WO2001046249A1 - Nouveau polypeptide, subtilisine 10, et polynucleotide codant pour ce polypeptide - Google Patents

Nouveau polypeptide, subtilisine 10, et polynucleotide codant pour ce polypeptide Download PDF

Info

Publication number
WO2001046249A1
WO2001046249A1 PCT/CN2000/000567 CN0000567W WO0146249A1 WO 2001046249 A1 WO2001046249 A1 WO 2001046249A1 CN 0000567 W CN0000567 W CN 0000567W WO 0146249 A1 WO0146249 A1 WO 0146249A1
Authority
WO
WIPO (PCT)
Prior art keywords
polypeptide
polynucleotide
subtilase
sequence
seq
Prior art date
Application number
PCT/CN2000/000567
Other languages
English (en)
Chinese (zh)
Inventor
Yumin Mao
Yi Xie
Original Assignee
Fudan University
Shanghai Bio Door Gene Technology Ltd.
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Fudan University, Shanghai Bio Door Gene Technology Ltd. filed Critical Fudan University
Priority to AU19840/01A priority Critical patent/AU1984001A/en
Publication of WO2001046249A1 publication Critical patent/WO2001046249A1/fr

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14Hydrolases (3)
    • C12N9/48Hydrolases (3) acting on peptide bonds (3.4)
    • C12N9/50Proteinases, e.g. Endopeptidases (3.4.21-3.4.25)
    • C12N9/52Proteinases, e.g. Endopeptidases (3.4.21-3.4.25) derived from bacteria or Archaea
    • C12N9/54Proteinases, e.g. Endopeptidases (3.4.21-3.4.25) derived from bacteria or Archaea bacteria being Bacillus
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00Medicinal preparations containing peptides

Definitions

  • the present invention belongs to the field of biotechnology. Specifically, the present invention describes a novel polypeptide, subtilase 10, and a polynucleotide sequence encoding the polypeptide. The invention also relates to methods and applications for preparing such polynucleotides and polypeptides.
  • subtilase family is a broad branch of the serine protease family. Its catalytic activity is provided by a charge relay system similar to the trypsin family of serine proteases.
  • the residue sequences near its catalytic three sites are completely different from those near trypsin-like sites, so these sequences can be used as a marker to distinguish subtilases.
  • subtilase family The conserved sequences of the subtilase family are: First, (STAIV) -X- (LIVMF)-(LIVM) -D- (DSTA) -G- (LIVMFC) -X (2, 3)-(DNH) (D is Active site residues), most subtilases have this site, with a few exceptions, of which the Asp-Asp-Gly tripeptide provides a high negative electron for the substrate binding site; second, HG- (STM) -X- (VIC)-(STAGG)-(GS) -X- (LIVMA)-(STAGCLV)-(SAGM) (H is the active site residue), except for aspA and ssal Active site; Third, GTSX- (SA) -XPX (2)-(STAVC)-(AG) (S is the active site residue), nisP, tagC and S. marcesens extracellular serine protease do not have this sequence.
  • the subtilase family is related to the binary sites of pre-cleavage proteins and pro-hormones (sites consisting of a pair of basic amino acid residues, mainly Lys-Arg and Arg-Arg, etc.) and multiple sites.
  • subtilase 10 protein plays an important role in important body functions as described above, and it is believed that a large number of proteins are involved in these regulatory processes, there has been a need in the art to identify more subtilase 10 proteins involved in these processes, especially to identify this. Amino acid sequence of several proteins.
  • the isolation of the new subtilisin 10 protein encoding gene also provides a basis for research to determine the role of the protein in health and disease states. This protein may form the basis for the development of diagnostic and / or therapeutic drugs for diseases, so it is important to isolate its coding DNA.
  • Another object of the invention is to provide a polynucleotide encoding the polypeptide.
  • Another object of the present invention is to provide a recombinant vector containing a polynucleotide encoding subtilase 10. It is another object of the present invention to provide a genetically engineered host cell containing a polynucleotide encoding subtilase 10.
  • Another object of the present invention is to provide a method for producing subtilase 10.
  • Another object of the present invention is to provide antibodies against the subtilisin 10 of the polypeptide of the present invention.
  • Another object of the present invention is to provide mimic compounds, antagonists, agonists, and inhibitors directed against the polypeptide of the present invention, subtilase 10.
  • Another object of the present invention is to provide a method for diagnosing and treating diseases related to subtilase 10 abnormalities.
  • the present invention relates to an isolated polypeptide, which is of human origin and comprises: a polypeptide having the amino acid sequence of SEQ ID No. 2, or a conservative variant, biologically active fragment or derivative thereof.
  • the polypeptide is a polypeptide having the amino acid sequence of SEQ ID NO: 2.
  • the invention also relates to an isolated polynucleotide comprising a nucleotide sequence or a variant thereof selected from the group consisting of:
  • sequence of the polynucleotide is one selected from the group consisting of: (a) a sequence having positions 288-557 in SEQ ID NO: 1; and (b) a sequence having 1-1278 in SEQ ID NO: 1 Sequence of bits.
  • the present invention further relates to a tailor, particularly an expression vector, containing the polynucleotide of the present invention; a host cell genetically engineered with the vector, including a transformed, transduced or transfected host cell; The method for preparing a polypeptide of the present invention by describing a host cell and recovering an expressed product is described.
  • the invention also relates to an antibody capable of specifically binding to a polypeptide of the invention.
  • the invention also relates to a method for screening compounds that mimic, activate, antagonize or inhibit the activity of a subtilase 10 protein, which comprises utilizing a polypeptide of the invention.
  • the invention also relates to compounds obtained by this method.
  • the present invention also relates to a method for detecting a disease or susceptibility to disease associated with abnormal expression of a subtilase 10 protein in vitro, comprising detecting a mutation in the polypeptide or a sequence encoding a polynucleotide thereof in a biological sample Change, or detect the amount or biological activity of a polypeptide of the invention in a biological sample.
  • the invention also relates to a pharmaceutical composition
  • a pharmaceutical composition comprising a polypeptide of the invention or a mimetic thereof, an activator, an antagonist or an inhibitor, and a pharmaceutically acceptable carrier.
  • the present invention also relates to the use of the polypeptide and / or polynucleotide of the present invention in the manufacture of a medicament for treating cancer, developmental disease or immune disease or other diseases caused by abnormal expression of subtilase 10.
  • FIG. 1 is a comparison diagram of amino acid sequence homology of a subtilase family of 52 with a total of 14 amino acids and domains in the subtilase 10 of the present invention.
  • the upper sequence is subtilase 10 and the lower sequence is the subtilase family domain.
  • ⁇ "and”: "" and ".” Indicate that the probability of the same amino acid appearing between two sequences decreases in sequence.
  • Figure 2 shows the polyacrylamide gel electrophoresis (SDS-PAGE) of isolated subtilase 10.
  • OkDa is the molecular weight of the protein.
  • the arrow indicates the isolated protein band.
  • Nucleic acid sequence refers to an oligonucleotide, a nucleotide or a polynucleotide and a fragment or part thereof, and may also refer to a genomic or synthetic DNA or RNA, they can be single-stranded or double-stranded, representing the sense or antisense strand.
  • amino acid sequence refers to an oligopeptide, peptide, polypeptide or protein sequence and fragments or portions thereof.
  • amino acid sequence in the present invention relates to the amino acid sequence of a naturally occurring protein molecule, such "polypeptide” or “protein” does not mean to limit the amino acid sequence to a complete natural amino acid related to the protein molecule .
  • a protein or polynucleotide “variant” refers to an amino acid sequence having one or more amino acids or nucleotide changes or a polynucleotide sequence encoding it.
  • the changes may include deletions, insertions or substitutions of amino acids or nucleotides in the amino acid sequence or nucleotide sequence.
  • Variants can have "conservative" changes in which the substituted amino acid has a structural or chemical property similar to the original amino acid, such as the replacement of isoleucine with leucine.
  • Variants may also have non-conservative changes, such as replacing glycine with tryptophan.
  • “Deletion” refers to the absence of one or more amino acids or nucleotides in an amino acid sequence or nucleotide sequence. Missed.
  • Insertion means that a change in the amino acid sequence or nucleotide sequence results in an increase in one or more amino acids or nucleotides compared to a molecule that exists in nature.
  • Replacement refers to the replacement of one or more amino acids or nucleotides with different amino acids or nucleotides.
  • Bioactivity refers to a protein that has the structure, regulation, or biochemical function of a natural molecule.
  • immunologically active refers to the ability of natural, recombinant or synthetic proteins and fragments thereof to induce a specific immune response in appropriate animals or cells and to bind to specific antibodies
  • An "agonist” refers to a molecule that, when combined with subtilase 10, causes a change in the protein to regulate the activity of the protein.
  • An agonist may include a protein, a nucleic acid, a carbohydrate, or any other molecule that can bind subtilase 10.
  • an “antagonist” or “inhibitor” refers to a molecule that can block or regulate the biological or immunological activity of subtilase 10 when combined with subtilase 10.
  • Antagonists and inhibitors may include proteins, nucleic acids, carbohydrates, or any other molecule that binds subtilase 10.
  • Regular refers to a change in the function of subtilase 10, including an increase or decrease in protein activity, a change in binding properties, and any other biological, functional, or immune properties of subtilase 10.
  • Substantially pure means substantially free of other proteins, lipids, carbohydrates or other substances with which it is naturally associated.
  • Those skilled in the art can purify subtilase 10 using standard protein purification techniques.
  • Substantially pure subtilase 10 produces a single main band on a non-reducing polyacrylamide gel.
  • the purity of the subtilisin 10 peptide can be analyzed by amino acid sequence.
  • Complementary refers to the natural binding of polynucleotides by base-pairing under conditions of acceptable salt concentration and temperature.
  • sequence C-T-G-A
  • complementary sequence G-A-C-T
  • the complementarity between two single-stranded molecules can be partial or complete.
  • the degree of complementarity between nucleic acid strands has a significant effect on the efficiency and strength of hybridization between nucleic acid strands.
  • “Homology” refers to the degree of complementarity and can be partially homologous or completely homologous.
  • Partial homology refers to a partially complementary sequence that at least partially inhibits hybridization of a fully complementary sequence to a target nucleic acid. This inhibition of hybridization can be detected by performing hybridization (Southern blotting or Nor thern blotting, etc.) under conditions of reduced stringency.
  • Substantially homologous sequences or hybridization probes can compete and inhibit the binding of completely homologous sequences to the target sequence under conditions of reduced stringency. This does not mean that the conditions of reduced stringency allow non-specific binding, because the conditions of reduced stringency require that the two sequences bind to each other as a specific or selective interaction.
  • Percent identity refers to the percentage of sequences that are identical or similar in the comparison of two or more amino acid or nucleic acid sequences. The percent identity can be determined electronically, such as by the MEGALIGN program (Lasergene sof tware package, DNASTAR, Inc., Mad son Wi s.). The MEGALIGN program can compare two or more sequences according to different methods such as the Clus ter method (Higg ins, DG and PM Sharp (1988) Gene 73: 237-244). The Cluster method arranges groups of sequences into clusters by checking the distance between all pairs. The clusters are then assigned in pairs or groups. The percentage identity between two amino acid sequences, such as sequence A and sequence B, is calculated by the MEGALIGN program (Lasergene sof tware package, DNASTAR, Inc., Mad son Wi s.). The MEGALIGN program can compare two or more sequences according to different methods such as the Clus ter method (Higg ins, DG and PM Sharp (1988) Gene 73: 237-24
  • the number of residues in the sequence-the number of spacer residues in the sequence-the number of spacer residues in the sequence X can also be determined by the Clus ter method or by methods known in the art such as Jotun He in (He in J., (1990) Methods in enzymo logy 183: 625-645)
  • Similarity refers to the degree of identical or conservative substitutions of amino acid residues at corresponding positions in the alignment of amino acid sequences.
  • Amino acids used for conservative substitutions for example, negatively charged amino acids may include aspartic acid and glutamic acid; positively charged amino acids may include lysine and arginine; Similar hydrophilic amino acids may include leucine, isoleucine and valine; glycine and alanine; asparagine and glutamine; serine and threonine; phenylalanine and tyrosine.
  • Antisense refers to a nucleotide sequence that is complementary to a particular DNA or RNA sequence.
  • the "antisense strand” refers to a nucleic acid strand that is complementary to the “sense strand”.
  • Derivative refers to HFP or a chemical modification of its nucleic acid. This chemical modification may be the replacement of a hydrogen atom with an alkyl, acyl or amino group. Nucleic acid derivatives can encode polypeptides that retain the main biological properties of natural molecules.
  • Antibody refers to a complete antibody molecule and its fragments, such as Fa,? ( ⁇ ') 2 and? It can specifically bind to the epitope of subtilase 10.
  • a “humanized antibody” refers to an antibody in which the amino acid sequence of a non-antigen binding region is replaced to become more similar to a human antibody, but still retains the original binding activity.
  • isolated refers to the removal of matter from its original environment (for example, its natural environment if it is naturally occurring).
  • a naturally occurring polynucleotide or polypeptide is not isolated when it is present in a living animal, but the same polynucleotide or polypeptide is separated from some or all of the substances that coexist in the natural system.
  • Such a polynucleotide may be part of a vector, or such a polynucleotide or polypeptide may be part of a composition. Since the carrier or composition is not part of its natural environment, they are still isolated.
  • isolated refers to the separation of a substance from its original environment (if it is a natural substance, the original environment is the natural environment). Polynucleotides and peptides in their natural state in living cells It is not isolated and purified, but the same polynucleotide or polypeptide is separated and purified if it is separated from other substances in its natural state.
  • isolated subtilase 10 means that subtilisin 10 is substantially free of other proteins, lipids, carbohydrates or other substances with which it is naturally associated. Those skilled in the art can purify subtilis using standard protein purification techniques. Protease 10. A substantially pure polypeptide produces a single main band on a non-reducing polyacrylamide gel. The purity of the subtilisin 10 polypeptide can be analyzed by amino acid sequence.
  • the present invention provides a new polypeptide ⁇ grassin 10, which basically consists of the amino acid sequence shown in SEQ ID NO: 2.
  • the polypeptide of the present invention may be a recombinant polypeptide, a natural polypeptide, or a synthetic polypeptide, and preferably a recombinant polypeptide.
  • the polypeptides of the present invention may be naturally purified products or chemically synthesized products, or produced using recombinant techniques from prokaryotic or eukaryotic hosts (eg, bacteria, yeast, higher plants, insects, and mammalian cells). Depending on the host used in the recombinant production protocol, the polypeptide of the invention may be glycosylated, or it may be non-glycosylated. Polypeptides of the invention may also include or exclude starting methionine residues.
  • the invention also includes fragments, derivatives and analogs of subtilase 10.
  • fragment refers to a polypeptide that substantially retains the same biological function or activity of the subtilase 10 of the present invention.
  • a fragment, derivative or analog of the polypeptide of the present invention may be: (I) a kind in which one or more amino acid residues are substituted with conservative or non-conservative amino acid residues (preferably conservative amino acid residues), and the substitution
  • the amino acid may or may not be encoded by the genetic code; or (II) such a type in which a group on one or more amino acid residues is substituted by other groups to include a substituent; or (III) such A type in which a mature polypeptide is fused with another compound (such as a compound that prolongs the half-life of the polypeptide, such as polyethylene glycol); or (IV) a type of polypeptide sequence in which an additional amino acid sequence is fused into a mature polypeptide (such as the leader sequence or secreted sequence or the sequence used to purify this polypeptide or protease sequence)
  • an additional amino acid sequence is fused into a mature polypeptide (such as the leader sequence or secreted sequence or the sequence used to purify this polypeptid
  • the present invention provides an isolated nucleic acid (polynucleotide), which basically consists of a polynucleotide encoding a polypeptide having the amino acid sequence of SEQ ID NO: 2.
  • the polynucleotide sequence of the present invention includes a nucleotide sequence of SEQ ID NO: 1.
  • the polynucleotide of the present invention is found from a cDNA library of human fetal brain tissue. It contains a polynucleotide sequence with a total length of ⁇ 78 bases, and its open reading frame 288-557 encodes 89 amino acids.
  • This polypeptide has the characteristic sequence of the subtilase family, and it can be deduced that the subtilase 10 has the structure and function represented by the subtilase family.
  • the polynucleotide of the present invention may be in the form of DNA or RNA.
  • DNA forms include cDNA, genomic DNA, or synthetic DNA.
  • DNA can be single-stranded or double-stranded.
  • DNA can be coding or non-coding.
  • the coding region sequence encoding the mature polypeptide may be the same as the coding region sequence shown in SEQ ID NO: 1 Or a degenerate variant.
  • degenerate variant means in the present invention that the code has
  • the polynucleotide encoding the mature polypeptide of SEQ ID NO: 2 includes: only the coding sequence of the mature polypeptide; the coding sequence of the mature polypeptide and various additional coding sequences; the coding sequence of the mature polypeptide (and optional additional coding sequences); Coding sequence.
  • polynucleotide encoding a polypeptide refers to a polynucleotide that includes the polypeptide and a polynucleotide that includes additional coding and / or non-coding sequences.
  • the invention also relates to variants of the polynucleotides described above, which encode polypeptides or fragments, analogs and derivatives of polypeptides having the same amino acid sequence as the invention.
  • This polynucleotide variant can be a naturally occurring allelic variant or a non-naturally occurring variant.
  • These nucleotide variants include substitution variants, deletion variants, and insertion variants.
  • an allelic variant is an alternative form of a polynucleotide that may be a substitution, deletion, or insertion of one or more nucleotides, but does not substantially change the function of the polypeptide it encodes .
  • the invention also relates to a polynucleotide that hybridizes to the sequence described above (having at least 50%, preferably 70% identity between the two sequences).
  • the present invention particularly relates to polynucleotides that can hybridize to the polynucleotides of the present invention under stringent conditions.
  • “strict conditions” means: (1) hybridization and elution at lower ionic strength and higher temperature, such as 0.2xSSC, 0.1% SDS, 60'C; or (2) Add denaturants during hybridization, such as 50 '/ »( ⁇ / ⁇ ) formamide, 0.1% calf serum / 0.1% F ico ll, 42'C, etc .; or (3) only in two sequences Crosses occur only when the identity between them is at least 95%, and more preferably 97%.
  • the polypeptide encoded by the hybridizable polynucleotide has the same biological function and activity as the mature polypeptide shown in SEQ ID NO: 2.
  • nucleic acid fragment contains at least 10 nucleotides in length, preferably at least 20-30 nucleotides, more preferably at least 50-60 nucleotides, and most preferably at least 100 nuclei. Glycylic acid or more. Nucleic acid fragments can also be used in nucleic acid amplification techniques (such as PCR) to identify and / or isolate polynucleotides encoding subtilase 10.
  • polypeptides and polynucleotides in the present invention are preferably provided in an isolated form and are more preferably purified to homogeneity.
  • the specific polynucleotide sequence encoding the subtilase 10 of the present invention can be obtained by various methods.
  • polynucleotides are isolated using hybridization techniques well known in the art. These techniques include, but are not limited to: 1) hybridization of probes to genomic or cDNA libraries to detect homologous polynucleotide sequences, and 2) antibody screening of expression libraries to detect cloned polynucleosides with common structural characteristics Acid fragments.
  • the DNA fragment sequence of the present invention can also be obtained by the following methods: 1) isolating the double-stranded DNA sequence from the genomic DNA; 2) chemically synthesizing the DNA sequence to obtain the double-stranded DNA of the polypeptide.
  • genomic DNA isolation is the least commonly used. Direct chemical synthesis of DNA sequences is often the method of choice. The more commonly used method is the isolation of cDNA sequences.
  • the standard method for isolating the cDNA of interest is to isolate mRNA from donor cells that overexpress the gene and perform reverse transcription to form a plasmid or phage cDNA library. There are many mature techniques for extracting mRNA, and kits are also commercially available (Qiagene).
  • cDNA libraries are also a common method (Sambrook, et al., Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory. New York, 1989).
  • Commercially available cDNA libraries are also available, such as different cDNA libraries from CloiUech. When polymerase reaction technology is used in combination, even very small expression products can be cloned.
  • genes of the present invention can be selected from these cDNA libraries by conventional methods. These methods include (but are not limited to): (l) DNA-DM or DM-RNA hybridization; (2) the presence or absence of marker gene functions; (3) determination of the level of subtilase 10 transcripts; (4) immunization by immunization Technology or measurement of biological activity to detect gene-expressed protein products. The above methods can be used singly or in combination.
  • the probe used for hybridization is homologous to any part of the polynucleotide of the present invention, and its length is at least 10 nucleotides, preferably at least 30 nucleotides, more preferably At least 50 nucleotides, preferably at least 100 nucleotides.
  • the length of the probe is usually within 2000 nucleotides, preferably within 1000 nucleotides.
  • the probe used here is usually a DNA sequence chemically synthesized based on the gene sequence information of the present invention.
  • the genes or fragments of the present invention can of course be used as probes.
  • DNA probes can be labeled with radioisotopes, luciferin, or enzymes (such as alkaline phosphatase).
  • immunological techniques such as Western blotting, radioimmunoprecipitation, and enzyme-linked immunosorbent assay (ELISA) can be used to detect the protein product of the subtilase 10 gene expression.
  • ELISA enzyme-linked immunosorbent assay
  • a method using PCR technology to amplify DNA / RNA is preferably used to obtain the gene of the present invention.
  • the RACE method RACE-Rapid Amplification of cDNA Ends
  • the primers for PCR can be appropriately based on the polynucleotide sequence information of the present invention disclosed herein Select and synthesize using conventional methods.
  • the amplified DNA / RNA fragments can be isolated and purified by conventional methods such as by gel electrophoresis.
  • polynucleotide sequence of the gene of the present invention or various DNA fragments and the like obtained as described above can be measured by a conventional method such as dideoxy chain termination method (Sanger et al. PNAS, 1977, 74: 5463-5467). Such polynucleotide sequences can also be determined using commercial sequencing kits and the like. In order to obtain the full-length cDNA sequence, sequencing needs to be repeated. Sometimes it is necessary to determine the cDNA sequence of multiple clones in order to splice into a full-length cDNA sequence.
  • the present invention also relates to a vector comprising a polynucleotide of the present invention, and a host cell genetically engineered using the vector of the present invention or directly with a subtilase 10 coding sequence, and produced by recombinant technology A method of a polypeptide according to the invention.
  • a polynucleotide sequence encoding subtilase 10 may be inserted into a vector to constitute a recombinant vector containing the polynucleotide of the present invention.
  • vector refers to bacterial plasmids, phages, yeast plasmids, plant cell viruses, mammalian cell viruses such as adenoviruses, retroviruses, or other vectors well known in the art.
  • Vectors suitable for use in the present invention include, but are not limited to: T7 promoter-based expression vectors (Rosenberg, et al.
  • any plasmid and vector can be used to construct a recombinant expression vector.
  • An important feature of expression vectors is that they usually contain origins of replication, promoters, marker genes, and translational regulatory elements.
  • the expression vector also includes a ribosome binding site for translation initiation, a transcription terminator, and the like. Insertion of enhancer sequences into the vector will enhance its transcription in higher eukaryotic cells. Enhancers are cis-acting factors for DNA expression, usually about 10 to 300 base pairs, which act on promoters to enhance gene transcription. Examples include SV40 enhancers of 100 to 270 base pairs on the late side of the origin of replication, polyoma enhancers and adenovirus enhancers on the late side of the origin of replication.
  • the expression vector preferably contains one or more selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
  • selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
  • GFP fluorescent protein
  • tetracycline or ampicillin resistance for E. coli.
  • a polynucleotide encoding subtilase 10 or a recombinant vector containing the polynucleotide can be transformed or transduced into a host cell to constitute a genetically engineered host cell containing the polynucleotide or the recombinant vector.
  • the term "host cell” refers to a prokaryotic cell, such as a bacterial cell; or a lower eukaryotic cell, such as Yeast cells; or higher eukaryotic cells, such as mammalian cells. Representative examples are: E.
  • coli Streptomyces
  • bacterial cells such as Salmonella typhimurium
  • fungal cells such as yeast
  • plant cells such as fly S2 or Sf9
  • animal cells such as CH0, COS or Bowes melanoma cells.
  • Transformation of a host cell with a DNA sequence described in the present invention or a recombinant vector containing the DNA sequence can be performed using conventional techniques well known to those skilled in the art.
  • the host is a prokaryote, such as E. coli
  • competent cells capable of absorbing DNA can be harvested after the exponential growth phase and treated with the CaCl 2 method.
  • the steps used are well known in the art.
  • the alternative is to use MgCl 2 strigo
  • transformation can also be performed by electroporation.
  • the host is a eukaryotic organism, the following DNA transfection methods can be used: calcium phosphate co-precipitation method, or conventional mechanical methods such as development Microinjection, electroporation, liposome packaging, etc.
  • the polynucleotide sequence of the present invention can be used to express or produce recombinant subtilase 10 by conventional recombinant DNA technology (Science, 1984; 224: 1431). Generally there are the following steps:
  • the medium used in the culture may be selected from various conventional mediums. Culture is performed under conditions suitable for host cell growth. After the host cells have grown to an appropriate cell density, the selected promoter is induced by a suitable method (such as temperature conversion or chemical induction), and the cells are cultured for a period of time.
  • a suitable method such as temperature conversion or chemical induction
  • the recombinant polypeptide may be coated in a cell, expressed on a cell membrane, or secreted outside the cell. If necessary, the recombinant protein can be isolated and purified by various separation methods using its physical, chemical and other properties. These methods are well known to those skilled in the art. These methods include, but are not limited to: conventional renaturation treatment, protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid chromatography (HPLC) and various other liquid chromatography techniques and combinations of these methods.
  • conventional renaturation treatment protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid
  • polypeptides of the present invention can be directly used in the treatment of diseases, for example, they can be used to treat malignant tumors, adrenal deficiency, skin diseases, various types of inflammation, HIV infection, and immunological diseases.
  • the subtilisin family is a broad branch of the serine protease family. Its catalytic activity is provided by a charge relay system, similar to the trypsin family of serine proteases.
  • the subtilase family is related to the binary sites (sites consisting of a pair of basic amino acid residues, mainly Lys-Arg, Arg-Arg, etc.) and multi-sites of preproteins and prohormones. So with grass The abnormal expression of the polypeptide of the motif sequence of the protease family active site will lead to processing deviation of proteins or hormones, which will affect its biological function and produce corresponding diseases such as growth and development disorders, various tumors, inflammation, etc.
  • subtilase 10 of the present invention will produce various diseases, especially various tumors, growth and development disorders, inflammation, and immune diseases. These diseases include, but are not limited to:
  • Tumors of various tissues gastric cancer, liver cancer, lung cancer, esophageal cancer, breast cancer, leukemia, lymphoma, thyroid tumor, uterine fibroids, neuroblastoma, astrocytoma, ependymoma, glioblastoma, Colon cancer, malignant histiocytosis, melanoma, teratoma, sarcoma, adrenal cancer, bladder cancer, bone cancer, osteosarcoma, myeloma, bone marrow cancer, brain cancer, uterine cancer, endometrial cancer, gallbladder cancer, colon Cancer, thymic tumor, nasal and sinus tumor, nasopharyngeal cancer, laryngocarcinoma, tracheal tumor, pleural mesothelioma, fibroid, fibrosarcoma, lipoma, liposarcoma, leiomyoma
  • Growth and development disorders mental retardation, cerebral palsy, brain development disorders, mental retardation, familial cerebral nucleus dysplasia syndrome, strabismus, skin, fat and muscular dysplasia such as congenital skin laxity, premature aging Disease, congenital keratosis, various metabolic defects such as various amino acid metabolic defects, stunting, dwarfism, sexual retardation
  • Rheumatoid arthritis chronic active hepatitis, arthritis after gonococcal infection, ankylosing spondylitis, systemic lupus erythematosus, scleroderma, polymyositis, myasthenia gravis, Guillain-Barre syndrome, autoimmunity Hemolytic anemia, immune thrombocytopenic purpura, autoimmune interstitial nephritis, antibody-specific primary specific immunodeficiency disease, combined immunodeficiency disease, immunodeficiency disease lacking phagocytes, complement system deficiency Acquired immune deficiency syndrome
  • subtilase 10 will also cause certain hereditary and blood diseases.
  • polypeptide of the present invention and the antagonists, agonists and inhibitors of the polypeptide can be directly used in the treatment of diseases, for example, it can treat various diseases, especially various tumors, growth and development disorders, inflammation, immune diseases, and some Hereditary, hematological diseases, etc.
  • the invention also provides methods for screening compounds to identify agents that increase (agonist) or suppress (antagonist) subtilase 10.
  • Agonists enhance biological functions such as subtilase 10 stimulating cell proliferation, while antagonists prevent and treat disorders related to excessive cell proliferation, such as various cancers.
  • mammalian cells or a formulation that expresses subtilase 10 can be cultured with labeled subtilase 10 in the presence of a drug. The ability of the drug to increase or block this interaction is then determined.
  • Antagonists of subtilase 10 include antibodies, compounds, receptor deletions, and analogs that have been screened.
  • An antagonist of subtilase 10 can bind to subtilase 10 and eliminate its function, or inhibit the production of the polypeptide, or bind to the active site of the polypeptide so that the polypeptide cannot perform a biological function.
  • subtilase 10 When screening compounds as antagonists, subtilase 10 can be added to a bioanalytical assay to determine whether the compound is an antagonist by measuring the effect of the compound on the interaction between subtilase 10 and its receptor. Receptor deletions and analogs that act as antagonists can be screened in the same manner as described above for screening compounds.
  • Polypeptide molecules capable of binding to subtilase 10 can be obtained by screening a random peptide library composed of various possible combinations of amino acids bound to a solid phase. When screening, the subtilase 10 molecule should generally be labeled.
  • the present invention provides a method for producing antibodies using polypeptides, and fragments, derivatives, analogs or cells thereof as antigens. These antibodies can be polyclonal or monoclonal antibodies.
  • the invention also provides antibodies directed against a subtilase 10 epitope. These antibodies include (but are not limited to): polyclonal antibodies, monoclonal antibodies, chimeric antibodies, single chain antibodies, Fab fragments, and fragments generated from Fab expression libraries.
  • subtilase 10 The production of polyclonal antibodies can be obtained by direct injection of subtilase 10 into immunized animals (such as rabbits, mice, rats, etc.).
  • immunized animals such as rabbits, mice, rats, etc.
  • a variety of adjuvants can be used to enhance the immune response, including but not limited to Freund's adjuvant.
  • Techniques for preparing monoclonal antibodies to subtilase 10 include, but are not limited to, hybridoma technology (Kohler and Milstein. Nature, 1975, 256: 495-497), triple tumor technology, human beta-cell hybridoma technology, and EBV-hybridoma technology. Wait. Chimeric antibodies that bind human constant regions and non-human variable regions can be produced using existing techniques (Morrison et al, PNAS, 1985, 81: 6851). And existing techniques for producing single-chain antibodies (US Pat No. .4946778) can also be used to produce single-chain antibodies against subtilase 10.
  • Antibodies to subtilase 10 can be used in immunohistochemistry to detect subtilase 10 in biopsy specimens.
  • Monoclonal antibodies that bind to subtilase 10 can also be labeled with radioisotopes and injected into the body to track their location and distribution. This radiolabeled antibody can be used as a non-invasive diagnostic method to locate tumor cells and determine whether there is metastasis.
  • Antibodies can also be used to design immunotoxins that target a particular part of the body.
  • subtilin 10 high affinity monoclonal antibodies can covalently bind to bacterial or plant toxins (such as diphtheria toxin, ricin, ormosine, etc.).
  • a common method is to attack the amino group of the antibody with a thiol crosslinker such as SPDP and bind the toxin to the antibody through the exchange of disulfide bonds.
  • This hybrid antibody can be used to kill subtilase 10 positive cells.
  • the antibodies in the present invention can be used to treat or prevent diseases related to subtilase 10. Administration of an appropriate dose of antibody can stimulate or block the production or activity of subtilase 10.
  • the invention also relates to a diagnostic test method for quantitative and localized detection of subtilase 10 levels. These tests are well known in the art and include F I SH assays and radioimmunoassays.
  • the level of subtilase 10 detected in the test can be used to explain the importance of subtilase 10 in various diseases and to diagnose diseases in which subtilase 10 plays a role.
  • polypeptide of the present invention can also be used for peptide mapping analysis.
  • the polypeptide can be specifically cleaved physically, chemically, or hi, and one-dimensional or two-dimensional or three-dimensional gel electrophoresis analysis is performed, and mass spectrometry analysis is more preferable.
  • Polynucleotides encoding subtilase 10 can also be used for a variety of therapeutic purposes. Gene therapy technology can be used to treat abnormal cell proliferation, development, or metabolism caused by the non-expression or abnormal / inactive expression of subtilase 10.
  • Recombinant gene therapy vectors (such as viral vectors) can be designed to express mutated subtilase 10 to inhibit endogenous subtilase 10 activity.
  • a mutated subtilase 10 may be a shortened subtilase 10 lacking a signaling domain. Although it can bind to downstream substrates, it lacks signaling activity. Therefore, the recombinant gene therapy vector can be used for treating diseases caused by abnormal expression or activity of subtilase 10.
  • Virus-derived expression vectors such as retrovirus, adenovirus, adenovirus-associated virus, herpes simplex virus, parvovirus, etc. can be used to transfer a polynucleotide encoding a subtilase 10 into a cell.
  • a method for constructing a recombinant viral vector carrying a polynucleotide encoding a subtilase 10 can be found in the existing literature (Sambrook, et al.).
  • a recombinant polynucleotide encoding subtilase 10 can be packaged into liposomes and transferred into cells.
  • Methods for introducing a polynucleotide into a tissue or cell include: directly injecting the polynucleotide into a tissue in vivo; or introducing the polynucleotide into a cell in vitro through a vector (such as a virus, phage, or plasmid), and then transplanting the cell Into the body and so on.
  • a vector such as a virus, phage, or plasmid
  • Oligonucleotides including antisense RNA and DNA
  • ribozymes that inhibit subtilase 10 mRNA are also within the scope of the present invention.
  • a ribozyme is an enzyme-like RNA molecule that specifically decomposes specific RNA. Its mechanism is that the ribozyme molecule specifically hybridizes with a complementary target RNA for endonucleation.
  • Antisense RNA, DNA, and ribozymes can be obtained using any existing RNA or DNA synthesis techniques, such as solid-phase phosphate amide chemical synthesis to synthesize oligonucleotides.
  • Antisense RNA molecules can be obtained by in vitro or in vivo transcription of a DNA sequence encoding the RNA.
  • This DNA sequence has been integrated downstream of the RNA polymerase promoter of the vector.
  • it can be modified in a variety of ways, such as increasing the sequence length on both sides, and the phosphorothioate or peptide bond instead of the phosphodiester bond is used for the ribonucleoside linkage.
  • Polynucleotide encoding subtilase 10 can be used for diagnosis of diseases related to subtilase 10 Off.
  • a polynucleotide encoding subtilase 10 can be used to detect the expression of subtilase 10 or the abnormal expression of subtilase 10 in a disease state.
  • a DNA sequence encoding subtilase 10 can be used to hybridize biopsy specimens to determine the expression status of subtilase 10.
  • Hybridization techniques include Southern blotting, Northern blotting, and in situ hybridization. These techniques and methods are publicly available and mature, and related kits are commercially available.
  • polynucleotides of the present invention can be used as probes to be fixed on a microarray or a DNA chip (also referred to as a "gene chip") for analyzing differential expression analysis and gene diagnosis of genes in tissues.
  • RNA-polymerase chain reaction (RT-PCR) in vitro amplification with subtilase 10 specific primers can also detect subtilase 10 transcripts.
  • subtilase 10 mutations include point mutations, translocations, deletions, recombinations, and any other abnormalities compared to normal wild-type subtilisin 10 DNA sequences. Mutations can be detected using existing techniques such as Southern imprinting, DNA sequence analysis, PCR, and in situ hybridization. In addition, mutations may affect protein expression. Therefore, Northern blotting and Western blotting can be used to indirectly determine whether a gene is mutated.
  • sequences of the invention are also valuable for chromosome identification. This sequence will specifically target a specific position on a human chromosome and can hybridize to it. Currently, the specific loci of each gene on the chromosome need to be identified. Currently, only a few chromosome markers based on actual sequence data (repeating polymorphisms) can be used to mark chromosome locations. According to the present invention, in order to associate these sequences with disease-related genes, an important first step is to locate these DNA sequences on a chromosome.
  • PCR primers (preferably 15-35bp) are prepared from cDNA, which can be used to localize the sequence. Only those hybrid cells containing human genes corresponding to the primers will produce amplified fragments.
  • PCR localization of somatic hybrid cells is a quick way to localize DNA to specific chromosomes.
  • oligonucleotide primers of the present invention by a similar method, a set of fragments from a specific chromosome or a large number of genomic clones can be used to achieve sublocalization.
  • Other similar strategies that can be used for chromosomal localization include in situ hybridization, chromosome pre-screening with labeled flow sorting, and hybrid pre-selection to construct chromosome-specific cDNA libraries.
  • Fluorescent in situ hybridization of cDNA clones to metaphase chromosomes allows precise chromosomal localization in one step.
  • FISH Fluorescent in situ hybridization
  • the difference in cDNA or genomic sequence between the affected and unaffected individuals needs to be determined. If a mutation is observed in some or all of the affected individuals and the mutation is not observed in any normal individual, the mutation may be the cause of the disease. Comparing affected and unaffected individuals usually involves first looking for structural changes in the chromosome, such as deletions or translocations that are visible at the chromosomal level or detectable with cDNA sequence-based PCR. According to the resolution capabilities of current physical mapping and gene mapping technology, the cDNA accurately mapped to the disease-related chromosomal region can be one of 50 to 500 potentially pathogenic genes (assuming 1 megabase mapping resolution) Capacity and each 20kb corresponds to a gene).
  • the polypeptides, polynucleotides and mimetics, agonists, antagonists and inhibitors of the present invention can be used in combination with a suitable pharmaceutical carrier.
  • suitable pharmaceutical carrier can be water, glucose, ethanol, salts, buffers, glycerol, and combinations thereof.
  • the composition comprises a safe and effective amount of the polypeptide or antagonist, and carriers and excipients which do not affect the effect of the drug. These compositions can be used as drugs for the treatment of diseases.
  • the invention also provides a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the invention.
  • a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the invention.
  • these containers there may be instructional instructions given by government agencies that manufacture, use, or sell pharmaceuticals or biological products, which prompts permission for administration on the human body by government agencies that produce, use, or sell.
  • the polypeptides of the invention can be used in combination with other therapeutic compounds.
  • the pharmaceutical composition can be administered in a convenient manner, such as by a topical, intravenous, intraperitoneal, intramuscular, subcutaneous, intranasal or intradermal route of administration.
  • Subtilisin 10 is administered in an amount effective to treat and / or prevent a specific indication.
  • the amount and range of subtilisin 10 administered to a patient will depend on many factors, such as the mode of administration, the health conditions of the person to be treated, and the judgment of the diagnostician.
  • Total human fetal brain RN V was extracted by one-step method with guanidine isothiocyanate / phenol / chloroform.
  • Poly (A) mRNA was isolated from total RNA using Quik raRNA I solat ion Kit (product of Qiegene). 2ug poly (A) raRNA is reverse transcribed CDNA is formed.
  • the Smart cDNA cloning kit purchased from Clontech) was used to insert the cDNA fragment into the multicloning site of pBSK (+) vector (Clontech) to transform DH5a. The bacteria formed a cDNA library.
  • Dye terminate cycle react ion sequencing kit Perkin-Elmer
  • ABI 377 automatic sequencer Perkin-Elmer
  • the determined cDNA sequence was compared with the existing public DNA sequence database (Genebank), and it was found that the cDNA sequence of one of the clones 0495b07 was new DNA.
  • a series of primers were synthesized to determine the inserted cDNA fragments of the clone in both directions.
  • subtilisin 10 of the present invention The sequence of the subtilisin 10 of the present invention and the protein sequence encoded by the subtilisin 10 of the present invention were analyzed using the profile scan program (Basic local alignment search tool) in GCG [Al tschul, SF et al. J. Mol. BioL 1990; 215: 403-10 ], Perform domain analysis in databases such as prosite.
  • the subtilisin 10 of the present invention is homologous with the domain subtilase family at 14-65, and the homology result is shown in Fig. 1. The homology is 0.12 and the score is 6.13. The threshold is 5.70.
  • Example 3 Using RT-PCR method Cloning the gene encoding subtilase 10
  • CDNA was synthesized using fetal brain total RNA as a template and oligo-dT as a primer for reverse transcription reaction. After purification with Qiagene's kit, the following primers were used for PCR amplification:
  • Primerl 5'- GAAGTTTATTTCTTCTTCATGTGC -3 '(SEQ ID NO: 3)
  • Primer2 5'- CATAACAAATTTTAATAACTGGTT -3 '(SEQ ID NO: 4)
  • Primerl is a forward sequence starting at lbp at the 5 ′ end of SEQ ID NO: 1;
  • Primer2 is the 3, terminal reverse sequence of SEQ ID NO: 1.
  • Amplification conditions 50 ⁇ l reaction volume containing 50 ⁇ l / L KC1, 10 mmol / L Tris-HCl, pH 8.5, 1.5 mmol / L MgCl 2 , 200 ⁇ mol / L dNTP, lOpmol primer, 1U Taq DNA polymerase (Clontech).
  • the reaction was performed on a PE9600 DNA thermal cycler (Perkin-Elmer) for 25 cycles under the following conditions: 94 ° C 30sec; 55 ° C 30sec; 72. C 2rain.
  • ⁇ -act in was set as a positive control and template blank was set as a negative control.
  • the amplified product was purified using a QIAGEN kit and ligated to a PCR vector using a TA cloning kit (Invitrogen).
  • the DNA sequence analysis results showed that the DNA sequence of the PCR product was exactly the same as l-1278bp shown in SEQ ID NO: 1.
  • RNA extraction in one step includes acid guanidinium thiocyanate phenol-chloroform extraction. 4M guanidine isothiocyanate-25mM sodium citrate, 0.2M acetic acid Sodium (pH 4.0) was used to homogenize the tissue, 1 volume of phenol and 1/5 volume of chloroform-isoamyl alcohol (49: 1) were added, and the mixture was centrifuged. The aqueous phase layer was aspirated and isopropyl alcohol (0.8 (Volume) and centrifuge the mixture to obtain an RNA pellet. The resulting RNA pellet was washed with 70 ° /. Ethanol, dried and dissolved in water.
  • RNA in 20 mM 3- (N-morpholino) propanesulfonic acid (PH7.0) -5mM sodium acetate-ImM EDTA-2.2M formaldehyde on a 1.2% agarose gel for electrophoresis. Then transferred to a nitrocellulose membrane.
  • 32 P- was prepared by random primer method using ex- 32 P dATP. labeled DNA probe.
  • the DNA probe used was 10 subtilase coding sequence shown in Figure 1 PCR amplification (288 bp to 557bp).
  • the 32P- labeled probes (about 2 x l0 6 cpm / ml) Hybridize with RNA-transferred nitrocellulose membrane at 42 ° C overnight in a solution containing 50% formamide-25mM H 2 P0 4 (pH7.4) -5 ⁇ SSC-5 ⁇ Denhardt's solution and 200 g / ml salmon sperm DNA. After hybridization, the filter was washed in 1 ⁇ SSC-0.1% SDS at 55 ° C for 30 min. Then, it was analyzed and quantified by Phosphor Imager.
  • Example 5 Recombinant subtilase 10 in vitro expression, isolation and purification
  • Primer3 5'- CCCCATATGATGCGGGGAACAAATCCTTATTCTG -3 '(Seq ID No: 5)
  • Priraer4 5'- CATGGATCCCTAAACCATTATATTGCCTCCCTGG -3' (Seq ID No: 6)
  • These two primers contain Ndel and BamHI restriction sites, respectively.
  • the coding sequences of the 5 'and 3' ends of the target gene are followed, respectively.
  • the Ndel and BamHI restriction sites correspond to the selective endonucleases on the expression vector plasmid pET-28M +) (Novagen, Cat. No. 69865.3). Site.
  • the PCR reaction was performed using pBS-0495b07 plasmid containing the full-length target gene as a template.
  • the PCR reaction conditions are as follows: the total volume of 50 ⁇ 1 contains 10 pg of pBS-0495b07 plasmid, primers? 1 " ⁇ 61: -3 and? 1" ⁇ 61 "-4 are 10 11101, Advantage polymerase Mix (Clontech) 1 ⁇ 1. Cycle parameters: 94 ° C 20s, 60 ° C 30s, 68. C 2 Rain, a total of 25 cycles. Ndel and BamHI were used to double-digest the amplified product and plasmid pET-28 (+), respectively, and large fragments were recovered and ligated with T4 ligase.
  • the ligation product was transformed by a calcium chloride method for large intestine
  • Bacteria DH5a were cultured overnight on LB plates containing kanamycin (final concentration 30 g / ml), and then positive clones were screened by colony PCR and sequenced. Positive clones with the correct sequence (pET-0495b07) were selected by chlorination the recombinant plasmid was transformed into calcium E. coli BL21 (DE3) plySs (Novagen Co.).
  • subtilase 10 The following peptides specific for subtilase 10 were synthesized using a peptide synthesizer (product of PE):
  • the polypeptide is coupled with hemocyanin and bovine serum albumin to form a complex, respectively.
  • hemocyanin and bovine serum albumin For methods, see: Avrameas, eta l. Immunochemi stry, 1969; 6: 43. Rabbits were immunized with 4 mg of the hemocyanin polypeptide complex plus complete Freund's adjuvant, and 15 days later, the hemocyanin polypeptide complex plus incomplete Freund's adjuvant was used to boost immunity once.
  • a titer plate coated with a 15 g / ml bovine serum albumin peptide complex was used as an ELISA to determine antibody titers in serum-free serum.
  • Total IgG was isolated from antibody-positive rabbit sera using protein A-Sepharose.
  • the peptide was bound to a cyanogen bromide-activated Sepharos B column and anti-peptide antibodies were separated from the total IgG by affinity chromatography.
  • the immunoprecipitation method demonstrated that the purified antibody could specifically bind to subtilase 10.
  • Suitable oligonucleotide fragments selected from the polynucleotides of the present invention are used as hybridization probes in various aspects.
  • the probes can be used to hybridize to genomic or cDNA libraries of normal tissue or pathological tissue from different sources to It is determined whether it contains the polynucleotide sequence of the present invention and a homologous polynucleotide sequence is detected. Further, the probe can be used to detect the polynucleotide sequence of the present invention or its homologous polynucleotide sequence in normal tissue or pathology. Whether the expression in tissue cells is abnormal.
  • the purpose of this embodiment is to select a suitable oligonucleotide fragment from the polynucleotide SEQ ID NO: 1 of the present invention as a hybridization probe, and to identify whether some tissues contain the polynucleoside of the present invention by a filter hybridization method.
  • Filter hybridization methods include dot blotting, Southern blotting, Nor thern blotting, and copying methods. They are all used to fix the polynucleotide sample to be tested on the filter and then hybridize using basically the same steps.
  • the sample-immobilized filter is first pre-hybridized with a probe-free hybridization buffer, so that the non-specific binding site of the sample on the filter is saturated with the carrier and the synthetic polymer.
  • the pre-hybridization solution is then replaced with a hybridization buffer containing the labeled probe and incubated to hybridize the probe to the target nucleic acid.
  • the unhybridized probes are removed by a series of membrane washing steps.
  • This embodiment makes use of higher-strength film washing conditions (such as lower salt concentration and higher temperature), so that The hybridization background is reduced and only strong specific signals are retained.
  • the probes used in this embodiment include two types: the first type of probes are oligonucleotide fragments that are completely the same as or complementary to the polynucleotide SEQ ID NO: 1 of the present invention; the second type of probes are partially related to the present invention
  • the polynucleotide SEQ ID NO: 1 is the same or complementary oligonucleotide fragment.
  • the dot blot method is used to fix the sample on the filter membrane. Under the high-intensity washing conditions, the first type of probe and the sample have the strongest hybridization specificity and are retained.
  • the preferred range of probe size is 18-50 nucleotides
  • Those that meet the above conditions can be used as primary selection probes, and then further computer sequence analysis, including the primary selection probe and its source sequence region (ie, SEQ ID NO: 1) and other known genomic sequences and their complements The regions are compared for homology. If the homology with the non-target molecular region is greater than 85% or there are more than 15 consecutive bases, then the primary probe should not be used;
  • Probe 1 (probel), which belongs to the first type of probe, is completely homologous or complementary to the gene fragment of SEQ ID NO: 1 (41Nt)
  • Probe 1 which belongs to the second type of probe, is equivalent to the replacement mutation sequence (41Nt) of the gene fragment or its complementary fragment of SEQ ID NO: 1:
  • PBS phosphate buffered saline
  • step 8-13 are only used when contamination must be removed, otherwise step 14 can be performed directly.
  • NC membranes nitrocellulose membranes
  • the 32 P-Probe (the second peak is free ⁇ - "P-dATP) is prepared.
  • the sample membrane was placed in a plastic bag, and a 3-1 Omg pre-hybridization solution (lOxDenhardfs; 6xSSC, 0.1 mg / ml CT DNA (calf thymus DNA)) was added. After the bag was sealed, it was shaken in a 68 ° C water bath for 2 hours.
  • a 3-1 Omg pre-hybridization solution (lOxDenhardfs; 6xSSC, 0.1 mg / ml CT DNA (calf thymus DNA)
  • Gene chip or gene microarray is a new technology currently being developed by many national laboratories and large pharmaceutical companies. It refers to the orderly and high-density arrangement of a large number of target gene fragments on glass, The data is compared and analyzed on a carrier such as silicon using fluorescence detection and computer software to achieve the purpose of rapid, efficient, and high-throughput analysis of biological information.
  • the polynucleotide of the present invention can be used as target DNA for gene chip technology for high-throughput research of new gene functions; search for and screen new tissue-specific genes, especially new genes related to diseases such as tumors; diagnosis of diseases such as hereditary diseases .
  • the specific method steps have been reported in the literature. For example, see DeRisi, JL, Lyer, V. & Brown, P.0. (1997) Science 278, 680-686. And Helle, RA, Schema, M. Chai, A., Shalom, D., (1997) PNAS 94: 2150-2155.
  • a total of 4,000 polynucleotide sequences of various full-length cDM are used as target DNA, including the polynucleotides of the present invention. They were respectively amplified by PCR, and the concentration of the amplified product was adjusted to about 500 ng / ul after purification, and spotted on a glass medium with a Cartesian 7500 spotting instrument (purchased from Cartesian Company, USA). The distance between them is 280 ⁇ . The spotted slides were hydrated, dried, and cross-linked in a UV cross-linker. After elution, the slides were fixed to fix the DNA on the glass slides to prepare chips. The specific method steps have been variously reported in the literature. The post-spot processing steps of this embodiment are: 1. Hydration in a humid environment for 4 hours;
  • Total mRNA was extracted from normal liver and liver cancer in one step, and mRNA was purified using Oligotex mRNA Midi Kit (purchased from QiaGen).
  • the fluorescent reagent Cy3dUTP (5-Amino- propargy -2'-deoxyur idine) was separately reverse transcribed.
  • the probes from the two types of tissues and the chips were hybridized in a UniHyb TM Hybridization Solution (purchased from TeleChem) hybridization solution for 16 hours, washed with a washing solution (lx SSC, 0.2 SDS) at room temperature, and then scanned with a ScanArray 3000 scanner. (Purchased from General Scanning Company, USA) for scanning. The scanned image was analyzed and processed with Imagene software (Biodiscovery Company, USA), and the Cy3 / Cy5 ratio of each point was calculated. The points with the ratio less than 0.5 and greater than 2 were considered as expressions. Different genes.

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Organic Chemistry (AREA)
  • Zoology (AREA)
  • Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Wood Science & Technology (AREA)
  • Microbiology (AREA)
  • Biotechnology (AREA)
  • Biomedical Technology (AREA)
  • Molecular Biology (AREA)
  • Biochemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Enzymes And Modification Thereof (AREA)
  • Peptides Or Proteins (AREA)

Abstract

L'invention concerne un nouveau polypeptide, une subtilisine 10, et un polynucléotide codant pour ce polypeptide ainsi qu'un procédé d'obtention de ce polypeptide par des techniques recombinantes d'ADN. L'invention concerne en outre les applications de ce polypeptide dans le traitement de maladies, notamment des tumeurs malignes, de l'hémopathie, de l'infection par VIH, de maladies immunitaires et de diverses inflammations. L'invention concerne aussi l'antagoniste agissant contre le polypeptide et son action thérapeutique ainsi que les applications de ce polynucléotide codant pour la subtilisine 10.
PCT/CN2000/000567 1999-12-21 2000-12-11 Nouveau polypeptide, subtilisine 10, et polynucleotide codant pour ce polypeptide WO2001046249A1 (fr)

Priority Applications (1)

Application Number Priority Date Filing Date Title
AU19840/01A AU1984001A (en) 1999-12-21 2000-12-11 A novel polypeptide - subtilisin 10 and a polynucleotide sequence encoding the same

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
CN 99125655 CN1300849A (zh) 1999-12-21 1999-12-21 一种新的多肽-枯草蛋白酶10和编码这种多肽的多核苷酸
CN99125655.7 1999-12-21

Publications (1)

Publication Number Publication Date
WO2001046249A1 true WO2001046249A1 (fr) 2001-06-28

Family

ID=5284069

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/CN2000/000567 WO2001046249A1 (fr) 1999-12-21 2000-12-11 Nouveau polypeptide, subtilisine 10, et polynucleotide codant pour ce polypeptide

Country Status (3)

Country Link
CN (1) CN1300849A (fr)
AU (1) AU1984001A (fr)
WO (1) WO2001046249A1 (fr)

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1999053078A2 (fr) * 1998-04-15 1999-10-21 Genencor International, Inc. Protease humaine, son utilisation dans des applications pharmaceutiques et pour reduire l'allergenecite de proteines non humaines

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1999053078A2 (fr) * 1998-04-15 1999-10-21 Genencor International, Inc. Protease humaine, son utilisation dans des applications pharmaceutiques et pour reduire l'allergenecite de proteines non humaines

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
J. BIOL. CHEM., vol. 265, no. 6, 1990, pages 2997 - 3000 *

Also Published As

Publication number Publication date
AU1984001A (en) 2001-07-03
CN1300849A (zh) 2001-06-27

Similar Documents

Publication Publication Date Title
WO2001068684A1 (fr) Nouveau polypeptide, protocadherine humaine 14, et polynucleotide codant pour ce polypeptide
WO2001046249A1 (fr) Nouveau polypeptide, subtilisine 10, et polynucleotide codant pour ce polypeptide
WO2001083743A1 (fr) Polypeptide sous-unite 11 d'adducine alpha de globule rouge humain et polynucleotide codant pour ce polypeptide
WO2001088112A1 (fr) Nouveau polypeptide, kinase d'adhesion focale humaine (fak) 13, et polynucleotide codant pour ce polypeptide
WO2001071003A1 (fr) Nouveau polypeptide, serine protease humaine 8, et polynucleotide codant pour ce polypeptide
WO2001048220A1 (fr) Nouveau polypeptide, serine protease 15, et polynucleotide codant pour ce polypeptide
WO2001049727A1 (fr) Nouveau polypeptide, transducteur de signal 9 a effet chemotactique de bacteries, et polynucleotide codant pour ce polypeptide
WO2001049726A1 (fr) Nouveau polypeptide, recepteur du peptide natriuretique humain 18, et polynucleotide codant pour ce polypeptide
WO2001090348A1 (fr) Nouveau polypeptide, chaine lourde de myoglobuline humaine 11, et polynucleotide codant ce polypeptide
WO2001046247A1 (fr) Nouveau polypeptide, subtilisine 9, et polynucleotide codant pour ce polypeptide
WO2001079430A2 (fr) Nouveau polypeptide, serine protease humaine 9, et polynucleotide codant pour ce polypeptide
WO2001081392A1 (fr) Nouveau polypeptide, phosphoproteine nucleolaire humaine 13, et polynucleotide codant pour ce polypeptide
WO2001081592A1 (fr) Nouveau polypeptide, proteine humaine 11 contenant un fragment de sequence particulier d'une signal peptidase i, et polynucleotide codant pour ce polypeptide
WO2001049732A1 (fr) Nouveau polypeptide, transglutaminase 10, et polynucleotide codant pour ce polypeptide
WO2001074894A1 (fr) Nouveau polypeptide, proteine humaine de regulation 12 de la proteine phosphorylase, et polynucleotide codant pour ce polypeptide
WO2001094576A1 (fr) Nouveau polypeptide, proteine humaine 10 contenant un fragment de sequence particulier de la famille de l'adn polymerase a de replication, et polynucleotide codant pour ce polypeptide
WO2001077286A2 (fr) Nouveau polypeptide, globine humaine 58 de l'uterus, et un polynucleotide codant pour ce polypeptide
WO2001072807A1 (fr) Nouveau polypeptide, neuropeptide humain 11, et polynucleotide codant pour ce polypeptide
WO2001075029A2 (fr) Nouveau polypeptide, facteur humain 11 associe a nf-e2, et polynucleotide codant pour ce polypeptide
WO2001055406A1 (fr) Nouveau polypeptide, adn polymerase iii 18, et polynucleotide codant pour ce polypeptide
WO2001094373A1 (fr) Nouveau polypeptide, globuline humaine 10 de l'uterus, et polynucleotide codant ce polypeptide
WO2001064732A1 (fr) Nouveau polypeptide, facteur humain associe a la retrotransposition 14, et polynucleotide codant pour ce polypeptide
WO2001081386A1 (fr) Nouveau polypeptide, proteine pax humaine 12.5, et polynucleotide codant pour ce polypeptide
WO2001075024A2 (fr) Nouveau polypeptide, facteur humain 13 associe a nf-e2, et polynucleotide codant pour ce polypeptide
WO2001040288A1 (fr) Nouveau polypeptide, uteroglobine humaine 13, et polynucleotide codant pour ce polypeptide

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
REG Reference to national code

Ref country code: DE

Ref legal event code: 8642

122 Ep: pct application non-entry in european phase
NENP Non-entry into the national phase

Ref country code: JP

DPE2 Request for preliminary examination filed before expiration of 19th month from priority date (pct application filed from 20040101)