technology is used in combination, even very small expression products can be cloned.

 The genes of the present invention can be selected from these cDNA libraries by conventional methods. These methods include (but are not limited to): (l) DNA-DNA or DNA-RNA hybridization; (2) the presence or absence of marker gene functions; (3) determination of the level of transcripts of KIAA0883-44; (4) immunization Technology or measurement of biological activity to detect gene-expressed protein products. The above methods can be used singly or in combination.

In the method (1), the probe used for hybridization is homologous to any part of the polynucleotide of the present invention, and its length is at least 10 nucleotides, preferably at least 30 nucleotides, more preferably At least 50 nucleotides, preferably at least 100 nucleotides. In addition, the length of the probe is usually within 2000 nucleotides, preferably within 1000 nucleotides. The probe used herein is generally a DNA sequence chemically synthesized based on the gene sequence information of the present invention. The gene or fragment of the present invention may of course Used as a probe. DNA probes can be labeled with radioisotopes, luciferin, or enzymes (such as alkaline phosphatase). In the (4) method, immunological techniques such as Western blotting, radioimmunoprecipitation, and enzyme-linked immunosorbent assay (ELISA) can be used to detect protein products expressed by the KIAA0883-44 gene.

 A method (Sa iki, et al. Science 1985; 230: 1350-1354) using PCR technology to amplify DNA / RNA is preferably used to obtain the gene of the present invention. In particular, when it is difficult to obtain full-length cDNA from a library, the RACE method (RACE-rapid amplification of cDNA ends) can be preferably used. The primers used for PCR can be appropriately based on the polynucleotide sequence information of the present invention disclosed herein. Select and synthesize using conventional methods. The amplified DNA / RNA fragments can be isolated and purified by conventional methods such as by gel electrophoresis.

 The polynucleotide sequence of the gene of the present invention or various DM fragments and the like obtained as described above can be measured by a conventional method such as dideoxy chain termination method (Sanger et al. PNAS, 1977, 74: 5463-5467). Such polynucleotide sequences can also be determined using commercial sequencing kits and the like. In order to obtain the full-length cDNA sequence, sequencing needs to be repeated. Sometimes it is necessary to determine the cDNA sequence of multiple clones in order to splice into a full-length cDNA sequence.

 The present invention also relates to a vector comprising a polynucleotide of the present invention, and a host cell genetically engineered using the vector of the present invention or directly using a KIAA0883-44 coding sequence, and a method for producing a polypeptide of the present invention by recombinant technology.

 In the present invention, the polynucleotide sequence encoding ΠΑΑ0883-44 can be inserted into a vector to constitute a recombinant vector containing the polynucleotide of the present invention. The term "vector" refers to bacterial plasmids, phages, yeast plasmids, plant cell viruses, mammalian cell viruses such as adenoviruses, retroviruses, or other vectors well known in the art. Vectors suitable for use in the present invention include, but are not limited to: T7 promoter-based expression vectors (Rosenberg, et al. Gene, 1987, 56: 125) expressed in bacteria; pMSXND expression vectors expressed in mammalian cells (Lee and Nathans, J Bio Chem. 263: 3521, 1988) and baculovirus-derived vectors expressed in insect cells. In short, as long as it can be replicated and stabilized in the host, any plasmid and vector can be used to construct a recombinant expression vector. An important feature of expression vectors is that they usually contain origins of replication, promoters, marker genes, and translational regulatory elements.

Methods known to those skilled in the art can be used to construct expression vectors containing DNA sequences encoding ΠAA0883-44 and appropriate transcriptional / translational regulatory elements. These methods include in vitro recombinant DM technology, DNA synthesis technology, in vivo recombination technology, etc. (Sambroook, et al. Molecular Cloning, a Laboratory Manual, Cold Spice Harbor Laboratory. New York, 1989). The DNA sequence can be operably linked to an appropriate promoter in an expression vector to guide mRM synthesis. Representative examples of these promoters are: the lac or trp promoter of E. coli; the PL promoter of lambda phage; eukaryotic promoters include the CMV immediate early promoter, HSV thymidine kinase promoter, early and The late SV40 promoter, retroviral LTRs, and other known promoters that control the expression of genes in prokaryotic or eukaryotic cells or their viruses. The expression vector also includes a ribosome binding site and a transcription terminator for translation initiation. Insertion of enhancer sequences into the vector will enhance its transcription in higher eukaryotic cells. Enhancers are cis-acting factors for DNA expression, usually about 10 to 300 base pairs, which act on promoters to enhance gene transcription. Illustrative examples include SV40 enhancers of 100 to 270 base pairs on the late side of the origin of replication, polyoma enhancers on the late side of the origin of replication, and adenoviral enhancers.

 In addition, the expression vector preferably contains one or more selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture. Fluorescent protein (GFP), or tetracycline or ampicillin resistance for E. coli.

 Those of ordinary skill in the art will know how to select appropriate vector / transcription control elements (such as promoters, enhancers, etc.) and selectable marker genes.

 In the present invention, a polynucleotide encoding KIAA0883-44 or a recombinant vector containing the polynucleotide can be transformed or transduced into a host cell to constitute a genetically engineered host cell containing the polynucleotide or the recombinant vector. The term "host cell" refers to a prokaryotic cell, such as a bacterial cell; or a lower eukaryotic cell, such as a yeast cell; or a higher eukaryotic cell, such as a mammalian cell. Representative examples are: Escherichia coli, Streptomyces; bacterial cells such as Salmonella typhimurium; fungal cells such as yeast; plant cells; insect cells such as fly S2 or Sf9; animal cells such as CH0, COS or Bowes melanoma cells.

Transformation of a host cell with a DNA sequence described in the present invention or a recombinant vector containing the DNA sequence can be performed using conventional techniques well known to those skilled in the art. When the host is a prokaryote such as E. coli, competent cells capable of DNA uptake can be harvested after exponential growth phase, with (Treatment 1 ₂ ^, with steps well known in the art. Alternatively, it is a MgCl _2. If necessary, transformation can also be performed by electroporation. When the host is a eukaryotic organism, the following DNA transfection methods can be used: calcium phosphate co-precipitation method, or conventional mechanical methods such as microinjection, electroporation, and liposomes Packaging, etc.

 Using conventional recombinant DNA technology, the polynucleotide sequence of the present invention can be used to express or produce recombinant KIAA0883- 44 (Science, 1984; 224: 1431). Generally, the following steps are followed:

 (1) using the polynucleotide (or variant) encoding human KIAA0883-44 of the present invention, or transforming or transducing a suitable host cell with a recombinant expression vector containing the polynucleotide;

 (2) culturing host cells in a suitable medium;

 (3) Isolate and purify protein from culture medium or cells.

In step (2), depending on the host cell used, the medium used in the culture may be selected from various conventional mediums. Culture is performed under conditions suitable for host cell growth. When host cells grow to proper After inducing the cell density, the appropriate promoter (such as temperature conversion or chemical induction) is used to induce the selected promoter, and the cells are cultured for a period of time.

 In step (3), the recombinant polypeptide may be coated in a cell, expressed on a cell membrane, or secreted outside the cell. If necessary, the recombinant protein can be isolated and purified by various separation methods using its physical, chemical and other properties. These methods are well known to those skilled in the art. These methods include, but are not limited to: conventional renaturation treatment, protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, Ion exchange chromatography, high performance liquid chromatography (HPLC), and various other liquid chromatography techniques and combinations of these methods.

 The polypeptides of the present invention, as well as antagonists, agonists and inhibitors of the polypeptides, can be directly used in the treatment of diseases, for example, they can treat malignant tumors, adrenal deficiency, skin diseases, various types of inflammation, HIV infection, and immune diseases.

 The polypeptide of the present invention has high homology with the ΠΑΑ0883 protein found in the human fetal brain, and contains the characteristic sequences of the KIAA0883 protein family, both of which have similar biological functions. ΠΑΑ0883 protein is a large protein that is involved in cell signaling / exchange, cell structure / movement, and nucleic acid control in vivo. The polypeptide of the present invention is also related to cell signaling / exchange, cell structure / movement, and nucleic acid control. It is expressed in multiple tissues and brain regions, especially in the spinal cord, fetal brain, and fetal liver. The abnormal expression of the polypeptide of the present invention will affect the signal transmission between cells, the development and regulation of nerve cells, thereby affecting the normal life activities of the body and causing related diseases.

 It can be seen that the abnormal expression of KIAA0883-44 of the present invention will produce various diseases, especially various tumors, embryonic development disorders, growth and development disorders, inflammation, and immune diseases. These diseases include, but are not limited to:

 Tumors of various tissues: stomach cancer, liver cancer, lung cancer, esophageal cancer, breast cancer, leukemia, lymphoma, thyroid tumor, uterine fibroids, neuroblastoma, astrocytoma, ependymoma, glioblastoma, nerve Fibroma, colon cancer, melanoma, bladder cancer, uterine cancer, endometrial cancer, thymic tumor,-nasopharyngeal cancer, laryngeal cancer, tracheal tumor, fibroid, fibrosarcoma, lipoma, liposarcoma

 Fetal developmental disorders: congenital abortion, cleft palate, limb loss, limb differentiation disorder, atrial septal defect, neural tube defect, congenital hydrocephalus, congenital glaucoma or cataract, congenital deafness

 Growth and development disorders: mental retardation, brain development disorders, skin, fat and muscular dysplasia, bone and joint dysplasia, various metabolic deficiencies, stunting, dwarfism, Cushing syndrome, Sexual retardation

Inflammation: chronic active hepatitis, sarcoidosis, polymyositis, chronic rhinitis, chronic gastritis, cerebrospinal multiple sclerosis, glomerulonephritis, myocarditis, cardiomyopathy, atherosclerosis, gastric ulcer, uterus Neckitis, various infectious inflammations

 Immune diseases: Systemic lupus erythematosus, rheumatoid arthritis, bronchial asthma, urticaria, specific dermatitis, post-infection myocarditis, scleroderma, myasthenia gravis, Guillain-Barre syndrome, common variable immunodeficiency disease , Primary B-lymphocyte immunodeficiency disease, Acquired immunodeficiency syndrome

 The abnormal expression of KIAA0883-44 of the present invention will also produce certain hereditary, hematological diseases and the like. The polypeptide of the present invention and the antagonists, agonists and inhibitors of the polypeptide can be directly used in the treatment of diseases, for example, it can treat various diseases, especially various tumors, embryonic development disorders, growth and development disorders, inflammation, and immunity. Sexual diseases, certain hereditary, blood diseases, etc.

 The invention also provides methods for screening compounds to identify agents that increase (agonist) or suppress (antagonist) KIAA0883-44. Agonists enhance biological functions such as KIAA0883-44 to stimulate cell proliferation, while antagonists prevent and treat disorders related to excessive cell proliferation, such as various cancers. For example, mammalian cells or membrane preparations expressing KIAA0883-44 can be cultured with labeled KIAA0883-44 in the presence of a drug. The ability of the drug to increase or block this interaction is then determined.

 Antagonists of KIAA0883-44 include antibodies, compounds, receptor deletions, and analogs that have been screened. The antagonist of KIAA0883-44 can bind to KIAA0883-44 and eliminate its function, or inhibit the production of the polypeptide, or bind to the active site of the polypeptide so that the polypeptide cannot perform biological functions.

 When screening compounds as antagonists, KIAA0883-44 can be added to bioanalytical assays to determine whether a compound is an antagonist by measuring the effect of the compound on the interaction between ΠAA0883-44 and its receptor. Receptor deletions and analogs that act as antagonists can be screened in the same manner as described above for screening compounds. Polypeptide molecules capable of binding to ΠΑΑ0883- 44 can be obtained by screening a random peptide library composed of various possible combinations of amino acids bound to a solid phase. When screening, the KIAA0883-44 molecule should generally be labeled.

 The present invention provides a method for producing antibodies using polypeptides, and fragments, derivatives, analogs or cells thereof as antigens. These antibodies can be polyclonal or monoclonal antibodies. The invention also provides antibodies against the KIAA0883- 44 epitope. These antibodies include (but are not limited to): polyclonal antibodies, monoclonal antibodies, chimeric antibodies, single chain antibodies, Fab fragments, and fragments produced by Fab expression libraries.

Polyclonal antibodies can be produced by injecting IAAA0883-44 directly into immunized animals (such as rabbits, mice, rats, etc.). A variety of adjuvants can be used to enhance the immune response, including but not limited to Freund's adjuvant. Techniques for preparing ΠΑΑ0883-44 monoclonal antibodies include, but are not limited to, hybridoma technology (Kohler and Mistein. Nature, 1975, 256: 495-497), triple tumor technology, human beta-cell hybridoma technology, and EBV-hybridization. Tumor technology, etc. Chimeric antibodies that bind human constant regions and non-human-derived variable regions can be produced using existing techniques (Morrison et al, PMS, 1985, 81: 6851). Single-chain antibodies The body technology (US Pat No. 4946778) can also be used to produce single chain antibodies against KIAA0883-44. Anti-KIAA0883-44 antibodies can be used in immunohistochemistry to detect KIAA0883-44 in biopsy specimens.

 Monoclonal antibodies that bind to KIAA0883-44 can also be labeled with radioisotopes and injected into the body to track their location and distribution. This radiolabeled antibody can be used as a non-invasive diagnostic method to locate tumor cells and determine whether there is metastasis.

 Antibodies can also be used to design immunotoxins that target a particular part of the body. For example, ΠΑΑ0883- 44 monoclonal antibodies with high affinity can covalently bind to bacterial or phytotoxins (such as diphtheria toxin, ricin, ormosine, etc.). A common method is to attack the amino group of an antibody with a thiol cross-linking agent such as SPDP and bind the toxin to the antibody through the exchange of disulfide bonds. This hybrid antibody can be used to kill ΠΑΑ0883- 44 positive cells.

 The antibodies of the present invention can be used to treat or prevent diseases related to KIAA0883-44. Administration of appropriate doses of antibodies can stimulate or block the production or activity of KIAA0883-44.

 The invention also relates to a diagnostic test method for quantitative and localized detection of KIAA0883-44 levels. These tests are well known in the art and include FISH assays and radioimmunoassays. The level of IAA0883-44 detected in the test can be used to explain the importance of ΠΑΑ0883- 44 in various diseases and to diagnose diseases in which KIAA0883-44 plays a role.

 The polypeptide of the present invention can also be used for peptide mapping analysis. For example, the polypeptide can be specifically cleaved by physical, chemical or enzymatic analysis, and subjected to one-dimensional or two-dimensional or three-dimensional gel electrophoresis analysis, and more preferably mass spectrometry analysis.

 The polynucleotide encoding KIAA0883-44 can also be used for a variety of therapeutic purposes. Gene therapy technology can be used to treat abnormal cell proliferation, development or metabolism caused by the non-expression or abnormal / inactive expression of ΠΑΑ0883-44. Recombinant gene therapy vectors (such as viral vectors) can be designed to express mutated KIAA0883-44 to inhibit endogenous KIAA0883-44 activity. For example, a variant of KIAA0883-44 may be shortened and lack the signaling functional domain ΠΑΑ0883-44. Although it can bind to downstream substrates, it lacks signaling activity. Therefore, recombinant gene therapy vectors can be used to treat diseases caused by abnormal expression or activity of KIAA0883-44. Virus-derived expression vectors such as retroviruses, adenoviruses, adenovirus-associated viruses, herpes simplex virus, and parvoviruses can be used to transfer polynucleotides encoding KIAA0883-44 into cells. Methods for constructing recombinant viral vectors carrying a polynucleotide encoding ΠAA0883-44 can be found in the existing literature (Sambrook, et al.). In addition, the polynucleotide encoding KIAA0883-44 can be packaged into liposomes and transferred into cells.

Methods for introducing polynucleotides into tissues or cells include: Injecting polynucleotides directly into tissues in vivo Or in vitro through a vector (such as a virus, phage, or plasmid) to introduce the polynucleotide into the cell, and then transplant the cell into the body.

 Oligonucleotides (including antisense RNA and DNA) and ribozymes that inhibit KIAA0883-44 mRNA are also within the scope of the present invention. A ribozyme is an enzyme-like RM molecule that specifically decomposes specific RNA. Its mechanism of action is that the ribozyme molecule specifically hybridizes with a complementary target RNA for endonucleation. Antisense RNA, DM, and ribozymes can be obtained using any existing RM or DNA synthesis technology, such as solid-phase phosphate amide chemical synthesis to synthesize oligonucleotides. Antisense RM molecules can be obtained by in vitro or in vivo transcription of a DNA sequence encoding the RNA. This DM sequence has been integrated downstream of the RM polymerase promoter of the vector. In order to increase the stability of the nucleic acid molecule, it can be modified in a variety of ways, such as increasing the sequence length on both sides, and the phosphorothioate or peptide bond instead of the phosphodiester bond is used for the ribonucleoside linkage.

 The polynucleotide encoding KIAA0883-44 can be used for the diagnosis of diseases related to ΠΑΑ0883-44. A polynucleotide encoding KIAA0883-44 can be used to detect the expression of KIAA0883-44 or the abnormal expression of KIAA0883-44 in a disease state. For example, the DM sequence encoding KIAA0883-44 can be used to hybridize biopsy specimens to determine the expression of KIAA0883-44. Hybridization techniques include Sou thern blotting, Nor thern blotting, and in situ hybridization. These techniques and methods are all mature and open technologies, and related kits are commercially available. Some or all of the polynucleotides of the present invention can be used as probes to be fixed on a microarray or a DM chip (also known as a "gene chip") for analyzing differential expression analysis of genes and genetic diagnosis in tissues. ΠΑΑ0883- 44 specific primers for RNA-polymerase chain reaction (RT-PCR) in vitro amplification can also detect ΠΑΑ0883- 44 transcripts.

 Detection of mutations in the ΠΑΑ0883- 44 gene can also be used to diagnose KIAA0883-44-related diseases. The forms of KIAA0883-44 mutations include point mutations, translocations, deletions, recombinations, and any other abnormalities compared to the normal wild-type KIAA0883-44 DM sequence. Mutations can be detected using well-known techniques such as Southern blotting, DM sequence analysis, PCR and in situ hybridization. In addition, mutations may affect protein expression. Therefore, the Nor thern blotting and Western blotting can be used to indirectly determine whether a gene is mutated.

 The sequences of the invention are also valuable for chromosome identification. This sequence will specifically target a specific position on a human chromosome and can hybridize to it. Currently, specific sites for each gene on the chromosome need to be identified. Currently, only a few chromosome markers based on actual sequence data (repeating polymorphisms) are available for marking chromosome positions. According to the present invention, in order to associate these sequences with disease-related genes, an important first step is to locate these DM sequences on a chromosome.

In short, PCR primers (preferably 15-35bp) are prepared according to CDM, and the sequences can be mapped on chromosomes. These primers were then used for PCR screening of somatic hybrid cells containing individual human chromosomes. Only those hybrid cells that contain the human gene corresponding to the primer will produce amplified fragments. PCR localization of somatic hybrid cells is a quick way to localize DM to specific chromosomes. Using the oligonucleotide primers of the present invention, by a similar method, a set of fragments from a specific chromosome or a large number of genomic clones can be used to achieve sublocalization. Other similar strategies that can be used for chromosomal localization include in situ hybridization, chromosome pre-screening with labeled flow sorting, and hybrid pre-selection to construct chromosome-specific cDNA libraries.

 Fluorescent in situ hybridization (FISH) of cDNA clones with metaphase chromosomes allows precise chromosomal localization in one step. For a review of this technique, see Verma et al., Human Chromosomes: a Manua l of Basic Techniques, Pergamon Pres s, New York (1988).

 Once the sequence is located at the exact chromosomal location, the physical location of the sequence on the chromosome can be correlated with the genetic map data. These data can be found in V. Mckusick, Mendel ian Inheritance in Man (available online with Johns Hopkins University Welch Medical Library). Linkage analysis can then be used to determine the relationship between genes and diseases that are mapped to chromosomal regions.

 Next, the difference in cDM or genomic sequence between the affected and unaffected individuals needs to be determined. If a mutation is observed in some or all diseased individuals and the mutation is not observed in any normal individuals, the mutation may be the cause of the disease. Comparing affected and unaffected individuals usually involves first looking for structural changes in chromosomes, such as deletions or translocations that are visible at the chromosomal level or detectable with cDNA sequence-based PCR. According to the resolution capabilities of current physical mapping and gene mapping technology, the cDNA accurately mapped to the chromosomal region associated with the disease can be one of 50 to 500 potentially pathogenic genes (assuming 1 megabase mapping resolution) Capacity and each 20kb corresponds to a gene).

 The polypeptides, polynucleotides and mimetics, agonists, antagonists and inhibitors of the present invention can be used in combination with a suitable pharmaceutical carrier. These carriers can be water, glucose, ethanol, salts, buffers, glycerol, and combinations thereof. The composition comprises a safe and effective amount of the polypeptide or antagonist, and carriers and excipients which do not affect the effect of the drug. These compositions can be used as drugs for the treatment of diseases.

 The invention also provides a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the invention. Along with these containers, there may be instructional instructions given by government agencies that manufacture, use, or sell pharmaceuticals or biological products, which prompts permission for administration on the human body by government agencies that produce, use, or sell. In addition, the polypeptides of the invention can be used in combination with other therapeutic compounds.

The pharmaceutical composition can be administered in a convenient manner, such as by a topical, intravenous, intraperitoneal, intramuscular, subcutaneous, intranasal or intradermal route of administration. KIAA0883-44 are administered in amounts effective to treat and / or prevent specific indications. The amount and dose range of KIAA0883-44 administered to patients will depend on many factors Such as the mode of administration, the health conditions of the person to be treated, and the judgment of the diagnostician.

Examples

 The present invention is further described below with reference to specific embodiments. It should be understood that these examples are only used to illustrate the present invention and not to limit the scope of the present invention. The experimental methods in the following examples are not marked with specific conditions, usually according to conventional conditions, such as Sambrook et al., Molecular Cloning: Laboratory Manual (New York: Cold Harbor Harbor Laboratory Pres s, 1989), or according to the conditions described in Conditions recommended by the manufacturer. .

 Example 1 Cloning of KIAA0883-44

 Total RM of human fetal brain was extracted by one-step method with guanidine isothiocyanate / phenol / chloroform. Poly (A) mRM was isolated from total RM using Quik mRNA Isolat ion Kit (product of Qiegene). 2ug poly (A) mRNA forms cDM by reverse transcription. The Smart cDNA Cloning Kit (purchased from Clontech) was used to insert the cDM fragment into the multiple cloning site of pBSK (+) vector (Clontech) to transform DH5α. The bacteria formed a cDNA library. Dye terminate cycle reaction ion sequencing kit (Perkin-Elmer) and ABI 377 automatic sequencer (Perkin-Elmer) were used to determine the sequences at the 5 'and 3' ends of all clones. The determined cDNA sequence was compared with the existing public DM sequence database (Genebank), and it was found that the cDM sequence of one of the clones 0317e08 was new DNA. The inserted cDNA fragments contained in this clone were determined in both directions by synthesizing a series of primers. The results show that the full-length cDNA contained in the 0317e08 clone is 2472bp (as shown in Seq ID NO: l), and there is a 1212bp open reading frame (0RF) from 747bp to 1958bp, which encodes a new protein (such as Seq ID NO : Shown in 2). We named this clone pBS-0317e08 and the encoded protein was named KIAA0883-44. Example 2 Homologous search of cDNA clones

 The sequence of KIAA0883-44 and the protein sequence encoded by the present invention were performed using the Blast program (Basic local al ignment search tool) [Al tschul, SF et al. J. Mol. Biol. 1990; 215: 403-10] Perform homology search in Genbank, Swissport and other databases. The gene with the highest homology to KIAA0883-44 of the present invention is a known KIAA0883 protein, and the encoded protein thereof has the accession number AB020690 in Genbank. The protein homology results are shown in Figure 1. The two are highly homologous, with 41% identity; 64% similarity. Example 3 Cloning of the gene encoding KIAA0883-44 by RT-PCR

CDNA was synthesized using fetal brain cell total MA as a template and ol igo-dT as a primer for reverse transcription reaction. After purification using Q i agene's kit, the following primers were used for PCR amplification: Primerl: 5,-GGAGGGGAGGTATCAGGTTTTCAG —3, (SEQ ID NO: 3)

 Primer2: 5'- TATTTATATATATTCATCGACATA -3 '(SEQ ID NO: 4)

 Primerl is a forward sequence starting at lbp of the 5th end of SEQ ID NO: 1;

 Primer2 is the 3 'end reverse sequence in SEQ ID NO: 1.

Conditions for the amplification reaction: A reaction volume of 50 μl contains 50 mmol / LKCl, 10 mmol / L Tris-HCl pH 8.5, 1.5 mmol / L MgCl ₂ , 200 mol / L dNTP, lOpmol primer, 1U Taq DM polymerase ( Clontech products). The reaction was performed on a PE9600 DNA thermal cycler (Perkin-Elmer) for 25 cycles under the following conditions: 94 ° C 30sec; 55 ° C 30sec; 72 ° C 2min. At the same time, set β-act in as positive during RT-PCR. Controls and template blanks were negative controls. The amplified products were purified using a QIAGEN kit and ligated to a PCR vector (Invitrogen) using a TA cloning kit. DNA sequence analysis results showed that the MA sequence of the PCR product was in accordance with SEQ ID NO: The 1- 2472bp shown in Figure 1 are exactly the same. Example 4 Northern blot analysis of KIAA0883-44 gene expression

Total RM extraction in one step [Anal. Biochem 1987, 162, 156-159] ₀ This method involves acid guanidinium thiocyanate-chloroform extraction. I.e. with 4M guanidinium isothiocyanate -25mM sodium citrate, 0.2M sodium acetate _(P H4.0) of the tissue was homogenized phenol, 1 volume and 1/5 volume of chloroform - isoamyl alcohol (49: 1) After mixing, centrifuge. The aqueous layer was aspirated, isopropanol (0.8 vol) was added and the mixture was centrifuged to obtain RM precipitate. The obtained RM precipitate was washed with 70% ethanol, dried and dissolved in water. Using 20 μ _δ RNA, electrophoresis was performed on a 1.2% agarose gel containing 20 mM 3- (N-morpholino) propanesulfonic acid (H7.0)-5raM sodium acetate-1 mM EDTA-2.2M formaldehyde. It was then transferred to a nitrocellulose membrane. Preparation ³² P- DNA probe labeled with a- ³² P dATP by random priming method. The DNA probe used was the PCR amplified KIAA0883-44 coding region sequence (747bp to 1958bp) shown in FIG. The 32P- labeled probes (about 2 x l0 ⁶ cpm / ml) and RNA was transferred to a nitrocellulose membrane overnight at 42 ° C in a hybridization solution, the solution comprising 50% formamide - 25mMK P0 ₄ (pH7 .4) -5 xSSC-5 xDenhardt's solution and 20 (^ g / ml salmon sperm DNA. After hybridization, the filter was washed in 1 x SSC-0.1% SDS at 55 ° C for 30 minutes. Then, analysis was performed using a Phosphor Imager And quantification. Example 5 In vitro expression, isolation and purification of recombinant KIAA0883-44

 Based on SEQ ID NO: 1 and the coding region sequence shown in Figure 1, a pair of specific amplification primers were designed, the sequence is as follows:

Primer 3: 5'- CCCCATATGATGGCTAGCATCACTGCGTGTGTG -3, (Seq ID No: 5) Primer4: 5'- CATGGATCCTTACTGTGGCTCAAAAGCATCACT -3 '(Seq ID No: 6) The 5' ends of these two primers contain Ndel and BamHI restriction sites, respectively , Followed by the 5 'end of the target gene And the 3 'end coding sequence, the Ndel and BamHI restriction sites correspond to the selective endonuclease sites on the expression vector plasmid pET-28b (+) (Novagen, Cat. No. 69865. 3). The PCR reaction was performed using the pBS-0317e08 plasmid containing the full-length target gene as a template. The PCR reaction conditions were as follows: a total volume of 50 μ1 containing 10 pg of pBS-0317e08 plasmid, primers Primer-3 and Primer-4 were lpmol, Advantage polymerase Mix (Clontech) 1 μ1, respectively. Cycle parameters: 94 ° C 20s, 60 ° C 30s, 68 ° C 2 min, a total of 25 cycles. The amplified product and plasmid _P ET-28 (+) were double-digested with Mel and BamHI, respectively, and large fragments were recovered and ligated with T4 ligase. The ligation product was transformed into E. coli DH5a by the calcium chloride method. After being cultured overnight on LB plates containing kanamycin (final concentration 30 μ _§ / ιη1), positive clones were screened by colony PCR method and sequenced. A positive clone (pET-0317e08) with the correct sequence was selected, and the recombinant plasmid was transformed into Escherichia coli BL21 (DE3) plySs (product of Novageri) by the calcium chloride method. Containing kanamycin (final concentration of 30μ β _/ ίΐι1) in LB liquid medium, host strain BL21 _(P ET-0317e08) cultured at 37 ° C to logarithmic phase, IPTG was added to a final concentration of 1 wound ol / L, continue to cultivate for 5 hours. The bacteria were collected by centrifugation, and the supernatant was collected by centrifugation. The supernatant was collected by centrifugation, and the chromatography was performed using an affinity column His s. Bind Quick Cartridge (product of Novagen) capable of binding to 6 histidines (6His-Tag). The purified target protein KIAA0883-44 was obtained. After SDS-PAGE electrophoresis, a single band was obtained at 44 KDa (Figure 2). The band was transferred to a PVDF membrane and the N-terminal amino acid sequence was analyzed by the Edams hydrolysis method. As a result, the 15 amino acids at the N-terminus were identical to the 15 amino acid residues at the N-terminus shown in SEQ ID NO: 2. Example 6 Production of anti-IIAA0883-44 antibodies

 A peptide synthesizer (product of PE company) was used to synthesize the following KIAA0883-44-specific peptides:

NH2-Met-Ala-Ser-I le-Thr-Ala-Cys-Val-Gly-Asn-Ser-Arg-Gln-Gln-Asn-C00H (SEQ ID NO: 7). The polypeptide is coupled to hemocyanin and bovine serum albumin to form a complex. For methods, see: Avrameas, et al. Immunochemis try, 1969; 6:43. Rabbits were immunized with 4 mg of the i-cyanin polypeptide complex plus complete Freund's adjuvant, and 15 days later, the hemocyanin polypeptide complex plus incomplete Freund's adjuvant was used to boost immunity once. A titer plate coated with a 15 g / ml bovine serum albumin peptide complex was used as an ELISA to determine antibody titers in rabbit serum. Total IgG was isolated from antibody-positive rabbit sera using protein A-Sepharose. The peptide was bound to a cyanogen bromide-activated Sepharose4B column, and anti-peptide antibodies were separated from the total IgG by affinity chromatography. Immunoprecipitation demonstrated that the purified antibodies specifically bind to KIAA0883-44. Example 7 Application of the polynucleotide fragment of the present invention as a hybridization probe

Selecting suitable oligonucleotide fragments from the polynucleotides of the present invention has various uses as hybridization probes, such as using the probes to hybridize to genomic or cDNA libraries of normal tissues or pathological tissues from different sources. In order to identify whether it contains a polynucleotide sequence of the present invention and detect a homologous polynucleotide sequence, the probe may further be used to detect the polynucleotide sequence of the present invention or a homologous polynucleotide sequence thereof in normal tissue or Whether the expression in pathological tissue cells is abnormal.

 The purpose of this embodiment is to select a suitable oligonucleotide fragment from the polynucleotide SEQ ID NO: 1 of the present invention as a hybridization probe, and to identify whether some tissues contain the polynucleoside of the present invention by using a filter hybridization method. Acid sequence or a homologous polynucleotide sequence thereof. Filter hybridization methods include dot blotting, Southern imprinting, Northern blotting, and copying methods. They all use the same steps to immobilize the polynucleotide sample to be tested on the filter. These same steps are as follows: The sample-immobilized filter is first pre-hybridized with a probe-free hybridization buffer to saturate the non-specific binding site of the sample on the filter with the carrier and the synthesized polymer. The pre-hybridization solution is then replaced with a hybridization buffer containing labeled probes and incubated to hybridize the probes to the target nucleic acid. After the hybridization step, the unhybridized probes are removed by a series of membrane washing steps. This embodiment uses higher-intensity washing conditions (such as lower salt concentration and higher temperature), so that the hybridization background is reduced and only strong specific signals are retained. The probes used in this embodiment include two types: the first type of probes are oligonucleotide fragments that are completely the same as or complementary to the polynucleotide SEQ ID NO: 1 of the present invention; the second type of probes are partially related to the present invention The polynucleotide SEQ ID NO: 1 is the same or complementary oligonucleotide fragment. In this example, the dot blot method is used to fix the sample on the filter membrane. Under the high-intensity washing conditions, the first type of probe and the sample have the strongest hybridization specificity and are retained.

 First, the selection of the probe

 The selection of oligonucleotide fragments from the polynucleotide SEQ ID NO: 1 of the present invention for use as hybridization probes should follow the following principles and several aspects to be considered:

 1. The preferred range of probe size is 18-50 nucleotides;

 2. GC content is 30% -70%, if it exceeds, non-specific hybridization increases;

 3. There should be no complementary regions inside the probe;

 4. Those that meet the above conditions can be used as primary selection probes, and then further computer sequence analysis, including the primary selection probe and its source sequence region (ie, SEQ ID NO: 1) and other unknown genomic sequences and their complements For homology comparison of the regions, if the homology with the non-target molecular region is greater than 85% or there are more than 15 consecutive bases, the primary probe should not be used generally;

 5. Whether the preliminary selection probe is finally selected as a probe with practical application value should be further determined by experiments.

 After completing the above analysis, select and synthesize the following two probes:

Probe 1 (probel), which belongs to the first type of probe, is completely homologous or complementary to the gene fragment of SEQ ID NO: 1 (41Nt): 5 '-TGGCTAGCATCACTGCGTGTGTGGGTAACAGCAGGCAGCAG -3' (SEQ ID NO: 8) Probe 2 (probe2), which belongs to the second type of probe, is equivalent to the replacement mutant sequence of the gene fragment of SEQ ID NO: 1 or its complementary fragment (41Nt):

 5'- TGGCTAGCATCACTGCGTGTCTGGGTAACAGCAGGCAGCAG -3 '(SEQ ID NO: 9) For other commonly used reagents and their preparation methods related to the following specific experimental procedures, please refer to the literature: DNA PROBES GH Kel ler; MM Manak; Stockton Press, 1989 ( USA) and more commonly used molecular cloning laboratory manual books such as "Molecular Cloning Experiment Guide" (Second Edition 1998) [US] Sambrook et al., Science Press.

 Sample Preparation:

 1.Extract DNA from fresh or frozen tissue

Steps: 1) Place fresh or freshly thawed normal liver tissue in a plate immersed in ice and filled with phosphate buffered saline (PBS). Cut the tissue into small pieces with scissors or a scalpel. Tissue should be kept moist during operation. 2) Centrifuge the tissue at 1,000 g for 10 minutes. 3) Suspend the pellet (about 10 ml / g) with cold homogenization buffer (0.25 mol / L sucrose; 25IMO1 / L Tris-HCl, pH 7.5; 25 mraol / L NaCl; 25iraiol / L MgCl ₂ ). 4) Homogenize the tissue suspension at 4 ° C at full speed with an electric homogenizer until the tissue is completely broken. 5) Centrifuge at 1000g for 10 minutes. 6) Resuspend the cell pellet (add 1-5 ml per 0.1 g of the original tissue sample), and centrifuge at 1,000 g for 10 minutes. 7) Resuspend the pellet in lysis buffer (1 ml per 0.1 g of the initial tissue sample), and then follow the phenol extraction method below.

 2, DM phenol extraction method

Steps: 1) Wash the cells with 1-10 ml of cold PBS and centrifuge at 1,000 g for 10 minutes. 2) with cold cell lysate pelleted cells were resuspended (l xl 0 ⁸ cells / ml) Minimum application lOOul lysis buffer. 3) Add SDS to a final concentration of 1%. If SDS is added directly to the cell pellet before resuspending the cells, the cells may form large clumps that are difficult to break, and reduce the overall yield. This is particularly serious when extracting> 10 ⁷ cells. 4) Add proteinase K to a final concentration of 200u _g / ml. 5) Incubate at 50 ° C for 1 hour or shake gently at 37 ° C overnight. 6) Extract with an equal volume of phenol: chloroform: isoamyl alcohol (25: 24: 1) and centrifuge in a small centrifuge tube for 10 minutes. The two should be clearly separated, otherwise centrifuge again. 7) Transfer the water phase to a new tube. 8) Extract with an equal volume of chloroform: isoamyl alcohol (24: 1) and centrifuge for 10 minutes. 9) Transfer the aqueous phase containing DM to a new tube. The DNA was then purified and ethanol precipitated.

 3. Purification of DNA and ethanol precipitation

Steps: 1) Add 1/10 volume of 2mol / L sodium acetate and 2 volumes of cold 100% ethanol to the DNA solution and mix. Leave at -20 ° C for 1 hour or overnight. 2) Centrifuge for 10 minutes. 3) Carefully aspirate or pour out the ethanol. 4) Wash the pellet with 500ul of 70% cold ethanol and centrifuge for 5 minutes. 5) Carefully aspirate or pour out the ethanol. use Wash the pellet with 500ul of cold ethanol and centrifuge for 5 minutes. 6) Carefully aspirate or pour out the ethanol, then invert on the absorbent paper to drain off the residual ethanol. Air dry for 10-15 minutes to allow the surface ethanol to evaporate. Be careful not to allow the pellet to dry completely, otherwise it will be more difficult to re-dissolve. 7) Resuspend the DM pellet in a small volume of TE or water. Low-speed vortexing or pipetting, with a dropper, while gradually increasing the TE, mixed until fully dissolved DM per 1- 5 χ10 ⁶ cells extracted about plus lul. . ·

 The following steps 8-13 are only used when contamination must be removed, otherwise step 14 can be performed directly.

8) Add RNase A to the DNA solution to a final concentration of 100 ug / tnl, 37. C was held for 30 minutes. 9) Add SDS and proteinase K to the final concentration of 0.5% and 100ug / ml. Incubate at 37 ° C for 30 minutes. 10) Extract the reaction solution with an equal volume of phenol: chloroform: isoamyl alcohol (25: 24: 1) and centrifuge for 10 minutes. 11) Carefully remove the aqueous phase and re-extract with an equal volume of chloroform: isoamyl alcohol (24: 1) and centrifuge for 10 minutes. 12) Carefully remove the aqueous phase, add 1/10 volume of 2mol / L sodium acetate and 2.5 volumes of cold ethanol, and mix well--20 ° C for 1 hour. 13) Wash the pellet with 70% ethanol and 100% ethanol, air dry, and resuspend the nucleic acid. The process is the same as steps 3-6. 14) A _26Q and A _28Q were measured to detect the purity and yield of DNA. 15) Store at -20 ° C after dispensing.

 Preparation of sample film:

 1) Take 4x2 pieces of nitrocellulose membranes (NC membranes) of appropriate size, and mark the spotting position and sample number on it with a pencil. Two NC membranes are required for each probe, so that they can be used in the following experimental steps. The film was washed with high-strength conditions and strength conditions, respectively.

 2) Pipette and control 15 microliters each, spot on the sample film, and dry at room temperature.

 3) Place on filter paper infiltrated with 0.1mol / L NaOH, 1.5mol / L NaCl for 5 minutes (twice), dry and place in 0.5raol / L Tris-HCl (pH7.0), 3mol / L NaCl filter paper for 5 minutes (twice) and allowed to dry.

 4) Clamp in clean filter paper and wrap with aluminum foil, 60-80. C was dried under vacuum for 2 hours.

 Labeling of probes

1) 3μ1 Probe (0.1OD / Ιθμΐ), add 2μ1 Kinase buffer, 8-10 uCi γ- ³² P-dATP + 2U Kinase to make up to a final volume of 20μ1.

 2) Incubate at 37 ° C for 2 hours.

 3) Add 1/5 volume of bromophenol blue indicator (BPB λ

 4) Pass through a Sephadex G-50 column.

5) Start collecting the first peak before ³² P-Probe washes out (can be monitored by Moni tor).

 6) 5 drops / tube, collect 10-15 tubes.

 7) Monitor the amount of isotope with a liquid scintillator

8) After the collection of the first peak is combined, the ³² P-Probe to be prepared (the second peak is free γ- ³² P- dATP).

 Pre-hybridization

 The sample membrane was placed in a plastic bag, and 3 to 10 mg of prehybridization solution (1 OxDenhardt's; 6xSSC, 0.1 mg / ml CT DM (calf thymus DNA)) was added. After sealing the mouth of the bag, shake at 68 ° C for 2 hours.

 Crossbreeding.

 Cut a corner of the plastic bag, add the prepared probe, seal the bag, and shake it at 42 ° C in a water bath overnight. Wash film:

 High-intensity washing film:

 1) Take out the hybridized sample membrane.

 2) 2xSSC, 0.1% SDS, wash at 40 ° C for 1 minute (twice).

 3) Wash in 0.1xSSC, 0.1% SDS at 40 ° C for 15 minutes (twice).

 4) 0.1xSSC, 0.1 ° /. Wash in SDS at 55 ° C for 30 minutes (twice) and dry at room temperature. Low-intensity washing film:

 1) Take out the hybridized sample membrane.

 2) 2xSSC, 0.1% SDS, wash at 37 ° C for 15 minutes (twice).

 3) Wash in 0.1xSSC, 0.1% SDS at 37 ° C for 15 minutes (twice).

 4) Wash in 0.1xSSC, 0.1% SDS at 40 ° C for 15 minutes (twice), and dry at room temperature.

X-ray autoradiography:

 -70 ° C, X-ray autoradiography (pressing time depends on the radioactivity of the hybrid spot).

 Experimental results:

 釆 The hybridization experiments performed under low-intensity membrane washing conditions did not differ significantly in the radioactivity of the above two probe hybrid spots; while the hybridization experiments performed under high-intensity membrane washing conditions, the radioactive intensity of hybridization spots of probe 1 was obvious Stronger in radioactivity than the hybridization spot of another probe. Therefore, the presence and differential expression of the polynucleotide of the present invention in different tissues can be analyzed qualitatively and quantitatively with the probe 1. Example 8 DNA Microarray

Gene chip or gene microarray (DM Microarray) is a new technology currently being developed by many national laboratories and large pharmaceutical companies. It refers to the orderly and high-density arrangement of a large number of target gene fragments on glass, The data is compared and analyzed on a carrier such as silicon using fluorescence detection and computer software to achieve the purpose of rapid, efficient, and high-throughput analysis of biological information. The polynucleotide of the present invention can be used as Targeting DM for gene chip technology for high-throughput research on new gene functions; finding and screening new tissue-specific genes, especially new genes related to diseases such as tumors; diagnosis of diseases such as hereditary diseases. The specific method steps have been reported in the literature, for example, see the literature DeRis i, JL, Lyer, V. & Brown, P. 0. (1997) Science 278, 680-686. And the literature Hel le, RA, Schema , M., Chai, A., Shalom, D., (1997) PNAS 94: 2150-2155.

 (1) Ordering ''

 A total of 4,000 polynucleotide sequences of various full-length cDMs were used as target DNA, including the polynucleotides of the present invention. They were respectively amplified by PCR. After purification, the concentration of the amplified product was adjusted to about 500 ng / ul, and spotted on a sloped glass medium using a Cartesian 7500 spotter (purchased from Cartesian Company, USA). The distance between them is 280 μΐη. The spotted slides were hydrated and dried, cross-linked in a UV cross-linker, and dried after elution to fix the DM on the glass slide to prepare chips. The specific method steps have been reported in the literature. The sample post-processing steps in this embodiment are:

 1. Hydration in a humid environment for 4 hours;

 2. 0.2% SDS was washed for 1 minute;

3. Wash twice with ddH ₂ 0 for 1 minute each time;

4. NaBH _{4 is} blocked for 5 minutes;

 5. 95 ° C water for 2 minutes;

 '6. 0.2% SDS was washed for 1 minute;

7. Rinse twice with ddH ₂ 0;

 8. Dry and store at 25 ° C in the dark for future use.

 (Two) probe marking

 Total mRM was extracted from normal liver and liver cancer in one step, and mRM was purified with Oligotex mRM Midi Kit (purchased from QiaGen). The fluorescent reagent Cy3dUTP (5- Amino-propargyl-2'- deoxyur idine 5'-tr iphate coupled to Cy3 f luorescent dye, purchased from Amersham Pharaacia Biotech company) labeled mRNA of normal liver tissue, using a fluorescent reagent Cy5dUTP (5-Amino-propargyl-2'-deoxyur idine 5 '-tr iphate coupled to Cy5 fluorescent dye (purchased from Amersham Phamacia Biotech) was used to label mRM of liver cancer tissue, and the probe was prepared after purification. For specific steps and methods, see:

 Schena, M., Shalon, D., Heller, R. (1996) Proc. Natl. Acad. Sci. USA. Vol. 93: 10614-10619. Schena, M., Shalon, Dar i., Davi s, RW (1.995) Science. 270 (20): 467-480.

 (Three) cross

Combine the probes from the two tissues with the chips in UniHyb ™ Hybridizat ion Solution (purchased from TeleChem) was used for hybridization for 16 hours, and then washed with a washing solution (1> SSC, 0.2% SDS) at room temperature, and then scanned with a ScanArray 3000 scanner (purchased from General Scanning, USA). Images were analyzed and processed with Imagene software (Biodicovery Company, USA), and the Cy3 / Cy5 ratio of each point was calculated. The points with the ratio less than 0.5 and greater than 2 were considered to be genes with different expression. The experimental results show that Cy3 signal = 10084. 2 (take the average of four experiments), Cy5 signal = 7947. 98 (take the average of four experiments), Cy3 / Cy5 = 1. 2688, the present invention There was no significant difference in the expression of polynucleotides in the above two tissues.

Claims

Uncle demand

1. An isolated polypeptide-KIAA0883-44, characterized in that it comprises: a polypeptide having the amino acid sequence shown in SEQ ID NO: 2, or an active fragment, analog, or derivative thereof.

 2. The polypeptide according to claim 1, characterized in that the amino acid sequence of the polypeptide, analog or derivative has at least 95% identity with the amino acid sequence shown in SEQ ID NO: 2.

 3. The polypeptide according to claim 2, characterized in that it comprises a polypeptide having the amino acid sequence shown in SEQ ID NO: 2.

 4. An isolated polynucleotide, characterized in that said polynucleotide comprises one selected from the group consisting of:

 (a) a polynucleotide encoding a polypeptide having an amino acid sequence shown in SEQ ID NO: 2 or a fragment, analog, or derivative thereof;

 (b) a polynucleotide complementary to polynucleotide (a); or

 (c) A polynucleotide that is at least 70% identical to (a) or (b).

 5. The polynucleotide according to claim 4, wherein the polynucleotide comprises a polynucleotide encoding an amino acid sequence represented by SEQ ID NO: 2.

 6. The polynucleotide according to claim 4, characterized in that the sequence of the polynucleotide comprises the sequence of positions 747-1958 in SEQ ID NO: 1 or the sequence of positions 1-2472 in SEQ ID NO: 1. .

 7. A recombinant vector containing an exogenous polynucleotide, characterized in that it is constructed from a polynucleotide, a plasmid, a virus or a vector expression vector according to any one of claims 4-6. Recombinant vector.

 8. A genetically engineered host cell containing an exogenous polynucleotide, characterized in that it is selected from one of the following host cells:

 (a) a host cell transformed or transduced with the recombinant vector of claim 7; or

 (b) a host cell transformed or transduced with the polynucleotide according to any one of claims 4-6.

 9. A method for preparing a polypeptide having ΠΑΑ0883-44 activity, characterized in that the method includes:

 (a) culturing the engineered host cell according to claim 8 under the condition of expressing KIAA0883-44;

(b) Isolating a polypeptide having KIAA0883-44 activity from the culture.

10. An antibody capable of binding to a polypeptide, characterized in that the antibody is an antibody capable of specifically binding to ΠAA0883-44.

11. A class of compounds that mimic or regulate the activity or expression of a polypeptide, characterized in that they are compounds that mimic, promote, antagonize or inhibit the activity of KIAA0883-44.

 12. The compound according to claim 11, characterized in that it is an antisense sequence of a polynucleotide sequence or a fragment thereof as shown in SEQ ID NO: 1.

 13. The use of the compound according to claim .11, characterized in that the compound is used for a method for regulating the activity of KIAA0883-44 in vivo and in vitro.

 14. A method for detecting a disease or susceptibility to a disease associated with a polypeptide according to any one of claims 1-3, characterized in that it comprises detecting the expression level of the polypeptide, or detecting the activity of the polypeptide Or detecting a nucleotide variation in a polynucleotide that causes abnormal expression or activity of the polypeptide.

 15. The use of the polypeptide according to any one of claims 1-3, characterized in that it is used to screen mimics, agonists, antagonists or inhibitors of KIAA0883-44; or for peptide fingerprint Identification.

 16. The use of a nucleic acid molecule according to any one of claims 4-6, characterized in that it is used as a primer for a nucleic acid amplification reaction, or as a probe for a hybridization reaction, or for the production of a gene Chip or microarray.

 17. Use of a polypeptide, polynucleotide or compound according to any one of claims 1-6 and 11, characterized in that said polypeptide, polynucleotide or mimetic, agonist, antagonist is used Or the inhibitor is composed of a safe and effective dose with a pharmaceutically acceptable carrier as a pharmaceutical composition for diagnosing or treating a disease associated with KIAA0883-44 abnormality.

 18. The use of the polypeptide, polynucleotide or compound according to any one of claims 1-6 and 11, characterized in that the polypeptide, polynucleotide or compound is used for preparing a treatment such as a malignant tumor, Hematological diseases, HIV infection and immune diseases and drugs of various inflammations.