WO2002012507A1 - Nouveau polypeptide, aminoacyl-arnt synthetase humaine 29, et polynucleotide codant ce polypeptide - Google Patents

Nouveau polypeptide, aminoacyl-arnt synthetase humaine 29, et polynucleotide codant ce polypeptide Download PDF

Info

Publication number
WO2002012507A1
WO2002012507A1 PCT/CN2001/001014 CN0101014W WO0212507A1 WO 2002012507 A1 WO2002012507 A1 WO 2002012507A1 CN 0101014 W CN0101014 W CN 0101014W WO 0212507 A1 WO0212507 A1 WO 0212507A1
Authority
WO
WIPO (PCT)
Prior art keywords
polypeptide
polynucleotide
trna synthetase
human aminoacyl
sequence
Prior art date
Application number
PCT/CN2001/001014
Other languages
English (en)
Chinese (zh)
Inventor
Yumin Mao
Yi Xie
Original Assignee
Biowindow Gene Development Inc. Shanghai
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Biowindow Gene Development Inc. Shanghai filed Critical Biowindow Gene Development Inc. Shanghai
Priority to AU93640/01A priority Critical patent/AU9364001A/en
Publication of WO2002012507A1 publication Critical patent/WO2002012507A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/93—Ligases (6)
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides

Definitions

  • the present invention belongs to the field of biotechnology. Specifically, the present invention describes a new polypeptide, a human 5 aminoacyl-tRNA synthetase 29, and a polynucleotide sequence encoding the polypeptide. The invention also relates to a preparation method and application of the polynucleotide and polypeptide. Background technique
  • RNA In the body, for genes whose final product is RNA, as long as transcription and post-transcription processing are performed, the entire process of gene expression is completed; for genes whose final product is protein, mRNA must also be translated into protein. There is no direct structural relationship between the nucleotide sequence of raRNA and the amino acid sequence of proteins. These two different genetic languages require translators to communicate with each other. These translators play a variety of tRNA molecules. Codons for protein translation are determined by the interaction between mRNA and tRNA carrying amino acids. The tRNA molecule itself cannot catalyze the load of the corresponding amino acid, and a corresponding aminoacyl-tRNA synthetase is required to catalyze the completion.
  • Each tRNA molecule has a specific region for aminoacyl-tRNA synthetase to recognize, which is the codon on the tRM molecule.
  • Protein translation also requires the presence and synergy of ribosomes and related factors. It can be seen that protein translation is an extremely complicated process. Any abnormal action of any substance in the plant will cause abnormal protein translation and expression, and then cause various related diseases.
  • Aminoacyl-tRNA synthetases from different sources have been cloned from a variety of eukaryotes and higher organisms, and the biological activities of these enzymes in vivo have been studied.
  • Hermann et al. Cloned a new human aminoacyl-tRNA synthetase from humans and found that the protein has similar structure and biological activity to known aminoacyl-tRNA synthetases.
  • the amino acid sequence also contains a conserved structural region. This region is important for enzymes to bind tRNA and catalyze protein translation.
  • This enzyme plays an important regulatory role in the translation process of proteins, it can recognize a group of isotropic tRNAs, and synergize with them to catalyze the completion of amino acid translation process.
  • the mutation or abnormal expression of this enzyme will cause abnormal protein translation, and then cause various related diseases.
  • the enzyme may be closely related to the occurrence of malignant diseases such as gastric cancer in vivo [Hermann Lü, Manf red Die tel etal., 1996, Gene, 178: 187-189] 0
  • the new human protein of the present invention has 98% identity and 98% similarity with the known murine aminoacyl-tRNA synthetase at the protein level, and the protein sequence also contains a conserved aminoacyl-tRNA Synthetic enzyme active action center. It can be seen that this protein is a new human aminoacyl-tRNA synthetase, named Human aminoacyl-tRNA synthetase 29. This enzyme has similar structural characteristics to known human aminoacyl-tRNA synthetases, and both have similar biological functions. The protein binds to the corresponding tRNA in the body and acts synergistically to regulate the normal progress of the protein translation process.
  • the enzyme is usually closely related to the development of various tissues and metabolic disorders, tumors of some tissues and cancer (such as gastric cancer) in the body. It can also be used to diagnose and treat the various related diseases mentioned above.
  • the human aminoacyl-tRNA synthetase 29 protein plays an important role in regulating important functions of the body such as cell division and embryonic development, and it is believed that a large number of proteins are involved in these regulatory processes, so the identification of more participation has been required in the field
  • These processes of the human aminoacyl-tRNA synthetase 29 protein in particular, identify the amino acid sequence of this protein.
  • Isolation of the novel human aminoacyl-tRNA synthetase 29 protein encoding gene also provides a basis for research to determine the role of this protein in health and disease states. This protein may form the basis for the development of diagnostic and / or therapeutic drugs for diseases, so it is important to isolate its coding DNA. Disclosure of invention
  • Another object of the invention is to provide a polynucleotide encoding the polypeptide.
  • Another object of the present invention is to provide a recombinant vector containing a polynucleotide encoding human aminoacyl-tRNA synthetase 29.
  • Another object of the present invention is to provide a genetically engineered host cell containing a polynucleotide encoding human aminoacyl-tRNA synthetase 29.
  • Another object of the present invention is to provide a method for producing human aminoacyl-tRNA synthetase 29.
  • Another object of the present invention is to provide an antibody against the polypeptide-human aminoacyl-tRNA synthetase 29 of the present invention.
  • Another object of the present invention is to provide mimic compounds, antagonists, agonists, and inhibitors against the polypeptide of the present invention-human aminoacyl-tRNA synthetase 29.
  • Another object of the present invention is to provide a method for diagnosing and treating diseases associated with abnormality of human aminoacyl-tRM synthase 29.
  • the present invention relates to an isolated polypeptide, which is of human origin and comprises: a polypeptide having the amino acid sequence of SEQ ID No. 2, or a conservative variant, biologically active fragment or derivative thereof.
  • the polypeptide is a polypeptide having the amino acid sequence of SEQ ID NO: 2.
  • the present invention also relates to an isolated polynucleotide comprising a nucleotide sequence selected from the group consisting of: Its variant:
  • sequence of the polynucleotide is one selected from the group consisting of: (a) having SEQ ID NO: 1
  • the invention further relates to a vector, in particular an expression vector, containing the polynucleotide of the invention; a host cell genetically engineered with the vector, including a transformed, transduced or transfected host cell; and a method comprising culturing said Host cell and method of preparing the polypeptide of the present invention by recovering the expression product.
  • a vector in particular an expression vector, containing the polynucleotide of the invention
  • a host cell genetically engineered with the vector including a transformed, transduced or transfected host cell
  • a method comprising culturing said Host cell and method of preparing the polypeptide of the present invention by recovering the expression product.
  • the invention also relates to an antibody capable of specifically binding to a polypeptide of the invention.
  • the invention also relates to a method for screening compounds that mimic, activate, antagonize or inhibit the activity of human aminoacyl-tRNA synthetase 29 protein, which comprises using the polypeptide of the invention.
  • the present invention also relates to a method for detecting a disease or disease susceptibility related to the abnormal expression of human aminoacyl-tRNA synthetase 29 protein15 in vitro by using the method, which comprises detecting the polypeptide or a polynucleus encoding the same in a biological sample. Mutations in the nucleotide sequence, or the amount or biological activity of a polypeptide of the invention in a biological sample.
  • the invention also relates to a pharmaceutical composition
  • a pharmaceutical composition comprising a polypeptide of the invention or a mimetic thereof, an activator, an antagonist or an inhibitor, and a pharmaceutically acceptable carrier.
  • the present invention also relates to the use of the polypeptide and / or polynucleotide of the present invention for the preparation of a medicament for treating cancer, developmental disease or immune disease or other diseases caused by abnormal expression of human aminoacyl-tRNA synthetase 29.
  • Nucleic acid sequence refers to an oligonucleotide, a nucleotide or a polynucleotide and a fragment or part thereof, and may also refer to a genome or a synthesis DNA or RNA, they can be single-stranded or double-stranded, representing the sense or antisense strand.
  • amino acid sequence refers to an oligopeptide, peptide, polypeptide or protein sequence and fragments or portions thereof.
  • amino acid sequence in the present invention relates to the amino acid sequence of a naturally occurring protein molecule, such "polypeptide” or “protein” does not mean to limit the amino acid sequence to a complete natural sequence related to the 50 molecules of the protein. Amino acid.
  • a protein or polynucleotide “variant” refers to an amino acid sequence having one or more amino acids or nucleotide changes, or a polynucleotide sequence encoding it.
  • the changes may include amino acid sequences or nucleotides A deletion, insertion, or substitution of an amino acid or nucleotide in a sequence.
  • Variants may have "conservative" changes in which the substituted amino acid has a structural or chemical property similar to the original amino acid, such as replacing isoleucine with leucine.
  • Variants can also have non-conservative changes, such as replacing glycine with tryptophan.
  • “Deletion” means the deletion of one or more amino acids or nucleotides in an amino acid sequence or nucleotide sequence.
  • Insertion refers to an alteration in the amino acid sequence or nucleotide sequence that results in an increase in one or more amino acids or nucleotides compared to a naturally occurring molecule.
  • Replacement refers to the replacement of one or more amino acids or nucleotides with different amino acids or nucleotides.
  • Bioactivity refers to a protein that has the structure, regulation, or biochemical function of a natural molecule.
  • immunologically active refers to the ability of natural, recombinant, or synthetic proteins and fragments thereof to induce a specific immune response and to bind specific antibodies in a suitable animal or cell.
  • An "agonist” refers to a molecule that, when combined with human aminoacyl-tRNA synthetase 29, causes a change in the protein to regulate the activity of the protein.
  • An agonist may include a protein, a nucleic acid, a carbohydrate, or any other molecule that binds human aminoacyl-tRNA synthetase 29.
  • Antagonist refers to a molecule that can block or regulate the biological or immunological activity of human aminoacyl-tRNA synthetase 29 when combined with human aminoacyl-tRNA synthetase 29.
  • Antagonists and inhibitors can include proteins, nucleic acids, carbohydrates or any other molecule that can bind human aminoacyl-tMA synthetase 29.
  • Regular refers to a change in the function of human aminoacyl-tRNA synthetase 29, including an increase or decrease in protein activity, 10 a change in binding characteristics, and any other biological properties, functions, or Changes in immune properties.
  • Substantially pure 11 means substantially free of other proteins, lipids, sugars or other substances with which it is naturally associated.
  • Those skilled in the art can purify human aminoacyl-tRNA synthetase 29 using standard protein purification techniques.
  • Substantially pure human aminoacyl-tRNA synthetase 29 produces a single major 15 band on a non-reducing polyacrylamide gel.
  • the purity of the human aminoacyl-tRNA synthetase 29 polypeptide can be analyzed by amino acid sequence.
  • Complementary refers to the natural binding of polynucleotides by base-pairing under conditions of acceptable salt concentration and temperature.
  • sequence C-T-G-A
  • complementary sequence G-A-C-T.
  • the complementarity between two single-stranded molecules may be partial or complete.
  • the degree of complementarity between nucleic acid strands has a significant effect on the efficiency and strength of hybridization between nucleic acid strands.
  • “Homology” refers to the degree of complementarity and can be partially or completely homologous.
  • "Partial homology” refers to a partially complementary sequence that at least partially inhibits hybridization of a fully complementary sequence to a target nucleic acid. This inhibition of hybridization can be achieved by hybridization under conditions of reduced stringency (Sou thern India Traces or Northern blots). Substantially homologous sequences or hybridization probes can compete and inhibit the binding of completely homologous sequences to target sequences under conditions of reduced stringency. This does not mean that the conditions of reduced stringency allow non-specific binding, because the conditions of reduced stringency require that the two sequences bind to each other as a specific or selective interaction.
  • Percent identity refers to the percentage of sequences that are the same or similar in a comparison of two or more amino acid or nucleic acid sequences. Percent identity can be determined electronically, such as through the MEGALIGN program
  • the MEGALIGN program can compare two or more sequences according to different methods such as the Clus ter method (Hi gg ins, DG and PM Sharp (1988) Gene 73: 237-244).
  • the Clus ter method arranges groups of sequences into clusters by checking the distance between all pairs. The clusters are then assigned in pairs or groups.
  • the percent identity between two amino acid sequences such as sequence A and sequence B is calculated by the following formula: The number of matching residues between sequence A and sequence X 100 The number of residues in sequence A-the number of spacer residues in sequence A The number of spacer residues in a sequence B can also be determined by Clus ter method or using methods known in the art such as Jotun Hein. The percent identity between nucleic acid sequences (He in J., (1990) Methods in emzumology 183: 625-645 ) 0
  • Similarity refers to the degree of identical or conservative substitutions of amino acid residues at corresponding positions in the alignment of amino acid sequences.
  • Amino acids used for conservative substitutions for example, negatively charged amino acids may include aspartic acid and glutamic acid; positively charged amino acids may include lysine and arginine; having an uncharged head group is Similar hydrophilic amino acids may include leucine, isoleucine and valine; glycine and alanine; asparagine and glutamine; serine and threonine; phenylalanine and tyrosine.
  • Antisense refers to a nucleotide sequence that is complementary to a particular DNA or RNA sequence.
  • Antisense strand refers to a nucleic acid strand that is complementary to a “sense strand.”
  • Derivative refers to a chemical modification of HFP or a nucleic acid encoding it. This chemical modification may be a substitution of a hydrogen atom with a fluorenyl, acyl or amino group. Nucleic acid derivatives can encode polypeptides that retain the main biological properties of natural molecules.
  • Antibody refers to a complete antibody molecule and its fragments, such as Fa, ⁇ ( ⁇ ) 2 and? , It can specifically bind to the epitope of human aminoacyl-tRNA synthetase 29.
  • a “humanized antibody” refers to an antibody in which the amino acid sequence of a non-antigen binding region is replaced to become more similar to a human antibody, but still retains the original binding activity.
  • isolated refers to the removal of a substance from its original environment (for example, its natural environment if it occurs naturally).
  • a naturally occurring polynucleotide or polypeptide is not isolated when it is present in a living animal, but the same polynucleotide or polypeptide is separated from some or all of the substances that coexist in the natural system.
  • Such a polynucleotide may be part of a vector,
  • polynucleotide or polypeptide is part of a certain composition. Since the carrier or composition is not part of its natural environment, they are still isolated.
  • isolated refers to the separation of a substance from its original environment (if it is a natural substance, the original environment is the natural environment).
  • polynucleotides and polypeptides in a natural state in a living cell are not separated and purified, but the same polynucleotides or polypeptides coexist in the same state as in a natural state.
  • L0 is separated and purified from other materials.
  • isolated human aminoacyl-tRNA synthetase 29 means human aminoacyl-tRM synthetase 29 is substantially free of other proteins, lipids, carbohydrates, or other substances with which it is naturally associated. Those skilled in the art can purify human aminoacyl-tRNA synthetase 29 using standard protein purification techniques. Substantially pure peptides can produce a single main band on a non-reducing polyacrylamide gel. Human aminoacyl-tRNA synthesis
  • the purity of the enzyme 29 peptide can be analyzed by amino acid sequence.
  • the present invention provides a new polypeptide, human aminoacyl-tRNA synthetase 29, which is basically composed of the amino acid sequence shown in SEQ ID NO: 2.
  • the polypeptide of the present invention may be a recombinant polypeptide, a natural polypeptide, or a synthetic polypeptide, and preferably a recombinant polypeptide.
  • Polypeptides of the invention can be naturally purified products or chemically synthesized products, or can be obtained from prokaryotic or eukaryotic hosts (e.g., bacteria, yeast, higher plants, insects and
  • polypeptide of the invention may be glycosylated, or it may be non-glycosylated.
  • Polypeptides of the invention may also include or exclude initial methionine residues.
  • the invention also includes fragments, derivatives and analogs of human aminoacyl-tRNA synthetase 29.
  • fragments, derivatives and analogs of human aminoacyl-tRNA synthetase 29 As used in the present invention, the terms “fragment”, “derivative” and “analog” refer to those who substantially maintain the present invention
  • a fragment, derivative, or analog of the polypeptide of the present invention may be: (I) a kind in which one or more amino acid residues are substituted with conservative or non-conservative amino acid residues (preferably conservative amino acid residues), and the substitution
  • the amino acid may or may not be encoded by a genetic codon; or ( ⁇ ) a type in which a group on one or more amino acid residues is replaced by another group to include a substituent; or ( ⁇ ⁇ )
  • Such a
  • the mature polypeptide is fused to another compound (such as a compound that prolongs the half-life of the polypeptide, such as polyethylene glycol); or (IV) such a polypeptide sequence in which the additional amino acid sequence is fused into the mature polypeptide (such as the leader Sequence or secreted sequence or the sequence or protein sequence used to purify this polypeptide)
  • another compound such as a compound that prolongs the half-life of the polypeptide, such as polyethylene glycol
  • additional amino acid sequence such as the leader Sequence or secreted sequence or the sequence or protein sequence used to purify this polypeptide
  • the present invention provides an isolated nucleic acid (polynucleotide), which basically consists of a polynucleotide encoding a polypeptide having the amino acid sequence of SEQ ID NO: 2.
  • the polynucleotide sequence of the present invention includes the nucleotide sequence of SEQ ID NO: 1.
  • the polynucleotide of the present invention is found from a CDM library of human fetal brain tissue. It contains a polynucleotide sequence of 1893 bases in length and its open reading frame 6 39-1433 encodes 264 amino acids. According to the amino acid sequence homology comparison, it was found that this polypeptide has 98% homology with human aminoacyl-tRNA synthetase. It can be deduced that the human aminoacyl-tRNA synthetase 29 has a similar structure and Features.
  • the polynucleotide of the present invention may be in the form of DNA or RNA.
  • DNA forms include cDNA, genomic DM, or synthetic DM.
  • DM can be single-stranded or double-stranded.
  • DNA can be coding or non-coding.
  • the coding region sequence encoding a mature polypeptide may be the same as the coding region sequence shown in SEQ ID NO: 1 or a degenerate variant.
  • a "degenerate variant" refers to a nucleic acid sequence encoding a protein or polypeptide having SEQ ID NO: 2 in the present invention, but which differs from the coding region sequence shown in SEQ ID NO: 1.
  • the polynucleotide encoding the mature polypeptide of SEQ ID NO: 2 includes: only the coding sequence of the mature polypeptide; the coding sequence of the mature polypeptide and various additional coding sequences; the coding sequence of the mature polypeptide (and optional additional coding sequences); Coding sequence.
  • polynucleotide encoding a polypeptide refers to a polynucleotide comprising the polypeptide and a polynucleotide comprising additional coding and / or non-coding sequences.
  • the invention also relates to variants of the polynucleotides described above, which encode polypeptides or fragments, analogs and derivatives of polypeptides having the same amino acid sequence as the invention.
  • Variants of this polynucleotide can be naturally occurring allelic variants or non-naturally occurring variants. These nucleotide variants include substitution variants, deletion variants, and insertion variants.
  • an allelic variant is an alternative form of a polynucleotide that may be a substitution, deletion, or insertion of one or more nucleotides, but does not substantially change the function of the polypeptide it encodes .
  • the invention also relates to a polynucleotide that hybridizes to the sequence described above (having at least 50%, preferably 70% identity between the two sequences).
  • the invention particularly relates to polynucleotides that can hybridize to the polynucleotides of the invention under stringent conditions.
  • "strict conditions” means: (1) hybridization and elution at lower ionic strength and higher temperature, such as 0.2xSSC, 0.1% SDS, 60 ° C; or (2) A denaturant was added during hybridization, such as 50% (v / v) formamide, 0.1% calf serum / 0.1 ° /.
  • hybridizable polynucleotide has the same biological function and activity as the mature polypeptide shown in SEQ ID NO: 2.
  • nucleic acid fragments that hybridize to the sequences described above.
  • a "nucleic acid fragment” contains at least 10 nucleotides in length, preferably at least 20-30 nucleotides, more preferably at least 50-60 nucleotides, and most preferably at least 100 nuclei. Glycylic acid or more. Nucleic acid fragments can also be used in nucleic acid amplification techniques such as PCR to identify and / or isolate polynucleotides encoding human aminoacyl-tRNA synthetase 29.
  • polypeptides and polynucleotides in the present invention are preferably provided in an isolated form and are more preferably purified to homogeneity.
  • the specific polynucleotide sequence encoding the human aminoacyl-tRNA synthetase 29 of the present invention can be obtained by various methods.
  • polynucleotides are isolated using hybridization techniques well known in the art. These techniques include, but are not limited to: 1) hybridization of probes to genomic or cDNA libraries to detect homologous polynucleotide sequences, and 2) antibody screening of expression libraries to detect cloned polynucleosides with common structural characteristics Acid fragments.
  • the DNA fragment sequence of the present invention can also be obtained by the following methods: 1) isolating the double-stranded DNA sequence from the genomic DNA; 2) chemically synthesizing the DNA sequence to obtain the double-stranded DNA of the polypeptide.
  • genomic DM is the least commonly used. Direct chemical synthesis of DNA sequences is often the method of choice. The more commonly used method is the isolation of cDNA sequences.
  • the standard method for isolating cDNA of interest is to isolate raRNA from donor cells that overexpress the gene and perform reverse transcription to form a plasmid or phage cDNA library. There are many mature techniques for mRNA extraction. Kits are also commercially available (Qiagene).
  • the construction of cDNA libraries is also a common method (Sambrook, et al., Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory. New York, 1989).
  • Commercially available cDNA libraries are also available, such as different cDNA libraries from Clontech. When polymerase reaction technology is used in combination, even very small expression products can be cloned.
  • the genes of the present invention can be selected from these cDNA libraries by conventional methods. These methods include (but are not limited to): (1) DNA-DM or DM-RM hybridization; (2) the presence or absence of a marker gene function; (3) determining the level of human aminoacyl-tRNA synthetase 29 transcripts; (4) Detecting the protein product of gene expression by immunological technology or measuring biological activity. The above methods can be used alone or in combination.
  • the probe used for hybridization is homologous to any part of the polynucleotide of the present invention, and its length is at least 10 nucleotides, preferably at least 30 nucleotides, more preferably At least 50 nucleotides, preferably at least 100 nucleotides. In addition, the length of the probe is usually within 2000 nucleotides, preferably within 1000 nucleotides.
  • the probe used herein is generally a DNA sequence chemically synthesized based on the gene sequence information of the present invention. The genes or fragments of the present invention can of course be used as probes. DNA probes can be labeled with radioisotopes, luciferin, or enzymes (such as alkaline phosphatase).
  • the protein product of human aminoacyl-tRM synthase 29 gene expression can be detected by immunological techniques such as Western blotting, radioimmunoprecipitation, and enzyme-linked immunosorbent assay (ELISA).
  • the RACE method RACE-rapid cDNA end rapid amplification method
  • the primers used for PCR can be appropriately based on the polynucleotide sequence information of the present invention disclosed herein.
  • the amplified DNA / RNA fragments can be isolated and purified by conventional methods such as by gel electrophoresis.
  • polynucleotide sequence of the gene of the present invention or various DNA fragments and the like obtained as described above can be determined by a conventional method such as dideoxy chain termination method (Sanger et al. PNAS, 1977, 74: 5463-5467). Such polynucleotide sequences can also be determined using commercial sequencing kits and the like. In order to obtain the full-length cDNA sequence, the sequencing must be repeated. Sometimes it is necessary to determine the cDNA sequence of multiple clones in order to splice into a full-length cDNA sequence.
  • the present invention also relates to a vector comprising the polynucleotide of the present invention, and a host cell produced by genetic engineering using the vector of the present invention or directly using a human aminoacyl-tRNA synthetase 29 coding sequence, and the recombinant technology to produce the polypeptide of the present invention Methods.
  • a polynucleotide sequence encoding human aminoacyl-tRNA synthetase 29 can be inserted into a vector to constitute a recombinant vector containing the polynucleotide of the present invention.
  • vector refers to bacterial plasmids, phages, yeast plasmids, plant cell viruses, mammalian cell viruses such as adenoviruses, retroviruses or other vectors well known in the art.
  • Vectors suitable for use in the present invention include, but are not limited to: T7 promoter-based expression vectors (Rosenberg, et al. Gene, 1987, 56: 125) expressed in bacteria; pMSXND expression vectors expressed in mammalian cells ( Lee and Nathans, J Bio Chem.
  • any plasmid and vector can be used to construct a recombinant expression vector.
  • An important feature of expression vectors is that they usually contain an origin of replication, a promoter, a marker gene, and translational regulatory elements.
  • Methods known to those skilled in the art can be used to construct expression vectors containing a DNA sequence encoding human aminoacyl-tRNA synthetase 29 and appropriate transcription / translation regulatory elements. These methods include in vitro recombinant DNA technology, DNA synthesis technology, and in vivo recombination technology (Sambroook, et al. Molecular Cloning, a Laboratory Manual, cold Spring Harbor Laboratory. New York, 1989).
  • the DNA sequence can be operably linked to an appropriate promoter in an expression vector to guide mRNA synthesis. Representative examples of these promoters are: the lac or trp promoter of E.
  • the expression vector also includes a ribosome binding site and a transcription terminator for translation initiation. Insertion of enhancer sequences into the vector will enhance its transcription in higher eukaryotic cells. Enhancers are cis-acting factors for DNA expression, usually about 10 to 300 base pairs, which act on promoters to enhance gene transcription. Illustrative examples include SV40 enhancers of 100 to 270 base pairs on the late side of the origin of replication, polyoma enhancers on the late side of the origin of replication, and adenovirus enhancers.
  • the expression vector preferably contains one or more selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture Fluorescent protein (GFP), or tetracycline or ampicillin resistance for E. coli.
  • selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture Fluorescent protein (GFP), or tetracycline or ampicillin resistance for E. coli.
  • a polynucleotide encoding human aminoacyl-tRNA synthetase 29 or a recombinant vector containing the polynucleotide can be transformed or transduced into a host cell to form a genetically engineered host cell containing the polynucleotide or the recombinant vector.
  • the term "host cell” refers to a prokaryotic cell, such as a bacterial cell; or a lower eukaryotic cell, such as a yeast cell; or a higher eukaryotic cell, such as a mammalian cell. Representative examples are: E.
  • coli Streptomyces
  • bacterial cells such as Salmonella typhimurium
  • fungal cells such as yeast
  • plant cells such as fly S2 or Sf 9
  • animal cells such as CH0, COS or Bowes melanoma cells.
  • Transformation of a host cell with a DNA sequence described in the present invention or a recombinant vector containing the DNA sequence can be performed using conventional techniques well known to those skilled in the art.
  • the host is a prokaryote such as E. coli
  • competent cells capable of absorbing DNA can be harvested after the exponential growth phase and treated with CaCl.
  • the steps used are well known in the art.
  • the alternative is to use MgC l 2 .
  • transformation can also be performed by electroporation.
  • the host is a eukaryote, the following DM transfection methods can be used: calcium phosphate co-precipitation method, or conventional mechanical methods such as microinjection, electroporation, and liposome packaging.
  • polynucleotide sequence of the present invention can be used to express or produce recombinant human aminoacyl-tRNA synthetase 29 (Science, 1984; 224: 1431). Generally there are the following steps:
  • the medium used in the culture may be selected from various Conventional medium. Culture is performed under conditions suitable for host cell growth. After the host cells have grown to an appropriate cell density, the selected promoter is induced by a suitable method (such as temperature conversion or chemical induction), and the cells are cultured for a period of time.
  • a suitable method such as temperature conversion or chemical induction
  • the recombinant polypeptide may be coated in a cell, expressed on a cell membrane, or secreted outside the cell.
  • recombinant proteins can be separated and purified by various separation methods using their physical, chemical and other properties. These methods are well known to those skilled in the art. These methods include, but are not limited to: conventional renaturation treatment, protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid chromatography (HPLC) and various other liquid chromatography techniques and combinations of these methods.
  • FIG. 1 is a comparison diagram of amino acid sequence: 5 columns of homology of human aminoacyl-tRNA synthetase 29 and human aminoacyl-tRNA synthetase of the present invention.
  • the upper sequence is human aminoacyl-tRNA synthetase 29, and the lower sequence is human aminoacyl-tRNA synthetase.
  • Identical amino acids are represented by single-character amino acids between the two sequences, and similar amino acids are represented by "+".
  • Figure 2 shows the polyacrylamide gel electrophoresis (SDS-PAGE) of isolated human aminoacyl-tRNA synthetase 29. 29kDa is the molecular weight of the protein. The arrow indicates the isolated protein band.
  • Total human fetal brain RNA was extracted by one-step method with guanidine isothiocyanate / phenol / chloroform.
  • 017 (human) mRNA was isolated from total 1 using Quik mRNA Isolation Kit (( ⁇ 6 ⁇ 611 ⁇ 2 company products). 2ug poly (A) raRNA was reverse transcribed to form cDNA. Using Smart cDNA Cloning Kit (purchased from Clontech) The cDNA fragment was inserted into the multicloning site of the pBSK (+) vector (Clontech) to transform DH5 ⁇ , and the bacteria formed a cDNA library. Dye terminate cycle reaction sequencing kit (Perlcin-Elmer) and ABI 377 were used.
  • An automatic sequencer (Perkin-Elmer) determined the sequences at the 5 'and 3' ends of all clones. The determined cDNA sequence was compared with the existing public DM sequence database (Genebank), and it was found that the cDNA sequence of one of the clones 2680h06 was new DNA. A series of primers were synthesized to determine the inserted cDNA fragments of the clone in both directions.
  • the 2680h06 clone contained a full-length cDNA of 1893 bp (as shown in Seq ID NO: l), a 795 bp open reading frame (0RF) from 639 bp to 1433 bp, encoding a new protein (such as Seq ID NO : Shown in 2).
  • a new protein such as Seq ID NO : Shown in 2.
  • Example 3 Cloning of a gene encoding human aminoacyl-tRNA synthetase 29 by RT-PCR
  • CDNA was synthesized using fetal brain total RM as a template and ol igo-dT as a primer for reverse transcription reaction. After purification with Qiagene's kit, the following primers were used for PCR amplification:
  • Pr imerl 5'- CTGGTCTTCCTTGGCCTTTGAAGG -3 '(SEQ ID NO: 3)
  • Pr imer2 5,-CATAGGCCGAGGCGGCCGACATGT-3, (SEQ ID NO: 4)
  • Primerl is a forward sequence located at the 5th end of SEQ ID NO: 1, starting from the Ibp;
  • Pr imer2 is the 3, terminal reverse sequence of SEQ ID NO: 1.
  • Amplification reaction conditions reaction volume containing 50 ⁇ 1 of 50 Implicit ol / L KC1, 10 bandit ol / L Tr i s- Cl, (pH8 5.), 1. 5mraol / L MgCl 2, 200 ⁇ mol / L dNTP, l Opmol primer, 1U Taq DNA polymerase (Clontech).
  • the reaction was performed on a PE9600 DNA thermal cycler (Perkin-Elmer) under the following conditions for 25 cycles: 94 ° C 30sec; 55 ° C 30sec; 72. C 2min.
  • RT-PCR set ⁇ -act in as a positive control and template blank as a negative control.
  • the amplified product was purified using a QIAGEN kit and ligated to a pCR vector (Invitrogen) using a TA cloning kit.
  • the DNA sequence analysis results showed that the DNA sequence of the PCR product was exactly the same as that of 1 to 1893bp shown in SEQ ID NO: 1.
  • Example 4 Northern blot analysis of human aminoacyl-tRNA synthetase 29 gene expression:
  • a 32P-labeled probe (about 2 x 10 6 cpm / ml) was hybridized with a nitrocellulose membrane to which RNA was transferred at 42 ° C overnight in a solution containing 50% formamide-25mM KH 2 P0 4 (pH7.4) -5 x SSC-5x Denhardt, s solution and 2G ( ⁇ g / ml salmon sperm DNA. After hybridization, the filter was washed in 1 x SSC-0.1 ° /. SDS at 55 ° C for 30 minutes. Then, Analysis and quantification were performed using a Phosphor Imager.
  • Example 5 In vitro expression, isolation and purification of recombinant human aminoacyl-tRNA synthetase 29
  • Primer3 5,-CCCCATATGATGGCCCAGGACACGGGGATCCCT- 3, (Seq ID No: 5)
  • Primer4 5 '-CCCGAATTCCTAGTTAGGACAGGAAAGAAAAAC-3' (Seq ID No: 6)
  • the 5 'ends of these two primers contain Ndel and EcoRI restriction sites, respectively, followed by the coding sequences of the 5' and 3 'ends of the target gene, respectively.
  • the Ndel and EcoRI restriction sites correspond to the expression vector plasmid pET-28b (+) (Novagen, Cat. No. 69865.3) a selective endonuclease site.
  • the pBS-2680h06 plasmid containing the full-length target gene was used as a template for the PCR reaction.
  • the PCR reaction conditions were as follows: a total volume of 50 ⁇ 1 containing pBS- 2680h06 plasmid 10 pg, primers Primer-and Primer-; ⁇ ] ⁇ ! ⁇ Advantage polymerase Mix
  • Cycle parameters 94. C 20s, 60 ° C 30s, 68. C 2 min, a total of 25 cycles.
  • Ndel and EcoRI were used to double digest the amplified product and plasmid pET-28 (+), respectively, and large fragments were recovered and ligated with T4 ligase.
  • the ligation product was transformed into coliform bacteria DH5a by the calcium chloride method, and cultured overnight in LB plates containing kanamycin (final concentration 3 ( ⁇ g / ml)), and positive clones were selected by colony PCR method and sequenced. correct positive clones (P ET-2680h06) recombinant plasmids by the calcium chloride method to transform E.
  • the peptide is coupled to hemocyanin and bovine serum albumin to form a complex.
  • the method see: Avraraeas, et al. I. Chemis try, 1969; 6: 43. Rabbits were immunized with 4 mg of the hemocyanin peptide complex plus complete Freund's adjuvant, and 15 days later, the hemocyanin peptide complex plus incomplete Freund's adjuvant was used to boost immunity once. 15The titer of antibody in rabbit serum was measured by ELISA using a 15 g / ml bovine serum albumin peptide complex-coated titration plate. Protein A-Sepharose was used to isolate total IgG from antibody-positive rabbit serum.
  • Example 7 Application of the polynucleotide fragment of the present invention as a hybridization probe
  • Suitable oligonucleotide fragments selected from the polynucleotides of the present invention are used as hybridization probes in a variety of ways.
  • the probes can be used to hybridize to genomic or cDNA libraries of normal tissue or pathological tissue from different sources to It is determined whether it contains the polynucleotide sequence of the present invention and a homologous polynucleotide sequence is detected.
  • the probe can be used to detect the polynucleotide sequence of the present invention or its homologous polynucleotide sequence in normal tissue or pathology. Whether the expression in tissue cells is abnormal.
  • the purpose of this embodiment is to select a suitable oligonucleotide fragment from the polynucleotide SEQ ID NO: 1 of the present invention as a hybridization probe, and to identify whether some tissues contain the polynucleoside of the present invention by a filter hybridization method.
  • Filter hybridization methods include dot blotting, Southern blotting, Northern blotting, and copying methods. They all use the same steps to fix the polynucleotide sample to be tested on the filter and then hybridize.
  • the sample-immobilized filter is first pre-hybridized with a probe-free hybridization buffer, so that the non-specific binding site of the sample on the filter is saturated with the carrier and the synthetic polymer.
  • the pre-hybridization solution is then replaced with a hybridization buffer containing the labeled probe and incubated to hybridize the probe to the target nucleic acid.
  • the unhybridized probes are removed by a series of membrane washing steps.
  • This embodiment utilizes higher-intensity washing conditions (such as lower salt concentration and higher temperature) to reduce the hybridization background and retain only strong specific signals.
  • the probes used in this embodiment include two types: the first type of probes are oligonucleotide fragments that are completely the same as or complementary to the polynucleotide SEQ ID NO: 1 of the present invention; the second type of probes are partially related to the present invention
  • the polynucleotide SEQ ID NO: 1 is the same or complementary oligonucleotide fragment.
  • the dot blot method is used to fix the sample on the filter membrane. Under the high-intensity washing conditions, the first type of probe and the sample have the strongest hybridization specificity and are retained.
  • the selection of oligonucleotide fragments from the polynucleotide SEQ ID NO: 1 of the present invention as hybridization probes should follow the following principles and several aspects to be considered:
  • the preferred range of probe size is 18-50 nucleotides
  • Probe 1 which belongs to the first type of probe, is completely homologous or complementary to the gene fragment of SEQ ID NO: 1 (41Nt):
  • Probe 2 (probe2), which belongs to the second type of probe, is equivalent to the replacement mutant sequence of the gene fragment of SEQ ID NO: 1 or its complementary fragment (41M):
  • step 8-13 are only used when contamination must be removed, otherwise step 14 can be performed directly.
  • NC membrane nitrocellulose membrane
  • probe 1 can be used to qualitatively and quantitatively analyze the presence and differential expression of the polynucleotide of the present invention in different tissues.
  • polypeptide of the present invention and the antagonists, agonists and inhibitors of the polypeptide can be directly used in the treatment of diseases, for example, it can treat malignant tumors, adrenal deficiency, skin diseases, various inflammations, HIV infections and immune diseases.
  • codons are determined by the interaction of mRNA and tRNA carrying amino acids.
  • Aminoacyl-tRNA synthetase catalyzes the loading of the corresponding amino acid.
  • Each tRM molecule has a specific region for aminoacyl-tRNA synthetase recognition.
  • Protein translation also requires the presence and synergy of ribosomes and related factors. Studies have found that there are a variety of aminoacyl-tRNA synthetases that play important regulatory roles in protein translation. They can recognize a group of tRNAs with the same function and catalyze the completion of amino acid translation. Their mutation or abnormal expression will lead to abnormal protein translation, and then cause various related diseases, such as gastric cancer and other malignant diseases.
  • the novel human protein of the present invention has 98% identity and 98% similarity with the known murine aminoacyl-tRNA synthetase at the protein level, and the protein sequence also contains a conservative aminoacyl-tRNA synthesis Enzyme active action center. It can be seen that this protein is a new human aminoacyl-tRNA synthetase and named as human aminoacyl-tRNA synthetase 29. This enzyme has similar structural characteristics to the known human aminoacyl-tRNA synthetase, and both have similar biological functions. This protein binds to the corresponding tRNA in the body and acts synergistically to regulate the normal progress of the protein translation process.
  • the enzyme is usually closely related to the development of various tissues and metabolic disorders, tumors of some tissues and cancer (such as gastric cancer) in the body. It can also be used to diagnose and treat the various related diseases mentioned above.
  • the polypeptide of the present invention and the murine aminoacyl-tRNA synthetase are human aminoacyl-tRNA synthetases, which contain characteristic sequences of the aminoacyl-tRNA synthetase family, and both have similar biological functions. It plays an important regulatory role in the translation process of proteins. It can recognize a group of isotactic tRNAs and work with them to catalyze ammonia. The completion of the amino acid translation process. Its abnormal expression is usually closely related to the occurrence of some related disorders of substance metabolism, disorders of protein metabolism, and tumors and cancers of related tissues, and produce related diseases such as gastric cancer.
  • abnormal expression of the human aminoacyl-tRNA synthetase 29 of the present invention will produce various diseases 5 especially various tumors, embryonic development disorders, growth disorders, inflammation, and immune diseases. These diseases include But not limited to:
  • Tumors of various tissues stomach cancer, liver cancer, lung cancer, esophageal cancer, breast cancer, leukemia, lymphoma, thyroid tumor, uterine fibroids, neuroblastoma, astrocytoma, ependymoma, glioblastoma, nerve Fibroma, colon cancer, melanoma, bladder cancer, uterine cancer, endometrial cancer, colon cancer, thorax adenocarcinoma, nasopharyngeal cancer, laryngeal cancer, tracheal tumor, fibroid, fibrosarcoma, lipoma, liposarcoma- Embryonic disorders: congenital abortion, cleft palate, limb loss, limb differentiation disorder, atrial septal defect, neural tube defect, congenital hydrocephalus, congenital glaucoma or cataract, congenital deafness
  • Inflammation chronic active hepatitis, sarcoidosis, polymyositis, chronic rhinitis, chronic gastritis, cerebrospinal multiple sclerosis, glomerulonephritis, myocarditis, cardiomyopathy, atherosclerosis, gastric ulcer, cervicitis, Various infectious inflammations
  • Immune diseases Systemic lupus erythematosus, rheumatoid arthritis, bronchial asthma, urticaria, 0 specific dermatitis, post-infection myocarditis, scleroderma, myasthenia gravis, Guillain-Barre syndrome, common variable immunodeficiency Disease, primary B lymphocyte immunodeficiency disease, acquired immunodeficiency syndrome
  • Abnormal expression of the human aminoacyl-tRNA synthetase 29 of the present invention will also cause certain hereditary, hematological diseases and the like.
  • polypeptides of the present invention can be directly used in the treatment of diseases. 5
  • it can treat various diseases, especially various tumors, embryonic development disorders, growth disorders, inflammation, Immune diseases, certain hereditary, blood diseases, etc.
  • the invention also provides methods for screening compounds to identify agents that increase (agonist) or suppress (antagonist) human aminoacyl-tRNA synthetase 29.
  • Agonists enhance biological functions such as human aminoacyl-tRNA synthetase 29 to stimulate cell proliferation, while antagonists prevent and treat disorders related to excessive cell proliferation, such as various cancers.
  • mammalian cells or membrane preparations expressing human aminoacyl-tRNA synthetase 29 can be cultured with labeled human aminoacyl-tRNA synthetase 29 in the presence of a drug. The ability of the drug to increase or block this interaction is then determined.
  • Antagonists of human aminoacyl-tRNA synthetase 29 include screened antibodies, compounds, receptor deletions, and the like.
  • Antagonists of human aminoacyl-tRM synthase 29 can bind to human aminoacyl-tRNA synthetase 29 and eliminate its function, or inhibit the production of the polypeptide, or bind to the active site of the polypeptide so that the polypeptide cannot function biological functions.
  • human aminoacyl-tRNA synthetase 29 When screening compounds as antagonists, human aminoacyl-tRNA synthetase 29 can be added to the bioanalytical assay, and the compound can be determined by measuring the effect of the compound on the interaction between human aminoacyl-tRNA synthetase 29 and its receptor Whether it is an antagonist. Receptor deletions and analogs that act as antagonists can be screened in the same way as for screening compounds described above. Polypeptide molecules capable of binding to human aminoacyl-tRNA synthetase 29 can be obtained by screening a random peptide library composed of various possible combinations of amino acids bound to a solid phase. In screening, human aminoacyl-tRNA synthetase 29 molecules should generally be labeled.
  • the present invention provides a method for producing antibodies using polypeptides, and fragments, derivatives, analogs or cells thereof as antigens. These antibodies can be polyclonal or monoclonal antibodies.
  • the invention also provides antibodies against human aminoacyl-tRM synthase 29 epitopes. These antibodies include (but are not limited to): polyclonal antibodies, monoclonal antibodies, chimeric antibodies, single chain antibodies, Fab fragments, and fragments generated from Fab expression libraries.
  • Polyclonal antibodies can be produced by injecting human aminoacyl-tRM synthase 29 directly into immunized animals (such as rabbits, mice, rats, etc.).
  • immunized animals such as rabbits, mice, rats, etc.
  • adjuvants can be used to enhance the immune response, including but not limited to Freund's Adjuvant, etc.
  • Techniques for preparing monoclonal antibodies to human aminoacyl-tRNA synthetase 29 include, but are not limited to, hybridoma technology (Kohler and Milstei n. Nature, 1975, 256: 495-497), triple tumor technology, human beta- Cell hybridoma technology, EBV-hybridoma technology, etc.
  • Chimeric antibodies that bind human constant regions and non-human-derived variable regions can be produced using known techniques (Morris on e t al, PNAS, 1985, 81: 6851).
  • the existing technology for producing single-chain antibodies U.S. Pat No. 4946778, can also be used to produce single-chain antibodies against human aminoacyl-tRNA synthetase 29.
  • Antibodies against human aminoacyl-tRNA synthetase 29 can be used in immunohistochemistry to detect human aminoacyl-tRNA synthetase 29 in biopsy specimens.
  • Monoclonal antibodies that bind to human aminoacyl-tRNA synthetase 29 can also be labeled with radioisotopes and injected into the body to track their location and distribution. This radiolabeled antibody can be used as a non-invasive diagnostic method to locate tumor cells and determine whether there is metastasis.
  • Antibodies can also be used to design immunotoxins that target a particular part of the body.
  • human aminoacyl-tRNA synthetase 29 high affinity monoclonal antibodies can covalently bind to bacterial or plant toxins (such as diphtheria toxin, ricin, ormosine, etc.).
  • a common method is to attack the amino group of an antibody with a thiol cross-linking agent such as SPDP and bind the toxin to the antibody through the exchange of disulfide bonds.
  • This hybrid antibody can be used to kill human ammonia Acyl-tRNA synthase 29 positive cells.
  • the antibodies of the present invention can be used to treat or prevent diseases related to human aminoacyl-tRNA synthetase 29.
  • Administration of an appropriate dose of the antibody can stimulate or block the production or activity of human aminoacyl-tRNA synthetase 29.
  • the invention also relates to a diagnostic test method for quantitative and localized detection of human aminoacyl-tRM synthase 29 levels. These tests are well known in the art and include FISH assays and radioimmunoassays. The level of human aminoacyl-tRNA synthetase 29 detected in the test can be used to explain the importance of human aminoacyl-tRNA synthetase 29 in various diseases and to diagnose the role of human aminoacyl-tRNA synthetase 29 disease.
  • polypeptide of the present invention can also be used for peptide mapping analysis.
  • the polypeptide can be specifically cleaved by physical, chemical or enzymatic analysis, and subjected to one-dimensional or two-dimensional or three-dimensional gel electrophoresis analysis, and more preferably mass spectrometry analysis.
  • the polynucleotide encoding human aminoacyl-tRNA synthetase 29 can also be used for a variety of therapeutic purposes.
  • Gene therapy technology can be used to treat abnormal cell proliferation, development or metabolism caused by the non-expression or abnormal / inactive expression of human aminoacyl-tRNA synthetase 29.
  • Recombinant gene therapy vectors (such as viral vectors) can be designed to express mutated human aminoacyl-tRNA synthetase 29 to inhibit endogenous human aminoacyl-tRNA synthetase. 29 activity.
  • a mutated human aminoacyl-tRNA synthetase 29 may be a shortened human aminoacyl-tRNA synthetase 29 that lacks a signaling domain, and although it can bind to a downstream substrate, it lacks signaling activity. Therefore, the recombinant gene therapy vector can be used for treating diseases caused by abnormal expression or activity of human aminoacyl-tRNA synthetase 29.
  • Virus-derived expression vectors such as retrovirus, adenovirus, adenovirus-associated virus, herpes simplex virus, parvovirus and the like can be used to transfer a polynucleotide encoding human aminoacyl-tRNA synthetase 29 into a cell.
  • Methods for constructing a recombinant viral vector carrying a polynucleotide encoding human aminoacyl-tRNA synthetase 29 can be found in existing literature (Sambrook, et al.).
  • the polynucleotide encoding human aminoacyl-tRNA synthetase 29 can be packaged into liposomes and transferred into cells.
  • Methods for introducing a polynucleotide into a tissue or cell include: directly injecting the polynucleotide into a tissue in vivo; or introducing the polynucleotide into a cell in vitro through a vector (such as a virus, phage, or plasmid), and then transplanting the cell Into the body and so on.
  • a vector such as a virus, phage, or plasmid
  • Oligonucleotides including antisense RNA and DNA
  • ribozymes that inhibit human aminoacyl-tRNA synthetase 29 mRNA are also within the scope of the present invention.
  • a ribozyme is an enzyme-like RNA molecule that can specifically decompose a specific RNA. Its mechanism of action is that the ribozyme molecule specifically hybridizes with a complementary target RNA for endonucleation.
  • Antisense RNA and DNA and ribozymes can be obtained by any conventional RNA or DNA synthesis technology. For example, the technology of solid phase phosphate amide synthesis of oligonucleotides has been widely used.
  • Antisense RM molecules can be obtained by in vitro or in vivo transcription of a DM sequence encoding the RM. This DM sequence has been integrated into the vector's RNA Downstream of the polymerase promoter. In order to increase the stability of a nucleic acid molecule, it can be modified in a variety of ways, such as increasing the sequence length on both sides, and the ribonucleoside linkages should use phosphate thioester or peptide bonds instead of phosphodiester bonds.
  • the polynucleotide encoding human aminoacyl-tRM synthetase 29 can be used for diagnosis of diseases related to human aminoacyl-tRNA synthetase 29.
  • a polynucleotide encoding human aminoacyl-tRNA synthetase 29 can be used to detect the expression of human aminoacyl-tRNA synthetase 29 or abnormal expression of human aminoacyl-tRNA synthetase 29 in a disease state.
  • the DM sequence encoding human aminoacyl-tRM synthetase 29 can be used to hybridize biopsy specimens to determine the expression of human aminoacyl-tRNA synthetase 29.
  • Hybridization techniques include Sou thern imprinting, Nor thern blotting, and in situ hybridization. These techniques and methods are publicly available, and related kits are commercially available.
  • a part or all of the polynucleotide of the present invention can be fixed as a probe on a micro array or a DM chip (also referred to as a "gene chip") for analyzing differential expression analysis and gene diagnosis of genes in a tissue.
  • Human aminoacyl-tRNA synthetase 29-specific primers can be used to perform RNA-polymerase chain reaction (RT-PCR) in vitro amplification to detect human aminoacyl-tRNA synthetase 29 transcription products.
  • Human aminoacyl-tRNA synthetase 29 mutant forms include point mutations, translocations, deletions, recombinations, and any other abnormalities compared to the normal wild-type human aminoacyl-tRNA synthetase 29 DNA sequence. Mutations can be detected using well-known techniques such as Southern blotting, DM sequence analysis, PCR and in situ hybridization. In addition, mutations may affect protein expression. Therefore, Nor thern blotting and Western blotting can be used to indirectly determine whether a gene is mutated.
  • the sequences of the invention are also valuable for chromosome identification.
  • the sequence specifically targets a specific position on a human chromosome and can hybridize to it.
  • specific sites for each gene on the chromosome need to be identified.
  • only a few chromosome markers based on actual sequence data are available for marking chromosome positions.
  • an important first step is to locate these DNA sequences on a chromosome.
  • PCR primers (preferably 15-35bp) are prepared based on cDNA, and the sequences can be located on chromosomes. These primers were then used for PCR screening of somatic hybrid cells containing individual human chromosomes. Only those heterozygous cells containing the human gene corresponding to the primer will produce amplified fragments.
  • PCR localization of somatic hybrid cells is a quick way to localize DNA to specific chromosomes.
  • oligonucleotide primers of the present invention by a similar method, a set of fragments from a specific chromosome or a large number of genomic clones can be used to achieve sublocalization.
  • Other similar strategies that can be used for chromosome localization include in situ hybridization, chromosome pre-screening with labeled flow sorting, and pre-selection of hybrids to construct chromosome-specific cDNA library.
  • Fluorescent in situ hybridization of cDNA clones with metaphase chromosomes allows precise chromosomal localization in one step.
  • FISH Fluorescent in situ hybridization
  • the difference in cDNA or genomic sequence between the affected and unaffected individuals needs to be determined. If a mutation is observed in some or all diseased individuals and the mutation is not observed in any normal individuals, the mutation may be the cause of the disease. Comparing affected and unaffected individuals usually involves first looking for structural changes in chromosomes, such as deletions or translocations that are visible at the chromosomal level or detectable with cDNA sequence-based PCR. Based on the resolution capabilities of current physical mapping and gene mapping technologies,
  • 15 Disease-associated chromosomal region cDNA can be one of 50 to 500 potentially pathogenic genes (assuming 1 megabase mapping resolution and one gene per 20 kb).
  • polypeptides, polynucleotides and mimetics, agonists, antagonists and inhibitors of the present invention can be used in combination with a suitable pharmaceutical carrier.
  • suitable pharmaceutical carrier can be water, glucose, ethanol, salts, buffers, glycerol, and combinations thereof.
  • the composition contains a safe and effective amount of the polypeptide or antagonist and does not affect
  • compositions can be used as drugs for the treatment of diseases.
  • the invention also provides a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the invention.
  • a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the invention.
  • these containers there may be instructional instructions given by government agencies that manufacture, use, or sell pharmaceuticals or biological products, which prompts permission for administration on the human body by government agencies that produce, use, or sell.
  • the polypeptides of the invention can be combined with other
  • the pharmaceutical composition can be administered in a convenient manner, such as by a topical, intravenous, intraperitoneal, intramuscular, subcutaneous, intranasal or intradermal route of administration.
  • Human aminoacyl-tRNA synthetase 29 is administered in an amount effective to treat and / or prevent a specific indication.
  • the amount and range of human aminoacyl-tRNA synthetase 29 administered to a patient will depend on many factors, such as the mode of administration, the health conditions of the person to be treated, and the diagnosis of the physician

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Organic Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Molecular Biology (AREA)
  • Microbiology (AREA)
  • Biotechnology (AREA)
  • Biomedical Technology (AREA)
  • Biochemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Enzymes And Modification Thereof (AREA)

Abstract

L'invention concerne un nouveau polypeptide, une aminoacyl-ARNt synthétase humaine 29, et un polynucléotide codant ce polypeptide ainsi qu'un procédé d'obtention de ce polypeptide par des techniques recombinantes d'ADN. L'invention concerne en outre les applications de ce polypeptide dans le traitement de maladies, notamment des tumeurs malignes, de l'hémopathie, de l'infection par VIH, de maladies immunitaires et de diverses inflammations. L'invention concerne aussi l'antagoniste agissant contre le polypeptide et son action thérapeutique ainsi que les applications de ce polynucléotide codant l'aminoacyl-ARNt synthétase humaine 29.
PCT/CN2001/001014 2000-06-21 2001-06-19 Nouveau polypeptide, aminoacyl-arnt synthetase humaine 29, et polynucleotide codant ce polypeptide WO2002012507A1 (fr)

Priority Applications (1)

Application Number Priority Date Filing Date Title
AU93640/01A AU9364001A (en) 2000-06-21 2001-06-19 A novel polypeptide, a human aminoacyl-trna synthetase 29 and the polynucleotideencoding the polypeptide

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
CN00116680.8 2000-06-21
CN 00116680 CN1329144A (zh) 2000-06-21 2000-06-21 一种新的多肽——人氨酰基－tRNA合成酶29和编码这种多肽的多核苷酸

Publications (1)

Publication Number Publication Date
WO2002012507A1 true WO2002012507A1 (fr) 2002-02-14

Family

ID=4586082

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/CN2001/001014 WO2002012507A1 (fr) 2000-06-21 2001-06-19 Nouveau polypeptide, aminoacyl-arnt synthetase humaine 29, et polynucleotide codant ce polypeptide

Country Status (3)

Country Link
CN (1) CN1329144A (fr)
AU (1) AU9364001A (fr)
WO (1) WO2002012507A1 (fr)

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
DATABASE DDBJ [online] 13 May 2000 (2000-05-13), Database accession no. D84224 *
DATABASE GENBANK [online] 3 December 1996 (1996-12-03), accession no. EMBL Database accession no. X94754 *
DATABASE GENBANK [online] 3 December 1996 (1996-12-03), accession no. EMBL Database accession no. Z94216 *
GENE, vol. 178, no. 1-2, 31 October 1996 (1996-10-31), pages 187 - 189 *

Also Published As

Publication number Publication date
AU9364001A (en) 2002-02-18
CN1329144A (zh) 2002-01-02

Similar Documents

Publication Publication Date Title
WO2002026972A1 (fr) Nouveau polypeptide, proteine humaine 20.13 de liaison de l'acide polyadenylique, et polynucleotide codant ce polypeptide
WO2001090169A1 (fr) Nouveau polypeptide, antigene nucleaire de proliferation cellulaire (pcna) 13, et polynucleotide codant ce polypeptide
WO2001083780A1 (fr) Nouveau polypeptide, methylthioadenosine phosphorylase humaine 37, et polynucleotide codant pour ce polypeptide
WO2002012507A1 (fr) Nouveau polypeptide, aminoacyl-arnt synthetase humaine 29, et polynucleotide codant ce polypeptide
WO2002012296A1 (fr) Nouveau polypeptide, leucotriene b412-hydroxy deshydrogenase 36 nadp-dependante, et polynucleotide codant ce polypeptide
WO2002002611A1 (fr) Nouveaux polypeptides, domaine de repetition 12 de recepteurs peptidiques de la motilite du sperme et proteine ribosomale l22, et polynucleotides codant ces polypeptides
WO2001038540A1 (fr) Nouveau polypeptide, la methionyl arnt synthetase humaine de 29 kda, et polynucleotide codant pour ledit polypeptide
WO2001072790A1 (fr) Nouveau polypeptide, proteine humaine p40 12 de facteur l1, et polynucleotide codant pour ce polypeptide
WO2001048173A1 (fr) Nouveau polypeptide, aminoacyl-arnt synthetase humaine 10, et polynucleotide codant pour ce polypeptide
WO2001055412A1 (fr) Nouveau polypeptide, phosphoenolpyruvate carboxylase 81, et polynucleotide codant pour ce polypeptide
WO2001079424A2 (fr) Nouveau polypeptide, facteur humaine de couplage d'atpase mitochondriale 6-10, et polynucleotide codant pour ce polypeptide
WO2001048159A1 (fr) Nouveau polypeptide, dihydroorotase 9, et polynucleotide codant pour ce polypeptide
WO2001055420A1 (fr) Nouveau polypeptide, site 27 actif de la famille rho des enzymes gtp, et polynucleotide codant pour ce polypeptide
WO2001096572A1 (fr) Nouveau polypeptide, multi-cuivre oxydase 12, et polynucleotide codant ce polypeptide
WO2001049738A1 (fr) Nouveau polypeptide, proteine fkbp humaine 11, et polynucleotide codant pour ce polypeptide
WO2001094591A1 (fr) Nouveau polypeptide, glyceraldehyde-3-phosphate deshydrogenase 10, et polynucleotide codant ce polypeptide
WO2001073068A1 (fr) Nouveau polypeptide, l1-12, et polynucleotide codant pour ce polypeptide
WO2001064733A1 (fr) Nouveau polypeptide, facteur humain 22 lie a la transcription inverse, et polynucleotide codant pour ce polypeptide
WO2002004631A1 (fr) Nouveau polypeptide, proteine 11 humaine associee a la transcription inverse orf2 du facteur l1, et polynucleotide codant ce polypeptide
WO2001075024A2 (fr) Nouveau polypeptide, facteur humain 13 associe a nf-e2, et polynucleotide codant pour ce polypeptide
WO2001074996A2 (fr) Nouveau polypeptide, c. elegans 52 humain, et polynucléotide codant pour ce polypeptide
WO2002012323A1 (fr) Nouveau polypeptide, proteine secretrice 11 de la famille des hlyd, et polynucleotide codant ce polypeptide
WO2001081381A1 (fr) Nouveau polypeptide, proteine humaine 9 contenant un fragment de sequence particulier d'une recombinase specifique au site, et polynucleotide codant pour ce polypeptide
WO2001055419A1 (fr) Nouveau polypeptide, site de liaison 27 d'arn s1, et polynucleotide codant pour ce polypeptide
WO2001068876A1 (fr) Nouveau polypeptide, proteine humaine 16 a multiples liaisons avec la dyneine atpase beta, et polynucleotide codant pour ce polypeptide

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CO CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
REG Reference to national code

Ref country code: DE

Ref legal event code: 8642

122 Ep: pct application non-entry in european phase
NENP Non-entry into the national phase

Ref country code: JP