WO2001064720A1 - Nouveau polypeptide, lamine humaine 14, et polynucleotide codant pour ce polypeptide - Google Patents

Nouveau polypeptide, lamine humaine 14, et polynucleotide codant pour ce polypeptide Download PDF

Info

Publication number
WO2001064720A1
WO2001064720A1 PCT/CN2001/000253 CN0100253W WO0164720A1 WO 2001064720 A1 WO2001064720 A1 WO 2001064720A1 CN 0100253 W CN0100253 W CN 0100253W WO 0164720 A1 WO0164720 A1 WO 0164720A1
Authority
WO
WIPO (PCT)
Prior art keywords
polypeptide
polynucleotide
human
sequence
seq
Prior art date
Application number
PCT/CN2001/000253
Other languages
English (en)
Chinese (zh)
Inventor
Yumin Mao
Yi Xie
Original Assignee
Biowindow Gene Development Inc. Shanghai
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Biowindow Gene Development Inc. Shanghai filed Critical Biowindow Gene Development Inc. Shanghai
Priority to AU44058/01A priority Critical patent/AU4405801A/en
Publication of WO2001064720A1 publication Critical patent/WO2001064720A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides

Definitions

  • the present invention belongs to the field of biotechnology. Specifically, the present invention describes a novel polypeptide, human laminin 14, and a polynucleotide sequence encoding the polypeptide. The invention also relates to a preparation method and application of the polynucleotide and polypeptide. Background technique
  • Lamin is an extracellular matrix glycoprotein that is located in the basement layer of the cell membrane that separates epithelial cells from their matrix and the basement membrane that surrounds fat, muscle, and peripheral nerve cells.
  • Nuclear fibroin is a large molecular weight glycoprotein with three subunits A, B, and C bound by disulfide bonds.
  • the human laminin A chain contains a unique domain composed of many cysteine-rich repeats.
  • Domain G is spherical, contains 5 repeats, has several conserved glycines and cysteines, and has an Arg-Gly-Asp (RGD) sequence on its long arm.
  • the laminin A chain contains 20 internal cysteine-rich repeats, distributed in three non-adjacent clusters (domains IIIa, Illb, and V). Domain I + II has a continuous o-helical structure, and domains Iva, Ivb, and VI contain some ⁇ -sheet structures.
  • domains IIIa, Illb, and V The laminin A chain contains 20 internal cysteine-rich repeats, distributed in three non-adjacent clusters. Domain I + II has a continuous o-helical structure, and domains Iva, Ivb, and VI contain some ⁇ -sheet structures.
  • the main role of laminin is to bind cells to the matrix. The interaction of cells with lamin is mediated by many cell surface receptors. These receptors include integrins, membrane-bound proteoglycans (such as dystrophin, and other membrane-surface glycoproteins). Among them, integrins play a key role in the regulation of cell growth and differentiation by nuclear laminin.
  • laminin also includes the differentiation of synapses, [Current Opinion in Neurobiology 1996, 6: 97-103] and the promotion of muscle cell growth [J. Biol. Chera. 1997272: 28590-28595].
  • Studies of Alzheimer's disease have shown that zinc ion-activated laminin can bind to the amyloid precursor protein of Alzheimer's disease. [J. Biol. Chem. 1996 271: 6845-6851]
  • Laminin accelerates cell proliferation. Therefore, laminin plays a role in the growth and spread of fast cells. The growth and metastasis of tumor cells also play a role.
  • laminin plays a role in physiological processes such as axon growth, nerve cell regeneration, apoptosis, wound healing, and survival of transplanted tissues.
  • human lamin 14 protein plays an important role in regulating important functions of the body such as cell division and embryonic development, and it is believed that a large number of proteins are involved in these regulatory processes, so there has been a need in the art to identify more involved in these processes.
  • the human lamin protein 1 4 protein identifies the amino acid sequence of this protein.
  • the isolation of new human lamin 14 protein-coding genes also provides a basis for research to determine the role of the protein in health and disease states. This protein may form the basis for the development of diagnostic and / or therapeutic drugs for diseases, so it is important to isolate its coding DNA. Disclosure of invention
  • Another object of the invention is to provide a polynucleotide encoding the polypeptide.
  • Another object of the present invention is to provide a recombinant vector containing a polynucleotide encoding human lamin 14.
  • Another object of the present invention is to provide a method for producing human lamin 14.
  • Another object of the present invention is to provide an antibody against the polypeptide of the present invention-human laminin 1 4.
  • Another object of the present invention is to provide mimetic compounds, antagonists, agonists, and inhibitors of human laminin 14 against the polypeptide of the present invention.
  • Another object of the present invention is to provide a method for diagnosing and treating diseases associated with abnormalities in human laminin 14.
  • the present invention relates to an isolated polypeptide, which is of human origin, and includes: a polypeptide having the amino acid sequence of SEQ ID D. 2, or a conservative variant, biologically active fragment, or derivative thereof.
  • the polypeptide is a polypeptide having the amino acid sequence of SEQ ID NO: 2.
  • the invention also relates to an isolated polynucleotide comprising a nucleotide sequence or a variant thereof selected from the group consisting of:
  • polynucleotide complementary to polynucleotide (a);
  • sequence of the polynucleotide is one selected from the group consisting of: (a) a sequence having positions 445-822 in SEQ ID NO: 1; and (b) a sequence having positions 1-2 in SEQ ID NO: 1 031 bit sequence.
  • the present invention further relates to a vector, particularly an expression vector, containing the polynucleotide of the present invention; a host cell genetically engineered with the vector, including a transformed, transduced or transfected host cell; Host cell and method of preparing the polypeptide of the present invention by recovering the expression product.
  • the invention also relates to an antibody capable of specifically binding to a polypeptide of the invention.
  • the invention also relates to a method for screening compounds that mimic, activate, antagonize or inhibit the activity of human lamin 14 protein, which comprises utilizing the polypeptide of the invention.
  • the invention also relates to compounds obtained by this method.
  • the present invention also relates to a method for in vitro detection of a disease or susceptibility to disease associated with abnormal expression of human lamin protein 1 4 protein, comprising detecting a mutation in said polypeptide or its encoding polynucleotide / 3 ⁇ 4 column in a biological sample, Alternatively, the amount or biological activity of a polypeptide of the invention in a biological sample is detected.
  • the invention also relates to a pharmaceutical composition
  • a pharmaceutical composition comprising a polypeptide of the invention or a mimetic thereof, an activator, an antagonist or an inhibitor, and a pharmaceutically acceptable carrier.
  • the present invention also relates to the use of the polypeptide and / or polynucleotide of the present invention in the preparation of a medicament for treating ⁇ cancer, developmental disease or immune disease ⁇ or other diseases caused by abnormal expression of human nuclear fibrin 14.
  • Nucleic acid sequence refers to oligonucleotides, nucleotides or polynucleotides and fragments or parts thereof. It can also refer to genomic or synthetic DNA Or RNA, they can be single-stranded or double-stranded, representing the sense or antisense strand.
  • amino acid sequence refers to an oligopeptide, peptide, polypeptide or protein sequence and fragments or portions thereof.
  • amino acid sequence in the present invention relates to the amino acid sequence of a naturally occurring protein molecule, such "polypeptide” or “protein” does not mean to limit the amino acid sequence to a complete natural amino acid related to the protein molecule .
  • a “variant" of a protein or polynucleotide refers to an amino acid sequence having one or more amino acids or nucleotide changes or a polynucleotide sequence encoding it.
  • the changes may include deletions, insertions or substitutions of amino acids or nucleotides in the amino acid sequence or nucleotide sequence.
  • Variants can have "conservative" changes, in which the amino acid substituted has a structural or chemical property similar to the original amino acid, such as replacing isoleucine with leucine.
  • Variants can also have non-conservative changes, such as replacing glycine with tryptophan.
  • “Deletion” means the deletion of one or more amino acids or nucleotides in an amino acid sequence or nucleotide sequence. Missing:
  • Insertion refers to an alteration in the amino acid sequence or nucleotide sequence that results in an increase in one or more amino acids or nucleotides compared to a naturally occurring molecule.
  • Replacement refers to the replacement of one or more amino acids or nucleotides with different amino acids or nucleotides.
  • Bioactivity refers to a protein that has the structure, regulation, or biochemical function of a natural molecule.
  • immunologically active refers to the ability of natural, recombinant or synthetic proteins and fragments thereof to induce a specific immune response in appropriate animals or cells and to bind to specific antibodies.
  • An "agonist” refers to a molecule that, when combined with human lamin 14, can cause changes in the protein and thereby regulate the activity of the protein.
  • An agonist may include a protein, a nucleic acid, a carbohydrate, or any other molecule that binds human lamin 14.
  • Antagonist refers to a molecule that can block or regulate the biological or immunological activity of human laminin 14 when combined with human laminin 14.
  • Antagonists and inhibitors may include proteins, nucleic acids, carbohydrates, or any other molecule that binds human nuclear lamin 14.
  • Regular refers to a change in the function of human lamin 14, including high or “low bar activity, changes in binding properties, and any other biological, functional, or immune properties of human lamin 14 .
  • substantially pure means substantially free of other proteins, lipids, sugars or other substances with which it is naturally associated.
  • Those skilled in the art can purify human laminin 14 using standard protein purification techniques.
  • Substantially pure human lamin 14 produces a single main band on a non-reducing polyacrylamide gel.
  • the purity of human lamin 14 polypeptide can be analyzed by amino acid sequence.
  • Complementary refers to the natural binding of a polynucleotide by a base 3 ⁇ 4 pair under conditions of acceptable salt concentration and temperature.
  • sequence "C-T-G-A” may be combined with the complementary sequence "G-A-C-T”.
  • the complementarity between two single-stranded molecules may be partial or complete.
  • the degree of complementarity between nucleic acid strands has a significant effect on the efficiency and strength of hybridization between nucleic acid strands.
  • “Homology” refers to the degree of complementarity and can be partially homologous or completely homologous.
  • Partial, source refers to a partially complementary sequence that can at least partially inhibit the hybridization of a completely complementary sequence to a target nucleic acid. The inhibition of such hybridization can be detected by performing hybridization (Sou t hern imprinting or No r the rn blotting, etc.) under conditions of reduced stringency.
  • Substantially homologous sequences or hybridization probes can compete and inhibit the binding of fully homologous sequences to the target sequence under conditions of reduced stringency. This does not mean that conditions with reduced stringency allow non-specific binding, because conditions with reduced stringency require that the two sequences bind to each other as either specific or selective interactions.
  • Percent identity refers to the percentage of sequences that are identical or similar in the comparison of two or more amino acid or nucleic acid sequences. Percent identity can be determined electronically, such as through the MEGAL I GN program (Lasergene software package, DNASTAR, Inc., Madison Wis.). The MEGALIGN program can compare two or more sequences according to different methods such as the Cluster method (Higgins, DG and PM Sharp (1988) Gene 73: 237-244). The Clus ter method arranges groups of sequences into clusters by checking the distance between all pairs. The clusters are then assigned in pairs or groups.
  • sequence A and sequence B The percent identity between two amino acid sequences such as sequence A and sequence B is calculated by the following formula: The number of matching residues between sequence A and sequence X 100 The number of residues in sequence A-the number of spacer residues in sequence A Number of interval residues in a sequence B
  • the percent identity between nucleic acid sequences can also be determined by the Cluster method or by methods known in the art such as Jotun Hein (Hein J., (1990) Methods in emzumology 183: 625-645).
  • Similarity refers to the degree of identical or conservative substitutions of amino acid residues at corresponding positions in the alignment of amino acid sequences.
  • Amino acids used for conservative substitutions for example, negatively charged amino acids include aspartic acid and glutamic acid; positively charged amino acids can include lysine and arginine; similarly, uncharged head groups are similar Hydrophilic amino acids may include leucine, isoleucine and valine; glycine and alanine; asparagine and glutamine; serine and threonine; phenylalanine and tyrosine.
  • Antisense refers to a nucleotide sequence that is complementary to a particular DNA or RNA sequence.
  • Antisense strand refers to a nucleic acid strand that is complementary to a “sense strand.”
  • Derivative refers to a chemical modification of HFP or a nucleic acid encoding it. This chemical modification may be the replacement of a hydrogen atom with an alkyl, acyl or amino group. Nucleic acid derivatives can encode polypeptides that retain the main biological properties of natural molecules
  • Antibody refers to a complete antibody molecule and its fragments, such as Fa, F (ab ') 2 and Fv, which can specifically bind to the epitope of human laminin 14.
  • a “humanized antibody” refers to an antibody in which the amino acid sequence of a non-antigen binding region is replaced to become more similar to a human antibody, but still retains the original binding activity.
  • isolated refers to the removal of a substance from its original environment (for example, its natural environment if it occurs naturally).
  • a naturally occurring polynucleotide or polypeptide is not isolated when it is present in a living animal, but the same polynucleotide or polypeptide is separated from some or all of the substances that coexist with it in the natural system.
  • Such a polynucleotide may be one-half of a certain vector, or such a polynucleotide or polypeptide may be part of a certain composition. Since the carrier or composition is not a component of its natural environment, they are still isolated.
  • isolated means that the substance is separated from its original environment (if it is natural Natural material, the original environment is the natural environment).
  • natural Natural material the original environment is the natural environment.
  • polynucleotides and polypeptides in a natural state in a living cell are not isolated and purified, but the same polynucleotides or polypeptides are separated and purified if they are separated from other substances existing in the natural state. .
  • isolated human laminin 14 means that human laminin 14 is substantially free of other proteins, lipids, sugars, or other substances with which it is naturally associated. Those skilled in the art can purify human laminin 14 using standard protein purification techniques. Substantially pure polypeptides produce a single main band on a non-reducing polyacrylamide gel. The purity of human lamin polypeptides can be analyzed by amino acid sequence.
  • the present invention provides a new polypeptide, human laminin 14, which basically consists of the amino acid sequence shown in SEQ ID NO: 2.
  • the polypeptide of the present invention may be a recombinant polypeptide, a natural polypeptide, or a synthetic polypeptide, and preferably a recombinant polypeptide.
  • the polypeptides of the present invention can be naturally purified products or chemically synthesized products, or can be produced from prokaryotic or eukaryotic hosts (eg, bacteria, yeast, higher plants, insects, and mammalian cells) using recombinant techniques. Depending on the host used in the recombinant production protocol, the polypeptide of the invention may be glycosylated, or it may be non-glycosylated. Polypeptides of the invention may also include or exclude starting methionine residues.
  • the invention also includes fragments, derivatives and analogs of human laminin 14.
  • fragment refers to a polypeptide that substantially maintains the same biological function or activity of the human nuclear fibrin protein 14 of the present invention.
  • a fragment, derivative or analog of the polypeptide of the present invention may be: (I) a kind in which one or more amino acid residues are substituted with conservative or non-conservative amino acid residues (preferably conservative amino acid residues), and the substitution
  • the amino acid may or may not be encoded by a genetic code; or ( ⁇ ) such a group in which one or more amino acid residues are substituted by other groups to include a substituent; or (in) such One in which the mature polypeptide is fused to another compound (such as a compound that extends the half-life of the polypeptide, such as polyethylene glycol); or
  • polypeptide sequence such as a leader sequence or a secreted sequence or a sequence used to purify this polypeptide or a protein sequence
  • a polypeptide sequence formed by fusing additional amino acid sequences into a mature polypeptide.
  • fragments, 00 derivatives and analogs are considered to be within the knowledge of those skilled in the art.
  • the present invention provides an isolated nucleic acid (polynucleotide), which basically consists of a polynucleotide encoding a polypeptide having the amino acid sequence of SEQ ID NO: 2.
  • the polynucleotide sequence of the present invention includes the nucleotide sequence of SEQ ID NO: 1.
  • the polynucleotide of the present invention is found from a cDNA library of human fetal brain tissue.
  • the polynucleotide of the present invention may be in the form of DNA or RNA.
  • DNA forms include cDNA, genomic DNA, or synthetic DNA.
  • DNA can be single-stranded or double-stranded.
  • DNA can be a coding strand Or non-coding chain.
  • the coding region sequence encoding a mature polypeptide may be the same as the coding region sequence shown in SEQ ID NO: 1 or a degenerate variant.
  • a "degenerate variant" refers to a nucleic acid sequence encoding a protein or polypeptide having SEQ ID NO: 2 but different from the coding region sequence shown in SEQ ID NO: 1 in the present invention.
  • the polynucleotide encoding the mature polypeptide of SEQ ID NO: 2 includes: only the coding sequence of the mature polypeptide; the coding sequence of the mature polypeptide and various additional coding sequences; the coding sequence of the mature polypeptide (and optional additional coding sequences); Coding sequence.
  • polynucleotide encoding a polypeptide refers to a polynucleotide comprising the polypeptide and a polynucleotide comprising additional coding and / or non-coding sequences.
  • the invention also relates to variants of the polynucleotides described above, which encode polypeptides or fragments, analogs and derivatives of polypeptides having the same amino acid sequence as the invention.
  • Variants of this polynucleotide can be naturally occurring allelic variants or non-naturally occurring variants. These nucleotide variants include substitution variants, deletion variants, and insertion variants.
  • an allelic variant is a replacement form of a polynucleotide, which may be a substitution, deletion or insertion of one or more nucleotides, but does not change the polypeptide encoded by it in substance two.
  • the invention also relates to a polynucleotide that hybridizes to the sequence described above (having at least 50%, preferably 70% identity, between the two sequences).
  • the present invention particularly relates to polynucleotides that can hybridize to the polynucleotides of the present invention under stringent conditions.
  • "strict conditions” means: (1) hybridization and elution at lower ionic strength and higher temperature, such as 0.2xS SC, 0.1% SDS, 60'C; or (2 ) Add a denaturant during hybridization, such as 50% (v / v) formamide, 0.1% calf serum / 0.1 ° /.
  • hybridization occurs only when the identity between the two sequences is at least 95%, and more preferably 97%.
  • polypeptide encoded by the hybridizable polynucleotide has the same biological function and activity as the mature polypeptide shown in SEQ ID NO: 2.
  • nucleic acid fragments that hybridize to the sequences described above.
  • a "nucleic acid fragment” contains at least 10 nucleotides in length, preferably at least 20-30 nucleotides, more preferably at least 50-60 nucleotides, most preferably At least 100 nucleotides or more.
  • Nucleic acid fragments can also be used in nucleic acid amplification techniques (such as PCR) to identify and / or isolate polynucleotides encoding human laminin 14.
  • polypeptides and polynucleotides in the present invention are preferably provided in an isolated form and are more preferably purified to homogeneity.
  • the specific polynucleotide sequence encoding human laminin 14 of the present invention can be obtained by various methods.
  • polynucleotides are isolated using hybridization techniques well known in the art. These techniques include, but are not limited to: 1) hybridization of probes to genomic or cDNA libraries to detect homologous polynucleotide sequences, and 2) antibody screening of expression libraries to detect cloned polynucleosides with common structural characteristics Acid fragments.
  • the DNA fragment sequence of the present invention can also be obtained by the following methods: 1) Isolation of double-stranded DNA from genomic DNA Sequence: 2) Chemically synthesize a DNA sequence to obtain double-stranded DNA of the polypeptide.
  • genomic DNA isolation is the least commonly used. Direct chemical synthesis of DNA sequences is often the method of choice. The more commonly used method is the isolation of cDNA sequences.
  • the standard method for isolating the cDNA of interest is to isolate mRNA from donor cells that overexpress the gene and perform reverse transcription to form a plasmid or phage cDNA library.
  • the construction of cDNA libraries is also a common method (Sambrook, et al., Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory. New York. 1989).
  • Commercially available cDNA libraries are also available, such as different cDNA libraries from Clontech. When polymerase reaction technology is used in combination, even very small expression products can be cloned.
  • genes of the present invention can be selected from these cDNA libraries by conventional methods. These methods include (but are not limited to): (l) DNA-DNA or DNA-RNA hybridization; (2) the presence or absence of marker gene functions; (3) measuring the level of human lamin 14 transcripts; (4) ) Detection of protein products expressed by genes through immunological techniques or determination of biological activity. The above methods can be used singly or in combination.
  • the probe used for hybridization is homologous to any part of the polynucleotide of the present invention, and its length is at least 10 nucleotides, preferably at least 30 nucleotides, more preferably At least 50 nucleotides, preferably at least 100 nucleotides.
  • the length of the probe is usually within 2000 nucleotides, preferably within 1000 nucleotides.
  • the probe used here is generally a DNA sequence chemically synthesized based on the gene sequence information of the present invention.
  • the genes or fragments of the present invention can of course be used as probes.
  • DNA probes can be labeled with radioisotopes, luciferin, or enzymes (such as alkaline phosphatase).
  • immunological techniques such as Western blotting, radioimmunoprecipitation, and enzyme-linked immunosorbent assay (ELISA) can be used to detect the protein products of human lamin 14 gene expression .
  • ELISA enzyme-linked immunosorbent assay
  • a method of applying a PCR technique to amplify DNA / RNA is preferably used to obtain the gene of the present invention.
  • the RACE method RACE- rapid cDNA end amplification method
  • the primers used for PCR can be appropriately based on the polynucleotide sequence information of the present invention disclosed herein. Select and synthesize using conventional methods.
  • the amplified DNA / RNA fragments can be isolated and purified by conventional methods such as by gel electrophoresis.
  • polynucleotide sequence of the gene of the present invention or various DNA fragments and the like obtained as described above can be determined by a conventional method such as dideoxy chain termination method (Sanger et al. PNAS, 1977, 74: 5463-5467). Such polynucleotide sequences can also be determined using commercial sequencing kits and the like. In order to obtain the full-length cDNA sequence, the sequencing must be repeated. Sometimes it is necessary to determine the cDNA sequence of multiple clones in order to splice into a full-length cDNA sequence.
  • the present invention also relates to a vector comprising the polynucleotide of the present invention, and a host cell produced by genetic engineering using the vector of the present invention or directly using human lamin 14 coding sequence, and produced by recombinant technology A method of a polypeptide according to the invention.
  • a polynucleotide sequence encoding human laminin 14 can be inserted into a vector to constitute a recombinant vector containing the polynucleotide of the present invention.
  • vector refers to bacterial plasmids, phages, yeast plasmids, plant cell viruses, mammalian cell viruses such as adenoviruses, retroviruses, or other vectors well known in the art.
  • Vectors suitable for use in the present invention include, but are not limited to: T7 promoter-based expression vectors (Rosenberg, et al.
  • any plasmid and vector can be used to construct a recombinant expression vector.
  • An important feature of expression vectors is that they usually contain an origin of replication, a promoter, a marker gene, and translational regulatory elements.
  • the expression vector also includes a ribosome binding site and a transcription terminator for translation initiation. Inserting the enhancer sequence into the vector will enhance its transcription in higher eukaryotic cells.
  • the enhancer is a cis-acting factor for DNA expression, usually about 10 to 300 hydrobase pairs. Transcription. Examples include 100 to 270 base pairs of SV40 enhancer at a later stage of the replication initiation point, polyoma enhancer and adenovirus enhancer at the late side of the replication initiation point.
  • the expression vector preferably contains one or more selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
  • selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
  • GFP fluorescent protein
  • tetracycline or ampicillin resistance for E. coli.
  • a polynucleotide encoding human laminin 14 or a recombinant vector containing the polynucleotide can be transformed or transduced into a host cell to form a genetically engineered host cell containing the polynucleotide or the recombinant vector.
  • the term "host cell” refers to a prokaryotic cell, such as a bacterial cell; or a lower eukaryotic cell, such as a yeast cell; or a higher eukaryotic cell, such as a mammalian cell. Representative examples are: E.
  • coli Streptomyces
  • bacterial cells such as Salmonella typhimurium
  • fungal cells such as yeast
  • plant cells insect cells
  • animal cells such as CH0, COS or Bowes s melanoma cells.
  • Transformation of a host cell with a DNA sequence described in the present invention or a recombinant vector containing the DNA sequence can be performed using conventional techniques well known to those skilled in the art.
  • the host is a prokaryote such as E. coli
  • competent cells capable of DNA uptake can be in the exponential growth phase were harvested, treated with CaC l 2 method, step Can be used it is well known in the art.
  • the alternative is to use MgC l 2 .
  • transformation can also be performed by electroporation.
  • the following DNA transfection methods can be used: calcium phosphate co-precipitation method, or conventional mechanical methods such as microinjection, electroporation, and liposome packaging.
  • polynucleotide sequence of the present invention can be used to express or produce recombinant human lamin protein 14 (Scence, 1984; 224: 1431). Generally there are the following:
  • the medium used in the culture may be selected from various conventional mediums. Culture is performed under conditions suitable for host cell growth. After the host cells have grown to an appropriate cell density, the selected promoter is induced by a suitable method (such as temperature conversion or chemical induction), and the cells are cultured for a period of time.
  • a suitable method such as temperature conversion or chemical induction
  • the recombinant polypeptide can be coated in the cell, or expressed on the cell membrane, or secreted outside the cell. If necessary, it can be separated and purified by various separation methods using its physical, chemical and other properties.
  • Recombinant protein These methods are well known to those skilled in the art. These methods include, but are not limited to: conventional renaturation treatment, protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid chromatography (HPLC) and various other liquid chromatography techniques and combinations of these methods.
  • conventional renaturation treatment protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid
  • Fig. 1 is a comparison diagram of gene chip expression profiles of human laminin 14 and human laminin B2 chain of the present invention.
  • the upper figure is a graph of the expression profile of human lamin 14, and the sequence below is a graph of the expression profile of the human lamin B2 chain.
  • FIG. 2 is a polyacrylamide gel electrophoresis image (SDS-PAGE) of human lamin protein 14 isolated.
  • 14KDa is the molecular weight of the protein.
  • the arrow indicates the isolated protein band. The best way to implement the invention
  • RNA from human fetal brain was extracted by guanidine isothiocyanate / phenol / chloroform method.
  • Poly (A) mRNA was isolated from total RNA using Quik raRNA Isolation Kit (Qiegene). 2ug poly (A) mRNA is reverse transcribed to form cDNA.
  • the Smart cDNA cloning kit purchased from Clontech was used to insert the cDNA fragment into the multicloning site of pBSK (+) vector (Clontech) to transform DH5 ⁇ . The bacteria formed a cDNA library.
  • the 0109D05 clone contains a full-length cDNA of 2031bp (as shown in Seq IDN0: 1), and has a 378bp open reading frame (0RF) from 445b P to 822bp, encoding a new protein (such as Seq ID NO : Shown in 2).
  • This clone pBS-0109D05 and the encoded protein was named human nuclear lamin protein 14.
  • Example 2 Cloning of a gene encoding human laminin 14 by RT-PCR
  • CDNA was synthesized using fetal brain total RNA as a template and oligo-dT as a primer for reverse transcription reaction. After purification using Qiagene's kit, the following primers were used for PCR amplification:
  • Primerl 5'- GAACAAAGAGATGTTAAAATATAG -3 '(SEQ ID NO: 3)
  • Priraer2 5'- ACTGCTCTCCCCTTCCCCGGTCCC-3 '(SEQ ID NO: 4)
  • Primerl is a forward sequence starting at lbp of the 5th end of SEQ ID NO: 1;
  • Priraer2 is the 3 'end reverse sequence in SEQ ID NO: 1.
  • Amplification reaction conditions 50 leg ol / L KC1, 10 mmol / L Tris-CI, (pH8.5), 1.5 mmol / L MgCl 2 , 200 ⁇ mol / L dNTP, lOpmol in a reaction volume of 50 ⁇ 1 Primer, 1U of Taq DNA polymerase (Clontech).
  • the reaction was performed on a PE9600 DNA thermal cycler (Perkin-Elmer) under the following conditions for 25 cycles: 94 ° C 30sec; 55 ° C 30sec; 72 ° C 2min.
  • ⁇ -act in was set as a positive control and template blank was set as a negative control.
  • Amplification products were purified using QIAGEN kits and TA The cloning kit was ligated to a pCR vector (Invitrogen). The DNA sequence analysis results showed that the DNA sequence of the PCR product was exactly the same as l_2031bp shown in SEQ ID NO: 1.
  • Example 3 Northern blot analysis of human laminin 14 gene expression:
  • a 32P-labeled probe (about 2 x 10 6 cpm / ml) was hybridized with a nitrocellulose membrane to which RNA was transferred at 42 ° C overnight in a solution containing 50% formamide-25mM KH 2 P0 4 (pH7.4) -5 x SSC- 5 x Denhardt's solution and 200 ⁇ g / nil salmon sperm DNA. After hybridization, the filter was washed in ix SSC-0.1% SDS at 55 ° C for 30 min. Then, Phosphor Imager was used for analysis and quantification.
  • Example 4 In vitro expression, isolation and purification of recombinant human lamin 14
  • Primer 3 5'- CATGCTAGCATGGTGAGGAGGGGGTGCAGTTAC -3 '(Seq ID No: 5)
  • Primer 4 5'- CCCGAGCTCTCAGGATGACTCAAATTCAGGTGC -3, (Seq ID No: 6)
  • These two primers contain Nhel and Sacl restriction sites respectively , followeded by the coding sequences of the 5 'end and 3' end of the gene of interest, respectively, and the Nhe I and Sac I restriction sites correspond to the expression vector plasmid pET-28 b (+) (Novagen product, Cat. No. 69865.3 Selective endonuclease sites on).
  • the pBS-0109D05 plasmid containing the full-length target gene was used as a template for the PCR reaction.
  • the PCR reaction conditions were as follows: 10 pg of P BS-0109D05 plasmid, Primer-3, and Primer-4 were included in a total volume of 50 ⁇ 1 [J is lOpmol, Advantage polymerase Mix (Clontecli) 1 ⁇ 1. Cycle parameters: 94 ° C 20s, 60 ° C 30s, 68 ° C 2 min, a total of 25 cycles. Nhel and Sacl were used to double digest the amplified product and plasmid P ET-28 (+), respectively, and large fragments were recovered and ligated with T4 ligase.
  • the ligation product was transformed into colibacillus DH5c by the calcium chloride method. After being cultured overnight in LB plates containing kanamycin (final concentration 30 g / ml), positive colonies were screened by colony PCR and sequenced: select the correct sequence Positive clone (pET-0109D05)
  • the recombinant plasmid was transformed into E. coli BL21 (DE3) plySs (product of Novagen) using the calcium chloride method.
  • E. coli BL21 DE3
  • plySs product of Novagen
  • NH2-Met-Val-Arg-Arg-Gly-Cys-Ser-Tyr-Arg-Trp-Thr-Thr-Met-Leu-Arg-COOH SEQ ID NO: 7
  • the polypeptide is coupled to hemocyanin and bovine serum albumin to form a couple, respectively.
  • hemocyanin and bovine serum albumin for the method, see: Avrameas, et al. Immunochemi s try, 1969; 6:43. Immunize with 4mg of the above II cyanoprotein peptide complex plus complete Freund's adjuvant, and then 15 days later use hemocyanin polypeptide complex ⁇ incomplete complete Freund's adjuvant to boost the immunity once.
  • Suitable oligonucleotide fragments selected from the polynucleotides of the present invention are used as hybridization probes in a variety of ways.
  • the probes can be used to hybridize to genomic or cDNA libraries of normal tissue or pathological tissue from different sources to It is identified whether it contains the polynucleotide sequence of the present invention and a homologous polynucleotide sequence is detected.
  • the probe can also be used to detect the polynucleotide sequence of the present invention or its homologous polynucleotide sequence in normal tissues or Whether the expression in pathological tissue cells is abnormal.
  • the purpose of this embodiment is to select a suitable oligonucleotide fragment from the polynucleotide SEQ ID NO: 1 of the present invention as a hybridization probe, and to identify whether some tissues contain the polynucleoside of the present invention by a filter hybridization method.
  • Filter hybridization methods include dot blotting, Southern blotting, Nor thern blotting, and copying methods. They all use the same stepwise hybridization after fixing the polynucleotide sample to be tested on the filter.
  • the sample-immobilized filter is first pre-hybridized with a probe-free hybridization buffer, so that the non-specific binding site of the sample on the filter is saturated with the carrier and the synthetic polymer.
  • the pre-hybridization solution is then replaced with a hybridization buffer containing labeled probes, and Incubation hybridizes the probe to the target nucleic acid.
  • the unhybridized probes are removed by a series of membrane washing steps.
  • This embodiment utilizes higher-intensity washing conditions (such as lower salt concentration and higher temperature) to reduce the hybridization background and retain only strong specific signals.
  • the probes used in this embodiment include two types: the first type of probes are oligonucleotide fragments that are completely the same as or complementary to the polynucleotide SEQ ID NO: 1 of the present invention; the second type of probes are partially related to the present invention
  • the polynucleotide SEQ ID NO: 1 is the same or complementary oligonucleotide fragment.
  • the dot blot method is used to fix the sample on the filter membrane. Under the high-intensity washing conditions, the first type of probe and the sample have the strongest hybridization specificity and are retained.
  • oligonucleotide fragments for use as hybridization probes from the polynucleotide SEQ ID NO: 1 of the present invention should follow the following principles and several aspects to be considered:
  • the preferred range of probe size is 18-50 nucleotides
  • the GC content is 30% -70%, and the non-specific hybridization increases when it exceeds;
  • Those that meet the above conditions can be used as primary selection probes, and then further computer sequence analysis, including the primary selection probe and its source sequence region (ie, SEQ ID NO: 1) and other known genomic sequences and their complements The regions are compared for homology. If the homology with the non-target molecular region is greater than 85% or there are more than 15 consecutive bases, the primary probe should not be used;
  • Probe 1 which belongs to the first type of probe, is completely homologous or complementary to the gene fragment of SEQ ID NO: 1 (41Nt):
  • Probe 2 which belongs to the second type of probe, is equivalent to the replacement mutation sequence (41Nt) of the gene fragment of SEQ ID NO: 1 or its complementary fragment:
  • PBS phosphate buffered saline
  • step 8-13 are only used when contamination must be removed, otherwise step 14 can be performed directly.
  • NC membranes nitrocellulose membranes
  • Gene microarrays or DNA microarrays are new technologies currently being developed by many national laboratories and large pharmaceutical companies. It refers to the orderly and high-density arrangement of a large number of target gene fragments on glass, The data is compared and analyzed on a carrier such as silicon using fluorescence detection and computer software to achieve the purpose of rapid, efficient, and high-throughput analysis of biological information.
  • the polynucleotide of the present invention can be used as target DNA for gene chip technology for high-throughput research of new gene functions; search for and screen new tissue-specific genes, especially new genes related to diseases such as tumors; diagnosis of diseases such as hereditary diseases .
  • the specific method steps have been reported in the literature, for example, see the literature DeRi si, JL, Lyer, V.
  • a total of 4,000 polynucleotide sequences of various full-length cDNAs are used as target DNA, including the polynucleotide of the present invention. They were amplified by PCR respectively, and the concentration of the amplified product was adjusted to about 500ng / ul after purification. The spots were spotted on a glass medium with a Cartesian 7500 spotting instrument (purchased by Cartesian Company, USA). The distance between them is 280 ⁇ ⁇ . The spotted slides were hydrated, dried, and cross-linked in a purple diplomatic coupling instrument. After elution, the DNA was fixed on a glass slide to prepare a chip. The specific method steps have been variously reported in the literature, and the post-spotting processing steps of this embodiment are:
  • Total mRNA was extracted from human mixed tissues and specific tissues (or stimulated cell lines) using a one-step method, and the mRNA was purified using Oligotex mRNA Midi Kit (purchased from QiaGen).
  • the fluorescent reagent Cy3dUTP 5— Amino-propargyl- 2'- deoxyuridine 5'- triphate coupled to Cy3 fluorescent dye (purchased from Amersham Phamacia Biotech) was used to label the mRNA of human mixed tissue, and the fluorescent reagent Cy5dUTP (5-Araino-propargyl-2'-deoxyur idine) was used.
  • the above specific tissues are thymus, testis, muscle, spleen, lung, skin, thyroid, liver, PMA + Ecv304 cell line, PMA-Ecv304 cell line, L02 cell line to starve, Arsenic stimulated the L02 cell line and prostate tissue for 1 hour.
  • the polypeptide of the present invention and the antagonists, agonists and inhibitors of the polypeptide can be directly used in the treatment of diseases.
  • it can treat malignant tumors, adrenal deficiency, skin diseases, various types of inflammation, HIV infection and immunity Sexually transmitted diseases.
  • Lamin is an extracellular matrix glycoprotein, located on the basement layer of the cell membrane that separates epithelial cells from the underlying matrix, and on the basement membrane that surrounds fat, muscle, and peripheral nerve cells.
  • Cell-plasmin interactions are mediated through many cell surface receptors. These receptors include integrins, membrane-connected proteoglycans (such as dystrophin), and other membrane-surface glycoproteins. Among them, integrins play a key role in regulating cell growth and differentiation. The role of laminin also includes differentiation of synapses and promotion of muscle cell growth.
  • laminin plays a role in accelerating cell growth and spread, and tumor cell growth and metastasis.
  • laminin also plays a role in physiological processes such as axon growth, regeneration of nerve cells, apoptosis, wound healing, and survival of transplanted tissues.
  • the expression profile of the polypeptide of the present invention is consistent with the expression profile of the human laminin B2 chain, and both have similar biological functions. It is closely related to axon growth, nerve cell regeneration, apoptosis, wound healing, and survival of transplanted tissues in vivo. Its abnormal expression is usually related to tumorigenesis and spread, Alzheimer's disease, inflammation repair, nerve regeneration, etc. The pathological process is extremely close and produces related diseases.
  • human laminin 14 of the present invention will produce various diseases, especially Alzheimer's disease, tumor growth, embryonic developmental disorders, abnormal inflammation and repair, growth and development disorders, immunity Sexually transmitted diseases, including but not limited to:
  • Tumors of various tissues neuroblastoma, astrocytoma, ependymoma, glioblastoma, neurofibroblastoma, liver cancer, lung cancer, esophageal cancer, breast cancer, leukemia, lymphoma, thyroid tumor, uterine muscle Tumor, colon cancer, melanoma, bladder cancer, uterine cancer, endometrial cancer, colon cancer, thymic tumor, nasopharyngeal cancer, laryngeal cancer, tracheal tumor, fibroid, fibrosarcoma, lipoma, liposarcoma embryonic developmental disorder Symptoms: Congenital abortion, cleft palate, limb loss, limb differentiation disorder, atrial septal defect, neural tube defect, congenital hydrocephalus, congenital glaucoma or cataract, congenital deafness
  • Growth and development disorders mental retardation, brain development disorders, skin, fat and muscle dysplasia, bone and joint dysplasia, sexual retardation
  • Inflammation and repair abnormalities chronic active hepatitis, sarcoidosis, polymyositis, chronic rhinitis, chronic gastritis, multiple sclerosis of the cerebral spinal cord, glomerulonephritis, myocarditis, cardiomyopathy, atherosclerosis, gastric ulcer, child Cervicitis, various infectious inflammations, pyloric stenosis, tracheal stenosis after injury, mitral stenosis, aortic stenosis, pulmonary stenosis, constrictive pericarditis
  • Immune diseases systemic lupus erythematosus, rheumatoid arthritis, bronchial asthma, urticaria, Specific dermatitis, post-infection myocarditis, scleroderma, myasthenia gravis, Guillain-Barre syndrome
  • human laminin 14 of the present invention will also produce certain hereditary, hematological diseases and the like.
  • the polypeptide of the present invention and the antagonists, agonists and inhibitors of the polypeptide can be directly used in the treatment of diseases, for example, it can treat various diseases, especially Alzheimer's disease, tumor growth, embryonic developmental disorders, inflammation and repair Abnormalities, nerve regeneration, growth disorders, immune diseases, certain hereditary, hematological diseases, etc.
  • the invention also provides methods for screening compounds to identify agents that increase (agonist) or suppress (antagonist) human nuclear fibrin 14. Agonists enhance biological functions such as human laminin 14 to stimulate cell proliferation, while antagonists prevent and treat disorders related to excessive cell proliferation such as various cancers.
  • mammalian cells or a membrane preparation expressing human laminin 14 can be cultured with labeled human laminin 14 in the presence of a drug. The ability of the drug to increase or block this interaction is then determined.
  • Antagonists of human laminin 14 include antibodies, compounds, receptor deletions, and the like that have been screened. Antagonists of human laminin 14 can bind to human laminin 14 and eliminate its function, or inhibit the production of the polypeptide, or bind to the active site of the polypeptide so that the polypeptide cannot perform biological functions.
  • human lamin 14 When screening compounds as antagonists, human lamin 14 can be added to bioanalytical assays to determine whether the compound is an antagonist by measuring the effect of the compound on the interaction between human lamin 14 and its receptor . Receptor deletions and analogs that act as antagonists can be screened in the same manner as described above for screening compounds.
  • Polypeptide molecules capable of binding to human lamin 14 can be obtained by screening a random peptide library composed of various possible combinations of amino acids bound to a solid phase. During screening, human laminin 14 molecules should generally be labeled.
  • the present invention provides a method for producing antibodies using polypeptides, and fragments, derivatives, analogs or cells thereof as antigens. These antibodies can be polyclonal or monoclonal antibodies.
  • the invention also provides antibodies against human lamin 14 epitopes. These antibodies include (but are not limited to): polyclonal antibodies, monoclonal antibodies, chimeric antibodies, single chain antibodies, Fab fragments, and fragments generated from Fab expression libraries.
  • Polyclonal antibodies can be produced by direct injection of human laminin 14 into immunized animals (such as home immunity, mice, rats, etc.).
  • immunized animals such as home immunity, mice, rats, etc.
  • adjuvants can be used to enhance the immune response, including but not limited to Freund's adjuvant .
  • Techniques for preparing monoclonal antibodies to human laminin 14 include, but are not limited to, hybridoma technology (Kohler and Miste in. Nature, 1975, 256: 495-497), triple tumor technology, human beta-cell hybridization Tumor technology, EBV-hybridoma technology, etc.
  • Chimeric antibodies that bind human constant regions to non-human variable regions can be produced using existing techniques (Morrison et al, PNAS, 1985, 81: 6851), while single-chain antibodies have been produced
  • the technology (US Pat No. 4946778) can also be used to produce single-chain antibodies against human laminin 14.
  • Anti-human laminin 14 antibodies can be used in immunohistochemical techniques to detect human laminin 14 in biopsy specimens.
  • Monoclonal antibodies that bind to human lamin 14 can also be labeled with radioisotopes and injected into the body to track their location and distribution. This radiolabeled antibody can be used as a non-invasive diagnostic method to locate tumor cells and determine whether there is metastasis.
  • Antibodies can also be used to design immunotoxins that target a particular part of the body.
  • human laminin 14 high-affinity monoclonal antibodies can covalently bind to bacterial or plant toxins (such as diphtheria toxin, ricin, ormosine, etc.).
  • a common method is to attack the amino group of an antibody with a sulfhydryl crosslinker such as SPDP, and toxin is bound to the antibody through the exchange of diphenyl bonds.
  • SPDP sulfhydryl crosslinker
  • This hybrid antibody can be used to kill human lamin 14 positive cells .
  • the antibodies of the present invention can be used to treat or prevent diseases related to human laminin 14. Administration of appropriate doses of antibodies can stimulate or block the production or activity of human laminin 14.
  • the invention also relates to a diagnostic test method for quantitative and localized detection of human laminin 14 levels.
  • tests are well known in the art and include FI SH assays and radioimmunoassays.
  • the levels of human lamin 14 detected in the test can be used to explain the importance of human lamin 14 in various diseases and to diagnose diseases in which human lamin 14 plays a role.
  • polypeptide of the present invention can also be used for peptide mapping analysis.
  • the polypeptide can be specifically cleaved by physical, chemical or enzymatic analysis, and subjected to one-dimensional or two-dimensional or three-dimensional gel electrophoresis analysis, and more preferably mass spectrometry analysis.
  • the polynucleotide encoding human lamin 14 can also be used for a variety of therapeutic purposes. Gene therapy technology can be used to treat abnormal cell proliferation, development or metabolism caused by the non-expression or abnormal / inactive expression of human lamin 14.
  • Recombinant gene therapy vectors (such as viral vectors) can be designed to express mutated human laminin 14 to inhibit endogenous human laminin 14 activity.
  • a variant human lamin 14 may be a shortened human lamin 14 lacking a signaling domain. Although it can bind to downstream substrates, it lacks signaling activity. Therefore, the recombinant gene therapy vector can be used for treating diseases caused by abnormal expression or activity of human lamin 14.
  • Virus-derived expression vectors such as retroviruses, adenoviruses, adenovirus-associated viruses, herpes simplex virus, parvoviruses, and the like can be used to transfer polynucleotides encoding human laminin 14 into cells.
  • a method for constructing a recombinant viral vector carrying a polynucleotide encoding human laminin 14 can be found in the existing literature (Sambrook, et al.).
  • a recombinant polynucleotide encoding human laminin 14 can be packed into lipid In vivo transfer into cells.
  • Methods for introducing a polynucleotide into a tissue or cell include: injecting the polynucleotide directly into a tissue in vivo; or introducing the polynucleotide into a cell through a vector (such as a virus, phage, or plasmid) in vitro, The cells are then transplanted into the body and the like.
  • a vector such as a virus, phage, or plasmid
  • Oligonucleotides including antisense RNA and DNA
  • ribozymes that inhibit human lamin 14 mRNA are also within the scope of the present invention.
  • a ribozyme is an enzyme-like RNA molecule that can specifically decompose specific RNA. Its mechanism of action is that the ribozyme molecule specifically hybridizes with a complementary target RNA for endonucleation.
  • Antisense RNA, DNA, and ribozymes can be obtained using any existing RNA or DNA synthesis technology, such as solid-phase phosphate amide chemical synthesis to synthesize oligonucleotides.
  • Antisense RNA molecules can be obtained by in vitro or in vivo transcription of a DNA sequence encoding the RNA.
  • This DNA sequence has been integrated downstream of the vector's RNA polymerase promoter.
  • it can be modified in a variety of ways, such as increasing the sequence length on both sides, and the linkage between ribonucleosides using phosphorothioate or peptide bonds instead of phosphodiester bonds.
  • the polynucleotide encoding human laminin 14 can be used for the diagnosis of diseases related to human laminin 14.
  • the polynucleotide encoding human lamin 14 can be used to detect the expression of human lamin 14 or the abnormal expression of human lamin 14 in a disease state.
  • the DNA sequence encoding human lamin 14 can be used to hybridize biopsy specimens to determine the expression of human lamin 14.
  • Hybridization techniques include Southern blotting, Nor thern blotting, and in situ hybridization. These techniques and methods are publicly available and mature, and related kits are commercially available.
  • Part or all of the polynucleotides of the present invention can be used as probes to be fixed on a microarray (Microray) or a DM chip (also known as a "gene chip") for analyzing differential expression analysis and gene diagnosis of genes in tissues .
  • Human lamin 14-specific primers can also be used to detect human lamin 14 transcripts by in vitro amplification of RNA-polymerase chain reaction (RT-PCR).
  • Detection of mutations in the human lamin 14 gene can also be used to diagnose human lamin 14-related diseases.
  • Human lamin 14 mutations include point mutations, translocations, deletions, recombinations, and any other abnormalities compared to normal wild-type human lamin 14 DNA sequences. Mutations can be detected using existing techniques such as Southern blotting, DNA sequence analysis, PCR and in situ hybridization. In addition, the mutation may affect the expression of the protein. Therefore, the Nor thern blotting and Western blotting can be used to indirectly determine whether a gene is mutated.
  • the sequence of the present invention is also valuable for chromosome identification. The sequence specifically targets a specific position on a human chromosome and can hybridize to it.
  • chromosome Currently, specific sites for each gene on the chromosome need to be identified. Currently, only a few chromosome markers based on actual sequence data (repeating polymorphisms) are available for marking chromosome positions. According to the present invention, in order to associate these sequences with disease-related genes, an important first step is to locate these DNA sequences on a chromosome.
  • PCR primers (preferably 15-35 bp) are prepared based on cDNA, and the sequence can be mapped on the chromosome. These primers were then used for PCR screening of somatic hybrid cells containing individual human chromosomes. Only those hybrid cells that contain the human gene corresponding to the primer will produce amplified fragments. PCR localization of somatic hybrid cells is a quick way to localize DNA to specific chromosomes. Using the oligonucleotide primers of the present invention, by a similar method, a set of fragments from a specific chromosome or a large number of genomic clones can be used to achieve sublocalization. Other similar strategies that can be used for chromosomal localization include in situ hybridization, chromosome pre-screening with labeled flow sorting, and hybrid pre-selection to construct chromosome-specific cDNA libraries.
  • Fluorescent in situ hybridization of cDNA clones with metaphase chromosomes allows precise chromosomal localization in a single step.
  • FISH Fluorescent in situ hybridization
  • the physical location of the sequence on the chromosome can be correlated with the genetic map data. These data can be found in, for example, V. Mckusick, Mendel ian Inheritance in Man (available online with Johns Hopkins University Welch Medical Library). Linkage analysis can then be used to determine the relationship between genes and diseases that have been mapped to chromosomal regions.
  • the difference in cDNA or genomic sequence between the affected and unaffected individuals needs to be determined. If a mutation is observed in some or all diseased individuals and the mutation is not observed in any normal individuals, the mutation may be the cause of the disease. Comparing affected and unaffected individuals usually involves first looking for structural changes in chromosomes, such as deletions or translocations that are visible at the chromosomal level or detectable with cDNA sequence-based PCR. According to the resolution capabilities of current physical mapping and gene mapping technology, the cDNA accurately mapped to the chromosomal region associated with the disease can be one of 50 to 500 potentially pathogenic genes (assuming 1 megabase mapping resolution) Capacity and each 20kb corresponds to a gene).
  • the polypeptides, polynucleotides and mimetics, agonists, antagonists and inhibitors of the present invention can be used in combination with a suitable pharmaceutical carrier.
  • suitable pharmaceutical carrier can be water, glucose, ethanol, salts, buffers, glycerol, and combinations thereof.
  • the composition comprises a safe and effective amount of the polypeptide or antagonist, and carriers and excipients which do not affect the effect of the drug. These compositions can be used as drugs for the treatment of diseases.
  • the invention also provides a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the invention.
  • a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the invention.
  • these containers there may be instructional instructions given by government agencies that manufacture, use, or sell pharmaceuticals or biological products, which prompts permission for administration on the human body by government agencies that produce, use, or sell.
  • the polypeptides of the invention can be used in combination with other therapeutic compounds.
  • the pharmaceutical composition can be administered in a convenient manner, such as by a topical, intravenous, intraperitoneal, intramuscular, subcutaneous, intranasal or intradermal route of administration.
  • Human lamin 14 is administered in an amount effective to treat and / or prevent a specific indication.
  • the amount and dose range of human lamin 14 to be administered to a patient will depend on a number of factors, such as the mode of administration, the health conditions of the person to be treated, and the judgment of the diagnostician.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • Zoology (AREA)
  • Genetics & Genomics (AREA)
  • Medicinal Chemistry (AREA)
  • Molecular Biology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Toxicology (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Peptides Or Proteins (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Abstract

L'invention concerne un nouveau polypeptide, une lamine humaine 14, et un polynucléotide codant pour ce polypeptide ainsi qu'un procédé d'obtention de ce polypeptide par des techniques recombinantes d'ADN. L'invention concerne en outre les applications de ce polypeptide dans le traitement de maladies, notamment la maladie d'Alzheimer, l'oncogenèse, les troubles du développement de l'embryon, les inflammations et les anomalies de réparation associées, la neurogenèse, les troubles du développement et de la croissance, les maladies immunitaires, l'hémopathie et l'infection par VIH. L'invention concerne aussi l'antagoniste agissant contre le polypeptide et son action thérapeutique ainsi que les applications de ce polynucléotide codant pour la lamine humaine 14.
PCT/CN2001/000253 2000-03-02 2001-02-26 Nouveau polypeptide, lamine humaine 14, et polynucleotide codant pour ce polypeptide WO2001064720A1 (fr)

Priority Applications (1)

Application Number Priority Date Filing Date Title
AU44058/01A AU4405801A (en) 2000-03-02 2001-02-26 A novel polypeptide-homo lamin 14 and polynucleotide encoding said polypeptide

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
CN00111845.5 2000-03-02
CN 00111845 CN1311233A (zh) 2000-03-02 2000-03-02 一种新的多肽——人核纤层蛋白14和编码这种多肽的多核苷酸

Publications (1)

Publication Number Publication Date
WO2001064720A1 true WO2001064720A1 (fr) 2001-09-07

Family

ID=4581741

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/CN2001/000253 WO2001064720A1 (fr) 2000-03-02 2001-02-26 Nouveau polypeptide, lamine humaine 14, et polynucleotide codant pour ce polypeptide

Country Status (3)

Country Link
CN (1) CN1311233A (fr)
AU (1) AU4405801A (fr)
WO (1) WO2001064720A1 (fr)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2004064773A2 (fr) * 2003-01-15 2004-08-05 Chiron Corporation Inhibition d'une e3-ubiquitine ligase, hakai, destinee au traitement de troubles a evolution chronique

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CA2758061C (fr) 2009-05-29 2016-06-28 Panasonic Corporation Systeme de biocapteur et procede permettant de mesurer la concentration en analyte

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
DATABASE GENBANK [online] 13 August 1999 (1999-08-13), BIAMONTI G. ET AL., Database accession no. A45023 *
ZHOU JIANTAO: "Lamin and cell proliferation", BIOTIC CHEMISTRY, vol. 17, no. 3, 1997, pages 23 - 24 *

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2004064773A2 (fr) * 2003-01-15 2004-08-05 Chiron Corporation Inhibition d'une e3-ubiquitine ligase, hakai, destinee au traitement de troubles a evolution chronique
WO2004064773A3 (fr) * 2003-01-15 2004-11-11 Chiron Corp Inhibition d'une e3-ubiquitine ligase, hakai, destinee au traitement de troubles a evolution chronique

Also Published As

Publication number Publication date
CN1311233A (zh) 2001-09-05
AU4405801A (en) 2001-09-12

Similar Documents

Publication Publication Date Title
WO2001064720A1 (fr) Nouveau polypeptide, lamine humaine 14, et polynucleotide codant pour ce polypeptide
WO2001068684A1 (fr) Nouveau polypeptide, protocadherine humaine 14, et polynucleotide codant pour ce polypeptide
WO2001070964A1 (fr) Nouveau polypeptide, proteine humaine de transport de glucose 18, et polynucleotide codant pour ce polypeptide
WO2001079432A2 (fr) Nouveau polypeptide, facteur humain de transcription de la differentiation cellulaire 58, et polynucleotide codant pour ce polypeptide
WO2001075023A2 (fr) Nouveau polypeptide, phosphatidylinositol-3 (ptdins 3) kinase humaine 9, et polynucleotide codant pour ce polypeptide
WO2001068873A1 (fr) Nouveau polypeptide, molecule humaine d'adhesion intercellulaire 12, et polynucleotide codant pour ce polypeptide
WO2001074876A1 (fr) Nouveau polypeptide, phosphatidylinositol-3 kinase humaine 14, et polynucleotide codant pour ce polypeptide
WO2001075101A1 (fr) Nouveau polypeptide, proteine humaine de regulation de la transcription 8, et polynucleotide codant pour ce polypeptide
WO2001048004A1 (fr) Nouveau polypeptide, proteine de liaison de l'heparine 10, et polynucleotide codant pour ce polypeptide
WO2001072790A1 (fr) Nouveau polypeptide, proteine humaine p40 12 de facteur l1, et polynucleotide codant pour ce polypeptide
WO2001064744A1 (fr) Nouveau polypeptide, facteur de croissance du fibroblaste 14, et polynucleotide codant pour ce polypeptide
WO2001066584A1 (fr) Nouveau polypeptide, proteine humaine pax 9, et polynucleotide codant pour ce polypeptide
WO2001079423A2 (fr) Nouveau polypeptide, proteine humaine bcr 10, et polynucleotide codant pour ce polypeptide
WO2001064730A1 (fr) Nouveau polypeptide, 5-phosphatase humaine 18, et polynucleotide codant pour ce polypeptide
WO2001075124A1 (fr) Nouveau polypeptide, proteine humaine de regulation de la transcription 9, et polynucleotide codant pour ce polypeptide
WO2001073061A1 (fr) Nouveau polypeptide, proteine humaine 22 du retinoblastome, et polynucleotide codant pour ce polypeptide
WO2001074887A1 (fr) Nouveau polypeptide, proteine humaine 9 humsiah, et polynucleotide codant pour ce polypeptide
WO2001081399A1 (fr) Nouveau polypeptide, proteine pax humaine 14, et polynucleotide codant pour ce polypeptide
WO2001064732A1 (fr) Nouveau polypeptide, facteur humain associe a la retrotransposition 14, et polynucleotide codant pour ce polypeptide
WO2001081537A2 (fr) Nouveau polypeptide, sous-unite 49 humaine du facteur c(a1) 37kd de replication de l'adn, et polynucleotide codant pour ce polypeptide
WO2001074893A1 (fr) Nouveau polypeptide, proteine humaine de regulation de la transcription 11.8, et polynucleotide codant pour ce polypeptide
WO2001074892A1 (fr) Nouveau polypeptide, proteine antigene prostatique specifique membranaire 12, et polynucleotide codant pour ce polypeptide
WO2001081392A1 (fr) Nouveau polypeptide, phosphoproteine nucleolaire humaine 13, et polynucleotide codant pour ce polypeptide
WO2001055183A1 (fr) Nouveau polypeptide, laminine humaine 24, et polynucleotide codant pour ce polypeptide
WO2001068874A1 (fr) Nouveau polypeptide, polypeptide humain d'activation endotheliale ii-62, et polynucleotide codant pour ce polypeptide

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
122 Ep: pct application non-entry in european phase
REG Reference to national code

Ref country code: DE

Ref legal event code: 8642

NENP Non-entry into the national phase

Ref country code: JP