WO2001090170A1 - Nouveau polypeptide, proteine humaine 31 d'adhesion des cellules nerveuses, et polynucleotide codant ce polypeptide - Google Patents

Nouveau polypeptide, proteine humaine 31 d'adhesion des cellules nerveuses, et polynucleotide codant ce polypeptide Download PDF

Info

Publication number
WO2001090170A1
WO2001090170A1 PCT/CN2001/000793 CN0100793W WO0190170A1 WO 2001090170 A1 WO2001090170 A1 WO 2001090170A1 CN 0100793 W CN0100793 W CN 0100793W WO 0190170 A1 WO0190170 A1 WO 0190170A1
Authority
WO
WIPO (PCT)
Prior art keywords
polypeptide
polynucleotide
cell adhesion
adhesion protein
sequence
Prior art date
Application number
PCT/CN2001/000793
Other languages
English (en)
Chinese (zh)
Inventor
Yumin Mao
Yi Xie
Original Assignee
Shanghai Biowindow Gene Development Inc.
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Shanghai Biowindow Gene Development Inc. filed Critical Shanghai Biowindow Gene Development Inc.
Priority to AU76246/01A priority Critical patent/AU7624601A/en
Publication of WO2001090170A1 publication Critical patent/WO2001090170A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/705—Receptors; Cell surface antigens; Cell surface determinants
    • C07K14/70503—Immunoglobulin superfamily
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides

Definitions

  • the present invention belongs to the field of biotechnology. Specifically, the present invention describes a new polypeptide ⁇ ⁇ nerve cell adhesion protein 31, and a polynucleotide sequence encoding the polypeptide. The invention also relates to a preparation method and application of the polynucleotide and polypeptide. Background
  • the axon-related cell adhesion molecules play a very important regulatory role in the formation, maintenance and function of neurons.
  • These protein molecules constitute an independent protein family in the body, namely the axon cell adhesion protein family.
  • This protein family is a subclass of the immunoglobulin superfamily. Its members have similar structural and functional characteristics and are involved in the formation, maintenance, and normal physiological activity of the cerebral nervous system in the body.
  • the novel human nerve cell adhesion protein 31 of the present invention is associated with a known mouse axon-associated cell adhesion molecule BIG-2 at the protein level with 96% identity and 98% similarity, and the protein sequences of the two Each of them has various characteristic sequence fragments as described above, so both are fine details related to axons. It is a member of the protein family of adhesion molecules and has similar biological functions.
  • the human nerve cell adhesion protein 31 of the present invention also participates in a variety of important nervous system development and growth regulation processes in the body. Mutations or abnormal expression of the protein are usually associated with various nervous system development and growth disorders and related tissues in the body. Carcinoma and cancer are closely related. The protein can also be used for the diagnosis and treatment of various related diseases mentioned above.
  • the human neural cell adhesion protein 31 protein plays an important role in regulating important functions of the body such as cell division and embryonic development, and it is believed that a large number of proteins are involved in these regulatory processes, so there has been a need to identify more involved in these processes
  • the human neural cell adhesion protein 31 protein in particular, identifies the amino acid sequence of this protein. Isolation of the new human neural cell adhesion protein 31 protein encoding gene also provides a basis for research to determine the role of this protein in health and disease states. This protein may form the basis for the development of diagnostic and / or therapeutic drugs for diseases, so it is important to isolate its code for DM.
  • Another object of the invention is to provide a polynucleotide encoding the polypeptide.
  • Another object of the present invention is to provide a recombinant vector containing a polynucleotide encoding human neural cell adhesion protein 31.
  • Another object of the present invention is to provide a genetically engineered host cell containing a polynucleotide encoding human neural cell adhesion protein 31.
  • Another object of the present invention is to provide a method for producing human neural cell adhesion protein 31.
  • Another object of the present invention is to provide mimetic compounds, antagonists, agonists, and inhibitors of the human nerve cell adhesion protein 31 of the polypeptide of the present invention.
  • Another object of the present invention is to provide a method for diagnosing and treating diseases associated with abnormalities in human neuronal adhesion protein 31. Ming outline
  • the present invention relates to an isolated polypeptide, which is of human origin and comprises: a polypeptide having the amino acid sequence of SEQ ID No. 2, or a conservative variant, biologically active fragment or derivative thereof.
  • the polypeptide is a polypeptide having the amino acid sequence of SEQ ID NO: 2.
  • the invention also relates to an isolated poly'nucleotide, which comprises a nucleotide sequence or a variant thereof selected from the group consisting of:
  • sequence of the polynucleotide is one selected from the group consisting of: (a) a sequence having positions 576-1424 in SEQ ID NO: 1; and (b) a sequence having 1-3157 in SEQ ID NO: 1 Sequence of bits.
  • the present invention further relates to a vector, particularly an expression vector, containing the polynucleotide of the present invention; a host cell genetically engineered with the vector, including a transformed, transduced or transfected host cell; Host cell and method of preparing the polypeptide of the present invention by recovering the expression product.
  • the invention also relates to an antibody capable of specifically binding to a polypeptide of the invention.
  • the invention also relates to a method for screening compounds that mimic, activate, antagonize or inhibit the activity of human neural cell adhesion protein 31 protein, which comprises utilizing the polypeptide of the invention.
  • the invention also relates to compounds obtained by this method.
  • the invention also relates to a method for detecting a disease or disease susceptibility related to abnormal expression of human neural cell adhesion protein 31 protein in vitro, comprising detecting a mutation in the polypeptide or a polynucleotide sequence encoding the same in a biological sample, or detecting a biological The amount or biological activity of a polypeptide of the invention in a sample.
  • the invention also relates to a pharmaceutical composition
  • a pharmaceutical composition comprising a polypeptide of the invention or a mimetic thereof, an activator, an antagonist or an inhibitor, and a pharmaceutically acceptable carrier.
  • the present invention also relates to the use of the polypeptide and / or polynucleotide of the present invention in the preparation of a medicament for treating cancer, developmental disease or immune disease or other diseases caused by abnormal expression of human neural cell adhesion protein 31.
  • FIG. 1 is a comparison diagram of amino acid sequence homology of human nerve cell adhesion protein 31 and human nerve cell adhesion protein of the present invention.
  • the upper sequence is human nerve cell adhesion protein 31, and the lower sequence is human nerve cell adhesion protein.
  • Identical amino acids are represented by single-character amino acids between the two sequences, and similar amino acids are represented by "+”.
  • Figure 2 is a polyacrylamide gel electrophoresis image (SDS-PAGE) of human neural cell adhesion protein 31 isolated.
  • 31 kDa is the molecular weight of the protein.
  • the arrow indicates the isolated protein band. Summary of the invention
  • Nucleic acid sequence refers to oligonucleotides, nucleotides or polynucleotides and fragments or parts thereof, and may also refer to the genome or synthetic DNA or RNA, they can be single-stranded or double-stranded, representing the sense or antisense strand.
  • amino acid sequence refers to an oligopeptide, peptide, polypeptide or protein sequence and fragments or portions thereof.
  • amino acid sequence in the present invention relates to the amino acid sequence of a naturally occurring protein molecule, such "polypeptide” or “protein” does not mean to limit the amino acid sequence to a complete natural amino acid related to the protein molecule .
  • a “variant" of a protein or polynucleotide refers to an amino acid sequence having one or more amino acids or nucleotide changes or a polynucleotide sequence encoding it.
  • the changes may include deletions, insertions or substitutions of amino acids or nucleotides in the amino acid sequence or nucleotide sequence.
  • Variants can have "conservative" changes, in which the amino acid substituted has a structural or chemical property similar to the original amino acid, such as replacing isoleucine with leucine.
  • Variants can also have non-conservative changes, such as replacing glycine with tryptophan.
  • “Deletion” refers to the deletion of one or more amino acids or nucleotides in an amino acid sequence or nucleotide sequence.
  • Insertion means that a change in the amino acid sequence or nucleotide sequence results in an increase in one or more amino acids or nucleotides compared to a molecule that exists in nature.
  • Replacement refers to the replacement of one or more amino acids or nucleotides with different amino acids or nucleotides.
  • Bioactivity refers to a protein that has the structure, regulation, or biochemical function of a natural molecule.
  • immunologically active refers to the ability of natural, recombinant or synthetic proteins and fragments thereof to induce a specific immune response and to bind specific antibodies in a suitable animal or cell.
  • An "agonist” refers to a molecule that, when combined with human neural cell adhesion protein 31, can cause the protein to change, thereby regulating the activity of the protein.
  • An agonist may include a protein, a nucleic acid, a carbohydrate, or any other molecule that can bind human neural cell adhesion protein 31.
  • Antagonist refers to a molecule that can block or regulate the biological or immunological activity of human neural cell adhesion protein 31 when combined with human neural cell adhesion protein 31.
  • Antagonists and inhibitors may include proteins, nucleic acids, carbohydrates, or any other molecule that can bind human neural cell adhesion protein 31.
  • Regular refers to changes in the function of human neural cell adhesion protein 31, including protein activity Increasing or decreasing, changes in binding properties, and any other biological, functional, or immune properties of human neural cell adhesion protein 31.
  • substantially pure means substantially free of other proteins, lipids, sugars or other substances with which it is naturally associated.
  • Those skilled in the art can purify human neural cell adhesion protein 31 using standard protein purification techniques.
  • Substantially pure human neural cell adhesion protein 31 produces a single main band on a non-reducing polyacrylamide gel.
  • the purity of human neural cell adhesion protein 31 can be analyzed by amino acid sequence analysis.
  • Complementary refers to the natural binding of polynucleotides by base-pairing under conditions of acceptable salt concentration and temperature.
  • sequence C-T-G-A
  • complementary sequence G-A-C-T.
  • the complementarity between two single-stranded molecules may be partial or complete.
  • the degree of complementarity between nucleic acid strands has a significant effect on the efficiency and strength of hybridization between nucleic acid strands.
  • “Homology” refers to the degree of complementarity and can be partially homologous or completely homologous.
  • Partial homology refers to a partially complementary sequence that at least partially inhibits hybridization of a fully complementary sequence to a target nucleic acid. This inhibition of hybridization can be detected by performing hybridization (Southern imprinting or Northern blotting, etc.) under conditions of reduced stringency. Substantially homologous sequences or hybridization probes can compete and inhibit the binding of fully homologous sequences to the target sequence under conditions of reduced stringency. This does not mean that the conditions of reduced stringency allow non-specific binding, because the conditions of reduced stringency require that the two sequences bind to each other as a specific or selective interaction.
  • Percent identity refers to the percentage of sequences that are identical or similar in the comparison of two or more amino acid or nucleic acid sequences. The percent identity can be determined electronically, such as by the MEGALIGN program (Lasergene sof tware package, DNASTAR, Inc., Madi son Wis.). The MEGALIGN program can compare two or more sequences according to different methods, such as the Clus ter method (Higgins, DG and PM Sharp (1988) Gene 73: 237-244). 0 The Clus ter method groups each group by checking the distance between all pairs. The sequences are arranged in clusters. The clusters are then assigned in pairs or groups. The percent identity between two amino acid sequences such as sequence A and sequence B is calculated by the following formula:
  • the assay may be Jotun Hein percent identity between nucleic acid sequences Clus ter or a method well known in the art (Hein J., (1990) Methods in enzymology 183: 625-645) 0
  • Similarity refers to the degree of identical or conservative substitutions of amino acid residues at corresponding positions in the alignment of amino acid sequences.
  • Amino acids used for conservative substitutions such as negatively charged amino acids, may include aspartic acid and glutamic acid.
  • Amino acids; positively charged amino acids can include lysine and arginine; amino acids with similarly hydrophilic head groups that have no charge can include leucine, isoleucine, and valine; glycine Ammonia Acids and alanine; asparagine and glutamine; serine and threonine; phenylalanine and tyrosine.
  • Antisense refers to a nucleotide sequence that is complementary to a particular DNA or RM sequence.
  • Antisense strand refers to a nucleic acid strand that is complementary to a “sense strand.”
  • Derivative refers to HFP or a chemical modification of its nucleic acid. This chemical modification may be a substitution of a hydrogen atom with a fluorenyl, acyl or amino group. Nucleic acid derivatives can encode polypeptides that retain the main biological properties of natural molecules.
  • Antibody refers to a complete antibody molecule and its fragments, such as Fa,? ( ⁇ ') 2 and? It can specifically bind to the epitope of human neural cell adhesion protein 31.
  • a “humanized antibody” refers to an antibody in which the amino acid sequence of a non-antigen binding region is replaced to become more similar to a human antibody, but still retains the original binding activity.
  • isolated refers to the removal of a substance from its original environment (for example, its natural environment if it is naturally occurring).
  • a naturally-occurring polynucleotide or polypeptide is not isolated when it is present in a living thing, but the same polynucleotide or polypeptide is separated from some or all of the substances that coexist with it in the natural system.
  • Such a polynucleotide may be part of a certain vector, or such a polynucleotide or polypeptide may be part of a certain composition. Since the carrier or composition is not part of its natural environment, they are still isolated.
  • isolated refers to the separation of a substance from its original environment (if it is a natural substance, the original environment is the natural environment).
  • polynucleotides and polypeptides in a natural state in a living cell are not isolated and purified, but the same polynucleotides or polypeptides are separated and purified if they are separated from other substances in the natural state .
  • isolated human neural cell adhesion protein 31 means that human neural cell adhesion protein 31 is substantially free of other proteins, lipids, sugars, or other substances with which it is naturally associated. Those skilled in the art can purify human neural cell adhesion protein 31 using standard protein purification techniques. Substantially pure peptides produce a single main band on a non-reducing polyacrylamide gel. The purity of human neural cell adhesion protein 31 can be analyzed by amino acid sequence.
  • the present invention provides a new polypeptide, human nerve cell adhesion protein 31, which is basically composed of the amino acid sequence shown in SEQ ID NO. ⁇ 2 .
  • the polypeptide of the present invention may be a recombinant polypeptide, a natural polypeptide, or a synthetic polypeptide, and preferably a recombinant polypeptide.
  • the polypeptides of the present invention can be naturally purified products or chemically synthesized products, or can be produced from prokaryotic or eukaryotic hosts (eg, bacteria, yeast, higher plants, insects, and mammalian cells) using recombinant techniques. Depending on the host used in the recombinant production protocol, the polypeptide of the invention may be glycosylated, or it may be non-glycosylated. Polypeptides of the invention may also include or exclude starting methionine residues.
  • the invention also includes fragments, derivatives, and analogs of human neuronal adhesion protein 31.
  • fragment refers to a polypeptide that substantially maintains the same biological function or activity of human neural cell adhesion protein 31 of the present invention.
  • a fragment, derivative or analog of the polypeptide of the present invention may be: (I) a kind in which one or more amino acid residues are substituted with conservative or non-conservative amino acid residues (preferably conservative amino acid residues), and the substitution
  • the amino acid may or may not be encoded by a genetic codon; or ( ⁇ ) a type in which a group on one or more amino acid residues is replaced by another group to include a substituent; or ( ⁇ ⁇ )
  • Such a polypeptide sequence in which the mature polypeptide is fused with another compound such as a compound that prolongs the half-life of the polypeptide, such as polyethylene glycol
  • a polypeptide sequence in which an additional amino acid sequence is fused into the mature polypeptide (Such as the leader or secretory sequence or the sequence used to purify the polypeptide or protease sequence).
  • such fragments, derivatives and analogs are considered to be within the knowledge of those skilled in the art.
  • the present invention provides an isolated nucleic acid (polynucleotide), which basically consists of a polynucleotide encoding a polypeptide having the amino acid sequence of SEQ ID NO: 2.
  • the polynucleotide sequence of the present invention includes the nucleotide sequence of SEQ ID NO: 1.
  • the polynucleotide of the present invention is found from a CDM library of human fetal brain tissue. It contains a polynucleotide sequence of 3157 bases in length and its open reading frame 576-1424 encodes 282 amino acids.
  • this peptide has 96% homology with human nerve cell adhesion protein, and it can be deduced that the human nerve cell adhesion protein 31 has a similar structure and function as human nerve cell adhesion protein.
  • the polynucleotide of the present invention may be in the form of DNA or RNA.
  • DNA forms include cDNA, genomic DNA, or synthetic DNA.
  • DNA can be single-stranded or double-stranded.
  • DM can be coded or non-coded.
  • the coding region sequence encoding a mature polypeptide may be the same as the coding region sequence shown in SEQ ID NO: 1 or a degenerate variant.
  • a "degenerate variant" refers to a nucleic acid sequence encoding a protein or polypeptide having SEQ ID NO: 2 but different from the coding region sequence shown in SEQ ID NO: 1 in the present invention.
  • the polynucleotide encoding the mature polypeptide of SEQ ID NO: 2 includes: only the coding sequence of the mature polypeptide; the coding sequence of the mature polypeptide and various additional coding sequences; the coding sequence of the mature polypeptide (and optional additional coding sequences); Coding sequence.
  • polynucleotide encoding a polypeptide refers to a polynucleotide comprising the polypeptide and a polynucleotide comprising additional coding and / or non-coding sequences.
  • the invention also relates to variants of the polynucleotides described above, which encode polypeptides or fragments, analogs and derivatives of polypeptides having the same amino acid sequence as the invention.
  • Variants of this polynucleotide may be naturally occurring allelic variants or non-naturally occurring variants. These nucleotide variants include substitution variants Body, deletion variant, and insertion variant.
  • an allelic variant is an alternative form of a polynucleotide that may be a substitution, deletion, or insertion of one or more nucleotides, but does not substantially change the function of the polypeptide it encodes .
  • the invention also relates to a polynucleotide that hybridizes to the sequence described above (having at least 50%, preferably 70% identity, between the two sequences).
  • the present invention particularly relates to polynucleotides that can hybridize to the polynucleotides of the present invention under stringent conditions.
  • “strict conditions” means: (1) hybridization and elution at lower ionic strength and higher temperature, such as 0.2xSSC, 0.1% SDS, 60 ° C; or (2) Add denaturants during hybridization, such as 50% (v / v) formamide, 0.1% calf serum / 0.1% Fi col l, 42 ° C, etc .; or (3) only between two sequences Hybridization occurs only when the identity is at least 95%, and more preferably 97%.
  • the polypeptide encoded by the hybridizable polynucleotide has the same biological function and activity as the mature polypeptide shown in SEQ ID NO: 2.
  • nucleic acid fragments that hybridize to the sequences described above.
  • a "nucleic acid fragment” contains at least 10 nucleotides in length, preferably at least 20-30 nucleotides, more preferably at least 50-60 nucleotides, and most preferably at least 100 nuclei. Glycylic acid or more. Nucleic acid fragments can also be used in nucleic acid amplification techniques such as PCR to identify and / or isolate polynucleotides encoding human neural cell adhesion protein 31.
  • polypeptides and polynucleotides in the present invention are preferably provided in an isolated form and are more preferably purified to homogeneity.
  • the specific polynucleotide sequence encoding human neural cell adhesion protein 31 of the present invention can be obtained by various methods.
  • polynucleotides are isolated using hybridization techniques well known in the art. These techniques include, but are not limited to: 1) hybridization of probes to genomic or cDNA libraries to detect homologous polynucleotide sequences, and 2) antibody screening of expression libraries to detect cloned polynucleosides with common structural characteristics Acid fragments.
  • the DNA fragment sequence of the present invention can also be obtained by the following methods: 1) separating a double-stranded DNA sequence from genomic DNA; 2) chemically synthesizing a DM sequence to obtain the double-stranded DM of the polypeptide.
  • genomic DNA isolation is the least commonly used. Direct chemical synthesis of DNA sequences is often the method of choice. The more commonly used method is the isolation of cDNA sequences.
  • the standard method for isolating the cDNA of interest is to isolate mRM from donor cells that overexpress the gene and perform reverse transcription to form a plasmid or phage cDM library. There are many mature techniques for extracting mRM, and kits are also commercially available (Qiagene;).
  • the construction of cDNA libraries is also a common method (Sambrook, et al., Molecular Cloning, A Laboratory Manua, Cold Spruing Harbor Laboratory. New York, 1989).
  • Commercially available cDNA libraries are also available, such as different cDM libraries from Clontech. When polymerase reaction technology is used in combination, even very small expression products can be cloned.
  • the genes of the present invention can be co-selected from these cDNA libraries by conventional methods. These methods include (but are not limited to): (l) DNA-DNA or DNA-RNA hybridization; (2) the appearance or loss of marker gene function; (3) measurement Determine the level of human nerve cell adhesion protein 31 transcripts; (4) Detect the protein product of gene expression by immunological techniques or by measuring biological activity. The above methods can be used singly or in combination.
  • the probe used for hybridization is homologous to any part of the polynucleotide of the present invention, and its length is at least 10 nucleotides, preferably at least 30 nucleotides, more preferably At least 50 nucleotides, preferably at least 100 nucleotides.
  • the length of the probe is usually within 2000 nucleotides, preferably within 1000 nucleotides.
  • the probe used here is generally a DNA sequence chemically synthesized based on the gene sequence information of the present invention.
  • the genes or fragments of the present invention can of course be used as probes.
  • DNA probes can be labeled with radioisotopes, luciferin, or enzymes (such as alkaline phosphatase).
  • immunological techniques such as Western blotting, radioimmunoprecipitation, and enzyme-linked immunosorbent assay (ELISA) can be used to detect the protein products expressed by human neuronal adhesion protein 31 gene expression.
  • ELISA enzyme-linked immunosorbent assay
  • a method for amplification of DM / RM using PCR technology is preferably used to obtain the gene of the present invention.
  • the RACE method RACE-Rapid Amplification of cDNA Ends
  • the primers for PCR can be appropriately based on the polynucleotide sequence information of the present invention disclosed herein Select and synthesize using conventional methods.
  • the amplified DNA / RM fragments can be isolated and purified by conventional methods such as by gel electrophoresis.
  • polynucleotide sequence of the gene of the present invention or various DNA fragments and the like obtained as described above can be measured by a conventional method such as dideoxy chain termination method (Sanger et al. PNAS, 1977, 74: 5463-5467). Such polynucleotide sequences can also be determined using commercial sequencing kits and the like. In order to obtain the full-length cDNA sequence, sequencing needs to be repeated. Sometimes it is necessary to determine the cDNA sequence of multiple clones in order to splice into a full-length cDNA sequence.
  • the present invention also relates to a vector comprising the polynucleotide of the present invention, and a host cell produced by genetic engineering using the vector of the present invention or directly using human neural cell adhesion protein 31 coding sequence, and a method for producing the polypeptide of the present invention by recombinant technology. .
  • a polynucleotide sequence encoding human neural cell adhesion protein 31 may be inserted into a vector to constitute a recombinant vector containing the polynucleotide of the present invention.
  • vector refers to bacterial plasmids, phages, yeast plasmids, plant cell viruses, mammalian cell viruses such as adenoviruses, retroviruses, or other vectors well known in the art.
  • Vectors suitable for use in the present invention include, but are not limited to: T7 promoter-based expression vectors (Rosenberg, et al.
  • any plasmid and vector can be used to construct a recombinant expression vector.
  • An important feature of expression vectors is that they usually contain origins of replication, promoters, marker genes, and translational regulators. Pieces.
  • Methods known to those skilled in the art can be used to construct expression vectors containing a DNA sequence encoding human neuronal cell adhesion protein 31 and appropriate transcriptional / translational regulatory elements. These methods include in vitro recombinant DNA technology, DM synthesis technology, in vivo recombination technology, etc. (Sambroook, et al. Molecular Cloning, a Laboratory Manual, Cold Spiring Harbor Laboratory. New York, 1989).
  • the DNA sequence can be operably linked to an appropriate promoter in an expression vector to guide mRNA synthesis. Representative examples of these promoters are: the lac or trp promoter of E.
  • the expression vector also includes a ribosome binding site for translation initiation, a transcription terminator, and the like. Insertion of enhancer sequences into the vector will enhance its transcription in higher eukaryotic cells. Enhancers are cis-acting factors expressed by DM, usually about 10 to 300 base pairs, which act on promoters to enhance gene transcription. Examples include SV40 enhancers of 100 to 270 base pairs on the late side of the origin of replication, polyoma enhancers and adenovirus enhancers on the late side of the origin of replication.
  • the expression vector preferably contains one or more selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
  • selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
  • GFP fluorescent protein
  • tetracycline or ampicillin resistance for E. coli.
  • a polynucleotide encoding human neural cell adhesion protein 31 or a recombinant vector containing the polynucleotide can be transformed or transduced into a host cell to constitute a genetically engineered host cell containing the polynucleotide or the recombinant vector.
  • host cell refers to a prokaryotic cell, such as a bacterial cell; or a lower eukaryotic cell, such as a yeast cell; or a higher eukaryotic cell, such as a mammalian cell.
  • Escherichia coli, Streptomyces bacterial cells such as Salmonella typhimurium
  • fungal cells such as yeast
  • plant cells insect cells such as fly S 2 or Sf 9
  • animal cells such as CH0, COS or Bowes melanoma cells, etc. .
  • Transformation of a host cell with a DNA sequence according to the present invention or a recombinant vector containing the MA sequence can be performed using conventional techniques well known to those skilled in the art.
  • the host is a prokaryote such as E. coli
  • competent cells capable of absorbing DM may be in exponential growth phase were harvested after treatment with 0 & (Method 12, using the procedure well known in the art. Alternatively, it is a MgCl 2. If necessary, transformation can also be performed by electroporation.
  • the host is a eukaryotic organism, the following DM transfection methods can be used: calcium phosphate co-precipitation method, or conventional mechanical methods such as microinjection, electroporation, and liposomes Packaging, etc.
  • the polynucleotide sequence of the present invention can be used to express or produce recombinant human neural cell adhesion protein 31 (Science, 1984; 224: 1431). Generally there are the following steps:
  • the medium used in the culture may be selected from various conventional mediums. Culture is performed under conditions suitable for host cell growth. After the host cells have grown to an appropriate cell density, the selected promoter is induced by a suitable method (such as temperature conversion or chemical induction), and the cells are cultured for a period of time.
  • a suitable method such as temperature conversion or chemical induction
  • the recombinant polypeptide may be coated in a cell, expressed on a cell membrane, or secreted outside the cell. If necessary, the recombinant protein can be isolated and purified by various separation methods using its physical, chemical and other properties. These methods are well known to those skilled in the art. These methods include, but are not limited to: conventional renaturation treatment, protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid chromatography (HPLC) and various other liquid chromatography techniques and combinations of these methods.
  • conventional renaturation treatment protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid
  • polypeptides of the present invention as well as antagonists, agonists and inhibitors of the polypeptides, can be directly used in the treatment of diseases, for example, they can treat malignant tumors, adrenal deficiency, skin diseases, various types of inflammation, HIV infection, and immune diseases.
  • the axon-related cell adhesion molecules play a very important regulatory role in the formation, maintenance and function of neurons.
  • These protein molecules constitute an independent protein family in the body, namely the axon cell adhesion protein family.
  • This protein family is a subclass of the immunoglobulin superfamily. Its members have similar structural and functional characteristics and are involved in the formation, maintenance, and normal physiological activity of the cerebral nervous system in the body.
  • the cell adhesion molecule BIG-2 of the polypeptide of the present invention and mouse axon is a human nerve cell adhesion protein, and contains a characteristic sequence of the axon-related cell adhesion molecule BIG-2 family. Similar biological functions. It plays a very important regulatory role in various biological processes such as nerve cell growth, cell clustering, neural signal transduction, signal recognition, and synapse formation. Its abnormal expression is usually related to many important nervous system development and growth regulation processes and the generation of neuropsychiatric diseases.
  • human nerve cell adhesion protein 31 of the present invention will produce various diseases, especially neurological developmental diseases, neuropsychiatric diseases, and other neurological diseases. These diseases include, but are not limited to:
  • neural tube insufficiency such as spina bifida, anencephaly, brain (meningeal) bulge, craniocerebral, neural tube cysts
  • brain developmental deformities such as foramen malformations, total forebrain, hydrocephalus deformities
  • Neuronal migration disorders such as abnormal brain gyrus formation
  • other malformations such as aqueduct malformations, cerebellar dysplasia, Down syndrome, spinal deformity, congenital hydrocephalus, congenital cerebellar dysplasia syndrome
  • Nervous system degenerative diseases Alzheimer's disease, Parkinson's disease, chorea, depression, amnesia, Huntington's disease, epilepsy, migraine, dementia, multiple sclerosis
  • Cerebrovascular disease transient ischemic attack, cerebral infarction, cerebral hemorrhage, subarachnoid hemorrhage
  • Psychiatric disorders schizophrenia, depressive disorder, paranoia, anxiety, obsessive-compulsive disorder, phobia, neurasthenia
  • Intracranial space-occupying lesions glioma, meningiomas, neurofibromas, pituitary adenomas, intracranial granulomas
  • Neuromuscular diseases myasthenia gravis, spinal muscular atrophy, muscular pseudohypertrophy, Duchenne muscular dystrophy, tonic muscular dystrophy, myasthenia, bradykinesia, dystonia
  • Neurocutaneous Syndrome Neurofibromatosis, Nodular Sclerosis, Cerebral Trigeminal Neurohemangioma, Ataxia Capillary Dilatation
  • Peripheral nerve disease trigeminal neuralgia, facial nerve palsy, bulbar palsy, sciatica, Guillain-Barre syndrome
  • human nerve cell adhesion protein 31 of the present invention will also produce certain hereditary, hematological diseases and the like.
  • polypeptides of the present invention can be directly used in the treatment of diseases, for example, can treat various diseases, especially neurological developmental diseases, neuropsychiatric diseases, other neurological diseases, Certain hereditary diseases, etc.
  • the invention also provides screening compounds to identify those that enhance (agonist) or suppress (antagonist) human nerve cells.
  • Method of medicament for lectin 31 Agonists enhance biological functions such as human neural cell adhesion protein 31 to stimulate cell proliferation, while antagonists prevent and treat disorders related to cell proliferation, such as various cancers.
  • mammalian cells or membrane preparations expressing human neural cell adhesion protein 31 can be cultured together with labeled human neural cell adhesion protein 31 in the presence of a drug. The ability of the drug to increase or block this interaction is then determined.
  • Antagonists of human nerve cell adhesion protein 31 include antibodies, compounds, receptor deletions, and the like that have been screened. Antagonists of human nerve cell adhesion protein 31 can bind to human nerve cell adhesion protein 31 and eliminate its function, or inhibit the production of the polypeptide, or bind to the active site of the polypeptide so that the polypeptide cannot perform biological functions.
  • human nerve cell adhesion protein 31 can be added to the bioanalytical assay to determine whether the compound is an antagonist by measuring the effect of the compound on the interaction between human nerve cell adhesion protein 31 and its receptor. .
  • Receptor deletions and analogs that act as antagonists can be screened in the same way as for screening compounds described above.
  • Polypeptide molecules capable of binding to human neural cell adhesion protein 31 can be obtained by screening a random peptide library composed of various possible combinations of amino acids bound to a solid phase. When screening, human neural cell adhesion protein 31 molecules should generally be labeled.
  • the present invention provides a method for producing antibodies using polypeptides, and fragments, derivatives, analogs or cells thereof as antigens. These antibodies can be polyclonal or monoclonal antibodies.
  • the invention also provides antibodies against human neural cell adhesion protein 31 epitopes. These antibodies include (but are not limited to): polyclonal antibodies, monoclonal antibodies, chimeric antibodies, single chain antibodies, Fab fragments, and fragments generated from Fab expression libraries.
  • Polyclonal antibodies can be produced by injecting human nerve cell adhesion protein 31 directly into immunized animals (such as rabbits, mice, rats, etc.).
  • immunized animals such as rabbits, mice, rats, etc.
  • a variety of adjuvants can be used to enhance the immune response, including but not limited to Freund's adjuvant. Wait.
  • Techniques for preparing monoclonal antibodies to human neuronal adhesion protein 31 include, but are not limited to, hybridoma technology (Kohler and Mistein. Nature, 1975, 256: 495-497), triple tumor technology, human beta-cell hybridoma technology, EBV-hybridoma technology, etc.
  • Chimeric antibodies that bind human constant regions and non-human-derived variable regions can be produced using existing techniques (Morrison et al, PNAS, 1985, 81: 6851).
  • the existing technology for producing single-chain antibodies (U.S. Pat No. 4946778) can also be used to produce single-chain antibodies against human neural cell adhesion protein 31.
  • Antibodies against human nerve cell adhesion protein 31 can be used in immunohistochemical techniques to detect human nerve cell adhesion protein 31 in biopsy specimens.
  • Monoclonal antibodies that bind to human neural cell adhesion protein 31 can also be labeled with radioisotopes and injected into the body to track their location and distribution.
  • This radiolabeled antibody can be used as a non-invasive diagnostic
  • the cutting method is used to locate tumor cells and determine whether there is metastasis.
  • Antibodies can also be used to design immunotoxins that target a particular part of the body.
  • human nerve cell adhesion protein 31 high-affinity monoclonal antibodies can covalently bind to bacterial or phytotoxins (such as diphtheria toxin, ricin, ormosine, etc.).
  • a common method is to attack the amino group of an antibody with a thiol cross-linking agent such as SPDP and bind the toxin to the antibody through the exchange of disulfide bonds.
  • This hybrid antibody can be used to kill human neural cell adhesion protein 31-positive cells .
  • the antibodies of the present invention can be used to treat or prevent diseases related to human neural cell adhesion protein 31.
  • Administration of an appropriate dose of the antibody can stimulate or block the production or activity of human neural cell adhesion protein 31.
  • the invention also relates to a diagnostic test method for quantitative and localized detection of human nerve cell adhesion protein 31 levels.
  • tests are well known in the art and include FISH assays and radioimmunoassays.
  • the levels of human nerve cell adhesion protein 31 detected in the test can be used to explain the importance of human nerve cell adhesion protein 31 in various diseases and to diagnose diseases in which human nerve cell adhesion protein 31 plays a role.
  • polypeptide of the present invention can also be used for peptide mapping analysis.
  • the polypeptide can be specifically cleaved by physical, chemical or enzymatic analysis, and subjected to one-dimensional or two-dimensional or three-dimensional gel electrophoresis analysis, and more preferably mass spectrometry analysis.
  • the polynucleotide encoding human neural cell adhesion protein 31 can also be used for a variety of therapeutic purposes. Gene therapy technology can be used to treat abnormal cell proliferation, development or metabolism caused by the non-expression or abnormal / inactive expression of human neural cell adhesion protein 31.
  • Recombinant gene therapy vectors (such as viral vectors) can be designed to express mutated human neuronal adhesion protein 31 to inhibit endogenous human neuronal adhesion protein 31 activity.
  • a mutated human nerve cell adhesion protein 31 may be shortened human nerve cell adhesion protein 31 lacking a signal transduction domain. Although it can bind to downstream substrates, it lacks signal transduction activity.
  • the recombinant gene therapy vector can be used for treating diseases caused by abnormal expression or activity of human neural cell adhesion protein 31.
  • Virus-derived expression vectors such as retrovirus, adenovirus, adenovirus-associated virus, herpes simplex virus, parvovirus, etc. can be used to transfer a polynucleotide encoding human neural cell adhesion protein 31 into cells.
  • Methods for constructing recombinant viral vectors carrying a polynucleotide encoding human neural cell adhesion protein 31 can be found in the literature (Sambrook, et al.).
  • a recombinant polynucleotide encoding human neural cell adhesion protein 31 can be packaged into liposomes and transferred into cells.
  • Methods for introducing a polynucleotide into a tissue or cell include: directly injecting the polynucleotide into a tissue in vivo; or introducing the polynucleotide into a cell in vitro through a vector (such as a virus, phage, or plasmid), and then transplanting the cell Into the body and so on.
  • a vector such as a virus, phage, or plasmid
  • Oligonucleotides including antisense RNA and DNA
  • ribozymes that inhibit human neural cell adhesion protein 31 mRNA are also within the scope of the present invention.
  • a ribozyme is an enzyme-like RNA component that specifically breaks down specific RMs. The mechanism of action is that the ribozyme molecule specifically hybridizes with a complementary target RM to perform endonucleation.
  • Antisense MA, DM, and ribozymes can be obtained by any existing RNA or DM synthesis technology, such as the technology for the synthesis of oligonucleotides by solid-phase phosphate amide chemical synthesis, which is widely used.
  • Antisense RM molecules can be obtained by in vitro or in vivo transcription of a DNA sequence encoding the RNA. This DM sequence has been integrated downstream of the vector's RNA polymerase promoter. In order to increase the stability of a nucleic acid molecule, it can be modified in a variety of ways, such as increasing the sequence length on both sides, and the ribonucleoside linkages should use phosphate thioester or peptide bonds instead of phosphodiester bonds.
  • the polynucleotide encoding human neural cell adhesion protein 31 can be used for the diagnosis of diseases related to human neural cell adhesion protein 31.
  • the polynucleotide encoding human neural cell adhesion protein 31 can be used to detect the expression of human neural cell adhesion protein 31 or the abnormal expression of human neural cell adhesion protein 31 in a disease state.
  • the DNA sequence encoding human nerve cell adhesion protein 31 can be used to hybridize biopsy specimens to determine the expression of human nerve cell adhesion protein 31.
  • Hybridization techniques include Southern blotting, Nor thern blotting, and in situ hybridization. These techniques and methods are publicly available and mature, and the relevant kits are commercially available.
  • a part or all of the polynucleotides of the present invention can be used as probes to be fixed on a microarray or a DNA chip (also called a "gene chip") for analyzing differential expression analysis of genes and genetic diagnosis in tissues.
  • Human nerve cell adhesion protein 31 specific primers for RNA-polymerase chain reaction (RT-PCR) amplification in vitro can also detect the transcription of human nerve cell adhesion protein 31. Detection of mutations in human nerve cell adhesion protein 31 gene can also be used to diagnose Nerve cell adhesion protein 31 related diseases.
  • Human neural cell adhesion protein 31 mutations include point mutations, translocations, deletions, recombinations, and any other abnormalities compared to normal wild-type human neural cell adhesion protein 31 DNA sequences. Mutations can be detected using existing techniques such as Southern blotting, DNA sequence analysis, PCR and in situ hybridization. In addition, mutations may affect protein expression. Therefore, the Nor thern blotting and Western blotting can be used to indirectly determine whether a gene is mutated.
  • sequences of the invention are also valuable for chromosome identification. This sequence will specifically target a specific position on a human chromosome and can hybridize to it. Currently, specific sites for each gene on the chromosome need to be identified. Currently, only a few chromosome markers based on actual sequence data (repeating polymorphisms) are available for marking chromosome positions. According to the present invention, in order to associate these sequences with disease-related genes, an important first step is to locate these DNA sequences on a chromosome.
  • the PCR primers (preferably 15-35bp) are prepared based on cDNA, and the sequence can be located on the chromosome. These primers were then used for PCR screening of somatic hybrid cells containing individual human chromosomes. Only those hybrid cells that contain the human gene corresponding to the primer will produce amplified fragments. PCR localization of somatic hybrid cells is a quick way to localize DNA to specific chromosomes. Using the oligonucleotide primers of the present invention, by a similar method, a set of fragments from a specific chromosome or a large number of genomic clones can be used to achieve sublocalization. Other similar strategies that can be used for chromosomal localization include in situ hybridization, chromosome pre-screening with labeled flow sorting, and hybrid pre-selection to construct a chromosome-specific CDM library.
  • Fluorescent in situ hybridization of cDNA clones with metaphase chromosomes allows precise chromosomal localization in one step.
  • FISH Fluorescent in situ hybridization
  • the difference in cDM or genomic sequence between the affected and unaffected individuals needs to be determined. If a mutation is observed in some or all diseased individuals and the mutation is not observed in any normal individuals, the mutation may be the cause of the disease. Comparing affected and unaffected individuals usually involves first looking for structural changes in chromosomes, such as deletions or translocations that are visible at the chromosomal level or detectable with cDNA sequence-based PCR. According to the resolution capabilities of current physical mapping and gene mapping technology, the CDM that is accurately mapped to a disease-related chromosomal region can be one of 50 to 500 potentially pathogenic genes (assuming 1 megabase mapping resolution) Capacity and each 20kb corresponds to a gene).
  • the polypeptides, polynucleotides and mimetics, agonists, antagonists and inhibitors of the present invention can be used in combination with a suitable pharmaceutical carrier.
  • suitable pharmaceutical carrier can be water, glucose, ethanol, salts, buffers, glycerol, and combinations thereof.
  • the composition comprises a safe and effective amount of the polypeptide or antagonist, and carriers and excipients which do not affect the effect of the drug. These compositions can be used as drugs for the treatment of diseases.
  • the invention also provides a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the invention.
  • a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the invention.
  • these containers there may be instructional instructions given by government agencies that manufacture, use, or sell pharmaceuticals or biological products, which prompts permission for administration on the human body by government agencies that produce, use, or sell.
  • the polypeptides of the invention can be used in combination with other therapeutic compounds.
  • the pharmaceutical composition can be administered in a convenient manner, such as by a topical, intravenous, intraperitoneal, intramuscular, subcutaneous, intranasal or intradermal route of administration.
  • Human neural cell adhesion protein 31 is administered in an amount effective to treat and / or prevent a specific indication. Amount and agent of human neuronal adhesion protein 31 administered to a patient The amount range will depend on many factors, such as the mode of administration, the health conditions of the person to be treated, and the judgment of the diagnostician. Examples
  • Total human fetal brain RNA was extracted by one-step method with guanidine isothiocyanate / phenol / chloroform.
  • Poly (A) mRNA was isolated from total RNA using Quik mRNA Isolat ion Kit (product of Qiegene). 2ug poly (A) mRNA is reverse transcribed to form cDNA.
  • a Smart cDNA cloning kit purchased from Clontech ⁇ cDNA fragment was inserted into the multicloning site of pBSK (+) vector (Clontech)) to transform DH5 ⁇ to form a CDM library.
  • Dye terminate cycle react ion sequencing ki t Perkin-Elmer
  • ABI 377 automatic sequencer Perkin-Elmer
  • the determined c, DM sequences were compared with a public database of common DM sequences (Genebank ), The result showed that one of the clones 0865c01 cDNA sequence was new DNA.
  • a series of primers were synthesized to determine the inserted cDNA fragment in both directions.
  • the sequence of the human neural cell adhesion protein 31 of the present invention and the protein sequence encoded by the same were performed using the Blast program (Basic local al ignment search tool) [Al tschul, SF et al. L Mol. Biol. 1990; 215: 403- 10].
  • the gene with the highest homology to the human nerve cell adhesion protein 31 of the present invention is a known human nerve cell adhesion protein, and the encoded number of the protein encoded in Genbank is (135371.
  • the results of protein homology are shown in FIG. 1 , The two are highly homologous, with an identity of 96% and a similarity of 98%.
  • Example 3 Cloning of a gene encoding human neural cell adhesion protein 31 by RT-PCR
  • the total RM of fetal brain cells was used as a template, and ol igo-dT was used as a primer for reverse transcription reaction to synthesize cDM. After purification by Qiagene's kit, PCR was performed using the following primers:
  • Primer 1 5 — — ATAGGGTAATGGGTACCGGCCCCC —3, (SEQ ID NO: 3)
  • Primer2 5,-AATGACAGAATATTTATTAACAAT -3, (SEQ ID NO: 4)
  • Primerl is a forward sequence located at the 5th end of SEQ ID NO: 1, starting at lbp;
  • Primer 2 is the 3, terminal reverse sequence of SEQ ID NO: 1.
  • a reaction volume of 50 ⁇ 1 contains 50 mmol / L KCl, l (tomol / L Tri s-HCl pH 8. 5, 1. 5 mmol / L MgCl 2 , 200 mol / L dNTP, lOpmol primer, 1U Taq DNA polymerase (Clontech).
  • the reaction was performed on a PE9600 DNA thermal cycler (Perkin-Elmer) for 25 cycles under the following conditions: 94 ° C 30sec; 55. C 30sec; 72 ° C 2min.
  • This method involves acid guanidinium thiocyanate phenol-chloroform extraction. That is, the tissue is homogenized with 4M guanidine isothiocyanate-25mM sodium citrate, 0.2M sodium acetate (pH4.0).
  • A- 32 P dATP was used to prepare 32 P-labeled DNA probes by random primers.
  • the DM probe used was the human neural cell adhesion protein 31 coding region sequence amplified by PCR as shown in Figure 1. (576bp to 1424bp).
  • a 32P-labeled probe (about 2 x 10 6 cpm / ml) was hybridized with a nitrocellulose membrane to which RNA was transferred at 42 ° C overnight in a solution containing 50% formamide -25raM KH 2 P0 4 ( ⁇ 7.4)-5 x SSC- 5 x Denhardt, s solution and 200 ⁇ ⁇ / ⁇ 1 salmon sperm DNA. After hybridization, the filter was placed in 1x SSC- 0.1% SDS at 55. Wash for 30 min at C. Then, analyze and quantify with Phosphor Imager.
  • Example 5 In vitro expression, isolation and purification of recombinant human neural cell adhesion protein 31
  • the Nhel and BamHI restriction sites correspond to the expression vectors on the expression vector plasmid pET- 2 8b (+) (Novagen, Cat. No. 69865. 3). Selective endonuclease site.
  • the pBS-0865c01 plasmid containing the full-length target gene was used as a template for the PCR reaction.
  • the PCR reaction conditions were as follows: a total volume of 50 ⁇ 1 containing 10 pg of pBS-0865c01 plasmid, primers Primer-3 and Primer-4 were lOpmol, Advantage polymerase Mix (Clontech) 1 ⁇ 1, respectively.
  • Cycle parameters 94 ° C 20s, 60 ° C 30s, 68 ° C 2 rain, a total of 25 cycles.
  • Nhel and BamHI were used to double digest the amplified product and plasmid pET-28 (+), respectively, and large fragments were recovered and ligated with T4 ligase.
  • Ligation products were transformed by the calcium chloride method Escherichia bacteria DH5 a, the (final concentration of 30 ⁇ ⁇ / ⁇ 1) LB plates incubated overnight positive clones by colony PCR method containing kanamycin, and sequenced.
  • a positive clone (pET-0865c01) with the correct sequence was selected, and the recombinant plasmid was transformed into E.
  • coli BL21 (DE3) plySs (product of Novagen) using the calcium chloride method.
  • host strain BL21 P ET-0865c01
  • IPTG IPTG
  • the bacteria were collected by centrifugation, and the supernatant was collected by centrifugation. The supernatant was collected by centrifugation. The affinity chromatography column His. Bind Quick Cartridge (product of Novagen) was used to obtain 6 Purified human nerve cell adhesion protein 31.
  • the following peptides specific for human neural cell adhesion protein 31 were synthesized using a peptide synthesizer (product of PE company): NH2-Met-I le-Trp-Met-Leu-Thr-Val-Leu-Ala-Ser-Ala-Asp- Ala-Ser-Arg-C00H (SEQ ID NO: 7).
  • the polypeptide is coupled to hemocyanin and bovine serum albumin to form a complex, respectively.
  • Suitable oligonucleotide fragments selected from the polynucleotides of the present invention are used as hybridization probes in a variety of ways.
  • the probes can be used to hybridize to genomic or cDNA libraries of normal tissue or pathological tissue from different sources to It is determined whether it contains the polynucleotide sequence of the present invention and a homologous polynucleotide sequence is detected.
  • the probe can be used to detect the polynucleotide sequence of the present invention or its homologous polynucleotide sequence in normal tissue or pathology. Whether the expression in tissue cells is abnormal.
  • the purpose of this embodiment is to select a suitable oligonucleotide fragment from the polynucleotide SEQ ID NO: 1 of the present invention as a hybridization probe, and to identify whether some tissues contain the polynucleoside of the present invention by using a filter hybridization method.
  • Filter hybridization methods include dot blotting, Southern imprinting, Northern blotting, and copying methods. They all use the same steps to immobilize the polynucleotide sample to be tested on the filter.
  • the sample-immobilized filter is first pre-hybridized with a probe-free hybridization buffer to saturate the non-specific binding site of the sample on the filter with the carrier and the synthesized polymer.
  • the pre-hybridization solution is then replaced with a hybridization buffer containing labeled probes and incubated to hybridize the probes to the target nucleic acid.
  • the unhybridized probes are removed by a series of membrane washing steps.
  • This embodiment uses higher-intensity washing conditions (such as lower salt concentration and higher temperature), so that the hybridization background is reduced and only strong specific signals are retained.
  • the probes used in this embodiment include two types: the first type of probes are oligonucleotide fragments that are completely the same as or complementary to the polynucleotide SEQ ID NO: 1 of the present invention; the second type of probes are partially related to the present invention
  • the polynucleotide SEQ ID NO: 1 is the same or complementary oligonucleotide fragment.
  • the dot blot method is used to fix the sample on the filter membrane. Under the high-intensity washing conditions, the first type of probe and the sample have the strongest hybridization specificity and are retained.
  • oligonucleotide fragments from the polynucleotide SEQ ID NO: 1 of the present invention for use as hybridization probes should follow the following principles and several aspects to be considered:
  • the preferred range of probe size is 18-50 nucleotides
  • GC content is 30% -70%, if it exceeds, non-specific hybridization increases
  • Those that meet the above conditions can be used as primary selection probes, and then further computer sequence analysis, including the primary selection probe and its source sequence region (ie, SEQ ID NO: 1) and other unknown genomic sequences and their complements The regions are compared for homology. If the homology with the non-target molecular region is greater than 85% or there are more than 15 consecutive bases, then the primary probe should not be used;
  • Probe 1 which belongs to the first type of probe, is completely homologous or complementary to the gene fragment of SEQ ID NO: 1 (41Nt):
  • Probe 2 which belongs to the second type of probe, is equivalent to the replacement mutant sequence of the gene fragment of SEQ ID NO: 1 or its complementary fragment (41Nt):
  • PBS phosphate buffered saline
  • step 8-13 are only used when contamination must be removed, otherwise step 14 can be performed directly.
  • NC membranes nitrocellulose membranes
  • Two NC membranes are required for each probe, so that they can be used in the following experimental steps.
  • the film was washed with high-strength conditions and strength conditions, respectively.
  • the 32 P-Probe (the second peak is free ⁇ - 32 P-dATP) is prepared.
  • the sample membrane was placed in a plastic bag, and 3-1 Orag pre-hybridization solution (1 OxDenhardt's; 6xSSC, 0.1 mg / ml CT DNA (calf thymus DM)) was added. After sealing the mouth of the bag, shake at 68 ° C for 2 hours.
  • 3-1 Orag pre-hybridization solution (1 OxDenhardt's; 6xSSC, 0.1 mg / ml CT DNA (calf thymus DM)

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Biochemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Toxicology (AREA)
  • Immunology (AREA)
  • Biophysics (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Medicinal Chemistry (AREA)
  • Molecular Biology (AREA)
  • Zoology (AREA)
  • Cell Biology (AREA)
  • Peptides Or Proteins (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Abstract

L'invention concerne un nouveau polypeptide, une protéine humaine 31 d'adhésion des cellules nerveuses, et un polynucléotide codant ce polypeptide ainsi qu'un procédé d'obtention de ce polypeptide par des techniques recombinantes d'ADN. L'invention concerne en outre les applications de ce polypeptide dans le traitement de maladies, notamment des pathologies du développement du système nerveux, des maladies neuropsychologiques et d'autres maladies du système nerveux. L'invention concerne aussi l'antagoniste agissant contre le polypeptide et son action thérapeutique ainsi que les applications de ce polynucléotide codant la protéine humaine 31 d'adhésion des cellules nerveuses.
PCT/CN2001/000793 2000-05-16 2001-05-14 Nouveau polypeptide, proteine humaine 31 d'adhesion des cellules nerveuses, et polynucleotide codant ce polypeptide WO2001090170A1 (fr)

Priority Applications (1)

Application Number Priority Date Filing Date Title
AU76246/01A AU7624601A (en) 2000-05-16 2001-05-14 A novel polypeptide, a human neural cell adhesion protein 31 and the polynucleotide encoding the polypeptide

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
CN 00115688 CN1323806A (zh) 2000-05-16 2000-05-16 一种新的多肽——人神经细胞粘连蛋白31和编码这种多肽的多核苷酸
CN00115688.8 2000-05-16

Publications (1)

Publication Number Publication Date
WO2001090170A1 true WO2001090170A1 (fr) 2001-11-29

Family

ID=4585132

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/CN2001/000793 WO2001090170A1 (fr) 2000-05-16 2001-05-14 Nouveau polypeptide, proteine humaine 31 d'adhesion des cellules nerveuses, et polynucleotide codant ce polypeptide

Country Status (3)

Country Link
CN (1) CN1323806A (fr)
AU (1) AU7624601A (fr)
WO (1) WO2001090170A1 (fr)

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4955892A (en) * 1988-10-24 1990-09-11 Louisiana State University Neural cell adhesion protein nerve prosthesis

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4955892A (en) * 1988-10-24 1990-09-11 Louisiana State University Neural cell adhesion protein nerve prosthesis

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
DATABASE GENBANK [online] 8 October 1995 (1995-10-08), YOSHIHARA Y. ET AL., Database accession no. U35371 *
KOBAYASHI HD. ET AL., J. PEDIATR. GASTROENTEROL. NUTR., vol. 20, no. 3, April 1995 (1995-04-01), pages 319 - 325 *
LANTUEJOUL S. ET AL., HUM. PATHOL., vol. 31, no. 4, April 2000 (2000-04-01), pages 415 - 421 *
MOLENAAR W.M. ET AL., HUM. PATHOL., vol. 30, no. 10, October 1999 (1999-10-01), pages 1207 - 1212 *

Also Published As

Publication number Publication date
AU7624601A (en) 2001-12-03
CN1323806A (zh) 2001-11-28

Similar Documents

Publication Publication Date Title
WO2002026972A1 (fr) Nouveau polypeptide, proteine humaine 20.13 de liaison de l'acide polyadenylique, et polynucleotide codant ce polypeptide
WO2001090170A1 (fr) Nouveau polypeptide, proteine humaine 31 d'adhesion des cellules nerveuses, et polynucleotide codant ce polypeptide
WO2001075103A1 (fr) Nouveau polypeptide, proteine humaine 9 de toxine de scorpion a chaine courte, et polynucleotide codant pour ce polypeptide
WO2001079432A2 (fr) Nouveau polypeptide, facteur humain de transcription de la differentiation cellulaire 58, et polynucleotide codant pour ce polypeptide
WO2002026810A1 (fr) Nouveau polypeptide, substance proteique p125-77.22, et polynucleotide codant ce polypeptide
WO2001049727A1 (fr) Nouveau polypeptide, transducteur de signal 9 a effet chemotactique de bacteries, et polynucleotide codant pour ce polypeptide
WO2001092286A1 (fr) Nouveau polypeptide, proteine humaine 48 de liaison oct, et polynucleotide codant ce polypeptide
WO2001075048A2 (fr) Nouveau polypeptide, proteine ribosomale humaine s11 23, et polynucleotide codant pour ce polypeptide
WO2001090348A1 (fr) Nouveau polypeptide, chaine lourde de myoglobuline humaine 11, et polynucleotide codant ce polypeptide
WO2001046409A1 (fr) Nouveau polypeptide, proteine ribosomale s7 9, et polynucleotide codant pour ce polypeptide
WO2001055417A1 (fr) Nouveau polypeptide, proteine a f-box 65, et polynucleotide codant pour ce polypeptide
WO2001094371A1 (fr) Nouveau polypeptide, proteine ribosomale humaine s4-10, et polynucleotide codant ce polypeptide
WO2001055374A1 (fr) Nouveau polypeptide, sequence 71 de multirepetition de la leucine, et polynucleotide codant pour ce polypeptide
WO2001047977A1 (fr) Nouveau polypeptide, proteine p0 9, et polynucleotide codant pour ce polypeptide
WO2001049739A1 (fr) Nouveau polypeptide, la proteine po 14 de la myeline, et polynucleotide le codant
WO2001055372A1 (fr) Nouveau polypeptide, proteine humaine tnfr/ngfr 10, et polynucleotide codant pour ce polypeptide
WO2001074895A1 (fr) Nouveau polypeptide, facteur humain de transcription de la differentiation cellulaire 12.1, et polynucleotide codant pour ce polypeptide
WO2002000698A1 (fr) Nouveau polypeptide, proteine humaine 12 de transport de l'acide phosphorique, et polynucleotide codant ce polypeptide
WO2001083544A1 (fr) Nouveau polypeptide, proteine pax humaine 18, et polynucleotide codant pour ce polypeptide
WO2001048003A1 (fr) Nouveau polypeptide, amyloide glycoproteine 10, et polynucleotide codant pour ce polypeptide
WO2001055406A1 (fr) Nouveau polypeptide, adn polymerase iii 18, et polynucleotide codant pour ce polypeptide
WO2001047985A1 (fr) Nouveau polypeptide, proteine kinase c-13, et polynucleotide codant pour ce polypeptide
WO2001087971A1 (fr) Proteine s18-14 ribosomale, polypeptide humain, et polynucleotide la codant
WO2001066576A1 (fr) Nouveau polypeptide, glycoproteine amyloidogenique humaine 11, et polynucleotide codant pour ce polypeptide
WO2001075024A2 (fr) Nouveau polypeptide, facteur humain 13 associe a nf-e2, et polynucleotide codant pour ce polypeptide

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CO CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
REG Reference to national code

Ref country code: DE

Ref legal event code: 8642

122 Ep: pct application non-entry in european phase
NENP Non-entry into the national phase

Ref country code: JP