WO2001047983A1 - A novel polypeptide - corticotrophin releasing factor 13 and a polynucleotide encoding the same - Google Patents

Abstract

The present invention discloses a novel polypeptide - corticotrophin releasing factor 13 and a polynucleotide encoding the same, as well as a method of producing the polypeptide by DNA recombinant technology. The present invention also discloses methods of using the polypeptide in treatment of various diseases, such as malignant tumor, blood disease, HIV infection, immunological disease and various type inflammation. The present invention also discloses an antagonist against the polypeptide and the therapeutic use of the same. The present invention also discloses the use of such polynucleotide encoding corticotrophin releasing factor 13.

Description

 A new polypeptide-adrenocorticotropic hormone-releasing factor 13 and a polynucleotide encoding the polypeptide TECHNICAL FIELD

 The present invention belongs to the field of biotechnology. Specifically, the present invention describes a new polypeptide, adrenocorticotropic hormone-releasing factor 13, and a polynucleotide sequence encoding the polypeptide. The invention also relates to a method and application for preparing the polynucleotide and polypeptide. Background technique

 Corticotropin-releasing factor (CRF) is a hormone in the hypothalamus that regulates the release of adrenocorticotropic hormone in the pituitary gland. Adrenocorticotropic hormone-releasing factors are highly conservative in evolution. Adrenocorticotropic hormone-releasing factors from different sources have high sequence homology. Adrenocorticotropic hormone regulates the release of some related hormones in the body, and has extremely important physiological functions.

Corticotropin-releasing factor was first cloned from mammalian brains. This protein regulates the secretion of pituitary adrenal glands, the secretion of some related endocrine glands, and some spontaneous responses in vivo. In 1990, Vaughan J. et al. Cloned another member of the ACTH family in rats. This protein is found in the midbrain of rats, and it also regulates the activity of ACTH in rats. Release [Vaughan J., Dona ldson C. et al., 1995, Nature, 378: 287-292] _{0 It is} well known that the regulation of adrenocorticotropic hormones in vivo promotes the adrenal cortex to secrete various hormones, and the adrenal cortex Various hormones such as adrenocortical hormone, glucocorticoid, mineralocorticoid and sex hormone can be secreted in the body. These hormones all have very important physiological functions in the body. Therefore, the corticotropin-releasing factor also plays a very important role in the body. The abnormal expression of this protein will cause the imbalance of corticotropin release in the body, which will affect a series of related hormone secretion processes and lead to the Internal environment disorders, which in turn cause a variety of related diseases.

 All corticotropin-releasing factors are composed of about 40 amino acid residues, and their C-termini are amidated. These proteins are spliced from a large protein precursor. Studies have shown that the amino acid residues 4 to 19 of the amino acid sequence of corticotropin-releasing factor in general animals contain a conserved consensus sequence fragment as shown below:

[PQ] -X- [LIVM] -S- [LIVM] -X (2)-[PST]-[LIVMF] -X- [LIVM] -LRX (2)-[LIVM]; This sequence fragment may be Corticotropin-releasing factor localizes and regulates the important site of adrenocortical hormone release in the body. Mutations at this site will cause abnormal protein expression, which will affect corticotropin and some related hormones in the body. Normal secretion, thus causing various related metabolic disorders in the body. The protein is usually related to the occurrence of some disorders of glucose metabolism, imbalance of physiological environment in the body, reproductive system diseases, gout, asthma and other diseases in the body. Since the ACTH 13 protein plays an important role in important body functions as described above, and it is believed that a large number of proteins are involved in these regulatory processes, there has been a need in the art to identify more ACTH releases involved in these processes. Factor 13 protein, especially the amino acid sequence of this protein. Isolation of the gene encoding the new adrenocorticotropin-releasing factor 13 protein also provides a basis for research to determine the role of this protein in health and disease states. This protein may form the basis for the development of diagnostic and / or therapeutic drugs for diseases, so it is important to isolate its coding DNA. Disclosure of invention

 It is an object of the present invention to provide isolated novel polypeptides-adrenocorticotropic hormone-releasing factor 13 and fragments, analogs and derivatives thereof.

 Another object of the invention is to provide a polynucleotide encoding the polypeptide.

 Another object of the present invention is to provide a recombinant vector containing a polynucleotide encoding a corticotropin-releasing factor 13.

 Another object of the present invention is to provide a genetically engineered host cell comprising a polynucleotide encoding a corticotropin-releasing factor 13.

 Another object of the present invention is to provide a method for producing corticotropin-releasing factor 13.

 Another object of the present invention is to provide adrenocorticotropic hormone-releasing factor for the polypeptide of the present invention.

13 antibodies.

Another object of the present invention is to provide mimetic compounds, antagonists, agonists, and inhibitors of the adrenocorticotropic hormone releasing factor 13 of the polypeptide of the present invention.

Another object of the present invention is to provide a method for diagnosing and treating a disease associated with an abnormality of corticotropin releasing factor 13.

The present invention relates to an isolated polypeptide, which is of human origin, and includes: a polypeptide having the amino acid sequence of SEQ ID No. 2 or a conservative variant, biologically active fragment or derivative thereof. Preferably, the polypeptide is a polypeptide having the amino acid sequence of SEQ ID NO: 2.

 The invention also relates to an isolated polynucleotide comprising a nucleotide sequence or a variant thereof selected from the group consisting of:

 (a) a polynucleotide encoding a polypeptide having the amino acid sequence of SEQ ID No. 2;

 (b) a polynucleotide complementary to polynucleotide (a);

 (c) A polynucleotide having at least 70% identity to a polynucleotide sequence of (a) or (b).

More preferably, the sequence of the polynucleotide is one selected from the group consisting of: (a) a sequence having positions 1 06-462 in SEQ ID NO: 1; and (b) a sequence having 1- in SEQ ID NO: 1 958-bit sequence. The invention further relates to a vector, in particular an expression vector, containing the polynucleotide of the invention; a host cell genetically engineered with the vector, including a transformed, transduced or transfected host cell; and a method comprising culturing said Host cell and method of preparing the polypeptide of the present invention by recovering the expression product.

 The invention also relates to an antibody capable of specifically binding to a polypeptide of the invention.

 The invention also relates to a method for screening compounds that mimic, activate, antagonize or inhibit the activity of the corticotropin-releasing factor 13 protein, which comprises utilizing the polypeptide of the invention. The invention also relates to compounds obtained by this method.

 The present invention also relates to a method for in vitro detection of a disease or susceptibility to a disease associated with abnormal expression of a corticotropin-releasing factor 13 protein, which comprises detecting a mutation in the polypeptide or a polynucleotide sequence encoding the same in a biological sample, or Detection of the amount or biological activity of a polypeptide of the invention in a biological sample.

 The present invention also relates to a pharmaceutical composition comprising a polypeptide of the present invention or a mimetic thereof, an activator, an antagonist or an inhibitor, and a pharmaceutically acceptable carrier.

 The present invention also relates to the use of the polypeptide and / or polynucleotide of the present invention for the preparation of a medicament for treating cancer, developmental disease or immune disease or other diseases caused by abnormal expression of corticotropin-releasing factor 13.

 Other aspects of the invention will be apparent to those skilled in the art from the disclosure of the techniques herein. The following terms used in this specification and claims have the following meanings unless specifically stated otherwise:

 "Nucleic acid sequence" refers to oligonucleotides, nucleotides or polynucleotides and fragments or parts thereof, and can also refer to genomic or synthetic DNA or RNA, which can be single-stranded or double-stranded, representing the sense strand or Antisense strand. Similarly, the term "amino acid sequence" refers to oligopeptides, peptides, polypeptides, or protein sequences and fragments or portions thereof. When the "amino acid sequence" in the present invention relates to the amino acid sequence of a naturally occurring protein molecule, such " A "polypeptide" or "protein" is not meant to limit the amino acid sequence to the complete natural amino acid associated with the protein molecule.

 A protein or polynucleotide "variant" refers to an amino acid sequence having one or more amino acids or nucleotide changes or a polynucleotide sequence encoding it. The changes may include deletions, insertions or substitutions of amino acids or nucleotides in the amino acid sequence or nucleotide sequence. Variants can have "conservative" changes in which the substituted amino acid has a structural or chemical property similar to the original amino acid, such as the replacement of isoleucine with leucine. Variants can also have non-conservative changes, such as replacing glycine with tryptophan.

"Deletion" refers to the deletion of one or more amino acids or nucleotides in an amino acid sequence or nucleotide sequence. "Insert" or "addition" refers to a change in the amino acid sequence or nucleotide sequence that results in a naturally occurring An increase in one or more amino acids or nucleotides compared to a molecule. "Replacement" refers to a substitution by a different amino acid or nucleoside An acid replaces one or more amino acids or nucleotides.

 "Biologically active" refers to a protein that has the structure, regulatory, or biochemical function of a natural molecule. Similarly, the term "immunologically active" refers to the ability of natural, recombinant, or synthetic proteins and fragments thereof to induce a specific immune response and to bind specific antibodies in a suitable animal or cell.

 An "agonist" refers to a molecule that, when combined with corticotropin-releasing factor 13, causes a change in the protein to regulate the activity of the protein. An agonist may include a protein, a nucleic acid, a carbohydrate, or any other molecule that can bind to corticotropin-releasing factor 13.

 An "antagonist" or "inhibitor" refers to a molecule that can block or regulate the biological or immunological activity of corticotropin-releasing factor 13 when combined with corticotrophin-releasing factor 13. Antagonists and inhibitors may include proteins, nucleic acids, carbohydrates or any other molecule that can bind to corticotropin-releasing factor 13.

 "Regulation" refers to a change in the function of corticotropin-releasing factor 13, including an increase or decrease in protein activity, a change in binding properties, and any other biological, functional, or immune properties of corticotropin-releasing factor 13. change.

 "Substantially pure" means substantially free of other proteins, lipids, sugars or other substances with which it is naturally associated. Those skilled in the art can purify corticotropin-releasing factor 13 using standard protein purification techniques. The substantially pure corticotropin-releasing factor 13 produces a single main band on a non-reducing polyacrylamide gel. The purity of the corticotropin releasing factor 13 polypeptide can be analyzed by amino acid sequence.

 "Complementary" or "complementary" refers to the natural binding of a polynucleotide by base-pairing under conditions of acceptable salt concentration and temperature. For example, the sequence "C-T-G-A" can be combined with the complementary sequence "G-A-C-T". The complementarity between two single-stranded molecules can be partial or complete. The degree of complementarity between nucleic acid strands has a significant effect on the efficiency and strength of hybridization between nucleic acid strands.

 "Homology" refers to the degree of complementarity and can be partially homologous or completely homologous. "Partial homology" refers to a partially complementary sequence that at least partially inhibits the hybridization of a fully complementary sequence to a target nucleic acid. The inhibition of such hybridization can be detected by performing hybridization (Southern blotting or Nor thern blotting, etc.) under conditions of reduced stringency. Substantially homologous sequences or hybridization probes can compete and inhibit the binding of completely homologous sequences to the target sequence under conditions of reduced stringency. This does not mean that the conditions of reduced stringency allow non-specific binding, because the conditions of reduced stringency require that two sequences bind to each other as a specific or selective interaction.

"Percent identity" refers to the percentage of sequences that are identical or similar in the comparison of two or more amino acid or nucleic acid sequences. The percent identity can be determined electronically, such as by the MEGALIGN program (Lasergene s of tware package, DNASTAR, Inc., Mad Son Wis.). The MEGALI GN program can compare two or more sequences according to different methods, such as the Cluster method (Higgs, DG and PM Sharp (1988) Gene 73: 237-244). ₀ The Cluster method arranges groups of sequences into clusters by checking the distance between all pairs. The clusters are then assigned in pairs or groups. The percent identity between two amino acid sequences such as sequence A and sequence B is calculated by the following formula: The number of matching residues between sequence A and sequence B

 X 100 Number of residues in sequence A-number of spacer residues in sequence A-number of spacer residues in sequence B

 The percent identity between nucleic acid sequences can also be determined by the Cluster method or by methods known in the art such as Jotun He in (He in J., (1990) Methods in emzumo logy 183: 625-645).

 "Similarity" refers to the degree of identical or conservative substitutions of amino acid residues at corresponding positions in the alignment of amino acid sequences. Amino acids used for conservative substitutions, for example, negatively charged amino acids may include aspartic acid and glutamic acid; positively charged amino acids may include lysine and arginine; having an uncharged head group is Similar hydrophilic amino acids may include leucine, isoleucine and valine; glycine and alanine; asparagine and glutamine; serine and threonine; phenylalanine and tyrosine.

 "Antisense" refers to a nucleotide sequence that is complementary to a particular DNA or RNA sequence. "Antisense strand" refers to a nucleic acid strand that is complementary to the "sense strand".

 "Derivative" refers to a chemical modification of HFP or a nucleic acid encoding it. This chemical modification may be the replacement of a hydrogen atom with an alkyl, acyl or amino group. Nucleic acid derivatives can encode polypeptides that retain the primary biological properties of natural molecules.

"Antibody" refers to a complete antibody molecule and its fragments, such as Fa,? (^ ') ₂ and? ^ It can specifically bind to the epitope of ACTH-13.

 A "humanized antibody" refers to an antibody in which the amino acid sequence of a non-antigen binding region is replaced to become more similar to a human antibody, but still retains the original binding activity.

 The term "isolated" refers to the removal of a substance from its original environment (for example, its natural environment if it occurs naturally). For example, a naturally occurring polynucleotide or polypeptide is not isolated when it is present in a living thing, but the same polynucleotide or polypeptide is separated from some or all of the substances that coexist with it in the natural system. Such a polynucleotide may be part of a vector, or such a polynucleotide or polypeptide may be part of a composition. Since the carrier or composition is not part of its natural environment, they are still isolated. As used herein, "isolated" refers to the separation of a substance from its original environment (if it is a natural substance, the original environment is the natural environment). For example, polynucleotides and polypeptides in a natural state in a living cell are not isolated and purified, but the same polynucleotides or polypeptides are separated and purified if they are separated from other substances existing in the natural state. .

As used herein, "isolated corticotropin releasing factor 1 3" means adrenocorticotropic The release factor 13 is essentially free of other proteins, lipids, sugars or other substances with which it is naturally associated. Those skilled in the art can purify corticotropin-releasing factor 13 using standard protein purification techniques. Substantially pure polypeptides can produce a single main band on a non-reducing polyacrylamide gel. The purity of the corticotropin-releasing factor 13 polypeptide can be analyzed by amino acid sequence.

 The present invention provides a new polypeptide-corticotropin-releasing factor 13, which is basically composed of the amino acid sequence shown in SEQ ID NO: 2. The polypeptide of the present invention may be a recombinant polypeptide, a natural polypeptide, or a synthetic polypeptide, and preferably a recombinant polypeptide. The polypeptides of the present invention can be naturally purified products or chemically synthesized products, or can be produced from prokaryotic or eukaryotic hosts (eg, bacteria, yeast, higher plants, insects, and mammalian cells) using recombinant techniques. Depending on the host used in the recombinant production protocol, the polypeptide of the invention may be glycosylated, or it may be non-glycosylated. Polypeptides of the invention may also include or exclude starting methionine residues. The invention also includes fragments, derivatives and analogs of corticotropin-releasing factor 13. As used herein, the terms "fragment", "derivative" and "analog" refer to a polypeptide that substantially maintains the same biological function or activity of the adrenocorticotropic hormone releasing factor 13 of the present invention. A fragment, derivative, or analog of the polypeptide of the present invention may be: (I) a kind in which one or more amino acid residues are substituted with conservative or non-conservative amino acid residues (preferably conservative amino acid residues), and the substitution The amino acid may or may not be encoded by a genetic codon; or UI) such a type in which a group on one or more amino acid residues is replaced by another group to include a substituent; or (Π Ι) such One in which the mature polypeptide and another compound

(Such as a compound that extends the half-life of a polypeptide, such as polyethylene glycol), or (IV) a polypeptide sequence in which an additional amino acid sequence is fused into a mature polypeptide (such as a leader sequence or a secreted sequence or used to purify this) The sequence of a polypeptide or protease sequence) As set forth herein, such fragments, derivatives and analogs are considered to be within the knowledge of those skilled in the art.

 The present invention provides an isolated nucleic acid (polynucleotide), which basically consists of a polynucleotide encoding a polypeptide having the amino acid sequence of SEQ ID NO: 2. The polynucleotide sequence of the present invention includes the nucleotide sequence of SEQ ID NO: 1. The polynucleotide of the present invention is found from a cDNA library of human fetal brain tissue. It contains a polynucleotide sequence of 958 bases in length and its open reading frame 106-462 encodes 118 amino acids. This polypeptide has a characteristic sequence of a characteristic sequence of a corticotropin-releasing factor, and it can be deduced that the corticotropin-releasing factor 13 has a structure and a function represented by the characteristic sequence of a corticotropin-releasing factor.

 The polynucleotide of the present invention may be in the form of DNA or RNA. DNA forms include cDNA, genomic DNA, or synthetic DNA. DNA can be single-stranded or double-stranded. DNA can be coding or non-coding. The coding region sequence encoding the mature polypeptide may be the same as the coding region sequence shown in SEQ ID NO: 1 or a degenerate variant. As used in the present invention, a "degenerate variant" refers to a nucleic acid sequence encoding a protein or polypeptide having SEQ ID NO: 2 but different from the coding region sequence shown in SEQ ID NO: 1 in the present invention.

The polynucleotide encoding the mature polypeptide of SEQ ID NO: 2 includes: only the coding sequence of the mature polypeptide; The coding sequence of the cooked polypeptide and various additional coding sequences; the coding sequence (and optional additional coding sequences) of the mature polypeptide and non-coding sequences.

 The term "polynucleotide encoding a polypeptide" refers to a polynucleotide that encodes the polypeptide and a polynucleotide that includes additional coding and / or non-coding sequences.

 The invention also relates to variants of the polynucleotides described above, which encode polypeptides or fragments, analogs and derivatives of polypeptides having the same amino acid sequence as the invention. Variants of this polynucleotide may be naturally occurring allelic variants or non-naturally occurring variants. These nucleotide variants include substitution variants, deletion variants, and insertion variants. As known in the art, an allelic variant is an alternative form of a polynucleotide that may be a substitution, deletion, or insertion of one or more nucleotides, but does not substantially change the function of the polypeptide it encodes .

 The invention also relates to a polynucleotide that hybridizes to the sequence described above (having at least 50%, preferably 70% identity between the two sequences). The present invention particularly relates to polynucleotides that can hybridize to the polynucleotides of the present invention under stringent conditions. In the present invention, "strict conditions" means: (1) hybridization and elution at lower ionic strength and higher temperature, such as 0.2xSSC, 0.1% SDS, 60 ° C; or (2) Add a denaturant during hybridization, such as 50% (v / v) formamide, 0.1% calf serum / 0.1 lcol 1, 42 ° C, etc .; or (3) only the same between the two sequences Crosses occur only when the sex is at least 95%, and more preferably 97%. In addition, the hybridizable polynucleotide-encoded polypeptide has the same biological function and activity as the mature polypeptide shown in SEQ ID NO: 2.

 The invention also relates to nucleic acid fragments that hybridize to the sequences described above. As used in the present invention, a "nucleic acid fragment" contains at least 10 nucleotides in length, preferably at least 20-30 nucleotides, more preferably at least 50-60 nucleotides, and most preferably at least 100 cores. Glycylic acid or more. Nucleic acid fragments can also be used in nucleic acid amplification techniques such as PCR to identify and / or isolate polynucleotides encoding corticotropin-releasing factor 13.

 The polypeptides and polynucleotides in the present invention are preferably provided in an isolated form and are more preferably purified to homogeneity. The specific polynucleotide sequence encoding the corticotropin-releasing factor 1 3 of the present invention can be obtained by various methods. For example, polynucleotides are isolated using hybridization techniques well known in the art. These techniques include, but are not limited to: 1) hybridization of probes to genomic or cDNA libraries to detect homologous polynucleotide sequences, and 2) antibody screening of expression libraries to detect cloned polynucleosides with common structural characteristics Acid fragments.

 The DNA fragment sequence of the present invention can also be obtained by the following methods: 1) isolating the double-stranded NA sequence from the genomic DNA; 2) chemically synthesizing the DNA sequence to obtain the double-stranded DNA of the polypeptide.

Of the methods mentioned above, genomic DNA isolation is the least commonly used. Direct chemical synthesis of MA sequences is often the method of choice. The more commonly used method is the isolation of cDNA sequences. The standard method for isolating the cDNA of interest is to isolate mRNA from donor cells that overexpress the gene and perform reverse transcription to form a plasmid or phage cDNA library. There are many mature techniques for extracting mRNA, and kits are also commercially available (Q i agene;). And the construction of cDNA library is also a common method (Sambrook, etal., Mo l ecu l ar Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory. New York, 1989). Commercially available cDNA libraries are also available, such as different cDNA libraries from Clontech. When polymerase reaction technology is used in combination, even very small expression products can be cloned.

 The genes of the present invention can be selected from these cDNA libraries by conventional methods. These methods include (but are not limited to): (1) DM-D or DM-RNA hybridization; (2) the presence or absence of marker gene functions; (3) determination of the level of transcripts of corticotropin-releasing factor 13; ( 4) Detecting gene-expressed protein products by immunological techniques or by measuring biological activity. The above methods can be used singly or in combination.

 In the method (1), the probe used for hybridization is homologous to any part of the polynucleotide of the present invention, and its length is at least 10 nucleotides, preferably at least 30 nucleotides, more preferably At least 50 nucleotides, preferably at least 100 nucleotides. In addition, the length of the probe is usually within 2000 nucleotides, preferably within 1000 nucleotides. The probe used here is usually a DM sequence chemically synthesized based on the gene sequence information of the present invention. The genes or fragments of the present invention can of course be used as probes. DNA probes can be labeled with radioisotopes, luciferin, or enzymes (such as alkaline phosphatase).

 In the (4) method, the protein product of the adrenocorticotropin-releasing factor 13 gene expression can be detected by immunological techniques such as Western blotting, radioimmunoprecipitation, and enzyme-linked immunosorbent assay (ELISA).

 A method of applying a PCR technique to amplify DNA / RNA (Saiki, et al. Science 1985; 230: 1350-1354) is preferably used to obtain the gene of the present invention. In particular, when it is difficult to obtain full-length cDNA from a library, the RACE method (RACE-rapid cDNA end rapid amplification method) may be preferably used. The primers for PCR may be appropriately based on the polynucleotide sequence information of the present invention disclosed herein. Select and synthesize using conventional methods. The amplified DNA / RNA fragments can be isolated and purified by conventional methods such as by gel electrophoresis.

 The polynucleotide sequence of the gene of the present invention or various DNA fragments and the like obtained as described above can be determined by a conventional method such as dideoxy chain termination method (Sanger et al. PNAS, 1977, 74: 5463-5467). Such polynucleotide sequences can also be determined using commercial sequencing kits and the like. In order to obtain the full-length cDNA sequence, the sequencing must be repeated. Sometimes it is necessary to determine the cDNA sequence of multiple clones in order to splice into a full-length cDNA sequence.

 The present invention also relates to a vector comprising the polynucleotide of the present invention, and a host cell produced by genetic engineering using the vector of the present invention or directly using a corticotropin-releasing factor 13 coding sequence, and the recombinant technology to produce the polypeptide of the present invention Methods.

In the present invention, a polynucleotide sequence encoding a corticotropin-releasing factor 13 can be inserted into a vector to constitute a recombinant vector containing the polynucleotide of the present invention. The term "vector" refers to bacterial plasmids, phages, yeast plasmids, plant cell viruses, mammalian cell viruses such as adenoviruses, retroviruses, or other vectors well known in the art. Vectors suitable for use in the present invention include, but are not limited to: T7 promoter-based expression vector (Rosenberg, et al. Gene, 1987, 56: 125); pMSXND expression vector expressed in mammalian cells (Lee and Nathans, J Bio Chem. 263: 3521, 1988) and in insects A baculovirus-derived vector expressed in cells. In short, as long as it can be replicated and stabilized in a host, any plasmid and vector can be used to construct a recombinant expression vector. An important feature of expression vectors is that they usually contain an origin of replication, a promoter, a marker gene, and translational regulatory elements.

 Methods known to those skilled in the art can be used to construct expression vectors containing a DNA sequence encoding a corticotropin-releasing factor 13 and appropriate transcriptional / translational regulatory elements. These methods include in vitro recombinant DNA technology, DNA synthesis technology, and in vivo recombination technology (Sambroook, et al. Molecular Cloning, a Laboratory Manual, cold Spring Harbor Laboratory. New York, 1989). The DNA sequence can be operably linked to an appropriate promoter in an expression vector to guide mRNA synthesis. Representative examples of these promoters are: the lac or trp promoter of E. coli; the PL promoter of lambda phage; eukaryotic promoters include the CMV immediate early promoter, the HSV thymidine kinase promoter, the early and late SV40 promoters, Retroviral LTRs and other known promoters that control the expression of genes in prokaryotic or eukaryotic cells or their viruses. The expression vector also includes a ribosome binding site for translation initiation and a transcription terminator. Insertion of enhancer sequences into the vector will enhance its transcription in higher eukaryotic cells. Enhancers are cis-acting factors for DNA expression, usually about 10 to 300 base pairs, which act on promoters to enhance gene transcription. Examples include 100 to 270 base pair SV40 enhancers on the late side of the origin of replication, polyoma enhancers on the late side of the origin of replication, and adenoviral enhancers.

 In addition, the expression vector preferably contains one or more selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture. Fluorescent protein (GFP), or tetracycline or ampicillin resistance for E. coli.

 Those of ordinary skill in the art will know how to select appropriate vector / transcription control elements (such as promoters, enhancers, etc.) and selectable marker genes.

 In the present invention, a polynucleotide encoding a corticotropin-releasing factor 13 or a recombinant vector containing the polynucleotide can be transformed or transduced into a host cell to form a genetically engineered host cell containing the polynucleotide or the recombinant vector. The term "host cell" refers to a prokaryotic cell, such as a bacterial cell; or a lower eukaryotic cell, such as a yeast cell; or a higher eukaryotic cell, such as a mammalian cell. Representative examples are: E. coli, Streptomyces; bacterial cells such as Salmonella typhimurium; fungal cells such as yeast; plant cells; insect cells such as flies S2 or Sf9; animal cells such as CH0, COS or Bowes melanoma cells.

Transformation of a host cell with a DNA sequence described in the present invention or a recombinant vector containing the DNA sequence can be performed using conventional techniques well known to those skilled in the art. When the host is a prokaryote such as E. coli, competent cells capable of DNA uptake can be harvested after exponential growth phase, (with &: Treatment 1 _2, step used in the art The domain is well known. The alternative is to use MgC l ₂ . If necessary, transformation can also be performed by electroporation. When the host is a eukaryotic organism, the following DM transfection methods can be used: calcium phosphate co-precipitation method, or conventional mechanical methods such as microinjection, electroporation, and liposome packaging.

 By conventional recombinant DNA technology, the polynucleotide sequence of the present invention can be used to express or produce recombinant corticotropin-releasing factor 1 3 (Scence, 1984; 224: 1431). Generally there are the following steps:

 (1) using the polynucleotide (or variant) encoding human corticotropin releasing factor 13 of the present invention, or transforming or transducing a suitable host cell with a recombinant expression vector containing the polynucleotide;

 (2) culturing host cells in a suitable medium;

 (3) Isolate and purify protein from culture medium or cells.

 In step (2), depending on the host cell used, the medium used in the culture may be selected from various conventional mediums. Culture is performed under conditions suitable for host cell growth. After the host cells have grown to an appropriate cell density, the selected promoter is induced by a suitable method (such as temperature conversion or chemical induction), and the cells are cultured for a period of time.

 In step (3), the recombinant polypeptide may be coated in a cell, expressed on a cell membrane, or secreted outside the cell. If desired, recombinant proteins can be isolated and purified by various separation methods using their physical, chemical, and other properties. These methods are well known to those skilled in the art. These methods include, but are not limited to: conventional renaturation treatment, protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid chromatography (HPLC) and various other liquid chromatography techniques and combinations of these methods. Brief description of the drawings

 The following drawings are used to illustrate specific embodiments of the invention, but not to limit the scope of the invention as defined by the claims.

 FIG. 1 is a comparison diagram of the amino acid sequence homology of a characteristic sequence of a corticotropin-releasing factor of 58 in the range of 5 1 to 1 18 in the present invention. The upper sequence is the corticotropin-releasing factor 1 3, and the lower sequence is the characteristic sequence of the corticotropin-releasing factor.和 "and": "and" · "indicate that the probability of different amino acids appearing at the same position between two sequences decreases in sequence

Figure 2 shows the polyacrylamide gel electrophoresis (SDS-PAGE) of the isolated adrenocorticotropin releasing factor 13. 13KDa is the molecular weight of the protein. The arrow indicates the isolated protein band. The best way to implement the invention The present invention is further described below with reference to specific embodiments. It should be understood that these examples are only used to illustrate the present invention and not to limit the scope of the present invention. In the following examples, the experimental methods without specific conditions are generally performed according to conventional conditions such as Sambrook et al., Molecular Cloning: The conditions described in the laboratory manual (New York: Cold Spring Harbor Laboratory Press, 1989), or according to the manufacturer Suggested conditions. Example 1: Cloning of corticotropin-releasing factor 13

 Human fetal brain total RNA was extracted by one-step method with guanidine isothiocyanate / phenol / chloroform. Using Quik mRNA Isolation Kit

(Qiegene product) Isolate poly (A) mRNA from total RNA. 2ug poly (A) mRNA is reverse transcribed to form cDNA. The Smart cDNA cloning kit (purchased from Clontech) was used to insert the cDNA fragments into the multiple cloning site of pBSK (+) vector (C'lontech) to transform DH5α. The bacteria formed a cDNA library. Dye terminate cycle react ion sequencing kit (Perk in-Elmer) and ABI 377 automatic sequencer (Perkin-Elmer) were used to determine the sequences at the 5 'and 3' ends of all clones. The determined cDNA sequence was compared with the existing public DNA sequence database (Genebank), and it was found that the cDNA sequence of one of the clones, 0022g07, was a new DNA. A series of primers were synthesized to determine the inserted cDNA fragments of the clone in both directions. The results showed that the full-length cDNA contained in the 0022g07 clone was 958 bp (as shown in Seq ID NO: 1), and there was a 357 bp open reading frame (0RF) from 106 bp to 462 bp, encoding a new protein (such as Seq ID N0 : 2)). We named this clone pBS-0022 _g 07 and named the encoded protein as corticotropin-releasing factor 13. Example 2: Domain analysis of cDNA clones

 The sequence of the adrenocorticotropin-releasing factor 13 of the present invention and the protein sequence encoded by the same were used in a profile scan program (Basiclocal Alignment search tool) in GCG [Altschul, SF et al. J. Mol. Biol. 1990; 215: 403-10], performing domain analysis in databases such as prosite. The corticotropin-releasing factor 13 of the present invention is homologous with the characteristic sequence of the domain corticotropin-releasing factor at 51-118, and the homology result is shown in FIG. 1. The homology rate is 0.15, and the score is 9.04; the threshold is 8.84 . Example 3: Cloning of a gene encoding corticotropin-releasing factor 13 by RT-PCR

 CDNA was synthesized using fetal brain total RNA as a template and oligo-dT as a primer.

 After purification of Qiagene's kit, PCR amplification was performed with the following primers:

 Primer 1: 5'— GGGAAACTAACTGGAGCGAAGTGG- 3 '(SEQ ID NO: 3)

 Primer 2: 5'- ACCTTAGGTTTGCCTCATGTCCCT- 3 '(SEQ ID NO: 4)

 Primerl is a forward sequence starting at lbp of the 5th end of SEQ ID NO: 1;

 Primer2 is the 3 'end reverse sequence in SEQ ID NO: 1.

Amplification conditions: 50 mmol / L KC1, 10 mmol / L Tris- CI, (pH 8.5), 1.5 mmol / L MgCl, 200 μmol! / L dNTP, lOpmol primer, 1 U Taq DNA polymerase (Clontech). The reaction was performed on a PE 00 DM thermal cycler (Perkin-Elmer) for 25 cycles under the following conditions: 94 ° C 30sec; 55 ° C 30sec; 72 ° C 2min. During RT-PCR, β-act in was set as a positive control and template blank was set as a negative control. The amplified product was purified using a QIAGEN kit and ligated to a PCR vector (Invitrogen product) using a TA cloning kit. The DNA sequence analysis results showed that the DNA sequence of the PCR product was exactly the same as 1-958bp shown in SEQ ID NO: 1. Example 4: Northern blot analysis of the expression of corticotropin-releasing factor 13 gene:

Total RNA extraction in one step [Anal. Biochem 1987, 162, 156-159]. This method involves acid guanidinium thiocyanate phenol-chloroform extraction. That is, the tissue is homogenized with 4M guanidinium isothiocyanate-25mM sodium citrate, 0.2M sodium acetate (pH4.0), and 1 volume of phenol and 1/5 volume of chloroform-isoamyl alcohol (49: 1 ) And centrifuge after mixing. Aspirate the aqueous layer, add isopropanol (0.8 vol) and centrifuge the mixture to obtain RNA precipitate. The resulting RNA pellet was washed with 70% ethanol, dried and dissolved in water. Using 20 g of RNA, electrophoresis was performed on a 1.2% agarose gel containing 20 mM 3- (N-morpholino) propanesulfonic acid (pH 7.0)-5raM sodium acetate-1 mM EDTA-2.2M formaldehyde. It was then transferred to a nitrocellulose membrane. Preparation ³² P- DNA probe labeled with a- ³² P dATP by random priming method. The DNA probe used was the PCR-enhanced corticotropin-releasing factor 13 coding region sequence (106b _P to 462bp) shown in Figure 1. The 32P-labeled probe (about 2 x 10 ⁶ cpm / ml) and RNA-transferred nitrocellulose membrane was hybridized overnight at 42 ° C in a solution containing 50% formamide-25mM KH ₂ P0 ₄ (pH7.4)-5 χ SSC-5 Denhardt's solution and 200 g / ml Salmon sperm DNA. After hybridization, the filter was washed in 1 x SSC-0.1% SDS at 55 ° C for 30 minutes. Then, it was analyzed and quantified using a Phosphor Imager. Example 5: Recombinant ACTH 13 in vitro Expression, isolation and purification

 Based on the sequence of the coding region shown in SEQ ID NO: 1 and Figure 1, a pair of specific amplification primers were designed. The sequences are as follows:

 Primer 3: 5'- CCCCATATGATGTGTCCAAGTCTGGTTTCTGGG- 3 '(Seq ID No: 5)

Primer4: 5'- CATGGATCCTTAGGAGAAGAAGTTTCTGGCGGT- 3 '(Seq ID No: 6) The 5' ends of these two primers contain Ndel and BamHI digestion sites, respectively, followed by the coding sequences of the 5 'and 3' ends of the target gene, respectively. The Ndel and BamHI restriction sites correspond to the selective endonuclease sites on the expression vector plasmid pET-28b (+) (Novagen, Cat. No. 69865.3). The PCR reaction was performed using the _P BS-0022g07 plasmid containing the full-length target gene as a template. The PCR reaction conditions were as follows: 10 pg of pBS-0022g07 plasmid, primers Primer-3 and Primer-4 were included in a total volume of 50 μ1, and ¹ j was lOpmol, Advantage polymerase Mix (Clontech) 1 μ1. Cycle parameters: 94 ° C 20s, 60 ° C 30s, 68 ° C 2 min, a total of 25 cycles. Ndel and BamHI were used to double digest the amplified product and plasmid pET-28 (+), respectively, and large fragments were recovered, respectively. And ligated with T4 ligase. The ligation product was transformed into DH5cc, a colibacillus bacillus Calcium chloride method, and cultured overnight in LB plates containing kanamycin (final concentration 30 μ _§ / ηα). Positive colonies were screened by colony PCR method and sequenced. A positive clone (pET-0022g07) with a correct sequence was selected, and the recombinant plasmid was transformed into E. coli BL21 (DE3) plySs (product of Novagen) using the calcium chloride method. In LB liquid medium containing kanamycin (final concentration 30 g / ml), the host strain BL21 (pET-0022g07) was cultured at 37 ° C to the logarithmic growth phase, and IPTG was added to a final concentration of 1 mmol / L, and continued Incubate for 5 hours. The cells were collected by centrifugation, and the supernatant was collected by centrifugation. The supernatant was collected by centrifugation. The affinity chromatography column His. Bind Quick Cartridge (product of Novagen) was used to obtain 6 histidines (6His-Tag). The purified protein of interest was adrenocorticotropic hormone-releasing factor-13. After SDS-PAGE electrophoresis, a single band was obtained at 13 KDa (Figure 2). The band was transferred to a PVDF membrane and the N-terminal amino acid sequence was analyzed by the Edams hydrolysis method. As a result, the 15 amino acids at the N-terminus were identical to the 15 amino acid residues at the N-terminus shown in SEQ ID NO: 2. Example 6 Production of Anti-Adrenocorticotropic Hormone Release Factor 13 Antibodies

 Polypeptide synthesizer (product of PE company) was used to synthesize the following adrenocorticotropic hormone-releasing factor 13-specific peptides:

 NH2-Met-Cys-Pro-Ser-Leu-Val-Ser-Gly-Phe-Leu-Cys-Ser-Pro-Ser-G 1 y- C00H (SEQ ID NO: 7). The polypeptide is coupled to hemocyanin and bovine serum albumin to form a complex, respectively. For methods, see: Avrameas, et al. Immunochemistry, 1969; 6: 43. Immunize the patient with 4 mg of the hemocyanin polypeptide complex and complete Freund's adjuvant. After 15 days, use the hemocyanin polypeptide complex and incomplete Freund's adjuvant to boost the immunity once. A titer plate coated with a 15 g / ml bovine serum albumin peptide complex was used as an ELISA to determine antibody titers in serum. Protein A-Sepharose was used to isolate total IgG from antibody-positive home-immunized serum. The peptide was bound to a cyanogen bromide-activated Sepharos B column, and the anti-peptide antibody was separated from the total IgG by affinity chromatography. The immunoprecipitation method proved that the purified antibody could specifically interact with corticotropin-releasing factor 13 Combined. Example 7: Application of the polynucleotide fragment of the present invention as a hybridization probe

 Suitable oligonucleotide fragments selected from the polynucleotides of the present invention are used as hybridization probes in various aspects. For example, the probes can be used to hybridize to genomic or cDNA libraries of normal tissue or pathological tissue from different sources to It is identified whether it contains the polynucleotide sequence of the present invention and a homologous polynucleotide sequence is detected. Further, the probe can also be used to detect the polynucleotide sequence of the present invention or its homologous polynucleotide sequence in normal tissue or Whether the expression in pathological tissue cells is abnormal.

The purpose of this embodiment is to select a suitable oligonucleotide fragment from the polynucleotide SEQ ID NO: 1 of the present invention as a hybridization probe, and to identify whether some tissues contain the polynucleoside of the present invention by a filter hybridization method. Acid sequence or a homologous polynucleotide sequence thereof. Filter hybridization methods include dot blotting, Southern blotting, Nor thern blotting method and copying method, etc., all use the same steps to fix the polynucleotide sample to be tested on the filter and then hybridize. These same steps are as follows: The sample-immobilized filter is first pre-hybridized with a probe-free hybridization buffer, so that the non-specific binding site of the sample on the filter is saturated with the carrier and the synthetic polymer. The pre-hybridization solution is then replaced with a hybridization buffer containing the labeled probe and incubated to hybridize the probe to the target nucleic acid. After the hybridization step, the unhybridized probes are removed by a series of membrane washing steps. This embodiment utilizes higher-intensity washing conditions (such as lower salt concentration and higher temperature) to reduce the hybridization background and retain only strong specific signals. The probes used in this embodiment include two types: the first type of probes are oligonucleotide fragments that are completely the same as or complementary to the polynucleotide SEQ ID NO: 1 of the present invention; the second type of probes are partially related to the present invention The polynucleotide SEQ ID NO: 1 is the same or complementary oligonucleotide fragment. In this embodiment, the dot blot method is used to fix the sample on the filter membrane. Under the high-intensity washing conditions, the first type of probe and the sample have the strongest hybridization specificity and are retained.

First, the selection of the probe

 The selection of oligonucleotide fragments for use as hybridization probes from the polynucleotide SEQ ID NO: 1 of the present invention should follow the following principles and several aspects to be considered:

 1. The preferred range of probe size is 18-50 nucleotides;

 2.The GC content is 30% -70%, and the non-specific hybridization increases when it exceeds;

 3, there should be no complementary regions inside the probe;

 4. Those that meet the above conditions can be used as primary selection probes, and then further computer sequence analysis, including the primary selection probe and its source sequence region (ie, SEQ ID NO: 1) and other known genomic sequences and their complements The regions are compared for homology. If the homology with the non-target molecular region is greater than 85% or there are more than 15 consecutive bases, then the primary probe should not be used;

 5. Whether the preliminary selection probe is finally selected as a probe with practical application value should be further determined by experiments.

 After completing the above analysis, select and synthesize the following two probes:

 Probe 1 (probel), which belongs to the first type of probe, is completely homologous or complementary to the gene fragment of SEQ ID NO: 1 (41Nt)

 5'-TGTGTCCAAGTCTGGTTTCTGGGTTTCTTTGTAGTCCCTCC-3 '(SEQ ID NO: 8) Probe 2 (probe2), which belongs to the second type of probe, is equivalent to the replacement mutation sequence (41Nt) of the gene fragment or its complementary fragment of SEQ ID NO: 1:

5'- TGTGTCCAAGTCTGGTTTCACGGTTTCTTTGTAGTCCCTCC— 3 '(SEQ ID NO: 9) For other commonly used reagents and their preparation methods related to the following specific experimental steps, please refer to the literature: DNA PROBES GH Ke ll er; MM Manak; S tock ton Pres s, 1989 (USA) and more commonly used molecular cloning experiment manuals such as the "Molecular Cloning Experiment Guide" U 998 Second Edition. [US] Sambrook et al., Science Press. Sample Preparation:

1. Extract DNA from fresh or frozen tissue

Steps: 1) Place fresh or freshly thawed normal liver tissue in a plate immersed in ice and filled with phosphate buffered saline (PBS). Cut the tissue into small pieces with scissors or a scalpel. Keep tissue moist during operation. 2) Centrifuge the tissue at 1,000 g for 10 minutes. 3) Use cold homogenization buffer (0.25mol / L sucrose; 25 ol / L Tris-HCl, pH7.5; 25ramol / LnaCl; 25mmol / L MgCl ₂ suspension pellet (about 10ml / g)) 4) at 4 ° C homogenize the tissue suspension at full speed with an electric homogenizer until the tissue is completely broken. 5) Centrifuge at 1000g for 10 minutes. 6) Resuspend the cell pellet (add 1-5ml per 0.1g of the original tissue sample), and then Centrifuge at 1000g for 10 minutes. 7) Resuspend the pellet with lysis buffer (add lral per 0.1 g of the initial tissue sample), and then follow the phenol extraction method below.

 2, DNA phenol extraction method

Steps: 1) Wash the cells with 1-10ml of cold PBS and centrifuge at 1000g for 10 minutes. 2) with cold cell lysate pelleted cells were resuspended (1 X 10 ⁸ cells / ml) Minimum application lOOul lysis buffer. 3) Add SDS to a final concentration of 1%. If SDS is added directly to the cell pellet before resuspending the cells, the cells may form large clumps that are difficult to break, and reduce the overall yield. This is particularly serious when extracting> 10 ⁷ cells. 4) Add proteinase K to a final concentration of 200ug / ml. 5) Incubate at 50 ° C for 1 hour or shake gently at 37 ° C overnight. 6) Extract with an equal volume of phenol: chloroform: isoamyl alcohol (25: 24: 1) and centrifuge in a small centrifuge tube for 10 minutes. The two should be clearly separated, otherwise centrifuge again. 7) Transfer the water phase to a new tube. 8) Extract with an equal volume of chloroform: isoamyl alcohol (24: 1) and centrifuge for 10 minutes. 9) Transfer the DNA-containing aqueous phase to a new tube. The DNA was then purified and ethanol precipitated.

 3, DNA purification and ethanol precipitation

Steps: 1) Add 1/10 volume of 2mol / L sodium acetate and 2 volumes of cold 100% ethanol to the DNA solution and mix. Leave at -20 ° C for 1 hour or overnight. 2) Centrifuge for 10 minutes. 3) Carefully aspirate or pour out the ethanol. 4) Wash the pellet with 500ul of 70% cold ethanol and centrifuge for 5 minutes. 5) Carefully aspirate or pour out the ethanol. Wash the pellet with 500ul of cold ethanol and centrifuge for 5 minutes. 6) Carefully aspirate or pour out the ethanol, then invert on the absorbent paper to drain off the residual ethanol. Air dry for 10-15 minutes to allow the surface ethanol to evaporate. Be careful not to allow the pellet to dry completely, otherwise it will be more difficult to re-dissolve. 7) Resuspend the DNA pellet in a small volume of TE or water. Low-speed vortexing or pipetting, with a dropper, while gradually increasing the TE, mixed until fully dissolved DNA, ¹⁰⁶ cells per 1- 5 χ extracted plus about lui.

 The following steps 8-13 are only used when contamination must be removed, otherwise step 14 can be performed directly.

8) Add RNase A to the DNA solution to a final concentration of 100ug / ml, and incubate at 37 ° C for 30 minutes. 9) Add SDS and proteinase K to the final concentration of 0.5% and 100ug / ml. Incubate at 37 ° C for 30 minutes. 10) Extract the reaction solution with an equal volume of phenol: chloroform: isoamyl alcohol (25: 24: 1) and centrifuge for 10 minutes. 11) Carefully remove The aqueous phase was re-extracted with an equal volume of chloroform: isoamyl alcohol (24: 1) and centrifuged for 10 minutes. 12) Carefully remove the water phase, add 10 volumes of 2mol / L sodium acetate and 2.5 volumes of cold ethanol, and mix well at -20 ° C for 1 hour. 13) Wash the precipitate with 70% ethanol and 100% ethanol, air dry, and resuspend the nucleic acid. The process is the same as steps 3-5. 14) Measure A ₂₆ . And A ₂₈ . To check the purity and yield of DM. 15) Store at -20 ° (:) after packing.

Preparation of sample film:

 1) Take 4 x 2 pieces of nitrocellulose membranes (NC membranes) of appropriate size, and mark the spotting position and sample number lightly with a pencil. Two NC membranes are required for each probe for subsequent experiments. In the step, the film is washed with high-strength conditions and strength conditions, respectively.

 2) Aspirate and control 15 microliters each, spot on the sample film, and dry at room temperature.

 3) Place on filter paper impregnated with 0.1 mol / L NaOH, 1.5 mol / L NaCl for 5 minutes (twice), dry and place on filter paper impregnated with 0.5 mol / L Tris-HCl (pH 7.0), 3 mol / L NaCl Allow to dry for 5 minutes (twice).

 4) Caught in clean filter paper, wrapped in aluminum foil, and dried under vacuum at 60-80 ° C for 2 hours.

 Labeling of probes

1) 3 μl Probe (0.1 IOD / Ιθμ 1), add 2 μ IKinase buffer, 8-10 uCi γ- ³² P- dATP + 2U Kinase, to make up to a final volume of 20 μ 1.

 2) Incubate at 37 ° C for 2 hours.

 3) Add 1/5 volume of bromophenol blue indicator (BPB).

 4) Pass through a Sephadex G-50 column.

5) Before the ³² P-Probe is washed out, start collecting the first peak (can be monitored by Monitor).

 6) 5 drops / tube, collect 10-15 tubes.

 7) Monitor the amount of isotope with a liquid scintillator

8) After combining the collection solutions of the first peak, the ³² P-Probe (the second peak is free γ- ³² P-dATP) is prepared. Pre-hybridization

 Put the sample film in a plastic bag, add 3-10 mg of pre-hybridization solution (lOxDenhardt's; 6xSSC, 0.1 mg / ml CT DNA (calf thymus DNA).), Seal the bag, and shake at 68 ° C for 2 hours in a water bath .

 Cross

 Cut a corner of the plastic bag, add the prepared probe, seal the bag, and shake it at 42 ° C in a water bath overnight.

 Wash film:

 High-intensity washing film:

 1) Take out the hybridized sample membrane.

 2) 2xSSC, 0.1% SDS, wash at 40 ° C for 15 minutes (twice).

3) Wash in 0.1xSSC, 0.1 SDS for 15 minutes at 40 ° C (twice). 4) Wash in 0.1xSSC, 0.1% SDS at 55 ° C for 30 minutes (twice), and dry at room temperature. Low-intensity washing film:

 1) Take out the hybridized sample membrane.

 2) 2xSSC, 0.1% SDS, wash at 37 ° C for 15 minutes (twice).

 3) Wash in 0.1xSSC, 0.125SDS at 37 ° C for 15 minutes (twice).

 4) 0.1xSSC, 0.1% SDS, 40. Wash for 15 minutes (twice) and dry at room temperature.

X-ray autoradiography:

 -70 ° C, X-ray autoradiography (pressing time depends on the radioactivity of the hybrid spot).

 Experimental results:

 釆 The hybridization experiments performed under low-intensity membrane washing conditions did not differ significantly in the radioactivity of the above two probe hybrid spots; while the hybridization experiments performed under high-intensity membrane washing conditions, the radioactive intensity of hybridization spots of probe 1 was obvious. Stronger in radioactivity than the hybridization spot of another probe. Therefore, probe 1 can be used to qualitatively and quantitatively analyze the presence and differential expression of the polynucleotide of the present invention in different tissues. Industrial applicability

 The polypeptides of the present invention, as well as antagonists, agonists and inhibitors of the polypeptides, can be directly used in the treatment of diseases, for example, they can treat malignant tumors, adrenal deficiency, skin diseases, various types of inflammation, HIV infection, and immune diseases.

 Corticotropin-releasing factor (CRF) is a hormone in the hypothalamus that regulates the synthesis and release of adrenocorticotropic hormone in the pituitary gland. The regulation of adrenocorticotropic hormone in the body promotes the secretion of various hormones by the adrenal cortex, and the adrenal cortex can secrete a variety of hormones such as adrenocortical hormone, glucocorticoid, mineralocorticoid and sex hormone in the body. Important physiological functions.

 Corticotropin-releasing factor-specific conserved sequences are required to form its active mot i f. It can be seen that the abnormal expression of the specific corticotropin-releasing factor mot if will cause the function of the polypeptide containing the mot if of the present invention to be abnormal, thereby causing abnormalities in the synthesis and release of corticotrophin, and thus the adrenal cortex. Secretion of various hormones is dysfunctional, and related diseases such as adrenal diseases and chemoreceptor tumors are generated.

It can be seen that the abnormal expression of the corticotropin-releasing factor 1 3 of the present invention will produce various diseases, especially adrenal diseases and chemoreceptor tumors, and these diseases include, but are not limited to: hyperadrenocortical function such as hypercortisolism ( Cu _S hing), primary hyperaldosteronism, adrenal insufficiency Diseases such as acute adrenal insufficiency, chronic adrenal insufficiency, adrenal medullary hyperplasia, pheochromocytoma, adrenal chemoreceptor tumor

The polypeptides of the present invention, as well as the antagonists, agonists and inhibitors of the polypeptides, can be directly used in the treatment of diseases, for example, they can treat various diseases, especially hyperadrenal function, such as Cortisol (Cushi _ng ), primary Hyperaldosteronism, adrenal insufficiency such as acute adrenal insufficiency, chronic adrenal insufficiency, adrenal medulla hyperplasia, pheochromocytoma, adrenal chemoreceptor tumors, etc. The invention also provides methods of screening compounds to identify agents that increase (agonist) or suppress (antagonist) corticotropin-releasing factor-13. Agonists increase biological functions such as corticotropin-releasing factor 13 to stimulate cell proliferation, while antagonists prevent and treat disorders related to cell proliferation, such as various cancers. For example, mammalian cells or membrane preparations expressing corticotropin-releasing factor 13 can be cultured together with labeled corticotropin-releasing factor 13 in the presence of a drug. The ability of the drug to increase or block this interaction is then determined.

 Antagonists of corticotropin-releasing factor 13 include antibodies, compounds, receptor deletions, and the like that have been screened. Antagonists of corticotropin-releasing factor 13 can combine with corticotropin-releasing factor 13 and eliminate its function, or inhibit the production of the polypeptide, or bind to the active site of the polypeptide so that the polypeptide cannot exert its biology Features.

 In screening compounds that act as antagonists, corticotropin-releasing factor 13 can be added to bioanalytical assays to determine whether a compound is a compound by measuring its effect on the interaction between corticotropin-releasing factor 13 and its receptor. Antagonist. Receptor deletions and analogs that act as antagonists can be screened in the same manner as described above for screening compounds. Polypeptide molecules capable of binding to the corticotropin releasing factor 1 3 can be obtained by screening a random peptide library composed of various possible combinations of amino acids bound to a solid phase. During screening, the adrenocorticotropin-releasing factor 13 molecule should generally be labeled.

 The present invention provides a method for producing an antibody using a polypeptide, a fragment, a derivative, an analog thereof, or a cell thereof as an antigen. These antibodies can be polyclonal or monoclonal antibodies. The invention also provides antibodies directed against the adrenal determinant of corticotropin-releasing factor 13. These antibodies include (but are not limited to): polyclonal antibodies, monoclonal antibodies, chimeric antibodies, single-chain antibodies, Fab fragments, and fragments from Fab expression libraries.

Polyclonal antibodies can be produced by injecting adrenocorticotropic hormone release factor 13 directly into immunized animals (such as rabbits, mice, rats, etc.). A variety of adjuvants can be used to enhance the immune response, including but not limited to Freund's Adjuvant, etc. Techniques for preparing monoclonal antibodies to corticotropin-releasing factor 13 include, but are not limited to, hybridoma technology (Koh ler and Miste in. Nature, 1975, 256: 495-497), three tumors Technology, human B-cell hybridoma technology, EBV-hybridoma technology, etc. Chimeric antibodies that combine human constant regions with non-human variable regions can be produced using existing techniques (Morrison et al, PNAS, 1985, 81: 6851) and existing techniques for producing single-chain antibodies (US Pa t No. 4946778) can also be used to produce single chain antibodies against corticotropin releasing factor 13.

 Antibodies to corticotropin-releasing factor 13 can be used in immunohistochemical techniques to detect corticotropin-releasing factor 13 in biopsy specimens.

 Monoclonal antibodies that bind to corticotropin-releasing factor 13 can also be labeled with radioisotopes and injected into the body to track their location and distribution. This radiolabeled antibody can be used as a non-invasive diagnostic method to locate tumor cells and determine whether there is metastasis.

 Antibodies can also be used to design immunotoxins that target a particular part of the body. For example, a high-affinity monoclonal antibody to corticotropin-releasing factor 13 can be covalently bound to bacterial or phytotoxins (such as diphtheria toxin, ricin, ormosine, etc.). A common method is to attack the amino group of an antibody with a thiol cross-linking agent such as SPDP and bind the toxin to the antibody through the exchange of disulfide bonds. This hybrid antibody can be used to kill adrenocorticotropic hormone-releasing factor 13 positive cell.

 The antibodies of the present invention can be used to treat or prevent diseases related to corticotropin-releasing factor 1 3. Administration of appropriate doses of antibodies can stimulate or block the production or activity of corticotropin-releasing factor 1 3.

 The invention also relates to a diagnostic test method for quantitatively and locally detecting the level of corticotropin-releasing factor 13. These tests are well known in the art and include FI SH assays and radioimmunoassays. The level of corticotropin-releasing factor 13 measured in the test can be used to explain the importance of corticotropin-releasing factor 1 3 in various diseases and to diagnose diseases where corticotropin-releasing factor 1 3 works .

 The polypeptide of the present invention can also be used for peptide mapping analysis. For example, the polypeptide can be specifically cleaved by physical, chemical or enzymatic analysis, and subjected to one-dimensional or two-dimensional or three-dimensional gel electrophoresis analysis, and more preferably mass spectrometry.

The polynucleotide encoding corticotropin-releasing factor 13 can also be used for a variety of therapeutic purposes. Gene therapy technology can be used to treat abnormal cell proliferation, development, or metabolism caused by the non-expression or abnormal / inactive expression of corticotropin-releasing factor 13. Recombinant gene therapy vectors (such as viral vectors) can be designed to express mutant corticotropin-releasing factor 13 to inhibit endogenous corticotropin-releasing factor 13 activity. For example, a variant of corticotropin-releasing factor 13 may be a shortened corticotropin-releasing factor 13 lacking a signaling domain, and although it can bind to a downstream substrate, it lacks signaling activity. Therefore, the recombinant gene therapy vector can be used to treat diseases caused by abnormal expression or activity of corticotropin-releasing factor 13. Virus-derived expression vectors such as retrovirus, adenovirus, adenovirus-associated virus, herpes simplex virus, parvovirus, etc. can be used to edit A polynucleotide encoding corticotropin-releasing factor 13 is transferred into the cell. A method for constructing a recombinant viral vector carrying a polynucleotide encoding a corticotropin-releasing factor 13 can be found in the existing literature (Sambrook, et al.). In addition, a recombinant polynucleotide encoding corticotropin-releasing factor 13 can be packaged into liposomes and transferred into cells.

 Methods for introducing a polynucleotide into a tissue or cell include: directly injecting the polynucleotide into a tissue in vivo; or introducing the polynucleotide into a cell in vitro through a vector (such as a virus, phage, or plasmid), and then transplanting the cell Into the body and so on.

 Oligonucleotides (including antisense RNA and DNA) and ribozymes that inhibit corticotropin-releasing factor 13 mRNA are also within the scope of the present invention. A ribozyme is an enzyme-like RNA molecule that specifically decomposes specific RNA. Its mechanism of action is that the ribozyme molecule specifically hybridizes with a complementary target RNA for endonucleation. Antisense RNA, DNA, and ribozymes can be obtained using any existing RNA or DNA synthesis technology, such as solid-phase phosphate amide chemical synthesis to synthesize oligonucleotides. Antisense RNA molecules can be obtained by in vitro or in vivo transcription of DM sequences encoding the RNA. This DM sequence has been integrated downstream of the RNA polymerase promoter of the vector. In order to increase the stability of the nucleic acid molecule, it can be modified in a variety of ways, such as increasing the sequence length on both sides, and the linkage between ribonucleosides using phosphate thioester or peptide bonds instead of phosphodiester bonds.

 The polynucleotide encoding corticotropin-releasing factor 13 can be used for the diagnosis of diseases related to corticotropin-releasing factor 13. The polynucleotide encoding corticotropin-releasing factor 13 can be used to detect the expression of corticotropin-releasing factor 13 or the abnormal expression of corticotropin-releasing factor 13 in a disease state. For example, the DNA sequence encoding corticotropin-releasing factor 13 can be used to hybridize biopsy specimens to determine the expression of corticotropin-releasing factor 13. Hybridization techniques include Southern blotting, Northern blotting, in situ hybridization, and so on. These techniques and methods are all mature and open technologies, and related kits are commercially available. A part or all of the polynucleotides of the present invention can be used as probes to be fixed on a microarray or a DNA chip (also referred to as a "gene chip") for analyzing differential expression analysis and gene diagnosis of genes in tissues. Adrenocorticotropin-releasing factor 13 specific primers for RNA-polymerase chain reaction (RT-PCR) in vitro amplification can also detect the transcription products of corticotropin-releasing factor 13.

 Detection of mutations in the corticotropin-releasing factor 13 gene can also be used to diagnose diseases related to corticotropin-releasing factor 13. Corticotrophin-releasing factor 13 mutations include point mutations, translocations, deletions, recombinations, and any other abnormalities compared to normal wild-type corticotropin-releasing factor 13 DNA sequences. Existing techniques such as Southern can be used Detection of mutations by blotting, DNA sequence analysis, PCR and in situ hybridization. In addition, mutations may affect protein expression. Therefore, Northern blotting and Western blotting can be used to indirectly determine whether a gene is mutated.

The sequences of the invention are also valuable for chromosome identification. This sequence will be specific to someone The chromosome is in a specific location and can be crossed with it. Currently, specific sites for each gene on the chromosome need to be identified. Currently, only a few chromosome markers based on actual sequence data (repeating polymorphisms) are available for labeling chromosome positions. According to the present invention, in order to associate these sequences with disease-related genes, an important first step is to locate these DNA sequences on a chromosome.

 In short, PCR primers (preferably 15-35bp) are prepared based on cDNA, and the sequences can be located on chromosomes. These primers were then used for PCR screening of somatic hybrid cells containing individual human chromosomes. Only those heterozygous cells containing the human gene corresponding to the primer will produce amplified fragments.

 PCR localization of somatic hybrid cells is a quick way to localize DNA to specific chromosomes. Using the oligonucleotide primers of the present invention, in a similar manner, a set of fragments from a specific chromosome or a large number of genomic clones can be used to achieve sublocalization. Other similar strategies that can be used for chromosomal localization include in situ hybridization, chromosome pre-screening with labeled flow sorting, and pre-selection of hybridization to construct chromosome-specific cDNA libraries.

 Fluorescent in situ hybridization (FISH) of cDNA clones with metaphase chromosomes allows precise chromosomal localization in a single step. For a review of this technique, see Verma et al., Human Chroraosomes: a Manual of Basic Techniques, Pergamon Press, New York (1988).

 Once the sequence is located at the exact chromosomal location, the physical location of the sequence on the chromosome can be correlated with the genetic map data. This data can be found, for example, in V. Mckusick, Mendelian Inheritance in Man (available online with Johns Hopkins University Welch Medical Library). Linkage analysis can then be used to determine the relationship between genes and diseases that have been mapped to chromosomal regions.

 Next, the cDNA or genomic sequence differences between the affected and the affected individuals need to be determined. If a mutation is observed in some or all of the affected individuals and the mutation is not observed in any normal individual, the mutation may be Is the cause of the disease. Comparing affected and unaffected individuals usually involves first looking for structural changes in chromosomes, such as deletions or translocations that are visible at the chromosomal level or detectable with cDNA sequence-based PCR. According to the resolution capabilities of current physical mapping and gene mapping technology, the cDNA accurately mapped to the chromosomal region associated with the disease can be one of 50 to 500 potentially pathogenic genes (assuming 1 megabase mapping resolution) Capacity and each 20kb corresponds to a gene).

 The polypeptides, polynucleotides and mimetics, agonists, antagonists and inhibitors of the present invention can be used in combination with a suitable pharmaceutical carrier. These carriers can be water, glucose, ethanol, salts, buffers, glycerol, and combinations thereof. The composition comprises a safe and effective amount of the polypeptide or antagonist, and carriers and excipients that do not affect the effect of the drug. These compositions can be used as drugs for the treatment of diseases.

The present invention also provides a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the present invention. Along with these containers, there can be medicines manufactured or used by or sold An indicative prompt given by a government regulatory agency for biological products that reflects the permission of the government regulatory agency that produces, uses, or sells it to be administered to the human body. In addition, the polypeptides of the invention can be used in combination with other therapeutic compounds.

 The pharmaceutical composition can be administered in a convenient manner, such as by a topical, intravenous, intraperitoneal, intramuscular, subcutaneous, intranasal or intradermal route of administration. Corticotropin-releasing factor 1 3 is administered in an amount effective to treat and / or prevent a specific indication. The amount and dose range of corticotropin-releasing factor 1 3 to be administered to a patient will depend on many factors, such as the mode of administration, the health conditions of the person to be treated, and the judgment of the diagnostician.

Claims

1. An isolated polypeptide-corticotropin-releasing factor 13, characterized in that it comprises: a polypeptide having the amino acid sequence shown in SEQ II) NO: 2, or an active fragment, analog, or derivative of a polypeptide thereof.

 2. The polypeptide according to claim 1, characterized in that the amino acid sequence of the polypeptide, analog or derivative has at least 95% identity with the amino acid sequence shown in SEQ ID NO: 2.

 3. The polypeptide according to claim 2, characterized in that it comprises a polypeptide having the amino acid sequence shown in SEQ ID NO: 2.

 4. An isolated polynucleotide, characterized in that said polynucleotide comprises one selected from the group consisting of:

 (a) a polynucleotide encoding a polypeptide having the amino acid sequence shown in SEQ ID NO: 2 or a fragment, analog, or derivative thereof;

 (b) a polynucleotide complementary to polynucleotide (a); or

 (c) A polynucleotide that is at least 70% identical to (a) or (b).

 5. The polynucleotide according to claim 4, wherein the polynucleotide comprises a polynucleotide encoding an amino acid sequence represented by SEQ ID NO: 2.

 6. The polynucleotide according to claim 4, characterized in that the sequence of the polynucleotide comprises the sequence of positions 106 to 462 in SEQ ID NO: 1 or the sequence of positions 1 to 958 in SEQ ID NO: 1. .

 7. A recombination vector containing an exogenous polynucleotide, characterized in that it is a recombination constructed by the polynucleotide according to any one of claims 4-6 and a plasmid, virus or a carrier expression vector Carrier.

 8. A genetically engineered host cell containing an exogenous polynucleotide, characterized in that it is selected from one of the following host cells:

 (a) a host cell transformed or transduced with the recombinant vector of claim 7; or

 (b) a host cell transformed or transduced with a polynucleotide according to any one of claims 4-6.

9. A method for preparing a polypeptide having corticotropin-releasing factor 13 activity, characterized in that the method includes:

 (a) culturing the engineered host cell according to claim 8 under the condition of expressing corticotropin releasing factor 13;

 (b) Isolating a polypeptide having adrenocorticotropic hormone-releasing factor 13 activity from the culture.

 10. An antibody capable of binding to a polypeptide, characterized in that said antibody is an antibody capable of specifically binding to a corticotropin releasing factor 13.

 11. A class of compounds that mimic or regulate the activity or expression of a polypeptide, characterized in that they are compounds that mimic, promote, antagonize or inhibit the activity of corticotropin-releasing factor 13.

12. The compound according to claim 11, characterized in that it is a polynuclear head-acid sequence shown in SEQ ID NO: 1. Antisense sequence of a column or fragment thereof.

 13. Use of a compound according to claim 11, characterized in that the compound is used for a method for regulating the activity of corticotropin-releasing factor 13 in vivo and in vitro.

 14. A method for detecting a disease or susceptibility to a disease associated with a polypeptide according to any one of claims 1-3, characterized in that it comprises detecting the expression level of the polypeptide, or detecting the activity of the polypeptide Or detecting a nucleotide variation in a polynucleotide that causes abnormal expression or activity of the polypeptide.

 15. Use of the polypeptide according to any one of claims 1-3, characterized in that it is used for screening mimetics, agonists, antagonists or inhibitors of corticotropin-releasing factor 13; or Identification of peptide fingerprints.

 16. The use of a nucleic acid molecule according to any one of claims 4-6, characterized in that it is used as a primer for a nucleic acid amplification reaction, or as a probe for a hybridization reaction, or for manufacturing a gene chip Or microarray.

 17. Use of a polypeptide, polynucleotide or compound according to any one of claims 1-6 and 11, characterized in that said polypeptide, polynucleotide or mimetic, agonist, antagonist is used Or the inhibitor is composed of a safe and effective dose in combination with a pharmaceutically acceptable carrier as a pharmaceutical composition for diagnosing or treating a disease associated with an abnormality of corticotropin releasing factor 13

 18. The use of a polypeptide, polynucleotide or compound according to any one of claims 1-6 and 11, characterized in that the polypeptide, polynucleotide or compound is used for preparing for treating malignant tumors, blood, etc. Diseases, HIV infection and immune diseases and drugs of various inflammations.