WO2002026975A1 - Nouveau polypeptide, proteine humaine 48-35.53 associee au rhomboide, et polynucleotide codant ce polypeptide - Google Patents

Nouveau polypeptide, proteine humaine 48-35.53 associee au rhomboide, et polynucleotide codant ce polypeptide Download PDF

Info

Publication number
WO2002026975A1
WO2002026975A1 PCT/CN2001/001363 CN0101363W WO0226975A1 WO 2002026975 A1 WO2002026975 A1 WO 2002026975A1 CN 0101363 W CN0101363 W CN 0101363W WO 0226975 A1 WO0226975 A1 WO 0226975A1
Authority
WO
WIPO (PCT)
Prior art keywords
polypeptide
polynucleotide
human
sequence
associated protein
Prior art date
Application number
PCT/CN2001/001363
Other languages
English (en)
Chinese (zh)
Inventor
Yumin Mao
Yi Xie
Original Assignee
Shanghai Biowindow Gene Development Inc.
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Shanghai Biowindow Gene Development Inc. filed Critical Shanghai Biowindow Gene Development Inc.
Priority to AU2002218107A priority Critical patent/AU2002218107A1/en
Publication of WO2002026975A1 publication Critical patent/WO2002026975A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides

Definitions

  • the present invention belongs to the field of biotechnology. Specifically, the present invention describes a new polypeptide ⁇ ⁇ diamond-shaped related protein 48-35.53, and a polynucleotide sequence encoding the polypeptide. The invention also relates to a method and application for preparing such polynucleotides and polypeptides.
  • Drosophila epidermal growth factor (EGF) receptor DER has many functions in growth and development.
  • the main antagonist of DER during embryonic and larval development is Spitz.
  • Spitz is a member of the EGF / Transforming Growth Factor alpha family. Like most other EGF-related proteins, Spitz is synthesized as a transmembrane precursor protein. The release of Spitz precursors from the cell membrane is specific to Spitz as a DER antagonist.
  • the second gene, the diamond gene product is genetically related to the Spitz process. Diamond proteins have six to seven transmembrane domains (Schweitzer, R., Shaharabany, M., Seger, R. And Shilo, B.-Z., (1995) Genes Dev. 9, 1518-1529).
  • rhomboid proteins The function of rhomboid proteins is evolutionarily conserved.
  • the major components of the EGF receptor signaling pathway are conserved between Drosophila and humans, so the diamond proteins of humans and Drosophila have homology.
  • RRP rhomboid-associated protein
  • RRP genetically makes the Spitz / epidermal growth factor receptor / mitogen-activated protein kinase pathway easy to signal.
  • the protein has seven transmembrane domains and has the highest expression levels in the brain and kidney. It is a new component of the mammalian EGF receptor signaling pathway (John C. Pascall, Kenneth D. Brown, FEBS Letters 429 (1998) 337-340).
  • the new human rhomboid-related protein and the human rhomboid-related protein of the present invention have 58% identity and 75% similarity at the protein level, and also contain various characteristic sequence fragments, which have similar biological functions, and are therefore named Human rhomboid-associated protein 48.
  • the polypeptide and its agonists, inhibitors, and antagonists can be used to diagnose and prevent various developmental diseases related to the epidermal growth factor receptor / mitogen-activated protein kinase pathway.
  • the human rhomboid-associated protein 48-35.53 protein plays an important role in regulating important functions of the body such as cell division and embryonic development, and it is believed that a large number of proteins are involved in these regulatory processes, so it has been necessary to identify more involved in these The human rhomboid-associated protein 48-35.53 protein, especially the amino acid sequence of this protein was identified. Isolation of the new rhomboid-associated protein 48-35.53 protein encoding gene also provides a basis for research to determine the role of this protein in health and disease states. This These proteins may form the basis for the development of diagnostic and / or therapeutic drugs for diseases, so it is important to isolate their coding DNA. Object of the invention
  • An object of the present invention is to provide an isolated novel polypeptide-human rhomboid-related protein 48-35.53 and fragments, analogs and derivatives thereof.
  • Another object of the invention is to provide a polynucleotide encoding the polypeptide.
  • Another object of the present invention is to provide a recombinant vector containing a polynucleotide encoding human rhomboid-associated protein 48-35.53.
  • Another object of the present invention is to provide a genetically engineered host cell containing a polynucleotide encoding human rhomboid-associated protein 48-35.53.
  • Another object of the present invention is to provide a method for producing human rhomboid-associated protein 48-35.53.
  • Another object of the present invention is to provide a human rhomboid-associated protein 48-
  • Another object of the present invention is to provide mimic compounds, antagonists, agonists, and inhibitors directed to the polypeptide of the present invention, human rhomboid-related protein 48-35.53.
  • Another object of the present invention is to provide a method for diagnosing and treating diseases related to the abnormality of human rhomboid-associated protein 48-35.53. Summary of invention
  • the present invention relates to an isolated polypeptide, which is of human origin and comprises: a polypeptide having the amino acid sequence of SEQ ID No. 2, or a conservative variant, biologically active fragment or derivative thereof.
  • the polypeptide is a polypeptide having the amino acid sequence of SEQ ID NO: 2.
  • the invention also relates to an isolated polynucleotide comprising a nucleotide sequence or a variant thereof selected from the group consisting of:
  • sequence of the polynucleotide is one selected from the group consisting of: (a) a sequence having positions 98-1069 in SEQ ID NO: 1; and (b) a sequence having 1-1303 in SEQ ID NO: 1 Sequence of bits.
  • the invention further relates to a vector, in particular an expression vector, containing the polynucleotide of the invention; a host cell genetically engineered with the vector, including a transformed, transduced or transfected host cell; a package
  • the method of preparing the polypeptide of the present invention includes culturing the host cell and recovering the expressed product.
  • the invention also relates to an antibody capable of specifically binding to a polypeptide of the invention.
  • the invention also relates to a method for screening compounds that mimic, activate, antagonize or inhibit the activity of human rhomboid-associated protein 48-35.53 protein, which comprises utilizing the polypeptide of the invention.
  • the invention also relates to compounds obtained by this method.
  • the present invention also relates to a method for in vitro detection of a disease or susceptibility to disease associated with abnormal expression of human rhomboid-associated protein 48-35.53 protein, comprising detecting a mutation in the polypeptide or a sequence encoding a polynucleotide thereof in a biological sample, Alternatively, the amount or biological activity of a polypeptide of the invention in a biological sample is detected.
  • the invention also relates to a pharmaceutical composition
  • a pharmaceutical composition comprising a polypeptide of the invention or a mimetic thereof, an activator, an antagonist or an inhibitor, and a pharmaceutically acceptable carrier.
  • the present invention also relates to the use of the polypeptide and / or polynucleotide of the present invention in the preparation of a medicament for treating cancer, developmental disease or immune disease or other diseases caused by abnormal expression of human rhomboid-associated protein 48-35.53.
  • Fig. 1 is a comparison diagram of the amino acid sequence homology of human rhomboid-related protein 48-35.53 and human rhomboid-related protein 48 of the present invention.
  • the upper sequence is human diamond-associated protein 48-35.53, and the lower sequence is human diamond-associated protein 48.
  • Identical amino acids are represented by single-character amino acids between the two sequences, and similar amino acids are represented by "+”.
  • Figure 2 is the polyacrylamide gel electrophoresis (SDS-PAGE) of the isolated human rhomboid-related protein 48-35.53. 35. 53kDa is the molecular weight of the protein. The arrow indicates the isolated protein band.
  • Nucleic acid sequence refers to an oligonucleotide, a nucleotide or a polynucleotide and a fragment or part thereof, and may also refer to a genomic or synthetic DM or RNA, they can be single-stranded or double-stranded, representing the sense or antisense strand.
  • amino acid sequence refers to an oligopeptide, peptide, polypeptide or protein sequence and fragments or portions thereof.
  • amino acid sequence in the present invention relates to the amino acid sequence of a naturally occurring protein molecule
  • polypeptide or “protein” is not meant to limit the amino acid sequence to the complete natural amino acid associated with the protein molecule.
  • a “variant" of a protein or polynucleotide refers to an amino acid sequence having one or more amino acids or nucleotide changes or a polynucleotide sequence encoding it.
  • the changes may include deletions, insertions or substitutions of amino acids or nucleotides in the amino acid sequence or nucleotide sequence.
  • Variants can have "conservative" changes, in which the amino acid substituted has a structural or chemical property similar to the original amino acid, such as replacing isoleucine with leucine.
  • Variants can also have non-conservative changes, such as replacing glycine with tryptophan.
  • “Deletion” refers to the deletion of one or more amino acids or nucleotides in an amino acid sequence or nucleotide sequence.
  • Insertion means that a change in the amino acid sequence or nucleotide sequence results in an increase in one or more amino acids or nucleotides compared to a molecule that exists in nature.
  • Replacement refers to the replacement of one or more amino acids or nucleotides with different amino acids or nucleotides.
  • Bioactivity refers to a protein that has the structure, regulation, or biochemical function of a natural molecule.
  • immunologically active refers to the ability of natural, recombinant or synthetic proteins and fragments thereof to induce a specific immune response and to bind specific antibodies in a suitable animal or cell.
  • An "agonist” refers to a molecule that, when combined with human rhomboid-associated protein 48-35.53, causes a change in the protein to regulate the activity of the protein.
  • An agonist may include a protein, a nucleic acid, a carbohydrate, or any other molecule that binds human rhomboid-associated protein 48-35.53.
  • Antagonist refers to a molecule that can block or regulate the biological or immunological activity of human rhomboid-associated protein 48-35.53 when combined with human rhomboid-associated protein 48-35.53.
  • Antagonists and inhibitors may include proteins, nucleic acids, carbohydrates, or any other molecule that can bind human rhomboid-associated proteins 48-35.53.
  • Regular refers to changes in the function of human diamond-associated protein 48-35.53, including the increase or decrease in protein activity, changes in binding characteristics, and any other biological properties and functions of human diamond-associated protein 48-35.53. Or changes in immune properties.
  • Substantially pure means substantially free of other proteins, lipids, carbohydrates or other substances with which it is naturally associated.
  • Those skilled in the art can purify human rhombohedral related proteins 48-35.53 using standard protein purification techniques.
  • Substantially pure human rhomboid-associated proteins 48-35.53 can produce a single main band on a non-reducing polyacrylamide gel.
  • the purity of human rhomboid-associated protein 48-35.53 polypeptide can be analyzed by amino acid sequence.
  • Complementary refers to a polynucleotide that naturally binds by base-pairing under conditions of acceptable salt concentration and temperature.
  • sequence C-GA
  • G-ACT complementary sequence
  • the complementarity between two single-stranded molecules may be partial or complete.
  • the degree of complementarity between nucleic acid strands The efficiency and strength of hybridization between nucleic acid strands has a significant effect.
  • “Homology” refers to the degree of complementarity and can be partially homologous or completely homologous.
  • Partial homology refers to a partially complementary sequence that at least partially inhibits hybridization of a fully complementary sequence to a target nucleic acid. This inhibition of hybridization can be detected by performing hybridization (Southern imprinting or Northern blotting, etc.) under conditions of reduced stringency. Substantially homologous sequences or hybridization probes can compete and inhibit the binding of fully homologous sequences to the target sequence under conditions of reduced stringency. This does not mean that the conditions of reduced stringency allow non-specific binding, because the conditions of reduced stringency require that the two sequences bind to each other as a specific or selective interaction.
  • Percent identity refers to the percentage of sequences that are identical or similar in the comparison of two or more amino acid or nucleic acid sequences. The percent identity can be determined electronically, such as by the MEGALIGN program (Lasergene sof tware package, DNASTAR, Inc., Madi son Wis.). The MEGALIGN program can compare two or more sequences according to different methods such as the Clus ter method (Hi ggins, DG and PM Sharp (1988) Gene 73: 237-244). 0 The Clus ter method compares each pair by checking the distance between all pairs. Group sequences are arranged in clusters. The clusters are then assigned in pairs or groups. The percent identity between two amino acid sequences such as sequence A and sequence B is calculated by the following formula:
  • the percent identity between nucleic acid sequences can also be determined by the Clus ter method or by methods known in the art, such as Jotun He in (He in J., (1990) Methods in enzymology 183: 625-645).
  • Similarity refers to the degree of identical or conservative substitutions of amino acid residues at corresponding positions in the alignment of amino acid sequences.
  • Amino acids used for conservative substitution for example, negatively charged amino acids may include aspartic acid and glutamic acid; positively charged amino acids may include lysine and arginine; having an uncharged head group is Similar hydrophilic amino acids may include leucine, isoleucine and valine; glycine and alanine; asparagine and glutamine; serine and threonine; phenylalanine and tyrosine.
  • Antisense refers to a nucleotide sequence that is complementary to a particular DNA or RM sequence.
  • Antisense strand refers to a nucleic acid strand that is complementary to a “sense strand.”
  • Derivative refers to HFP or a chemical modification of its nucleic acid. This chemical modification may be the replacement of a hydrogen atom with an alkyl, acyl or amino group. Nucleic acid derivatives can encode polypeptides that retain the main biological properties of natural molecules.
  • Antibody refers to an intact antibody molecules and fragments thereof, such as Fa, F (a b,) 2 and F V, which specifically binds to human antigen diamond 35.53 48-related protein determinants.
  • Humanized antibody means that the amino acid sequence of a non-antigen binding region is replaced with a human antibody Antibodies that are more similar but still retain their original binding activity.
  • isolated refers to the removal of a substance from its original environment (for example, its natural environment if it is naturally occurring).
  • a naturally-occurring polynucleotide or polypeptide is not isolated when it is present in a living thing, but the same polynucleotide or polypeptide is separated from some or all of the substances that coexist with it in the natural system.
  • Such a polynucleotide may be part of a certain vector, or such a polynucleotide or polypeptide may be part of a certain composition. Since the carrier or composition is not part of its natural environment, they are still isolated.
  • isolated refers to the separation of a substance from its original environment (if it is a natural substance, the original environment is the natural environment).
  • polynucleotides and polypeptides in a natural state in a living cell are not isolated and purified, but the same polynucleotides or polypeptides are separated and purified if they are separated from other substances in the natural state .
  • isolated human rhomboid-associated protein 48-35.53 refers to human rhomboid-associated protein 48-35.53 that is substantially free of other proteins, lipids, sugars, or other substances with which it is naturally associated.
  • Those skilled in the art can purify human rhombohedral related proteins 48-35.53 using standard protein purification techniques.
  • Substantially pure polypeptides can produce a single main band on a non-reducing polyacrylamide gel.
  • the purity of human rhomboid-associated protein 48-35.53 polypeptide can be analyzed by amino acid sequence.
  • the present invention provides a new polypeptide, human rhomboid-related protein 48-35.53, which is basically composed of the amino acid sequence shown in SEQ ID NO: 2.
  • the polypeptide of the present invention may be a recombinant polypeptide, a natural polypeptide, or a synthetic polypeptide, and preferably a recombinant polypeptide.
  • the polypeptides of the present invention can be naturally purified products or chemically synthesized products, or can be produced from prokaryotic or eukaryotic hosts (eg, bacteria, yeast, higher plants, insects, and mammalian cells) using recombinant techniques. Depending on the host used in the recombinant production protocol, the polypeptide of the invention may be glycosylated, or it may be non-glycosylated. Polypeptides of the invention may also include or exclude initial methionine residues.
  • the present invention also includes fragments, derivatives, and analogs of human rhomboid-associated protein 48-35.53.
  • fragment refers to a polypeptide that substantially retains the same biological function or activity of the human rhomboid-related proteins 48-35.53 of the present invention.
  • a fragment, derivative or analog of the polypeptide of the present invention may be: (I) a kind in which one or more amino acid residues are substituted with conservative or non-conservative amino acid residues (preferably conservative amino acid residues), and the substitution
  • the amino acid may or may not be encoded by the genetic code; or (II) such a type in which a group on one or more amino acid residues is substituted by other groups to include a substituent; or (III) such One, in which the mature polypeptide is fused to another compound (such as a compound that prolongs the half-life of the polypeptide, such as polyethylene glycol); or (IV) one in which the additional amino acid sequence is fused to the mature polypeptide
  • the resulting polypeptide sequence (such as a leader sequence or a secreted sequence or a sequence used to purify the polypeptide or a protein sequence).
  • such fragments, derivatives and analogs are considered to be within the knowledge of those skilled in the art.
  • the present invention provides an isolated nucleic acid (polynucleotide), which basically consists of a polynucleotide encoding a polypeptide having the amino acid sequence of SEQ ID NO: 2.
  • the polynucleotide sequence of the present invention includes the nucleotide sequence of SEQ ID NO: 1.
  • the polynucleotide of the present invention is found from a cDNA library of human fetal brain tissue. It contains a polynucleotide sequence with a total length of 1303 bases, and its open reading frame 98-1 069 encodes 323 amino acids.
  • this peptide has 75% homology with human rhomboid-related protein 48, and it can be deduced that the human rhomboid-related protein 48-35. 53 has similar structure and function to human rhomboid-related protein 48.
  • the polynucleotide of the present invention may be in the form of DNA or RM.
  • DNA forms include cDNA, genomic DNA, or synthetic DNA.
  • DNA can be single-stranded or double-stranded.
  • DNA can be coding or non-coding.
  • the coding region sequence encoding a mature polypeptide may be the same as the coding region sequence shown in SEQ ID NO: 1 or a degenerate variant.
  • a "degenerate variant" refers to a nucleic acid sequence encoding a protein or polypeptide having SEQ ID NO: 2 but different from the coding region sequence shown in SEQ ID NO: 1 in the present invention.
  • the polynucleotide encoding the mature polypeptide of SEQ ID NO: 2 includes: only the coding sequence of the mature polypeptide; the coding sequence of the mature polypeptide and various additional coding sequences; the coding sequence of the mature polypeptide (and optional additional coding sequences); Coding sequence.
  • polynucleotide encoding a polypeptide refers to a polynucleotide comprising the polypeptide and a polynucleotide comprising additional coding and / or non-coding sequences.
  • the invention also relates to variants of the polynucleotides described above, which encode polypeptides or fragments, analogs and derivatives of polypeptides having the same amino acid sequence as the invention.
  • Variants of this polynucleotide can be naturally occurring allelic variants or non-naturally occurring variants. These nucleotide variants include substitution variants, deletion variants, and insertion variants.
  • an allelic variant is an alternative form of a polynucleotide that may be a substitution, deletion, or insertion of one or more nucleotides, but does not substantially change the function of the polypeptide it encodes .
  • the invention also relates to a polynucleotide that hybridizes to the sequence described above (having at least 50 %, preferably 70% identity between the two sequences).
  • the invention particularly relates to polynucleotides that can hybridize to the polynucleotides of the invention under stringent conditions.
  • “strict conditions” means: (1) hybridization and elution at lower ionic strength and higher temperature, such as 0.2xSSC, 0.1% SDS, 6 (TC; or (2) Add a denaturant during hybridization, such as 50% (v / v) formamide, 0.1% calf serum / 0.1% F i co ll, 42 ° C, etc .; or (3) Hybridization occurs only when the identity between the two sequences is at least 95% or more, and more preferably 97% or more.
  • the polypeptide encoded by the hybridizable polynucleotide has the same biological function and activity as the mature polypeptide shown in SEQ ID NO: 2.
  • nucleic acid fragments that hybridize to the sequences described above.
  • a "nucleic acid fragment” contains at least 10 nucleotides in length, preferably at least 20-30 nucleotides, more preferably at least 50-60 nucleotides, and most preferably at least 100 nuclei. Glycylic acid or more. Nucleic acid fragments can also be used in nucleic acid amplification techniques (such as PCR) to identify and / or isolate polynucleotides encoding human rhomboid-associated proteins 48-35.53.
  • polypeptides and polynucleotides in the present invention are preferably provided in an isolated form and are more preferably purified to homogeneity.
  • the specific polynucleotide sequence encoding the human rhomboid-associated protein 48-35.53 of the present invention can be obtained by various methods.
  • polynucleotides are isolated using hybridization techniques well known in the art. These techniques include, but are not limited to: 1) hybridization of probes to genomic or cDNA libraries to detect homologous polynucleotide sequences, and 2) antibody screening of expression libraries to detect cloned polynucleosides with common structural characteristics Acid fragments.
  • the DNA fragment sequence of the present invention can also be obtained by the following methods: 1) isolating the double-stranded DM sequence from the genomic DNA; 2) chemically synthesizing the DM sequence to obtain the double-stranded DM of the polypeptide.
  • genomic DNA isolation is the least commonly used. Direct chemical synthesis of DNA sequences is often the method of choice. The more commonly used method is the isolation of cDNA sequences.
  • the standard method for isolating the cDM of interest is to isolate mRM from donor cells that overexpress the gene and perform reverse transcription to form a plasmid or phage cDNA library.
  • the construction of cDNA libraries is also a common method (Sambrook, et al., Molecular Cl oning, A Labora tory Manua l, Cold Spirit Harbor Labora tory. New York, 1989).
  • Commercially available cDNA libraries are also available, such as different cDNA libraries from Clontech. When polymerase reaction technology is used in combination, even very small expression products can be cloned.
  • genes of the present invention can be selected from these cDNA libraries by conventional methods. These methods include (but are not limited to): (l) DNA-DNA or DNA-RM hybridization; (2) the presence or absence of marker gene functions; (3) determination of the level of transcripts of human diamond-associated protein 48-35.53 (4) Detecting protein products expressed by genes through immunological techniques or measuring biological activity. The above methods can be used alone or in combination.
  • the probe used for hybridization is homologous to any part of the polynucleotide of the present invention, and its length is at least 10 nucleotides, preferably at least 30 nucleotides, more preferably At least 50 nucleotides, preferably at least 100 nucleotides.
  • the length of the probe is usually within 2000 nucleotides, preferably within 1000 nucleotides.
  • the probe used here is generally a DM sequence chemically synthesized based on the gene sequence information of the present invention.
  • the gene or fragment of the present invention may of course Used as a probe.
  • DM probes can be labeled with radioisotopes, luciferin, or enzymes (such as alkaline phosphatase).
  • the protein product of human rhomboid-associated protein 48-35.53 gene expression can be detected by immunological techniques such as Western blotting, radioimmunoprecipitation, and enzyme-linked immunosorbent assay (ELISA).
  • immunological techniques such as Western blotting, radioimmunoprecipitation, and enzyme-linked immunosorbent assay (ELISA).
  • a method using PCR technology to amplify DNA / RNA is preferably used to obtain the gene of the present invention.
  • the RACE method RACE-cDM terminal rapid amplification method
  • the primers used for PCR can be appropriately based on the polynucleotide sequence information of the present invention disclosed herein. Select and synthesize using conventional methods.
  • the amplified DNA / RNA fragments can be isolated and purified by conventional methods such as by gel electrophoresis.
  • polynucleotide sequence of the gene of the present invention or various DNA fragments and the like obtained as described above can be measured by a conventional method such as dideoxy chain termination method (Sanger et al. PNAS, 1977, 74: 5463-5467). Such polynucleotide sequences can also be determined using commercial sequencing kits and the like. In order to obtain the full-length cDM sequence, sequencing needs to be repeated. Sometimes it is necessary to determine the cDM sequence of multiple clones in order to splice into a full-length cDNA sequence.
  • the present invention also relates to a vector comprising a polynucleotide of the present invention, and a host cell produced by genetic engineering using the vector of the present invention or directly using human rhombic-associated protein 48-35.53 coding sequence, and a recombinant technology to produce a polypeptide of the present invention method.
  • a polynucleotide sequence encoding human rhombic related protein 48-35.53 can be inserted into a vector to constitute a recombinant vector containing the polynucleotide of the present invention.
  • vector refers to bacterial plasmids, phages, yeast plasmids, plant cell viruses, mammalian cell viruses such as adenoviruses, retroviruses, or other vectors well known in the art.
  • Vectors suitable for use in the present invention include, but are not limited to: T7 promoter-based expression vectors expressed in bacteria (Rosenberg, et al.
  • any plasmid and vector can be used to construct a recombinant expression vector.
  • An important feature of expression vectors is that they usually contain an origin of replication, a promoter, a marker gene, and translational regulatory elements.
  • an expression vector containing a DNA sequence encoding human rhomboid-associated protein 48-35.53 and suitable transcription / translation regulatory elements can be used to construct an expression vector containing a DNA sequence encoding human rhomboid-associated protein 48-35.53 and suitable transcription / translation regulatory elements. These methods include in vitro recombinant DM technology, DM synthesis technology, in vivo recombination technology, etc. (Sambroook, et al. Molecular Cloning, a Laboratory Manual, Cold Spring Harbor Laboratory. New York, 1989).
  • the DNA sequence can be operably linked to an appropriate promoter in the expression vector to guide mRM synthesis. Representative examples of these promoters are: the l ac or trp promoter of E.
  • the expression vector also includes a ribosome binding site and a transcription terminator for translation initiation. Insertion of enhancer sequences into the vector will enhance its transcription in higher eukaryotic cells. Enhancers are cis-acting factors for DNA expression, usually about 10 to 300 base pairs, which act on promoters to enhance gene transcription. Illustrative examples include SV40 enhancers of 100 to 270 base pairs on the late side of the origin of replication, polyoma enhancers on the late side of the origin of replication, and adenoviral enhancers.
  • the expression vector preferably contains one or more selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
  • selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
  • GFP fluorescent protein
  • tetracycline or ampicillin resistance for E. coli.
  • a polynucleotide encoding human rhombic related protein 48-35.53 or a recombinant vector containing the polynucleotide can be transformed or transduced into a host cell to form a genetically engineered host containing the polynucleotide or the recombinant vector.
  • the term "host cell” refers to a prokaryotic cell, such as a bacterial cell; or a lower eukaryotic cell, such as a yeast cell; or a higher eukaryotic cell, such as a mammalian cell. Representative examples are: E.
  • coli Streptomyces
  • bacterial cells such as Salmonella typhimurium
  • fungal cells such as yeast
  • plant cells such as fly S2 or Sf 9
  • animal cells such as CH0, COS, or Bowes s melanoma cells, etc. .
  • Transformation of a host cell with a DNA sequence described in the present invention or a recombinant vector containing the DNA sequence can be performed using conventional techniques well known to those skilled in the art.
  • the host is a prokaryote such as E. coli
  • competent cells capable of DNA uptake can be harvested after exponential growth phase, 0 & 012 processing method, the step used are well known in the art.
  • the alternative is to use MgC l 2 .
  • transformation can also be performed by electroporation.
  • the host is a eukaryotic organism, the following DNA transfection methods can be used: calcium phosphate co-precipitation method, or conventional mechanical methods such as microinjection, electroporation, and liposome packaging.
  • the polynucleotide sequence of the present invention can be used to express or produce recombinant human diamond-shaped related proteins 48-35. 53 (Scence, 1984; 224: 1431). Generally there are the following steps:
  • the medium used in the culture may be selected from various conventional mediums. Culture is performed under conditions suitable for host cell growth. After the host cells have grown to an appropriate cell density, the selected promoter is induced by a suitable method (such as temperature conversion or chemical induction), and the cells are cultured for a period of time.
  • a suitable method such as temperature conversion or chemical induction
  • the recombinant polypeptide may be coated in a cell, expressed on a cell membrane, or secreted outside the cell. If necessary, the recombinant protein can be isolated and purified by various separation methods using its physical, chemical and other properties. These methods are well known to those skilled in the art. These methods include, but are not limited to: conventional renaturation treatment, protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid chromatography (HPLC) and various other liquid chromatography techniques and combinations of these methods.
  • conventional renaturation treatment protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid
  • polypeptides of the present invention as well as antagonists, agonists and inhibitors of the polypeptides, can be directly used in the treatment of diseases, for example, they can treat malignant tumors, adrenal deficiency, skin diseases, various types of inflammation, HIV infection, and immune diseases.
  • EGF receptor DER Human epidermal growth factor (EGF) receptor DER has many functions in human growth and development. EGF, in combination with DER, stimulates the proliferation of many types of cells and acts as an induction signal during embryonic development. Human rhomboid-associated protein is a new component in the human EGF receptor signaling pathway and affects the normal physiological function of EGF. Abnormal expression in the human body can cause EGF dysfunction, lead to dysfunction of human cell proliferation, and then cause related diseases.
  • EGF epidermal growth factor
  • the polypeptide of the present invention and human rhomboid-associated protein are human rhomboid-associated protein 48, which contains characteristic sequences of the protein family. Both have similar biological functions.
  • the abnormal expression of the polypeptide in vivo can cause EGF to cause functional disorders and cause human body. Disturbance of cell proliferation causes related diseases, including but not limited to:
  • Tumors are common in various tissues, such as skin squamous cell carcinoma, bone (sarcoma) tumors, various leukemias, (malignant) gliomas, (malignant) hydatidiform moles, (malignant) teratomas, and the like.
  • polypeptide of the present invention and the antagonist, agonist and inhibitor of the polypeptide can be directly used for the treatment of various diseases, such as embryonic developmental malformations, tumors, and the like.
  • the invention also provides methods for screening compounds to identify agents that increase (agonist) or suppress (antagonist) human diamond-associated protein 48-35.53.
  • Agonists enhance human rhomboid-associated proteins 48-35.53 to stimulate biological functions such as cell proliferation, while antagonists prevent and treat disorders related to cell proliferation such as various Cancer.
  • mammalian cells or membrane preparations expressing human rhomboid-associated protein 48-35.53 can be cultured with labeled human rhomboid-associated protein 48-35.53 in the presence of drugs. The ability of the drug to increase or block this interaction is then determined.
  • Antagonists of human rhomboid-associated protein 48-35.53 include antibodies, compounds, receptor deletions, and the like that have been screened. Antagonists of human rhomboid-associated protein 48-35.53 can bind to human rhomboid-associated protein 48-35.53 and eliminate its function, or inhibit the production of the polypeptide, or bind to the active site of the polypeptide to make the polypeptide Cannot perform biological functions.
  • human rhomboid-associated protein 48-35.53 When screening compounds as antagonists, human rhomboid-associated protein 48-35.53 can be added to the bioanalytical assay by determining the effect of the compound on the interaction between human rhomboid-associated protein 48-35.53 and its receptor. Determine if the compound is an antagonist. Receptor deletions and analogs that act as antagonists can be screened in the same manner as described above for screening compounds. Polypeptide molecules capable of binding to human rhomboid-related proteins 48-35.53 can be obtained by screening a random peptide library composed of various possible combinations of amino acids bound to a solid phase. In the screening, generally, 48-35.53 molecules of human rhomboid-associated protein should be labeled.
  • the present invention provides a method for producing antibodies using polypeptides, and fragments, derivatives, analogs or cells thereof as antigens. These antibodies can be polyclonal or monoclonal antibodies.
  • the invention also provides antibodies against the human rhombic-associated protein 48-35.53 epitope. These antibodies include (but are not limited to): polyclonal antibodies, monoclonal antibodies, chimeric antibodies, single chain antibodies, Fab fragments, and fragments produced by Fab expression libraries.
  • polyclonal antibodies can be obtained by direct injection of human rhomboid-associated protein 48-35.53 into immunized animals (such as rabbits, mice, rats, etc.).
  • immunized animals such as rabbits, mice, rats, etc.
  • a variety of adjuvants can be used to enhance the immune response, including but not limited to 'S adjuvant and so on.
  • Techniques for preparing monoclonal antibodies to human rhomboid-associated protein 48-35.53 include, but are not limited to, hybridoma technology (Kohler and Miste in. Nature, 1975, 256: 495-497), triple tumor technology, human beta -Cell hybridoma technology, EBV-hybridoma technology, etc.
  • Chimeric antibodies that bind human constant regions and non-human variable regions can be produced using existing techniques (Morrison et al, PNAS, 1985, 81: 6851). 0 Existing techniques for producing single-chain antibodies (US Pat No. 4946778) can also be used to produce single chain antibodies against human rhomboid-associated protein 48-35.53.
  • Antibodies against human rhomboid-associated protein 48-35.53 can be used in immunohistochemical techniques to detect human rhomboid-associated protein 48-35.53 in biopsy specimens.
  • Monoclonal antibodies that bind to human rhomboid-associated protein 48-35.53 can also be labeled with radioisotopes and injected into the body to track their location and distribution. This radiolabeled antibody can be used as a non-invasive diagnostic method to locate tumor cells and determine whether there is metastasis.
  • Antibodies can also be used to design immunotoxins that target a particular part of the body. Rhomboid-associated protein 48- 35. 53 High affinity monoclonal antibodies can covalently bind to bacterial or plant toxins (such as diphtheria toxin, ricin, ormosine, etc.). A common method is to attack the amino group of an antibody with a thiol cross-linking agent such as SPDP, and bind the toxin to the antibody through the exchange of disulfide bonds. This hybrid antibody can be used to kill human 'diamond-shaped proteins 48-35. 53 positive cells.
  • a thiol cross-linking agent such as SPDP
  • the antibodies of the present invention can be used to treat or prevent diseases related to human rhomboid-associated protein 48-35.53. Administration of appropriate doses of antibodies can stimulate or block the production or activity of human rhomboid-associated protein 48-35.53.
  • the invention also relates to a diagnostic test method for quantitatively and locally detecting the level of human rhomboid-associated protein 48-35.53.
  • tests are well known in the art and include FISH assays and radioimmunoassays.
  • the levels of human rhomboid-associated protein 48-35.53 detected in the test can be used to explain the importance of human rhomboid-associated protein 48-35.53 in various diseases and to diagnose human rhomboid-associated protein 48-35.53. A working disease.
  • polypeptide of the present invention can also be used for peptide mapping analysis.
  • the polypeptide can be specifically cleaved by physical, chemical or enzymatic analysis, and subjected to one-dimensional or two-dimensional or three-dimensional gel electrophoresis analysis, and more preferably mass spectrometry analysis.
  • Polynucleotides encoding human diamond-associated proteins 48-35.53 can also be used for a variety of therapeutic purposes. Gene therapy technology can be used to treat abnormal cell proliferation, development or metabolism caused by the non-expression or abnormal / inactive expression of human rhomboid-associated protein 48-35.53.
  • Recombinant gene therapy vectors (such as viral vectors) can be designed to express mutated human diamond-associated protein 48-35.53 to inhibit endogenous human diamond-associated protein 48-35.53 activity.
  • a mutant human rhomboid-associated protein 48-35.53 may be a shortened human rhomboid-associated protein 48-35.53, which lacks a signaling functional domain.
  • the recombinant gene therapy vector can be used to treat diseases caused by abnormal expression or activity of human rhomboid-associated protein 48-35.53.
  • Virus-derived expression vectors such as retrovirus, adenovirus, adenovirus-associated virus, herpes simplex virus, and parvovirus can be used to transfer polynucleotides encoding human rhomboid-associated proteins 48-35.53 into cells. Methods for constructing recombinant viral vectors carrying polynucleotides encoding human rhomboid-associated proteins 48-35.53 can be found in existing literature (Sambrook, et al.). In addition, the recombinant polynucleotide encoding human rhomboid-associated protein 48-35.53 can be packaged into liposomes and transferred into cells.
  • Methods for introducing a polynucleotide into a tissue or cell include: directly injecting the polynucleotide into a tissue in vivo; or introducing the polynucleotide into a cell in vitro through a vector (such as a virus, phage, or plasmid), and then transplanting the cell Into the body and so on.
  • a vector such as a virus, phage, or plasmid
  • Oligonucleotides (including antisense RNA and DNA) that inhibit human diamond-associated protein 4 8 ⁇ 35. 53 mRNA And ribozymes are also within the scope of the invention.
  • a ribozyme is an enzyme-like RNA molecule that can specifically decompose specific RNA. Its mechanism of action is that the ribozyme molecule specifically hybridizes with a complementary target RNA and performs endonucleation.
  • Antisense RM and DM and ribozymes can be obtained by any existing RM or DNA synthesis technology. For example, the technology for the synthesis of oligonucleotides by solid-phase phosphoramidite chemical synthesis has been widely used.
  • Antisense RNA molecules can be obtained by in vitro or in vivo transcription of a DNA sequence encoding the RNA. This DM sequence is integrated downstream of the vector's RNA polymerase promoter. In order to increase the stability of a nucleic acid molecule, it can be modified in a variety of ways, such as increasing the sequence length on both sides, and the ribonucleoside linkages should use phosphate thioester or peptide bonds instead of phosphodiester bonds.
  • the polynucleotide encoding human rhomboid-associated protein 48-35.53 can be used for diagnosis of diseases related to human rhomboid-associated protein 48-35.53.
  • the polynucleotide encoding human rhomboid-related protein 48-35.53 can be used to detect the expression of human rhomboid-related protein 48-35.53 or the abnormal expression of human rhomboid-related protein 48-35.53 in the disease state.
  • the DNA sequence encoding human rhomboid-associated protein 48-35.53 can be used to hybridize biopsy specimens to determine the expression of human rhomboid-associated protein 48-35.53.
  • Hybridization techniques include Southern blotting, Nor thern blotting, and in situ hybridization. These techniques and methods are publicly available and mature, and related kits are commercially available.
  • a part or all of the polynucleotide of the present invention can be used as a probe to be fixed on a micro array or a DNA chip (also called a "gene chip") for analyzing differential expression analysis of genes and genetic diagnosis in tissues.
  • Human diamond-associated protein 48-35.53 specific primers for RNA-polymerase chain reaction (RT-PCR) in vitro amplification can also detect the human diamond-associated protein 48-35.53 transcripts.
  • Detection of mutations in the human rhomboid-associated protein 48-35.53 gene can also be used to diagnose human rhomboid-associated protein 48-35.53-related diseases.
  • Human rhomboid-associated protein 48-35.53 mutations include point mutations, translocations, deletions, recombinations, and any other abnormalities compared to the normal wild-type human rhomboid-associated protein 48-35.53 DNA sequence. Mutations can be detected using existing techniques such as Southern blotting, DNA sequence analysis, PCR and in situ hybridization. In addition, mutations may affect protein expression. Therefore, the Nor thern imprinting method and Western blotting method can be used to indirectly determine whether a gene is mutated.
  • sequences of the invention are also valuable for chromosome identification. This sequence will specifically target a specific position on a human chromosome and can hybridize to it. Currently, specific sites for each gene on the chromosome need to be identified. Currently, only a few chromosome markers based on actual sequence data (repeating polymorphisms) are available for marking chromosome positions. According to the present invention, in order to associate these sequences with disease-related genes, an important first step is to locate these DNA sequences on a chromosome.
  • PCR primers (preferably 15-35 bp) are prepared based on cDNA, and the sequences can be mapped on chromosomes. These primers were then used for PCR screening of somatic hybrid cells containing individual human chromosomes. Only Heterozygous cells that contain human genes corresponding to the primers produce amplified fragments.
  • PCR localization of somatic hybrid cells is a quick way to localize DNA to specific chromosomes.
  • oligonucleotide primers of the present invention in a similar manner, a set of fragments from a specific chromosome or a large number of genomic clones can be used to achieve sublocalization.
  • Other similar strategies that can be used for chromosomal localization include in situ hybridization, chromosome pre-screening with labeled flow sorting, and pre-selection of hybridization to construct chromosome-specific cDNA libraries.
  • Fluorescent in situ hybridization of cDNA clones with metaphase chromosomes allows precise chromosomal localization in one step.
  • FISH Fluorescent in situ hybridization
  • the difference in cDM or genomic sequence between affected and unaffected individuals needs to be determined. If a mutation is observed in some or all diseased individuals and the mutation is not observed in any normal individuals, the mutation may be the cause of the disease. Comparing affected and unaffected individuals usually involves first looking for structural changes in chromosomes, such as deletions or translocations that are visible at the chromosomal level or detectable with cDNA sequence-based PCR. According to the resolution capabilities of current physical mapping and gene mapping technology, the cDNA accurately mapped to the chromosomal region associated with the disease can be one of 50 to 500 potentially pathogenic genes (assuming 1 megabase mapping resolution) Capacity and each 20kb corresponds to a gene).
  • the polypeptides, polynucleotides and mimetics, agonists, antagonists and inhibitors of the present invention can be used in combination with a suitable pharmaceutical carrier.
  • suitable pharmaceutical carrier can be water, glucose, ethanol, salts, buffers, glycerol, and combinations thereof.
  • the composition comprises a safe and effective amount of the polypeptide or antagonist, and carriers and excipients which do not affect the effect of the drug. These compositions can be used as drugs for the treatment of diseases.
  • the invention also provides a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the invention.
  • a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the invention.
  • these containers there may be instructional instructions given by government agencies that manufacture, use, or sell pharmaceuticals or biological products, which prompts permission for administration on the human body by government agencies that produce, use, or sell.
  • the polypeptides of the invention can be used in combination with other therapeutic compounds.
  • the pharmaceutical composition can be administered in a convenient manner, such as by a topical, intravenous, intraperitoneal, intramuscular, subcutaneous, intranasal or intradermal route of administration.
  • the amount and range of human diamond-associated protein 48-35.53 administered to a patient will depend on many factors, such as the mode of administration, the health conditions of the person to be treated, and the judgment of the diagnostician. Examples
  • RNA Human fetal brain total RNA was extracted by one-step method with guanidine isothiocyanate / phenol / chloroform.
  • Poly (A) mRNA was isolated from total RNA using Quik mRNA Isolat ion Kit (product of Qiegene). 2ug poly (A) mRM forms cDNA by reverse transcription.
  • the Smart cDNA cloning kit purchased from Clontech was used to orient the cDNA fragment into the multiple cloning site of the pBSK (+) vector (Clontech) to transform DH5 ⁇ , and the bacteria formed a cDNA library.
  • Dye terminate cycle reaction ion sequencing kit Perkin-Elmer
  • ABI 377 automatic sequencer Perkin-Elmer
  • the determined cDNA sequence was compared with the existing public DNA sequence database (Genebank), and it was found that the cDNA sequence of one of the clones 2953 ⁇ 2 was new DNA.
  • the inserted cDNA fragments contained in this clone were determined in both directions by synthesizing a series of primers.
  • the sequence of the human rhomboid-related protein 48-35.53 of the present invention and the protein sequence encoded by the same were performed using the Blas t program (Basic local al ignment search tool) [Al tschul, SF et al. J. Mol. Biol. 1990 215: 403-10], to perform homology search in databases such as Genbank, Switzerland, and so on.
  • the gene with the highest homology to the human rhomboid-associated protein 48-35.53 of the present invention is a known human rhomboid-associated protein 48, whose accession number encoded by Genbank is Y17108.
  • the protein homology results are shown in Figure 1.
  • Example 3 Cloning of the gene encoding human rhomboid-associated protein 48-35.53 by RT-PCR method. Total fetal brain cells were used as a template, and oligo-dT was used as a primer for reverse transcription reaction to synthesize cDNA, and purified using Qiagene's kit. Afterwards, the following primers were used for PCR amplification:
  • Primerl 5,-GGCAGTCATTGCTGGGTGATGGTC -3, (SEQ ID NO: 3)
  • Primer2 5'- CATAGGCCGAGGCGGCCGACATGT -3, (SEQ ID NO: 4)
  • Primerl is a forward sequence located at the 5th end of SEQ ID NO: 1, starting at lbp;
  • Primer2 is the 3, terminal reverse sequence of SEQ ID NO: 1.
  • Amplification reaction conditions 50 containing recite ol / L KCl, 10mmol / L Tri s-HCl pH8 5, 1. 5mmol / L MgCl 2, 20 ( ⁇ mol / L dNTP, l Opmol in a reaction volume of 50 ⁇ 1.
  • Primer 1U of Taq DNA polymerase (Clontech).
  • the reaction was performed on a PE9600 DM thermal cycler (Perkin-Elmer) for 25 cycles under the following conditions: 94.C 30sec; 55 ° C 30sec; 72.C 2min During RT-PCR, set ⁇ -ac tin as a positive control and template blank as a negative control.
  • Amplification products were purified using a QIAGEN kit, and connected to a PCR vector using a TA cloning kit (Invi trogen).
  • DM sequence analysis results show that the DM sequence of the PCR product is exactly the same as l-1303bp shown in SEQ ID NO: 1.
  • Example 4 Northern blot analysis of human rhomboid-associated protein 48-35.53 gene expression: Extraction in one step Total RNA [Anal. Biochem 1987, 162, 156-159] 0 This method involves acid guanidinium thiocyanate phenol-chloroform extraction.
  • RNA precipitate 4M guanidine isothiocyanate-25mM sodium citrate, 0.2M sodium acetate (pH4 0) homogenize the tissue, add 1 volume of phenol and 1/5 volume of chloroform-isoamyl alcohol (49: 1) , Mix after centrifugation. Aspirate the aqueous phase layer, add isopropanol (0.8 vol) and centrifuge the mixture to obtain RNA precipitate. Wash the obtained RNA precipitate with 70 ° /. Ethanol, dry and dissolve in water. Use 20 ⁇ ⁇ RNA was electrophoresed on a 1.2% agarose gel containing 20 mM 3- (N-morpholino) propanesulfonic acid (H7.
  • A- 32 P dATP was used to prepare 32 P-labeled DNA probes by random primers.
  • the DNA probes used were human rhomboid-associated protein 48-35.53 amplified by PCR as shown in Figure 1. Sequence of coding region (98bp to 1069bp).
  • a 32P-labeled probe (approximately 2 x 10 6 cpm / ml) was hybridized with a nitrocellulose membrane to which RNA was transferred at 42 ° C overnight in a solution containing 50 % Formamide-25mM KH 2 P0 4 (pH7.
  • Example 5 In vitro expression, isolation and purification of recombinant human rhomboid-associated protein 48-35.53
  • a pair of specific amplification primers were designed, the sequence is as follows: Pr imer3: 5'-CCCCATATGATGGAATGGAGCCTGTTCCGTTCC-3 '(Seq ID No: 5)
  • Primer4 5, -CCCGAATTCTCAGGGGGGAGGCGGCAGCTTTAA-3, (Seq ID No: 6)
  • the 5' ends of these two primers contain Ndel and EcoRI restriction sites, respectively.
  • the PCR reaction was performed using the pBS-2953 ⁇ 2 plasmid containing the full-length target gene as a template.
  • the PCR reaction conditions were as follows: a total volume of 50 ⁇ 1 containing 10 pg of pBS-2953fl2 plasmid, primers Primer-3 and Primer-4 were 1 Opmol, Advantage polymerase Mix (Clontech) 1 ⁇ 1, respectively.
  • Cycle parameters 94 ° C 20s, 60 ° C 30s, 68 ° C 2 min, a total of 25 cycles.
  • Ndel and EcoRI were used to double digest the amplified product and plasmid pET-28 (+), respectively, and large fragments were recovered and ligated with T4 ligase.
  • the ligated product was transformed into coliform bacteria DH5a by the calcium chloride method, and cultured overnight in LB plates containing kanamycin (final concentration 3 ( ⁇ g / ml)), and positive clones were selected by colony PCR method and sequenced. Positive sequence correct clone ( ⁇ -2953 ⁇ 2) was used to transform the recombinant plasmid into E.
  • coli BL21 (DE3) plySs (product of Novagen) by calcium chloride method. Cultured in LB liquid containing kanamycin (final concentration 30 ⁇ ⁇ / ⁇ 1) In the medium, the host bacteria BL21 (pET-2953f 12) was cultured at 37 ° C to the logarithmic growth phase, IPTG was added to a final concentration of 1 mmol / L, and the culture was continued for 5 hours. The cells were collected by centrifugation. Chromatography using His. Bind Quick Cartridge (Novagen) affinity chromatography column capable of binding 6 histidines (6His-Tag) to obtain purified human rhombic related protein 48-35. 53.
  • a peptide synthesizer (product of PE company) was used to synthesize the following human rhomboid-related proteins 48-35.53-specific peptides:
  • NH2-Met-Glu-Trp-Ser-Leu-Phe-Arg-Ser-Pro-Glu-Glu-Gly-Arg-Gly-Gln-C00H (SEQ ID NO: 7).
  • the polypeptide is coupled to hemocyanin and bovine serum albumin to form a complex, respectively.
  • hemocyanin and bovine serum albumin For methods, see: Avrameas, et al. Immunochemis try, 1969; 6: 43. Rabbits were immunized with 4 mg of the hemocyanin polypeptide complex plus complete Freund's adjuvant, and 15 days later, the hemocyanin polypeptide complex plus incomplete Freund's adjuvant was used to boost immunity once.
  • a titer plate coated with 1 g / ml bovine serum albumin polypeptide complex was used as an ELISA to determine the titer of antibody in rabbit serum.
  • Protein A-Sepharose was used to isolate total IgG from antibody-positive rabbit sera.
  • the peptide was bound to a cyanogen bromide-activated Sepharose4B column, and anti-peptide antibodies were separated from the total IgG by affinity chromatography.
  • the immunoprecipitation method proved that the purified antibody could specifically bind to human rhomboid-related protein 4 8— 35. 53 combined.
  • Example 7 Application of the polynucleotide fragment of the present invention as a hybridization probe
  • Suitable oligonucleotide fragments selected from the polynucleotides of the present invention are used as hybridization probes in a variety of ways.
  • the probes can be used to hybridize to genomic or cDNA libraries of normal tissue or pathological tissue from different sources to It is determined whether it contains the polynucleotide sequence of the present invention and a homologous polynucleotide sequence is detected.
  • the probe can be used to detect the polynucleotide sequence of the present invention or its homologous polynucleotide sequence in normal tissue or pathology. Whether the expression in tissue cells is abnormal.
  • the purpose of this embodiment is to select a suitable oligonucleotide fragment from the polynucleotide SEQ ID NO: 1 of the present invention as a hybridization probe, and to identify whether some tissues contain the polynucleoside of the present invention by using a filter hybridization method.
  • Filter hybridization methods include dot blotting, Southern imprinting, Northern blotting, and copying methods. They all use the same steps to immobilize the polynucleotide sample to be tested on the filter.
  • the sample-immobilized filter is first pre-hybridized with a probe-free hybridization buffer to saturate the non-specific binding site of the sample on the filter with the carrier and the synthesized polymer.
  • the pre-hybridization solution is then replaced with a hybridization buffer containing labeled probes and incubated to hybridize the probes to the target nucleic acid.
  • the unhybridized probes are removed by a series of membrane washing steps.
  • This embodiment uses higher-intensity washing conditions (such as lower salt concentration and higher temperature) to reduce the hybridization background and retain only strong specific signals.
  • the probes used in this embodiment include two types: the first type of probes are oligonucleotide fragments that are completely the same as or complementary to the polynucleotide SEQ ID NO: 1 of the present invention; the second type of probes are partially related to the present invention
  • the polynucleotide SEQ ID NO: 1 is the same or complementary oligonucleotide fragment.
  • the dot blot method is used to fix the sample on the filter membrane. Under the high-intensity washing conditions, the first type of probe and the sample have the strongest hybridization specificity and are retained.
  • oligonucleotide fragments from the polynucleotide SEQ ID NO: 1 of the present invention for use as hybridization probes should follow the following principles and several aspects to be considered:
  • the preferred range of probe size is 18-50 nucleotides
  • Those that meet the above conditions can be used as primary selection probes, and then further computer sequence analysis, including the primary selection probe and its source sequence region (ie, SEQ ID NO: 1) and other known genomic sequences and their complements The regions are compared for homology. If the homology with the non-target molecular region is greater than 85% or there are more than 15 consecutive bases, then the primary probe should not be used; 5. Whether the preliminary selection probe is finally selected as a probe with practical application value should be further determined by experiments. After completing the above analysis, select and synthesize the following two probes:
  • Probe 1 which belongs to the first type of probe, is completely homologous or complementary to the gene fragment of SEQ ID NO: 1 (41Nt):
  • Probe 2 which belongs to the second type of probe, is equivalent to the replacement mutant sequence of the gene fragment of SEQ ID NO: 1 or its complementary fragment (41Nt):
  • PBS phosphate buffered saline
  • step 8-13 are only used when contamination must be removed, otherwise step 14 can be performed directly.
  • NC membrane nitrocellulose membrane
  • the 32 P-Probe (the second peak is free ⁇ - 32 P-dATP) is prepared.
  • the sample film was placed in a plastic bag pre-hybridization solution was added 3-10m g (10xDenhardt 's; 6 xSSC, 0. lrng / ml CT DM ( calf thymus DM)). After sealing the bag, shake at 68 ° C for 2 hours.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • Zoology (AREA)
  • Genetics & Genomics (AREA)
  • Medicinal Chemistry (AREA)
  • Molecular Biology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Toxicology (AREA)
  • Peptides Or Proteins (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

L'invention concerne un nouveau polypeptide, une protéine humaine 48-35.53 associée au rhomboïde, et un polynucléotide codant ce polypeptide ainsi qu'un procédé d'obtention de ce polypeptide par des techniques recombinantes d'ADN. L'invention concerne en outre les applications de ce polypeptide dans le traitement de maladies, notamment de malformations apparaissant lors du développement de l'embryon et de tumeurs. L'invention concerne aussi l'antagoniste agissant contre le polypeptide et son action thérapeutique ainsi que les applications de ce polynucléotide codant la protéine humaine 48-35.53 associée au rhomboïde.
PCT/CN2001/001363 2000-09-12 2001-09-10 Nouveau polypeptide, proteine humaine 48-35.53 associee au rhomboide, et polynucleotide codant ce polypeptide WO2002026975A1 (fr)

Priority Applications (1)

Application Number Priority Date Filing Date Title
AU2002218107A AU2002218107A1 (en) 2000-09-12 2001-09-10 Novel polypeptide- human rhombus related protein 48-35.53 and polynucleotide encoding it

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
CN00125187.2 2000-09-12
CN 00125187 CN1342710A (zh) 2000-09-12 2000-09-12 一种新的多肽——人菱形相关蛋白48－35.53和编码这种多肽的多核苷酸

Publications (1)

Publication Number Publication Date
WO2002026975A1 true WO2002026975A1 (fr) 2002-04-04

Family

ID=4590979

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/CN2001/001363 WO2002026975A1 (fr) 2000-09-12 2001-09-10 Nouveau polypeptide, proteine humaine 48-35.53 associee au rhomboide, et polynucleotide codant ce polypeptide

Country Status (3)

Country Link
CN (1) CN1342710A (fr)
AU (1) AU2002218107A1 (fr)
WO (1) WO2002026975A1 (fr)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2003100049A1 (fr) * 2002-05-29 2003-12-04 Bayer Healthcare Ag Regulation de la proteine liee aux rhomboides humaine

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5466668A (en) * 1989-04-28 1995-11-14 Schering Aktiengesellschaft Superior thrombomodulin analogs for pharmaceutical use

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5466668A (en) * 1989-04-28 1995-11-14 Schering Aktiengesellschaft Superior thrombomodulin analogs for pharmaceutical use

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2003100049A1 (fr) * 2002-05-29 2003-12-04 Bayer Healthcare Ag Regulation de la proteine liee aux rhomboides humaine

Also Published As

Publication number Publication date
AU2002218107A1 (en) 2002-04-08
CN1342710A (zh) 2002-04-03

Similar Documents

Publication Publication Date Title
WO2002026973A1 (fr) Nouveau polypeptide, une ribonucleoproteine nucleaire heterogene humaine 32.01, et un polynucleotide codant ce polypeptide
WO2002051867A1 (fr) Nouveau facteur 8.8 polypeptidique liberant de la corticotrophine et polynucleotide codant ledit polypeptide
WO2002026972A1 (fr) Nouveau polypeptide, proteine humaine 20.13 de liaison de l'acide polyadenylique, et polynucleotide codant ce polypeptide
WO2001090169A1 (fr) Nouveau polypeptide, antigene nucleaire de proliferation cellulaire (pcna) 13, et polynucleotide codant ce polypeptide
WO2001083780A1 (fr) Nouveau polypeptide, methylthioadenosine phosphorylase humaine 37, et polynucleotide codant pour ce polypeptide
WO2002026975A1 (fr) Nouveau polypeptide, proteine humaine 48-35.53 associee au rhomboide, et polynucleotide codant ce polypeptide
WO2001068694A1 (fr) Nouveau polypeptide, proteine humaine d'hexokinase 10, et polynucleotide codant pour ce polypeptide
WO2001055189A1 (fr) NOUVEAU POLYPEPTIDE, SECp43, 32 S'ASSOCIANT AVEC L'ARNt DE LA SELENOCYSTEINE HUMAINE, ET POLYNUCLEOTIDE CODANT POUR CE POLYPEPTIDE
WO2001090378A1 (fr) Nouveau polypeptide, proteine humaine hexokinase 11, et polynucleotide codant ce polypeptide
WO2002026810A1 (fr) Nouveau polypeptide, substance proteique p125-77.22, et polynucleotide codant ce polypeptide
WO2001094591A1 (fr) Nouveau polypeptide, glyceraldehyde-3-phosphate deshydrogenase 10, et polynucleotide codant ce polypeptide
WO2001073068A1 (fr) Nouveau polypeptide, l1-12, et polynucleotide codant pour ce polypeptide
WO2001087949A1 (fr) Nouveau polypeptide, proteine pax humaine 9, et polynucleotide codant pour ce polypeptide
WO2002033077A1 (fr) Nouveau polypeptide, une proteine de regulation 10.01 etant associee au developpement humain et polynucleotide la codant
WO2001079279A1 (fr) Nouveau polypeptide, facteur humain associe au recepteur du facteur de necrose tumorale 16, et polynucleotide codant pour ce polypeptide
WO2001049724A1 (fr) Nouveau polypeptide, proteine lissencephale humaine 43, et polynucleotide codant pour ce polypeptide
WO2001094530A2 (fr) Nouveau polypeptide, proteine 57 de la sous-famille des proteines a doigt de zinc scan, et polynucleotide codant ce polypeptide
WO2001072796A1 (fr) Nouveau polypeptide, facteur humain de transcription de la differentiation cellulaire 11, et polynucleotide codant pour ce polypeptide
WO2002006333A1 (fr) Nouveau polypeptide, proteine vn1-18 du recepteur de la pheromone, et polynucleotide codant ce polypeptide
WO2002038605A1 (fr) Nouveau polypeptide, recepteur olfactif 27.61, et polynucleotide codant ce polypeptide
WO2001090373A1 (fr) Nouveau polypeptide, sous-unite de regulation 37 de la proteine phosphatase 4, et polynucleotide codant ce polypeptide
WO2001074894A1 (fr) Nouveau polypeptide, proteine humaine de regulation 12 de la proteine phosphorylase, et polynucleotide codant pour ce polypeptide
WO2002040526A1 (fr) Nouveau polypeptide, proteine 18.70 exprimee de maniere specifique dans le cerveau chez l'homme, et polynucleotide codant ledit polypeptide
WO2001083682A2 (fr) Nouveau polypeptide, proteine pax humaine 11.6, et polynucleotide codant pour ce polypeptide
WO2002012494A1 (fr) Nouveau polypeptide, proteine receptrice de sperme 12, et polynucleotide codant ce polypeptide

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CO CR CU CZ DE DK DM DZ EC EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GQ GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
REG Reference to national code

Ref country code: DE

Ref legal event code: 8642

122 Ep: pct application non-entry in european phase
NENP Non-entry into the national phase

Ref country code: JP