WO2001055406A1 - Nouveau polypeptide, adn polymerase iii 18, et polynucleotide codant pour ce polypeptide - Google Patents

Nouveau polypeptide, adn polymerase iii 18, et polynucleotide codant pour ce polypeptide Download PDF

Info

Publication number
WO2001055406A1
WO2001055406A1 PCT/CN2001/000071 CN0100071W WO0155406A1 WO 2001055406 A1 WO2001055406 A1 WO 2001055406A1 CN 0100071 W CN0100071 W CN 0100071W WO 0155406 A1 WO0155406 A1 WO 0155406A1
Authority
WO
WIPO (PCT)
Prior art keywords
polypeptide
polynucleotide
dna polymerase
sequence
dna
Prior art date
Application number
PCT/CN2001/000071
Other languages
English (en)
Chinese (zh)
Inventor
Yumin Mao
Yi Xie
Original Assignee
Biodoor Gene Technology Ltd. Shanghai
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Biodoor Gene Technology Ltd. Shanghai filed Critical Biodoor Gene Technology Ltd. Shanghai
Priority to AU2001231485A priority Critical patent/AU2001231485A1/en
Publication of WO2001055406A1 publication Critical patent/WO2001055406A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/10—Transferases (2.)
    • C12N9/12—Transferases (2.) transferring phosphorus containing groups, e.g. kinases (2.7)
    • C12N9/1241—Nucleotidyltransferases (2.7.7)
    • C12N9/1252—DNA-directed DNA polymerase (2.7.7.7), i.e. DNA replicase

Definitions

  • the present invention belongs to the field of biotechnology. Specifically, the present invention describes a novel polypeptide, a DNA polymerase III, and a polynucleotide sequence encoding the polypeptide. The invention also relates to a method and application for preparing such polynucleotides and polypeptides. Background technique
  • E. coli DNA polymerase III (Pol III) holoenzyme is responsible for efficient and accurate replication of bacterial chromosomes (Kelman, Z., and M. O'Donnel. 1995. DNA polyraeraselll holoenzyme: structure and function of a chromosomal replicating machine. Amiu. Rev. Biochem. 64: 171-200).
  • the enzyme is a multi-subunit enzyme whose core enzyme has both polymerization and proofreading functions. Unlike other proofreading polymerases, the two functions of the enzyme are performed by two different subunits.
  • the ⁇ subunit has the aggregation function (dnaE gene product), 3'-5, and the exonuclease activity, ie, the proofreading function, is completed by the ⁇ subunit (dnaQ gene product).
  • the three subunits of the whole enzyme follow a linear pattern Permutations, ⁇ - ⁇ - ⁇ , ⁇ combine both ⁇ and ⁇ (Studwel l-Vaughan, PS, and M. O'Donnel 1.1993, DNA polymeraselll accessory prote ins. V. ⁇ encoded by holE. J. Biol.
  • the ⁇ subunit is composed of two different domains. One is the N-terminus containing an exonuclease cleavage site (also includes the ⁇ -binding site), and the other is the C-terminus required domain.
  • the C-terminal domain consists of three motif sequences: A, B, and C. There are about 280 amino acids.
  • T7 DNA polymerase and human 'DNA polymerase ⁇ motif sequence B one tyrosine is dideoxynucleotide sensitive (Longley, MJ, Ropp, PA, Lim, SE, and Copeland, WC1998. Characterization of the native and recomb inant catalytic subuni t of human DNA polymerase gamma: I dentif ication of residues critical for exonuclease activity and dideoxnucleotide sensitivity.
  • Abnormal expression of the C-terminus of DNA polymerase will cause but is not limited to the symptoms of the following diseases: gradual loss of blood cells, skeletal system disorders, growth and development disorders, hyperpigmentation of the skin, and primed cancer.
  • the polypeptides of the present inventors have the structural characteristics of the C-terminus of the DNA polymerase and belong to this family, and it is speculated that they have similar biological functions.
  • DM polymerase IIIII protein plays an important role in the important functions of the body as described above, and it is believed that a large number of proteins are involved in these regulatory processes, there has been a need in the art to identify more DNA polymerase III18 proteins involved in these processes. In particular, the amino acid sequence of this protein is identified.
  • the isolation of the new DM polymerase III18 protein encoding gene also provides a basis for research to determine the role of this protein in health and disease states. This protein may form the basis for the development of diagnostic and / or therapeutic drugs for diseases, so it is important to isolate its coding for DM. Disclosure of invention
  • An object of the present invention is to provide an isolated novel polypeptide, DNA polymerase III 18, and fragments and classes thereof.
  • Another object of the present invention is to provide a polynucleotide encoding the polypeptide.
  • Another object of the present invention is to provide a method for producing a DNA polymerase III.
  • Another object of the present invention is to provide an antibody against the polypeptide-DNA polymerase III18 of the present invention.
  • Another object of the present invention is to provide mimetic compounds, antagonists, agonists, and inhibitors of the DNA polymerase IIIII of the polypeptide of the present invention.
  • Another object of the present invention is to provide a method for diagnosing and treating diseases related to abnormalities of DNA polymerase III.
  • the present invention relates to an isolated polypeptide, which is of human origin, and includes: a polypeptide having the amino acid sequence of SEQ ID No. 2, or a conservative variant, biologically active fragment or derivative thereof.
  • the polypeptide is a polypeptide having the amino acid sequence of SEQ ID NO: 2.
  • the invention also relates to an isolated polynucleotide comprising a nucleotide sequence or a variant thereof selected from the group consisting of: (a) a polynucleotide encoding a polypeptide having the amino acid sequence of SEQ ID No. 2;
  • sequence of the polynucleotide is one selected from the group consisting of: (a) a sequence having positions 249-749 in SEQ ID NO: 1; and (b) a sequence having 1-845 in SEQ ID NO: 1 Sequence of bits.
  • the invention further relates to a vector, in particular an expression vector, containing the polynucleotide of the invention; a host cell genetically engineered with the vector, including a transformed, transduced or transfected host cell; and a method comprising culturing said Host cell and method of preparing the polypeptide of the present invention by recovering the expression product.
  • a vector in particular an expression vector, containing the polynucleotide of the invention
  • a host cell genetically engineered with the vector including a transformed, transduced or transfected host cell
  • a method comprising culturing said Host cell and method of preparing the polypeptide of the present invention by recovering the expression product.
  • the invention also relates to an antibody capable of specifically binding to a polypeptide of the invention.
  • the invention also relates to a method for screening compounds that mimic, activate, antagonize or inhibit the activity of a DNA polymerase III 18 protein, which comprises utilizing the polypeptide of the invention.
  • the invention also relates to compounds obtained by this method.
  • the invention also relates to a method for in vitro detection of a disease or disease susceptibility related to abnormal expression of a DNA polymerase IIIII protein, which comprises detecting a mutation in the polypeptide or a polynucleotide sequence encoding the same in a biological sample, or detecting a biological sample.
  • the amount or biological activity of a polypeptide of the invention comprises detecting a mutation in the polypeptide or a polynucleotide sequence encoding the same in a biological sample, or detecting a biological sample.
  • the present invention also relates to a pharmaceutical composition
  • a pharmaceutical composition comprising a polypeptide of the present invention or a mimetic thereof, an activator, an antagonist or an inhibitor, and a pharmaceutically acceptable carrier.
  • the present invention also relates to the use of the polypeptide and / or polynucleotide of the present invention in the preparation of a medicament for treating cancer, developmental disease or immune disease or other diseases caused by abnormal expression of DNA polymerase III 18.
  • Nucleic acid sequence refers to an oligonucleotide, a nucleotide or a polynucleotide and a fragment or part thereof, and may also refer to a genome or a synthetic DNA or RNA, they can be single-stranded or double-stranded, representing the sense or antisense strand.
  • amino acid sequence refers to an oligopeptide, peptide, polypeptide or protein sequence and a fragment or part thereof.
  • amino acid sequence in the present invention relates to the amino acid sequence of a naturally occurring protein molecule, such "polypeptide” or “protein” does not mean to limit the amino acid sequence to a complete natural amino acid related to the protein molecule .
  • a protein or polynucleotide “variant” refers to an amino acid sequence having one or more amino acids or nucleotide changes, or a polynucleotide sequence encoding it.
  • the changes may include deletions, insertions or substitutions of amino acids or nucleotides in the amino acid sequence or nucleotide sequence.
  • Variants may have "conservative" changes in which the substituted amino acid has a structural or chemical property similar to the original amino acid, such as replacing isoleucine with leucine.
  • Variants can also have non-conservative changes, such as replacing glycine with tryptophan.
  • “Deletion” refers to the deletion of one or more amino acids or nucleotides in an amino acid sequence or nucleotide sequence.
  • Insertion refers to an alteration in the amino acid sequence or nucleotide sequence that results in an increase in one or more amino acids or nucleotides compared to a naturally occurring molecule.
  • Replacement refers to the replacement of one or more amino acids or nucleotides with different amino acids or nucleotides.
  • Bioactivity refers to a protein that has the structure, regulation, or biochemical function of a natural molecule.
  • immunologically active refers to the ability of natural, recombinant or synthetic proteins and fragments thereof to induce a specific immune response and to bind to specific antibodies in a suitable animal or cell.
  • An "agonist” refers to a molecule that, when combined with a DNA polymerase III18, causes a change in the protein to regulate the activity of the protein.
  • An agonist may include a protein, a nucleic acid, a carbohydrate, or any other molecule that can bind DNA polymerase III 18.
  • Antagonist refers to a molecule that can block or regulate the biological or immunological activity of DNA polymerase III 18 when combined with DM polymerase III18.
  • Antagonists and inhibitors may include proteins, nucleic acids, carbohydrates or any other molecule that can bind DNA polymerase III 18.
  • Regular refers to a change in the function of DM polymerase IIIII 18, including an increase or decrease in protein activity, a change in binding properties, and any other biological, functional, or immune properties of DNA polymerase IIIII 18.
  • substantially pure means substantially free of other proteins, lipids, sugars or other substances with which it is naturally associated.
  • Those skilled in the art can purify DNA polymerase 11118 using standard protein purification techniques.
  • the substantially pure DNA polymerase III18 produces a single main band on a non-reducing polyacrylamide gel.
  • the purity of DNA polymerase III18 polypeptide can be analyzed by amino acid sequence.
  • Complementary refers to the natural binding of a polynucleotide by base-pairing under conditions of acceptable salt concentration and temperature.
  • sequence "C-T-G-A” can be combined with the complementary sequence "G-A-C-T”.
  • the complementarity between two single-stranded molecules can be partial or complete.
  • the degree of complementarity between nucleic acid strands has a significant effect on the efficiency and strength of hybridization between nucleic acid strands.
  • “Homology” refers to the degree of complementarity and can be partially homologous or completely homologous.
  • Partial homology refers to a partially complementary sequence that at least partially inhibits the hybridization of a fully complementary sequence to a target nucleic acid. The inhibition of such hybridization can be detected by performing hybridization (Southern or Northern blotting, etc.) under conditions of reduced stringency. Substantially homologous sequences or hybridization probes can compete and inhibit the binding of completely homologous sequences to the target sequence under conditions of reduced stringency. This does not mean that the conditions of reduced stringency allow non-specific binding, because the conditions of reduced stringency require that two sequences bind to each other as a specific or selective interaction.
  • Percent identity refers to the percentage of sequences that are identical or similar in the comparison of two or more amino acid or nucleic acid sequences. The percent identity can be determined electronically, such as through the MEGALIGN program (Lasergene software package, DNASTAR, Inc., Madison Wis.). The MEGALIGN program can compare two or more sequences according to different methods such as the Cluster method (Higgins, DG and PM Sharp (1988) Gene 73: 237-244). 0 The Cluster method arranges each group of sequences by checking the distance between all pairs. Into clusters. The clusters are then assigned in pairs or groups. The percent identity between two amino acid sequences such as sequence A and sequence B is calculated by the following formula:
  • the percent identity between nucleic acid sequences can also be determined by the Clus ter method or by methods known in the art such as Jotun Hein (Hein J "(1990) Methods in emzuraology 183: 625-645). 0
  • Similarity refers to the degree of identical or conservative substitutions of amino acid residues at corresponding positions in the alignment of amino acid sequences.
  • Amino acids used for conservative substitutions for example, negatively charged amino acids may include aspartic acid and glutamic acid; positively charged amino acids may include lysine and arginine; having an uncharged head group is Similar hydrophilic amino acids may include leucine, isoleucine and valine; glycine and alanine; asparagine and glutamine; serine and threonine; phenylalanine and tyrosine.
  • Antisense refers to a nucleotide sequence that is complementary to a particular DM or RNA sequence.
  • Antisense strand refers to a nucleic acid strand that is complementary to the “sense strand”.
  • Derivative refers to a chemical modification of HFP or a nucleic acid encoding it. This chemical modification may be the replacement of a hydrogen atom with an alkyl, acyl or amino group. Nucleic acid derivatives can encode polypeptides that retain the primary biological properties of natural molecules.
  • Antibody refers to a complete antibody molecule and its fragments, such as Fa,? ( ⁇ ) 2 and?, Which can specifically bind
  • a “humanized antibody” refers to an antibody in which the amino acid sequence of a non-antigen binding region is replaced to become more similar to a human antibody, but still retains the original binding activity.
  • isolated refers to the removal of a substance from its original environment (for example, its natural environment if it occurs naturally).
  • a naturally occurring polynucleotide or polypeptide is not isolated when it is present in a living thing, but the same polynucleotide or polypeptide is separated from some or all of the substances that coexist with it in the natural system.
  • Such a polynucleotide may be part of a vector, or such a polynucleotide or polypeptide may be part of a composition. Since the carrier or composition is not part of its natural environment, they are still isolated.
  • isolated refers to the separation of a substance from its original environment (if it is a natural substance, the original environment is the natural environment).
  • polynucleotides and polypeptides in the natural state in a living cell are not isolated and purified, but the same polynucleotides or polypeptides are separated from other substances that exist in the natural state On, it is isolated and purified.
  • isolated DM polymerase III 18 means that MA polymerase III 18 is substantially free of other proteins, lipids, carbohydrates, or other substances with which it is naturally associated.
  • Those skilled in the art can purify DNA polymerase 11118 using standard protein purification techniques. Substantially pure polypeptides can generate a single 'one' band on non-reducing polyacrylamide gels. The purity of the DNA polymerase IIIII polypeptide can be analyzed by amino acid sequence.
  • the present invention provides a new polypeptide DNA polymerase 11118, which basically consists of the amino acid sequence shown in SEQ ID NO: 2.
  • the polypeptide of the present invention may be a recombinant polypeptide, a natural polypeptide, or a synthetic polypeptide, and preferably a recombinant polypeptide.
  • the polypeptides of the present invention can be naturally purified products or chemically synthesized products, or can be produced from prokaryotic or eukaryotic hosts (eg, bacteria, yeast, higher plants, insects, and mammalian cells) using recombinant techniques. Depending on the host used in the recombinant production protocol, the polypeptides of the invention may be glycosylated or may be non-glycosylated. Polypeptides of the invention may also include or exclude starting methionine residues.
  • the invention also includes fragments, derivatives and analogs of DNA polymerase III.
  • fragment refers to a polypeptide that substantially maintains the same biological function or activity of the DM polymerase III18 of the present invention.
  • a fragment, derivative or analog of the polypeptide of the present invention may be: (I) a type in which one or more amino acid residues are replaced with conservative or non-conservative amino acid residues (preferably conservative amino acid residues), and the substitution
  • the amino acid may or may not be encoded by a genetic codon; or ( ⁇ ) such a type in which a group on one or more amino acid residues is replaced by another group to include a substituent; or (III) such One, in which the mature polypeptide is fused to another compound (such as a compound that prolongs the half-life of the polypeptide, such as polyethylene glycol); or (IV) such a polypeptide sequence in which the additional amino acid sequence is fused into the mature polypeptide ( Such as the leader sequence or secreted sequence or the sequence used to purify this polypeptide or protease sequence)
  • such fragments, derivatives and analogs are considered to be within the knowledge of those skilled in the art.
  • the present invention provides an isolated nucleic acid (polynucleotide), which basically consists of a polynucleotide encoding a polypeptide having the amino acid sequence of SEQ ID NO: 2.
  • the polynucleotide sequence of the present invention includes the nucleotide sequence of SEQ ID NO: 1.
  • the polynucleotide of the present invention is found from a cDNA library of human fetal brain tissue. It contains a full-length polynucleotide sequence of 845 bases and its open reading frame of 249-749 encodes 166 amino acids.
  • This polypeptide has the characteristic sequence of the C-terminus of the DNA polymerase, and it can be deduced that the DNA polymerase III 18 has the structure and function represented by the C-terminus of the DNA polymerase.
  • the polynucleotide of the present invention may be in the form of DNA or RNA.
  • the form of DNA includes cDNA, genomic DNA, or synthetic DNA.
  • DNA can be single-stranded or double-stranded.
  • DNA can be coding or non-coding.
  • the coding region sequence encoding the mature polypeptide may be the same as the coding region sequence shown in SEQ ID NO: 1 or a degenerate variant.
  • "degenerate variant” means in the present invention encoding a gene having SEQ ID NO: 2 A protein or polypeptide, but a nucleic acid sequence that differs from the coding region sequence shown in SEQ ID NO: 1.
  • the polynucleotide encoding the mature polypeptide of SEQ ID NO: 2 includes: only the coding sequence of the mature polypeptide; the coding sequence of the mature polypeptide and various additional coding sequences; the coding sequence of the mature polypeptide (and optional additional coding sequences); Coding sequence.
  • polynucleotide encoding a polypeptide refers to a polynucleotide that encodes the polypeptide and a polynucleotide that includes additional coding and / or non-coding sequences.
  • the invention also relates to variants of the polynucleotides described above, which encode polypeptides or fragments, analogs and derivatives of polypeptides having the same amino acid sequence as the invention.
  • Variants of this polynucleotide may be naturally occurring allelic variants or non-naturally occurring variants. These nucleotide variants include substitution variants, deletion variants, and insertion variants.
  • an allelic variant is an alternative form of a polynucleotide that may be a substitution, deletion, or insertion of one or more nucleotides, but does not substantially change the function of the polypeptide it encodes .
  • the invention also relates to a polynucleotide that hybridizes to the sequence described above (having at least 50%, preferably 70% identity between the two sequences).
  • the present invention particularly relates to polynucleotides that can hybridize to the polynucleotides of the present invention under stringent conditions.
  • "strict conditions” means: (1) hybridization and elution at lower ionic strength and higher temperature, such as 0.2xSSC, 0.1% SDS, 60 ° C; or (2) Add a denaturant during hybridization, such as 50 ° /.
  • polypeptide encoded by the hybridizable polynucleotide has the same biological function and activity as the mature polypeptide shown in SEQ ID NO: 2.
  • nucleic acid fragments that hybridize to the sequences described above.
  • a "nucleic acid fragment” contains at least 10 nucleotides in length, preferably at least 20-30 nucleotides, more preferably at least 50-60 nucleotides, most preferably at least 100 nucleotides. Nucleotides or more. Nucleic acid fragments can also be used in nucleic acid amplification techniques such as PCR to identify and / or isolate polynucleotides encoding DNA polymerase III 18.
  • polypeptides and polynucleotides in the present invention are preferably provided in an isolated form and are more preferably purified to homogeneity.
  • the specific polynucleotide sequence encoding the DNA polymerase IIIII of the present invention can be obtained by various methods.
  • polynucleotides are isolated using hybridization techniques well known in the art. These techniques include, but are not limited to: 1) hybridization of probes to genomic or cDNA libraries to detect homologous polynucleotide sequences, and 2) antibody screening of expression libraries to detect cloned polynucleosides with common structural characteristics Acid fragments.
  • the DNA fragment sequence of the present invention can also be obtained by the following methods: 1) isolating the double-stranded DNA sequence from the genomic DNA; 2) chemically synthesizing the DNA sequence to obtain the double-stranded DNA of the polypeptide.
  • genomic DNA isolation is the least commonly used. Direct chemical synthesis of DNA sequences is often the method of choice. The more commonly used method is the isolation of cDNA sequences. Isolation of cDNA of interest The standard method is to isolate mRNA from donor cells that highly express the gene and perform reverse transcription to form a plasmid or phage cDNA library. There are many mature techniques for extracting mRNA, and kits are also commercially available (Qiagene). The construction of cDNA libraries is also a common method (Sarabrook, et al., Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory. New York, 1989). Commercially available cDNA libraries are also available, such as different cDNA libraries from Clontech. When polymerase reaction technology is used in combination, even very small expression products can be cloned.
  • the genes of the present invention can be selected from these cDNA libraries by conventional methods. These methods include (but are not limited to): (1) DNA-DNA or DNA-RNA hybridization; (2) the presence or absence of marker gene functions; (3) measuring the level of the transcript of DNA polymerase I ⁇ 18; (4) passing Immunological techniques or assays for biological activity to detect gene-expressed protein products. The above methods can be used singly or in combination.
  • the probe used for hybridization is homologous to any part of the polynucleotide of the present invention, and its length is at least 10 nucleotides, preferably at least 30 nucleotides, more preferably At least 50 nucleotides, preferably at least 100 nucleotides.
  • the length of the probe is usually within 2000 nucleotides, preferably within 1000 nucleotides.
  • the probe used here is generally a DNA sequence chemically synthesized based on the gene sequence information of the present invention.
  • the genes or fragments of the present invention can of course be used as probes.
  • DNA probes can be labeled with radioisotopes, luciferin, or enzymes (such as alkaline phosphatase).
  • the protein product for detecting the DNA polymerase III protein expression can be detected by immunological techniques such as Western blotting, radioimmunoprecipitation, and enzyme-linked immunosorbent assay (ELISA).
  • immunological techniques such as Western blotting, radioimmunoprecipitation, and enzyme-linked immunosorbent assay (ELISA).
  • a method for amplifying DNA / RNA using PCR technology is preferably used to obtain the gene of the present invention.
  • the RACE method RACE-rapid amplification of cDNA ends
  • the primers used for PCR can be appropriately based on the polynucleotide sequence information of the present invention disclosed herein. Select and synthesize using conventional methods.
  • the amplified DNA / RNA fragments can be separated and purified by conventional methods such as by gel electrophoresis.
  • polynucleotide sequence of the gene of the present invention or various DNA fragments and the like obtained as described above can be determined by a conventional method such as dideoxy chain termination method (Sanger et al. PNAS, 1977, 74: 5463-5467). Such polynucleotide sequences can also be determined using commercial sequencing kits. In order to obtain the full-length cDNA sequence, the sequencing must be repeated. Sometimes it is necessary to determine the cMA sequence of multiple clones in order to splice into a full-length cDNA sequence.
  • the present invention also relates to a vector comprising the polynucleotide of the present invention, and a host cell produced by genetic engineering using the vector of the present invention or directly using a DNA polymerase III18 coding sequence, and a method for producing a polypeptide according to the present invention by recombinant technology.
  • the polynucleotide sequence encoding the DNA polymerase IIIII can be inserted into a vector to constitute A recombinant vector having a polynucleotide according to the present invention.
  • vector refers to bacterial plasmids, phages, yeast plasmids, plant cell viruses, mammalian cell viruses such as adenoviruses, retroviruses, or other vectors well known in the art.
  • Vectors suitable for use in the present invention include, but are not limited to: T7 promoter-based expression vectors expressed in bacteria (Rosenberg, et al.
  • any plasmid and vector can be used to construct a recombinant expression vector.
  • An important feature of expression vectors is that they usually contain an origin of replication, a promoter, a marker gene, and translational regulatory elements.
  • Methods well known to those skilled in the art can be used to construct expression vectors containing a DNA sequence encoding a DNA polymerase III and appropriate transcription / translation regulatory elements. These methods include in vitro recombinant DNA technology, DNA synthesis technology, in vivo recombination technology, etc. (Sambroook, et al. Mo l ecu l ar Cl oning, a Labora tory Manua l, cold Harbor Labora tory. New York, 1989).
  • the DNA sequence can be operably linked to an appropriate promoter in an expression vector to guide mRNA synthesis. Representative examples of these promoters are: the l ac or trp promoter of E.
  • the expression vector also includes a ribosome binding site and a transcription terminator for translation initiation. Insertion of enhancer sequences into the vector will enhance its transcription in higher eukaryotic cells. Enhancers are cis-acting factors expressed by DNA. They usually have about 10 to 300 base pairs and act on promoters to enhance gene transcription. Illustrative examples include SV40 enhancers of 100 to 270 base pairs on the late side of the origin of replication, polyoma enhancers on the late side of the origin of replication, and adenoviral enhancers.
  • the expression vector preferably contains one or more selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
  • selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
  • GFP fluorescent protein
  • tetracycline or ampicillin resistance for E. coli.
  • a polynucleotide encoding the DNA polymerase III 18 or a recombinant vector containing the polynucleotide can be transformed or transduced into a host cell to constitute a genetically engineered host cell containing the polynucleotide or the recombinant vector.
  • the term "host cell” refers to a prokaryotic cell, such as a bacterial cell; or a lower eukaryotic cell, such as a yeast cell; or a higher eukaryotic cell, such as a mammalian cell. Representative examples are: E.
  • Transformation of a host cell with a DNA sequence described in the present invention or a recombinant vector containing the DNA sequence can be performed using conventional techniques well known to those skilled in the art.
  • the host is a prokaryote, such as E. coli
  • competent cells capable of absorbing DNA can be harvested after the exponential growth phase and treated with the CaCl 2 method. The steps used are well known in the art. Alternatively, M g Cl 2 is used. If necessary, transformation can also be performed by electroporation.
  • the host is a eukaryotic organism, the following DNA transfection methods can be used: calcium phosphate co-precipitation method, or conventional mechanical methods such as microinjection, electroporation, and liposome packaging.
  • the polynucleotide sequence of the present invention can be used to express or produce recombinant DNA polymerase III 18 by conventional recombinant DNA technology (Science, 1984; 224: 1431). Generally there are the following steps:
  • the medium used in the culture may be selected from various conventional mediums according to the host cells used. Culture is performed under conditions suitable for host cell growth. After the host cells have grown to an appropriate cell density, the selected promoter is induced by a suitable method (such as temperature conversion or chemical induction), and the cells are cultured for a period of time.
  • a suitable method such as temperature conversion or chemical induction
  • the recombinant polypeptide may be coated in a cell, expressed on a cell membrane, or secreted outside the cell.
  • recombinant proteins can be isolated and purified by various separation methods using their physical, chemical, and other properties. These methods are well known to those skilled in the art. These methods include, but are not limited to: conventional renaturation treatment, protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid chromatography (HPLC) and various other liquid chromatography techniques and combinations of these methods.
  • conventional renaturation treatment protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid chromat
  • Fig. 1 is a diagram comparing the amino acid sequences of the DNA polymerase III and the C-terminal domain of the DNA polymerase of the present invention.
  • FIG. 2 is a polyacrylamide gel electrophoresis diagram (SDS-PAGE) of the isolated DNA polymerase III 18.
  • 18KDa is the molecular weight of the protein.
  • the arrow indicates the isolated protein band.
  • the present invention is further described below with reference to specific embodiments. It should be understood that these examples are only used to illustrate the present invention and not to limit the scope of the present invention. In the following examples, the experimental methods without specific conditions are generally performed according to conventional conditions such as Sambrook et al., Molecular Cloning: The conditions described in the laboratory manual (New York: Cold Spring Harbor Laboratory Press, 1989), or according to the manufacturer Suggested conditions.
  • Example 1 Cloning of DNA polymerase III
  • Human fetal brain total MA was extracted by one-step method with guanidine isothiocyanate / phenol / chloroform.
  • Poly (A) mRNA was isolated from total RNA using Quik mRNA Isolat ion Kit (product of Qiegene). 2ug Poly (A) mRNA was formed into cLi by reverse transcription. The Smart cDNA cloning kit (purchased from Clontech) was used to insert the cDNA fragments into the multicloning site of the pBSK (+) vector (Clontech) to transform DH5 ⁇ . The bacteria formed a cDNA library.
  • Dye terminate cycle react ion sequencing kit Perkin-Elmer
  • ABI 377 automatic sequencer Perkin-Elmer
  • the determined cDNA sequence was compared with the existing public DNA sequence database (Genebank), and it was found that the cDNA sequence of one of the clones 0446h09 was new DNA.
  • the cloned insert cDNA fragment was bidirectionally determined by synthesizing a series of primers.
  • the sequence of the DNA polymerase ⁇ 18 of the present invention and the protein sequence encoded by the same were analyzed using the profil scan program (Basicloca l Al ignment search tool) in GCG [Al tschul, SF et al. J. Mol. Biol. 1990 215: 403-10], performing domain analysis in databases such as prosotti.
  • the DNA polymerase III 18 of the present invention is homologous to the C-terminus of the domain DNA polymerase, and the homology results are shown in FIG. 1
  • Example 3 Cloning of the gene encoding DNA polymerase III 18 by RT-PCR method
  • CDNA was synthesized using fetal brain total RNA as a template and ol igo-dT as a primer for reverse transcription reaction.
  • PCR amplification was performed with the following primers:
  • Primer 1 5'- ACGGCTGCGAGAAGACGATGCTTA-3 (SEQ ID NO: 3)
  • Pr imer2 5'- AAACATATCGAAAACTTTACTAGA -3 '(SEQ ID NO: 4)
  • Primerl is a forward sequence located at the 5th end of SEQ ID NO: 1, starting at Ibp;
  • Pr imer2 is the 3'-end reverse sequence in SEQ ID NO: 1.
  • Conditions for the amplification reaction 50 ol / L KC1, 10 mmol / L Tr is- CI, (pH 8.5), 1.5 mmol / L MgCl 2 , 200 ⁇ mol / L dNTP, lOpmol primer, 1U of Taq DM polymerase (Clontech).
  • the reaction was performed on a PE9600 DNA thermal cycler (Perkin-Elmer) under the following conditions for 25 cycles: 94 ° C 30sec; 55. C 30sec; 72 ° C 2min. At-? 1 set 0 01; 111 as the positive control and template blank as the negative control.
  • the amplified product was purified using a QIAGEN kit and ligated to a pCR vector using a TA cloning kit (Invitrogen).
  • the DNA sequence analysis results showed that the DM sequence of the PCR product was exactly the same as the 1-845bp shown in SEQ ID NO: 1.
  • Example 4 Northern blot analysis of DNA polymerase III18 gene expression:
  • a 32P-labeled probe (approximately 2 ⁇ 10 6 cpm / ral) and RNA-transferred nitrocellulose membrane were placed in a solution at 42 ° C. C overnight hybridization, the solution containing 50% formamide - 25mMKH 2 P0 4 (pH7.4) -5 x SSC- 5 x Denhardt's solution and 200 g / ml salmon sperm DNA. After hybridization, the filter was placed at 3300.1. / 03 in 55. (: Wash 3001111. Then, Phosphor Imager was used for analysis and quantification.
  • Example 5 In vitro expression, isolation, and purification of recombinant DM polymerase III18
  • Primer3 5'- CCCCATATGATGGTTTGTGCTCAAAATTGCCTG -3, (Seq ID No: 5)
  • Primer 4 5'- CATGGATCCCTAGGTCCAGTGGGGCTGCTCCCG -3 '(Seq ID No: 6)
  • the 5' ends of these two primers contain Ndel and BamHI digestion sites, respectively, followed by the coding sequences of the 5 'and 3, ends of the target gene, respectively.
  • the Ndel and BamHI restriction sites correspond to the selective endonuclease sites on the expression vector plasmid pET 28b (+) (Novagen, Cat. No. 69865.3).
  • PCR was performed using the pBS-0446h09 plasmid containing the full-length target gene as a template.
  • the PCR reaction conditions were as follows: a total volume of 50 ⁇ 1 containing 10 pg of pBS-0446h09 plasmid, Primer-3 Primer-4; ⁇ ! ⁇ 10 pmol, Advantage polymerase Mix (Clontech) 1 ⁇ 1. Cycle parameters: 94. C 20s, 60 ° C 30s, 68 ° C 2 min, 25 cycles Ring. Ndel and BamHI were used to double-digest the amplified product and plasmid pET-28 (+), respectively, and large fragments were recovered and ligated with T4 ligase. The ligation product was transformed into the coliform bacteria DH5o by the calcium chloride method.
  • a peptide synthesizer (product of PE company) was used to synthesize the following DNA polymerase ⁇ 18-specific peptides:
  • Suitable oligonucleotide fragments selected from the polynucleotides of the present invention are used as hybridization probes in various aspects.
  • the probes can be used to hybridize to genomic or cDNA libraries of normal tissue or pathological tissue from different sources to It is determined whether it contains the polynucleotide sequence of the present invention and a homologous polynucleotide sequence is detected. Further, the probe can be used to detect the polynucleotide sequence of the present invention or its homologous polynucleotide sequence in normal tissue or pathology. Whether the expression in tissue cells is abnormal.
  • the purpose of this embodiment is to select a suitable oligonucleotide fragment from the polynucleotide SEQ ID NO: 1 of the present invention as a hybridization probe, and to identify whether some tissues contain the polynucleoside of the present invention by using a filter hybridization method.
  • Filter hybridization methods include dot blotting, Southern blotting, Northern blotting, and copying methods. They all use the same steps of hybridization after fixing the polynucleotide sample to be tested on the filter.
  • the sample-immobilized filter is first pre-hybridized with a probe-free hybridization buffer, so that the non-specific binding site of the sample on the filter is saturated with the carrier and the synthetic polymer.
  • the pre-hybridization solution is then replaced with a hybridization buffer containing the labeled probe and incubated to hybridize the probe to the target nucleic acid.
  • the unhybridized probes are removed by a series of membrane washing steps.
  • This embodiment utilizes higher-intensity washing conditions (such as lower salt concentration and higher temperature) to reduce the hybridization background and retain only strong specific signals.
  • the probes used in this embodiment include two types: the first type of probes are oligonucleotide fragments that are completely the same as or complementary to the polynucleotide SEQ ID NO: 1 of the present invention; the second type of probes are partially related to the present invention
  • the polynucleotide SEQ ID NO: 1 is the same or complementary oligonucleotide fragment.
  • the dot blot method is used to fix the sample on the filter membrane. Under the high-intensity washing conditions, the first type of probe and the sample have the strongest hybridization specificity and are retained.
  • oligonucleotide fragments for use as hybridization probes from the polynucleotide SEQ ID NO: 1 of the present invention should follow the following principles and several aspects to be considered:
  • the preferred range of probe size is 18-50 nucleotides
  • the GC content is 30% -70%, and the non-specific hybridization increases when it exceeds;
  • Those that meet the above conditions can be used as primary selection probes, and then further computer sequence analysis, including the primary selection probe and its source sequence region (ie, SEQ ID NO: 1) and other unknown genomic sequences and their complements The regions are compared for homology. If the homology with the non-target molecular region is greater than 85% or there are more than 15 consecutive bases, then the primary probe should not be used;
  • Probe 1 which belongs to the first type of probe, is completely homologous or complementary to the gene fragment of SEQ ID NO: 1 (41Nt):
  • Probe 2 which belongs to the second type of probe, is equivalent to the replacement mutation sequence (41Nt) of the gene fragment or its complementary fragment of SEQ ID NO: 1:
  • step 14 can be performed directly.
  • 8) Add RNase A to the DNA solution to a final concentration of 100 ⁇ g / ml, and incubate at 37 ° C for 30 minutes.
  • 9) Add SDS and proteinase K, the final concentrations are 0.5% and 100ug / ml. Incubate at 37 ° C for 30 minutes.
  • 10) Extract the reaction solution with an equal volume of phenol: chloroform: isoamyl alcohol (25: 24: 1) and centrifuge for 10 minutes. 11) Carefully remove the aqueous phase and re-extract with an equal volume of chloroform: isoamyl alcohol (24: 1) and centrifuge for 10 minutes.
  • NC membranes nitrocellulose membranes
  • Two NC membranes are required for each probe, so that they can be used in the following experimental steps.
  • the film was washed with high-strength conditions and strength conditions, respectively.
  • the 32 P-Probe (the second peak is free ⁇ - 32 P-dATP) is prepared.
  • High-intensity washing film 1) Take out the hybridized sample membrane.
  • probe 1 can be used to qualitatively and quantitatively analyze the presence and differential expression of the polynucleotide of the present invention in different tissues.
  • Gene microarrays or DNA microarrays are new technologies currently being developed by many national laboratories and large pharmaceutical companies. It refers to the orderly and high-density arrangement of a large number of target gene fragments on glass, The data is compared and analyzed on a carrier such as silicon using fluorescence detection and computer software to achieve the purpose of rapid, efficient, and high-throughput analysis of biological information.
  • the polynucleotide of the present invention can be used as target DNA for gene chip technology for high-throughput research of new gene functions; search for and screen new tissue-specific genes, especially new genes related to diseases such as tumors; diagnosis of diseases such as hereditary diseases .
  • the specific method steps have been reported in the literature, for example, see the literature DeRi s i, J. L., Lyer, V. & Brown, P. 0.
  • a total of 4,000 polynucleotide sequences of various full-length cDNAs are used as target DNA, including the polynucleotide of the present invention. They were respectively amplified by PCR, and the concentration of the amplified product was adjusted to about 500ng / ul after purification.
  • the spots were spotted on a glass medium with a Cartesian 7500 spotter (purchased from Cartesian Company, USA). The distance between them is 280 ⁇ ⁇ .
  • the spotted slides were hydrated, dried, and cross-linked in a UV cross-linker. After elution, the slides were fixed to prepare the DNA on a glass slide to prepare a chip.
  • the specific method steps are in the text There are various reports in Xianzhong, and the post-sampling processing steps in this embodiment are:
  • Total mRNA was extracted from normal laryngeal and laryngeal cancers in one step, and mRNA was purified using Oligotex mRNAMidiKit (purchased from QiaGen).
  • Cy3dUTP 5 -Amino- propargyl- 2'- deoxyuridine 5'- triphate coupled to Cy3 fluorescent dye, purchased from Amersham Phamacia Biotech company
  • Cy5dUTP 5-Amino-propar gy 1-2 '-deoxyur id ine 5'-triphate coupled to Cy5 fluorescent dye (Purchased from Amersham Phamacia Biotech) to label laryngeal cancer tissue mRM.
  • Purified probes were prepared. For specific steps and methods, see:
  • Probes from the above two types of tissues were hybridized with the chip in UniHyb TM Hybridization Solution (purchased from TeleChem) for 16 hours, washed with a washing solution (lx SSC, 0.2% SDS) at room temperature and scanned with ScaiiArray 3000. Instrument (purchased from General Scanning Company, USA) for scanning. The scanned image is analyzed and processed with Imagene software (Biodiscovery Company, USA), and the Cy3 / Cy5 ratio of each point is calculated. The points whose ratio is less than 0.5 and greater than 2 are considered as Differentially expressed genes.
  • polypeptide of the present invention and the antagonists, agonists and inhibitors of the polypeptide can be directly used in the treatment of diseases, For example, it can treat malignant tumors, adrenal deficiency, skin diseases, various inflammations, HIV infections and immune diseases.
  • DNA polymerase III (Pol III) is responsible for efficient and accurate replication of chromosomes.
  • DNA polymerase III has ⁇ , ⁇ , and ⁇ subunits.
  • the dnaQ mutation of the ⁇ subunit gene can cause the loss or decrease of the catalytic activity of the DnaQ enzyme.
  • the C-terminal characteristic sequence of the ⁇ subunit is necessary for its activity. Deletion of the C-terminus of DNA polymerase will result in partial or complete loss of DNA polymerase function.
  • the polypeptide of the present invention is a polypeptide containing the characteristic C-terminal sequence of the DNA polymerase III family. Abnormal expression of the polypeptide will cause abnormal chromosome replication function, cause abnormal information transmission, and cause related diseases.
  • DM polymerase III18 will produce various diseases, especially various tumors, embryonic development disorders, growth and development disorders, and endocrine diseases. These diseases include, but are not limited to:
  • Tumors of various tissues stomach cancer, liver cancer, lung cancer, esophageal cancer, breast cancer, leukemia, lymphoma, thyroid tumor, uterine fibroids, neuroblastoma, astrocytoma, ependymoma, glioblastoma, nerve Fibroma, colon cancer, melanoma, adrenal cancer, bladder cancer, bone cancer, osteosarcoma, myeloma, bone marrow cancer, uterine cancer, endometrial cancer, gallbladder cancer, colon cancer, thymic tumor, nasal and sinus tumors, nose Pharyngeal cancer, Laryngeal cancer, Tracheal tumor, Fibroma, Fibrosarcoma, Lipoma, Liposarcoma, Leiomyoma
  • Fetal developmental disorders congenital abortion, cleft palate, limb loss, limb differentiation disorder, hyaline membrane disease, atelectasis, polycystic kidney, cryptorchidism, congenital inguinal hernia, double uterus, vaginal atresia, hypospadias, androgynous Malformation, Atrial septal defect, Ventricular septal defect, Pulmonary stenosis, Arterial duct occlusion, Neural tube defect, Congenital hydrocephalus, Iris defect, Congenital glaucoma or cataract, Congenital deafness
  • Growth and development disorders mental retardation, cerebral palsy, brain development disorders, mental retardation, familial cerebral nucleus hypoplasia syndrome, strabismus, skin, fat and muscular dysplasia such as congenital skin relaxation, albinism , Alzheimer's disease, congenital keratosis, bone and joint dysplasia diseases such as cartilage dysplasia, epiphyseal dysplasia, metabolic bone disease, various metabolic defects such as various amino acid metabolic defects, dementia, dwarfism Cushing syndrome, sexual retardation
  • Endocrine diseases diabetes insipidus, precocious puberty, giant disease and acromegaly, dwarfism, pituitary tumors, simple goiter, thyroiditis, hyperthyroidism, hypothyroidism, hyperparathyroidism, Hypoparathyroidism, Cortisol, Primary Aldosterone, Adrenal Insufficiency, Adrenal Tumor, Diabetes, Insulinoma, Gastrinoma, Ovarian Disease: Premenstrual Tension, Menopausal Syndrome Symptoms, ovarian hypoplasia, amenorrhea, hypogonadism, precocious puberty
  • the abnormal expression of the DNA polymerase III 18 of the present invention will also produce certain hereditary, hematological and immune system diseases.
  • the polypeptide of the present invention and the antagonists, agonists and inhibitors of the polypeptide can be directly used in the treatment of diseases, for example, it can treat various diseases, especially various tumors, embryonic developmental disorders, growth and development disorders, and endocrine diseases.
  • the invention also provides methods for screening compounds to identify agents that increase (agonist) or suppress (antagonist) DNA polymerase III 18.
  • Agonists enhance biological functions such as DNA polymerase III 18 to stimulate cell proliferation, while antagonists prevent and treat disorders related to excessive cell proliferation, such as various cancers.
  • mammalian cells or membrane preparations expressing DNA polymerase III 18 can be cultured with labeled DNA polymerase III 18 in the presence of a drug. The ability of the drug to increase or block this interaction is then determined.
  • Antagonists of DNA polymerase IIIII include antibodies, compounds, receptor deletions, and the like that have been screened.
  • the antagonist of DNA polymerase III 18 can bind to DM polymerase III 18 and eliminate its function, or inhibit the production of the polypeptide, or bind to the active site of the polypeptide so that the polypeptide cannot perform a biological function.
  • DM polymerase III 18 can be added to a bioanalytical assay to determine whether a compound is an antagonist by measuring the effect of the compound on the interaction between DNA polymerase III 18 and its receptor.
  • receptor deletions and analogs that function as antagonists can be screened.
  • Polypeptide molecules capable of binding to DNA polymerase III can be obtained by screening a random peptide library composed of various possible combinations of amino acids bound to a solid phase. When screening, DNA polymerase III 18 molecules should generally be labeled.
  • the present invention provides a method for producing an antibody using a polypeptide, a fragment, a derivative, an analog thereof, or a cell thereof as an antigen.
  • These antibodies can be polyclonal or monoclonal antibodies.
  • the invention also provides antibodies directed against a DNA polymerase III 18 epitope. These antibodies include (but are not limited to): polyclonal antibodies, monoclonal antibodies, chimeric antibodies, single chain antibodies, Fab fragments, and fragments produced by Fab expression libraries.
  • Polyclonal antibodies can be produced by direct injection of DNA polymerase III 18 into immunized animals (such as rabbits, mice, rats, etc.).
  • immunized animals such as rabbits, mice, rats, etc.
  • adjuvants can be used to enhance the immune response, including but not limited to Freund's adjuvant.
  • Techniques for preparing monoclonal antibodies to DNA polymerase III 18 include, but are not limited to, hybridoma technology (Kohler and Mistein. Nature, 1975, 256: 495-497), triple tumor technology, human beta-cell hybridoma technology, EBV -Hybridoma technology, etc.
  • Chimeric antibodies that bind human constant regions and non-human-derived variable regions can be produced using existing techniques (Morrison et al., PNAS, 1985, 81: 6851).
  • the existing technology for producing single chain antibodies (U.S. Pat No. 4946778) can also be used to produce single chain antibodies against DNA polymerase III.
  • Anti-DM polymerase III 18 antibodies can be used in immunohistochemistry to detect DNA polymerase 11118 in biopsy specimens.
  • Monoclonal antibodies that bind to DNA polymerase ⁇ 18 can also be labeled with radioisotopes. Track its location and distribution. This radiolabeled antibody can be used as a non-invasive diagnostic method to locate tumor cells and determine whether there is metastasis.
  • Antibodies can also be used to design immunotoxins that target a particular part of the body.
  • DNA polymerase III 18 high affinity monoclonal antibodies can covalently bind to bacterial or plant toxins (such as diphtheria toxin, ricin, ormosine, etc.).
  • a common method is to attack the amino group of an antibody with a thiol cross-linking agent such as SPDP and bind the toxin to the antibody through the exchange of disulfide bonds.
  • This hybrid antibody can be used to kill DNA polymerase III 18-positive cells.
  • the antibodies in the present invention can be used to treat or prevent diseases related to DNA polymerase IIIII.
  • Administration of appropriate doses of antibodies can stimulate or block the production or activity of DNA polymerase IIIII.
  • the invention also relates to a diagnostic test method for quantitative and localized detection of DM polymerase III 18 levels.
  • tests are well known in the art and include FISH assays and radioimmunoassays.
  • the level of DNA polymerase IIIII detected in the test can be used to explain the importance of DNA polymerase III 18 in various diseases and to diagnose diseases in which MA polymerase port 18 functions.
  • polypeptide of the present invention can also be used for peptide mapping analysis.
  • the polypeptide can be specifically cleaved by physical, chemical or enzymatic analysis, and subjected to one-dimensional or two-dimensional or three-dimensional gel electrophoresis analysis, and more preferably mass spectrometry.
  • the polynucleotide encoding DNA polymerase III 18 can also be used for a variety of therapeutic purposes. Gene therapy technology can be used to treat abnormal cell proliferation, development or metabolism caused by the non-expression or abnormal / inactive expression of DNA polymerase III 18.
  • Recombinant gene therapy vectors (such as viral vectors) can be designed to express mutated DNA polymerase III 18 to inhibit endogenous DNA polymerase III 18 activity.
  • a mutated DNA polymerase III 18 may be a shortened DNA polymerase III, lacking a signaling domain, and although it can bind to downstream substrates, it lacks signaling activity. Therefore, recombinant gene therapy vectors can be used to treat diseases caused by abnormal expression or activity of DNA polymerase III 18.
  • Virus-derived expression vectors such as retroviruses, adenoviruses, adenovirus-associated viruses, herpes simplex virus, parvoviruses, and the like can be used to transfer polynucleotides encoding DNA polymerase III 18 into cells.
  • Methods for constructing a recombinant viral vector carrying a polynucleotide encoding a DNA polymerase III 18 can be found in existing literature (Sarabrook, et al.).
  • the recombinant polynucleotide encoding DNA polymerase III 18 can be packaged into liposomes and transferred into cells.
  • Methods for introducing a polynucleotide into a tissue or cell include: directly injecting the polynucleotide into a tissue in vivo; or introducing the polynucleotide into a cell in vitro through a vector (such as a virus, phage, or plasmid), and then transplanting the cell Into the body and so on.
  • a vector such as a virus, phage, or plasmid
  • Oligonucleotides including antisense RNA and DNA
  • ribozymes that inhibit DNA polymerase III DNA are also within the scope of the present invention.
  • a ribozyme is an enzyme-like RNA molecule that can specifically decompose specific RNA. Its mechanism of action is that the ribozyme molecule specifically hybridizes with a complementary target RM to perform endonucleation.
  • Antisense RNA and DNA and ribozymes can be obtained by any existing RNA or DNA synthesis technology. For example, the technique of solid-phase phosphate amide chemical synthesis to synthesize oligonucleotides has been widely used.
  • Antisense MA molecules can be obtained by in vitro or in vivo transcription of a DNA sequence encoding the RNA.
  • This MA sequence is integrated downstream of the RNA polymerase promoter of the vector.
  • it can be modified in a variety of ways, such as increasing the sequence length on both sides, and the ribonucleoside linkages should use phosphate thioester or peptide bonds instead of phosphodiester bonds.
  • the polynucleotide encoding the DNA polymerase IIIII can be used for the diagnosis of diseases related to the DNA polymerase IIIII.
  • a polynucleotide encoding DM polymerase IIIII 18 can be used to detect the expression of DNA polymerase III18 or abnormal expression of DNA polymerase IIIII in a disease state.
  • the DNA sequence encoding DNA polymerase III 18 can be used to hybridize biopsy specimens to determine the expression of DNA polymerase III 18.
  • Hybridization techniques include Southern blotting, Northern blotting, in situ hybridization, and the like. These techniques and methods are publicly available and mature, and related kits are commercially available.
  • polynucleotides of the present invention can be used as probes to be fixed on a microarray or a DNA chip (also referred to as a "gene chip") for analyzing differential expression analysis and gene diagnosis of genes in tissues.
  • DNA polymerase III 18 transcripts can also be detected using RNA polymerase chain reaction (RT-PCR) in vitro amplification with MA polymerase III 18 specific primers.
  • RT-PCR RNA polymerase chain reaction
  • DNA polymerase III 18 mutations include point mutations, translocations, deletions, recombinations, and any other abnormalities compared to the normal wild-type DM polymerase III 18 DNA sequence. Mutations can be detected using existing techniques such as Southern blotting, DNA sequence analysis, PCR, and in situ hybridization. In addition, mutations may affect the expression of proteins. Therefore, Nor thern blotting and Western blotting can be used to indirectly determine whether a gene is mutated.
  • the sequences of the invention are also valuable for chromosome identification.
  • the sequence specifically targets a specific position on a human chromosome and can hybridize to it.
  • specific sites for each gene on the chromosome need to be identified.
  • only a few chromosome markers based on actual sequence data are available for marking chromosome positions.
  • an important first step is to locate these DNA sequences on a chromosome.
  • PCR primers (preferably 15-35bp) are prepared based on the cDNA, and the sequence can be mapped on the chromosome. These primers were then used for PCR screening of somatic hybrid cells containing individual human chromosomes. Only those hybrid cells containing human genes corresponding to the primers will produce amplified fragments.
  • PCR localization of somatic hybrid cells is a quick way to localize DNA to specific chromosomes.
  • oligonucleotide primers of the present invention by a similar method, a set of fragments from a specific chromosome or a large number of genomic clones can be used to achieve sublocalization.
  • Other similar strategies that can be used for chromosomal localization include in situ hybridization, chromosome pre-screening with labeled flow sorting, and hybrid pre-selection to construct chromosome-specific cDNA libraries.
  • Fluorescent in situ hybridization (FISH) of cDM clones and metaphase chromosomes allows precise chromosomal localization in one step.
  • FISH fluorescent in situ hybridization
  • the physical location of the sequence on the chromosome can be correlated with the genetic map data. These data can be found in, for example, V. Mckus ck, Mendel ian Inher tance in Man (available online with Johns Hopkins University Welch Medical Library). Linkage analysis can then be used to determine the relationship between genes and diseases that are mapped to chromosomal regions.
  • the difference in cDNA or genomic sequence between the affected and unaffected individuals needs to be determined. If a mutation is observed in some or all diseased individuals, and the mutation is observed in any normal individual, the mutation may be the cause of the disease. Comparing affected and unaffected individuals usually involves first looking for structural changes in chromosomes, such as deletions or translocations that are visible at the chromosomal level or detectable with cDNA sequence-based PCR. According to the resolution capabilities of current physical mapping and gene mapping technology, the cDNA accurately mapped to the chromosomal region associated with the disease can be one of 50 to 500 potentially pathogenic genes (assuming 1 megabase mapping resolution) Capacity and each 20kb corresponds to a gene).
  • the polypeptides, polynucleotides and mimetics, agonists, antagonists and inhibitors of the present invention can be used in combination with a suitable pharmaceutical carrier.
  • suitable pharmaceutical carrier can be water, glucose, ethanol, salts, buffers, glycerol, and combinations thereof.
  • the composition comprises a safe and effective amount of the polypeptide or antagonist, and carriers and excipients that do not affect the effect of the drug. These compositions can be used as drugs for the treatment of diseases.
  • the present invention also provides a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the present invention.
  • a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the present invention.
  • these containers there may be instructional instructions given by government agencies that manufacture, use, or sell pharmaceuticals or biological products, which reminders permit their administration on the human body by government agencies that manufacture, use, or sell them.
  • the polypeptide of the present invention can be used in combination with other therapeutic compounds.
  • the pharmaceutical composition can be administered in a convenient manner, such as by a topical, intravenous, intraperitoneal, intramuscular, subcutaneous, intranasal or intradermal route of administration.
  • DM polymerase III is administered in an amount effective to treat and / or prevent a specific indication.
  • the amount and dose range of DNA polymerase III 18 administered to a patient will depend on many factors, such as the mode of administration, the health conditions of the person to be treated, and the judgment of the diagnostician.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Molecular Biology (AREA)
  • Organic Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Genetics & Genomics (AREA)
  • Microbiology (AREA)
  • Biotechnology (AREA)
  • Biomedical Technology (AREA)
  • Biochemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Peptides Or Proteins (AREA)
  • Enzymes And Modification Thereof (AREA)

Abstract

L'invention concerne un nouveau polypeptide, une ADN polymérase III 18, et un polynucléotide codant pour ce polypeptide ainsi qu'un procédé d'obtention de ce polypeptide par des techniques recombinantes d'ADN. L'invention concerne en outre les applications de ce polypeptide dans le traitement de maladies, notamment des tumeurs malignes, de l'hémopathie, de l'infection par VIH, de maladies immunitaires et de diverses inflammations. L'invention concerne aussi l'antagoniste agissant contre le polypeptide et son action thérapeutique ainsi que les applications de ce polynucléotide codant pour l'ADN polymérase III 18.
PCT/CN2001/000071 2000-01-28 2001-01-21 Nouveau polypeptide, adn polymerase iii 18, et polynucleotide codant pour ce polypeptide WO2001055406A1 (fr)

Priority Applications (1)

Application Number Priority Date Filing Date Title
AU2001231485A AU2001231485A1 (en) 2000-01-28 2001-01-21 A novel polypeptide-dna polymerase iii 18 and the polynucleotide encoding said polypeptide

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
CN00111569.3 2000-01-28
CN 00111569 CN1307107A (zh) 2000-01-28 2000-01-28 一种新的多肽——dna聚合酶iii18和编码这种多肽的多核苷酸

Publications (1)

Publication Number Publication Date
WO2001055406A1 true WO2001055406A1 (fr) 2001-08-02

Family

ID=4581478

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/CN2001/000071 WO2001055406A1 (fr) 2000-01-28 2001-01-21 Nouveau polypeptide, adn polymerase iii 18, et polynucleotide codant pour ce polypeptide

Country Status (3)

Country Link
CN (1) CN1307107A (fr)
AU (1) AU2001231485A1 (fr)
WO (1) WO2001055406A1 (fr)

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1998045452A2 (fr) * 1997-04-08 1998-10-15 The Rockfeller University Enzyme derivee d'organismes thermophiles fonctionnant comme replicase chromosomique, production et emplois de cette enzyme
WO1999013060A1 (fr) * 1997-09-12 1999-03-18 Enzyco, Inc. Nouvel holoenzyme polymerase iii thermophile

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1998045452A2 (fr) * 1997-04-08 1998-10-15 The Rockfeller University Enzyme derivee d'organismes thermophiles fonctionnant comme replicase chromosomique, production et emplois de cette enzyme
WO1999013060A1 (fr) * 1997-09-12 1999-03-18 Enzyco, Inc. Nouvel holoenzyme polymerase iii thermophile

Also Published As

Publication number Publication date
AU2001231485A1 (en) 2001-08-07
CN1307107A (zh) 2001-08-08

Similar Documents

Publication Publication Date Title
WO2001074879A1 (fr) Nouveau polypeptide, proteine ribosomale humaine s3-12, et polynucleotide codant pour ce polypeptide
WO2001055406A1 (fr) Nouveau polypeptide, adn polymerase iii 18, et polynucleotide codant pour ce polypeptide
WO2001055374A1 (fr) Nouveau polypeptide, sequence 71 de multirepetition de la leucine, et polynucleotide codant pour ce polypeptide
WO2001055195A1 (fr) Nouveau polypeptide, proteine de type an1 humaine, et polynucleotide codant pour ce polypeptide
WO2001053492A1 (fr) Nouveau polypeptide, s-adenosylmethionine synthetase 31, et polynucleotide codant pour ce polypeptide
WO2001085752A1 (fr) Polynucleotide codant un peptide de myosine
WO2001046244A1 (fr) Nouveau polypeptide, adn polymerase 17, et polynucleotide codant pour ce polypeptide
WO2001070965A1 (fr) Nouveau polypeptide, facteur humain de regulation de la transcription 15, et polynucleotide codant pour ce polypeptide
WO2001046250A1 (fr) Nouveau polypeptide, triose phosphate isomerase 9, et polynucleotide codant pour ce polypeptide
WO2001072796A1 (fr) Nouveau polypeptide, facteur humain de transcription de la differentiation cellulaire 11, et polynucleotide codant pour ce polypeptide
WO2001079432A2 (fr) Nouveau polypeptide, facteur humain de transcription de la differentiation cellulaire 58, et polynucleotide codant pour ce polypeptide
WO2001055165A1 (fr) Nouveau polypeptide, adn polymerase iii 12, et polynucleotide codant pour ce polypeptide
WO2001046247A1 (fr) Nouveau polypeptide, subtilisine 9, et polynucleotide codant pour ce polypeptide
WO2001064732A1 (fr) Nouveau polypeptide, facteur humain associe a la retrotransposition 14, et polynucleotide codant pour ce polypeptide
WO2001081392A1 (fr) Nouveau polypeptide, phosphoproteine nucleolaire humaine 13, et polynucleotide codant pour ce polypeptide
WO2001075024A2 (fr) Nouveau polypeptide, facteur humain 13 associe a nf-e2, et polynucleotide codant pour ce polypeptide
WO2001074893A1 (fr) Nouveau polypeptide, proteine humaine de regulation de la transcription 11.8, et polynucleotide codant pour ce polypeptide
WO2002000698A1 (fr) Nouveau polypeptide, proteine humaine 12 de transport de l'acide phosphorique, et polynucleotide codant ce polypeptide
WO2001048194A1 (fr) Nouveau polypeptide, proteine ribosomale s18 13, et polynucleotide codant pour ce polypeptide
WO2001046249A1 (fr) Nouveau polypeptide, subtilisine 10, et polynucleotide codant pour ce polypeptide
WO2001055401A1 (fr) Nouveau polypeptide, helicase atp-dependante humaine 31, et polynucleotide codant pour ce polypeptide
WO2001079437A2 (fr) Nouveau polypeptide, facteur humain de transcription de la differentiation cellulaire 14, et polynucleotide codant pour ce polypeptide
WO2001055400A1 (fr) Nouveau polypeptide, site 90 actif de la famille rho des enzymes gtp, et polynucleotide codant pour ce polypeptide
WO2001047964A1 (fr) Nouveau polypeptide, helicase atp-dependante 68, et polynucleotide codant pour ce polypeptide
WO2001075000A2 (fr) Nouveau polypeptide, facteur humain 15 lié á la rétrotransposition, et polynucléotide codant pour ce polypeptide

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
REG Reference to national code

Ref country code: DE

Ref legal event code: 8642

122 Ep: pct application non-entry in european phase
NENP Non-entry into the national phase

Ref country code: JP