WO2001004330A1 - Identifizierung und überexpression einer dna-sequenz kodierend für eine 2-methyl-6-phytylhydrochinon-methyltransferase in pflanzen - Google Patents

Identifizierung und überexpression einer dna-sequenz kodierend für eine 2-methyl-6-phytylhydrochinon-methyltransferase in pflanzen Download PDF

Info

Publication number
WO2001004330A1
WO2001004330A1 PCT/EP2000/005862 EP0005862W WO0104330A1 WO 2001004330 A1 WO2001004330 A1 WO 2001004330A1 EP 0005862 W EP0005862 W EP 0005862W WO 0104330 A1 WO0104330 A1 WO 0104330A1
Authority
WO
WIPO (PCT)
Prior art keywords
plants
dna sequence
seq
methyl
plant
Prior art date
Application number
PCT/EP2000/005862
Other languages
English (en)
French (fr)
Inventor
Karin Herbers
Ralf Badur
Irene Kunze
Michael Geiger
Hans-Peter Mock
Original Assignee
Sungene Gmbh & Co. Kgaa
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Sungene Gmbh & Co. Kgaa filed Critical Sungene Gmbh & Co. Kgaa
Priority to AU56858/00A priority Critical patent/AU5685800A/en
Priority to CA002378657A priority patent/CA2378657A1/en
Priority to EP00942130A priority patent/EP1194577A1/de
Publication of WO2001004330A1 publication Critical patent/WO2001004330A1/de

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
    • C12N15/8242—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits
    • C12N15/8243—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits involving biosynthetic or metabolic pathways, i.e. metabolic engineering, e.g. nicotine, caffeine
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07H—SUGARS; DERIVATIVES THEREOF; NUCLEOSIDES; NUCLEOTIDES; NUCLEIC ACIDS
    • C07H3/00—Compounds containing only hydrogen atoms and saccharide radicals having only carbon, hydrogen, and oxygen atoms
    • C07H3/02—Monosaccharides
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
    • C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
    • C12N15/8271—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance
    • C12N15/8274—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance for herbicide resistance
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/10—Transferases (2.)
    • C12N9/1003—Transferases (2.) transferring one-carbon groups (2.1)
    • C12N9/1007—Methyltransferases (general) (2.1.1.)

Definitions

  • the invention relates to a DNA coding for a polypeptide with 2-methyl-6-phytylhydroquinone-methyltransferase activity.
  • the invention relates to the use of DNA sequences coding for a polypeptide with 2-methyl-6-phytylhydroquinone methyltransferase activity for the production of plants with an increased content of tocopherols and tocotrienols, especially the use of the DNA sequence SEQ-ID No. 1 or SEQ-ID No. 7 or with these hybridizing DNA sequences or homologous to the overall sequence or partial sequences, a process for the production of plants with an increased content of tocopherols and tocotrienols, and the plant itself prepared in this way.
  • the eight naturally occurring compounds with vitamin E activity are derivatives of 6-chromanol (Ulimann's Encyclopedia of Industrial Chemistry, Vol. A 27 (1996), VCH Verlagsgesellschaft, Chapter 4., 478-488, vitamin E ).
  • the first group (la-d) is derived from tocopherol, the second group consists of derivatives of tocotrienol (2ad):
  • ⁇ -Tocopherol is of great economic importance.
  • a sensible alternative is the genetic engineering procedure, for example to isolate the essential biosynthesis genes coding for the tocopherol synthesis performance and to transfer them specifically in crop plants. This method assumes that biosynthesis and its regulation are known and that genes that influence biosynthesis performance are identified.
  • Isoprenoids or terpenoids consist of different classes of lipid-soluble molecules and are partially or completely formed from Cs-isoprene units.
  • Pure prenyl lipids e.g. carotenoids
  • mixed prenyl lipids e.g. chlorophylls, tocopherols and vitamin K
  • isoprenoid side chain that is linked to an aromatic nucleus.
  • the starting point for the biosynthesis of prenyl lipids are 3 x acetyl-CoA units, which are converted via ß-hydroxymethylglutaryl-CoA (HMG-CoA) and mevalonate into the starting isoprene unit (C5), the isopentenyl pyrophosphate (IPP). It has recently been shown by in vivo feeding experiments with C 13 that in various eubacteria, green algae and plant chloroplasts a Mevalonate-independent path to the formation of IPP is followed.
  • HMG-CoA ß-hydroxymethylglutaryl-CoA
  • IPP isopentenyl pyrophosphate
  • hydroxyethylthiamine which is formed by decarboxylation of pyruvate, and glyceraldehyde-3-phosphate (3-GAP) in a "transketolase" reaction mediated by the l-deoxy-D-xylulose-5-phosphate synthase are initially in 1- Deoxy-D-xylulose-5-phosphate converted (Lange et al, 1998; Schwender et al, 1997; Arigoni et al, 1997; Lichtenthaler et al, 1997; Sprenger et al, 1997).
  • the mevalonate-independent route is localized plastidically and leads primarily to the formation of carotenoids and plastidic prenyl lipids (Schwender et al, 1997; Arigoni et al, 1997).
  • IPP is in equilibrium with its isomer, dimethylallyl pyrophosphate (DMAPP).
  • DMAPP dimethylallyl pyrophosphate
  • the isoprene side chain of various lengths is linked to non-isoprene rings, such as a porphyrin ring in chlorophyll a and b.
  • the chlorophylls and phylloquinones contain a C20 phytyl chain in which only the first isoprene unit contains a double bond.
  • GGPP is transformed by geranylgeranyl pyrophosphate oxidoreductase (GGPPOR) into phytyl pyrophosphate (PPP), the starting material for the further formation of tocopherols.
  • the ring structures of the mixed prenyl lipids that lead to the formation of vitamins E and K are quinones, the starting metabolites of which come from the Shikimate pathway.
  • the aromatic amino acids phenylalanine and tyrosine are converted into hydroxyphenyl pyruvate, which is converted into ho-gentisic acid by dioxygenation.
  • the chorismate is based on erythrose-4-phosphate and phosphoenolpyruvate (PEP) by their condensation to 3-deoxy-D-arabino-heptulosonate-7-phosphate (DAHP) via the intermediate stages of the shikimate pathway 3 'dehydroquinate,
  • phenylalanine ammonium lyase catalyzes the breakdown of phenylalanine, i.e. it removes it from phenylpropanoid biosynthesis (BHencee et al., Proc. Natl. Acad. Sei USA 91 (16): 7608-7612 (1994); Howles et al., Plant Physiol. 112, 1617-1624 (1996)).
  • WO 99/23231 shows that the expression of a geranylgeranyl reductase in transgenic plants results in an increased tocopherol biosynthesis.
  • the object of the present invention was to develop a transgenic plant with an increased content of tocopherols and tocotrienols.
  • the object was surprisingly achieved by overexpressing a 2-methyl-6-phytylhydroquinone-methyltransferase gene in plants.
  • MPMT 2-methyl-6-phytylhydroquinone methyltransferase
  • Example 2 the cloning of an MPMT DNA sequence (SEQ ID No. 1) from Synechocystis spec. PCC 6803.
  • the MPMT nucleotide sequence from Synechocystis is preceded by a transit signal sequence (Fig. 3, Fig. 4).
  • a DNA sequence which codes for an MPMT gene which hybridizes with SEQ ID No. 1 or which is homologous to the entire sequence or to partial sequences and which originates from other organisms or from plants.
  • the transgenic plants are produced by transforming the plants with a construct containing the MPMT gene.
  • Arabidopsis thaliana, Brassica napus and Nicotiana tabacum were used as model plants for the production of tocopherols and tocotrienols.
  • the invention relates to the use of a DNA sequence SEQ ID No. 1 from Synechocystis spec. PCC 6803, which codes for an MPMT or its functional equivalents, for the production of a plant with an increased content of tocopherols and tocotrienols.
  • the nucleic acid sequence can e.g. be a DNA or cDNA sequence. Coding sequences suitable for insertion into an expression cassette are, for example, those which code for an MPMT and which give the host the ability to overproduce tocopherols and tocotrienols.
  • the expression cassettes also contain regulatory nucleic acid sequences which control the expression of the coding sequence in the host cell.
  • an expression cassette upstream, ie at the 5 'end of the coding sequence comprises a promoter and downstream, ie at the 3' end, a polyadenylation signal and, if appropriate, further regulatory elements which are associated with the intermediate sequence for the MPMT gene are operatively linked.
  • An operative link is understood to mean the sequential arrangement of promoter, coding sequence, terminator and, if appropriate, further regulatory elements in such a way that each of the regulatory elements can fulfill its function as intended when expressing the coding sequence.
  • sequences preferred but not limited to the operative linkage are targeting sequences to ensure the subcellular localization in the apoplast, in the vacuole, in plastids, in the mitochondrion, in the endoplasmic reticulum (ER), in the nucleus, in oil bodies or other compartments and translation enhancers such as the 5 'guiding sequence from the tobacco mosaic virus (Gallie et al., Nucl. Acids Res. 15 (1987), 8693-8711).
  • the plant expression cassette can be installed in a derivative of the transformation vector pBin-19 with 35s promoter (Bevan, M., Nucleic Acids Research 12: 8711-8721 (1984)).
  • Figure 4 shows a derivative of the transformation vector pBin -19 with seed-specific Legumin B4 promoter.
  • any promoter which can control the expression of foreign genes in plants is suitable as promoters of the expression cassette.
  • a plant promoter or a promoter which originates from a plant virus is preferably used.
  • the CaMV 35S promoter from the cauliflower mosaic virus is particularly preferred (Franck et al., Cell 21 (1980), 285-294).
  • this promoter contains different recognition sequences for transcriptional effectors, which in their entirety lead to permanent and constitutive expression of the introduced gene (Benfey et al., EMBO J. 8 (1989), 2195-2202).
  • the expression cassette can also contain a chemically inducible promoter, by means of which the expression of the exogenous MPMT gene in the plant can be controlled at a specific point in time.
  • a chemically inducible promoter by means of which the expression of the exogenous MPMT gene in the plant can be controlled at a specific point in time.
  • promoters as e.g. the PRPl promoter (Ward et al., Plant. Mol. Biol. 22 (1993), 361-366), a promoter inducible by salicylic acid (WO 95/19443), one inducible by benzenesulfonamide (EP-A 388186 ), one that can be induced by tetracycline (Gatz et al., (1992) Plant J. 2, 397-404), one that can be induced by abscisic acid (EP-A 335528) or one that can be induced by ethanol or cyclohexanone (WO 93 / 21334)
  • Promoter can
  • promoters are particularly preferred which ensure expression in tissues or parts of plants in which, for example, the biosynthesis of tocopherol or its precursor fen takes place. Promoters that ensure leaf-specific expression should be mentioned in particular. These are the
  • the expression cassette can therefore, for example, be a seed-specific promoter (preferably the phaseolin promoter (US 5504200), the USP- (Baumlein, H. et al., Mol. Gen. Genet. (1991) 225 (3), 459-467) or LEB4 promoter (Fiedler and Conrad, 1995)), the LEB4 signal peptide, the gene to be expressed and an ER retention signal.
  • a seed-specific promoter preferably the phaseolin promoter (US 5504200), the USP- (Baumlein, H. et al., Mol. Gen. Genet. (1991) 225 (3), 459-467) or LEB4 promoter (Fiedler and Conrad, 1995)
  • the LEB4 signal peptide the gene to be expressed and an ER retention signal.
  • An expression cassette is produced by fusing a suitable promoter with a suitable MPMT-DNA sequence and preferably a DNA inserted between the promoter and MPMT-DNA sequence, which codes for a chloroplast-specific transit peptide, and a polyadenylation signal according to common recombination and cloning techniques as described, for example, in T. Maniatis, EF Fritsch and J. Sambrook, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY (1989) and in T.J. Silhavy, M.L. Berman and L.W. Inquist, Experiments with Gene Fusions, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY (1984) and in Ausubel, F.M. et al. , Current Protocols in Molecular Biology, Greene Publishing Assoc. and Wiley-Interscience (1987).
  • Expression cassettes can also be used, the DNA sequence of which codes for an MPMT fusion protein, part of the fusion protein being a transit peptide which controls the translocation of the polypeptide.
  • Preferred transit peptides are preferred for the chloroplasts, which are cleaved enzymatically from the MPMT part after translocation of the MPMT gene into the chloroplasts.
  • the transit peptide which is derived from the plastic Nicotiana tabacum Transketolase or another transit peptide (for example the transit peptide of the small subunit of Rubisco or the ferredoxin NADP oxidoreductase) or its functional equivalent is particularly preferred.
  • the inserted nucleotide sequence coding for an MPMT can be produced synthetically or obtained naturally or contain a mixture of synthetic and natural DNA components, as well as consist of different heterologous MPMT gene sections of different organisms.
  • synthetic nucleotide sequences are generated with codons that are preferred by plants. These codons preferred by plants can be determined from codons with the highest protein frequency, which are expressed in most interesting plant species.
  • various DNA fragments can be manipulated in order to obtain a nucleotide sequence which expediently reads in the correct direction and which is equipped with a correct reading frame.
  • adapters or linkers can be attached to the fragments.
  • the promoter and terminator regions can expediently be provided in the transcription direction with a linker or polylinker which contains one or more restriction sites for the insertion of this sequence.
  • the linker has 1 to 10, usually 1 to 8, preferably 2 to 6, restriction sites.
  • the linker has a size of less than 100 bp, often less than 60 bp, but at least 5 bp within the regulatory ranges.
  • the promoter can be native or homologous as well as foreign or heterologous to the host plant.
  • the expression cassette contains in the 5 '-3' transcription direction the promoter, a DNA sequence which codes for an MPMT gene and a region for the transcriptional termination. Different termination areas are interchangeable.
  • Preferred polyadenylation signals are plant polyadenylation signals, preferably those which essentially correspond to T-DNA polyadenylation signals from Agrobacterium tumefaciens, in particular gene 3 of T-DNA (octopine synthase) of the Ti plasmid pTiACH5 (Gielen et al., EMBO J. 3 (1984), 835 ff) or functional equivalents.
  • the fused expression cassette which codes for an MPMT gene is preferably cloned into a vector, for example pBin19, which is suitable for transforming Agrobacterium tumefaciens.
  • Agrobacteria transformed with such a vector can then be used in a known manner to transform plants, in particular crop plants, such as, for example, tobacco plants, for example by bathing wounded leaves or leaf pieces in an agrobacterial solution and then cultivating them in suitable media.
  • the transformation of plants by agrobacteria is known, inter alia, from FF White, Vectors for Gene Transfer in Higher Plants; in Transgenic Plants, Vol. 1, Engineering and Utilization, edited by SD Kung and R. Wu, Academic Press, 1993, pp. 15-38.
  • Transgenic plants can be regenerated in a known manner from the transformed cells of the wounded leaves or leaf pieces . which contain a gene integrated into the expression cassette for the expression of an MPMT gene.
  • an expression cassette is inserted as an insert into a recombinant vector whose vector DNA contains additional functional regulation signals, for example sequences for replication or integration.
  • additional functional regulation signals for example sequences for replication or integration.
  • Suitable vectors are inter alia in "Methods in Plant Molecular Biology and Biotechnology" (CRC Press), Chap. 6/7, pp. 71-119 (1993).
  • the expression cassettes can be cloned into suitable vectors that allow their proliferation, for example in E. coli.
  • suitable cloning vectors include pBR332, pUC series, M13mp series and pACYC184.
  • Binary vectors which can replicate both in E. coli and in agrobacteria are particularly suitable.
  • Another object of the invention relates to the use of an expression cassette containing a DNA sequence SEQ ID No. 1 or a DNA sequence hybridizing therewith for transforming plants, cells, tissues or parts of plants.
  • the aim of the use is preferably to increase the tocopherols and tocotrienols content of the plant.
  • the expression can take place specifically in the leaves, in the seeds, petals or other parts of the plant.
  • Such transgenic plants, their reproductive material and their plant cells, tissue or parts are a further subject of the present invention.
  • the expression cassette can also be used to transform bacteria, cyanobacteria, yeast, filamentous fungi and algae with the aim of increasing the tocopherol and tocotrienol content.
  • transformation The transfer of foreign genes into the genome of a plant is called transformation.
  • the methods described for the transformation and regeneration of plants from plant tissues or plant cells for transient or stable transformation are used. Suitable methods are protoplast transformation by polyethylene glycol-induced DNA uptake, the biolistic method with the gene gun - the so-called particle bombardment method, electroporation, the incubation of dry embryos in DNA-containing solution, microinjection and Agrobacterium mediated gene transfer.
  • the methods mentioned are described, for example, in B. Jenes et al., Techniques for Gene Transfer, in: Transgenic Plants, Vol. 1, Engineering and Utilization, edited by SD Kung and R. Wu, Acade ic 5 Press (1993), 128- 143 and in Potrykus, Annu. Rev.
  • the construct to be expressed is preferably cloned into a vector which is suitable for transforming Agrobacterium tumefaciens, for example pBin19 (Bevan et al., Nucl. Acids Res. 10 12 (1984), 8711).
  • Agrobacteria transformed with an expression cassette can also be used in a known manner to transform plants, in particular crop plants, such as cereals, corn, oats, soybeans,
  • Function-equivalent sequences which code for an MPMT gene are those sequences which, despite a different nucleotide sequence, still have the desired functions.
  • Functional equivalents thus include naturally occurring variants of the sequences described here 5 as well as artificial, e.g. Artificial nucleotide sequences obtained by chemical synthesis and adapted to the codon use of a plant.
  • a functional equivalent is understood to mean, in particular, natural or artificial mutations of an originally isolated sequence coding for an MPMT, which furthermore show the desired function. Mutations include substitutions, additions, deletions, exchanges or insertions of one or more nucleotide residues. Thus, for example, 5 such nucleotide sequences are also encompassed by the present invention, which are obtained by modification of the MPMT nucleotide sequence. The aim of such a modification can e.g. further narrowing down the coding sequence contained therein or e.g. also be the insertion of further restriction enzyme interfaces. 0
  • Example 8 describes a deletion clone of the MPMT gene, see SEQ ID No. 7)
  • amino acids are also those variants whose function is weakened or enhanced compared to the original gene or gene fragment.
  • artificial DNA sequences are suitable as long as, as described above, they impart the desired property, for example to increase the tocopherol content in the plant by overexpressing an MPMT gene in crop plants.
  • Such artificial DNA sequences can be determined, for example, by back-translation of proteins constructed using molecular modeling, which have MPM activity, or by in vitro selection. Coding DNA sequences which are obtained by back-translating a polypeptide sequence according to the codon usage specific for the host plant are particularly suitable. The specific codon usage can easily be determined by a person skilled in plant genetic methods by computer evaluations of other, known genes of the plant to be transformed.
  • Suitable equivalent nucleic acid sequences are sequences which code for fusion proteins, part of the fusion protein being an MPMT polypeptide or a functionally equivalent part thereof.
  • the second part of the fusion protein can e.g. be another polypeptide with enzymatic activity or an antigenic polypeptide sequence that can be used to detect MPMT expression (e.g. myc-tag or his-tag).
  • this is preferably a regulatory protein sequence, such as e.g. a transit peptide that directs the MPMT protein into the plastids.
  • Increasing the content of tocopherols and tocotrienols in the context of the present invention means the artificially acquired ability of an increased biosynthetic performance of these compounds by functional overexpression of an MPMT gene SEQ-ID No. 1 or SEQ-ID No. 7 in the plant compared to the non-genetically modified Plant for at least one generation of plants.
  • Both the tocopherols and tocotrienols content can be increased.
  • the tocopherol content is preferably increased. But it is also possible under certain conditions to preferably increase the tocotrienol content.
  • the biosynthetic site of tocopherols is the leaf tissue, so that leaf-specific expression of the MPMT gene is useful.
  • the tocopherol biosynthesis need not be restricted to the leaf tissue, but can also be tissue-specific in all other parts of the plant - especially in fatty seeds.
  • constitutive expression of the exogenous MPMT gene is advantageous.
  • inducible expression may also appear desirable.
  • the effectiveness of the expression of the transgenically expressed MPMT gene can be determined, for example, in vitro by multiplication of the shoot meristem.
  • a change in the type and level of expression of the MPMT gene and its effect on the tocopherol biosynthesis performance on test plants can be tested in greenhouse experiments.
  • the invention also relates to transgenic plants, transformed with an expression cassette containing the sequence SEQ-ID No. 1 or SEQ-ID No. 7 or a DNA sequence hybridizing with it or homologous to the overall sequence or to partial sequences, and transgenic cells , Tissue, parts and propagation material of such plants.
  • Transgenic crop plants such as e.g. Barley, wheat, rye, corn, oats, soy, rice, cotton, sugar beet, canola, sunflower, flax, hemp, potato, tobacco, tomato, rapeseed, alfalfa, tagetes, lettuce and the various tree, nut and wine species.
  • Plants in the sense of the invention are mono- and dicotyledonous plants.
  • the invention furthermore relates to photosynthetically active organisms transformed with an expression cassette containing the sequence SEQ-ID No. 1 or SEQ-ID No. 7 or a DNA sequence which hybridizes with it or is homologous to the overall sequence or to partial sequences.
  • Photosynthetically active organisms are next to plants, for example cyanobacteria, mosses and algae.
  • the MPMT is a potential target for herbicides.
  • the complete cDNA sequence of the MPMT from Synechocystis is cloned into an expression vector (pQE, Qiagen) and overexpressed in E. coli.
  • the MPMT protein expressed with the aid of the expression cassette according to the invention is particularly suitable for the detection of inhibitors specific for the MPMT.
  • the MPMT can be used, for example, in an enzyme test in which the activity of the MPMT is determined in the presence and absence of the active substance to be tested. By comparing the two activity determinations, a qualitative and quantitative statement can be made about the inhibitory behavior of the active substance to be tested.
  • test system With the help of the test system according to the invention, a large number of chemical compounds can be checked quickly and easily for herbicidal properties.
  • the method makes it possible to selectively reproducibly select those with great potency from a large number of substances, in order to subsequently carry out further in-depth tests known to the person skilled in the art.
  • the invention further relates to herbicides which can be identified using the test system described above.
  • transgenic plants produced in this way are also the subject of the invention.
  • the MPMT protein produced using the DNA sequence SEQ-ID No. 1 or SEQ-ID No. 7 is also suitable for carrying out biotransformations to provide larger amounts of 2,3-dimethyl-6-phytylhydroquinone.
  • 2-Methyl-6-phytylhydroquinone is converted to 2,3-dimethyl-6-phytylhydroquinone in the presence of the enzyme MPMT and the cosubstrate S-adenosyl-L-methionine.
  • the biotransformation can in principle be carried out with whole cells which express the enzyme MPMT or cell extracts from these cells or with purified or highly pure MPMT in the presence of S-adenosyl-L-methionine.
  • SAM S-adenosyl-L-methionine
  • PCC 6803 ⁇ -tocopherol methyl transferase (referred to as slr0089) and the Arabidopsis thaliana ⁇ -tocopherol methyl transferase (David Shintani and Dean DellaPenna. Sience. 40 282: 2098-2100, 1998) were compared.
  • the predicted molecular weight of the unprocessed protein is 34.9 kDa and is therefore in a range that is also for the Synechocystis spec. PCC 6803 ⁇ -tocopherol methyl transferase (David Shintani and Dean DellaPenna, Sience. 282: 2098-2100, 1998) and the ⁇ -tocopherol methyl transferase purified from paprika fruits (d'Harlingue and Camara, plastid enzymes of terpenoid bio-synthesis: Purification of ⁇ -Tocopherol methyltransferase from Capsicum Chromoplasts, Journal of Biological Chemistry, Vol. 269 No.28, 15200-152003, 1985).
  • the DNA coding for the ORF (open reading frame) sll0418 was obtained by means of polymerase chain reaction (PCR) from Synechocystis spec. PCC 6803 according to the method according to Crispin A. Howitt (BioTechniques 21: 32-34, July 1996) using a sense-specific primer (sll04185 'Seq. No. 5) and an antisense-specific primer (sll04183' Seq. No. 6) amplified.
  • PCR polymerase chain reaction
  • the PCR conditions were as follows:
  • the PCR was carried out in a 50 ⁇ l reaction mixture which contained:
  • the PCR was carried out under the following cycle conditions:
  • Step 1 5 minutes 94 ° C (denaturation)
  • Step 2 3 seconds at 94 ° C
  • Step 3 2 minutes 58 ° C (annealing)
  • Step 4 2 minutes 72 ° C (elongation)
  • Step 5 10 minutes 72 ° C (post-elongation)
  • Step 6 4 ° C (holding pattern)
  • the amplicon was cloned into the PCR cloning vector pGEM-T (Promega) using standard methods. The identity of the amplicon generated was confirmed by sequencing using the M13F (-40) primer.
  • the vector pGEM-T / sll0418 was constructed using the restriction
  • Tn903 was isolated as an EcoRI fragment from the vector pUC4k (Vieira, J and Messing, J Gene: 19, 259-268, 1982), the protruding ends of the restriction digest were converted into smooth ends according to standard methods and vector pGEM- cut into the ball. T / sll0418 ligated. The ligation approach became
  • Synechocystis spec. PCC 6803 transformants were selected on kanamycin-containing (kan) BG-11 solid medium (Castenholz, Methods in Enzymology, pages 68-93, 1988) at 28 ° C. and 30 ⁇ mol 45 photons x (m 2 xs) _ i.
  • Four independent knock out mutants were able to after five rounds of selection (passages from individual colonies onto fresh BG-11kn medium).
  • PCC 6803 knock out mutants of ORF sll0418 and untransformed wild type cells were used to inoculate liquid cultures. These cultures were cultivated at 28 ° C. and 30 ⁇ mol photons x (m 2 xs) _1 (30 ⁇ m) for about 3 days. After determining the OD 73 o of the individual cultures, the OD 30 of all cultures was synchronized by appropriate dilutions with BG-11 (wild types) or BG-llkan (mutants). These cultures, synchronized to cell density, were used to inoculate three cultures per mutant or the wild-type controls.
  • the biochemical analyzes could therefore be carried out using three independently grown cultures of a mutant and the corresponding wild types.
  • the medium of the cell culture was removed by centrifugation twice at 14000 rpm in an Eppendorf table centrifuge.
  • the subsequent digestion of the cells was carried out by four incubations in an Eppendorf shaker at 30 ° C., 100 orpm in 100% methanol for 15 minutes, the supernatants obtained in each case being combined. Further incubation steps resulted in no further release of tocopherols or tocotrienols.
  • the hypothetical protein sll0418 from Synechocystis spec. PCC 6803 was identified by functional expression in E. coli as 2-methyl-6-phytylhydroquinone methyl transferase.
  • the sll0418 Fragment was isolated from the recombinant plasmid pGEM-T / sll0418 using these flanking BamHI restriction sites and ligated into a BamHI cut pQE-30 using standard methods.
  • the ligation approach was used to transform M15 E. coli cells and kanamycin and ampicillin resistant transformants were analyzed. Kanamycin resistance is mediated by the pREP-4 plasmid contained in the M15 cells.
  • a recombinant plasmid (pQE-30 / sll0418) which carried the sll0418 fragment in the correct orientation was isolated. The identity and orientation of the insert was confirmed by sequencing.
  • the recombinant plasmid pQE-30 / sll0418 was used to transform M15 E. coli cells to produce recombinant sll0418 protein. Using a colony that emerged from the transformation, an overnight culture in Luria
  • IPTG isopropyl- ⁇ -D-thiogalactopyranoside
  • the pellet was resuspended in 600 ⁇ l lysis buffer (approx. 1-1.5 ml / g pellet wet weight, 10 mM HEPES KOH pH 7.8, 5 mM dithiothreitol (DTT), 0.24 M sorbitol). Then PMSF (phenyl methyl sulfonate) was added to a final concentration of 0.15 mM and the mixture was placed on ice for 10 minutes. The cells were disrupted by a 10-second ultrasound pulse using an ultrasound rod. After adding Triton X100 (final concentration 0.1%), the cell suspension was incubated on ice for 30 minutes. The mixture was then centrifuged at 25,000 ⁇ g for 30 minutes and the supernatant was used for the assay.
  • lysis buffer approximately 11.5 ml / g pellet wet weight, 10 mM HEPES KOH pH 7.8, 5 mM dithiothreitol (DTT), 0.24 M sorbitol.
  • PMSF
  • the activity of the 2-methyl-6-phytylhydroquinone methyl transferase is determined by detecting the radioactively labeled reaction product 2, 3-dimethyl-6-phytylhydroquinone.
  • 135 ⁇ l of the enzyme (approx. 300-600 ⁇ g) together with 20 ⁇ l substrate (2-methyl-6-phytylhydroquinone) and 15 ⁇ l (0.46 mM SAM 14 C) methyl group donor were added in the following reaction buffer: 200 ⁇ l (125mM) tricine-NaOH pH 7 , 6, 100 ⁇ l (1.25 mM) sorbitol, 10 ⁇ l (50 mM) MgCl 2 and 20 ⁇ l (250 mM) ascorbate for 4 hours at 25 ° C. in the dark.
  • the reaction was stopped by adding 750 ⁇ l chloroform / methanol (1: 2) + 150 ⁇ l 0.9% NaCl.
  • the mixed batch was centrifuged briefly and the upper phase was discarded.
  • the lower phase is transferred to a new reaction vessel and evaporated under nitrogen.
  • the residues were taken up in 20 ⁇ l ether and applied to a thin-layer plate for chromatographic separation of the substances (solid phase: HPTLC plates: silica gel 60 F 254 (Merk), liquid phase: toluene).
  • the radioactively labeled reaction product is detected using a phosphoimager.
  • PCC 6803 encoded protein is a 2-methyl-6-phytylhydroquinone methyltransferase because it has the enzymatic activity to convert Has 2-methyl-6-phytylhydroquinone in 2, 3-dimethyl-6-phytylhydroquinone.
  • Figure 2 shows a sequence comparison at the amino acid level between the ⁇ -tocopherol methyl transferases from Synechocystis spec.
  • PCC Synechocystis spec. PCC 6803 (slr0089) and A. thaliana (arat t) with the 2-methyl-6-phytylhydroquinone methyltransferase (sll04189) from Synechocystis spec. PCC 6803.
  • Agreement with the ⁇ -tocopherol methyltransferases from Synechocystis spec. PCC 6803 and Arabisopsis thaliana are 36 and 28% identity, respectively.
  • Enzymatic tests as carried out in Example 5 show that the enzyme MPMT - encoded by the gene sll0418 (SEQ ID No. 1) from Synechocystis spec. PCC 6803 - 2-methyl-6-phytylhydroquinone converted into 2, 3-dimethyl-6-phytylhydroquinone.
  • the enzyme MPMT has a 2-methyl-6-geranylgeranyl-hydroquinone-methyltransferase activity, whereas a ⁇ -tocopherolmethyltransferase activity could not be detected. It is thus proven that the enzyme 2-methyl-6-phytylhydroquinone methyltransferase is involved in the biosynthesis of the tocotrienols, since it converts 2-methyl-6-geranylgeranylhydroquinone to 2,3-dimethyl-6-geranylgeranyl hydroquinone. This clearly shows the difference in the enzyme activity of the 2-methyl-6-phytylhydroquinone-methyltransferase compared to the ⁇ -tocopherol methyltransferase.
  • Transgenic plants were generated which contain the 2-methyl-6-phytylhydroquinone methyltransferase from Synechocystis spec. PCC6803 on the one hand under the control of the constitutive 35S promoter of the CaMV (cauliflower mosaic virus) (Franck et al., Cell 21: 285-294, 1980) and on the other hand under the control of the seed-specific promoter of the legumin gene from Vicia faba (Kafatos et al., Nuc. Acid. Res., 14 (6): 2707-2720, 1986).
  • CaMV cauliflower mosaic virus
  • Plasmid generated by PCC 6803 was pBinAR-TkTp-9 (Ralf Badur, dissertation University of Göttingen, 1998).
  • This vector is a derivative of pBinAR (Höfgen and Willmitzer, plan to be. 66: 221-230, 1990) and contains the CaMV (cauliflower mosaic virus) 35S promoter (Franck et al., 1980), the octopine synthase gene termination signal (Gielen et al., EMBO J. 3: 835-846 , 1984) and the DNA sequence coding for the transit peptide of the plastid Nicotiana tabacum Transketolase (Ralf Badur, dissertation University of Göttingen, 1998).
  • the sll0418 gene was isolated from the plasmid pGEM-T / sll0418 using the flanking BamHI restriction sites. This fragment was ligated into a BamHI cut pBinAR-TkTp-9 using standard methods (see Figure 3). This plasmid (pBinAR-TkTp-9 / sll0418) was used to generate transgenic Arabidopsis thaliana, Brassica napus and Nicotiana tabacum.
  • Fragment A (529 bp) in Figure 3 contains the 35S promoter of the CaMV (nucleotides 6909 to 7437 of the cauliflower mosaic virus), fragment B (245 bp) encodes the transit peptide of the Nicotiana tabacum transketolase, fragment C (977Bp) encodes ORF sll0418 from Syn echoeystis spec. PCC 6803, fragment D (219 bp) codes for the termination signal of the octopine synthase gene.
  • the seed-specific promoter of the Legumin B4 gene (Kafatos et al., Nuc. Acid. Res., 14 (6): 2707-2720, 1986) was used.
  • the 2.7 Kb fragment of the legumin B4 gene promoter was isolated from the plasmid pCR-Script / lePOCS using the EcoRl 5 'flanking the promoter and the Kpnl 3' flanking interfaces.
  • the plasmid pBinAR-TkTp-9 / sll0418 was also treated with the restriction enzymes EcoRI and Kpnl. As a result, the CaMV 35S promoter was separated from this plasmid. The promoter of the legumin gene was then cloned into this vector as an EcoRI / Kpnl fragment, producing a plasmid which placed the expression of the sll0418 gene under the control of this seed-specific promoter, see Figure 4.
  • This plasmid (pBinARleP-TkTp-9 / sll0418) was used to produce transgenic Arabidopsis thaliana, Brassica napus and Nicotiana tabacum plants.
  • Fragment A (2700 bp) in Figure 4 contains the promoter of the legumin B4 gene from Vicia faba, fragment B (245 bp) encodes the transit peptide of the Nicotina tabacum transketolase, fragment C (977 bp) encodes the ORF sll0418 from Synechocystis spec. PCC 6803, fragment D (219 bp) for the termination signal of the octopine synthase gene.
  • a putative prokaryotic secretion signal was identified in the primary sequence of ORF sll0418 based on computer analysis. In order to ensure that this does not have a negative influence on the import of the protein into the plastids when expressed in plants, a derivative of the sequence of sll0418 was generated in which the putative secretion signal was deleted (sequence ID No. 7). This deletion was carried out using PCR technology. The primers used (sll0418DSp5 ', sequence ID No. 9 and sll0418DSp3', sequence ID No.
  • Fragment A (529 bp) in Figure 5 contains the 35S promoter of the CaMV (nucleotides 6909 to 7437 of the cauliflower mosaic virus), fragment B (245 bp) fragment encodes the transit peptide of the Nicotiana tabacum transketolase, fragment C (930Bp) ORF sll0418 ⁇ SP from Synechocystis spec , PCC 6803 fragment D (219 bp) for the termination signal of the octopine synthase gene.
  • legumin B4 gene was isolated from the plasmid PCR-Script / lePOCS using the EcoRl 5 'flanking the promoter and the 3' flanking Kpnl cleavage sites.
  • the plasmid pBinAR-TkTp-9 / sll0418 ⁇ SP was also treated with the restriction enzymes EcoRI and Kpnl. As a result, the CaMV 35S promoter was separated from this plasmid. The promoter of the legumin gene was then cloned into this vector as an EcoRI / Kpnl fragment, resulting in a WO 01/04330 ".
  • Plasmid was generated which placed the expression of the deletion clone of the gene sll0418 under the control of this seed-specific promoter, see Figure 6.
  • Fragment A (2700 bp) in Figure 6 contains the promoter of the legumin B4 gene from Vicia 5 faba, fragment B (245bp) Fragment encodes the transit peptide of Nicotiana tabacum transketolase, fragment C (930Bp) ORF S110418 ⁇ SP from Synechocystis spec. PCC 6803 fragment D (219 bp) for the termination signal of the octopine synthase gene.
  • This plasmid (pBinARleP-TkTp-9 / sll0418 ⁇ SP) was used to generate transgenic Arabidopsis thaliana, Brassica napus and Nicotiana tabacum plants.
  • Wild-type Arabidopsis thaliana plants (Columbia) were transformed with the Agrobacterium tumefaciens strain (EHA105) based on a modified vacuum infiltration method (Steve
  • 35 seeds of the primary transformants were selected on the basis of antibiotic resistance.
  • Antibiotic-resistant seedlings were planted in soil and used as fully developed plants for biochemical analysis.
  • transgenic oilseed rape plants were based on a protocol by Bade, JB and Damm, B. (in Gene Transfer to Plants, Potrykus, I. and Spangenberg, G., eds, Springer Lab Ma- nual, Springer Verlag, 1995, 30-38), in which the composition of the media and buffers used is also given.
  • the transformations were carried out with the Agrobacterium tumefaciens 5 strain EHA105.
  • the plasmids pBinARleP-TkTp-9 / sll0418 and pBinAR-TkTp-9 / sll0418 were used for the transformation.
  • Brassica napus var. Westar seeds were surface sterilized with 70% ethanol (v / v), washed in water for 10 minutes at 55 ° C., in 1% hypochlorite solution (25% v / v tea pol, 0.1% v / v Tween 20) for
  • An overnight culture of the Agrobacterium strain was set up at 29 ° C. in Luria Broth medium with kanamycin (20 mg / l), of which 2 ml in 50 ml Luria Broth medium without kanamycin for 4 hours at 29 ° C. up to an OD 600 v ° n 0.4-0.5 incubated. After pelleting the 5 culture at 2000 rpm for 25 min, the cell pellet was resuspended in 25 ml of basal medium. The concentration of the bacteria in the solution was adjusted to an ODeoo of 0.3 by adding further basal medium.
  • the callus induction medium was removed from the oilseed rape explants using sterile pipettes, 50 ml of Agrobacterium solution were added, mixed gently and incubated for 20 min. The Agrobacteria suspension was removed, the oilseed rape explant was washed for 1 min with 50 ml callus induction medium and then 100 ml callus 5 induction medium was added. The co-cultivation was carried out on a rotary shaker at 100 rpm for 24 h. The co-cultivation was stopped by removing the callus induction medium and the explants were washed twice for 1 min with 25 ml and twice for 60 min with 100 ml washing medium at 100 rpm. The washing medium with the explants was transferred to 15 cm petri dishes and the medium was removed with sterile pipettes.
  • the wild-type plants from sterile culture were obtained by vegetative replication. For this purpose, only the tip of the plant was cut off and transferred to fresh 2MS medium in a sterile mason jar. The hair on the top of the leaf and the central ribs of the leaves were removed from the rest of the plant. The leaves were cut into approximately 1 cm 2 pieces with a razor blade. The agrobacterial culture was transferred to a small petri dish (2 cm in diameter). The leaf pieces were briefly pulled through the solution and placed with the underside of the leaf on 2MS medium in Petri dishes (diameter 9 cm) so that they touched the medium. After two days in the dark at 25 ° C, the explants were transferred to plates with callus induction medium and heated to 28 ° C in the climatic chamber.
  • the medium had to be changed every 7-10 days. As soon as calli formed, the explants were transferred to sterile mason jars on shoot induction medium with claforan (see above). Organogenesis occurred after about a month and the sprouts formed could be cut off. The shoots were cultivated on 2MS medium with Claforan and a selection marker. As soon as a strong root ball had formed, the plants could be potted in prickly soil.
  • the transgenic plants were cultivated in the greenhouse and plants which code the gene for the 2-methyl-6-phytylhydroquinone methyltransferase from Synechocystis spec.
  • PCC 6803 express analyzed at Northern level.
  • the tocopherol content and the tocotrienol content were determined in the leaves and seeds of these plants.
  • the tocopherol or tocotrienol concentration in transgenic plants which additionally express a DNA sequence SEQ-ID No. 1 or SEQ-ID No. 7 was increased compared to non-transformed plants.

Landscapes

  • Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Organic Chemistry (AREA)
  • Biotechnology (AREA)
  • Molecular Biology (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • Biomedical Technology (AREA)
  • General Health & Medical Sciences (AREA)
  • Biochemistry (AREA)
  • Microbiology (AREA)
  • Plant Pathology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Cell Biology (AREA)
  • Nutrition Science (AREA)
  • Medicinal Chemistry (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Breeding Of Plants And Reproduction By Means Of Culturing (AREA)

Abstract

Verfahren zur Herstellung von Pflanzen mit erhöhtem Gehalt an Tocopherolen und Tocotrienolen durch Überexpression eines Gens codierend für eine 2-Mehtyl-6-phytylhydrochinon-methyltransferase.

Description

Identifizierung und Überexpression einer DNA-Sequenz codierend für eine 2-Methyl-6-phytylhydrochinon-methyltransferase in Pflanzen
Beschreibung
Die Erfindung betrifft eine DNA kodierend für ein Polypeptid mit 2-Methyl-6-phytylhydrochinon-methyltransferase Aktivität. Zudem betrifft die Erfindung die Verwendung von DNA-Sequenzen codierend für ein Polypeptid mit 2-Methyl-6-phytylhydrochinon-Methyltrans- ferase Aktivität zur Herstellung von Pflanzen mit erhöhtem Gehalt an Tocopherolen und Tocotrienolen, speziell die Verwendung der DNA-Sequenz SEQ-ID Nr. 1 oder SEQ-ID Nr. 7 oder mit dieser hybri- disierende oder zur Gesamtsequenz oder zu Teilsequenzen homologen DNA-Sequenzen, einem Verfahren zur Herstellung von Pflanzen mit erhöhtem Gehalt an Tocopherolen und Tocotrienolen, sowie die derart hergestellte Pflanze selbst.
Ein wichtiges Ziel pflanzen olekulargenetischer Arbeiten ist bisher die Erzeugung von Pflanzen mit erhöhtem Gehalt an Zuckern, Enzymen und Aminosäuren. Wirtschaftlich interessant ist jedoch auch die Entwicklung von Pflanzen mit erhöhtem Gehalt an Vitaminen, wie z.B. der Erhöhung des Tocopherol- und Tocotrienolgehal- tes.
Die in der Natur vorkommenden acht Verbindungen mit Vitamin E-Ak- tivität sind Derivate des 6-Chromanols (Ulimann's Encyclopedia of Industrial Chemistry, Vol. A 27 (1996), VCH Verlagsgesell- schaft, Chapter 4., 478-488, Vitamin E) . Die erste Gruppe (la-d) stammt von Tocopherol ab, die zweite Gruppe besteht aus Derivaten des Tocotrienols (2a- d) :
Figure imgf000003_0001
R3
la , α-Tocopherol Rl = R2 = R3 = H3 lb , ß-Tocopherol [ 148-03 -81 : R1 = R3 = CH3 , R2 = H lc , γ-Tocopherol [ 54-28-41 : Rl = H , R2 = R3 = CH3 ld, δ-Tocopherol [ 119-13-11 : Rl = R2 = H , R3 = CH3
Figure imgf000004_0001
R3
2a, α-Tocotrienol [1721-51-3] : Rl = R2 = R3 = CH3
2b, ß-Tocotrienol [490-23-3]: R = R3 = CH3 , R2 = H 2c, γ-Tocotrienol [14101-61-2] : Rl = H, R2 = R3 = CH3
2d, δ-Tocotrienol [25612-59-3]: Rl = R2 = H, R3 = CH3
Wirtschaftlich große Bedeutung besitzt α-Tocopherol .
Der Entwicklung von Kulturpflanzen mit erhöhtem Gehalt an Tocopherolen und Tocotrienolen durch klassische Züchtungsmethoden sind Grenzen gesetzt.
Eine sinnvolle Alternative ist das gentechnische Vorgehen, beispielsweise die für die Tocopherol Syntheseleistung kodierenden, essentiellen Biosynthesegene zu isolieren und in Kulturpflanzen gezielt zu übertragen. Dieses Verfahren setzt voraus, daß die Biosynthese und deren Regulation bekannt ist und daß Gene, die die Biosyntheseleistung beeinflussen, identifiziert werden.
Isoprenoide oder Terpenoide bestehen aus verschiedenen Klassen lipidlöslicher Moleküle und werden teilweise oder vollständig aus Cs-Isopren-Einheiten gebildet. Reine Prenyllipide (z.B. Carotinoide) bestehen aus C-Gerüsten, die ausschließlich auf Isopren-Einheiten zurückgehen, während gemischte Prenyllipide (z.B. Chlorophylle, Tocopherole und Vitamin K) eine Isoprenoid-Seiten- kette besitzen, die mit einem aromatischen Kern verbunden ist.
Ausgangspunkt der Biosynthese von Prenyllipiden sind 3 x Acetyl- CoA Einheiten, die über ß-Hydroxymethylglutaryl-CoA (HMG-CoA) und Mevalonat in die Ausgangs-Isopren-Einheit (C5), dem Isopentenyl- pyrophosphat (IPP) , umgewandelt werden. Kürzlich wurde durch in vivo Fütterungsexperimente mit Cl3 gezeigt, daß in verschiedenen Eubakterien, Grünalgen und pflanzlichen Chloroplasten ein Mevalo- nat-unabhängiger Weg zur Bildung von IPP beschritten wird. Dabei werden Hydroxyethylthiamin, das durch Decarboxylierung von Pyru- vat entsteht, und Glycerinaldehyd-3-Phosphat (3-GAP) in einer durch die l-Deoxy-D-Xylulose-5-Phosphat Synthase vermittelten "Transketolase"-Reaktion zunächst in 1-Deoxy-D-Xylu- lose-5-phosphat umgewandelt (Lange et al, 1998; Schwender et al, 1997; Arigoni et al, 1997; Lichtenthaler et al, 1997; Sprenger et al, 1997) . Dieses wird dann durch eine intramolekulare Umordnung in 2-C-Methyl-D-Erythritol-4-Phosphat und im weiteren zu IPP umgesetzt (Arigoni et al, 1997; Zeidler et al, 1998). Biochemische Daten deuten darauf hin, daß der Mevalonat-Weg im Zytosol ope- riert und zur Bildung von Phytosterolen führt. Das Antibiotikum Mevinolin, ein spezifischer Inhibitor der Mevalonat-Bildung, führt lediglich zur Inhibition der Sterol-Biosynthese im Zyto- plasma, während die Prenyllipid-Bildung in den Piastiden unbeeinflußt ist (Bach & Lichtenthaler, 1993). Der Mevalonat-unabhängige Weg ist dagegen plastidär lokalisiert und führt vornehmlich zur Bildung von Carotinoiden und plastidären Prenyllipiden (Schwender et al, 1997; Arigoni et al, 1997) .
IPP steht im Gleichgewicht mit seinem Isomer, dem Dimethylallyl Pyrophosphat (DMAPP) . Eine Kondensation von IPP mit DMAPP in
Kopf-Schwanz Anlagerung ergibt das Monoterpen (CIO) Geranyl-Pyro- phosphat (GPP) . Die Addition von weiteren IPP Einheiten führt zum Sesquiterpen (C15) Farnesy-Pyrophosphat (FPP) und zum Diterpen (C20) Geranyl-Geranyl-Pyrophosphat (GGPP) . Die Verknüpfung zweier GGPP Moleküle führt zur Bildung der C40-Vorläufer für Carotinoide.
Bei gemischten Prenyllipiden ist die Isopren-Seitenkette verschiedener Länge mit Nicht-Isopren Ringen verbunden wie beispielsweise ein Porphyrin-Ring bei Chlorophyll a und b. Die Chlorophylle und Phylloquinone enthalten eine C20 Phytyl-Kette, in der nur die erste Isopren-Einheit eine Doppelbindung enthält. GGPP wird durch die Geranylgeranyl-Pyrophosphat-Oxidoreduktase (GGPPOR) zum Phytyl-Pyrophosphat (PPP) umgeformt, dem Ausgangs- stoff für die weitere Bildung von Tocopherolen.
Bei den Ringstrukturen der gemischten Prenyllipide, die zur Bildung der Vitamine E und K führen, handelt es sich um Quinone, deren Ausgangsmetabolite aus dem Shikimat-Weg stammen. Die aroma- tischen Aminosäuren Phenylalanin bzw. Tyrosin werden in Hydroxy- phenyl-Pyruvat umgewandelt, welches durch Dioxygenierung in Ho o- gentisinsäure überführt wird. Das Chorismat wird ausgehend von Erythrose-4-Phosphat und Phosphoenolpyruvat (PEP) durch deren Kondensation zu 3-deoxy-D-Arabino-heptulosonat-7-Phosphat (DAHP) über die Zwischenstufen des Shikimatweges 3 ' -Dehydroquinat ,
3 x -Dehydroshikimat , Shikimat, Shikimat-3-Phosphat und 5 l -Enolpy- ruvylshikimat-3-Phosphat gebildet. Dabei wird das Eryt- hrose-4-Phosphat vom Calvinzyklus gebildet und das PEP von der Glykolyse bereitgestellt. Die oben beschriebene Homogentisinsäure wird anschließend an Phytylpyrophosphat (PPP) bzw. Geranylgera- nylpyrophosphat gebunden, um die Vorläufer von α-Tocopherol und α-Tocotrienol, das 2-Methyl-6-phytylhydrochinon bzw. das 2-Methyl-6-geranylgeranylhydrochinon zu bilden. Durch Methylier- ungsschritte mit S-Adenosylmethionin als Methyl-Gruppen-Donor entsteht zunächst 2, 3-Dimethyl-6-phytylquinol, dann durch Zyklisierung α-Tocopherol und durch nochmalige Methylierung α- Tocopherol (Richter, Biochemie der Pflanzen, Georg Thieme Verlag Stuttgart, 1996) .
In der Literatur finden sich Beispiele die zeigen, daß die Manipulation eines Enzyms den Metabolit-Fluß direktional beeinflußen kann. In Experimenten mit einer veränderten Expression der Phy- toen Synthase, welche zwei GGPP-Moleküle zu 15-cis-Phytoen miteinander verknüpft, konnte ein direkter Einfluß auf die Carotino- id-Mengen dieser transgenen Tomatenpflanzen gemessen werden (Fray und Grierson, Plant Mol. Biol.22 (4) , 589-602 (1993) ; Fray et al . , Plant J. , 8, 693-701(1995)). Wie zu erwarten, zeigen transgene Tabakpflanzen mit verringerten Mengen an Phenylalanin-Ammonium Lyase reduzierte Phenylpropanoid-Mengen. Das Enzym Phenylalanin- Ammonium Lyase katalysiert den Abbau von Phenylalanin, entzieht es also der Phenylpropanoid-Biosynthese (Bäte et al . , Proc . Natl. Acad. Sei USA 91 (16): 7608-7612 (1994); Howles et al . , Plant Physiol. 112. 1617-1624(1996)).
Über die Erhöhung des Metabolitflusses zur Steigerung des Tocopherol- bzw. Tocotrienolgehaltes in Pflanzen durch Überexpression einzelner Biosynthesegene ist bisher wenig bekannt. Lediglich WO 97/27285 beschreibt eine Modifikation des Tocopherol-Gehaltes durch verstärkte Expression bzw. durch Herunterregulation des Enzyms p-Hydroxyphenylpyruvatdioxygenase (HPPD) . WO 99/04622 beschreibt eine Gensequenz codierend für eine γ-Tocopherolmethyl- transferase aus einem photosynthetisch aktiven Organismus.
WO 99/23231 zeigt, daß die Expression einer Geranylgeranyl-Reduc- tase in transgenen Pflanzen eine gesteigerte Tocopherolbiosynt- hese zur Folge hat .
Aufgabe der vorliegenden Erfindung war die Entwicklung einer transgenen Pflanze mit erhöhtem Gehalt an Tocopherolen und Tocotrienolen.
Die Aufgabe wurden überraschenderweise gelöst durch die Über- expression eines 2-Methyl-6-phytylhydrochinon-methyltransferase Gens in Pflanzen.
Zu diesem Zweck wurde in transgenen Pflanzen die Aktivität der 2-Methyl-6-phytylhydrochinon-methyltransferase ( MPMT ) durch Überexpression des MPMT-Gens aus Synechocystis spec. PCC 6803 er- höht . Dies kann prinzipiell durch Expression homologer oder hete- rologer MPMT-Gene erreicht werden.
In Beispiel 2 wird erstmals die Klonierung einer MPMT-DNA-Sequenz (SEQ-ID Nr. 1) aus Synechocystis spec. PCC 6803 beschrieben. Um eine Plastidenlokalisation zu gewährleisten wird der MPMT- Nukleotidsequenz aus Synechocystis eine Transitsignalsequenz (Abb. 3, Abb. 4) vorangestellt. Auch geeignet als Expressionskassette ist eine DNA-Sequenz, die für ein MPMT-Gen codiert, das mit SEQ-ID Nr. 1 hybridisiert, bzw. zur Gesamtsequenz oder zu Teilsequenzen homolog ist und das aus anderen Organismen bzw. aus Pflanzen stammt.
Das durch die zusätzliche Expression des MPMT-Gens nun vermehrt zur Verfügung stehende 2, 3-Dimethyl-6-phytylhydrochinon wird weiter in Richtung Tocopherole und Tocotrienol umgesetzt (Abbildung 1) •
Die Herstellung der transgenen Pflanzen erfolgt durch Transfor a- tion der Pflanzen mit einem das MPMT-Gen enthaltenden Konstrukt. Als Modellpflanzen für die Produktion von Tocopherolen und Tocotrienolen wurden Arabidopsis thaliana, Brassica napus und Nicotiana tabacum eingesetzt.
Messungen an MPMT-Synechocystis knock out Mutanten ergaben bezüglich des Gehaltes an Tocopherolen und Tocotrienolen eine drastische Abnahme. Dies belegt den direkten Einfluß der plastidären pflanzlichen MPMT auf die Synthese von Tocopherolen und Tocotrienolen.
Gegenstand der Erfindung ist die Verwendung einer DNA-Sequenz SEQ-ID Nr. 1 aus Synechocystis spec. PCC 6803, die für eine MPMT oder deren funktioneile Äquivalente kodiert, zur Herstellung einer Pflanze mit erhöhtem Gehalt an Tocopherolen und Tocotrieno- len. Die Nukleinsäuresequenz kann dabei z.B. eine DNA- oder cDNA- Sequenz sein. Zur Insertion in eine Expressionskassette geeignete kodierende Sequenzen sind beispielsweise solche, die für eine MPMT kodieren und die dem Wirt die Fähigkeit zur Überproduktion von Tocopherolen und Tocotrienolen verleihen.
Die Expressionskassetten beinhalten außerdem regulative Nuklein- säuresequenzen, welche die Expression der kodierenden Sequenz in der Wirtszelle steuern. Gemäß einer bevorzugten Ausführungsform umfaßt eine Expressionskassette stromaufwärts, d.h. am 5' -Ende der kodierenden Sequenz, einen Promotor und stromabwärts, d.h. am 3 '-Ende, ein Polyadenylierungssignal und gegebenenfalls weitere regulatorische Elemente, welche mit der dazwischenliegenden ko- dierenden Sequenz für das MPMT-Gen operativ verknüpft sind. Unter einer operativen Verknüpfung versteht man die sequenzielle Anordnung von Promotor, kodierender Sequenz, Terminator und ggf. weiterer regulativer Elemente derart, daß jedes der regulativen Ele- mente seine Funktion bei der Expression der kodierenden Sequenz bestimmungsgemäß erfüllen kann. Die zur operativen Verknüpfung bevorzugten aber nicht darauf beschränkten Sequenzen sind Targeting-Sequenzen zur Gewährleistung der subzellulären Lokalisation im Apoplasten, in der Vakuole, in Piastiden, im Mitochondriu , im Endoplasmatischen Retikulum (ER) , im Zellkern, in Ölkörperchen oder anderen Kompartimenten und Translationsverstärker wie die 5 '-Führungssequenz aus dem Tabak-Mosaik-Virus (Gallie et al., Nucl. Acids Res. 15 (1987), 8693 -8711).
Beispielhaft kann die pflanzliche Expressionskassette in ein Derivat des Transformationsvektors pBin-19 mit 35s Promotor (Bevan, M. , Nucleic Acids Research 12: 8711-8721 (1984)) eingebaut werden. Abbildung 4 zeigt ein Derivat des Transfor ationsvektors pBin -19 mit samenspezifischem Legumin B4-Promotor.
Als Promotoren der Expressionskassette ist grundsätzlich jeder Promotor geeignet, der die Expression von Fremdgenen in Pflanzen steuern kann. Vorzugsweise verwendet man insbesondere einen pflanzlichen Promotor oder einen Promotor, der einem Pflanzenvi- rus entstammt. Insbesondere bevorzugt ist der CaMV 35S-Promotor aus dem Blumenkohl-Mosaik-Virus (Franck et al., Cell 21 (1980), 285 - 294) . Dieser Promotor enthält bekanntlich unterschiedliche ErkennungsSequenzen für transkriptionale Effektoren, die in ihrer Gesamtheit zu einer permanenten und konstitutiven Expression des eingeführten Gens führen (Benfey et al . , EMBO J. 8 (1989), 2195-2202) .
Die Expressionskassette kann auch einen chemisch induzierbaren Promotor enthalten, durch den die Expression des exogenen MPMT- Gens in der Pflanze zu einem bestimmten Zeitpunkt gesteuert werden kann. Derartige Promotoren wie z.B. der PRPl-Promotor (Ward et al., Plant. Mol. Biol. 22 (1993), 361-366), ein durch Salizylsäure induzierbarer Promotor (WO 95/19443) , ein durch Benzenesul- fonamid-induzierbarer (EP-A 388186), ein durch Tetrazyklin- induzierbarer (Gatz et al . , (1992) Plant J. 2, 397-404), ein durch Abscisinsäure-induzierbarer (EP-A 335528) bzw. ein durch Ethanol- oder Cyclohexanon-induzierbarer (WO 93/21334) Promotor können u.a. verwendet werden.
Weiterhin sind insbesondere solche Promotoren bevorzugt, die die Expression in Geweben oder Pflanzenteilen sicherstellen, in denen beispielsweise die Biosynthese von Tocopherol bzw. dessen Vorstu- fen stattfindet. Insbesondere zu nennen sind Promotoren, die eine blattspezifische Expression gewährleisten. Zu nennen sind der
Promotor der cytosolischen FBPase aus Kartoffel oder der ST-LSI
Promotor aus Kartoffel (Stockhaus et al., EMBO J. 8 (1989), 2445 - 245) .
Mit Hilfe eines samenspezifischen Promotors konnte ein Fremdprotein stabil bis zu einem Anteil von 0,67 % des gesamten löslichen Samenproteins in den Samen transgener Tabakpflanzen expri- miert werden (Fiedler und Conrad, Bio/Technology 10 (1995) , 1090-1094) . Die Expressionskassette kann daher beispielsweise einen samenspezifischen Promotor (bevorzugt den Phaseolin- Promotor (US 5504200), den USP- (Baumlein, H. et al . , Mol. Gen. Genet. (1991) 225 (3), 459 - 467) oder LEB4-Promotor (Fiedler und Conrad, 1995) ) , das LEB4-Signalpeptid, das zu exprimierende Gen und ein ER-Retentionssignal enthalten.
Die Herstellung einer Expressionskassette erfolgt durch Fusion eines geeigneten Promotors mit einer geeigneten MPMT-DNA Sequenz und vorzugsweise einer zwischen Promotor und MPMT-DNA-Sequenz inserierten DNA, die für ein chloroplastenspezifisches Transitpep- tid kodiert, sowie einem Polyadenylierungssignal nach gängigen Reko binations- und Klonierungstechniken, wie sie beispielsweise in T. Maniatis, E.F. Fritsch und J. Sambrook, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY (1989) sowie in T.J. Silhavy, M.L. Berman und L.W. En- quist, Experiments with Gene Fusions, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY (1984) und in Ausubel, F.M. et al . , Current Protocols in Molecular Biology, Greene Publishing Assoc . and Wiley-Interscience (1987) beschrieben sind.
Insbesondere bevorzugt sind Sequenzen, die ein Targeting in den Piastiden gewährleisten.
Es können auch Expressionskassetten verwendet werden, deren DNA- Sequenz für ein MPMT-Fusionsprotein kodiert, wobei ein Teil des Fusionsproteins ein Transitpeptid ist, das die Translokation des Polypeptides steuert. Bevorzugt sind für die Chloroplasten spezifische Transitpeptide, welche nach Translokation des MPMT-Gens in die Chloroplasten vom MPMT-Teil enzymatisch abgespalten werden. Insbesondere bevorzugt ist das Transitpeptid, das von der plasti- dären Nicotiana tabacum Transketolase oder einem anderen Transitpeptid (z.B. dem Transitpeptid der kleinen Untereinheit der Rubi- sco oder der Ferredoxin NADP Oxidoreduktase) oder dessen funktio- nellem Äquivalent abgeleitet ist. Besonders bevorzugt sind DNA-Sequenzen von drei Kassetten des
Plastiden-Transitpeptids der plastidären Transketolase aus Tabak in drei Leserastern als Kpnl/BamHI Fragmente mit einem ATG-Codon in der Ncol Schnittstelle:
pTP09
KpnI_GGTACCATGGCGTCTTCTTCTTCTCTCACTCTCTCTCAAGCTATCCTCTCTCGTTCTGTC CCTCGCCATGGCTCTGCCTCTTCTTCTCAACTTTCCCCTTCTTCTCTCACTTTTTCCGGCCTTAA ATCCAATCCCAATATCACCACCTCCCGCCGCCGTACTCCTTCCTCCGCCGCCGCCGCCGCCGTCG TAAGGTCACCGGCGATTCGTGCCTCAGCTGCAACCGAAACCATAGAGAAAACTGAGACTGCGGGA TCC_BamHI
pTPlO
KpnI_GGTACCATGGCGTCTTCTTCTTCTCTCACTCTCTCTCAAGCTATCCTCTCTCGTTCTGTC CCTCGCCATGGCTCTGCCTCTTCTTCTCAACTTTCCCCTTCTTCTCTCACTTTTTCCGGCCTTAA ATCCAATCCCAATATCACCACCTCCCGCCGCCGTACTCCTTCCTCCGCCGCCGCCGCCGCCGTCG TAAGGTCACCGGCGATTCGTGCCTCAGCTGCAACCGAAACCATAGAGAAAACTGAGACTGCGCTG GATCC_BamHI
pTPll
KpnI_GGTACCATGGCGTCTTCTTCTTCTCTCACTCTCTCTCAAGCTATCCTCTCTCGTTCTGTC CCTCGCCATGGCTCTGCCTCTTCTTCTCAACTTTCCCCTTCTTCTCTCACTTTTTCCGGCCTTAA ATCCAATCCCAATATCACCACCTCCCGCCGCCGTACTCCTTCCTCCGCCGCCGCCGCCGCCGTCG TAAGGTCACCGGCGATTCGTGCCTCAGCTGCAACCGAAACCATAGAGAAAACTGAGACTGCGGGG ATCC_BamHI
Die inserierte Nukleotid-Sequenz kodierend für eine MPMT kann synthetisch hergestellt oder natürlich gewonnen sein oder eine Mischung aus synthetischen und natürlichen DNA-Bestandteilen enthalten, sowie aus verschiedenen heterologen MPMT-Genabschnitten verschiedener Organismen bestehen. Im allgemeinen werden synthe- tische Nukleotid-Sequenzen mit Kodons erzeugt, die von Pflanzen bevorzugt werden. Diese von Pflanzen bevorzugten Kodons können aus Kodons mit der höchsten Proteinhäufigkeit bestimmt werden, die in den meisten interessanten Pflanzenspezies expri iert werden. Bei der Präparation einer Expressionskassette können ver- schiedene DNA-Fragmente manipuliert werden, um eine Nukleotid-Sequenz zu erhalten, die zweckmäßigerweise in der korrekten Richtung liest und die mit einem korrekten Leseraster ausgestattet ist. Für die Verbindung der DNA-Fragmente miteinander können an die Fragmente Adaptoren oder Linker angesetzt werden. Zweckmäßigerweise können die Promotor- und die Terminator-Regionen in Transkriptionsrichtung mit einem Linker oder Polylinker, der eine oder mehrere Restriktionsstellen für die Insertion dieser Sequenz enthält, versehen werden. In der Regel hat der Linker 1 bis 10, meistens 1 bis 8, vorzugsweise 2 bis 6 Restriktionsstellen. Im allgemeinen hat der Linker innerhalb der regulatorischen Bereiche eine Größe von weniger als 100 bp, häufig weniger als 60 bp, mindestens jedoch 5 bp. Der Promotor kann sowohl nativ bzw. homolog als auch fremdartig bzw. heterolog zur Wirtspflanze sein. Die Expressionskassette beinhaltet in der 5 ' -3 ' -Transkriptionsrichtung den Promotor, eine DNA-Sequenz die für ein MPMT-Gen codiert und eine Region für die transkriptionale Termination. Verschiedene Terminationsbereiche sind gegeneinander beliebig austauschbar .
Ferner können Manipulationen, die passende Restriktionsschnittstellen bereitstellen oder die überflüssige DNA oder Restriktionsschnittstellen entfernen, eingesetzt werden. Wo Insertionen, Deletionen oder Substitutionen wie z.B. Transitionen und Trans- Versionen in Frage kommen, können in viüro-Mutagenese, "primerre- pair", Restriktion oder Ligation verwendet werden. Bei geeigneten Manipulationen, wie z.B. Restriktion, "chewing-back" oder Auffüllen von Überhängen für "bluntends", können komplementäre Enden der Fragmente für die Ligation zur Verfügung gestellt werden.
Bevorzugte Polyadenylierungssignale sind pflanzliche Polyadeny- lierungssignale, vorzugsweise solche, die im wesentlichen T-DNA- Polyadenylierungssignale aus Agrobacterium tumefaciens, insbesondere des Gens 3 der T-DNA (Octopin Synthase) des Ti-Plasmids pTiACH5 entsprechen (Gielen et al . , EMBO J. 3 (1984), 835 ff) oder funktioneile Äquivalente.
Vorzugsweise wird die fusionierte Expressionskassette, die für ein MPMT-Gen kodiert, in einen Vektor, beispielsweise pBinl9, kloniert, der geeignet ist, Agrobacterium tumefaciens zu transformieren. Mit einem solchen Vektor transformierte Agrobakterien können dann in bekannter Weise zur Transformation von Pflanzen, insbesondere von Kulturpflanzen, wie z.B. von Tabakpflanzen, verwendet werden, indem beispielsweise verwundete Blätter oder Blattstücke in einer Agrobakterienlösung gebadet und anschließend in geeigneten Medien kultiviert werden. Die Transformation von Pflanzen durch Agrobakterien ist unter anderem bekannt aus F.F. White, Vectors for Gene Transfer in Higher Plants ; in Transgenic Plants, Vol. 1, Engineering and Utilization, herausgegeben von S.D. Kung und R. Wu, Academic Press, 1993, S. 15 - 38. Aus den transformierten Zellen der verwundeten Blätter bzw. Blattstücke können in bekannter Weise transgene Pflanzen regeneriert werden, die ein in die Expressionskassette integriertes Gen für die Expression eines MPMT-Gens enthalten.
Zur Transformation einer Wirtspflanze mit einer für eine MPMT ko- dierenden DNA wird eine Expressionskassette als Insertion in einen rekombinanten Vektor eingebaut, dessen Vektor-DNA zusätzliche funktionelle Regulationssignale, beispielsweise Sequenzen für Replikation oder Integration enthält . Geeignete Vektoren sind unter anderem in "Methods in Plant Molecular Biology and Bio- technology" (CRC Press), Kap. 6/7, S. 71 - 119 (1993) beschrieben.
Unter Verwendung der oben zitierten Rekombinations- und Klonierungstechniken können die Expressionskassetten in geeignete Vektoren kloniert werden, die ihre Vermehrung, beispielsweise in E. coli, ermöglichen. Geeignete Klonierungsvektoren sind u.a. pBR332, pUC-Serien, M13mp-Serien und pACYC184. Besonders geeignet sind binäre Vektoren, die sowohl in E. coli als auch in Agrobakterien replizieren können.
Ein weiterer Gegenstand der Erfindung betrifft die Verwendung einer Expressionskassette enthaltend eine DNA-Sequenz SEQ-ID Nr. 1 oder eine mit dieser hybridisierende DNA-Sequenz zur Transformation von Pflanzen, -zellen, -geweben oder Pflanzenteilen. Vorzugsweise ist Ziel der Verwendung die Erhöhung des Gehaltes an Tocopherolen und Tocotrienolen der Pflanze.
Dabei kann je nach Wahl des Promotors die Expression spezifisch in den Blättern, in den Samen, Blütenblättern oder anderen Teilen der Pflanze erfolgen. Solche transgenen Pflanzen, deren Vermehrungsgut, sowie deren Pflanzenzellen, -gewebe oder -teile sind ein weiterer Gegenstand der vorliegenden Erfindung.
Die Expressionskassette kann darüberhinaus auch zur Transforma- tion von Bakterien, Cyanobakterien, Hefen, filamentösen Pilzen und Algen mit dem Ziel einer Erhöhung des Gehaltes an Tocopherolen und Tocotrienolen eingesetzt werden.
Die Übertragung von Fremdgenen in das Genom einer Pflanze wird als Transformation bezeichnet. Es werden dabei die beschriebenen Methoden zur Transformation und Regeneration von Pflanzen aus Pflanzengeweben oder Pflanzenzellen zur transienten oder stabilen Transformation genutzt. Geeignete Methoden sind die Protoplasten- transformation durch Polyethylenglykol-induzierte DNA-Aufnahme, das biolistische Verfahren mit der Genkanone - die sogenannte particle bombardment Methode, die Elektroporation, die Inkubation trockener Embryonen in DNA-haltiger Lösung, die Mikroinjektion und der durch Agrobacterium vermittelte Gentransfer. Die genannten Verfahren sind beispielsweise in B. Jenes et al., Techniques for Gene Transfer, in: Transgenic Plants, Vol. 1, Engineering and Utilization, herausgegeben von S.D. Kung und R. Wu, Acade ic 5 Press (1993), 128 - 143 sowie in Potrykus, Annu. Rev. Plant Phy- siol. Plant Molec. Biol. 42 (1991), 205 - 225) beschrieben. Vorzugsweise wird das zu exprimierende Konstrukt in einen Vektor kloniert, der geeignet ist, Agrobacterium tumefaciens zu transformieren, beispielsweise pBinl9 (Bevan et al . , Nucl. Acids Res . 10 12 (1984) , 8711) .
Mit einer Expressionskassette transformierte Agrobakterien können ebenfalls in bekannter Weise zur Transformation von Pflanzen, insbesondere von Kulturpflanzen, wie Getreide, Mais, Hafer, Soja,
15 Reis, Baumwolle, Zuckerrübe, Canola, Sonnenblume, Flachs, Hanf, Kartoffel, Tabak, Tomate, Raps, Alfalfa, Salat und den verschiedenen Baum-, Nuß- und Weinspezies, verwendet werden, z.B. indem verwundete Blätter oder Blattstücke in einer Agrobakterienlösung gebadet und anschließend in geeigneten Medien kultiviert werden. 0
Funktionen äquivalente Sequenzen, die für ein MPMT-Gen kodieren, sind solche Sequenzen, welche trotz abweichender Nukleotidsequenz noch die gewünschten Funktionen besitzen. Funktionelle Äquivalente umfassen somit natürlich vorkommende Varianten der hierin 5 beschriebenen Sequenzen sowie künstliche, z.B. durch chemische Synthese erhaltene, an den Kodon-Gebrauch einer Pflanze angepaßte, künstliche Nukleotid-Sequenzen.
Unter einem funktioneilen Äquivalent versteht man insbesondere 0 auch natürliche oder künstliche Mutationen einer ursprünglich isolierten für eine MPMT kodierende Sequenz, welche weiterhin die gewünschte Funktion zeigen. Mutationen umfassen Substitutionen, Additionen, Deletionen, Vertauschungen oder Insertionen eines oder mehrerer Nukleotidreste. Somit werden beispielsweise auch 5 solche Nukleotidsequenzen durch die vorliegende Erfindung mit umfaßt, welche man durch Modifikation der MPMT-Nukleotidsequenz erhält. Ziel einer solchen Modifikation kann z.B. die weitere Eingrenzung der darin enthaltenen kodierenden Sequenz oder z.B. auch die Einfügung weiterer Restriktionsenzym-Schnittstellen sein. 0
Beispiel 8 beschreibt einen Deletionsklon des MPMT-Gens, siehe SEQ-ID Nr. 7)
Funktionelle Äquivalente sind auch solche Varianten, deren Funk- 5 tion, verglichen mit dem Ausgangsgen bzw. Genfragment, abgeschwächt oder verstärkt ist. Außerdem sind artifizielle DNA-Sequenzen geeignet, solange sie, wie oben beschrieben, die gewünschte Eigenschaft beispielsweise der Erhöhung des Tocopherol-Gehaltes in der Pflanze durch Überexpression eines MPMT-Gens in Kulturpflanzen vermitteln. Solche artifiziellen DNA-Sequenzen können beispielsweise durch Rückübersetzung mittels Molecular Modelling konstruierter Proteine, die MPM -Aktivität aufweisen oder durch in vitro-Selektion ermittelt werden. Besonders geeignet sind kodierende DNA-Sequenzen, die durch Rückübersetzung einer Polypeptidsequenz gemäß der für die Wirtspflanze spezifischen Kodon-Nutzung erhalten wurden. Die spezifische Kodon-Nutzung kann ein mit pflanzengenetischen Methoden vertrauter Fachmann durch Computerauswertungen anderer, bekannter Gene der zu transformierenden Pflanze leicht ermitteln.
Als weitere geeignete äquivalente Nukleinsäure-Sequenzen sind zu nennen Sequenzen, welche für Fusionsproteine kodieren, wobei Bestandteil des Fusionsproteins ein MPMT-Polypeptid oder ein funk- tionell äquivalenter Teil davon ist. Der zweite Teil des Fusionsproteins kann z.B. ein weiteres Polypeptid mit enzymatischer Aktivität sein oder eine antigene Polypeptidsequenz mit deren Hilfe ein Nachweis auf MPMT-Expression möglich ist (z.B. myc-tag oder his-tag) . Bevorzugt handelt es sich dabei jedoch um eine regulative Proteinsequenz, wie z.B. ein Transitpeptid, das das MPMT-Protein in die Piastiden leitet.
Erhöhung des Gehaltes an Tocopherolen und Tocotrienolen bedeutet im Rahmen der vorliegenden Erfindung die künstlich erworbene Fähigkeit einer erhöhten Biosyntheseleistung dieser Verbindungen durch funktioneile Überexpression eines MPMT-Gens SEQ-ID Nr. 1 oder SEQ-ID Nr. 7 in der Pflanze gegenüber der nicht gentechnisch modifizierten Pflanze für die Dauer mindestens einer Pflanzengeneration.
Dabei kann sowohl der Gehalt an Tocopherolen und Tocotrienolen gesteigert werden. Vorzugsweise wird der Gehalt an Tocopherolen gesteigert . Aber es ist auch möglich unter bestimmten Bedingungen vorzugsweise den Gehalt an Tocotrienolen zu steigern.
Der Biosyntheseort von Tocopherolen beispielsweise ist unter an- derem das Blattgewebe, so daß eine blattspezifische Expression des MPMT-Gens sinnvoll ist. Es ist jedoch naheliegend, daß die Tocopherol-Biosynthese nicht auf das Blattgewebe beschränkt sein muß, sondern auch in allen übrigen Teilen der Pflanze - besonders in fetthaltigen Samen - gewebespezifisch erfolgen kann. Darüberhinaus ist eine konstitutive Expression des exogenen MPMT- Gens von Vorteil. Andererseits kann aber auch eine induzierbare Expression wünschenswert erscheinen.
Die Wirksamkeit der Expression des transgen exprimierten MPMT- Gens kann beispielsweise in vitro durch Sproßmeristemvermehrung ermittelt werden. Zudem kann eine in Art und Höhe veränderte Expression des MPMT-Gens und deren Auswirkung auf die Tocopherol- Biosyntheseleistung an Testpflanzen in Gewächshausversuchen gete- stet werden.
Gegenstand der Erfindung sind außerdem transgene Pflanzen, transformiert mit einer Expressionskassette enthaltend die Sequenz SEQ-ID Nr. 1 oder SEQ-ID Nr. 7 oder eine mit dieser hybridisie- rende bzw. zur Gesamtsequenz oder zu Teilsequenzen homologen DNA- Sequenz, sowie transgene Zellen, Gewebe, Teile und Vermehrungsgut solcher Pflanzen. Besonders bevorzugt sind dabei transgene Kulturpflanzen, wie z.B. Gerste, Weizen, Roggen, Mais, Hafer, Soja, Reis, Baumwolle, Zuckerrübe, Canola, Sonnenblume, Flachs, Hanf, Kartoffel, Tabak, Tomate, Raps, Alfalfa, Tagetes, Salat und die verschiedenen Baum-, Nuß- und Weinspezies.
Pflanzen im Sinne der Erfindung sind mono- und dikotyle Pflanzen.
Gegenstand der Erfindung sind weiterhin photosynthetisch aktive Organismen transformiert mit einer Expressionskassette enthaltend die Sequenz SEQ-ID Nr. 1 oder SEQ-ID Nr. 7 oder eine mit dieser hybridisierende bzw. zur Gesamtsequenz oder zu Teilsequenzen homologen DNA-Sequenz. Photosynthetisch aktive Organismen sind ne- ben Pflanzen, beispielsweise Cyanobakterien, Moose und Algen.
Da es sich bei diesem Biosyntheseweg um einen ausschließlich pla- stidär-lokalisierten Stoffwechselweg handelt, bietet er optimale Targetenzyme für die Entwicklung von Inhibitoren. Da sich nach heutigem Stand der Technik kein mit der Synechocystis MPMT identisches oder ähnliches Enzym in humanen und tierischen Organismen befindet, ist davon auszugehen, daß Inhibitoren sehr spezifisch auf Pflanzen wirken sollten.
Wie bereits erwähnt ist die MPMT ein potentielles Target für Herbizide. Um effiziente Hemmstoffe der MPMT finden zu können, ist es notwendig, geeignete Testsysteme, mit denen Inhibitor-Enzym-Bindungsstudien durchgeführt werden können, zur Verfügung zu stellen. Hierzu wird beispielsweise die komplette cDNA-Sequenz der MPMT aus Synechocystis in einen Expressionsvektor (pQE, Qia- gen) kloniert und in E. coli überexprimiert . Das mit Hilfe der erfindungsgemäßen Expressionskassette expri- mierte MPMT-Protein eignet sich besonders zur Auffindung von für die MPMT spezifischen Hemmstoffen.
Dazu kann die MPMT beispielsweise in einem Enzymtest eingesetzt werden, bei dem die Aktivität der MPMT in An- und Abwesenheit des zu testenden Wirkstoffs ermittelt wird. Aus dem Vergleich der beiden Aktivitätsbestimmungen läßt sich eine qualitative und quantitative Aussage über das Hemmverhalten des zu testenden Wirkstoffes machen.
Mit Hilfe des erfindungsgemäßen Testsystems kann eine Vielzahl von chemischen Verbindungen schnell und einfach auf herbizide Eigenschaften überprüft werden. Das Verfahren gestattet es, reproduzierbar aus einer großen Anzahl von Substanzen gezielt solche mit großer Wirkstärke auszuwählen, um mit diesen Substanzen anschließend weitere, dem Fachmann geläufige vertiefte Prüfungen durchzuführen.
Ein weiterer Gegenstand der Erfindung sind Herbizide, die mit dem oben beschriebenen Testsystem identifizierbar sind.
Durch Überexpression der für eine MPMT kodierenden Gensequenz SEQ-ID Nr. 1 oder SEQ-ID Nr. 7 in einer Pflanze wird eine erhöhte Resistenz gegenüber Inhibitoren der MPMT erreicht. Die derart hergestellten transgenen Pflanzen sind ebenfalls Gegenstand der Erfindung.
Das unter Verwendung der DNA-Sequenz SEQ-ID Nr. 1 oder SEQ-ID Nr. 7 hergestellte MPMT-Protein eignet sich auch zur Durchführung von Biotransformationen zur Bereitstellung größerer Mengen 2, 3-Dimethyl-6-phytylhydrochinon. Dabei wird 2-Methyl-6-phytylhy- drochinon in Gegenwart des Enzyms MPMT und des Cosubstrats S-Ade- nosyl-L-Methionin zu 2 , 3-Dimethyl-6-phytylhydrochinon umgesetzt. Die Biotransformation läßt sich prinzipiell mit ganzen Zellen, die das Enzym MPMT exprimieren oder Zellextrakten aus diesen Zellen oder aber mit aufgereinigter oder hochreiner MPMT in Gegenwart von S-Adenosyl-L-Methionin durchführen.
Weitere Gegenstände der Erfindung sind:
Verfahren zur Transformation einer Pflanze dadurch gekennzeichnet, daß man Expressionskassetten enthaltend eine DNA- Sequenz SEQ-ID Nr. 1 oder SEQ-ID Nr. 7 oder eine mit dieser hybridisierende, bzw. zur Gesamtsequenz oder zu Teilsequenzen homologen DNA-Sequenz in eine Pflanzenzelle oder Protoplasten WO 01/04330 „ __ PCT/EP00/05862
15 von Pflanzen einbringt und diese zu ganzen Pflanzen regeneriert .
Verwendung der DNA-Sequenz SEQ-ID Nr. 1 oder SEQ-ID Nr. 7 5 oder eine mit dieser hybridisierende DNA-Sequenz zur Herstellung von Pflanzen mit erhöhtem Gehalt an Tocopherolen und Tocotrienolen durch Expression einer MPMT DNA-Sequenz in Pflanzen.
10 Die Erfindung wird durch die nun folgenden Beispiele erläutert, ist aber nicht auf diese beschränkt :
Sequenzanalyse rekombinanter DNA
15 Die Sequenzierung rekombinanter DNA-Moleküle erfolgte mit einem Laserfluoreszenz-DNA-Sequenzierer der Firma Licor (Vertrieb durch MWG Biotech, Ebersbach) nach der Methode von Sanger (Sanger et al., Proc. Natl . Acad. Sei. USA 74 (1977), 5463 - 5467).
20 Beispiel 1
Identifizierung einer 2-Methyl-6-phytylhydrochinon-methyltransfe- rase aus Synechocystis spec. PCC 6803.
25 Die Klonierung und Identifizierung der 2-Methyl-6-phytylhydro- chinon-methyltransferase aus Synechocystis spec. PCC 6803 erfolgte folgendermaßen:
Unter Verwendung eines in S-Adenosyl-L-Methionin Methyltransfera- 30 sen konservierten Sequenzmotivs, welches für die Bindung des
S-Adenosyl-L-Methionin (SAM) verantwortlich ist (C.P. Joshi und V.L. Chiang. PMB. 37: 663-374, 1998), wurde eine genomische DNA Datenbank von Synechocystis spec. PCC 6803 durchmustert (Kaneko et al., DNA Res . 34:109-136, 1996). Die bei der Durchmusterung 35 identifizierten hypothetischen Proteine, welche über das SAM-Bin- demotiv verfügten, wurden mit den Primärsequenzen der Synechocystis spec. PCC 6803 γ-Tocopherol-methyltransferase (bezeichnet als slr0089) sowie der Arabidopsis thaliana γ-Tocopherol-methyltrans- ferase (David Shintani und Dean DellaPenna. Sience. 40 282:2098-2100,1998) verglichen.
Dabei konnte ein hypothetisches Protein identifiziert werden (bezeichnet sll0418 SEQ.-ID Nr. 2), welches geringe Übereinstimmung in der Aminosäuresequenz mit den γ-Tocopherol-methyltransferasen 45 aus Synechocystis spec. PCC 6803 und Arabidopsis thaliana aufwies (36% bzw. 28% Identität). o
Weitere Untersuchungen der Primärsequenz des hypothetischen Proteins sll0418 belegten das Vorkommen einer putativen prokaryonti- schen Signalsequenz innerhalb der ersten 20 Aminosäuren (PSIGNAL, PC/GENE™ IntelliGenetics, Ine ©1991) . Eine solche Sequenz konnte ebenfalls in der Synechocystis spec. PCC 6803 γ-Tocopherolmethyl- transferase (slr0089) identifiziert werden (D. Shintani und D. DellaPenna. Sience. 282:2098-2100,1998) und deutet auf eine identische Lokalisation der beiden Proteine hin.
Das vorhergesagte Molekulargewicht des unprozessierten Proteins beträgt 34,9 kDa und liegt damit in einem Bereich der auch für die Synechocystis spec. PCC 6803 γ-Tocopherolmethyltransferase (David Shintani und Dean DellaPenna, Sience. 282:2098-2100,1998) und der aus Paprikafrüchten gereinigten γ-Tocopherolmethyltrans- ferase (d'Harlingue and Camara, Plastid enzymes of terpenoid bio- synthesis: Purification of γ-Tocopherol Methyltransferase from Capsicum Chromoplasts . Journal of Biological Chemistry, Vol. 269 No.28, 15200-152003,1985) ermittelt wurde.
Unter Berücksichtigung der Fakten, schlußfolgerten wir, daß es sich bei dem hypothetischen Protein sll0418 um eine Tocopherolme- thyltransferase handeln könnte.
Beispiel 2
Amplifikation und Klonierung der 2-Methyl-6-phytylhydrochinon-me- thyltransferase aus Synechocystis spec. PCC 6803
Die DNA kodierend für den ORF (open reading frame) sll0418 wurde mittels polymerase chain reaction (PCR) aus Synechocystis spec. PCC 6803 gemäß der Methode nach Crispin A. Howitt (BioTechniques 21 : 32-34, July 1996) unter Verwendung eines sense spezifischen Primers (sll04185' Seq. Nr. 5) und eines antisense spezifischen Primers (sll04183' Seq. Nr. 6) amplifiziert .
Die PCR Bedingungen waren die folgenden:
Die PCR erfolgte in einem 50μl Reaktionsansatz in dem enthalten war:
-5μl einer Synechocystis spec. PCC 6803 Zellsuspension -0,2 mM dATP, dTTP, dGTP, dCTP -1,5 mM Mg(0Ac)2 -5μg Rinderserum-Albumin -40pmol S1104185' -40pmol S1104183' -15μl 3,3x rTth DNA Polymerase XLPuffer (PE Applied Biosystems) -5U rTth DNA Polymerase XL (PE Applied Biosystems)
Die PCR wurde unter folgenden Zyklusbedingungen durchgeführt :
Schritt 1: 5 Minuten 94°C (Denaturierung)
Schritt 2 : 3 Sekunden 94°C
Schritt 3 : 2 Minuten 58°C (Annealing)
Schritt 4: 2 Minuten 72°C (Elongation)
40 Wiederholungen der Schritte 2-4
Schritt 5: 10 Minuten 72°C (Post-Elongation)
Schritt 6: 4°C (Warteschleife)
10
Das Amplikon wurde unter Verwendung von Standardmethoden in den PCR Klonierungsvektor pGEM-T (Promega) kloniert. Die Identität des erzeugten Amplikons wurde durch Sequenzierung unter Verwendung des M13F (-40) Primers bestätigt.
15
Beispiel 3
Erzeugung einer sll0418 Knock out Mutante
20 Ein DNA Konstrukt zur Erzeugung einer Deletionsmutante des ORF sll0418 in Synechocystis spec. PCC 6803 wurde unter Anwendung von Standard Klonierungstechniken erzeugt .
Der Vektor pGEM-T/sll0418 wurde unter Verwendung des Restrikti-
25 onsenzyms Ball verdaut. Das Vorhandensein von zwei Ball Schnittstellen innerhalb der sll0418 Sequenz (Position Bp 109 bzw Bp 202) hatte den Verlust eines 93 Bp umfassenden internen Fragmentes zur Folge. In die Ball Schnittstellen des sll0418 ORF wurde die Aminoglycosid-3 'Phosphotransferase des Transposons Tn903 klo-
30 niert. Dazu wurde das Tn903 als EcoRl Fragment aus dem Vektor pUC4k (Vieira, J und Messing, J Gene: 19, 259-268, 1982) isoliert, die überstehenden Enden des Restriktionsverdaus nach Standardmethoden in glatte Enden überführt und in den Ball geschnittenen Vektor pGEM-T/sll0418 ligiert. Der Ligationsansatz wurde zur
35 Transformation von E.coli Xll blue Zellen verwendet. Transformanden wurden durch Verwendung von Kanamycin und Ampicillin selek- tioniert. Ein rekombinantes Plasmid (pGEM-T/sll0418 : : tn903 ) wurde isoliert und zur Transformation von Synechocystis spec. PCC 6803 gemäß der Methode nach Williams (Methods Enzymol. 167:776-778,
40 1987) eingesetzt.
Synechocystis spec. PCC 6803 Transformanden wurden selektioniert auf Kanamycin haltigem (kan) BG-11 Festmedium (Castenholz, Methods in Enzymology, Seite 68-93, 1988) bei 28°C und 30μmol 45 Photonen x (m2x s)_i . Vier unabhängige Knock out Mutanten konnten nach fünf Selektionsrunden (Passagen von Einzelkolonien auf frisches BG-llkn Medium) erzeugt werden.
Der vollständige Verlust des sll0418 Endogens bzw. der Austausch gegen die rekombinante S110418: : tn903 DNA, wurde durch PCR Analysen bestätigt.
Beispiel 4
Vergleich der Tocopherolproduktion in Synechocystis spec. PCC 6803 Wildtypzellen und den erzeugten Knock out Mutanten des ORF sll0418.
Die auf den BG-llkan Agarmedium kultivierten Zellen der vier un- abhängigen Synechocystis spec. PCC 6803 Knock out Mutanten des ORF sll0418 sowie untransformierte Wildtypzellen wurden zum Animpfen von Flüssigkulturen verwendet. Diese Kulturen wurden bei 28°C und 30μmol Photonen x (m2x s)_1 (30μE) für ca. 3 Tage kultiviert. Nach Bestimmung der OD73o der einzelnen Kulturen, wurde die OD30 aller Kulturen durch entsprechende Verdünnungen mit BG-11 (Wildtypen) bzw. BG-llkan (Mutanten) synchronisiert. Diese auf Zelldichte synchronisierten Kulturen wurden zum Animpfen von drei Kulturen pro Mutante bzw. der Wildtypkontrollen verwendet. Die biochemischen Analysen konnten somit unter Verwendung von jeweils drei unabhängig gewachsenen Kulturen einer Mutante und der entsprechenden Wildtypen durchgeführt werden. Die Kulturen wurden bis zu einer optischen Dichte von OD3o=0,3 angezogen. Das Medium der Zellkultur wurde durch zweimalige Zentrifugation bei 14000 rpm in einer Eppendorf Tischzentrifuge entfernt. Der daran anschließende Aufschluß der Zellen erfolgte durch viermalige Inkubation im EppendorfSchüttler bei 30°C, lOOOrpm in 100% Methanol für 15 Minuten, wobei die jeweils erhaltenen Überstände vereinigt wurden. Weitere Inkubationsschritte ergaben keine weitere Freisetzung von Tocopherolen oder Tocotrienolen.
Um Oxidation zu vermeiden, wurden die erhaltenen Extrakte direkt nach der Extraktion mit Hilfe einer Waters Allience 2690 HPLC-An- lage analysiert. Tocopherole und Tocotrienole wurden über eine reverse Phase Säule ( ProntoSil 200-3-C30, Bischoff) mit einer mo- bilen Phase von 100% Methanol getrennt und anhand von Standards (Merck) identifiziert. Als Detektionssystem diente die Fluoreszenz der Substanzen (Anregung 295nm, Emmision 320 nm) , die mit Hilfe eines Jasco Fluoreszensdetektors FP 920 nachgewiesen wurde. In den Synecchocystis spec. PCC 6803 knock out Mutanten des ORF sll0418 konnten keine Tocopherole und Tocotrienole gefunden werden. Tocopherole und Tocotrienole wurden jedoch in den Synecchocystis spec. PCC 6803 Wildtypzellen gemessen.
Der Verlust der Fähigkeit zur Produktion von Tocopherolen und Tocotrienolen innerhalb der knock out Mutanten des ORF sll0418 im Vergleich zu den Synechocystis spec. PCC 6803 Wildtypzellen zeigt, daß das Gen sll0418 für eine 2-Methyl-6-phytylhydrochinon- methyltransferase kodiert.
Beispiel 5
Funktionelle Charakterisierung der 2-Methyl-6-phytylhydrochinon- methyltransferase aus Synechocystis spec. PCC 6803 durch hetero- loge Expression in E.coli.
Das hypothetische Protein sll0418 aus Synechocystis spec. PCC 6803 konnte durch funktionelle Expression in E.coli als 2-Methyl-6-phytylhydrochinon-methyltransferase identifiziert werden.
Das aus Synechocystis spec. PCC 6803 amplifizierte Gen sll0418 wurde im korrekten Leserahmen in den Expressionsvektor pQE-30 (Qiagen) subkloniert. Die zur Amplifikation des OFR sll0418 aus Synechocystis spec. PCC 6803 verwendeten Primer sll04185' bzw. sll04183' (Sequenz ID Nr. 5 und 6) waren so konstruiert, daß an das 5 ' Ende und das 3 ' Ende des Amplikons BamHl Restriktionsschnittstellen addiert wurden, siehe Sequenz ID Nr. 3. Das sll0418 Fragment wurde unter Verwendung dieser flankierenden BamHl Restriktionschnittstellen aus dem rekombinanten Plasmid pGEM-T/sll0418 isoliert und unter Anwendung von Standardmethoden in einen BamHl geschnittenen pQE-30 ligiert. Der Ligationsansatz wurde zur Transformation von M15 E.coli Zellen verwendet und Kanamycin und Ampicillin resistente Transformanden wurden analysiert. Die Kanamycin Resistenz wird durch das in den M15 Zellen enthaltene pREP-4 Plasmid vermittelt. Ein rekombinantes Plasmid (pQE-30/sll0418) welches das sll0418 Fragment in der richtigen Orientierung trug, wurde isoliert. Die Identität und Orientie- rung des Inserts wurde durch Sequenzierung bestätigt.
Das rekombinante Plasmid pQE-30/sll0418 wurde zur Transformation von M15 E.coli Zellen verwendet, um rekombinantes sll0418 Protein zu erzeugen. Unter Verwendung einer aus der Transformation hervorgegangenen Kolonie wurde eine Übernachtkultur in Luria
Broth Medium mit 200μg/ml Ampicillin (Amp) und 50μg/ml Kanamycin (Kan) angeimpft. Ausgehend von dieser Kultur wurde am nächsten Morgen eine 100ml Luria Broth Kultur (Amp/Kan) angeimpft. Diese Kultur wurde bei 28°C auf einem Schüttelinkubator bis zum erreichen einer OD6oo: 0, 35-0, 4 inkubiert. Anschließend wurde die Produktion des rekombinanten Proteins durch Zugabe von 0 , 4 mM Iso- propyl-ß-D-thiogalaktopyranosid (IPTG) induziert. Die Kultur wurde für weitere 3 Stunden bei 28°C geschüttelt und die Zellen anschließend durch Zentrifugation bei 8000g pelletiert.
Das Pellet wurde in 600μl Lysispuffer (ca. 1-1,5 ml /g Pellet Naßgewicht, 10 mM HEPES KOH pH 7,8, 5 mM Dithiothreitol (DTT) , 0,24 M Sorbitol ) resuspendiert. Anschließend wurde PMSF ( Phe- nylmethylsulfonat ) zu einer Endkonzentration von 0,15 mM beigefügt und der Ansatz für 10 Minuten auf Eis gestellt. Der Aufschluß der Zellen erfolgte durch einen 10 Sekunden Ultraschall- Puls unter Verwendung eines Ultraschallstabes. Nach Zugabe von Triton X100 (Endkonzentration 0,1%) wurde die Zellsuspension für 30 Minuten auf Eis inkubiert. Der Ansatz wurde anschließend für 30 Minuten bei 25000xg abzentrifugiert und der Überstand zum Assay eingesetzt.
Die Aktivitätsbestimmung der 2-Methyl-6-phytylhydrochinon-methyl- transferase erfolgt durch Nachweis des radioaktiv markierten Reaktionsproduktes 2 , 3-Dimethyl-6-phytylhydrochinon.
Dazu wurden 135μl des Enzyms (ca.300-600μg) zusammen mit 20μl Substrat (2-Methyl-6-phytylhydrochinon) und 15μl (0,46 mM SAM 14C) Methylgruppendonor in folgendem Reaktionspuffer : 200μl (125mM) Tricine-NaOH pH 7,6, lOOμl (1,25 mM) Sorbitol, lOμl (50mM) MgCl2 und 20μl (250mM) Ascorbat für 4 Stunden bei 25°C im Dunkeln inkubiert.
Das Abstoppen der Reaktion erfolgte durch Zugabe von 750μl Chloroform/Methanol (1:2) + 150μl 0,9% NaCl. Der gemischte Ansatz wurde kurz zentrifugiert und die obere Phase wurde verworfen. Die untere Phase wird in ein neues Reaktionsgefäß überführt und unter Stickstoff eingedampft. Die Rückstände wurden in 20μl Ether aufgenommen und auf eine Dünnschicht-Platte zur chromatographischen Trennung der Substanzen aufgetragen (feste Phase: HPTLC-Platten: Kieselgel 60 F254 (Merk) , flüssige Phase: Toluol) . Der Nachweis des radioaktiv markierten Reaktionsproduktes erfolgt durch Verwendung eines Phosphoimagers .
Diese Experimente bestätigten, daß es sich bei dem durch das Gen S110418 (SEQ-ID Nr.l) aus Synechocystis spec. PCC 6803 kodierte Protein um eine 2-Methyl-6-phytylhydrochinon-methyltransferase handelt, da es die enzymatische Aktivität zur Umwandlung von 2-Methyl-6-phytylhydrochinon in 2 , 3-Dimethyl-6-phytylhydrochinon besitzt .
Abbildung 2 zeigt einen Sequenzvergleich auf Aminosäureebene zwi- sehen den γ-Tocopherolmethyltransferasen aus Synechocystis spec. PCC Synechocystis spec. PCC 6803 (slr0089) und A. thaliana (arat t) mit der 2-Methyl-6-phytylhydrochinon-methyltransferase (sll04189) aus Synechocystis spec. PCC 6803. Die Übereinstimmung mit den γ-Tocopherolmethyltransferasen aus Synechocystis spec. PCC 6803 und Arabisopsis thaliana beträgt 36 bzw. 28 % Identität.
Beispiel 6
Substratspezifität der 2-Methyl-6-phytylhydrochinon-methyltrans- ferase
Enzymatische Untersuchungen wie in Beispiel 5 durchgeführt belegen, daß das Enzym MPMT - kodiert durch das Gen sll0418 (SEQ-ID Nr. 1) aus Synechocystis spec. PCC 6803 - 2-Methyl-6-phytylhydro- chinon in 2, 3-Dimethyl-6-phytylhydrochinon umwandelt.
Zusätzlich besitzt das Enzym MPMT eine 2-Methyl-6-geranylgeranyl- hydrochinon-methyltransferase Aktivität, wohingegen eine γ-Toco- pherolmethyltransferase Aktivität nicht nachgewiesen werden konnte. Somit ist belegt, daß das Enzym 2-Methyl-6-phytylhydro- chinon-methyltransferase an der Biosynthese der Tocotrienole beteiligt ist, da es 2-Methyl-6-geranylgeranylhydrochinon zu 2 , 3-Dimethyl-6-geranylgeranyl-hydrochinon umwandelt . Dies zeigt deutlich die Verschiedenheit der Enzymaktivität der 2-Methyl-6-phytylhydrochinon-methyltransferase im Vergleich zur γ-Tocopherolmethyltransferase .
Beispiel 7
Herstellung von Expressionskassetten enthaltend das MPMT-Gen
Transgene Pflanzen wurden erzeugt, die die 2-Methyl-6-phytylhy- drochinon-methyltransferase aus Synechocystis spec. PCC6803 zum einen unter Kontrolle des konstitutiven 35S-Promotor des CaMV (Blumenkohlmosaikvirus) (Franck et al . , Cell 21: 285-294, 1980) und zum anderen unter Kontrolle des samenspezifischen Promotors des Legumin Gens aus Vicia faba (Kafatos et al . , Nuc . Acid. Res.,14(6): 2707-2720, 1986) exprimieren. Die Grundlage des zur konstitutiven Expression der 2-Methyl-6-phytylhydrochinon-methyl- transferase aus Synechocystis spec. PCC 6803 erzeugten Plasmides war der pBinAR-TkTp-9 (Ralf Badur , Dissertation Universität Göttingen, 1998) . Dieser Vektor ist ein Derivat des pBinAR (Höfgen und Willmitzer, Plant Sei. 66: 221-230, 1990) und enthält den 35S-Promotor des CaMV (Blumenkohlmosaikvirus) (Franck et al., 1980) , das Ter inationssignal des Octopin-Synthase Gens (Gielen et al., EMBO J. 3: 835-846, 1984) sowie die für das Transitpeptid der plastidären Nicotiana tabacum Transketolase kodierende DNA Sequenz (Ralf Badur, Dissertation Universität Göttingen, 1998) . Die unter Berücksichtigung des korrekten Leserasters erfolgte Klonierung der 2-Methyl-6-phytylhydrochinon-methyltransferase aus Synechocystis spec. PCC6803 in diesen Vektor, erzeugt eine Translationsfusion der 2-Methyl-6-phytylhydrochinon-methyltrans- ferase mit dem plastidären Transitpeptid. Dadurch erfolgt ein Transport des Transgens in die Piastiden.
Zur Erstellung dieses Plasmides wurde das Gen sll0418 unter Verwendung der flankierenden BamHl Restriktionsschnittstellen aus dem Plasmid pGEM-T/sll0418 isoliert. Dieses Fragment wurde unter Anwendung von Standardmethoden in einen BamHl geschnittenen pBi- nAR-TkTp-9 ligiert (siehe Abbildung 3) . Dieses Plasmid (pBinAR- TkTp-9/sll0418) wurde zur Erzeugung transgener Arabidopsis tha- liana, Brassica napus und Nicotiana tabacum verwendet. Fragment A (529 bp) in Abbildung 3 beinhaltet den 35S-Promotor des CaMV (Nukleotide 6909 bis 7437 des Blumenkohlmosaikvirus) , Fragment B (245bp) kodiert für das Transitpeptid der Nicotiana tabacum Transketolase, Fragment C (977Bp) kodiert ORF sll0418 aus Syn- echoeystis spec. PCC 6803, Fragment D (219Bp) kodiert für das Terminationssignal des Octopin-Synthase Gens.
Zur Erzeugung eines Plasmides, welches die samenspezifische Expression der 2-Methyl-6-phytylhydrochinon-methyltransferase aus Synechocystis spec. PCC 6803 in Pflanzen ermöglicht, wurde der samenspezifiche Promotor des Legumin B4 Gens (Kafatos et al . , Nuc. Acid. Res. ,14 (6) :2707-2720, 1986) verwendet. Aus dem Plasmid pCR-Script/lePOCS wurde das 2,7 Kb Fragment des Legumin B4 Gen Promotors unter Verwendung der den Promotor 5 ' flankierenden EcoRl und der 3' flankierenden Kpnl Schnittstellen isoliert. Das Plasmid pBinAR-TkTp-9/sll0418 wurde ebenfalls mit den Restriktionsenzymen EcoRl und Kpnl behandelt. Dies hatte zur Folge, daß der 35S-Promotor des CaMV aus diesem Plasmid herausgetrennt wurde. Der Promotor des Legumin Gens wurde anschließend als EcoRl/Kpnl Fragment in diesen Vektor kloniert, wodurch ein Plasmid erzeugt wurde, welches die Expression des Gen sll0418 unter die Kontrolle dieses samenspezifischen Promotors stellte, siehe Abbildung 4. Dieses Plasmid (pBinARleP-TkTp-9/sll0418) wurde zur Erzeugung transgener Arabidopsis thaliana, Brassica napus und Nicotiana tabacum Pflanzen verwendet. Fragment A (2700 bp) in Abbildung 4 beinhaltet den Promotor des Legumin B4 Gens aus Vicia faba, Fragment B (245bp) kodiert für das Transitpeptid der Nicotina tabacum Transketolase, Fragment C (977Bp) kodiert für das ORF sll0418 aus Synechocystis spec. PCC 6803 , Fragment D (219Bp) für das Terminationssignal des Octopin- Synthase Gens .
Beispiel 8
Herstellung von Expressionskassetten enthaltend einen Deletions- klon des MPMT-Gens
Auf Grundlage einer Computeranalyse wurde in der Primärsequenz des ORF sll0418 ein putatives prokaryontisches Sekretionssignal identifiziert. Um sicherzustellen, daß dieses bei der Expression in Pflanzen keinen negativen Einfluß auf den Import des Proteins in die Piastiden nimmt, wurde ein Derivat der Sequenz des sll0418 erzeugt, bei dem das putative Sekretionssignal deletiert wurde (Sequenz-ID Nr. 7) . Diese Deletion wurde unter Anwendung der PCR Technologie durchgeführt. Durch die dabei verwendeten Primer (sll0418DSp5' , Sequenz-ID Nr. 9 und sll0418DSp3 ', Sequenz-ID Nr. 10) wurde an das 5 'Ende der Sequenz eine EcoRV Restriktionsschnittstelle und an das 3 'Ende eine Sall Restriktionsschnittstelle addiert, durch die eine gerichtete Klonierung in den Vek- tor pBinAR-TkTp-9 ermöglicht wurde. Das entstandene Plasmid pBi- nAR-TkTp-9/sll0418ΔSP ist in Abbildung 5 beschrieben. Fragment A (529 bp) in Abbildung 5 beinhaltet den 35S-Promotor des CaMV (Nukleotide 6909 bis 7437 des Blumenkohlmosaikvirus) , Fragment B (245bp) Fragment kodiert für das Transitpeptid der Nicotiana tabacum Transketolase, Fragment C (930Bp) ORF sll0418ΔSP aus Synechocystis spec. PCC 6803 Fragment D (219Bp) für das Terminationssignal des Octopin-Synthase Gens.
Zur Erzeugung eines Plasmides, welches die samenspezifische Ex- pression des Deletionsklons der 2-Methyl-6-phytylhydrochinon-me- thyltransferase aus Synechocystis spec. PCC6803 in Pflanzen ermöglicht, wurde ebenfalls der bereits beschriebene samenspezifi- che Promotor des Legumin B4 Gens (Kafatos et al . , Nuc . Acid. Res. ,14(6) :2707-2720, 1986) verwendet. Aus dem Plasmid PCR- Script/lePOCS wurde das 2,7 Kb Fragment des Legumin B4 Gen Promotors unter Verwendung der den Promotor 5 ' flankierenden EcoRl und der 3 ' flankierenden Kpnl Schnittstellen isoliert . Das Plasmid pBinAR-TkTp-9/sll0418ΔSP wurde ebenfalls mit den Restriktionsenzymen EcoRl und Kpnl behandelt. Dies hatte zur Folge, daß der 35S-Promotor des CaMV aus diesem Plasmid herausgetrennt wurde. Der Promotor des Legumin Gens wurde anschließend als EcoRl/Kpnl Fragment in diesen Vektor kloniert, wodurch ein WO 01/04330 „ . PCT/EPOO/05862
24
Plasmid erzeugt wurde, welches die Expression des Deletionsklons des Gen sll0418 unter die Kontrolle dieses samenspezifischen Promotors stellte, siehe Abbildung 6. Fragment A (2700 bp) in Abbildung 6 beinhaltet den Promotor des Legumin B4 Gens aus Vicia 5 faba, Fragment B (245bp) Fragment kodiert für das Transitpeptid der Nicotiana tabacum Transketolase, Fragment C (930Bp) ORF S110418ΔSP aus Synechocystis spec. PCC 6803 Fragment D (219Bp) für das Terminationssignal des Octopin-Synthase Gens.
10 Dieses Plasmid (pBinARleP-TkTp-9/sll0418ΔSP) wurde zur Erzeugung transgener Arabidopsis thaliana, Brassica napus und Nicotiana tabacum Pflanzen verwendet .
Auch durch Expression der DNA-Sequenz SEQ-ID Nr. 7 in transgenen 15 Pflanzen wurde eine Steigerung des Gehaltes an Tocopherol und Tocotrienol gemessen.
Beispiel 9
20 Herstellung transgener Arabidopsis thaliana Pflanzen
Wildtyp Arabidopsis thaliana Pflanzen (Columbia) wurden mit dem Agrobacterium tumefaciens Stamm (EHA105) auf Grundlage einer modifizierten Vacuum Infiltrationsmethode transformiert (Steve
25 Clough und Andrew Bent, Floral dip: a simplified method for Agrobacterium mediated transformation of Arabidopsis thaliana. Plant J. 16(6) :735-43, 1998; Bechtold, N. , Ellis, J. und Pelltier, G. , in: Planta Agrobacterium-mediated gene transfer by infiltration of adult Arabidopsis thaliana plants. CRAcad Sei Paris, 1993.
30 1144(2) : 204-212) . Die verwendeten Agrobacterium tumefaciens Zellen waren im Vorfeld mit den Plasmiden pBinARleP-TkTp-9/sll0418 bzw. pBinAR-TkTp-9/sll0418 (Abbildung 3 und 4) transformiert worden.
35 Samen der Primärtransformanden wurden auf Grundlage der Antibiotikaresistenz selektioniert . Antibiotika resistente Keimlinge wurden in Erde gepflanzt und als vollentwickelte Pflanzen zur biochemischen Analyse verwendet.
40 Beispiel 10
Herstellung transgener Brassica napus Pflanzen
Die Herstellung transgener Raps Pflanzen orientierte sich an 5 einem Protokoll von Bade, J.B. und Damm,B. (in Gene Transfer to Plants, Potrykus, I. und Spangenberg, G. , eds , Springer Lab Ma- nual, Springer Verlag, 1995, 30-38), in welchem auch die Zusammensetzung der verwendeten Medien und Puffer angegeben ist.
Die Transformationen erfolgten mit dem Agrobacterium tumefaciens 5 Stamm EHA105. Zur Transformation wurden die Plasmide pBinARleP- TkTp-9/sll0418 bzw. pBinAR-TkTp-9/sll0418 verwendet. Samen von Brassica napus var. Westar wurden mit 70% Ethanol (v/v) oberflächensteril gemacht, 10 Minuten bei 55°C in Wasser gewaschen, in l%iger Hypochlorit-Lösung (25% v/v Teepol, 0,1% v/v Tween 20) für
10 20 Minuten inkubiert und sechsmal mit sterilem Wasser für jeweils 20 Minuten gewaschen. Die Samen wurden drei Tage auf Filterpapier getrocknet und 10-15 Samen in einem Glaskolben mit 15 ml Keimungsmedium zur Keimung gebracht. Von mehreren Keimlingen (ca. 10 cm groß) wurden die Wurzeln und Apices entfernt und die verblei-
15 benden Hypokotyle in ca. 6 mm lange Stücke geschnitten. Die so gewonnenen ca. 600 Explantate wurden 30 Minuten mit 50 ml Basal- mediu gewaschen und in einen 300 ml Kolben überführt. Nach Zugabe von 100 ml Kallusinduktions edium wurden die Kulturen für 24 Stunden bei 100 U/min inkubiert. 0
Vom Agrobacterium Stamm wurde eine Übernachtkultur bei 29°C in Lu- ria Broth-Medium mit Kanamycin (20mg/l) angesetzt, davon 2 ml in 50 ml Luria Broth-Medium ohne Kanamycin für 4 Stunden bei 29°C bis zu einer OD600 v°n 0,4-0,5 inkubiert. Nach der Pelletierung der 5 Kultur bei 2000 U/min für 25 min wurde das Zellpellet in 25 ml Basalmedium resuspendiert . Die Konzentration der Bakterien in der Lösung wurde durch Zugabe von weiterem Basalmedium auf eine ODeoo von 0,3 eingestellt.
0 Aus den Raps-Explanten wurde das Kallus-Induktionsmedium mit sterilen Pipetten entfernt, 50 ml Agrobacterium-Lösung hinzugefügt, vorsichtig gemischt und für 20 min inkubiert. Die Agrobacterien- Suspension wurde entfernt, die Raps-Explante für 1 min mit 50 ml Kallus-Induktionsmedium gewaschen und anschließend 100 ml Kallus- 5 Induktionsmedium hinzugefügt. Die Co-Kultivierung wurde für 24 h auf einem Rotationsschüttler bei 100 U/min durchgeführt. Die Co- Kultivierung wurde durch Wegnahme des Kallus-Induktionsmediums gestoppt und die Explante zweimal für jeweils 1 min mit 25 ml und zweimal für 60 min mit jeweils 100 ml Waschmedium bei 100 U/min 0 gewaschen. Das Waschmedium mit den Explanten wurde in 15 cm Pe- trischalen überführt und das Medium mit sterilen Pipetten entfernt .
Zur Regeneration wurden jeweils 20-30 Explante in 90 mm Petri- 5 schalen überführt, welche 25 ml Sproß-Induktionsmedium mit Kanamycin enthielten. Die Petrischalen wurden mit 2 Lagen Leukopor verschlossen und bei 25 °C und 2000 lux bei Photoperioden von 16 Stunden Licht/ 8 Stunden Dunkelheit inkubiert. Alle 12 Tage wurden die sich entwickelnden Kalli auf frische Petrischalen mit Sproß-Induktionsmedium umgesetzt . Alle weiteren Schritte zur Regeneration ganzer Pflanzen wurden wie von Bade, J.B und Damm, B. (in: Gene Transfer to Plants, Potrykus, I. und Spangenberg, G. , eds, Springer Lab Manual, Springer Verlag, 1995, 30-38) beschrieben durchgeführt.
Beispiel 11
Herstellung transgener Nicotiana tabacum Pflanzen
Zehn ml YEB-Medium mit Antibiotikum (5 g/1 Rinder-Extrakt, 1 g/1 Hefe-Extrakt, 5 g/1 Pepton, 5 g/1 Saccharose und 2 mM MgSo4) wur- den mit einer Kolonie von Agrobacterium tumefaciens beimpft und über Nacht bei 28°C kultiviert. Die Zellen wurden 20 min bei 4°C, 3500 U/min in einer Tischzentrifuge pelletiert und danach in frischem YEB-Medium ohne Antibiotika unter sterilen Bedingungen resuspendiert. Die Zellsuspension wurde für die Transformation eingesetzt.
Die Wildtyp-Pflanzen aus Sterilkultur wurden durch vegetative Re- plikation erhalten. Dazu wurde nur die Spitze der Pflanze abgeschnitten und auf frisches 2MS-Medium in ein steriles Einweckglas überführt . Vom Rest der Pflanze wurden die Haare auf der Blattoberseite und die Mittelrippen der Blätter entfernt. Die Blätter wurden mit einer Rasierklinge in etwa 1 cm2 große Stücke geschnitten. Die Agrobakterienkultur wurde in eine kleine Petrischale überführt (Durchmesser 2 cm) . Die Blattstücke wurden kurz durch die Lösung gezogen und mit der Blattunterseite auf 2MS-Medium in Petrischalen (Durchmesser 9 cm) gelegt, so daß sie das Medium berührten. Nach zwei Tagen im Dunkeln bei 25°C wurden die Explantate auf Platten mit Kallusinduktionsmedium überführt und in der Klimakammer auf 28°C temperiert. Das Medium mußte alle 7-10 Tage ge- wechselt werden. Sobald sich Kalli bildeten, wurden die Explantate in sterile Einweckgläser auf Sproßinduktionsmedium mit Cla- foran (siehe oben) überführt. Nach etwa einem Monat trat Organo- genese ein und die gebildeten Sprossen konnten abgeschnitten werden. Die Kultivierung der Sprosse wurde auf 2MS-Medium mit Clafo- ran und Selektionsmarker durchgeführt. Sobald sich ein kräftiger Wurzelballen gebildet hatte, konnte die Pflanzen in Pikiererde getopft werden.
Beispiel 12
Charakterisierung der transgenen Pflanzen WO 01/04330 Λ„ PCT/EPO0/O5862
27
Um zu bestätigen, daß durch die Expression der 2-Methyl-6-phytyl- hydrochinon-methyltransferase aus Synechocystis spec. PCC 6803 die Vitamin E Biosynthese in den transgenen Pflanzen gesteigert wird, wurden die Tocopherol- und Tocotrienol-Gehalte in Blätter und Samen der mit den Konstrukten pBinARleP-TkTp-9/sll0418 bzw. pBinAR-TkTp-9/sll0418 Pflanzen (Arabidopsis thaliana, Brassica napus und Nicotiana tabacum) analysiert . Dazu wurden die transgenen Pflanzen im Gewächshaus kultiviert und Pflanzen die das Gen kodierend für die 2-Methyl-6-phytylhydrochinon-methyltransferase aus Synechocystis spec. PCC 6803 exprimieren auf Northern-Ebene analysiert . In Blättern und Samen dieser Pflanzen wurde der Toco- pherolgehalt und der Tocotrienolgehalt ermittelt. In allen Fällen war die Tocopherol- bzw. Tocotrienol-Konzentration in transgenen Pflanzen, die zusätzlich eine DNA-Sequenz SEQ-ID Nr. 1 oder SEQ-ID Nr. 7 exprimieren, im Vergleich zu nicht transformierten Pflanzen erhöht.

Claims

Patentansprüche
1. DNA-Sequenz SEQ-ID Nr. 1 oder SEQ-ID Nr. 7 und mit dieser hy- bridisierende oder zur Gesamtsequenz oder zu Teilsequenzen homologen DNA-Sequenz kodierend für eine 2-Methyl-6-phytylhy- drochinon-methyltransferase aus Synechocystis.
2. Verwendung von DNA-Sequenzen codierend für eine 2-Methyl-6-phytylhydrochinon-methyltransferase zur Herstellung von Pflanzen und photosynthetisch aktiven Organismen mit erhöhtem Gehalt an Tocopherolen und Tocotrienolen.
3. Verwendung einer DNA-Sequenz SEQ-ID Nr. 1 oder SEQ-ID Nr. 7 oder einer mit dieser hybridisierenden DNA-Sequenz kodierend für eine 2-Methyl-6-phytylhydrochinon-methyltransferase zur Herstellung von Pflanzen und photosynthetisch aktiven Organismen mit erhöhtem Gehalt an Tocopherolen und Tocotrienolen.
4. Verfahren zur Herstellung von Pflanzen und photosynthetisch aktiven Organismen mit erhöhtem Gehalt an Tocopherolen und Tocotrienolen dadurch gekennzeichnet, daß eine DNA-Sequenz SEQ-ID Nr. 1 oder SEQ-ID Nr. 7 oder eine mit dieser hybridisierende oder zur Gesamtsequenz oder zu Teilsequenzen homolo- gen DNA-Sequenz in Pflanzen und photosynthetisch aktiven Organismen exprimiert wird.
5. Verfahren zur Transformation einer Pflanze dadurch gekennzeichnet, daß man eine Expressionskassette enthaltend einen Promotor, eine Signalsequenz, eine DNA-Sequenz SEQ-ID Nr. 1 oder SEQ-ID Nr. 7 und einen Terminator oder eine mit dieser hybridisierende DNA-Sequenz in eine Pflanzenzelle, in Kallus- gewebe, eine ganze Pflanze oder Protoplasten von Pflanzenzellen einbringt .
Verfahren zur Transformation von Pflanzen gemäß Anspruch 5, dadurch gekennzeichnet, daß die Transformation mit Hilfe des Stammes Agrobacterium tumefaciens, der Elektroporation oder der particle bombardment Methode erfolgt.
Pflanze mit erhöhtem Gehalt an Tocopherolen und Tocotrienolen enthaltend eine Expressionskassette gemäß Anspruch 5.
Zeichn.
8. Pflanze nach Anspruch 7, ausgewählt aus der Gruppe Soja, Ca- nola, Gerste, Hafer, Weizen, Raps, Mais, Roggen, Tagetes oder Sonnenblume .
9. Verwendung der DNA-Sequenz SEQ-ID Nr. 1 oder SEQ-ID Nr. 7 oder einer mit dieser hybridisierende DNA-Sequenz gemäß Anspruch 1 zur Herstellung eines Testsystems zur Identifizierung von Inhibitoren der 2-Methyl-6-phytylhydrochinon-methyl- transferase.
10. Testsystem basierend auf der Expression der DNA-Sequenz
SEQ-ID Nr. 1 oder SEQ-ID Nr. 7 oder einer mit dieser hybridisierende DNA-Sequenz gemäß Anspruch 1 zur Identifizierung von Inhibitoren der 2-Methyl-6-phytylhydrochinonmethyltransfe- rase.
PCT/EP2000/005862 1999-07-09 2000-06-23 Identifizierung und überexpression einer dna-sequenz kodierend für eine 2-methyl-6-phytylhydrochinon-methyltransferase in pflanzen WO2001004330A1 (de)

Priority Applications (3)

Application Number Priority Date Filing Date Title
AU56858/00A AU5685800A (en) 1999-07-09 2000-06-23 Identification and overexpression of a dna sequence coding for 2-methyl-6-phytylhydroquinone-methyltransferase in plants
CA002378657A CA2378657A1 (en) 1999-07-09 2000-06-23 Identification and overexpression of a dna sequence coding for 2-methyl-6-phytylhydroquinone-methyltransferase in plants
EP00942130A EP1194577A1 (de) 1999-07-09 2000-06-23 Indentifizierung und ueberexpression einer dna-sequenz kodierend fuer eine 2-methyl-6-phytylhydrochinon-methyltransferase in pflanzen

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
DE19931834.4 1999-07-09
DE1999131834 DE19931834A1 (de) 1999-07-09 1999-07-09 Identifizierung und Überexpression einer DNA-Sequenz codierend für eine 2-Methyl-6-phytylhydrochinon-methyltransferase in Pflanzen

Publications (1)

Publication Number Publication Date
WO2001004330A1 true WO2001004330A1 (de) 2001-01-18

Family

ID=7914084

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/EP2000/005862 WO2001004330A1 (de) 1999-07-09 2000-06-23 Identifizierung und überexpression einer dna-sequenz kodierend für eine 2-methyl-6-phytylhydrochinon-methyltransferase in pflanzen

Country Status (5)

Country Link
EP (1) EP1194577A1 (de)
AU (1) AU5685800A (de)
CA (1) CA2378657A1 (de)
DE (1) DE19931834A1 (de)
WO (1) WO2001004330A1 (de)

Cited By (12)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2000061771A3 (en) * 1999-04-12 2001-07-05 Monsanto Co Transgenic plants containing altered levels of sterol compounds and tocopherols
WO2003080844A2 (de) * 2002-03-21 2003-10-02 Sungene Gmbh & Co Kgaa Erhöhung des vitamin-e-gehalts in organismen durch erhöhung der 2-methyl-6-phytylhydrochinon-methyltransferase-aktivität
US6787683B1 (en) 1999-05-07 2004-09-07 Pioneer Hi-Bred International, Inc. Phytyl/prenyltransferase nucleic acids, polypeptides and uses thereof
US6841717B2 (en) 2000-08-07 2005-01-11 Monsanto Technology, L.L.C. Methyl-D-erythritol phosphate pathway genes
US6872815B1 (en) 2000-10-14 2005-03-29 Calgene Llc Nucleic acid sequences to proteins involved in tocopherol synthesis
WO2005054453A1 (en) 2003-12-02 2005-06-16 Basf Aktiengesellschaft 2-methyl-6-solanylbenzoquinone methyltransferase as target for herbicides
US7067647B2 (en) 1999-04-15 2006-06-27 Calgene Llc Nucleic acid sequences to proteins involved in isoprenoid synthesis
US7112717B2 (en) 2002-03-19 2006-09-26 Monsanto Technology Llc Homogentisate prenyl transferase gene (HPT2) from arabidopsis and uses thereof
US7230165B2 (en) 2002-08-05 2007-06-12 Monsanto Technology Llc Tocopherol biosynthesis related genes and uses thereof
US7238855B2 (en) 2001-05-09 2007-07-03 Monsanto Technology Llc TyrA genes and uses thereof
US7244877B2 (en) 2001-08-17 2007-07-17 Monsanto Technology Llc Methyltransferase from cotton and uses thereof
US7262339B2 (en) 2001-10-25 2007-08-28 Monsanto Technology Llc Tocopherol methyltransferase tMT2 and uses thereof

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1999004622A1 (en) * 1997-07-25 1999-02-04 University Of Nevada Transgenic plants with tocopherol methyltransferase
WO2000010380A1 (en) * 1998-08-25 2000-03-02 University Of Nevada Manipulation of tocopherol levels in transgenic plants
WO2000032757A2 (en) * 1998-12-03 2000-06-08 E.I. Du Pont De Nemours And Company Plant vitamin e biosynthetic enzymes

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1999004622A1 (en) * 1997-07-25 1999-02-04 University Of Nevada Transgenic plants with tocopherol methyltransferase
WO2000010380A1 (en) * 1998-08-25 2000-03-02 University Of Nevada Manipulation of tocopherol levels in transgenic plants
WO2000032757A2 (en) * 1998-12-03 2000-06-08 E.I. Du Pont De Nemours And Company Plant vitamin e biosynthetic enzymes

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
DATABASE EMBL SEQUENCE DATABASE 31 October 1996 (1996-10-31), KANEKO, T., ET AL.: "sequence analysis of the genome of the unicellular cyanobacterium Syecchocystis sp. PCC6803. II. sequence determination of the entire genome and assignment of the potential protein-coding regions", XP002152668 *
HOEFGEN R ET AL: "BIOCHEMICAL AND GENETIC ANALYSIS OF DIFFERENT PATATIN ISOFORMS EXPRESSED IN VARIOUS ORGANS OF POTATO SOLANUM-TUBEROSUM", PLANT SCIENCE (LIMERICK), vol. 66, no. 2, 1990, pages 221 - 230, XP000964790, ISSN: 0168-9452 *

Cited By (24)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2000061771A3 (en) * 1999-04-12 2001-07-05 Monsanto Co Transgenic plants containing altered levels of sterol compounds and tocopherols
US7709666B2 (en) 1999-04-12 2010-05-04 Monsanto Technology Llc Transgenic plants containing altered levels of sterol compounds and tocopherols
US7067647B2 (en) 1999-04-15 2006-06-27 Calgene Llc Nucleic acid sequences to proteins involved in isoprenoid synthesis
US7141718B2 (en) 1999-04-15 2006-11-28 Calgene Llc Nucleic acid sequences to proteins involved in tocopherol synthesis
US7335815B2 (en) 1999-04-15 2008-02-26 Calgene Llc Nucleic acid sequences to proteins involved in isoprenoid synthesis
US7265207B2 (en) 1999-04-15 2007-09-04 Calgene Llc Nucleic acid sequences to proteins involved in tocopherol synthesis
US6787683B1 (en) 1999-05-07 2004-09-07 Pioneer Hi-Bred International, Inc. Phytyl/prenyltransferase nucleic acids, polypeptides and uses thereof
US6841717B2 (en) 2000-08-07 2005-01-11 Monsanto Technology, L.L.C. Methyl-D-erythritol phosphate pathway genes
US7405343B2 (en) 2000-08-07 2008-07-29 Monsanto Technology Llc Methyl-D-erythritol phosphate pathway genes
US8362324B2 (en) 2000-10-14 2013-01-29 Monsanto Technology Llc Nucleic acid sequences to proteins involved in tocopherol synthesis
US6872815B1 (en) 2000-10-14 2005-03-29 Calgene Llc Nucleic acid sequences to proteins involved in tocopherol synthesis
US7420101B2 (en) 2000-10-14 2008-09-02 Calgene Llc Nucleic acid sequences to proteins involved in tocopherol synthesis
US7238855B2 (en) 2001-05-09 2007-07-03 Monsanto Technology Llc TyrA genes and uses thereof
US7244877B2 (en) 2001-08-17 2007-07-17 Monsanto Technology Llc Methyltransferase from cotton and uses thereof
US7553952B2 (en) 2001-08-17 2009-06-30 Monsanto Technology Llc Gamma tocopherol methyltransferase coding sequence identified in Cuphea and uses thereof
US7595382B2 (en) 2001-08-17 2009-09-29 Monsanto Technology Llc Gamma tocopherol methyltransferase coding sequences from Brassica and uses thereof
US7605244B2 (en) 2001-08-17 2009-10-20 Monsanto Technology Llc Gamma tocopherol methyltransferase coding sequence from Brassica and uses thereof
US7262339B2 (en) 2001-10-25 2007-08-28 Monsanto Technology Llc Tocopherol methyltransferase tMT2 and uses thereof
US7112717B2 (en) 2002-03-19 2006-09-26 Monsanto Technology Llc Homogentisate prenyl transferase gene (HPT2) from arabidopsis and uses thereof
WO2003080844A3 (de) * 2002-03-21 2003-12-24 Sungene Gmbh & Co Kgaa Erhöhung des vitamin-e-gehalts in organismen durch erhöhung der 2-methyl-6-phytylhydrochinon-methyltransferase-aktivität
WO2003080844A2 (de) * 2002-03-21 2003-10-02 Sungene Gmbh & Co Kgaa Erhöhung des vitamin-e-gehalts in organismen durch erhöhung der 2-methyl-6-phytylhydrochinon-methyltransferase-aktivität
US7230165B2 (en) 2002-08-05 2007-06-12 Monsanto Technology Llc Tocopherol biosynthesis related genes and uses thereof
JP2007516704A (ja) * 2003-12-02 2007-06-28 ビーエーエスエフ　アクチェンゲゼルシャフト 除草剤の標的としての２−メチル−６−ソラニルベンゾキノン・メチルトランスフェラーゼ
WO2005054453A1 (en) 2003-12-02 2005-06-16 Basf Aktiengesellschaft 2-methyl-6-solanylbenzoquinone methyltransferase as target for herbicides

Also Published As

Publication number Publication date
CA2378657A1 (en) 2001-01-18
DE19931834A1 (de) 2001-01-11
EP1194577A1 (de) 2002-04-10
AU5685800A (en) 2001-01-30

Similar Documents

Publication Publication Date Title
EP1102852A1 (de) Dna-sequenz kodierend für eine 1-deoxy-d-xylulose-5-phosphat synthase und deren überproduktion in pflanzen
WO1999004021A1 (de) Dna-sequenz codierend für eine hydroxyphenylpyruvatdioxygenase und deren überproduktion in pflanzen
EP1294913B1 (de) Veränderung des gehalts an feinchemikalien in organismen durch genetische veränderung des shikimatweges
DE60129011T2 (de) Nukleinsäuresequenzen für proteine, die an der tocopherolbiosynthese beteiligt sind
WO2001062781A2 (de) Homogentisatphytyltransferase
WO2001004330A1 (de) Identifizierung und überexpression einer dna-sequenz kodierend für eine 2-methyl-6-phytylhydrochinon-methyltransferase in pflanzen
EP1180149A2 (de) Überexpression einer dna-sequenz codierend für eine 1-desoxy-d-xylulose-5-phosphat reduktoisomerase in pflanzen
DE10046462A1 (de) Verbesserte Verfahren zur Vitamin E Biosynthese
DE19835219A1 (de) DNA-Sequenz codierend für eine 1-Deoxy-D-Xylulose-5-Phosphat Synthase und deren Überproduktion in Pflanzen
EP1025250A2 (de) Beeinflussung des tocopherolgehaltes in transgenen pflanzen
WO2001012827A2 (de) Verfahren zur herstellung transgener pflanzen mit erhöhtem tocopherol-gehalt
EP1373533B1 (de) Erhöhung des vitamin-e-gehalts in organismen durch erhöhung der tyrosinaminotransferase-aktivität
WO2000044911A1 (de) Überexpression einer dna-sequenz codierend für transketolase in pflanzen
DE19845231A1 (de) DNA-Sequenzen codierend für eine 1-Deoxy-D-Xylulose-5-Pphosphat Synthase, eine Hydroxyphenylpyruvat Dioxygenase und eine Geranylgeranylpyrophosphat Oxidoreduktase und deren Überproduktion in Pflanzen
WO2003080844A2 (de) Erhöhung des vitamin-e-gehalts in organismen durch erhöhung der 2-methyl-6-phytylhydrochinon-methyltransferase-aktivität
DE19845216A1 (de) DNA-Sequenzen codierend für eine 1-Deoxy-D-Xylulose-5-Phosphat Synthase und eine Hydroxyphenylpyruvat Dioxygenase und deren Überproduktion in Pflanzen
DE19845224A1 (de) DNA-Sequenzen codierend für eine 1-Deoxy-D-Xylulose-5-Phosphat Synthase und eine Geranylgeranyl-Pyrosphat Oxidoreduktase und deren Überproduktion in Pflanzen
EP1576164A2 (de) VERFAHREN ZUR HERSTELLUNG VON TRANSGENEN PFLANZEN MIT ERHöHT EM VITAMIN E-GEHALT DURCH VER äNDERUNG DES SERIN-ACETYLTRANSF ERASE-GEHALTS
DE10064454A1 (de) Veränderung des Gehalts an Feinchemikalien in Organismen durch genetische Veränderung des Shikimatweges
DE10030647A1 (de) Veränderung des Gehalts an Feinchemikalien in Organismen durch genetische Veränderung des Shikimatweges
EP1198578A2 (de) Planzliche s-adenosylmethionin: mg-protoporphyrin-ix-o-methyltransferase, pflanzen mit verändertem chlorophyllgehalt und/oder herbizidtoleranz

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CN CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
WWE Wipo information: entry into national phase

Ref document number: 2000942130

Country of ref document: EP

WWE Wipo information: entry into national phase

Ref document number: 2378657

Country of ref document: CA

WWP Wipo information: published in national office

Ref document number: 2000942130

Country of ref document: EP

WWE Wipo information: entry into national phase

Ref document number: 10019541

Country of ref document: US

REG Reference to national code

Ref country code: DE

Ref legal event code: 8642

NENP Non-entry into the national phase

Ref country code: JP

WWW Wipo information: withdrawn in national office

Ref document number: 2000942130

Country of ref document: EP