WO2001038392A1 - Nouveau facteur de transcription et son adn - Google Patents

Nouveau facteur de transcription et son adn Download PDF

Info

Publication number
WO2001038392A1
WO2001038392A1 PCT/JP2000/008257 JP0008257W WO0138392A1 WO 2001038392 A1 WO2001038392 A1 WO 2001038392A1 JP 0008257 W JP0008257 W JP 0008257W WO 0138392 A1 WO0138392 A1 WO 0138392A1
Authority
WO
WIPO (PCT)
Prior art keywords
dna
polypeptide
present
salt
seq
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/JP2000/008257
Other languages
English (en)
French (fr)
Japanese (ja)
Inventor
Koji Yoshimura
Yuichi Hikichi
Kenichi Noguchi
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Takeda Pharmaceutical Co Ltd
Original Assignee
Takeda Chemical Industries Ltd
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Takeda Chemical Industries Ltd filed Critical Takeda Chemical Industries Ltd
Priority to EP00977879A priority Critical patent/EP1233023B1/en
Priority to AT00977879T priority patent/ATE286911T1/de
Priority to US10/130,872 priority patent/US7241860B1/en
Priority to DE60017453T priority patent/DE60017453T2/de
Priority to CA002392351A priority patent/CA2392351A1/en
Priority to AU15497/01A priority patent/AU1549701A/en
Publication of WO2001038392A1 publication Critical patent/WO2001038392A1/ja
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/47Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • C07K14/4701Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals not used
    • C07K14/4702Regulators; Modulating activity
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P19/00Drugs for skeletal disorders
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P19/00Drugs for skeletal disorders
    • A61P19/02Drugs for skeletal disorders for joint disorders, e.g. arthritis, arthrosis
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P19/00Drugs for skeletal disorders
    • A61P19/08Drugs for skeletal disorders for bone diseases, e.g. rachitism, Paget's disease
    • A61P19/10Drugs for skeletal disorders for bone diseases, e.g. rachitism, Paget's disease for osteoporosis
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P29/00Non-central analgesic, antipyretic or antiinflammatory agents, e.g. antirheumatic agents; Non-steroidal antiinflammatory drugs [NSAID]
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00Antineoplastic agents
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/475Growth factors; Growth regulators
    • C07K14/51Bone morphogenetic factor; Osteogenins; Osteogenic factor; Bone-inducing factor
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00Medicinal preparations containing peptides

Definitions

  • the present invention relates to a novel transcription factor, its DNA, a recombinant vector, a transformant, a production method, an antibody, or a use thereof.
  • gene transcription is regulated by the interaction between chromosomal sequences (cis-elements) such as promoters and the transcription factors that bind to them.
  • Promote consists of a core (basic) sequence composed of the TATA box and transcription start site, and a gene-specific expression control region.
  • the transcriptional regulator bound to the expression control region activates RNA polymerase II I holoenzyme (a complex of shakuhachi polymerase 11 I and a basic transcription factor group) that binds to the core sequence, and promotes gene transcription.
  • the basic transcription factor that binds to the core sequence is involved in the transcription of many genes and has no gene specificity.
  • transcriptional regulators that bind to the expression control region are activated when cells proliferate or differentiate or respond to external stimuli such as hormones and cytokins, and promote transcription of selected genes. For this reason, transcription factors are sometimes called gene-specific transcription factors. In humans, there are expected to be about 3,000 gene-specific transcription factors, which are expected to be drug targets as well as cell surface receptors (Mol. Med. Today, 358, 1998).
  • ChM-I Human chondromodulin-I promotes chondrocyte DNA synthesis by Hiraki et al. (Biochem. Biophys. Res. Commun. 175: 371, 1991). Purified and cloned from fetal epiphyseal cartilage as a factor. Purified ChM-I weakly promoted chondrocyte DNA synthesis, and its activity was enhanced in the presence of bFGF. It was also shown that it promotes proteodalican synthesis. ChM-I is synthesized from the cDNA sequence as a precursor consisting of 335 amino acids, and the mature form consists of 121 C-terminal amino acids. It became clear.
  • ChM-I This mature form of ChM-I was obtained from J. Neame et al. (J. Biol. Chem. 265: 9628-9633, 1990). Purified from nasal septum cartilage. 18 Kd whose physiological function was unknown. Glycoproteins. Northern blot analysis showed that ChM-I expression was cartilage-specific. Thereafter, ChM_I promoted chondrocyte colony formation (Biochem. Biophys. Res. Co., un. 241: 395, 1997), and inhibited vascular endothelial cell proliferation (J. Biol. Chem.
  • ChM-I is expressed in the growth plate cartilage in the avascular proliferative cartilage layer, etc., and promotes cartilage proliferation and matrix production, and prevents the invasion of blood vessels, thereby controlling the replacement of cartilage with bone. (J. Biol. Chem. 272: 32419, 1997). As described above, ChM-I is a regulator of cartilage differentiation and growth having angiogenesis inhibitory action.
  • chondrocytes in the growth plate cartilage continue to differentiate from stationary cartilage to proliferating, hypertrophic, and calcified cartilage, and osteoblasts are supplied by blood vessel invasion, replacing bone.
  • cartilage cells emerge after an inflammatory response, and the fracture is repaired through a similar pathway. Therefore, it is clear that chondrocyte differentiation and proliferation are important in the healing process of bone disease and cartilage disease.
  • Suzuki et al. Clarified the sequence of the human ChM-I gene, and since human ChM-I protein has cartilage growth activity and vascular endothelial cell growth inhibition, fractured human ChM-I protein, various cartilage diseases, cancer, etc.
  • An application to a therapeutic agent for tumors is described (JP-A-7-138295). However, the regulation of ChM-I gene expression has not been clarified.
  • Transcriptional regulators have the effect of regulating their activity, expression and stability, and various diseases based on their activity, expression and stability, such as joint diseases such as osteoarthritis and rheumatoid arthritis, and fractures. Enables the development of new drugs that are useful for the prevention and treatment of bone diseases and cancer. Therefore, in this field, it has been desired to find a new transcription regulatory factor and to develop a method for mass production.
  • ChM_I A novel transcriptional regulator that binds to the promoter of a gene has been found.
  • the present inventors have further studied based on these findings, and have completed the present invention.
  • polypeptide or a salt thereof according to the above (1) which comprises the same or substantially the same amino acid sequence as the amino acid sequence represented by SEQ ID NO: 4;
  • polypeptide according to (1) or a polypeptide thereof comprising the polypeptide according to (1) or a salt thereof, the DNA according to (5) or the transformant according to (7).
  • the medicament according to (14) which is an agent for treating or preventing rheumatoid arthritis, osteoarthritis, osteoporosis, fracture, cancer, intervertebral disc herniation, sciatica or ectopic cartilage formation.
  • a cell having the ability to produce the polypeptide or its salt according to (1) above is cultured in the presence of a test compound, and a DNA encoding the polypeptide according to (1) or its complementary DNA or a portion thereof is obtained.
  • a screening method for the salt
  • a medicament comprising a compound capable of promoting or inhibiting the expression of DNA encoding the polypeptide according to (1) or a salt thereof, which can be obtained by using the screening method according to (16);
  • FIG. 1 shows the nucleotide sequence of the human C ′ hM — I promoter.
  • the upper row shows the sequence obtained in Example 1, and the lower row shows the sequence described in JP-A-7-138295.
  • FIG. 2 shows a schematic diagram of the plasmid pTB275.
  • FIG. 3 shows the DNA sequence and amino acid sequence of the human transcription factor gene.
  • FIG. 4 shows the DNA sequence and the amino acid sequence of the mouse transcription factor gene.
  • Figure 5 shows a comparison of the amino acid sequences of human and mouse transcription factors.
  • polypeptide of the present invention containing the amino acid sequence represented by SEQ ID NO: 5 (hereinafter sometimes referred to as human polypeptide), the polypeptide containing the amino acid sequence represented by SEQ ID NO: 19 Peptides (hereinafter sometimes referred to as mouse-type polypeptides) and polypeptides having substantially the same amino acid sequence as human-type polypeptides (hereinafter, human-type polypeptides, mouse-type polypeptides and human-type polypeptides) Polypeptides containing substantially the same amino acid sequence as the polypeptide may be collectively referred to as the polypeptide of the present invention.
  • Human warm-blooded animals eg, guinea pigs, rats, mice, chickens, and egrets
  • Cells eg, hepatocytes, spleen cells, neurons, glial cells, glandular i3 cells, bone marrow cells, Sangium cells, Langerhans cells, epidermal cells, epithelial cells, endothelial cells, fibroblasts, fiber cells, muscle cells, fat cells, immune cells (eg, macrophages, T cells, B cells, natural killer cells, mast cells, Neutrophils, basophils, eosinophils, monocytes), megakaryocytes, synovial cells, chondrocytes, osteocytes, osteoblasts, osteoclasts, breast cells, or stromal cells, or precursors of these cells Cells, stem cells, cancer cells, etc.) or any tissue in which these cells are present, such as the brain, parts of the brain (eg, olfactory bulb, amygdal
  • the amino acid sequence substantially the same as the amino acid sequence represented by SEQ ID NO: 5 includes about 50% or more, preferably about 60% or more, more preferably the amino acid sequence represented by SEQ ID NO: 5 Is an amino acid sequence having a homology of about 70% or more, more preferably about 80% or more, particularly preferably about 90% or more, and most preferably about 95% or more.
  • amino acid sequence substantially the same as the amino acid sequence represented by SEQ ID NO: 5 include the amino acid sequence represented by SEQ ID NO: 19, and the like.
  • polypeptide containing the amino acid sequence represented by SEQ ID NO: 5 or the substantially identical amino acid sequence include, for example, the amino acid sequence represented by SEQ ID NO: 4 or the substantially identical amino acid And polypeptides containing the sequence.
  • the amino acid sequence substantially the same as the amino acid sequence represented by SEQ ID NO: 4 includes about 50% or more, preferably about 60% or more, more preferably about 50% or more of the amino acid sequence represented by SEQ ID NO: 4.
  • amino acid sequence substantially the same as the amino acid sequence represented by SEQ ID NO: 4 include, for example, the amino acid sequence represented by SEQ ID NO: 7, and the like.
  • polypeptide having an amino acid sequence substantially the same as the amino acid sequence represented by SEQ ID NO: 4 include, for example, an amino acid sequence substantially the same as the amino acid sequence represented by SEQ ID NO: 4 described above.
  • polypeptide having an amino acid sequence substantially the same as the amino acid sequence represented by SEQ ID NO: 5 examples include, for example, amino acids substantially the same as the amino acid sequence represented by the aforementioned SEQ ID NO: 5 Having the sequence, represented by SEQ ID NO: 5
  • Polypeptides and the like having substantially the same properties as polypeptides having an amino acid sequence are preferred, and specific examples include a polypeptide having the amino acid sequence represented by SEQ ID NO: 19.
  • substantially the same properties include, for example, acting as a transcription regulatory factor. Substantially the same means that those properties are qualitatively the same. Therefore, properties such as binding to the ChM_I gene promoter and transcription regulation are equivalent (eg, about 0.1 to 100 times, preferably about 0.5 to 10 times, more preferably 0 to 10 times). (5 to 2 times), but the degree of these properties and the quantitative factors such as the molecular weight of the polypeptide may be different.
  • the position of the insertion, deletion or substitution is not particularly limited, but is as follows: (1) each of SEQ ID NO: 4 and SEQ ID NO: 7 Positions other than the amino acid sequence common to the amino acid sequences represented by SEQ ID NOs: (2) Positions other than the amino acid sequence common to the amino acid sequences represented by the respective SEQ ID NOs: 4 and 5 No.
  • the polypeptide has an N-terminal (amino terminal) at the left end and a C-terminal (capillary terminal) at the right end according to the convention of peptide labeling.
  • polypeptides of the present invention including the polypeptide containing the amino acid sequence represented by SEQ ID NO: 5, usually have a C-terminus of a carboxyl group (one COOH) or a carboxylate (_COO—).
  • the terminus may be amide (_C ⁇ NH 2 ) or ester (one COOR).
  • R in the ester e.g., methyl, Echiru, n- propyl Le, C i _ 6 alkyl groups such as isopropyl or n _-butyl, cyclo pentyl, C 3 _ 8 cycloalkyl group cyclohexyl, etc.
  • cyclohexylene for example, phenyl, shed - 1 2 Ariru group, e.g., benzyl, phenylene Lou such phenethyl ( ⁇ _ 2 alkyl or ⁇ - flying one-naphthyl naphthylmethyl etc. - - C Bok 2 alkyl radical C 6 of naphthyl in addition to C 7 _ E 4 Ararukiru group such, Viva Roy Ruo carboxymethyl group that will be universal, is used as an oral ester.
  • polypeptide of the present invention has a lipoxyl group (or lipoxylate) other than at the C-terminus
  • a polypeptide in which the lipoxyl group is amidated or esterified is also included in the polypeptide of the present invention.
  • ester for example, the above-mentioned C-terminal ester and the like are used.
  • the amino group of the amino acid residue at the ⁇ -terminal is protected by a protecting group (eg, an acyl group of alkanol such as formyl group or acetyl group).
  • a protecting group eg, an acyl group of alkanol such as formyl group or acetyl group.
  • Protected, N-terminal glutamine residue generated by cleavage in vivo, pyroglutamine-oxidized, Substituent on the side chain of amino acid in the molecule eg, 1H, —SH, amino group, Those in which an imidazole group, an indole group, a guanidino group, etc.
  • a protecting group for example, a Ci- 6 acyl group such as a C i_ 6 alkanol group such as a formyl group and an acetyl group
  • a sugar also included are complex polypeptides such as so-called sugar polypeptides with chains attached.
  • polypeptide of the present invention or a salt thereof, a salt with a physiologically acceptable acid (eg, an inorganic acid or an organic acid) or a base (eg, an alkali metal salt) is used. Acceptable acid addition salts are preferred.
  • a physiologically acceptable acid eg, an inorganic acid or an organic acid
  • a base eg, an alkali metal salt
  • Such salts include, for example, salts with inorganic acids (eg, hydrochloric acid, phosphoric acid, hydrobromic acid, sulfuric acid) or organic acids (For example, salts with acetic acid, formic acid, propionic acid, fumaric acid, maleic acid, succinic acid, tartaric acid, citric acid, malic acid, oxalic acid, benzoic acid, methanesulfonic acid, benzenesulfonic acid) and the like are used.
  • inorganic acids eg, hydrochloric acid, phosphoric acid, hydrobromic acid, sulfuric acid
  • organic acids for example, salts with acetic acid, formic acid, propionic acid, fumaric acid, maleic acid, succinic acid, tartaric acid, citric acid, malic acid, oxalic acid, benzoic acid, methanesulfonic acid, benzenesulfonic acid
  • the polypeptide of the present invention or a salt thereof can be produced from a cell or tissue of a human warm-blooded animal by the above-mentioned method for purifying a polypeptide (protein) known per se, or encodes a polypeptide described below. It can also be produced by culturing a transformant containing DNA. It can also be produced according to the peptide synthesis method described below.
  • the human or mammalian tissues or cells are homogenized and then extracted with an acid or the like, and the extract is subjected to chromatography such as reverse phase chromatography or ion exchange chromatography. Purification and isolation can be achieved by combining the chromatography.
  • a commercially available resin for polypeptide (protein) synthesis can be usually used.
  • resins include chloromethyl resin, hydroxymethyl resin, benzhydrylamine resin, aminomethyl resin, 4-benzyloxybenzyl alcohol resin, 4-methylbenzhydrylamine resin, PAM resin, Hydroxymethylmethylphenylacetamidomethyl resin, polyacrylamide resin, 4- (2 ', 4'-dimethoxyphenyl-hydroxymethyl) phenoxy resin, 4- (2', 4'dimethoxyphenyl F moc amino Ethyl) phenoxy resin and the like.
  • an amino acid appropriately protected with a amino group and a side chain functional group is condensed on the resin in accordance with the sequence of the objective polypeptide according to various known condensation methods.
  • the polypeptide is cleaved from the resin, and at the same time, various protecting groups are removed.
  • an intramolecular disulfide bond formation reaction is performed in a highly diluted solution to obtain the target polypeptide or an amide thereof. .
  • the protected amino acid may be added directly to the resin along with a racemization inhibitor additive (eg, H ⁇ B t, HOOB t), or may be pre-formed as a symmetrical anhydride or HOB t ester or H ⁇ OB t ester. It can be added to the resin after activation of the protected amino acid.
  • a racemization inhibitor additive eg, H ⁇ B t, HOOB t
  • the solvent used for activating the protected amino acid or condensing with the resin may be appropriately selected from solvents known to be usable for the polypeptide (protein) condensation reaction.
  • acid amides such as N, N-dimethylformamide, N, N-dimethylacetamide, N-methylpyrrolidone, halogenated hydrocarbons such as methylene chloride, chloroform, alcohols such as trifluoroethanol, Sulfoxides such as dimethyl sulfoxide, ethers such as pyridine, dioxane, and tetrahydrofuran; nitriles such as acetonitrile and propionitrile; esters such as methyl acetate and ethyl acetate; or an appropriate mixture thereof are used.
  • the reaction temperature is appropriately selected from a range known to be usable for a polypeptide (protein) bond formation reaction, and is usually appropriately selected from a range of about ⁇ 20 to 50.
  • the activated amino acid derivative is usually used in a 1.5 to 4-fold excess.
  • Examples of the protecting group for the amino group of the starting material include Z, Boc, t-pentyloxycarbonyl, isopolnyloxycarbonyl, 4-methoxybenzyloxycarbonyl, C1_Z, Br—Z, and adaman. Tiloxycarbonyl, trifluoroacetyl, phthaloyl, formyl, 2-nitrophenylsulfenyl, diphenylphosphinothioyl, Fmoc and the like are used.
  • the carboxyl group may be, for example, a linear, branched or cyclic alkyl such as an alkyl esterified (eg, methyl, ethyl, propyl, butyl, t-butyl, cyclopentyl, cyclohexyl, cycloheptyl, cyclooctyl, 2-adamantyl).
  • alkyl esterified eg, methyl, ethyl, propyl, butyl, t-butyl, cyclopentyl, cyclohexyl, cycloheptyl, cyclooctyl, 2-adamantyl.
  • Esterification Esterification
  • aralkyl esterification for example, benzyl ester, 4-nitrobenzyl ester, 4-methoxybenzyl ester, 4-chlorobenzyl ester
  • Benzyl ester, benzhydryl esterification phenacyl esterification, benzyloxycarbonyl hydrazide, t-butoxycarbonyl hydrazide, trityl hydrazide and the like.
  • the hydroxyl group of serine can be protected, for example, by esterification or etherification.
  • a group suitable for the esterification for example, a group derived from carbonic acid such as a lower (dialkanol group, an aroyl group such as a benzoyl group) such as an acetyl group, a benzyloxycarponyl group, and an ethoxycarponyl group can be used.
  • Examples of a group suitable for etherification include a benzyl group, a tetrahydrobiranyl group, and a t-butyl group.
  • the protecting group of the phenolic hydroxyl group of tyrosine for example, Bz 1, C 1 2
  • protecting group for histidine imidazole for example, Tos, 4-methoxy2,3,6-trimethylbenzenesulfonyl, DNP, benzyloxymethyl, Bum, Boc, Trt, Fmoc and the like are used.
  • activated raw oxypoxyl groups include, for example, corresponding acid anhydrides, azides, active esters [alcohols (eg, pentachlorophenol, 2,4,5_trichloromouth phenol, 2,4- Dinitrophenol, cyanomethyl alcohol, paranitrophenol, H ⁇ NB, N-hydroxysuccinimide, N-hydroxyphthalimide, and esters with H ⁇ Bt).
  • active esters eg, pentachlorophenol, 2,4,5_trichloromouth phenol, 2,4- Dinitrophenol, cyanomethyl alcohol, paranitrophenol, H ⁇ NB, N-hydroxysuccinimide, N-hydroxyphthalimide, and esters with H ⁇ Bt.
  • a method for removing (eliminating) the protecting group for example, catalytic reduction in a hydrogen stream in the presence of a catalyst such as Pd-black or Pd-carbon, or hydrogen fluoride anhydride, methanesulfonic acid,
  • a catalyst such as Pd-black or Pd-carbon, or hydrogen fluoride anhydride, methanesulfonic acid
  • the 2,4-dinitrophenyl group used as an imidazole protecting group of histidine is removed by thiophenol treatment, and the formyl group used as an indole protecting group of tryptophan is replaced with 1,2-ethanedithiol, 'In addition to deprotection by acid treatment in the presence of 4-butanedithiol, etc., it is also removed by alkali treatment with dilute sodium hydroxide solution, dilute ammonia, etc.
  • the protection of the functional group which should not be involved in the reaction of the raw material, the elimination of the protective group and its protective group, the activation of the functional group involved in the reaction, and the like can be appropriately selected from known groups or known means.
  • a peptide (polypeptide) chain is added to the amino group side with a desired chain length
  • a polypeptide was obtained by removing only the protecting group of the ⁇ -amino group at the ⁇ -terminal of the peptide chain
  • a polypeptide was obtained by removing only the protecting group of the C-terminal carbonyl group.
  • the polypeptide is condensed in a mixed solvent as described above. The details of the condensation reaction are the same as described above.
  • the crude polypeptide is purified by various known purification means, and the main fraction is freeze-dried to obtain a desired polypeptide amide.
  • an ester of the polypeptide for example, after condensing a strong alcohol group of the carboxy terminal amino acid with a desired alcohol to form an amino acid ester, in the same manner as the amide of the polypeptide, An ester form can be obtained.
  • the polypeptide of the present invention or a salt thereof can be produced according to a peptide synthesis method known per se.
  • a method for synthesizing a peptide for example, any of a solid phase synthesis method and a liquid phase synthesis method may be used. That is, the desired peptide is produced by condensing a partial peptide or amino acid capable of constituting the partial peptide of the present invention with the remaining portion, and removing the protective group when the product has a protective group.
  • Known condensation methods and elimination of protecting groups include, for example, the methods described in the following 1 to 5. (M. Bodanszky and MA OndettK Peptide Synthesis, Interscience Publishers, New York (1966)
  • the polypeptide of the present invention can be purified and isolated by a combination of ordinary purification methods such as solvent extraction, distillation, column chromatography, liquid chromatography, and recrystallization.
  • the polypeptide obtained by the above method is a free form, it can be converted to an appropriate salt by a known method or a method analogous thereto, and conversely, when the polypeptide is obtained by a salt, it is a known method or Can be converted into a free form or another salt by a method analogous thereto.
  • the DNA encoding the polypeptide of the present invention may be any DNA as long as it contains the above-described nucleotide sequence encoding the polypeptide of the present invention. Further, it may be any of genomic DNA, cDNA derived from the above-mentioned cells and tissues, and synthetic DNA.
  • the vector used for the library may be any of bacteriophage, plasmid, cosmid, phagemid and the like. Further, Reverse Transcriptase Polymerase Chain Reaction (hereinafter, abbreviated as RT-PCR method) is directly performed using a preparation of tota1 RNA or mRNA fraction from the above-described cell'tissue. ).
  • RT-PCR method Reverse Transcriptase Polymerase Chain Reaction
  • Examples of the DNA encoding the polypeptide of the present invention include, for example, DNA containing the base sequence of SEQ ID NO: 18 or the base sequence of SEQ ID NO: 18 under high stringency conditions.
  • DNA containing the base sequence represented by SEQ ID NO: 18 for example, a DNA containing the base sequence represented by SEQ ID NO: 3 or the like is used.
  • Examples of a DNA that can hybridize with the nucleotide sequence represented by SEQ ID NO: 18 under high stringency conditions include, for example, about 60% or more, and preferably about 70%, of the nucleotide sequence represented by SEQ ID NO: 18. As described above, more preferably, DNA or the like containing a nucleotide sequence having a homology of about 80% or more is used.
  • the polypeptide of the present invention eg, transcriptional regulatory activity, DNA that encodes a polypeptide having the same properties as the polypeptide of the present invention (eg, SEQ ID NO: 3, SEQ ID NO: 6 or Such as DNA containing the base sequence represented by No. 20).
  • Hybridization can be performed by a method known per se or a method analogous thereto, for example, by Molecular Cloning .2nd (J. Sambrook et a., Cold Spring Harbor Lab. Press, 1989). It can be carried out according to the method described. When a commercially available library is used, the procedure can be performed according to the method described in the attached instruction manual. More preferably, it can be performed under high stringent conditions.
  • High stringent conditions refer to, for example, a condition in which the sodium concentration is about 19 to 40 mM, preferably about 19 to 20 mM, and the temperature is about 50 to 70 ° C, preferably about 60 to 65 ° C. .
  • Examples of the DNA encoding the polypeptide having the amino acid sequence represented by SEQ ID NO: 4 include DNA having the 1st to 1212th base sequences in the nucleotide sequence represented by SEQ ID NO: 3, and the like.
  • the DNA encoding the polypeptide of the present invention having the amino acid sequence represented by 5 is represented by SEQ ID NO: 18.
  • the DNA having the amino acid sequence represented by SEQ ID NO: 7 encodes the polypeptide of the present invention, and the DNA having the base sequence represented by SEQ ID NO: 7 includes 364 to 1887 in the nucleotide sequence represented by SEQ ID NO: 6.
  • Examples of the DNA encoding the polypeptide of the present invention having the amino acid sequence represented by SEQ ID NO: 19 include DNA having the nucleotide sequence represented by SEQ ID NO: 20, and the like. Used.
  • the DNA incorporated in an appropriate vector is selected by hybridization with a DNA fragment encoding a partial or entire region of the polypeptide of the present invention or labeled with a synthetic DNA.
  • Hybridization can be performed according to, for example, the method described in Molecular Cloning 2nd (J. Sambrook et al., Cold Spring Harbor Lab. Press, 1989). When a commercially available library is used, it can be performed according to the method described in the attached instruction manual.
  • the DNA base sequence can be converted using PCR or a known kit, for example, Mutan TM —Super Exress Km (Takara Shuzo), Mutan TM —K (Takara Shuzo), or the like. ODA-LA PCR method, Gapped edlex method, Kunke 1 method and the like, or a method similar thereto.
  • the DNA encoding the cloned polypeptide can be used as it is depending on the purpose, or it can be used after digesting with a restriction enzyme or adding a linker, if desired.
  • the DNA may have ATG as a translation initiation codon at its 5 'end and TAA, TGA or TAG as a translation stop codon at its 3' end. These translation initiation codon and translation termination codon can be added using an appropriate synthetic DNA adapter.
  • the expression vector for the polypeptide of the present invention includes, for example, (a) cutting out a DNA fragment of interest from DNA encoding the polypeptide of the present invention, and (mouth) converting the DNA fragment into a promoter in an appropriate expression vector. By connecting downstream of Can be manufactured.
  • the vector examples include a plasmid derived from E. coli (eg, pBR322, pBR325, pUC12, pUC13), a plasmid derived from Bacillus subtilis (eg, pUB110, pTP5, pC194), a plasmid derived from yeast ( For example, pSH19, pSH15), pacteriophages such as ⁇ phage, animal viruses such as retrovirus, vaccinia virus, baculovirus, etc., pA11_1, ⁇ 1, pRC / CMV , pRcZRSV, pcDNAIeo and the like are used.
  • E. coli eg, pBR322, pBR325, pUC12, pUC13
  • Bacillus subtilis eg, pUB110, pTP5, pC194
  • yeast e.g, pSH19, pSH15
  • pacteriophages such as
  • the promoter used in the present invention may be any promoter as long as it is appropriate for the host used for gene expression.
  • SR promoter when animal cells are used as the host, SR promoter, SV40 promoter, LTR promoter, CMV promoter, HSV-TK promoter, ⁇ -actin and the like can be mentioned.
  • CMV cytomegalovirus
  • SRa promoter cytomegalovirus
  • the host is Eshierihia genus bacterium, trp promoter, lac promoter, re cA pro seventy-one evening one, lambda P L promoter Isseki one, l pp promoter, T 7 promoter etc.
  • the promoter is preferably SPO1 promoter, SPO2 promoter, penP promoter, etc.
  • yeast PHO5 promoter, PGK promoter, GAP promoter, ADH promoter and the like are preferable.
  • the host is an insect cell, a polyhedrin promoter, a P10 promoter and the like are preferable.
  • an expression vector containing, if desired, an enhancer, a splicing signal, a poly (A) addition signal, a selection marker, an SV40 replication origin (hereinafter sometimes abbreviated as SV40 ori) and the like may be used.
  • the selection marker include a dihydrofolate reductase (hereinafter sometimes abbreviated as dh fr) gene [methotrexate (MTX) resistance] and an ampicillin resistance gene (hereinafter sometimes abbreviated as Amp 1 ) , neomycin resistance gene (hereinafter sometimes abbreviated as Ne o F, Geneticin resistance) Hitoshigakyo up.
  • dh fr dihydrofolate reductase
  • Amp 1 ampicillin resistance gene
  • Ne o F neomycin resistance gene
  • a signal sequence suitable for the host is added to the N-terminal side of the polypeptide of the present invention.
  • the host is a bacterium belonging to the genus Escherichia, a Pti oA signal sequence, an OmpA * signal sequence, and the like
  • the host is a bacterium belonging to the genus Bacillus
  • the ⁇ -amylase signal sequence when the host is an yeast, MFa signal sequence, SUC2 signal sequence, etc.
  • the host is an animal cell, insulin signal sequence, ⁇ _interferin signal sequence, antibody molecule, signal An array or the like can be used respectively.
  • a transformant can be produced using the thus constructed vector containing the DNA encoding the polypeptide of the present invention.
  • Escherichia bacteria for example, Escherichia bacteria, Bacillus bacteria, yeast, insect cells, insects, animal cells and the like are used.
  • Escherichia include, for example, Escherichia coli.
  • Bacillus bacteria examples include, for example, Bacillus subtilis MI114 [Gene, 24, 255 (1983)], 207-21 [Journal of Biochemistry, 95] Vol. 87 (1 984)].
  • yeast examples include Saccharomyces cerevisiae AH22, AH22R—, ⁇ 87-11A, DKD—5D, 20 ⁇ —12, Schizosaccharomyces pombe NCYC 1913, NCYC 2036, (Pichia pastoris) KM 71 or the like is used.
  • insect cells for example, when the virus is Ac NPV, a cell line derived from a larva of night moth (Spodoptera frugiperda cell; S f cell), MG1 cell derived from the midgut of Trichoplusia ni, High derived from egg of Trichoplusia ni Five TM cells, cells derived from Mamestra brassicae or cells derived from Estigmena acrea are used.
  • Sf cells include Sf9 cells (ATCC CRL1711) and Sf21 cells (Vaughn, JL et al., In Vivo, 13, 213-217, (1977)) and the like. Used.
  • insects for example, silkworm larvae are used [Maeda et al., Nature, Vol. 315, 592 (1985)].
  • animal cells examples include monkey cell COS-7, Vero, Chinese hamster cell CHO (hereinafter abbreviated as CHO cell), and dh fr gene-deficient Chinese hamster cell CHO (hereinafter CHO (dh fr—) cell).
  • CHO cell Chinese hamster cell CHO
  • dh fr— Chinese hamster cell CHO
  • mouse L cells mouse AtT-20, mouse myeloma cells, rat GH3, human FL cells, etc. are used.
  • Transformation of Bacillus spp. can be performed, for example, according to the method described in Molecular & General Genetics, Molecular & General Genetics, vol. 168, 111 (1979).
  • a liquid medium is suitable as a medium for culturing, and a carbon source necessary for the growth of the transformant is contained therein.
  • carbon sources include glucose, dextrin, soluble starch, sucrose, etc.
  • nitrogen sources include ammonium salts, nitrates, corn chip liquor, peptone, casein, yeast extract, meat extract, Inorganic or organic substances such as soybean meal and potato extract, and inorganic substances include, for example, calcium chloride, sodium dihydrogen phosphate, magnesium chloride and the like.
  • yeast, vitamins, growth promoting factors and the like may be added.
  • the pH of the medium is preferably about 5-8.
  • an M9 medium containing glucose and casamino acids As a medium for culturing the genus Escherichia, for example, an M9 medium containing glucose and casamino acids (Miller, Journal of Ex-limen-in-Molecular-Genetics (Journal of Experiments) in Molecular Genetics), 431-433, Cold Spring Harbor Laboratory, New York 1972]. If necessary, an agent such as 3] 3-indolylacrylic acid can be added to make the promoter work efficiently.
  • culturing is usually performed at about 15 to 43 "C for about 3 to 24 hours, and if necessary, aeration and stirring may be added.
  • the cultivation is usually performed at about 30 to 40 for about 6 to 24 hours, and if necessary, aeration and stirring can be applied.
  • the ⁇ of the medium is adjusted to about 5-8. Culture is usually about
  • the ⁇ of the culture medium is adjusted to about 6.2 to 6.4. Cultivation is usually performed at about 27 for about 3 to 5 days, and aeration and agitation are added as necessary.
  • the pH is about 6-8.
  • the cultivation is usually carried out at about 30 to 40 for about 15 to 60 hours, and if necessary, aeration and stirring are applied.
  • polypeptide of the present invention can be produced in the cells, in the cell membrane, or outside the cells of the transformant.
  • polypeptide of the present invention can be separated and purified from the culture by, for example, the following method.
  • the cells or cells are collected by a known method after culturing, suspended in an appropriate buffer, and subjected to ultrasound, lysozyme and After disrupting cells or cells by freezing and thawing, etc., a method of obtaining a crude extract of the polypeptide by centrifugation or filtration is suitable.
  • the buffer may contain a protein denaturing agent such as urea or guanidine hydrochloride, or a surfactant such as Triton X-100 TM .
  • Purification of the polypeptide contained in the culture supernatant or extract thus obtained can be carried out by appropriately combining known separation and purification methods.
  • These known separation and purification methods include methods utilizing solubility such as salting out and solvent precipitation, dialysis, ultrafiltration, gel filtration, and SDS-polyacrylamide gel electrophoresis.
  • a method utilizing the difference in hydrophobicity such as isoelectric point electrophoresis and a method utilizing the difference in isoelectric point are used.
  • the polypeptide thus obtained when obtained in a free form, it can be converted to a salt by a method known per se or a method analogous thereto, and conversely, when the polypeptide is obtained as a salt, a method known per se or The compound can be converted into a free form or another salt by an analogous method.
  • the polypeptide produced by the recombinant may be appropriately modified or partially removed by the action of a protein modifying enzyme or a protease.
  • a protein modifying enzyme for example, trypsin, chymotrypsin, arginyl endopeptidase, protein kinase, glycosidase and the like are used.
  • the presence of the thus produced polypeptide of the present invention or a salt thereof can be measured by, for example, Enzymimnoatse ⁇ Western blot analysis using a specific antibody.
  • the antibody against the polypeptide of the present invention or a salt thereof may be any of a polyclonal antibody and a monoclonal antibody as long as it can recognize the polypeptide of the present invention or a salt thereof.
  • Antibodies against the polypeptide of the present invention or a salt thereof can be produced by using the polypeptide of the present invention as an antigen according to a method for producing an antibody or antiserum known per se. Can be.
  • the polypeptide of the present invention or a salt thereof is administered to a warm-blooded animal itself or together with a carrier or a diluent at a site capable of producing an antibody upon administration.
  • Complete Freund's adjuvant or incomplete Freund's adjuvant may be administered to enhance the antibody-producing ability upon administration.
  • the administration is usually performed once every 2 to 6 weeks, for a total of about 2 to 10 times.
  • warm-blooded animals to be used include monkeys, egrets, dogs, guinea pigs, mice, rats, sheep, goats, and chickens, with mice and rats being preferred.
  • a warm-blooded animal immunized with the antigen for example, an individual with an antibody titer from a mouse, and collect the spleen or lymph nodes 2 to 5 days after the final immunization and include them in them.
  • a monoclonal antibody-producing hybridoma can be prepared.
  • the antibody titer in the antiserum can be measured, for example, by reacting a labeled polypeptide described below with the antiserum, and then measuring the activity of a labeling agent bound to the antibody.
  • the fusion operation can be performed according to a known method, for example, the method of Kohler and Milstein [Nature, 256, 495 (1975)].
  • the fusion promoter include polyethylene glycol (PEG) and Sendai virus, but PEG is preferably used.
  • myeloma cells examples include myeloma cells of warm-blooded animals such as NS_1, P3U1, SP2 / 0, and AP-1, but P3U1 is preferably used.
  • the preferred ratio between the number of antibody-producing cells (spleen cells) and the number of myeloma cells used is about 1: 1 to 20: 1, and PEG (preferably PEG 1000 to PEG 6000) is used at a concentration of about 10 to 80%.
  • Cell fusion can be carried out efficiently by adding the mixture and incubating at about 20 to 40, preferably about 30 to 37 for about 1 to 10 minutes.
  • polypeptide antigens are adsorbed directly or together with a carrier.
  • the hybridoma culture supernatant is added to the solid phase (eg, microplate), and then an anti-immunoglobulin antibody labeled with a radioactive substance or an enzyme (anti-mouse immunization if the cells used for cell fusion are mice) Globulin antibody is used) or protein A is added, and the monoclonal antibody bound to the solid phase is detected.
  • the hybridoma culture supernatant is added to the solid phase to which anti-immune globulin antibody or protein A is adsorbed.
  • the selection of the monoclonal antibody can be performed according to a method known per se or a method analogous thereto. Usually, it can be performed in an animal cell culture medium supplemented with HAT (hypoxanthine, aminopterin, thymidine).
  • HAT hyperxanthine, aminopterin, thymidine
  • any medium can be used as long as it can grow a hybridoma.
  • RPMI 1640 medium containing about 1 to 20%, preferably about 10 to 20% fetal bovine serum, GIT medium containing about 1 to 10% fetal bovine serum (Wako Pure Chemical Industries, Ltd.)
  • a serum-free medium for hybridoma culture SFM-101, Nissui Pharmaceutical Co., Ltd.
  • the culture temperature is usually about 20 to 40, preferably about 37.
  • the culture time is usually 5 days to 3 weeks, preferably 1 week to 2 weeks.
  • the culture can be usually performed under 5% carbon dioxide gas.
  • the antibody titer of the hybridoma culture supernatant can be measured in the same manner as the measurement of the antibody titer in the antiserum described above.
  • Monoclonal antibodies can be separated and purified by methods known per se, for example, immunoglobulin separation and purification methods (eg, salting out, alcohol precipitation, isoelectric precipitation, electrophoresis, ion exchangers (eg, DEAE) Absorption / desorption method, ultracentrifugation method, gel filtration method, antigen-binding solid phase or specific purification method in which only antibody is collected using an active adsorbent such as protein A or protein G, and the bond is dissociated to obtain the antibody. You can do it.
  • immunoglobulin separation and purification methods eg, salting out, alcohol precipitation, isoelectric precipitation, electrophoresis, ion exchangers (eg, DEAE) Absorption / desorption method, ultracentrifugation method, gel filtration method, antigen-binding solid phase or specific purification method in which only antibody is collected using an active adsorbent such as protein A or protein G, and the bond is dissociated to obtain the antibody. You
  • the polyclonal antibody of the present invention can be produced by a method known per se or a method analogous thereto.
  • the immunizing antigen polypeptide antigen itself or a complex thereof with a carrier protein is formed, and the above monoclonal A method of immunizing a warm-blooded animal in the same manner as in the method for producing an antibody, collecting the antibody-containing substance of the polypeptide of the present invention or a salt thereof from the immunized animal, and separating and purifying the antibody.
  • the immunizing antigen polypeptide antigen
  • a complex thereof with a carrier protein is formed, and the above monoclonal
  • a method of immunizing a warm-blooded animal in the same manner as in the method for producing an antibody, collecting the antibody-containing substance of the polypeptide of the present invention or a salt thereof from the immunized animal, and separating and purifying the antibody.
  • the type of carrier protein and the mixing ratio of carrier to hapten are determined by the efficiency of antibodies against hapten immunized by cross-linking with carrier. If possible, any material may be cross-linked at any ratio.For example, ⁇ serum albumin ⁇ ⁇ cysiloglopurine, hemocyanin, etc., in a weight ratio of about 0 to hapten 1 per hapten 1. A method of coupling at a rate of 1 to 20 and preferably about 1 to 5 is used.
  • Various condensing agents can be used for force coupling between the hapten and the carrier.
  • daltaraldehyde ⁇ carposimide a maleimide active ester, an active ester reagent containing a thiol group or a dithioviridyl group, or the like is used.
  • the condensation product is administered to a warm-blooded animal at a site where antibody production is possible or together with a carrier or diluent.
  • Complete Freund's adjuvant or incomplete Freund's adjuvant may be administered in order to enhance the antibody-producing ability upon administration.
  • the administration is usually performed once every about 2 to 6 weeks, for a total of about 3 to 10 times.
  • the polyclonal antibody can be collected from the blood, ascites, etc., preferably from the blood of a warm-blooded animal immunized by the above method.
  • the measurement of the polyclonal antibody titer in the antiserum can be performed in the same manner as the measurement of the antibody titer in the antiserum described above. Separation and purification of the polyclonal antibody can be performed according to the same immunoglobulin separation and purification method as in the above-described separation and purification of the monoclonal antibody.
  • the antisense DNA having a nucleotide sequence complementary to or substantially complementary to DNA encoding the polypeptide of the present invention includes the DNA of the present invention. Any antisense DNA may be used as long as it has a nucleotide sequence complementary to or substantially complementary to NA and has an action capable of suppressing the expression of the DNA.
  • the base sequence substantially complementary to the DNA of the present invention is, for example, the entire base sequence of the base sequence complementary to the DNA of the present invention (that is, the complementary strand of the DNA of the present invention). Or about 70% or more, preferably about 80% or more, more preferably about 90% or more, and most preferably about 95% or more homology with the partial base sequence.
  • about 70% of the total nucleotide sequence of the complementary strand of the DNA of the present invention is complementary to the complementary sequence of the nucleotide sequence of the portion encoding the N-terminal site of the polypeptide of the present invention (for example, the nucleotide sequence near the start codon).
  • Antisense DNA having a homology of at least about 80%, more preferably at least about 90%, most preferably at least about 95% is preferred. These antisense DNAs can be produced using a known DNA synthesizer or the like.
  • the polypeptide of the present invention or a salt thereof hereinafter sometimes abbreviated as the polypeptide of the present invention
  • a DNA encoding the polypeptide of the present invention hereinafter sometimes abbreviated as the DNA of the present invention
  • a transformant transformed with a recombinant vector containing a DNA encoding the polypeptide of the present invention hereinafter sometimes abbreviated as the transformant of the present invention
  • the polypeptide of the present invention or a salt thereof Antibodies (hereinafter sometimes abbreviated as the antibodies of the present invention), and uses of antisense DNA.
  • the DNA encoding the polypeptide of the present invention has abnormalities. If present or missing, various diseases such as rheumatoid arthritis, osteoarthritis, osteoporosis, fractures, and cancer are likely to develop.
  • the polypeptide of the present invention and the DNA of the present invention can be used, for example, as a medicament such as an agent for treating or preventing various diseases such as rheumatoid arthritis, osteoarthritis, osteoporosis, bone fracture, and cancer. .
  • the polypeptide of the present invention when there is a patient in which the polypeptide of the present invention is reduced or deficient in a living body, (a) administering the DNA of the present invention to the patient and expressing the polypeptide of the present invention in the living body (Mouth) inserting the DNA of the present invention into cells, expressing the polypeptide of the present invention, and then transplanting the cells into a patient; or (8) administering the polypeptide of the present invention to the patient.
  • the role of the polypeptide of the present invention in the patient can be sufficiently or normally exerted.
  • the DNA of the present invention When the DNA of the present invention is used as the above-mentioned therapeutic or prophylactic agent, the DNA is inserted alone or into an appropriate vector such as a retrovirus vector, an adenovirus vector, an adenovirus-associated virus vector, and the like. According to the means, it can be administered to humans or warm-blooded animals.
  • the DNA of the present invention can be administered as such or with a physiologically acceptable carrier such as an adjuvant for promoting uptake, and administered with a gene gun or a catheter such as a hydrogel catheter.
  • polypeptide of the present invention When used as the above therapeutic or prophylactic agent, it is purified to at least 90%, preferably at least 95%, more preferably at least 98%, and even more preferably at least 99%. It is preferred to use
  • the polypeptide of the present invention can be used, for example, as a sugar-coated tablet, capsule, elixir, microcapsule, or the like, if necessary, orally, or water or other pharmaceutically acceptable liquid. It can be used parenterally in the form of injections, such as sterile solutions or suspensions.
  • the polypeptide of the present invention is mixed with a physiologically acceptable carrier, flavoring agent, excipient, vehicle, preservative, stabilizer, binder, etc. in a unit dosage form required for a generally accepted formulation. By doing so, it can be manufactured.
  • the amount of active ingredient in these preparations is such that a suitable dosage in the specified range can be obtained.
  • binders such as gelatin, corn starch, tragacanth, gum arabic
  • excipients such as crystalline cellulose, corn starch, gelatin, alginic acid, and the like.
  • leavening agents such as magnesium stearate
  • sweeteners such as sucrose, lactose or saccharin
  • flavoring agents such as peppermint, cocoa oil or cellulose are used.
  • the unit dosage form is a capsule
  • the above-mentioned dinner material may further contain a liquid carrier such as oil and fat.
  • Sterile compositions for injection should be formulated according to standard pharmaceutical manufacturing methods, such as dissolving or suspending the active substance in vehicles such as water for injection, or naturally occurring vegetable oils such as sesame oil or coconut oil. Can be.
  • aqueous liquids for injection include physiological saline, isotonic solutions containing glucose and other adjuvants (eg, D-sorbitol, D_mannitol, sodium chloride, etc.).
  • Agents for example, alcohol (eg, ethanol, etc.), polyalcohol (eg, propylene glycol, polyethylene glycol, etc.), nonionic surfactant (eg, polysorbate 80 TM , HCO-50, etc.) Is also good.
  • oily liquid examples include sesame oil and soybean oil, and may be used in combination with a solubilizing agent such as benzyl benzoate or benzyl alcohol.
  • a solubilizing agent such as benzyl benzoate or benzyl alcohol.
  • buffers for example, phosphate buffer, sodium acetate buffer, etc.
  • soothing agents for example, benzalkonium chloride, proprochlorinate, etc.
  • stabilizers for example, human serum albumin, polyethylene glycol, etc.
  • Preservatives eg, benzyl alcohol, phenol, etc.
  • antioxidants antioxidants and the like.
  • the prepared injection is usually filled in an appropriate ampoule.
  • the vector into which the DNA of the present invention has been inserted is also formulated in the same manner as described above, and is usually used parenterally.
  • the preparations obtained in this way are safe and low toxic and can be used, for example, in humans or warm-blooded animals (for example, rats, mice, guinea pigs, egrets, birds, higgies, bushes, dogs, dogs, Cats, dogs, monkeys, chimpanzees, etc.).
  • warm-blooded animals for example, rats, mice, guinea pigs, egrets, birds, higgies, bushes, dogs, dogs, Cats, dogs, monkeys, chimpanzees, etc.
  • the dose of the polypeptide of the present invention may vary depending on the target disease, the subject of administration, the administration route, and the like.For example, when the polypeptide of the present invention is orally administered for the purpose of treating rheumatoid arthritis, it is generally used. In adults (as 6 O kg), about 0.1 mg to 10 O mg, preferably about 1.0 to 50 mg, more preferably about 1.0 to 20 mg of the polypeptide is administered per day. When administered parenterally, a single dose of the polypeptide may vary depending on the administration subject, target disease, and the like.For example, for the purpose of treating rheumatoid arthritis, the polypeptide of the present invention may be in the form of an injection.
  • the activity of the polypeptide of the present invention eg, the binding activity to the ChM-I gene promoter, — A compound or its salt that promotes the transcriptional activity of the I gene, the activity of promoting the expression of the type II collagen gene, etc.
  • the activity of the polypeptide of the present invention can be used as medicine.
  • the compound or its salt that inhibits the activity of the polypeptide of the present invention can be used as a medicament such as a therapeutic or prophylactic agent for disc herniation, sciatica, ectopic cartilage formation and the like.
  • the polypeptide of the present invention can be used as a reagent for screening a compound or a salt thereof that promotes or inhibits the activity of the polypeptide of the present invention.
  • the DNA of the present invention or a transformant transformed with the DNA has an ability to produce the polypeptide of the present invention, a compound or a salt thereof that promotes or inhibits the activity of the polypeptide of the present invention. Can be used as a reagent for screening.
  • the present invention provides a method for screening for a compound that inhibits MAP (hereinafter sometimes abbreviated as an inhibitor). More specifically, for example, (2) (i) the cis- comparison between the case where the DNA containing the element is contacted and the case where (ii) the DNA of the present invention is brought into contact with the DNA containing the cis-element of the ChM-I gene promoter and the test compound. And a method of screening for an accelerator or an inhibitor.
  • the polypeptide of the present invention is transferred to the ChM-I gene promoter. Are compared with each other.
  • the DNA containing the cis-element of the ChM-I gene promoter those labeled with, for example, a radioisotope or a dye are preferably used.
  • a radioisotope for example, 32 P, 3 H or the like is used.
  • the dye for example, fluorescein, FAM (manufactured by PE Biosystems), JOE (PE), PE
  • the DNA containing the cis-element of the ChM-I gene promoter is, for example, six or more (preferably 6 to 6) consecutive nucleotides identical or substantially identical to the nucleotide sequence represented by SEQ ID NO: 17
  • a single-stranded or double-stranded DNA having a sequence composed of 20 (more preferably, 8 to 20, more preferably 10 to 20) bases. can be prepared.
  • base sequence substantially the same as the base sequence represented by SEQ ID NO: 17 for example, about 1 to 3 bases in the base sequence represented by SEQ ID NO: 17 are substituted with other bases Base sequence. More specifically, the base sequence represented by SEQ ID NO: 21 (JP-A-7-138295) and the like can be mentioned.
  • the amount of the polypeptide of the present invention bound to the cis-element-containing DNA of the ChM-I gene promoter is determined by the amount of the cis-element-containing promoter of the ChM-I gene bound to the polypeptide of the present invention.
  • A can be quantified, for example, by measuring the activity of the labeled body as an indicator, and a method known per se, for example, the-gel shift assay method (New Genetic Engineering Handbook, 3rd revised edition, edited by Masami Muramatsu et al., Sheep (Published by Tsuchiya, p. 150, 1999).
  • Test compounds include, for example, peptides, proteins, non-peptidic compounds, synthetic compounds, fermentation products, cell extracts, plant extracts, and animal tissue extracts, and these compounds are novel compounds. Or a known compound.
  • the present invention also relates to a method for screening for an accelerator or an inhibitor, which comprises using the DNA of the present invention or the transformant of the present invention.
  • the present invention relates to the DNA of the present invention and a cis-element of the ChM-I gene promoter.
  • Yeasts e.g., Sacc aromyces cerevisiae transformed with a DNA linked to a reporter gene downstream of E. coli are cultured in the presence and absence of a test compound, and the expression of the reporter gene is detected and compared.
  • Reporter genes include, for example, Fudenkos that complement nutritional requirements such as HIS3, TRP1, and URA3; drug resistance genes such as aureobasidin A resistance gene; for example, 1acZ (0-galactosidase gene) ) And the like.
  • a yeast having an auxotrophy for histidine was transformed with the DNA of the present invention and a DNA in which the HIS3 gene was linked as a reporter gene downstream of the cis-element of the ChM-I gene promoter.
  • the activity of the polypeptide of the present invention is promoted by culturing the transformant in a medium lacking histidine in the presence of the test compound and measuring the viability (promotion or inhibition of growth) of the transformant.
  • Compounds or salts thereof that promote or inhibit can be screened.
  • a test compound that promotes the growth of the transformant can be selected as a compound that promotes the activity of the polypeptide of the present invention, and a test compound that inhibits the growth of the transformant is the activity of the polypeptide of the present invention.
  • a transformant obtained by transforming a yeast with the DNA of the present invention and a DNA in which an aureobasidin A resistance gene was linked as a repo overnight gene downstream of the cis-element of the ChM_I gene promoter was tested.
  • a compound or a salt thereof that promotes or inhibits the activity of the polypeptide of the present invention by culturing in a medium containing the compound and o-leobasidin A and measuring the viability (promotion or inhibition of growth) of the transformant Can be screened.
  • a test compound that promotes the growth of the transformant can be selected as a compound that promotes the activity of the polypeptide of the present invention, and a test compound that inhibits the growth of the transformant can be selected as the activity of the polypeptide of the present invention.
  • the transformant is cultured in the presence of a test compound and, for example, a reagent serving as a substrate for a / 3-galactosidase such as 5_bromo_4_cloth—3—indolyl / 3 / 3-galactovyranoside (X—gal).
  • a compound or a salt thereof that promotes or inhibits the activity of the polypeptide of the present invention can be screened. If the transformant cultured in the presence of the test compound stains darker blue than when cultured in the absence of the test compound, the test compound is selected as a compound that promotes the activity of the polypeptide of the present invention.
  • a test compound can be selected as a compound that inhibits the activity of the polypeptide of the present invention when it is stained lighter blue or no stain at all.
  • a test compound that increases the amount of a reporter gene product can be used as a test compound to increase the activity of the polypeptide of the present invention.
  • a test compound that reduces the amount of a reporter gene product can be selected as a compound that inhibits the activity of the polypeptide of the present invention.
  • the cis-element of the ChM_I gene promoter used in the above-mentioned screening method includes, for example, a nucleotide sequence identical or substantially identical to the nucleotide sequence represented by SEQ ID NO: 17, A DNA containing a base sequence composed of 6 or more consecutive (preferably 6 to 20, preferably 10 to 20, more preferably 10 to 20) bases is exemplified.
  • Examples of the base sequence substantially identical to the base sequence represented by SEQ ID NO: 17 include, for example, about 1 to 3 bases in the base sequence represented by SEQ ID NO: 17
  • Substituted nucleotide sequences are exemplified. More specifically, the base sequence represented by SEQ ID NO: 21 (Japanese Patent Application Laid-Open No. Hei 7-138295) and the like can be mentioned.
  • the number of bases between the ChM-I gene promoter and the translation initiation codon of the repo overnight gene linked downstream thereof is not particularly limited, but is usually 0 to 100 bases, preferably 10 to 100 bases. It is 50 bases, more preferably 10 to 30 bases.
  • the culture of the transformant can be performed in the same manner as the culture of the transformant described above.
  • the screening kit of the present invention contains the polypeptide of the present invention, the DNA of the present invention, or the transformant of the present invention.
  • the po It contains a repeptide, the DNA of the present invention or the transformant of the present invention and a DNA containing the cis-element of the promoter of the ChM-I gene.
  • a transformant transformed with a DNA containing the DNA of the present invention and a cis-element of a ChM-I gene promoter may be used.
  • a cell encoding the polypeptide of the present invention which is characterized by culturing cells having the ability to produce the polypeptide of the present invention in the presence of a test compound, and measuring the amount of mRNA encoding the polypeptide of the present invention.
  • Examples of the cell capable of producing the polypeptide of the present invention include the above-mentioned transformant of the present invention and known warm-blooded animal cells capable of producing ChM-I.
  • Known warm-blooded animal cells having the ability to produce ChM-I include, for example, animal cells that produce ChM-I with an expression inducer such as insulin, and more specifically, mouse ATDC5 cells and the like. Is raised.
  • the culturing of cells having the ability to produce the polypeptide of the present invention is performed in the same manner as the culturing of the above-described transformant of the present invention.
  • the animal cell can be cultured in the presence or absence of the expression inducer.
  • the amount of mRNA encoding the polypeptide of the present invention is measured by contacting RNA extracted from cells with the DNA of the present invention or its complementary DNA in accordance with a method known per se, and then contacting the DNA of the present invention or its complement. This is done by measuring the amount of mRNA bound to DNA.
  • the complementary DNA of the DNA of the present invention or its partial DNA with, for example, a radioisotope, a dye, or the like.
  • the present invention The amount of mRNA encoding the polypeptide of the present invention bound to the complementary DNA of the above DNA can be easily measured.
  • the radioisotope and dye those similar to those used for labeling the DNA containing the cis-element of the ChM-I gene promoter described above are used.
  • the amount of mRNA encoding the polypeptide of the present invention is determined by converting RNA extracted from cells into cDNA by reverse transcriptase and then priming the DNA of the present invention or its complementary DNA or a partial DNA thereof. The measurement can be performed by measuring the amount of cDNA to be amplified depending on the PC scale used as the sample.
  • the complementary DNA to the DNA of the present invention used for measuring the amount of mRNA encoding the polypeptide of the present invention includes a DNA (lower strand) having a sequence complementary to the DNA of the present invention (upper strand). .
  • the partial DNA of the DNA of the present invention is composed of, for example, about 10 to 2200, preferably about 10 to 300, and more preferably about 10 to 30 bases in the base sequence of the DNA of the present invention.
  • Examples of the partial DNA of the DNA complementary to the DNA of the present invention include a DNA having a sequence complementary to the partial DNA of the DNA of the present invention.
  • Particularly preferred examples of primers used for PCR include, for example, DNA having the nucleotide sequence represented by SEQ ID NO: 8 and DNA having the nucleotide sequence ′ represented by SEQ ID NO: 9.
  • a test compound that increases the amount of mRNA encoding the polypeptide of the present invention can be selected as a compound that promotes the expression of the DNA of the present invention, and the mRNA of the mRNA encoding the polypeptide of the present invention can be selected.
  • a test compound that reduces the amount can be selected as a compound that inhibits the expression of the DNA of the present invention.
  • Compounds or salts thereof obtained using the screening method or screening kit of the present invention include the test compounds described above, for example, peptides, proteins, non-peptidic compounds, synthetic compounds, fermentation products, cell extracts, and plants.
  • a compound selected from extracts, animal tissue extracts, plasma, etc., and the activity of the polypeptide of the present invention eg, binding activity to ChM-I gene promoter, transcription activity of ChM-I gene, type II collagen gene Or a compound that promotes or inhibits the expression of the DNA of the present invention.
  • salt of the compound those similar to the aforementioned salts of the polypeptide of the present invention can be used. Used.
  • the activity of the polypeptide of the present invention eg, the activity of binding to the ChM_I gene promoter, the transcription activity of the ChM-I gene, the activity of promoting the expression of the type II collagen gene, etc.
  • the compound that promotes the expression of the DNA of the present invention is for example, it can be used as a drug for treating or preventing diseases such as rheumatoid arthritis, osteoarthritis, osteoporosis, bone fracture, and cancer. .
  • compounds that inhibit the activity of the polypeptide of the present invention or the expression of DNA of the present invention are useful as medicaments such as therapeutic and prophylactic agents for diseases such as herniated disc, sciatica, and ectopic cartilage formation. is there.
  • a compound obtained by using the screening method or the screening kit of the present invention is used as the above-mentioned therapeutic / prophylactic agent, it can be carried out according to conventional means.
  • tablets, capsules, elixirs, microcapsules, sterile solutions, suspensions, and the like can be prepared in the same manner as the above-mentioned drug containing the polypeptide of the present invention.
  • the preparations obtained in this way are safe and low toxic, such as, for example, human or warm-blooded animals (eg, mouse, rat, puppies, sheep, pigs, puppies, puppies, birds, cats, dogs, Monkeys, chimpanzees, etc.).
  • the dose of the compound or a salt thereof varies depending on its action, target disease, subject to be administered, route of administration, and the like.
  • the activity of the polypeptide of the present invention or the activity of the polypeptide of the present invention for the purpose of treating rheumatoid arthritis is intended.
  • a compound that promotes the expression of DNA When a compound that promotes the expression of DNA is administered orally, generally, in an adult (with a body weight of 60 kg), about 0.1 to 100 mg, preferably about 1.0 to 50 mg, more preferably about 0.1 to 100 mg of the compound per day is administered. Or about 1.0 to 20 mg.
  • the single dose of the compound may vary depending on the administration subject, target disease, etc., for example, the activity of the polypeptide of the present invention or the DN of the present invention for the treatment of rheumatoid arthritis.
  • a compound that promotes the expression of A is administered to an adult (as 6 O kg) in the form of an injection, usually about 0.01 to 30 mg, preferably about 0.1 to 20 mg of the compound per day, More preferably, about 0.1 to 1 Omg is conveniently administered by intravenous injection. In the case of other animals, the dose can be administered in terms of 60 kg.
  • a compound that inhibits the activity of the polypeptide of the present invention or the expression of the DNA of the present invention is orally administered for the treatment of intervertebral disc herniation, generally, in an adult (assuming a body weight of 60 kg), the daily dose is The compound is administered in about 0.1-100 mg, preferably about 1.0-5 Omg, more preferably about 1.0-20 mg.
  • the single dose of the compound may vary depending on the administration subject, target disease, etc., for example, the activity of the polypeptide of the present invention or the DN of the present invention for the treatment of herniated disc herniation.
  • a compound that inhibits the expression of A is usually administered to an adult (as 6 O kg) in the form of an injection, about 0.01 to 30 mg, preferably about 0.1 to 20 mg of the compound per day is administered. More preferably, about 0.1 to 1 Omg is administered by intravenous injection. For other animals, the dose can be administered in terms of 60 kg.
  • polypeptide of the present invention specifically binds to a cis-element having the same or substantially the same nucleotide sequence as the nucleotide sequence represented by SEQ ID NO: 17, and thus is represented by SEQ ID NO: 17.
  • SEQ ID NO: 17 Promotes transcription of a gene having a cis-element having the same or substantially the same base sequence as the base sequence. Therefore, the polypeptide of the present invention, the DNA of the present invention or the transformant of the present invention has, in addition to the ChM_I gene, the same or substantially the same nucleotide sequence as the nucleotide sequence represented by SEQ ID NO: 17. It can also be used for screening for a compound that promotes or inhibits the transcription of another gene having a cis-element.
  • the antibody of the present invention can specifically recognize the polypeptide of the present invention, it may be used for quantification of the polypeptide of the present invention in a test solution, particularly for quantification by a sandwich immunoassay. Can be.
  • a method for quantifying the polypeptide of the present invention in a test wave which comprises:
  • one antibody may be an antibody that recognizes the N-terminal of the polypeptide of the present invention, and the other antibody may be an antibody that reacts with the C-terminal of the polypeptide of the present invention. desirable.
  • a monoclonal antibody against the polypeptide of the present invention may be used to measure the polypeptide of the present invention, and may be detected by tissue staining or the like. You can also.
  • the antibody molecule itself may be used, or F (ab ') 2 , Fab', or Fab fraction of the antibody molecule may be used.
  • the method for quantifying the polypeptide of the present invention using the antibody of the present invention is not particularly limited, and may be an antibody, an antigen, or an antibody-antigen complex corresponding to the amount of antigen (eg, the amount of protein) in the test solution.
  • Any method can be used as long as it is a method for detecting the amount of the enzyme by chemical or physical means and calculating the amount from a standard curve prepared using a standard solution containing a known amount of the antigen.
  • nephelometry, a competition method, an immunometric method, and a sandwich method are suitably used, but it is particularly preferable to use a sandwich method described later in terms of sensitivity and specificity.
  • a labeling agent used in a measurement method using a labeling substance for example, a radioisotope, an enzyme, a fluorescent substance, a luminescent substance and the like are used.
  • the radioisotope for example, [1 2 5 I], [1 3 1 I], [3 H], and [1 4 C] used.
  • the above enzyme a stable enzyme having a large specific activity is preferable.
  • 3-galactosidase, 3-dalcosidase, alkaline phosphatase, peroxidase, malate dehydrogenase and the like are used.
  • the fluorescent substance for example, fluorescamine, fluorescein isothiosinate and the like are used.
  • the luminescent substance for example, luminol, luminol derivative, luciferin, lucigenin and the like are used.
  • a biotin-avidin system can be used for binding the antibody or antigen to the labeling agent.
  • Carriers include agarose, dextran, and cellulose Examples include insoluble polysaccharides, synthetic resins such as polystyrene, polyacrylamide, and silicon, and glass.
  • a test solution is reacted with the insolubilized monoclonal antibody of the present invention (primary reaction), and further reacted with another labeled monoclonal antibody of the present invention (secondary reaction).
  • primary reaction the insolubilized monoclonal antibody of the present invention
  • secondary reaction another labeled monoclonal antibody of the present invention
  • the primary reaction and the secondary reaction may be performed in reverse order, may be performed simultaneously, or may be performed at a later time.
  • the labeling agent and the method of insolubilization can be the same as those described above.
  • the antibody used for the solid phase antibody or the labeling antibody is not necessarily one type, and a mixture of two or more types of antibodies is used for the purpose of improving measurement sensitivity and the like. May be used.
  • the monoclonal antibody of the present invention used in the primary reaction and the secondary reaction is an antibody having a different site to which the polypeptide of the present invention binds. Is preferably used.
  • the antibody used in the primary reaction and the secondary reaction is, for example, when the antibody used in the secondary reaction recognizes the C-terminal of the polypeptide of the present invention, the antibody used in the primary reaction is Preferably, an antibody that recognizes other than the C-terminal, such as the N-terminal, is used.
  • the monoclonal antibody of the present invention can be used in a measurement system other than the sandwich method, for example, a competition method, an immunometric method, or a nephrometry.
  • the competition method after the antigen in the test wave and the labeled antigen are allowed to react competitively with the antibody, the unreacted labeled antigen (F) and the labeled antigen (B) bound to the antibody are separated ( BZF separation), measure the amount of B, F labeling, and determine the amount of antigen in the test solution.
  • a soluble antibody is used as the antibody
  • B / F separation is performed using polyethylene glycol
  • a liquid phase method using a second antibody against the antibody or a solid phase immobilized as the first antibody.
  • a solid-phase method using a soluble antibody as the first antibody and using a solid-phased antibody as the second antibody is used.
  • the antigen in the test wave and the immobilized antigen are subjected to a competitive reaction with a certain amount of the labeled antibody, and then the solid phase and the liquid phase are separated. And an excess amount of the labeled antibody. After binding the antibody to the solid phase, the solid phase and the liquid phase are separated. Next, the amount of label in either phase is measured to quantify the amount of antigen in the test solution.
  • nephelometry the amount of insoluble sediment generated as a result of an antigen-antibody reaction in a gel or in a solution is measured. Even when the amount of antigen in the test wave is small and only a small amount of sediment is obtained, laser nephrometry utilizing laser scattering is preferably used.
  • the measurement system for the polypeptide of the present invention may be constructed by adding ordinary technical considerations of those skilled in the art to ordinary conditions and operation methods in each method. For details of these general technical means, reference can be made to reviews, books, etc.
  • the polypeptide of the present invention can be quantified with high sensitivity by using the antibody of the present invention.
  • the antibody of the present invention can be used for detecting the polypeptide of the present invention present in a subject such as a body fluid or a tissue.
  • preparation of an antibody column used for purifying the polypeptide of the present invention preparation of an antibody column used for purifying the polypeptide of the present invention, detection of the polypeptide of the present invention in each fraction at the time of purification, and behavior of the polypeptide of the present invention in the test cells. It can be used for analysis and the like.
  • the DNA of the present invention can be used, for example, in humans or warm-blooded animals (for example, rats, mice, guinea pigs, egrets, birds, higgies, bush, horses, horses, cats, dogs) by using them as probes. , Monkeys, chimpanzees, etc.) can be detected for abnormalities (genetic abnormalities) in the DNA or mRNA encoding the polypeptide of the present invention, such as, for example, damage, mutation or reduced expression of the DNA or mRNA. It is useful as a diagnostic agent for a gene such as an increase or excessive expression of the DNA or mRNA.
  • the above-described genetic diagnosis using the DNA of the present invention includes, for example, known Northern hybridization and PCR-SSCP method (Genomics, Vol. 5, pp. 874-879 (11989)). Proceedings of the National Academy of Sciences of the United States of America, Vol. 86, pp. 2766-2770 (1 989) Year))).
  • a decrease in expression is detected by Northern hybridization, it is possible to diagnose that the disease is likely to be a disease such as rheumatoid arthritis, osteoarthritis, osteoporosis, bone fracture, and cancer. .
  • DNA mutation is detected by PCR-SSCP method, for example, disc herniation, sciatica or ectopic cartilage formation, or rheumatoid arthritis, osteoarthritis, osteoporosis, fracture or cancer May be a disease such as It can be diagnosed that the efficiency is high.
  • the antisense DNA capable of binding complementarily to the DNA of the present invention and suppressing the expression of the DNA can suppress the function of the polypeptide of the present invention or the DNA of the present invention in vivo, For example, it can be used as an agent for treating and preventing intervertebral disc herniation, sciatic nerve pain, and ectopic cartilage formation.
  • the above-mentioned antisense DNA is used as the above-mentioned therapeutic / prophylactic agent, it can be carried out in the same manner as the aforementioned therapeutic / prophylactic agent for various diseases containing DNA of the present invention.
  • the antisense DNA when using the antisense DNA, may be used alone or after being inserted into an appropriate vector such as a retrovirus vector, an adenovirus vector, an adenovirus associated virus vector, and the like, followed by a conventional method. it can.
  • the antisense DNA can be administered as it is or in the form of a formulation together with a physiologically acceptable carrier such as an adjuvant for promoting uptake, and can be administered by a gene gun or a catheter such as a hide mouth gel catheter.
  • the antisense DNA can also be used as a diagnostic oligonucleotide probe for examining the presence of the DNA of the present invention in tissues or cells and the state of its expression.
  • the antibody of the present invention which has the activity of neutralizing the activity of the polypeptide of the present invention, is used as a medicament such as an agent for treating or preventing various diseases such as disc herniation, sciatica, and ectopic cartilage formation. be able to.
  • the therapeutic or prophylactic agent for the above-mentioned diseases containing the antibody of the present invention can be used as it is as a liquid or as a pharmaceutical composition in an appropriate dosage form, in humans or mammals (eg, rat, rabbit, egret, sheep, bush, pig, etc.). , Cats, dogs, monkeys, etc.) can be administered orally or parenterally.
  • the dosage varies depending on the administration subject, target disease, symptoms, administration route, and the like.For example, when used for the treatment or prevention of an intervertebral hernia in an adult, the antibody of the present invention is usually administered as a single dose.
  • OmgZkg body weight preferably 0.1-; L OmgZkg body weight, more It is convenient to administer preferably about 0.1 to 5 mg Z kg body weight by intravenous injection about 1 to 5 times a day, preferably about 1 to 3 times a day. In the case of other parenteral administration and oral administration, an equivalent dose can be administered. If the symptoms are particularly severe, the dose may be increased accordingly.
  • the antibodies of the present invention can be administered by themselves or as a suitable pharmaceutical composition.
  • the pharmaceutical composition used for the above administration contains the above or a salt thereof and a pharmacologically acceptable carrier, diluent or excipient.
  • Such compositions are provided in dosage forms suitable for oral or parenteral administration.
  • compositions for oral administration include solid or liquid dosage forms, specifically tablets (including sugar-coated tablets and film-coated tablets), pills, granules, powders, capsules (soft capsules and the like). ), Syrups, emulsions, suspensions and the like.
  • Such a composition is produced by a method known per se and contains a carrier, diluent or excipient usually used in the field of formulation.
  • a carrier for example, lactose, starch, sucrose, magnesium stearate and the like are used as carriers and excipients for tablets.
  • compositions for parenteral administration for example, injections, suppositories and the like are used.
  • Injections are in the form of intravenous injections, subcutaneous injections, intradermal injections, intramuscular injections, drip injections and the like. Is included.
  • Such injections are prepared according to a method known per se, for example, by dissolving, suspending or emulsifying the antibody or a salt thereof in a sterile aqueous or oily liquid commonly used for injections.
  • aqueous solutions for injection include physiological saline, isotonic solutions containing glucose and other adjuvants, and suitable solubilizing agents, for example, alcohols (eg, ethanol), polyalcohols (eg, , Propylene glycol, polyethylene glycol), nonionic surfactants (eg, polysorbate 80, HC ⁇ -50 (polyoxythylene (5 Omol) adduc t of hydrogenated cas tor oil)), etc. Is also good.
  • the oily liquid for example, sesame oil, soybean oil, and the like are used, and benzyl benzoate, benzyl alcohol, and the like may be used in combination as a solubilizing agent.
  • the prepared injection solution is usually filled in a suitable ampoule.
  • a suppository for rectal administration is prepared by mixing the above antibody or a salt thereof with a usual suppository base.
  • the above-mentioned oral or parenteral pharmaceutical composition is compatible with the dosage of the active ingredient. It is convenient to prepare such dosage unit forms. Examples of the dosage unit include tablets, pills, capsules, injections (ampoules), suppositories and the like, and usually 5 to 500 mg, especially 5 to 100 mg for each dosage unit. However, other dosage forms preferably contain 10 to 250 mg of the above antibody.
  • compositions may contain other active ingredients as long as the composition does not cause an undesirable interaction with the above-mentioned antibody.
  • the present invention relates to a DNA encoding the exogenous polypeptide of the present invention (hereinafter abbreviated as the exogenous DNA of the present invention) or a mutant DNA thereof (when abbreviated as the exogenous mutant DNA of the present invention).
  • Non-human mammals having the exogenous DNA of the present invention or the mutant DNA thereof include unfertilized eggs, fertilized eggs, germ cells including spermatozoa and their progenitor cells, and the like.
  • the calcium phosphate method, the electric pulse method, and the ribofection method It can be produced by transferring the desired DNA by a method such as a coagulation method, a coagulation method, a microinjection method, a particle gun method, or a DEAE-dextran method.
  • the exogenous DNA of the present invention can be transferred to somatic cells, organs of living organisms, tissue cells, and the like, and can be used for cell culture, tissue culture, and the like.
  • the DNA transgenic animal of the present invention can also be produced by fusing the cells with the above-mentioned germ cells by a cell fusion method known per se.
  • Non-human mammals include, for example, reeds, pigs, sheep, goats, reefs, Nu, cat, guinea pig, hams, mouse, rat, etc. are used.
  • the system is preferably a BGCS Fi system, a BDFi system, a BSDS Fi system, a BALBZc system, an ICR system, etc.) or a rat (eg, Wistar, SD, etc.).
  • Examples of the “mammal” in the recombinant vector that can be expressed in mammals include humans and the like in addition to the above-mentioned non-human mammals.
  • the exogenous DNA of the present invention refers to the DNA of the present invention once isolated and extracted from a mammal, not the DNA of the present invention originally possessed by a non-human mammal.
  • DNA having a mutation (for example, mutation) in the base sequence of the original DNA of the present invention, specifically, base addition, deletion, substitution with another base, etc. DNA that has been used is used, and also includes abnormal DNA.
  • the abnormal DNA means a DNA that expresses an abnormal polypeptide of the present invention.
  • a DNA that expresses a protein that suppresses the function of a normal polypeptide of the present invention is used.
  • the exogenous DNA of the present invention may be derived from a mammal of the same or different species as the animal of interest.
  • DNs derived from various mammals eg, egrets, dogs, cats, guinea pigs, hamsters, rats, mice, etc.
  • having the DNA of the present invention having a high homology to the human DNA are transferred.
  • the present invention is achieved by microinjecting a DNA construct (eg, vector 1) to which the human DNA of the present invention is bound downstream of various promoters capable of expressing A into a fertilized egg of a target mammal, for example, a mouse fertilized egg.
  • a DNA construct eg, vector 1
  • various promoters capable of expressing A into a fertilized egg of a target mammal, for example, a mouse fertilized egg.
  • expression vectors for the polypeptide of the present invention include plasmids derived from Escherichia coli, plasmids derived from Bacillus subtilis, plasmids derived from yeast, bacteriophages such as ⁇ phage, retroviruses such as Moroni monoleukemia virus, and vaccinia virus. Animal viruses such as Rus or Baculovirus are used. Among them, a plasmid derived from Escherichia coli, a plasmid derived from Bacillus subtilis, or a plasmid derived from yeast are preferably used.
  • promoters that regulate the expression of DNA include: (1) promoters of DNA derived from viruses (eg, Simian virus, cytomegalovirus, Moroni leukemia virus, JC virus, breast cancer virus, poliovirus, etc.) , 2 Promoters derived from various mammals (humans, egrets, dogs, cats, guinea pigs, hamsters, rats, mice, etc.), for example, albumin, insulin II, ⁇ roplakin II, elastase, erythropoietin, endothelin, muscle Creatine kinase, glial fibrillary acidic protein, glutathione S-transferase, platelet-derived growth factor) 3, keratin Kl, K10 and ⁇ 14, collagen type I and type II, cyclic AMP-dependent protein kinase) 3 I sub Unit, dystrophin Tartrate-resistant alkaline phosphatase, atrial natriuretic factor, endo
  • cytomegalovirus promoters capable of high expression throughout the whole body, human polypeptide chain elongation factor 1 (EF-1 ⁇ ) promoter, human and chicken 3 actin promoters and the like are preferable.
  • the vector preferably has a sequence that terminates transcription of the target messenger RII in a DNA-transferred mammal (generally referred to as Yuichi Minei Yuichi). For example, it is derived from viruses and various mammals. And preferably, the SV40 virus of Simian virus One or the like is used.
  • the splicing signal of each DNA, the enhancer region, a part of the intron of the eukaryotic DNA, etc. are placed 5 'upstream of the promoter region, between the promoter region and the translation region, or Connection to the 3 'downstream of the translation area is also possible depending on the purpose.
  • the normal translation region of the polypeptide of the present invention may be a liver, a kidney, a thyroid cell, a fibroblast derived from a human or various mammals (eg, a heron, a dog, a cat, a guinea pig, a hamster, a rat, a mouse, etc.).
  • the foreign abnormal DNA can be used to produce a translation region obtained by mutating the normal polypeptide translation region obtained from the above-described cells or tissues by the point mutagenesis method.
  • the translation region can be produced as a DNA construct that can be expressed in a transposed animal by a conventional DNA engineering technique in which it is ligated downstream of the aforementioned promoter and, if desired, upstream of the transcription termination site.
  • Transfer of the exogenous DNA of the present invention at the fertilized egg cell stage is ensured to be present in all germ cells and somatic cells of the target mammal.
  • the presence of the exogenous DNA of the present invention in the germinal cells of the animal after the transfer of the DNA indicates that the progeny of the animal from which the exogenous DNA of the present invention is present in all its germinal cells and somatic cells. Means to keep.
  • the progeny of such an animal that inherits the exogenous DNA of the present invention has the exogenous DNA of the present invention in all of its germ cells and somatic cells.
  • the non-human mammal to which the exogenous normal DNA of the present invention has been transferred is confirmed to stably maintain the exogenous DNA by mating, and is subcultured as an animal having the DNA in a normal breeding environment. be able to.
  • Transfer of the exogenous DNA of the present invention at the fertilized egg cell stage is ensured to be present in excess in all germ cells and somatic cells of the target mammal.
  • Excessive presence of the exogenous DNA of the present invention in the germ cells of the produced animal after DNA transfer indicates that all the offspring of the produced animal have the exogenous DNA of the present invention in all of their germ cells and somatic cells. It means having an excess of DNA.
  • Progeny of animals of this species that have inherited the exogenous DNA of the present invention will have an excess of the exogenous DNA of the present invention in all of their germinal and somatic cells.
  • the non-human mammal having the normal DNA of the present invention expresses the normal DNA of the present invention at a high level, and eventually promotes the function of the endogenous normal DNA by promoting the function of the endogenous normal DNA. It may cause hypertension and can be used as a model animal for the disease.
  • the normal DNA transgenic animal of the present invention is used to elucidate the pathological mechanism of hyperactivity of the polypeptide of the present invention and the disease associated with the protein of the present invention, and to examine a method for treating these diseases. It is possible.
  • the mammal into which the exogenous normal DNA of the present invention has been transferred has an increased symptom of the released polypeptide of the present invention, it can also be used for screening tests for therapeutic drugs for diseases related to the protein of the present invention. It is. '
  • a non-human mammal having the foreign abnormal DNA of the present invention can be subcultured in a normal breeding environment as an animal having the DNA after confirming that the foreign DNA is stably retained by mating. it can. Furthermore, the desired foreign DNA can be incorporated into the above-mentioned plasmid and used as a source substance.
  • the DNA construct with Promo Yoichi can be created by ordinary genetic engineering techniques. The transfer of the abnormal DNA of the present invention at the fertilized egg cell stage is ensured to be present in all germ cells and somatic cells of the target mammal.
  • the presence of the abnormal DNA of the present invention in the germinal cells of the produced animal after DNA transfer means that all the offspring of the produced animal have the abnormal DNA of the present invention in all of its germ cells and somatic cells.
  • the progeny of this type of animal that has inherited the exogenous DNA of the present invention has the abnormal DNA of the present invention in all of its germinal and somatic cells.
  • the non-human mammal having the abnormal DNA of the present invention expresses the abnormal DNA of the present invention at a high level, and eventually inhibits the function of the endogenous normal DNA to thereby finally produce the polypeptide of the present invention. In some cases, it becomes functionally inactive refractory, and it can be used as a model animal for the disease. For example, using the abnormal DNA-transferred animal of the present invention, it is possible to elucidate the pathological mechanism of the function-inactive refractory of the polypeptide of the present invention and to examine a method for treating this disease.
  • the abnormal DNA-highly expressing animal of the present invention is useful for inhibiting the function of a normal protein by the abnormal protein of the present invention (dominant negative effect) in the inactive refractory disease of the polypeptide of the present invention. ).
  • the mammal into which the foreign abnormal DNA of the present invention has been transferred has an increased symptom of the released polypeptide of the present invention
  • screening for a therapeutic drug for a functionally inactive type refractory disease of the polypeptide of the present invention can also be used for testing.
  • the present invention can be used to determine the specificity of the polypeptide-producing cell of the present invention, its relationship with apoptosis, differentiation or proliferation, or its signal transduction mechanism, and its abnormalities. It is an effective research material for elucidation. Furthermore, in order to use the DNA transgenic animal of the present invention to develop a therapeutic agent for a disease associated with the polypeptide of the present invention, including a refractory inactive type of the polypeptide of the present invention, the above-mentioned test method It is possible to provide an effective and rapid screening method for a therapeutic agent for the disease by using the method and the quantitative method. In addition, using the DNA transgenic animal of the present invention or the exogenous DNA expression vector of the present invention, it is possible to examine and develop a method for treating a DNA associated with the polypeptide of the present invention. (8) Knockout animal
  • the present invention provides a non-human mammalian embryonic stem cell in which the DNA of the present invention has been inactivated, and a non-human mammal deficient in expression of the DNA of the present invention.
  • the DNA is inactivated by introducing a repo overnight gene (eg, a 3-galactosidase gene derived from Escherichia coli), and the repo overnight gene controls a promoter for the DNA of the present invention.
  • a repo overnight gene eg, a 3-galactosidase gene derived from Escherichia coli
  • the present invention provides a method for screening a compound or a salt thereof which promotes or inhibits the activity of a promoter for DNA of the present invention, which is characterized by detecting the presence of the promoter.
  • a non-human mammalian embryonic stem cell in which the DNA of the present invention has been inactivated refers to a DNA that is non-human mammal and has the DNA of the present invention artificially mutated to suppress the DNA expression ability, Alternatively, by substantially losing the activity of the polypeptide of the present invention encoded by the DNA, the DNA has substantially no ability to express the polypeptide of the present invention (hereinafter, the present invention This may be referred to as knockout DNA of non-human mammal embryonic stem cells (hereinafter abbreviated as ES cells).
  • ES cells non-human mammal embryonic stem cells
  • the method of artificially mutating the DNA of the present invention can be performed, for example, by deleting a part or all of the DNA sequence and inserting or substituting another DNA by a genetic engineering technique.
  • the sockout DNA of the present invention may be produced by, for example, shifting the reading frame of a codon or disrupting the function of a promoter or exon by these mutations.
  • non-human mammalian embryonic stem cells in which the DNA of the present invention has been inactivated include, for example, The DNA of the present invention possessed by a non-human mammal is isolated, and a neomycin resistance gene, a drug resistance gene typified by a hygromycin resistance gene, a lacZ (/ 3-galactosidase enzyme), a cat ( A DNA sequence that disrupts exon function by inserting a reporter gene or the like represented by chloramphenicylacetyltransferase gene) or terminates gene transcription in the intron between exons (eg, polyly A signal, etc.) to prevent synthesis of the complete messenger RNA
  • a DNA strand having a DNA sequence constructed so as to disrupt the gene is introduced into the chromosome of the animal by, for example,
  • the original ES cells for inactivating the DNA of the present invention by the homologous recombination method or the like for example, those already established as described above may be used. It may be newly established according to the method of ufma.
  • mouse ES cells currently, 129 ES cells are generally used, but since the immunological background is not clear, an alternative pure immunological and genetically
  • C57BLZ6 mice or BDFi mice in which the number of eggs collected by C57BLZ6 has been reduced by crossing with DBAZ2 (using C57BLZ6 and DBAZ2) BDFi mice have the advantage of high number of eggs collected and robust eggs, and also have the C57BL / 6 mouse as a background.
  • the obtained ES cells can be advantageously used when a pathological model mouse is created, because the genetic background can be replaced by C57.BLZ6 mice by backcrossing with C57BLZ6 mice.
  • blastocysts 3.5 days after fertilization are generally used. Embryos can be obtained.
  • Either male or female ES cells may be used, but male ES cells are generally more convenient for producing breeding line chimeras. It is also desirable to discriminate between males and females as soon as possible in order to reduce the complexity of culturing.
  • a method for determining the sex of ES cells a method of amplifying and detecting a gene in the sex-determining region on the Y chromosome by PCR is mentioned.
  • this method conventionally, for example G-banding method, requires about 10 6 cells for karyotype analysis, than suffices ES cell number of about 1 colony (about 50),
  • the primary selection of ES cells in the early stage of culture can be performed by discriminating between males and females, and the early stages of culture can be greatly reduced by enabling early selection of male cells.
  • Embryonic stem cell lines obtained in this way usually have very good proliferative properties, but must be carefully subcultured because they tend to lose their ontogenetic potential.
  • a suitable feeder cell such as STO fibroblasts
  • a carbon dioxide incubator preferably 5% carbon dioxide, 95% air or 5% oxygen
  • LIF 1-1 000 OU / ml
  • 5% CO 2, 90% air at about 37.
  • trypsin ZEDTA solution usually 0.001-0.5% trypsin 0.1-5 mM EDTA, preferably Can be converted into single cells by treatment with about 0.1% trypsin / ImM EDTA
  • Such subculture is usually carried out every 113 days. At this time, it is desirable to observe the cells and, if morphologically abnormal cells are found, discard the cultured cells.
  • ES cells are differentiated into various types of cells, such as parietal, visceral, and cardiac muscles, by monolayer culture up to high density or suspension culture until cell clumps are formed under appropriate conditions.
  • MJ Evans and MH Kaufman Nature 292, 154, 1981; GR Martin proceedings of National Academy of Sciences 'Science'. Proc. Natl. Acad. Sci. USA) 78, 7634, 1981; TC Doetschman et al., Journal of emblemology and experimental morphology, 87, 27, 1985
  • the DNA-deficient cells of the present invention obtained by differentiating the ES cells of the present invention are useful in the cell biological examination of the protein of the present invention in the mouth of an in vivo.
  • the non-human mammal deficient in DNA expression of the present invention can be distinguished from a normal animal by measuring the mRNA level of the animal using a known method and indirectly comparing the expression level.
  • non-human mammal those similar to the aforementioned can be used.
  • the non-human mammal deficient in DNA expression of the present invention may be prepared, for example, by introducing the targeting vector prepared as described above into mouse embryonic stem cells or mouse egg cells.
  • the DNA of the present invention can be knocked out.
  • Cells in which the DNA of the present invention has been knocked out are subjected to Southern hybridization analysis using a DNA sequence on or near the DNA of the present invention as a probe, or to a DNA sequence on a evening-targeting vector, and And the DNA sequence of a neighboring region other than the DNA of the present invention derived from the mouse used for the targeting vector can be determined by PCR-based analysis using a primer.
  • the DNA-inactivated cell line of the present invention is cloned by gene homologous recombination, and the cells are used at an appropriate time, for example, at the 8-cell stage of non-human cells.
  • the chimeric embryo is injected into a mammalian embryo or a blastocyst, and the resulting chimeric embryo is transplanted into the uterus of the pseudo-pregnant non-human mammal.
  • the produced animal is a chimeric animal composed of both a normal cell having the DNA locus of the present invention and an artificially mutated cell having the DNA locus of the present invention.
  • all tissues are artificially obtained from the population obtained by crossing such a chimeric individual with a normal individual. It can be obtained by selecting individuals composed of cells having the DNA locus of the present invention with mutation added thereto, for example, by judging coat color or the like.
  • the individual thus obtained is usually an individual having a heterozygous expression of the polypeptide of the present invention, which is crossed with an individual having a heterozygous expression of the polypeptide of the present invention. Can be obtained.
  • a transgenic non-human mammal having a chromosome into which a getter vector has been introduced can be obtained by injecting a DNA solution into the nucleus of an egg by a microinjection method. Compared to these transgenic non-human mammals, they can be obtained by selecting those having a mutation in the DNA locus of the present invention by homologous recombination.
  • the individual in which the DNA of the present invention has been knocked out can be used to confirm that the DNA of the individual animal obtained by the crossing is also knocked out.
  • the breeding passage can be performed in a normal breeding environment.
  • the acquisition and maintenance of the germ line may be performed according to a conventional method. That is, by crossing male and female animals having the inactivated DNA, homozygous animals having the inactivated DNA on both homologous chromosomes can be obtained. The obtained homozygote animal can be efficiently obtained by rearing the mother animal in such a manner that one normal individual and a plurality of homozygotes are obtained. By mating male and female heterozygous animals, homozygous and heterozygous animals having the inactivated DNA are bred and subcultured.
  • the non-human mammalian embryonic stem cells in which the DNA of the present invention has been inactivated are extremely useful for producing the non-human mammal deficient in expression of the DNA of the present invention.
  • the non-human mammal deficient in expressing the DNA of the present invention lacks various biological activities that can be induced by the polypeptide of the present invention, it may be caused by inactivation of the biological activity of the polypeptide of the present invention. It can be used as a model for such diseases, and is useful for investigating the causes of these diseases and examining treatment methods.
  • the non-human mammal deficient in expression of the DNA of the present invention is used for treating diseases (eg, rheumatoid arthritis, osteoarthritis, osteoporosis, bone fractures, cancer, etc.) caused by the DNA deficiency or damage of the present invention.
  • diseases eg, rheumatoid arthritis, osteoarthritis, osteoporosis, bone fractures, cancer, etc.
  • Can be used for screening for compounds having a prophylactic effect.
  • the present invention comprises administering a test compound to a non-human mammal deficient in expression of the DNA of the present invention, and observing and measuring changes in the animal.
  • the present invention provides a method for screening a compound or a salt thereof having a therapeutic / preventive effect on a disease caused by the disease.
  • Examples of the non-human mammal deficient in DNA expression of the present invention used in the screening method include the same as described above.
  • Test compounds include, for example, peptides, proteins, non-peptidic compounds, synthetic compounds, fermentation products, cell extracts, plant extracts, animal tissue extracts, and plasma, and these compounds are novel compounds. Or a known compound. Specifically, a non-human mammal deficient in expression of the DNA of the present invention is treated with a test compound, compared with a non-treated control animal, and changes in organs, tissues, disease symptoms, etc. of the animal are used as indices. The test compound can be tested for its therapeutic and prophylactic effects.
  • test compound for example, oral administration, intravenous injection, or the like is used, and it can be appropriately selected according to the symptoms of the test animal, properties of the test compound, and the like.
  • the dose of the test compound can be appropriately selected according to the administration method, the properties of the test compound, and the like.
  • a non-human mammal deficient in expression of the DNA of the present invention is subjected to glucose tolerance treatment.
  • the test compound is administered before or after the treatment, and the blood glucose level and weight change of the animal are measured over time.
  • the blood glucose level of the test animal decreases by about 10% or more, preferably about 30% or more, more preferably about 50% or more.
  • the compound can be selected as a compound having a therapeutic / preventive effect on rheumatoid arthritis, osteoarthritis, osteoporosis, bone fracture or cancer.
  • the compound obtained by using the screening method of the present invention is a compound selected from the test compounds described above, and is a disease caused by deficiency or damage of the polypeptide of the present invention (eg, rheumatoid arthritis, It has therapeutic and prophylactic effects against osteoarthritis, osteoporosis, fractures, cancer, etc., and can be used as a drug for safe and low-toxic therapeutic and prophylactic agents for such diseases. Further, compounds derived from the compounds obtained by the above-mentioned screening can be used in the same manner.
  • the compound obtained by the screening method may form a salt.
  • the salt of the compound include physiologically acceptable acids (eg, inorganic acids, organic acids, etc.) and bases (eg, alkali metals). And the like, and particularly preferred are physiologically acceptable acid addition salts.
  • physiologically acceptable acids eg, inorganic acids, organic acids, etc.
  • bases eg, alkali metals
  • physiologically acceptable acid addition salts examples include salts with inorganic acids (eg, hydrochloric acid, phosphoric acid, hydrobromic acid, sulfuric acid, etc.), and organic acids (eg, acetic acid, formic acid, propionic acid, fumaric acid, maleic acid) , Succinic, tartaric, citric, malic, oxalic, benzoic, methanesulfonic, benzenesulfonic, etc.) And the like.
  • inorganic acids eg, hydrochloric acid, phosphoric acid, hydrobromic acid, sulfuric acid
  • a drug containing the compound or a salt thereof obtained by the screening method can be produced in the same manner as the drug containing the polypeptide of the present invention described above.
  • the preparations obtained in this way are safe and low toxic and can be used, for example, in humans or mammals (eg, rats, mice, guinea pigs, egrets, sheep, higgs, bushus, dogs, dogs, cats, dogs, Monkeys).
  • the dose of the compound or a salt thereof varies depending on the target disease, the subject of administration, the administration route, and the like. For example, when the compound is orally administered for the purpose of treating rheumatoid arthritis, generally the adult (body weight) is used.
  • the compound is administered from about 0.1 to: L0 Omg per day, preferably from about 1.0 to 50 mg, more preferably from about 1.0 to 20 mg.
  • the single dose of the compound varies depending on the subject of administration, the target disease, and the like.
  • the compound is usually administered in the form of an injection to adults (6) for the purpose of treating rheumatoid arthritis.
  • As O kg about 0.01 to 30 mg, preferably about 0.1 to 2 Omg, more preferably about 0.1 to 10 mg of the compound per day by intravenous injection. It is more convenient to administer. In the case of other animals, the dose can be administered in terms of 6 O kg.
  • the present invention relates to a compound which promotes or inhibits the activity of a promoter for the DNA of the present invention, which comprises administering a test compound to a non-human mammal deficient in expressing the DNA of the present invention and detecting the expression of a reporter gene. Or, provide a method for screening the salt.
  • the non-human mammal deficient in expression of DNA of the present invention may be the non-human mammal deficient in expression of DNA of the present invention in which the DNA of the present invention is inactive by introducing a reporter gene.
  • a gene which can be expressed under the control of a promoter for the DNA of the present invention is used.
  • test compound examples include the same compounds as described above.
  • reporter gene the same one as described above is used. Preferred is the casease gene (1acZ), soluble alkaline phosphatase gene or luciferase gene.
  • the reporter gene is under the control of a promoter for the DNA of the present invention, the substance encoded by the reporter gene By tracing the expression of the promoter, the activity of the promoter can be detected.
  • the tissue of the present invention that originally expresses the polypeptide of the present invention may -Galactosidase is expressed in place of this polypeptide. Therefore, staining with a reagent such as) 3-galactosidase, such as, for example, 5-bromo-4-monocloth-3- ⁇ -n-drill-1 / 3-galactopyranoside ( ⁇ -gal) Thereby, the expression state of the polypeptide of the present invention in an animal body can be easily observed.
  • the polypeptide-deficient mouse of the present invention or a tissue section thereof is fixed with daltaraldehyde or the like, washed with phosphate buffered saline (PBS), and then stained with X-gal at room temperature.
  • PBS phosphate buffered saline
  • the / 3-galactosidase reaction may be stopped by washing the tissue sample with ImM EDTAZPBS solution, and the coloration may be observed.
  • mRNA encoding 1acZ may be detected according to a conventional method.
  • the compound or a salt thereof obtained by using the above-mentioned screening method is a compound selected from the above-mentioned test compounds, and is a compound that promotes or inhibits the promoter activity of DNA of the present invention.
  • the compound obtained by the screening method may form a salt.
  • the salt of the compound include physiologically acceptable acids (eg, inorganic acids) and bases (eg, organic acids). And the like, and particularly preferably a physiologically acceptable acid addition salt.
  • 'Such salts include, for example, salts with inorganic acids (eg, hydrochloric acid, phosphoric acid, hydrobromic acid, sulfuric acid, etc.) or organic acids (eg, acetic acid, formic acid, propionic acid, fumaric acid, maleic acid, maleic acid Acids, succinic acid, tartaric acid, citric acid, malic acid, oxalic acid, benzoic acid, methanesulfonic acid, benzenesulfonic acid, etc.) are used.
  • inorganic acids eg, hydrochloric acid, phosphoric acid, hydrobromic acid, sulfuric acid, etc.
  • organic acids eg, acetic acid, formic acid, propionic acid, fuma
  • the compound or its salt of the present invention that promotes the promoter activity for DNA can promote the expression of the polypeptide of the present invention and promote the function of the polypeptide.
  • rheumatoid arthritis For example, rheumatoid arthritis, osteoarthritis It is useful as a safe and low toxic therapeutic and prophylactic agent for diseases such as osteoporosis, bone fracture and cancer.
  • the compound or its salt of the present invention that inhibits the promoter activity against DNA can inhibit the expression of the polypeptide of the present invention and inhibit the function of the polypeptide. It is useful as a safe and low toxic therapeutic and prophylactic agent for diseases such as neuralgia and ectopic cartilage formation.
  • a compound derived from the compound obtained by the above screening can also be used.
  • a drug containing the compound or a salt thereof obtained by the screening method can be produced in the same manner as the above-mentioned drug containing the polypeptide of the present invention.
  • the preparations obtained in this way are safe and low toxic, and can be used, for example, in humans or mammals (for example, rats, mice, guinea pigs, egrets, higgs, bushes, horses, cats, cats, Dogs, monkeys, etc.).
  • the dosage of the compound or a salt thereof varies depending on the target disease, the administration subject, the administration route, and the like.For example, for the purpose of treating rheumatoid arthritis, a compound that promotes the promoter activity of the DNA of the present invention for oral administration is administered. If you do, generally adult
  • the single dose of the compound varies depending on the administration subject, target disease, and the like.
  • a compound that promotes the promoter activity of DNA of the present invention for the purpose of treating rheumatoid arthritis may be used.
  • the compound is administered in an amount of about 0.01 to 3 Omg per day, preferably about 0.1 to 2 Omg, more preferably about 0.1 to 2 Omg. It is convenient to administer about 1 to 1 Omg by intravenous injection.
  • the dose can be administered in terms of 60 kg.
  • a compound of the present invention which inhibits the promoter overnight activity against DNA for the purpose of treating a herniated disc generally, in an adult (as a body weight of 60 kg), the compound is administered daily. About 0.1 to 100 mg, preferably about 1.0 to 50 mg, more preferably about 1.0 to 20 mg is administered.
  • the single dose of the compound varies depending on the administration subject, target disease, and the like.For example, it inhibits the promoter activity of the DNA of the present invention for the purpose of treating a herniated disc.
  • the compound to be administered When the compound to be administered is usually administered to an adult (60 kg) in the form of an injection, the compound is administered in an amount of about 0.01 to 30 mg, preferably about 0.1 to 2 Omg, more preferably about 0.1 to 20 mg per day. It is convenient to administer about 0.1 to about 10 mg by intravenous injection. In the case of other animals, the dose can be administered in terms of 6 O kg.
  • the non-human mammal deficient in DNA expression of the present invention is extremely useful for screening a compound or a salt thereof that promotes or inhibits the activity of the promoter for DNA of the present invention
  • the present invention can greatly contribute to the investigation of the causes of various diseases caused by DNA expression deficiency or the development of preventive and therapeutic drugs.
  • genes encoding various proteins are ligated downstream thereof and injected into egg cells of an animal to produce a so-called transgenic animal ( Creating a transgenic animal) would allow the protein to be specifically synthesized and its effects on the living body could be examined.
  • DNA Deoxylipo nucleic acid C DNA complementary deoxylipo nucleic acid
  • HONB 1-hydroxy-5-norporene-2,3-dicarboximide DCC N, N'-dicyclohexylcarposimide
  • Example 1 shows the nucleotide sequence of the synthetic cis-element DNA (upper chain) of cis-element used in Example 1.
  • Example 1 shows the base sequence of cis-eleInent synthetic DNA (lower chain) used in Example 1.
  • 1 shows the nucleotide sequence of a human transcription factor gene.
  • 1 shows the amino acid sequence of a human transcription factor.
  • 1 shows the nucleotide sequence of a mouse transcription factor gene.
  • FIG. 2 shows the amino acid sequence of a mouse-derived transcriptional regulator.
  • Example 3 shows the nucleotide sequence of a primer used in Example 2.
  • Example 3 shows the nucleotide sequence of a primer used in Example 2.
  • Example 3 shows the nucleotide sequence of a primer used in Example 2.
  • Example 3 shows the nucleotide sequence of a primer used in Example 2.
  • Example 3 shows the nucleotide sequence of a primer used in Example 3.
  • Example 1 shows the nucleotide sequence of a primer used in Example 1.
  • Example 1 shows the nucleotide sequence of a primer used in Example 1.
  • FIG. 2 shows the amino acid sequence of 90 amino acid residues on the C-terminal side of a mouse transcription factor.
  • FIG. 6 shows the nucleotide sequence of a primer used in Example 4.
  • FIG. 6 shows the nucleotide sequence of a primer used in Example 4.
  • Example 7 shows one base sequence used in Example 5.
  • Example 7 shows one base sequence used in Example 5.
  • Example 7 shows one base sequence used in Example 6.
  • [SEQ ID NO: 27] 7 shows the nucleotide sequence of a primer used in Example 6.
  • Escherichiacoli TOP 10 / pTB 2074 carrying the vector pTB 2074 obtained in Example 2 described below has been used since September 22, 1999 by Fermentation Research Institute (NIBH) 2-17-85, Jusanhoncho, Yodogawa-ku, Osaka-shi, Japan, deposited as FERM BP-6886 from July 21, 1999 under the deposit number FERM BP-6886. (IF ⁇ ) and deposited under IFO 16299.
  • Escherichiacoli JM109ZpTB2075 carrying the plasmid pTB2075 obtained in Example 1 described below has been used since September 22, 1999 in Tsukuba, Higashi, Ibaraki, Japan. No. FERM BP-6887 at the National Institute of Fermentation (IF ⁇ ), 2-17-17-85, Yodogawa-ku, Osaka-shi, Osaka, Japan from 21 July 1999 Deposit number IF # 16300 has been deposited respectively.
  • IF ⁇ National Institute of Fermentation
  • a DNA having the sequence (SEQ ID NO: 2) was synthesized and annealed. The resulting double-stranded DNA is inserted into the EcoRI-Xbal site of the plasmid pHISi attached to the Matchmaker one-hybrid system (Clontech) to create the yeast repo one-hybrid pHISi-56 of the yeast one-hybrid method. did. pHISi-56 was introduced into the yeast (Saccharomyces cerevisiae) YM4271 strain attached to the Matchmaker one hybrid system (Clontech) to transform His3 +.
  • PTB2075 (Fig. 2) was constructed by improving the reporter plasmid.
  • PTB2075 was obtained by (1) EcoRI-BamHI fragment of pHISi-56 (1.4 kb fragment containing GCTGGAAGGGGTGGGGACCG sequence and HIS3 gene repeated three times) on EcoRI-BamHI site of pBR322, and (2) blunting of PBR322.
  • the Sphl-PvuII site was obtained by inserting a smoothed Sphl-PvuII fragment (1.0 kb fragment containing the TRP1 gene) from PBD-GAL4 Cam (Stratagene) into the respective sites.
  • the plasmid PTB2075 was digested with XhoI and then introduced into the yeast strain YM4271 to obtain a ⁇ 1 + transformant (YM4271:: pTB2075).
  • YM4271 Human chondrocyte matchmaker cDNA 1 ibrary (Clontech) was introduced into: pTB2075, and yeasts exhibiting His + and Leu + phenotypes were selected. After the plasmid DNA was recovered from this yeast, the recovered plasmid DNA was again introduced into YM4271 :: pTB2075, whereby the phenotypes of His + and Leu + were confirmed in the four clones.
  • the nucleotide sequence of the plasmid DNA of each clone was determined. As a result, they were found to be derived from one gene, although the lengths of the inserts were different. Among these, the nucleotide sequence of the longest DNA was represented by SEQ ID NO: 3, and the amino acid sequence of the protein encoded by this DNA was represented by SEQ ID NO: 4 (FIG. 3). The DNA represented by SEQ ID NO: 3 lacked the gene portion encoding the N-terminal region It was a partial gene.
  • YM4271 :: pTB2075 was transformed with the plasmid (PHT56-H6) into which the shortest DNA (SEQ ID NO: 18) was inserted among the plasmid DNAs of the four clones obtained, showing the Leu + phenotype.
  • Ten transformants were arbitrarily selected. All of these strains exhibited a His3 + phenotype.
  • SEQ ID NO: 8 and SEQ ID NO: 9 Two kinds of primers (SEQ ID NO: 8 and SEQ ID NO: 9) were designed based on SEQ ID NO: 4, and using these primers against Fetal Mouse Library Master DNAPlate (OriGene Technologies, Inc. Lot # 004). PCR was performed according to the protocol. As a result, it was found that the 4F gel contained a mouse homolog of the transcription regulatory factor gene obtained in Example 1. According to the protocol, a subplate (Fetal mouse library plate 4F Lot # 001) was obtained, and it was confirmed that a 7A-well of the subplate had a mouse transcription factor gene. As a result of determining the sequence of the DNA contained in the 7A well by the 5'-RACE method and the 3'-RACE method, it was found that the 7A well contained the full length of the mouse transcription factor gene.
  • SEQ ID NO: 8 and SEQ ID NO: 9 Two kinds of primers (SEQ ID NO: 8 and SEQ ID NO: 9) were designed based on
  • SEQ ID NO: 10 Based on the obtained sequence information, two types of primers (SEQ ID NO: 10 and SEQ ID NO: 11) were designed, PCR was performed on the 7 A well of the subplate, and the obtained amplified fragment was pCRII ( Invitrogen). Determine base sequence As a result, it was found that the DNA having the nucleotide sequence represented by SEQ ID NO: 6 encodes a protein consisting of 508 amino acid residues (SEQ ID NO: 7) (FIG. 4).
  • ChM-I chondromodulin-I
  • the plasmid having the nucleotide sequence represented by SEQ ID NO: 8 When PCR (2, 8 cycles) was performed using primers having the nucleotide sequence represented by SEQ ID NO: 9, strong mRNA expression was observed in liver and heart, and skeletal muscle, fetus on days 1 and 15 On the 17th day, the second strongest mRNA expression was observed.
  • mice fibroblast cell line C 3 HZ 10 T 1 Z 2 on cartilage differentiation induced by pTB 2074
  • Mouse fibroblast cell lines C3H / 10T1 / 2, Clone 8 (ATCC Accession No. CCL-226) were cultured in DMEM (GIBC0) containing 10% FBS. Approximately 150,000 cells per well are seeded on a 24-well plate, and the next day, PTB2074 or pcDNA3.1 (+) (Invitrogen) obtained in Example 2 and Fugene6 (Beilinger) are mixed. Was added to perform transfection. On the second day after transfection, RNA was extracted using RNeasy mini kit (Qiagen) and subjected to DNase treatment using message clean kit (genhunter) to obtain an RNA sample.
  • RNeasy mini kit Qiagen
  • DNase treatment using message clean kit (genhunter)
  • RNA sample as type III, a primer (SEQ ID NO: 22 and SEQ ID NO: 23) prepared based on the sequence of mouse Typell B collagen gene (Col2al) and RT-PCR kit (Takara Shuzo) were used. Performed CR. After agarose gel electrophoresis, target bands were compared using Gel image (Genomic solutions).
  • Transfection was carried out by adding a mixture of (Invitrogen) and Fugene6 (Boehringer). After obtaining an RNA sample according to the method described in Example 4, RT-PC was performed using a primer (SEQ ID NO: 24 and SEQ ID NO: 25) designed based on the human Type II collagen gene (C0L2A1). R performed.
  • PCDNA3.1 (+) was introduced into normal human chondrocytes, no expression of C0L2A1 was observed, whereas when PTB2074 was introduced into normal human chondrocytes, expression of C0L2A1 was observed.
  • RNA sample was obtained according to the method described in Example 4, a primer (SEQ ID NO: 2) designed based on a dried typell collagen type gene (Biochimica et Biophysica Acta vol. 1350, PP253-258 (1997); Col2al) : 26 and SEQ ID NO: 27) were used for RT-PCR.
  • SEQ ID NO: 2 designed based on a dried typell collagen type gene (Biochimica et Biophysica Acta vol. 1350, PP253-258 (1997); Col2al) : 26 and SEQ ID NO: 27) were used for RT-PCR.
  • the polypeptide of the present invention specifically binds to the cis-element of the ChM-I gene promoter and has an activity to promote the transcription of the ChM-I gene. Therefore, the polypeptide of the present invention or the DNA of the present invention is useful as a prophylactic / therapeutic agent for diseases such as rheumatoid arthritis, osteoarthritis, osteoporosis, bone fracture and cancer.
  • polypeptide of the present invention can be used for screening a compound or a salt thereof which promotes or inhibits the activity of the polypeptide of the present invention.
  • the compound or its salt that promotes the activity of the polypeptide of the present invention or the expression of the DNA of the present invention can be used, for example, as an agent for preventing or treating diseases such as rheumatoid arthritis, osteoarthritis, osteoporosis, bone fracture, and cancer.
  • Useful as The compounds or salts thereof that inhibit the activity of the polypeptide of the present invention or the expression of DNA of the present invention are useful as agents for preventing or treating diseases such as intervertebral disc herniation, sciatica, and ectopic cartilage formation. .
  • the antibody of the present invention can be used for quantification of the polypeptide of the present invention, and can be used as a diagnostic agent for diseases related to the present invention.

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Orthopedic Medicine & Surgery (AREA)
  • Physical Education & Sports Medicine (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Animal Behavior & Ethology (AREA)
  • General Chemical & Material Sciences (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Rheumatology (AREA)
  • Toxicology (AREA)
  • Zoology (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • Genetics & Genomics (AREA)
  • Molecular Biology (AREA)
  • Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Pain & Pain Management (AREA)
  • Immunology (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
  • Peptides Or Proteins (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Saccharide Compounds (AREA)
  • Medicines Containing Material From Animals Or Micro-Organisms (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Investigating Or Analysing Biological Materials (AREA)
PCT/JP2000/008257 1999-11-26 2000-11-24 Nouveau facteur de transcription et son adn Ceased WO2001038392A1 (fr)

Priority Applications (6)

Application Number Priority Date Filing Date Title
EP00977879A EP1233023B1 (en) 1999-11-26 2000-11-24 Transcription factor and dna thereof
AT00977879T ATE286911T1 (de) 1999-11-26 2000-11-24 Transkriptionsfaktor und dessen dna
US10/130,872 US7241860B1 (en) 1999-11-26 2000-11-24 Transcription factor polypeptide that regulates Chondromodulin-I expression
DE60017453T DE60017453T2 (de) 1999-11-26 2000-11-24 Transkriptionsfaktor und dessen dna
CA002392351A CA2392351A1 (en) 1999-11-26 2000-11-24 Novel transcription factor and dna thereof
AU15497/01A AU1549701A (en) 1999-11-26 2000-11-24 Novel transcription factor and dna thereof

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
JP33647599 1999-11-26
JP11/336475 1999-11-26

Publications (1)

Publication Number Publication Date
WO2001038392A1 true WO2001038392A1 (fr) 2001-05-31

Family

ID=18299528

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/JP2000/008257 Ceased WO2001038392A1 (fr) 1999-11-26 2000-11-24 Nouveau facteur de transcription et son adn

Country Status (8)

Country Link
US (1) US7241860B1 (https=)
EP (1) EP1233023B1 (https=)
JP (1) JP2001211890A (https=)
AT (1) ATE286911T1 (https=)
AU (1) AU1549701A (https=)
CA (1) CA2392351A1 (https=)
DE (1) DE60017453T2 (https=)
WO (1) WO2001038392A1 (https=)

Family Cites Families (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JPH05178896A (ja) 1990-08-23 1993-07-20 Mitsubishi Kasei Corp 新規なタンパク質、それをコードする遺伝子及びその産生方法
JP3585180B2 (ja) 1993-05-11 2004-11-04 三菱化学株式会社 新規なヒトタンパク質およびそれをコードする遺伝子
US5851775A (en) * 1997-03-20 1998-12-22 Johns Hopkins University β-catenin, Tcf-4, and APC interact to prevent cancer

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
HIRAKI Y. ET AL.: "Identification of chondromodulin-1 as a novel endothelial cell growth inhibitor", J. BIOL. CHEM., vol. 272, no. 51, 1997, pages 32419 - 32426, XP002937899 *
HIRAKI Y. ET AL.: "Molecular cloning of a new class of cartilage-specific matrix, chondromodulin-1, which stimulates growth of cultured chondrocytes", BIOCHEM. BIOPHYS. RES. COMMUN., vol. 175, no. 3, 1991, pages 971 - 977, XP002937900 *

Also Published As

Publication number Publication date
AU1549701A (en) 2001-06-04
CA2392351A1 (en) 2001-05-31
JP2001211890A (ja) 2001-08-07
ATE286911T1 (de) 2005-01-15
EP1233023A1 (en) 2002-08-21
US7241860B1 (en) 2007-07-10
DE60017453D1 (de) 2005-02-17
DE60017453T2 (de) 2005-12-22
EP1233023B1 (en) 2005-01-12
EP1233023A4 (en) 2003-01-02

Similar Documents

Publication Publication Date Title
JP2002112772A (ja) 新規ポリペプチドおよびそのdna
WO2001044475A1 (fr) Nouveau polypeptide et son adn
KR20020059726A (ko) 신규 단백질 및 그의 dna
WO2001002564A1 (fr) Nouveau polypeptide et adn de ce polypeptide
US7053053B2 (en) Humanin-like peptide and use thereof
WO2001046413A1 (fr) Nouveau gene et utilisation
EP1191096A1 (en) Novel protein and dna thereof
WO2000071581A1 (fr) Nouveau polypeptide
WO2001048203A1 (fr) Nouvelle proteine et adn associe
JP4344408B2 (ja) 新規タンパク質およびそのdna
WO2001038392A1 (fr) Nouveau facteur de transcription et son adn
JP4320151B2 (ja) 新規ポリペプチドおよびその用途
WO2004028558A1 (ja) 神経変性疾患の予防・治療剤
WO2000014226A1 (fr) Nouvelle proteine et son procede de production
JP2000139480A (ja) 新規タンパク質およびそのdna
JP2001228146A (ja) 疾患関連遺伝子の用途
JP4300008B2 (ja) 新規タンパク質およびそのdna
JP4799775B2 (ja) 新規タンパク質およびそのdna
JP2001299363A (ja) 新規タンパク質およびそのdna
JP2000053700A (ja) 新規タンパク質およびそのdna
JP2002348299A (ja) Irap結合タンパク質
JP2001299364A (ja) 新規タンパク質およびそのdna
WO2002016428A1 (fr) Proteine de liaison a l'irap
WO2002003063A1 (fr) Utilisation d'un gene associe a une maladie
JP2003144177A (ja) 新規タンパク質、そのdnaおよびその用途

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AE AG AL AM AU AZ BA BB BG BR BY BZ CA CN CR CU CZ DM DZ EE GD GE HR HU ID IL IN IS JP KG KR KZ LC LK LR LT LV MA MD MG MK MN MX NO NZ PL RO RU SG SI SK TJ TM TR TT UA US UZ VN YU ZA

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG

DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
121 Ep: the epo has been informed by wipo that ep was designated in this application
WWE Wipo information: entry into national phase

Ref document number: 10130872

Country of ref document: US

WWE Wipo information: entry into national phase

Ref document number: 2000977879

Country of ref document: EP

WWE Wipo information: entry into national phase

Ref document number: 2392351

Country of ref document: CA

WWP Wipo information: published in national office

Ref document number: 2000977879

Country of ref document: EP

NENP Non-entry into the national phase

Ref country code: JP

WWG Wipo information: grant in national office

Ref document number: 2000977879

Country of ref document: EP