WO2002040526A1 - Nouveau polypeptide, proteine 18.70 exprimee de maniere specifique dans le cerveau chez l'homme, et polynucleotide codant ledit polypeptide - Google Patents

Nouveau polypeptide, proteine 18.70 exprimee de maniere specifique dans le cerveau chez l'homme, et polynucleotide codant ledit polypeptide Download PDF

Info

Publication number
WO2002040526A1
WO2002040526A1 PCT/CN2001/001372 CN0101372W WO0240526A1 WO 2002040526 A1 WO2002040526 A1 WO 2002040526A1 CN 0101372 W CN0101372 W CN 0101372W WO 0240526 A1 WO0240526 A1 WO 0240526A1
Authority
WO
WIPO (PCT)
Prior art keywords
seq
lys
thr
polypeptide
protein
Prior art date
Application number
PCT/CN2001/001372
Other languages
English (en)
Chinese (zh)
Inventor
Yumin Mao
Yi Xie
Original Assignee
Shanghai Biowindow Gene Development Inc.
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Shanghai Biowindow Gene Development Inc. filed Critical Shanghai Biowindow Gene Development Inc.
Priority to AU2002221430A priority Critical patent/AU2002221430A1/en
Publication of WO2002040526A1 publication Critical patent/WO2002040526A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals

Definitions

  • the present invention belongs to the field of biotechnology. Specifically, the present invention describes a novel polypeptide, a human brain-specific expression protein 18. 70, and a polynucleotide sequence encoding the polypeptide. The invention also relates to a preparation method and application of the polynucleotide and polypeptide.
  • the new polypeptide of the present invention has 57% identity and 77% similarity at the protein level with the consistent human brain-specific expressed protein, and the two have similar structural and functional characteristics, so it is considered to be a new Human brain-specific expression protein, named human brain-specific expression protein 18. 70.
  • the protein is also involved in regulating a variety of important neural development and action processes in the body, and its mutation or abnormal expression is closely related to the development of various related nervous system development and generation disorders in the body.
  • the protein can also be used for the diagnosis and treatment of various related diseases mentioned above.
  • the human brain-specific expression protein 18.70 protein plays an important role in regulating important functions of the body, such as cell division and embryonic development, and it is believed that a large number of proteins are involved in these regulatory processes, so there has been a need to identify more participation in the field.
  • the human brain specifically expressed protein 18.70 protein during these processes, and in particular the amino acid sequence of this protein was identified. Isolation of the new human brain-specific expression protein 18. 70 protein encoding gene also provides a basis for research to determine the role of this protein in health and disease states. This protein may form the basis for the development of diagnostic and / or therapeutic drugs for diseases, so it is important to isolate its code for DM.
  • Another object of the invention is to provide a polynucleotide encoding the polypeptide.
  • Another object of the present invention is to provide a recombinant vector containing a polynucleotide encoding a human brain-specific expression protein 18.70.
  • Another aspect of the present invention is to provide a genetically engineered host cell comprising a polynucleotide encoding a human brain-specific expression protein 18.70.
  • Another object of the present invention is to provide a method for producing human brain-specific expressed protein 18.70.
  • Another object of the present invention is to provide an antibody against the polypeptide of the present invention, a specific expression protein 18.70 of human brain.
  • Another object of the present invention is to provide mimic compounds, antagonists, agonists, and inhibitors directed against the polypeptide of the present invention, human brain-specific expression protein 18.70.
  • Another object of the present invention is to provide a method for diagnosing and treating diseases associated with abnormal expression of human brain-specific protein 18.70. Summary of invention
  • the present invention relates to an isolated polypeptide, which is of human origin and comprises: a polypeptide having the amino acid sequence of SEQ ID No. 2, or a conservative variant, biologically active fragment or derivative thereof.
  • the polypeptide is a polypeptide having the amino acid sequence of SEQ ID NO: 2.
  • the present invention also relates to an isolated polynucleotide, which comprises a nucleotide sequence or a variant thereof selected from the group-.
  • sequence of the polynucleotide is one selected from the group consisting of: (a) a sequence having positions 1 2 6 to 6 in SEQ ID NO: 1; and (b) having a sequence in SEQ ID NO: 1 A sequence of 1-766 bits.
  • the present invention further relates to a vector, particularly an expression vector, containing the polynucleotide of the present invention; a host cell genetically engineered with the vector, including a transformed, transduced or transfected host cell; Host cell and method of preparing the polypeptide of the present invention by recovering the expression product.
  • the invention also relates to an antibody capable of specifically binding to a polypeptide of the invention.
  • the invention also relates to a screening simulation, activation, antagonism or inhibition of human brain specific expression protein 18.
  • 70 A method of a protein-active compound comprising utilizing a polypeptide of the invention. The invention also relates to compounds obtained by this method.
  • the invention also relates to a method for in vitro detection of a disease or susceptibility to disease associated with abnormal expression of a human brain-specific expression protein 18.70 protein, comprising detecting mutations in the polypeptide or a sequence encoding a polynucleotide thereof in a biological sample, or Detection of the amount or biological activity of a polypeptide of the invention in a biological sample.
  • the invention also relates to a pharmaceutical composition
  • a pharmaceutical composition comprising a polypeptide of the invention or a mimetic thereof, an activator, an antagonist or an inhibitor, and a pharmaceutically acceptable carrier.
  • the present invention also relates to the use of the polypeptide and / or polynucleotide of the present invention in the preparation of a medicament for treating cancer, developmental disease or immune disease or other diseases caused by abnormal expression of human brain-specific expressed protein 18.70.
  • Figure 1 is a comparison diagram of the amino acid sequence homology of the human brain-specifically expressed protein 18.70 and human brain-specifically expressed protein of the present invention.
  • the upper sequence is human brain-specific protein 18. 70
  • the lower sequence is human brain-specific protein.
  • Identical amino acids are represented by single-character amino acids between the two sequences, and similar amino acids are represented by "+”. ,
  • Figure 2 shows the polyacrylamide gel electrophoresis (SDS-PAGE) of the isolated human brain-specific expressed protein 18.70.
  • 18. 70kDa is the molecular weight of the protein.
  • the arrow indicates the isolated protein band.
  • Nucleic acid sequence refers to oligonucleotides, nucleotides or polynucleotides and fragments or parts thereof, and may also refer to the genome or synthetic DNA or RM, they can be single-stranded or double-stranded, representing the sense or antisense strand.
  • amino acid sequence refers to an oligopeptide, peptide, polypeptide or protein sequence and fragments or portions thereof.
  • amino acid sequence in the present invention relates to the amino acid sequence of a naturally occurring protein molecule, such "polypeptide” or “protein” does not mean to limit the amino acid sequence to a complete natural amino acid related to the protein molecule .
  • a protein or polynucleotide “variant” refers to a protein or polynucleotide that has one or more amino acid or nucleotide changes Amino acid sequence or polynucleotide sequence encoding it. The changes may include deletions, insertions or substitutions of amino acids or nucleotides in the amino acid sequence or nucleotide sequence. Variants may have "conservative" changes in which the substituted amino acid has a structural or chemical property similar to the original amino acid, such as replacing isoleucine with leucine. Variants can also have non-conservative changes, such as replacing glycine with tryptophan.
  • “Deletion” refers to the deletion of one or more amino acids or nucleotides in an amino acid sequence or nucleotide sequence.
  • Insertion means that a change in the amino acid sequence or nucleotide sequence results in an increase in one or more amino acids or nucleotides compared to a molecule that exists in nature.
  • Replacement refers to the replacement of one or more amino acids or nucleotides with different amino acids or nucleotides.
  • Bioactivity refers to a protein that has the structure, regulation, or biochemical function of a natural molecule.
  • immunologically active refers to the ability of natural, recombinant or synthetic proteins and fragments thereof to induce a specific immune response and to bind specific antibodies in a suitable animal or cell.
  • An "agonist” refers to a molecule that, when combined with human brain-specifically expressed protein 18. 70, causes a change in the protein to regulate the activity of the protein.
  • An agonist may include a protein, a nucleic acid, a carbohydrate, or any other molecule that binds to the human brain-specific expression protein 18.70.
  • Antagonist refers to a molecule that blocks or regulates the biological or immunological activity of human brain-specific expressed protein 18.70 when combined with human brain-specific expressed protein 18.70.
  • Antagonists and inhibitors may include proteins, nucleic acids, carbohydrates or any other molecule that binds to human brain-specific expression protein 18.70.
  • Regular refers to a change in the function of human brain-specific protein 18.70, including an increase or decrease in protein activity, a change in binding properties, and any other biological property, function, or immunity of human brain-specific protein 18.70. Change of nature.
  • substantially pure means substantially free of other proteins, lipids, sugars or other substances with which it is naturally associated.
  • Those skilled in the art can purify the human brain-specific expression protein IS. 70 using standard protein purification techniques.
  • Substantially pure human brain-specific expressed protein 18. 70 produces a single main band on a non-reducing polyacrylamide gel.
  • the purity of human brain-specific expressed protein 18. 70 peptides can be analyzed by amino acid sequence.
  • Complementary refers to the natural binding of polynucleotides by base-pairing under conditions of acceptable salt concentration and temperature.
  • sequence C-T-G-A
  • complementary sequence G-A-C-T.
  • the complementarity between two single-stranded molecules may be partial or complete.
  • the degree of complementarity between nucleic acid strands has a significant effect on the efficiency and strength of hybridization between nucleic acid strands.
  • “Homology” refers to the degree of complementarity and can be partially homologous or completely homologous.
  • Partial homology refers to a partially complementary sequence that at least partially inhibits the hybridization of a completely complementary sequence to a target nucleic acid. Pay. This inhibition of hybridization can be detected by performing hybridization (Southern blotting or Nor thern blotting, etc.) under conditions of reduced stringency. Substantially homologous sequences or hybridization probes can compete and inhibit the binding of completely homologous sequences to the target sequence under conditions of reduced stringency. This does not mean that the conditions of reduced stringency allow non-specific binding, because the conditions of reduced stringency require that the two sequences bind to each other as a specific or selective interaction.
  • Percent identity refers to the percentage of sequences that are identical or similar in the comparison of two or more amino acid or nucleic acid sequences. The percent identity can be determined electronically, such as by the MEGALIGN program (Lasergene sof tware package, DNASTAR, Inc., Madi son Wis.). The MEGA GN program can compare two or more sequences based on different methods, such as the Clus ter method (Hi ggins, DG and PM Sharp (1988) Gene 73: 237-244). 0 The Cl us ter method checks all pairs. The distances of each group are arranged into clusters. The clusters are then assigned in pairs or groups. The percent identity between two amino acid sequences such as sequence A and sequence B is calculated by the following formula:
  • the percent identity between nucleic acid sequences can also be determined by the Clus ter method or by methods known in the art such as Jotun Hein (He in J., (1990) Methods in enzymology 183: 625-645) 0 "similarity" means The degree of identical or conservative substitutions of amino acid residues at corresponding positions in the alignment of amino acid sequences.
  • Amino acids used for conservative substitution such as negatively charged amino acids may include aspartic acid and glutamic acid; positively charged amino acids may include lysine and arginine; having uncharged head groups are Similar hydrophilic amino acids may include leucine, isoleucine and valine; glycine and alanine; asparagine and glutamine; serine and threonine; phenylalanine and tyrosine.
  • Antisense refers to a nucleotide sequence that is complementary to a particular DNA or RM sequence.
  • Antisense strand refers to a nucleic acid strand that is complementary to a “sense strand.”
  • Derivative refers to HFP or a chemical modification of its nucleic acid. This chemical modification may be the replacement of a hydrogen atom with an alkyl, acyl or amino group. Nucleic acid derivatives can encode polypeptides that retain the main biological properties of natural molecules.
  • Antibody refers to a complete antibody molecule and its fragments, such as Fa,? ( ⁇ ') 2 and? 7. It can specifically bind to the epitope of human brain-specific expression protein 18.70.
  • a “humanized antibody” refers to an antibody in which the amino acid sequence of a non-antigen binding region is replaced to become more similar to a human antibody, but still retains the original binding activity.
  • isolated refers to the removal of a substance from its original environment (for example, its natural environment if it occurs naturally).
  • a naturally occurring polynucleotide or polypeptide exists in a living animal. It is not isolated, but the same polynucleotide or polypeptide is separated from some or all of the substances that coexist with it in the natural system.
  • Such a polynucleotide may be part of a certain vector, or such a polynucleotide or polypeptide may be part of a certain composition. Since the carrier or composition is not a component of its natural environment, they are still isolated.
  • isolated refers to the separation of a substance from its original environment (if it is a natural substance, the original environment is the natural environment).
  • polynucleotides and polypeptides in a natural state in a living cell are not isolated and purified, but the same polynucleotides or polypeptides are separated and purified if they are separated from other substances in the natural state .
  • isolated human brain-specific expression protein 18. 70 refers to human brain-specific expression protein 18. 70 that is substantially free of other proteins, lipids, sugars, or other substances that are naturally associated with it. Those skilled in the art can purify human brain-specific expressed proteins 18.70 using standard protein purification techniques. Substantially pure peptides can produce a single main band on a non-reducing polyacrylamide gel. Human brain-specific expressed protein 18. 70 The purity of the polypeptide can be analyzed by amino acid sequence.
  • the present invention provides a new polypeptide, a human brain-specific expression protein 18. 70, which basically consists of the amino acid sequence shown in SEQ ID NO: 2.
  • the polypeptide of the present invention may be a recombinant polypeptide, a natural polypeptide, or a synthetic polypeptide, and preferably a recombinant polypeptide.
  • the polypeptides of the invention can be naturally purified products, or chemically synthesized products, or produced using recombinant techniques from prokaryotic or eukaryotic hosts (e.g., bacteria, yeast, higher plants, insects, and mammalian cells). Depending on the host used in the recombinant production protocol, the polypeptide of the invention may be glycosylated, or it may be non-glycosylated. Polypeptides of the invention may also include or exclude starting methionine residues.
  • the invention also includes fragments, derivatives and analogs of human brain-specific expression protein 18.70.
  • fragment refers to a polypeptide that substantially retains the same biological function or activity of the human brain-specific expressed protein 18.70 of the present invention.
  • a fragment, derivative or analog of the polypeptide of the present invention may be: (I) a kind in which one or more amino acid residues are replaced with conservative or non-conservative amino acid residues (preferably conservative amino acid residues), and the substitution
  • the amino acid may or may not be encoded by a genetic codon; or ( ⁇ ) such a type in which a group on one or more amino acid residues is substituted by another group to include a substituent; or (III) such One, in which the mature polypeptide is fused to another compound (such as a compound that prolongs the half-life of the polypeptide, such as polyethylene glycol); or (IV) such a polypeptide sequence in which the additional amino acid sequence is fused into the mature polypeptide ( Such as leader sequences or secreted sequences or sequences used to purify this polypeptide or protease sequences).
  • such fragments, derivatives and analogs are considered to be within the knowledge of those skilled in the art.
  • the present invention provides an isolated nucleic acid (polynucleotide), which basically consists of an amino acid encoding SEQ ID NO: 2 Polynucleotide composition of a polypeptide of the amino acid sequence.
  • the polynucleotide sequence of the present invention includes the nucleotide sequence of SEQ ID NO: 1.
  • the polynucleotide of the present invention is found from a cDNA library of human fetal brain tissue. It contains a polynucleotide sequence with a total length of 766 bases, and its open reading frame 126-638 encodes 170 amino acids. According to the amino acid sequence homology comparison, it was found that this polypeptide has 75% homology with human brain-specific expression protein, and it can be deduced that the human brain-specific expression protein 18.70 has similar structure and function to human brain-specific expression protein.
  • the polynucleotide of the present invention may be in the form of DNA or RM.
  • DM forms include cDNA, genomic DNA, or synthetic DNA.
  • DNA can be single-stranded or double-stranded.
  • DNA can be coding or non-coding.
  • the coding region sequence encoding a mature polypeptide may be the same as the coding region sequence shown in SEQ ID NO: 1 or a degenerate variant.
  • a "degenerate variant" refers to a nucleic acid sequence encoding a protein or polypeptide having SEQ ID NO: 2 but different from the coding region sequence shown in SEQ ID NO: 1 in the present invention.
  • the polynucleotide encoding the mature polypeptide of SEQ ID NO: 2 includes: only the coding sequence of the mature polypeptide; the coding sequence of the mature polypeptide and various additional coding sequences; the coding sequence of the mature polypeptide (and optional additional coding sequences); Coding sequence.
  • polynucleotide encoding a polypeptide refers to a polynucleotide comprising the polypeptide and a polynucleotide comprising additional coding and / or non-coding sequences.
  • the invention also relates to variants of the polynucleotides described above, which encode polypeptides or fragments, analogs and derivatives of polypeptides having the same amino acid sequence as the invention.
  • Variants of this polynucleotide can be naturally occurring allelic variants or non-naturally occurring variants. These nucleotide variants include substitution variants, deletion variants, and insertion variants.
  • an allelic variant is an alternative form of a polynucleotide that may be a substitution, deletion, or insertion of one or more nucleotides, but does not substantially change the function of the polypeptide it encodes .
  • the invention also relates to a polynucleotide that hybridizes to the sequence described above (having at least 50 %, preferably 70% identity between the two sequences).
  • the invention particularly relates to polynucleotides that can hybridize to the polynucleotides of the invention under stringent conditions.
  • “strict conditions” means: (1) hybridization and elution at lower ionic strength and higher temperature, such as 0.2xSSC, 0.1% SDS, 6 (TC; or (2) Add a denaturant during hybridization, such as 50 ° / ((v / v) formamide, 0.1% calf serum / 0.1% Ficol l, 42 ° C, etc.); or (3) only between two sequences The hybridization occurs only when the identity between them is at least 95%, and more preferably 97%.
  • the polypeptide encoded by the hybridizable polynucleotide has the same biological function as the mature polypeptide shown in SEQ ID NO: 2 and active.
  • the invention also relates to nucleic acid fragments that hybridize to the sequences described above.
  • core Acid fragments contain at least 10 nucleotides in length, preferably at least 20-30 nucleotides, more preferably at least 50-60 nucleotides, and most preferably at least 100 nucleotides.
  • Nucleic acid fragments It can also be used in nucleic acid amplification techniques (such as PCR) to identify and / or isolate a polynucleotide encoding a human brain-specific expression protein 18.70.
  • polypeptides and polynucleotides in the present invention are preferably provided in an isolated form and are more preferably purified to homogeneity.
  • the specific polynucleotide sequence encoding the human brain-specific expression protein 18.70 of the present invention can be obtained by various methods.
  • polynucleotides are isolated using hybridization techniques well known in the art. These techniques include, but are not limited to: 1) hybridization of probes to genomic or CDM libraries to detect homologous polynucleotide sequences, and 2) antibody screening of expression libraries to detect cloned polynucleosides with common structural characteristics Acid fragments.
  • the DNA fragment sequence of the present invention can also be obtained by the following methods: 1) isolating the double-stranded DNA sequence from the genomic DNA; 2) chemically synthesizing the DNA sequence to obtain the double-stranded DM of the polypeptide.
  • genomic DM is the least commonly used. Direct chemical synthesis of DNA sequences is often the method of choice. The more commonly used method is the isolation of cDNA sequences.
  • the standard method for isolating the cDM of interest is to isolate mRNA from donor cells that overexpress the gene and perform reverse transcription to form a plasmid or phage cDNA library. There are many mature techniques for mRNA extraction. Kits are also commercially available (Q i agene).
  • the construction of cDNA libraries is also a common method (Sambrook, et al., Molecular Cloning, A Laboratory Manua, Cold Spooning Harbor Labora tory. New York, 1989).
  • Commercially available cDNA libraries are also available, such as different cDM libraries from Clontech. When polymerase reaction technology is used in combination, even very small expression products can be cloned.
  • genes of the present invention can be selected from these cDNA libraries by conventional methods. These methods include (but are not limited to): (l) DNA-DM or DNA-RNA hybridization; (2) the presence or absence of a marker gene function; (3) the level of a human brain-specific protein 18.70 transcript; (4) Detecting the protein product of gene expression by immunological technology or measuring biological activity. The above methods can be used alone or in combination.
  • the probe used for hybridization is homologous to any part of the polynucleotide of the present invention, and its length is at least 10 nucleotides, preferably at least 30 nucleotides, more preferably At least 50 nucleotides, preferably at least 100 nucleotides.
  • the length of the probe is usually within 2000 nucleotides, preferably within 1000 nucleotides.
  • the probe used here is generally a DNA sequence chemically synthesized based on the gene sequence information of the present invention.
  • the genes or fragments of the present invention can of course be used as probes.
  • DNA probes can be labeled with radioisotopes, luciferin, or enzymes (such as alkaline phosphatase).
  • the protein product of the human brain-specific expressed protein 18.70 gene can be detected by immunological techniques such as Western blotting, radioimmunoprecipitation, and enzyme-linked immunosorbent assay (ELISA).
  • a method for amplifying DNA / RNA by using PCR technology is preferably used to obtain the gene of the present invention.
  • the RACE method RACE-rapid amplification of cDNA ends
  • the primers used for PCR can be appropriately based on the polynucleotide sequence information of the present invention disclosed herein. Select and synthesize using conventional methods.
  • the amplified DM / RNA fragment can be isolated and purified by conventional methods such as by gel electrophoresis.
  • the polynucleotide sequence of the gene of the present invention or various DM fragments and the like obtained as described above can be measured by a conventional method such as dideoxy chain termination method (Sanger et al. PNAS, 1977, 74: 5463-5467). Commercial sequencing kits can also be used for the sequencing of such polynucleosides. In order to obtain the full-length cDNA sequence, sequencing needs to be repeated. Sometimes it is necessary to determine the cDNA sequence of multiple clones in order to splice into a full-length cDNA sequence.
  • the present invention also relates to a vector comprising the polynucleotide of the present invention, and a host cell produced by genetic engineering using the vector of the present invention or directly using a human brain-specific expression protein 18.70 coding sequence, and recombinant technology to produce the polypeptide of the present invention Methods.
  • a polynucleotide sequence encoding a human brain-specific expression protein 18. 70 can be inserted into a vector to constitute a recombinant vector containing the polynucleotide of the present invention.
  • vector refers to bacterial plasmids, phages, yeast plasmids, plant cell viruses, mammalian cell viruses such as adenoviruses, retroviruses or other vectors well known in the art.
  • Vectors suitable for use in the present invention include, but are not limited to: T7 promoter-based expression vectors (Rosenberg, et al.
  • any plasmid and vector can be used to construct a recombinant expression vector.
  • An important feature of expression vectors is that they usually contain an origin of replication, a promoter, a marker gene, and translational regulatory elements.
  • Methods known to those skilled in the art can be used to construct expression vectors containing a DNA sequence encoding human brain-specific expression protein 18.70 and appropriate transcription / translation regulatory elements. These methods include in vitro recombination DM technology, DM synthesis technology, in vivo recombination technology, etc. (Sambroook, et al. Molecu lar Cloning, a Laboratory Manua, Cold Spooning Harbor Labora tory. New York, 1989).
  • the DNA sequence can be operably linked to an appropriate promoter in an expression vector to guide mRNA synthesis. Representative examples of these promoters are: the lac or trp promoter of E.
  • coli the PL promoter of lambda phage
  • eukaryotic promoters include the CMV immediate early promoter, the HSV thymidine kinase promoter, the early and late SV40 promoters, Retroviral LTRs and other known promoters that control the expression of genes in prokaryotic or eukaryotic cells or their viruses.
  • Expression vector also includes ribosomes for translation initiation Binding sites, transcription terminators, etc. Insertion of enhancer sequences into the vector will enhance its transcription in higher eukaryotic cells.
  • Enhancers are cis-acting factors for DNA expression, usually about 10 to 300 base pairs, which act on promoters to enhance gene transcription.
  • Illustrative examples include SV40 enhancers of 100 to 270 base pairs on the late side of the origin of replication, polyoma enhancers on the late side of the origin of replication, and adenovirus enhancers.
  • the expression vector preferably contains one or more selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
  • selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
  • GFP fluorescent protein
  • tetracycline or ampicillin resistance for E. coli.
  • a polynucleotide encoding a human brain-specific expression protein 18.70 or a recombinant vector containing the polynucleotide can be transformed or transduced into a host cell to form a genetically engineered host cell containing the polynucleotide or the recombinant vector.
  • the term "host cell” refers to a prokaryotic cell, such as a bacterial cell; or a lower eukaryotic cell, such as a yeast cell; or a higher eukaryotic cell, such as a mammalian cell. Representative examples are: E.
  • coli Streptomyces
  • bacterial cells such as Salmonella typhimurium
  • fungal cells such as yeast
  • plant cells such as fly S2 or Sf 9
  • animal cells such as CH0, COS or Bowes melanoma cells.
  • Transformation of a host cell with a DNA sequence described in the present invention or a recombinant vector containing the DNA sequence can be performed using conventional techniques well known to those skilled in the art.
  • the host is a prokaryote, such as E. coli
  • competent cells capable of absorbing D can be harvested after the exponential growth phase and treated with the CaCl 2 method.
  • the steps used are well known in the art.
  • the alternative is to use MgC l 2 .
  • transformation can also be performed by electroporation.
  • the following DNA transfection methods can be used: calcium phosphate co-precipitation method, or conventional mechanical methods such as microinjection, electroporation, and liposome packaging.
  • the polynucleotide sequence of the present invention can be used to express or produce recombinant human brain-specific expression protein 18. 70 (Scence, 1984; 224: 1431). Generally there are the following steps:
  • the medium used in the culture may be selected from various conventional mediums. Culture is performed under conditions suitable for host cell growth. When the host cell has grown to an appropriate cell density, the selected promoter is induced by a suitable method (such as temperature conversion or chemical induction), and The cells are cultured for a period of time.
  • a suitable method such as temperature conversion or chemical induction
  • the recombinant polypeptide may be coated in a cell, expressed on a cell membrane, or secreted outside the cell. If necessary, the recombinant protein can be isolated and purified by various separation methods using its physical, chemical and other properties. These methods are well known to those skilled in the art. These methods include, but are not limited to: conventional renaturation treatment, protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid chromatography (HPLC) and various other liquid chromatography techniques and combinations of these methods.
  • conventional renaturation treatment protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid
  • polypeptides of the present invention as well as antagonists, agonists and inhibitors of the polypeptides, can be directly used in the treatment of diseases, for example, they can treat malignant tumors, adrenal deficiency, skin diseases, various types of inflammation, HIV infection, and immune diseases.
  • the human brain-specific expression protein is an important protein in the human brain, which regulates a variety of important biological processes in the human brain, such as the interaction between nerve cells, signaling, neurotransmitter metabolism and release. Its abnormal expression can cause the development of the nervous system and metabolic disorders in the brain, and then cause related diseases.
  • the polypeptide of the present invention and the human brain-specific expression protein are human brain-specific expression proteins, which contain characteristic sequences of the protein family. Both have similar biological functions.
  • the abnormal expression of the polypeptide in vivo can cause the development of the nervous system in the brain and The occurrence of metabolic disorders, which in turn causes related diseases, including but not limited to:
  • Frontal lobe dementia, personality changes (frontal frontal), strabismus, inability to write (back middle frontal gyrus), motor aphasia (back lower frontal gyrus), loss of smell (bottom of frontal lobe), limb paralysis, Convulsions (central gyrus), etc .;
  • Parietal lobe sensory disturbance (central posterior gyrus), dyslexia (left corner gyrus), body image disorder (right parietal lobe), etc .;
  • Temporal lobe Hookback attack (anterior temporal lobe), sensory / amnestic aphasia (left temporal lobe), hearing impairment (rear superior temporal gyrus), etc.
  • Occipital lobe hemianopia, hallucinations, visual disagreement, etc.
  • V. Limbic system emotional symptoms, memory loss, disturbance of consciousness, hallucinations, etc.
  • the striatum is the main component of the extrapyramidal system, and its dysfunction can cause various extrapyramidal diseases, including but not limited to: 1. Increased dyskinesia-dystonia syndrome: chorea, hand and foot asthma, torsion spasm, etc .; 2. Reduced dyskinesia-tonic syndrome: tremor paralysis, etc .;
  • polypeptide of the present invention and the antagonist, agonist and inhibitor of the polypeptide can be directly used in the diagnosis and treatment of various diseases, such as dementia, limb paralysis, hearing impairment, cerebellar ataxia, chorea, and the like.
  • the invention also provides methods of screening compounds to identify agents that increase (agonist) or suppress (antagonist) human brain-specific expression protein 18.70.
  • Agonists enhance human brain-specific expressed proteins 18. 70 stimulate biological functions such as cell proliferation, while antagonists prevent and treat disorders related to excessive cell proliferation, such as various cancers.
  • mammalian cells or membrane preparations expressing human brain-specific expression protein 18. 70 can be cultured with labeled human brain-specific expression protein 18. 70 in the presence of a drug. The ability of the drug to increase or block this interaction is then determined.
  • Antagonists of human brain-specific protein 18.70 include antibodies, compounds, receptor deletions, and analogs that have been screened. Antagonist of human brain-specific expression protein 18.70 can bind to human brain-specific expression protein 18.70 and eliminate its function, or inhibit the production of the polypeptide, or bind to the active site of the polypeptide so that the polypeptide cannot function biological functions.
  • human brain-specific expression protein 18.70 can be added to the bioanalytical assay and determined by determining the effect of the compound on the interaction between human brain-specific expression protein 18.70 and its receptors. 'Whether the compound is an antagonist. Receptor deletions and analogs that act as antagonists can be screened in the same way as for screening compounds described above.
  • Peptide molecules capable of binding to human brain-specific expressed protein 18. 70 can be obtained by screening a random peptide library composed of various possible combinations of amino acids bound to a solid phase. When screening, the human brain-specific expressed protein 18. 70 molecules should generally be labeled.
  • the present invention provides a method for producing antibodies using polypeptides, and fragments, derivatives, analogs or cells thereof as antigens. These antibodies can be polyclonal or monoclonal antibodies.
  • the invention also provides antibodies against the human brain-specifically expressed protein 18.70 epitope. These antibodies include (but are not limited to): polyclonal antibodies, monoclonal antibodies, chimeric antibodies, single chain antibodies, Fab fragments, and fragments generated from Fab expression libraries.
  • Polyclonal antibodies can be produced by direct injection of human brain-specific protein 18.70 into immunized animals (such as rabbits, mice, rats, etc.).
  • immunized animals such as rabbits, mice, rats, etc.
  • a variety of adjuvants can be used to enhance the immune response, including but not limited to Freund's Adjuvant, etc.
  • Techniques for preparing monoclonal antibodies specifically expressing human brain protein 18.70 include, but are not limited to, hybridoma technology (KoMer and Mistein. Nature, 1975, 256: 495-497), triple tumor technology, human beta-cell hybridoma Technology, EBV-hybridoma technology, etc.
  • Chimeric antibodies that bind human constant regions to non-human variable regions can be produced using existing techniques (Morr i son et al, PNAS, 1985, 81: 6851). 0
  • the existing technology for producing single chain antibodies (US Pat No. 4946778) can also be used to produce single chain antibodies against human brain specific expression protein 18.70.
  • Antibodies against human brain-specific protein 18. 70 can be used in immunohistochemical techniques to detect human brain-specific protein 18. 70 in biopsy specimens.
  • Monoclonal antibodies that bind to human brain-specific expressed proteins 18. 70 can also be labeled with radioisotopes and injected into the body to track their location and distribution. This radiolabeled antibody can be used as a non-invasive diagnostic method to locate tumor cells and determine whether there is metastasis.
  • Antibodies can also be used to design immunotoxins that target a particular part of the body.
  • human brain-specific proteins 18. 70 High affinity monoclonal antibodies can covalently bind to bacterial or phytotoxins (such as diphtheria toxin, ricin, ormosine, etc.).
  • a common method is to attack the amino group of an antibody with a sulfhydryl cross-linking agent such as SPDP, and bind the toxin to the antibody through the exchange of disulfide bonds.
  • This hybrid antibody can be used to kill human brain-specific expression protein 18. 70 positive Cell.
  • the antibodies of the present invention can be used to treat or prevent diseases related to human brain-specific expression protein 18.70.
  • the proper dose of antibody can stimulate or block the production or activity of human brain-specific protein 18.70.
  • the invention also relates to a diagnostic test method for quantitatively and locally detecting the level of human brain-specific expressed protein 18.70.
  • diagnostic test method for quantitatively and locally detecting the level of human brain-specific expressed protein 18.70.
  • These tests are well known in the art and include FISH assays and radioimmunoassays.
  • the level of human brain-specific expression protein 18.70 detected in the test can be used to explain the importance of human brain-specific expression protein 18.70 in various diseases and to diagnose the role of human brain-specific expression protein 18.70. disease.
  • polypeptide of the present invention can also be used for peptide mapping analysis.
  • the polypeptide can be specifically cleaved by physical, chemical or enzymatic analysis, and subjected to one-dimensional or two-dimensional or three-dimensional gel electrophoresis analysis, and more preferably mass spectrometry analysis.
  • the polynucleotide encoding human brain-specific expression protein 18.70 can also be used for a variety of therapeutic purposes. Gene therapy technology can be used to treat abnormal cell proliferation, development or metabolism caused by the non-expression or abnormal / inactive expression of human brain-specific expression protein 18.70.
  • Recombinant gene therapy vectors (such as viral vectors) can be designed to express mutated human brain-specific expression protein 18.70 to inhibit endogenous human brain-specific expression protein 18.70 activity.
  • a mutated human brain-specific expression protein 18.70 may be a shortened human brain-specific expression protein 18.70 lacking a signaling domain, although it can bind to downstream substrates, but lacks signaling activity.
  • the recombinant gene therapy vector can be used to treat diseases caused by abnormal expression or activity of human brain-specific expressed protein 18.70.
  • Virus-derived expression vectors such as retrovirus, adenovirus, adenovirus-associated virus, herpes simplex virus, parvovirus, etc. can be used to transfer a polynucleotide encoding a human brain-specific expression protein 18.70 into a cell. Construction of a protein encoding human brain-specific expression 18. 70 Methods for recombinant viral vectors of polynucleotides can be found in the existing literature (Satnbrook, et al.). In addition, a recombinant polynucleotide encoding human brain-specific expression protein 18.70 can be packaged into liposomes and transferred into cells.
  • Methods for introducing a polynucleotide into a tissue or cell include: directly injecting the polynucleotide into a tissue in vivo; or introducing the polynucleotide into a cell in vitro through a vector (such as a virus, phage, or plasmid), and then transplanting the cell Into the body and so on.
  • a vector such as a virus, phage, or plasmid
  • Oligonucleotides including antisense RM and DM
  • ribozymes that inhibit human brain-specific expression of 18.70 mRNA are also within the scope of the present invention.
  • a ribozyme is an enzyme-like RNA molecule that can specifically decompose a specific A. Its mechanism of action is that the ribozyme molecule specifically hybridizes with a complementary target R to perform endonucleation.
  • Antisense RNA, DNA, and ribozymes can be obtained using any existing RNA or DNA synthesis technology, such as solid-phase phosphoramidite chemical synthesis to synthesize oligonucleotides.
  • Antisense RNA molecules can be obtained by in vitro or in vivo transcription of a DNA sequence encoding the MA.
  • This DNA sequence has been integrated downstream of the vector's RNA polymerase promoter.
  • it can be modified in a variety of ways, such as increasing the sequence length on both sides, and the linkage between ribonucleosides using phosphate thioester or peptide bonds instead of phosphodiester bonds.
  • the polynucleotide encoding human brain-specific expression protein 18. 70 can be used for the diagnosis of diseases related to human brain-specific expression protein 18. 70.
  • the polynucleotide encoding human brain-specific expression protein 18. 70 can be used to detect the expression of human brain-specific expression protein 18. 70 or the abnormal expression of human brain-specific expression protein 18. 70 in a disease state.
  • the DNA sequence encoding human brain-specific expression protein 18. 70 can be used to hybridize biopsy specimens to determine the expression status of human brain-specific expression protein 18. 70.
  • Hybridization techniques include Southern blotting, Nor thern blotting, and in situ hybridization. These techniques and methods are publicly available and mature, and related kits are commercially available.
  • a part or all of the polynucleotide of the present invention can be used as a probe to be fixed on a micro array or a DNA chip (also referred to as a "gene chip") for analyzing differential expression analysis of genes and genetic diagnosis in tissues.
  • 70 specific primers for RNA-polymerase chain reaction (RT-PCR) amplification in vitro can also detect human brain-specifically expressed protein 18.
  • 70 transcripts can also detect human brain-specifically expressed protein 18.
  • Human brain-specific expression protein 18.70 gene can also be used to diagnose human brain-specific expression protein 18.70-related diseases.
  • Human brain-specific expression protein 18.70 mutations include point mutations, translocations, deletions, recombinations, and any other abnormalities compared to the normal wild-type human brain-specific expression protein 18.70 DNA sequence. Mutations can be detected using existing techniques such as Southern blotting, DM sequence analysis, PCR and in situ hybridization. In addition, mutations may affect protein expression. Therefore, Nor thern blotting and Western blotting can be used to indirectly determine whether a gene is mutated. The sequences of the invention are also valuable for chromosome identification.
  • This sequence will specifically target a specific position on a human chromosome and can hybridize to it.
  • specific sites for each gene on the chromosome need to be identified.
  • only a few chromosome markers based on actual sequence data are available for labeling chromosome positions.
  • an important first step is to locate these DM sequences on a chromosome.
  • the PCR primers (preferably 15-35bp) are prepared according to cDM, and the sequences can be located on the chromosomes. These primers were then used for PCR screening of somatic hybrid cells containing individual human chromosomes. Only those heterozygous cells containing the human gene corresponding to the primer will produce amplified fragments.
  • PCR localization of somatic hybrid cells is a quick way to localize DNA to specific chromosomes.
  • oligonucleotide primers of the present invention in a similar manner, a set of fragments from a specific chromosome or a large number of genomic clones can be used to achieve sublocalization.
  • Other similar strategies that can be used for chromosomal localization include in situ hybridization, chromosome pre-screening with labeled flow sorting, and hybrid pre-selection to construct chromosome-specific cDM libraries.
  • Fluorescent in situ hybridization of cDNA clones to metaphase chromosomes allows precise chromosomal localization in one step.
  • FISH Fluorescent in situ hybridization
  • the difference in cDNA or genomic sequence between the affected and unaffected individuals needs to be determined. If a mutation is observed in some or all diseased individuals and the mutation is not observed in any normal individuals, the mutation may be the cause of the disease. Comparing affected and unaffected individuals usually involves first looking for structural changes in the chromosomes, such as deletions or translocations that are visible at the chromosomal level or detectable with cDM sequence-based PCR. According to the resolution capabilities of current physical mapping and gene mapping technology, the cDNA accurately mapped to the chromosomal region associated with the disease can be one of 50 to 500 potentially pathogenic genes (assuming 1 megabase mapping resolution) Capacity and each 20kb corresponds to a gene).
  • the polypeptides, polynucleotides and mimetics, agonists, antagonists and inhibitors of the present invention can be used in combination with a suitable pharmaceutical carrier.
  • suitable pharmaceutical carrier can be water, glucose, ethanol, salts, buffers, glycerol, and combinations thereof.
  • the composition comprises a safe and effective amount of the polypeptide or antagonist, and carriers and excipients that do not affect the effect of the drug. These compositions can be used as drugs for the treatment of diseases.
  • the present invention also provides a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the present invention.
  • polypeptides of the invention can be used in combination with other therapeutic compounds.
  • the pharmaceutical composition can be administered in a convenient manner, such as by a topical, intravenous, intraperitoneal, intramuscular, subcutaneous, intranasal or intradermal route of administration.
  • Human brain-specific expressed protein 18. 70 is administered in an amount effective to treat and / or prevent a specific indication.
  • the amount and range of human brain-specific protein 18.70 administered to a patient will depend on many factors, such as the mode of administration, the health conditions of the person to be treated, and the judgment of the diagnostician. Examples
  • Dye terminate Cycle react ion sequencing kit Perkin-Elmer
  • ABI 377 automatic sequencer Perkin-Elmer
  • the determined cDNA sequence was compared with the existing public DM sequence
  • the database (Genebank) was compared, and it was found that the cDNA sequence of one of the clones 3853 ⁇ 0 was new DNA.
  • a series of primers were synthesized to determine the inserted cDNA fragment of the clone in both directions.
  • the sequence of the human brain-specifically expressed protein 18.70 of the present invention and the protein sequence encoded by the protein were calculated using the Blast procedure.
  • Foreword Basic local Alarm search tool
  • Genbank The gene with the highest homology to the human brain-specific expression protein 18.70 of the present invention is a known human brain-specific expression protein.
  • accession number of the encoded protein in Genbank is the human brain-specific expression protein number.
  • the protein homology results are shown in Figure 1. The two are highly homologous, with 75% identity; 88% similarity.
  • Example 3 Cloning of a gene encoding human brain-specific expression protein 18.70 by RT-PCR
  • CDNA was synthesized using fetal brain cell total RNA as a template and ol igo-dT as a primer for reverse transcription reaction. After purification with Qiagene's kit, the following primers were used for PCR amplification:
  • Primer2 5'- ACATAGGCCGAGGCGGCCGACATG -3 '(SEQ ID NO: 4)
  • Primerl is a forward sequence starting at lbp of the 5th end of SEQ ID NO: 1;
  • Primer2 is the 3 'end reverse sequence in SEQ ID NO: 1.
  • a reaction volume of 50 ⁇ 1 contains 5 (kmol / L KC1, 10mraol / L Tris-HCl, pH 8.5, 1.5 mmol / L MgCl 2 , 20 ( ⁇ mol / L dNTP, l Opmol primer, 1U of Taq DNA polymerase (Clotitech).
  • the reaction was performed on a PE9600 DM thermal cycler (Perkin-Elmer) under the following conditions for 25 cycles: 94.C 30sec; 55 ° C 30sec; 72 ° C 2min. Set ⁇ -act in as a positive control and template blank as a negative control at the same time during RT-PCR.
  • RNA precipitate with 70% ethanol, dry and dissolve in water.
  • RNA Perform electrophoresis on a 1.2 ° /.
  • A- 32 P dATP was used to prepare a 32 P-labeled DNA probe by a random primer method.
  • the DNA probe used was a PCR amplified human brain-specific expression protein 18.70 coding region shown in FIG. 1. Sequence (126bp to 638bp).
  • 32P-labeled probe (about 2 x 10 s cpra / ml) was hybridized with a nitrocellulose membrane to which RNA was transferred at 42 ° C overnight in a solution containing 50% alpha Amide-25mM KH 2 P0 4 (pH7. 4) -5 x SSC- 5 x Denhardt's solution and 20 ⁇ g / ml salmon sperm DNA.
  • Primer3 5'-CCCCATATGATGGCATCAGAGGCAGAAAAAACA-3 '(Seq ID No: 5)
  • Primer4 5' -CATGGATCCCTACTTGGTCTTCTTATCGTAGGT- 3 '(Seq ID No: 6)
  • the 5' ends of these two primers contain Ndel and BamHI restriction sites, respectively.
  • the coding sequences of the 5 'and 3' ends of the target gene are followed, respectively.
  • the Ndel and BamHI restriction sites correspond to the selection on the expression vector plasmid pET-28b (+) (Novagen, Cat. No. 69865. 3). Sex endonuclease site.
  • a PCR reaction was performed using the PBS-3853 ⁇ 0 plasmid containing the full-length target gene as a template.
  • the PCR reaction conditions were as follows: a total volume of 50 ⁇ 1 containing 10 pg of pBS-3853f10 plasmid, Primer-3 and Primer-4 were 1 Opmol and Advantage polymerase Mix (Clontech) 1 ⁇ 1, respectively. Cycle parameters: 4 ° C 20s, 60 ° C 30s, 68 ° C 2 min, a total of 25 cycles. Ndel and BamHI were used to double digest the amplified product and plasmid pET-28 (+), respectively, and large fragments were recovered and ligated with T4 ligase.
  • the ligated product was transformed into Escherichia coli DH5 C using the calcium chloride method. After being cultured overnight on LB plates containing kanamycin (final concentration 30 ⁇ 8 ⁇ 1), positive clones were screened by colony PCR method and sequenced. Selected positive clones with the correct sequence (PET- 3853fl0) the recombinant plasmid by the calcium chloride method to transform E. coli BL21 (DE3) plySs (Nova g en Products).
  • the host bacteria BL21 (pET-3853f 10) was cultured at 37 ° C to the logarithmic growth phase, and IPTG was added to a final concentration of 1 mmol / L, Continue incubation for 5 hours. The cells were collected by centrifugation, and the supernatant was collected by centrifugation. The supernatant was collected by centrifugation, and the layers were layered with His s. Bind Quick Cartridge (product of Novagen) using an affinity chromatography column capable of binding 6 histidines (6His-Tag) 70, a purified human brain-specific expression protein 18.70 was obtained.
  • 6His-Tag 6 histidines
  • a peptide synthesizer product of PE company
  • 70-specific peptides were synthesized: -Ala-Ala-Phe-C00H (SEQ ID NO: 7).
  • the polypeptide was coupled with hemocyanin and bovine serum albumin to form a complex.
  • hemocyanin polypeptide For the method, see: Avrameas, et al. Iramunochemi s try, 1969; 6: 43 0.
  • the complex plus complete Freund's adjuvant was used to immunize rabbits. After 15 days, the hemocyanin polypeptide complex plus incomplete Freund's adjuvant was used to boost the immunity once.
  • a titer plate coated with a 15 g / ml bovine serum albumin peptide complex was used as an ELISA to determine antibody titers in rabbit serum.
  • Total IgG was isolated from antibody-positive rabbit serum using protein A-Sepharose.
  • the peptide was bound to a cyanogen bromide-activated Sepharose4B column, and anti-peptide antibodies were separated from the total IgG by affinity chromatography. 70 ⁇ It was confirmed by immunoprecipitation that the purified antibody could specifically bind to human brain-specific expression protein 18.70.
  • Example 7 Application of the polynucleotide fragment of the present invention as a hybridization probe
  • Suitable oligonucleotide fragments selected from the polynucleotides of the present invention are used as hybridization probes in a variety of ways.
  • the probes can be used to hybridize to genomic or cDNA libraries of normal tissue or pathological tissue from different sources to It is determined whether it contains the polynucleotide sequence of the present invention and a homologous polynucleotide sequence is detected.
  • the probe can be used to detect the polynucleotide sequence of the present invention or its homologous polynucleotide sequence in normal tissue or pathology. Whether the expression in tissue cells is abnormal.
  • the purpose of this embodiment is to select a suitable oligonucleotide fragment from the polynucleotide SEQ ID NO: 1 of the present invention as a hybridization probe, and to identify whether some tissues contain the polynucleoside of the present invention by using a filter hybridization method.
  • Filter hybridization methods include dot blotting, Southern imprinting, Northern blotting, and copying methods. They all use the same steps to immobilize the polynucleotide sample to be tested on the filter.
  • the sample-immobilized filter is first pre-hybridized with a probe-free hybridization buffer to saturate the non-specific binding site of the sample on the filter with the carrier and the synthesized polymer.
  • the pre-hybridization solution is then replaced with a hybridization buffer containing labeled probes and incubated to hybridize the probes to the target nucleic acid.
  • the unhybridized probes are removed by a series of membrane washing steps.
  • This embodiment uses higher-intensity washing conditions (such as lower salt concentration and higher temperature), so that the hybridization background is reduced and only strong specific signals are retained.
  • the probes used in this embodiment include two types: the first type of probes are oligonucleotide fragments that are completely the same as or complementary to the polynucleotide SEQ ID NO: 1 of the present invention; the second type of probes are partially related to the present invention
  • the polynucleotide SEQ ID NO: 1 is the same or complementary oligonucleotide fragment.
  • the dot blot method is used to fix the sample on the filter membrane. Under the high-intensity washing conditions, the first type of probe and the sample have the strongest hybridization specificity and are retained.
  • oligonucleotide fragments from the polynucleotide SEQ ID NO: 1 of the present invention for use as hybridization probes should follow the following principles and several aspects to be considered:
  • the preferred range of probe size is 18-50 nucleotides
  • Those that meet the above conditions can be used as primary selection probes, and then further computer sequence analysis, including the primary selection probe and its source sequence region (ie, SEQ ID NO: 1) and other known genomic sequences and their complements For homology comparison of the regions, if the homology with the non-target molecular region is greater than 85% or there are more than 15 consecutive bases, the primary probe should not be used generally;
  • Probe 1 which belongs to the first type of probe, is completely homologous or complementary to the gene fragment of SEQ ID NO: 1 (41Nt):
  • Probe 2 which belongs to the second type of probe, is equivalent to the replacement mutation sequence (41Nt) of the gene fragment or its complementary fragment of SEQ ID NO: 1:
  • PBS phosphate buffered saline
  • step 8-13 are only used when contamination must be removed, otherwise step 14 can be performed directly.
  • NC membranes nitrocellulose membranes
  • Two NC membranes are required for each probe, so that they can be used in the following experimental steps.
  • the film was washed with high-strength conditions and strength conditions, respectively.
  • the 32 PP r0 (the second peak is free ⁇ - 32 P-dATP) to be prepared.
  • the sample film was placed in a plastic bag pre-hybridization solution was added 3 -10mg (10xDenha ⁇ dt's; 6xSSC, 0. lmg / ml CT DNA ( calf thymus DNA)). After closing the bag, 68. C water bath for 2 hours.
  • probe 1 can be used to qualitatively and quantitatively analyze the presence and differential expression of the polynucleotide of the present invention in different tissues. Rights request
  • An isolated polypeptide-a human brain-specific expression protein 18. 70 characterized in that it comprises: a polypeptide having the amino acid sequence shown in SEQ ID NO: 2, or an active fragment, analog, or derivative thereof.
  • polypeptide according to claim 1 characterized in that the amino acid sequence of the polypeptide, analog or derivative has at least 95% identity with the amino acid sequence shown in SEQ ID NO: 2.
  • polypeptide according to claim 2 characterized in that it comprises a polypeptide having the amino acid sequence shown in SEQ ID NO: 2.
  • polynucleotide characterized in that said polynucleotide comprises one selected from the group consisting of:
  • polynucleotide according to claim 4 wherein the polynucleotide comprises a polynucleotide encoding an amino acid sequence shown in SEQ ID NO: 2.
  • polynucleotide according to claim 4 characterized in that the sequence of the polynucleotide comprises the sequence of positions 126-638 in SEQ ID NO: 1 or the sequence of positions 1-766 in SEQ ID NO: 1. .
  • a recombinant vector containing an exogenous polynucleotide characterized in that it is constructed from the polynucleotide described in any of claims 4-6 and a plasmid, virus or vector expression vector Recombinant vector.
  • a genetically engineered host cell containing an exogenous polynucleotide characterized in that it is selected from one of the following host cells:
  • a method for preparing a polypeptide having human brain-specific expression protein 18.70 activity characterized in that the method includes:
  • an antibody capable of binding to a polypeptide characterized in that the antibody is capable of expressing specifically to the human brain Protein 18. 70 specifically binds to the antibody.
  • a class of compounds that mimic or regulate the activity or expression of a polypeptide characterized in that they are compounds that mimic, promote, antagonize or inhibit the activity of human brain-specific expression protein 18.70.
  • the compound according to claim 11 characterized in that it is an antisense sequence of a polynucleotide sequence or a fragment thereof as shown in SEQ ID NO: 1.
  • a method for detecting a disease or susceptibility to a polypeptide related to any one of claims 1-3 characterized in that it comprises detecting the expression level of the polypeptide, or detecting the polypeptide Activity, or detecting a nucleotide variation in a polynucleotide that causes abnormal expression or activity of the polypeptide.
  • polypeptide according to any one of claims 1-3, characterized in that it is used for screening a mimic, agonist, antagonist or inhibitor of human brain-specific expression protein 18.70; or Identification of peptide fingerprints.
  • nucleic acid molecule according to any of the claims 4 to 6, characterized in that it is used as a primer for a nucleic acid amplification reaction, or as a probe for a hybridization reaction, or for manufacturing Gene chip or microarray.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • Zoology (AREA)
  • Genetics & Genomics (AREA)
  • Medicinal Chemistry (AREA)
  • Molecular Biology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Toxicology (AREA)
  • Peptides Or Proteins (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Abstract

L'invention concerne un nouveau type de polypeptide, la protéine 18.70 exprimée de manière spécifique dans le cerveau chez l'homme, ainsi qu'un polynucléotide codant ledit polypeptide, et un procédé pour produire ledit polypeptide par des procédés de recombinaison d'ADN. L'invention concerne également un procédé pour appliquer ce polypeptide dans le traitement de divers types de maladies, telles que la démence, la paralysie des membres, les troubles auditifs, l'ataxie cérébrale, la chorée mineure. L'invention concerne en outre des antagonistes et l'utilisation thérapeutique de ce polypeptide. Enfin, elle concerne l'utilisation du polynucléotide codant cette protéine 18.70 exprimée de manière spécifique dans le cerveau chez l'homme.
PCT/CN2001/001372 2000-09-12 2001-09-10 Nouveau polypeptide, proteine 18.70 exprimee de maniere specifique dans le cerveau chez l'homme, et polynucleotide codant ledit polypeptide WO2002040526A1 (fr)

Priority Applications (1)

Application Number Priority Date Filing Date Title
AU2002221430A AU2002221430A1 (en) 2000-09-12 2001-09-10 A novel polypeptide-homo brain specific expressed protein 18.70 and polynucleotide encoding said polypeptide

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
CN 00125171 CN1342701A (zh) 2000-09-12 2000-09-12 一种新的多肽——人脑特异表达蛋白18.70和编码这种多肽的多核苷酸
CN00125171.6 2000-09-12

Publications (1)

Publication Number Publication Date
WO2002040526A1 true WO2002040526A1 (fr) 2002-05-23

Family

ID=4590963

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/CN2001/001372 WO2002040526A1 (fr) 2000-09-12 2001-09-10 Nouveau polypeptide, proteine 18.70 exprimee de maniere specifique dans le cerveau chez l'homme, et polynucleotide codant ledit polypeptide

Country Status (3)

Country Link
CN (1) CN1342701A (fr)
AU (1) AU2002221430A1 (fr)
WO (1) WO2002040526A1 (fr)

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
DATABASE GENBANK [online] 1 March 1996 (1996-03-01), SHIRATSUCHI A. ET AL., retrieved from GI:2136726 Database accession no. (S58793) *
DATABASE GENBANK [online] 1 November 1997 (1997-11-01), SHIRATSUCHT A. ET AL., retrieved from GI:2498194 Database accession no. (Q27957) *

Also Published As

Publication number Publication date
AU2002221430A1 (en) 2002-05-27
CN1342701A (zh) 2002-04-03

Similar Documents

Publication Publication Date Title
WO2002051867A1 (fr) Nouveau facteur 8.8 polypeptidique liberant de la corticotrophine et polynucleotide codant ledit polypeptide
WO2002026972A1 (fr) Nouveau polypeptide, proteine humaine 20.13 de liaison de l'acide polyadenylique, et polynucleotide codant ce polypeptide
WO2001083780A1 (fr) Nouveau polypeptide, methylthioadenosine phosphorylase humaine 37, et polynucleotide codant pour ce polypeptide
WO2002040526A1 (fr) Nouveau polypeptide, proteine 18.70 exprimee de maniere specifique dans le cerveau chez l'homme, et polynucleotide codant ledit polypeptide
WO2001064720A1 (fr) Nouveau polypeptide, lamine humaine 14, et polynucleotide codant pour ce polypeptide
WO2001038540A1 (fr) Nouveau polypeptide, la methionyl arnt synthetase humaine de 29 kda, et polynucleotide codant pour ledit polypeptide
WO2001075085A1 (fr) Nouveau polypeptide, serine hydrolase humaine atp-dependante 11.3, et polynucleotide codant pour ce polypeptide
WO2001075125A1 (fr) Nouveau polypeptide, serine hydrolase humaine atp-dependante 31, et polynucleotide codant pour ce polypeptide
WO2002026975A1 (fr) Nouveau polypeptide, proteine humaine 48-35.53 associee au rhomboide, et polynucleotide codant ce polypeptide
WO2001074876A1 (fr) Nouveau polypeptide, phosphatidylinositol-3 kinase humaine 14, et polynucleotide codant pour ce polypeptide
WO2001046437A1 (fr) Nouveau polypeptide, region de liaison d'arn-eucaryote rnp-1-21, et polynucleotide codant pour ce polypeptide
WO2001046409A1 (fr) Nouveau polypeptide, proteine ribosomale s7 9, et polynucleotide codant pour ce polypeptide
WO2002006333A1 (fr) Nouveau polypeptide, proteine vn1-18 du recepteur de la pheromone, et polynucleotide codant ce polypeptide
WO2001079434A2 (fr) Nouveau polypeptide, signal peptidase humaine 10, et polynucleotide codant pour ce polypeptide
WO2001068873A1 (fr) Nouveau polypeptide, molecule humaine d'adhesion intercellulaire 12, et polynucleotide codant pour ce polypeptide
WO2002026810A1 (fr) Nouveau polypeptide, substance proteique p125-77.22, et polynucleotide codant ce polypeptide
WO2001072796A1 (fr) Nouveau polypeptide, facteur humain de transcription de la differentiation cellulaire 11, et polynucleotide codant pour ce polypeptide
WO2001090170A1 (fr) Nouveau polypeptide, proteine humaine 31 d'adhesion des cellules nerveuses, et polynucleotide codant ce polypeptide
WO2001075051A2 (fr) Nouveau polypeptide, proteine humaine 17 stag3 (antigene stromal), et polynucleotide codant pour ce polypeptide
WO2001055372A1 (fr) Nouveau polypeptide, proteine humaine tnfr/ngfr 10, et polynucleotide codant pour ce polypeptide
WO2001079436A2 (fr) Nouveau polypeptide, facteur humain de transcription de la differentiation cellulaire 10, et polynucleotide codant pour ce polypeptide
WO2001049739A1 (fr) Nouveau polypeptide, la proteine po 14 de la myeline, et polynucleotide le codant
WO2001079508A1 (fr) Nouveau polypeptide, proteine porteuse mitochondriale humaine 18, et polynucleotide codant pour ce polypeptide
WO2001072991A1 (fr) Nouveau polypeptide, serine hydrolase humaine atp-dependante 9.8, et polynucleotide codant pour ce polypeptide
WO2001048199A1 (fr) Nouveau polypeptide, proteine ribosomale s10 14, et polynucleotide codant pour ce polypeptide

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CO CR CU CZ DE DK DM DZ EC EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GQ GW ML MR NE SN TD TG

DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
121 Ep: the epo has been informed by wipo that ep was designated in this application
REG Reference to national code

Ref country code: DE

Ref legal event code: 8642

122 Ep: pct application non-entry in european phase
NENP Non-entry into the national phase

Ref country code: JP