WO2000073469A2 - Protein kinases - Google Patents

Protein kinases Download PDF

Info

Publication number
WO2000073469A2
WO2000073469A2 PCT/US2000/014842 US0014842W WO0073469A2 WO 2000073469 A2 WO2000073469 A2 WO 2000073469A2 US 0014842 W US0014842 W US 0014842W WO 0073469 A2 WO0073469 A2 WO 0073469A2
Authority
WO
WIPO (PCT)
Prior art keywords
seq
polypeptide
kinase
group
nucleic acid
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US2000/014842
Other languages
English (en)
French (fr)
Other versions
WO2000073469A3 (en
Inventor
Gregory D. Plowman
Ricardo Martinez
David Whyte
Sucha Sudersanam
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Sugen LLC
Original Assignee
Sugen LLC
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Sugen LLC filed Critical Sugen LLC
Priority to EP00936414A priority Critical patent/EP1180151A2/en
Priority to CA002383244A priority patent/CA2383244A1/en
Priority to JP2001500781A priority patent/JP2003501038A/ja
Priority to AU51734/00A priority patent/AU5173400A/en
Publication of WO2000073469A2 publication Critical patent/WO2000073469A2/en
Anticipated expiration legal-status Critical
Publication of WO2000073469A3 publication Critical patent/WO2000073469A3/en
Priority to US11/377,316 priority patent/US20060234344A1/en
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/10Transferases (2.)
    • C12N9/12Transferases (2.) transferring phosphorus containing groups, e.g. kinases (2.7)
    • C12N9/1205Phosphotransferases with an alcohol group as acceptor (2.7.1), e.g. protein kinases
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00Drugs for disorders of the nervous system
    • A61P25/28Drugs for disorders of the nervous system for treating neurodegenerative disorders of the central nervous system, e.g. nootropic agents, cognition enhancers, drugs for treating Alzheimer's disease or other forms of dementia
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00Antineoplastic agents
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P37/00Drugs for immunological or allergic disorders
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P43/00Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P9/00Drugs for disorders of the cardiovascular system
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00Medicinal preparations containing peptides

Definitions

  • the present invention relates to novel kinase polypeptides, nucleotide sequences encoding the novel kinase polypeptides, as well as various products and methods useful for the diagnosis and treatment of various kinase-related diseases and conditions.
  • Cellular signal transduction is a fundamental mechanism whereby external stimuli that regulate diverse cellular processes are relayed to the interior of cells.
  • One of the key biochemical mechanisms of signal transduction involves the reversible phosphorylation of proteins, which enables regulation of the activity of mature proteins by altering their structure and function.
  • Protein phosphorylation plays a pivotal role in biological signal transduction.
  • biological functions controlled by protein phosphorylation are the following: cell division; differentiation and death (apoptosis); cell motility and cytoskeletal structure; control of DNA replication, transcription, splicing and translation; protein translocation events from the endoplasmic reticulum and Golgi apparatus to the membrane and extracellular space; protein nuclear import and export; regulation of metabolic reactions, etc.
  • Abnormal protein phosphorylation is widely recognized to be causally linked to the etiology of many diseases including cancer as well as immunologic, neuronal and metabolic disorders.
  • the most common phospho-acceptor amino acid residues are serine, threonine and tyrosine. Phosphorylation in histidine has also been observed in bacteria.
  • the presence of a phosphate moeity modulates protein function in multiple ways.
  • a common mechanism includes changes in the catalytic properties (V max and K m ) of an enzyme leading to its activation or inactivation.
  • a second widely recognized mechanism involves promoting protein-protein interactions. An example of this is the tyrosine autophosphorylation of the ligand- activated EGF receptor tyrosine kinase. This event triggers the high-affinity binding to the phosphotyrosine residue on the receptor's C-terminal intracellular domain to the SH2 motif of the adaptor molecule Grb2.
  • Grb2 in turn binds through its SH3 motif to a second adaptor molecule, such as SHC.
  • SHC second adaptor molecule
  • This ternary complex acivates the signaling events that are responsible for the biological effects of EGF.
  • Serine and threonine phosphorylation events have also being recently recognized to exert their biological function through protein-protein interaction events mediated by the high- affinity binding of phosphoserine and phosphothreonine to WW motifs present in a large variety of proteins (Lu, P.J. et al. (1999) Science 283:1325-1328).
  • a third important outcome of protein phosphorylation is changes in the subcellular localization of the substrate. As an example, nuclear import and export events in a large diversity of proteins are regulated by protein phosphorylation (Drier E.A. et al. (1999) Genes Dev 13: 556- 568).
  • Protein kinases are one of the largest families of eukaryotic proteins with several hundred known members. These proteins share a 250-300 amino acid domain that can be subdivided into 12 distinct subdomains that comprise the common catalytic core structure. These conserved protein motifs have recently been exploited using PCR-based and bioinformatic strategies leading to a significant expansion of the known kinases. Multiple alignment of the sequences in the catalytic domain of protein kinases and subsequent parsimony analysis permits their segregation into a dendrogram reflecting the relatedness of their catalytic domains (Fig. 1).
  • kinases are clustered into distinct branches or subfamilies including: tyrosine kinases, cyclic-nucleotide-dependent kinases, calcium/calmodulin kinases, cyclin-dependent kinases and MAP -kinases, serine- threonine kinase receptors, and several other less defined subfamilies.
  • C. elegans the multicellular organism whose entire DNA sequence has been determined.
  • the protein kinases may be divided into 4 major groups:
  • AGC, CAMK, CMGC and tyrosine kinases there are a number of minor yet distinct families, including the STE and casein kinase 1 , families related to worm- or fungal-specific kinases, and a family designated "other" to represent several smaller families.
  • the AGC kinases are basic amino acid-directed enzymes that phosphorylate residues found proximal to Arg and Lys. Examples of this group are the cyclic nucleoti de- dependent kinases, G protein kinases, NDR or DBF2 and the ribosomal S6 kinases.
  • the CAMK group kinases are also basic amino acid-directed kinases. They include the Ca2+/calmodulin-regulated and AMP-dependent protein kinases, myosin light chain kinases, checkpoint 2 kinases (CHK2) and EMK-related protein kinases.
  • the EMK family of STK are involved in the control of cell polarity, micotubule stability and cancer.
  • C-TAK1 One member of the EMK family, C-TAK1 has been reported to control entry into mitosis by activating Cdc25C which in turn dephosphorylates Cdc2.
  • CMGC group kinases are "proline-directed" enzymes phosphorylating residues that exist in a proline-rich context. They include the cyclin-dependent kinases (CDKs), mitogen-activated kinases (MAPKs), GSK3s and CLKs. Most CMGC kinases have larger-than-average kinase domains owing to the presence of insertions within subdomains X and XL
  • the tyrosine kinase group encompass both cytoplasmic (i.e. src) as well as transmembrane receptor tyrosine kinases (i.e. EGF receptor). These kinases play a pivotal role in the signal transduction processes that mediate cell proliferation, differentiation and apoptotis.
  • EIFKs elongation factor 2 kinases
  • STE yeast sterile family kinases
  • MLKs mixed lineage kinases
  • LIMKs Lim-domain containing kinases
  • CAMKK Calcium-calmodulin kinase kinases
  • DRRK dual-specific tyrosine kinases
  • IRAK integrin receptor associated kinase
  • TSK testis-specific kinases
  • UNC-51 related kinases (UNC); several families that are close homologues to worm (C26C2.1, YQ09, ZC581.9, YFL033c, C24A1.3), Drosophila
  • SLOB yeast
  • YDOD_sp yeast
  • YGR262_sc yeast
  • the present invention includes the partial or complete sequence of new protein kinases, their classification, predicted or deduced protein structure, and a strategy for elucidating their biologic and therapeutic relevance.
  • a first aspect of the invention features an isolated, enriched, or purified nucleic acid molecule encoding a kinase polypeptide selected from the group consisting SEQ ID NO:122, SEQ ID NO:123, SEQ FD NO:124, SEQ ID NO:125, SEQ ID NO:126,
  • SEQ ID NO:152 SEQ ID NO:153, SEQ ID NO:154, SEQ ID NO:155, SEQ ID NO:156, SEQ ID NO:157, SEQ ID NO:158, SEQ ID NO:159, SEQ ED NO:160, SEQ ID NO:161, SEQ ID NO:162, SEQ D NO:163, SEQ ID NO:164, SEQ ID NO:165.
  • SEQ ID NO:166 SEQ ID NO:167, SEQ ID NO:168, SEQ ID NO:169, SEQ ID NO:170, SEQ ID NO:171, SEQ ID NO:172, SEQ ID NO:173, SEQ ID NO:174, SEQ ID NO:175, SEQ ID NO:176,
  • SEQ ID NO:237 SEQ ID NO:238, SEQ ID NO:239, SEQ ID NO:240, SEQ ID NO:241, and SEQ ID NO:242.
  • isolated in reference to nucleic acid is meant a polymer of nucleotides conjugated to each other, including DNA and RNA, that is isolated from a natural source or that is synthesized.
  • the isolated nucleic acid of the present invention is unique in the sense that it is not found in a pure or separated state in nature.
  • Use of the term “isolated” indicates that a naturally occurring sequence has been removed from its normal cellular (i.e., chromosomal) environment. Thus, the sequence may be in a cell-free solution or placed in a different cellular environment.
  • sequence is the only nucleotide chain present, but that it is essentially free (about 90 - 95% pure at least) of non-nucleotide material naturally associated with it, and thus is distinguished from isolated chromosomes.
  • enriched in reference to nucleic acid is meant that the specific DNA or RNA sequence constitutes a significantly higher fraction (2 - 5 fold) of the total DNA or RNA present in the cells or solution of interest than in normal or diseased cells or in the cells from which the sequence was taken. This could be caused by a person by preferential reduction in the amount of other DNA or RNA present, or by a preferential increase in the amount of the specific DNA or RNA sequence, or by a combination of the two. However, it should be noted that enriched does not imply that there are no other DNA or RNA sequences present, just that the relative amount of the sequence of interest has been significantly increased.
  • the term "significant" is used to indicate that the level of increase is useful to the person making such an increase, and generally means an increase relative to other nucleic acids of about at least 2 fold, more preferably at least 5 to 10 fold or even more.
  • the term also does not imply that there is no DNA or RNA from other sources.
  • the other source DNA may, for example, comprise
  • DNA from a yeast or bacterial genome or a cloning vector such as pUC19.
  • This term distinguishes from naturally occurring events, such as viral infection, or tumor type growths, in which the level of one mRNA may be naturally increased relative to other species of mRNA. That is, the term is meant to cover only those situations in which a person has intervened to elevate the proportion of the desired nucleic acid.
  • nucleotide sequence be in purified form.
  • purified in reference to nucleic acid does not require absolute purity
  • the cDNA clones are not naturally occurring, but rather are preferably obtained via manipulation of a partially purified naturally occurring substance (messenger RNA).
  • the construction of a cDNA library from mRNA involves the creation of a synthetic substance (cDNA) and pure individual cDNA clones can be isolated from the synthetic library by clonal selection of the cells carrying the cDNA library.
  • cDNA synthetic substance
  • pure individual cDNA clones can be isolated from the synthetic library by clonal selection of the cells carrying the cDNA library.
  • the process which includes the construction of a cDNA library from mRNA and isolation of distinct cDNA clones yields an approximately 10 -fold purification of the native message.
  • purification of at least one order of magnitude preferably two or three orders, and more preferably four or five orders of magnitude is expressly contemplated.
  • kinase polypeptide 10 (preferably 20, more preferably 40, most preferably 75) or more contiguous amino acids set forth in an amino acid sequence selected from the group consisting of those set forth in SEQ ID NO: 122, SEQ ID NO: 123, SEQ ID NO:124, SEQ ID NO:125, SEQ ID NO:126, SEQ ID NO:127, SEQ ID NO:128, SEQ ID NO:129, SEQ ID NO:130, SEQ ID NO:131, SEQ ED NO:132, SEQ ED NO:133, SEQ ED NO:134, SEQ ID NO:135, SEQ ED NO:136, SEQ ID NO:137, SEQ ED NO:138,
  • SEQ ED NO:224 SEQ ED NO:225, SEQ ED NO:226, SEQ ID NO:227, SEQ ID NO:228, SEQ ED NO:229, SEQ ED NO:230, SEQ ED NO:231, SEQ ID NO:232, SEQ ID NO:233, SEQ ED NO:234, SEQ ED NO:235, SEQ ID NO:236, SEQ ID NO:237, SEQ ID NO:238, SEQ ED NO:239, SEQ ED NO:240, SEQ ID NO:241, and SEQ ID NO:242, or functional derivatives thereof as described herein.
  • sequences for which the full-length sequence is not given the remaining sequences can be determined using methods well-known to those in the art and are intended to be included in the invention.
  • polypeptides of 100, 200, 300 or more amino acids are preferred.
  • the kinase polypeptide can be encoded by a full-length nucleic acid sequence or any portion of the full-length nucleic acid sequence, so long as a functional activity of the polypeptide is retained.
  • “functional” domain is meant any region of the polypeptide that may play a regulatory or catalytic role as predicted from amino acid sequence homology to other proteins or by the presence of amino acid sequences that may give rise to specific structural conformations (i.e., coiled-coils).
  • polypeptide domains are preferred, including, but not limited to, N-terminal, catalytic/kinase and C-terminal.
  • amino acid sequence will be substantially similar to a sequence selected from the group consisting of those set forth in SEQ ED NO: 122, SEQ ED NO: 123, SEQ ID NO: 124, SEQ ID NO: 125, SEQ ED NO: 126, SEQ ED NO: 127, SEQ ED NO: 128, SEQ ED NO:129, SEQ ED NO:130, SEQ ED NO:131, SEQ ID NO:132, SEQ ED NO:133, SEQ ID NO:134, SEQ ID NO:135, SEQ ID NO:136, SEQ ID NO:137, SEQ ID NO:138, SEQ ID
  • SEQ ID NO:139 SEQ ID NO:140, SEQ ID NO:141, SEQ ID NO:142, SEQ ID NO:143, SEQ ID NO: 144, SEQ ED NO: 145, SEQ ED NO: 146, SEQ ED NO: 147, SEQ ED NO: 148, SEQ ID NO:149, SEQ ED NO:150, SEQ ED NO:151, SEQ ID NO:152, SEQ ID NO:153, SEQ ID NO:154, SEQ ED NO:155, SEQ ED NO:156, SEQ ED NO:157, SEQ ED NO:158, SEQ ID NO:159, SEQ ED NO:160, SEQ ID N0:161, SEQ ID NO:162, SEQ ID NO:163, SEQ ID NO: 164, SEQ ED NO: 165.
  • SEQ ID NO: 166 SEQ ID NO: 167, SEQ ID NO: 168, SEQ ID NO:169, SEQ ED NO:170, SEQ ED NO:171, SEQ ED NO:172, SEQ ED NO:173, SEQ ID NO: 166, SEQ ID NO: 167, SEQ ID NO: 168, SEQ ID NO:169, SEQ ED NO:170, SEQ ED NO:171, SEQ ED NO:172, SEQ ED NO:173, SEQ ID NO: 166, SEQ ID NO: 167, SEQ ID NO: 168, SEQ ID NO:169, SEQ ED NO:170, SEQ ED NO:171, SEQ ED NO:172, SEQ ED NO:173, SEQ ID NO: 166, SEQ ID NO: 167, SEQ ID NO: 168, SEQ ID NO:169, SEQ ED NO:170, SEQ ED NO:171, SEQ ED NO:172, SEQ ED NO:17
  • SEQ ED NO:224 SEQ ED NO:225, SEQ ID NO:226, SEQ ID NO:227, SEQ ID NO:228, SEQ ID NO:229, SEQ ID NO:230, SEQ ED NO:231, SEQ ID NO:232, SEQ ID NO:233, SEQ ED NO:234, SEQ ED NO:235, SEQ ED NO:236, SEQ ID NO:237, SEQ ID NO:238, SEQ ID NO:239, SEQ ED NO:240, SEQ ED NO:241, and SEQ ID NO:242, or the corresponding full-length amino acid sequence, or fragments thereof.
  • SEQ ID NO:142 SEQ ED NO:143, SEQ ID NO:144, SEQ ID NO:145, SEQ ID NO:146, SEQ ID NO: 147, SEQ ED NO: 148, SEQ ED NO: 149, SEQ ID NO: 150, SEQ ID NO: 151, SEQ ID NO:152, SEQ ED NO:153, SEQ ED NO:154, SEQ ED NO:155, SEQ ED NO:156, SEQ ID NO:157, SEQ ED NO:158, SEQ ED NO:159, SEQ ED NO:160, SEQ ID NO:161, SEQ ID NO:162, SEQ ID NO:163, SEQ ID NO:164, SEQ ID NO:165.
  • SEQ ID NO:166 SEQ ID NO:
  • SEQ ID NO:227, SEQ ED NO:228, SEQ ED NO:229, SEQ ID NO:230, SEQ ID NO:231, SEQ ID NO:232, SEQ ID NO:233, SEQ ID NO:234, SEQ ED NO:235, SEQ ID NO:236, SEQ ID NO:237, SEQ ID NO:238, SEQ ID NO:239, SEQ ID NO:240, SEQ ID NO:241, and SEQ ED NO:242 will have at least 75%o identity (preferably 90%, more preferably at least 95% and most preferably 99-100%) to a sequence selected from the group consisting of those set forth in SEQ ID NO:122, SEQ ID NO:123, SEQ ID NO:124, SEQ ID NO: 125, SEQ ED NO:126, SEQ ED NO:127, SEQ ED NO:128, SEQ ID NO:129, SEQ ED NO:130, SEQ ED NO:131, SEQ ED NO:132, SEQ ED NO:133
  • SEQ ID NO: 146 SEQ ED NO: 147, SEQ ED NO: 148, SEQ ED NO: 149, SEQ ED NO: 150, SEQ ED NO:151, SEQ ED NO:152, SEQ ED NO:153, SEQ ED NO:154, SEQ ED NO:155, SEQ ID NO:156, SEQ ED NO:157, SEQ ED NO:158, SEQ ED NO:159, SEQ ID NO:160, SEQ ID NO:161, SEQ ED NO:162, SEQ ED NO:163, SEQ ED NO:164, SEQ ID NO:165.
  • ED NO: 196 SEQ ED NO.T97, SEQ ED NO: 198, SEQ ID NO: 199, SEQ ID NO:200, SEQ ED NO:201, SEQ ED NO:202, SEQ ED NO:203, SEQ ED NO:204, SEQ ED NO:205, SEQ ID NO:206, SEQ ED NO:207, SEQ ID NO:208, SEQ ID NO:209, SEQ ID NO:210, SEQ ED NO:211, SEQ ID NO:212, SEQ ID NO:213, SEQ ED NO:214, SEQ ID NO:215, SEQ ID NO:216, SEQ ED NO:217, SEQ ID NO:218, SEQ ID NO:219, SEQ ID NO:220, SEQ ID NO:221, SEQ ID NO:222, SEQ ED NO:223, SEQ ID NO:224, SEQ ID NO:225, SEQ ED NO:226, SEQ ED NO:227, SEQ ED NO:228,
  • identity is meant a property of sequences that measures their similarity or relationship. Identity is measured by dividing the number of identical residues between two sequences (either full-length or a defined domain) by the total number of residues in the known sequence, or the domain of the known sequence, and multiplying the product by 100.
  • the invention features isolated, enriched, or purified nucleic acid molecules encoding a kinase polypeptide comprising a nucleotide sequence that: (a) encodes a polypeptide having an amino acid sequence selected from the group consisting of those set forth in SEQ ID NO:122, SEQ ED NO:123, SEQ ID NO:124, SEQ ED NO:125, SEQ ID NO: 126, SEQ ID NO: 127, SEQ ID NO: 128, SEQ ID NO: 129, SEQ ED NO:130, SEQ ED NO:131, SEQ ED NO:132, SEQ ED NO:133, SEQ ID NO:134, SEQ
  • ED NO:195 SEQ ID NO:196, SEQ ID NO:197, SEQ ID NO:198, SEQ ID NO:199, SEQ ID NO:200, SEQ ED NO:201, SEQ ED NO:202, SEQ ED NO:203, SEQ ID NO:204, SEQ ED NO:205, SEQ ED NO:206, SEQ ED NO:207, SEQ ID NO:208, SEQ ID NO:209, SEQ ED NO:210, SEQ ID NO:211, SEQ ID NO:212, SEQ ID NO:213, SEQ ID NO:214, SEQ ID NO:215, SEQ ED NO:216, SEQ ED NO:217, SEQ ED NO:218, SEQ ED NO:219, SEQ
  • SEQ ID NO:220 SEQ ID NO:221, SEQ ID NO:222, SEQ ID NO:223, SEQ ID NO:224, SEQ ID NO:225, SEQ ID NO:226, SEQ ID NO:227, SEQ ED NO:228, SEQ ID NO:229, SEQ ED NO:230, SEQ ED NO:231, SEQ ID NO:232, SEQ ID NO:233, SEQ ED NO:234, SEQ ID NO:235, SEQ ID NO:236, SEQ ID NO:237, SEQ ID NO:238, SEQ ID NO:239, SEQ ED NO:240, SEQ ED NO:241, and SEQ ED NO:242, or the corresponding full-length amino acid sequence, or fragments thereof.
  • SEQ ID NO:223, SEQ ID NO:224, SEQ ID NO:225, SEQ ID NO:226, SEQ ED NO:227, SEQ ID NO:228, SEQ ED NO:229, SEQ ID NO:230, SEQ ED NO:231, SEQ ED NO:232, SEQ ED NO:233, SEQ ED NO:234, SEQ ID NO:235, SEQ ID NO:236, SEQ ED NO:237, SEQ ED NO:238, SEQ ED NO:239, SEQ ID NO:240, SEQ ID NO:241, and SEQ ID NO:242 will have at least 75% identity (preferably 90%, more preferably at least 95% and most preferably 99-100%) to the sequence selected from the group consisting of those set forth in SEQ ED NO:122, SEQ ID NO:123, SEQ ED NO:124, SEQ ID NO:125, SEQ ID NO: 126, SEQ ED NO: 127, SEQ ED NO: 128, SEQ ID NO:
  • SEQ ID NO:141 SEQ ID NO:142, SEQ ID NO:143, SEQ ID NO:144, SEQ ID NO:145, SEQ ID NO:146, SEQ ID NO:147, SEQ ID NO:148, SEQ ID NO:149, SEQ ID NO:150, SEQ ID NO:151, SEQ ID NO:152, SEQ ID NO:153, SEQ ID NO:154, SEQ ED NO:155, SEQ ID NO:156, SEQ ED NO:157, SEQ ED NO:158, SEQ ED NO:159, SEQ ID NO:160, SEQ ID NO:161, SEQ ID NO: 162, SEQ ID NO:163, SEQ ID NO:164, SEQ ID NO:165.
  • SEQ ED NO:160 SEQ ID NO:161, SEQ ID NO: 162, SEQ ID NO:163, SEQ ID NO:164, SEQ ID NO:165.
  • SEQ ID NO:162 SEQ ED NO:163, SEQ ED NO:164, SEQ ED NO:165.
  • SEQ ID NO:241, and SEQ ID NO:242 will have at least 75% identity (preferably 90%, more preferably at least 95% and most preferably 99-100%) to the sequence of SEQ ID NO: 122, SEQ ID NO: 123, SEQ ID NO: 124, SEQ DD NO: 125, SEQ DD NO: 126, SEQ ID NO:127, SEQ DD NO:128, SEQ DD NO:129, SEQ DD NO:130, SEQ DD NO:131, SEQ DD NO:132, SEQ ID NO:133, SEQ DD NO:134, SEQ ID NO:135, SEQ ID NO:136, SEQ ID NO:137, SEQ DD NO:138, SEQ DD NO:139, SEQ ED NO:140, SEQ ID NO: 141, SEQ ID NO: 142, SEQ ID NO: 143, SEQ ID NO: 144, SEQ ID NO: 145, SEQ ID NO: 146, SEQ ID NO: 141, SEQ ID NO
  • SEQ ID NO: 197 SEQ DD NO: 198, SEQ DD NO: 199, SEQ DD NO:200, SEQ ID NO:201, SEQ ID NO:202, SEQ ED NO:203, SEQ ID NO:204, SEQ ED NO:205, SEQ ED NO:206, SEQ ID NO:207, SEQ ID NO:208, SEQ ID NO:209, SEQ ID NO:210, SEQ ID NO:211, SEQ ID NO:212, SEQ ED NO:213, SEQ ID NO:214, SEQ ID NO:215, SEQ ID NO:216, SEQ ID NO:217, SEQ ID NO:218, SEQ ID NO:219, SEQ ED NO:220, SEQ ID NO:221, SEQ ID NO:
  • SEQ ID NO:126 SEQ ID NO:127, SEQ ID NO:128, SEQ ID NO:129, SEQ ID NO:130, SEQ ID NO:131, SEQ ID NO:132, SEQ ID NO:133, SEQ ID NO:134, SEQ ID NO:135, SEQ ID NO: 136, SEQ ED NO:137, SEQ ED NO: 138, SEQ ID NO: 139, SEQ ID NO: 140, SEQ ID NO:141, SEQ ID NO:142, SEQ ID NO:143, SEQ DD NO:144, SEQ DD NO:145, SEQ DD NO: 146, SEQ DD NO: 147, SEQ DD NO: 148, SEQ ID NO: 149, SEQ ED NO: 150, SEQ ID NO:151, SEQ DD NO:152, SEQ DD NO:153, SEQ DD NO:154, SEQ ED NO:155, SEQ ID NO: 156, SEQ ED NO: 157, SEQ ED NO: 158,
  • SEQ ID NO: 186 SEQ ED NO: 187, SEQ ID NO: 188, SEQ ED NO: 189, SEQ ID NO: 190, SEQ ID NO: 191, SEQ ED NO: 199, SEQ ID NO: 193, SEQ ED NO: 194, SEQ ED NO: 195, SEQ ID NO: 196, SEQ DD NO: 197, SEQ ID NO: 198, SEQ ID NO: 199, SEQ ID NO:200, SEQ ID NO:201, SEQ ID NO:202, SEQ DD NO:203, SEQ DD NO:204, SEQ ID NO:205, SEQ ID NO:206, SEQ ED NO:207, SEQ ED NO:208, SEQ ID NO:209, SEQ ID NO:210, SEQ ID NO: 186, SEQ ED NO: 187, SEQ ID NO: 188, SEQ ED NO: 189, SEQ ID NO: 190, SEQ ID NO: 191, SEQ ED NO: 199,
  • SEQ ED NO:166 SEQ ID NO:167, SEQ ID NO:168, SEQ ED NO:169, SEQ ED NO:170, SEQ ID N0:171, SEQ ID NO:172, SEQ ED NO:173, SEQ ED NO:174, SEQ ID NO:175, SEQ ID NO:176, SEQ ID NO:177, SEQ ID NO:178, SEQ ID NO:179, SEQ ID NO:180, SEQ ID N0: 181, SEQ ID
  • SEQ ID NO: 182 SEQ ID NO: 183, SEQ ED NO: 184, SEQ ED NO: 185, SEQ ID NO: 186, SEQ ID NO:187, SEQ DD NO:188, SEQ ID NO:189, SEQ ID NO:190, SEQ ID NO:191, SEQ ID NO:199, SEQ ID NO:193, SEQ ID NO:194, SEQ ED NO:195, SEQ ID NO:196, SEQ ID NO:197, SEQ HD NO:198, SEQ ED NO:199, SEQ ED NO:200, SEQ ED NO:201, SEQ ID NO:202, SEQ ED NO:203, SEQ ED NO:204, SEQ ED NO:205, SEQ ED NO:206, SEQ ED
  • SEQ ID NO:232, SEQ ID NO:233, SEQ ID NO:234, SEQ ED NO:235, SEQ ID NO:236, SEQ ID NO:237, SEQ ED NO:238, SEQ ED NO:239, SEQ ED NO:240, SEQ ED NO:241, and SEQ ID NO:242 will have at least 75% identity (preferably 90%, more preferably at least 95% and most preferably 99-100%) to the sequence selected from the group consisting of those set forth in SEQ ID NO:122, SEQ ID NO:123, SEQ HD NO:124, SEQ ID NO:125, SEQ
  • ED NO:151 SEQ ED NO:152, SEQ ED NO:153, SEQ ID NO:154, SEQ ID NO:155, SEQ ED NO:156, SEQ ED NO:157, SEQ ED NO:158, SEQ ID NO:159, SEQ ID NO:160, SEQ ED NO: 161, SEQ ID NO: 162, SEQ ID NO: 163, SEQ ID NO: 164, SEQ ID NO: 165.
  • SEQ ED NO:166 SEQ ED NO:167, SEQ ED NO:168, SEQ ED NO:169, SEQ ED NO:170, SEQ DD NO: 171, SEQ DD NO: 172, SEQ ID NO: 173, SEQ DD NO: 174, SEQ ID NO: 175, SEQ
  • SEQ ID NO: 176 SEQ ID NO: 177, SEQ ID NO: 178, SEQ ID NO: 179, SEQ ID NO: 180, SEQ DD NO:181, SEQ DD NO:182, SEQ ID NO:183, SEQ ED NO:184, SEQ ID NO:185, SEQ HD NO: 186, SEQ ED NO: 187, SEQ ED NO: 188, SEQ ED NO: 189, SEQ ED NO: 190, SEQ ED NO:191, SEQ ED NO:199, SEQ ED NO:193, SEQ ED NO:194, SEQ HD NO:195, SEQ HD NO:196, SEQ ID NO:197, SEQ HD NO:198, SEQ ED NO:199, SEQ ED NO:200, SEQ ED NO:201, SEQ ED NO:202, SEQ ED NO:203, SEQ ED NO:204, SEQ ED NO:205, SEQ ED NO:206, SEQ ED NO:207, SEQ
  • (b) is the complement of the nucleotide sequence of (a);
  • (d) encodes a kinase polypeptide having an amino acid sequence selected from the group consisting of those set forth in SEQ ID
  • SEQ ED NO:147 SEQ DD NO:148, SEQ ED NO:149, SEQ ID NO:150, SEQ ID NO:151, SEQ ID NO:152, SEQ ED NO:153, SEQ ED NO:154, SEQ ID NO:155, SEQ ID NO:156, SEQ ID NO:157, SEQ ID NO:158, SEQ ED NO:159, SEQ ED NO:160, SEQ ID NO:161, SEQ ID NO:162, SEQ ED NO:163, SEQ ED NO:164, SEQ ED NO:165.
  • SEQ ED NO: 197 SEQ ED NO: 198, SEQ ED NO: 199, SEQ ED NO:200, SEQ ID NO:201, SEQ ID NO:202, SEQ ED NO:203, SEQ ID NO:204, SEQ ID NO:205, SEQ ID NO:206, SEQ ID NO:207, SEQ ID NO:208, SEQ ED NO:209, SEQ ID NO:210, SEQ ID NO:211, SEQ ID NO:212, SEQ ED NO:213, SEQ ED NO:214, SEQ ED NO:215, SEQ ED NO:216, SEQ ID NO:217, SEQ ID NO:218, SEQ ED NO:219, SEQ HD NO:220, SEQ ID NO:221, SEQ ID NO:222, SEQ ED NO:223, SEQ ED NO:224, SEQ ED NO:225, SEQ ED NO:226, SEQ ID NO:227, SEQ ED NO:228, SEQ ED NO:
  • SEQ ED NO:232 SEQ ED NO:233, SEQ ED NO:234, SEQ ED NO:235, SEQ ED NO:236, SEQ ED NO:237, SEQ ED NO:238, SEQ ED NO:239, SEQ ED NO:240, SEQ ED NO:241, and SEQ ED NO:242, or the corresponding full-length amino acid sequence, or fragments thereof.
  • SEQ ED NO:126 SEQ ID NO:127, SEQ ID NO:128, SEQ ED NO:129, SEQ ID NO:130, SEQ ED NO:131, SEQ ED NO:132, SEQ ED NO:133, SEQ ED NO:134, SEQ ED NO:135, SEQ ED NO:136, SEQ ED NO:137, SEQ ED NO:138, SEQ ID NO:139, SEQ ID NO:140, SEQ ED NO:141, SEQ ED NO:142, SEQ ED NO:143, SEQ ED NO:144, SEQ ED NO:145, SEQ ED NO:146, SEQ ID NO:147, SEQ ED NO:148, SEQ ID NO: 149, SEQ ID NO: 150,
  • SEQ DD NO:201 SEQ DD NO:202, SEQ ID NO:203, SEQ ID NO:204, SEQ ID NO:205, SEQ ED NO:206, SEQ ⁇ D NO:207, SEQ ID NO:208, SEQ ⁇ D NO:209, SEQ ID NO:210, SEQ DD NO:211, SEQ ID NO:212, SEQ DD NO:213, SEQ ID NO:214, SEQ ID NO:215, SEQ ED NO:216, SEQ HD NO:217, SEQ ED NO:218, SEQ ED NO:219, SEQ HD NO:220, SEQ ED NO:221, SEQ ED NO:222, SEQ ED NO:223, SEQ ED NO:224, SEQ ED NO:225,
  • SEQ ED NO:226, SEQ ED NO:227, SEQ ED NO:228, SEQ ED NO:229, SEQ ED NO:230, SEQ ED NO:231, SEQ ED NO:232, SEQ ED NO:233, SEQ ED NO:234, SEQ ED NO:235, SEQ ED NO:236, SEQ ID NO:237, SEQ ID NO:238, SEQ ID NO:239, SEQ ID NO:240, SEQ ED NO:241, and SEQ ED NO:242 will have at least 75% identity (preferably 90%, more preferably at least 95% and most preferably 99-100%) to a domain of a polypeptide selected from the group consisting of those set forth in SEQ ID NO: 122, SEQ ED NO: 123, SEQ ED NO:124, SEQ ED NO:125, SEQ ED NO:126, SEQ ED NO:127, SEQ ID NO:128,
  • SEQ DD NO:154 SEQ DD NO:155, SEQ DD NO:156, SEQ DD NO:157, SEQ ID NO:158, SEQ ED NO:159, SEQ HD NO:160, SEQ HD NO:161, SEQ ID NO:162, SEQ ⁇ D NO:163, SEQ ID NO: 164, SEQ ED NO: 165.
  • the domain is selected from the group consisting of an N-terminal domain, a catalytic domain, a C-terminal domain, a coiled-coil structure region, a proline-rich region, a spacer region, an insert, and a C-terminal tail; (g) is the complement of the nucleotide sequence of (f); (h) encodes a polypeptide having an amino acid sequence selected from the group consisting of those set forth in SEQ ID NO:122, SEQ ED NO:123, SEQ ED N0:124, SEQ
  • SEQ ED NO: 145 SEQ HD NO: 146, SEQ ED NO: 147, SEQ ED NO: 148, SEQ ID NO: 149, SEQ ID NO:150, SEQ ED NO:151, SEQ ED NO:152, SEQ ID NO:153, SEQ ID NO:154, SEQ ID NO:155, SEQ ED NO:156, SEQ ED NO:157, SEQ ED NO:158, SEQ ED NO:159, SEQ ID NO:160, SEQ ED NO:161, SEQ ED NO:162, SEQ ED NO:163, SEQ ID NO:164, SEQ ID NO:165.
  • SEQ DD NO: 174 SEQ DD NO: 175, SEQ DD NO: 176, SEQ DD NO: 177, SEQ ED NO: 178, SEQ ED NO: 179, SEQ ED NO: 180, SEQ ED NO: 181, SEQ ED NO: 182, SEQ ED NO: 183, SEQ ED NO: 184, SEQ ED NO: 185, SEQ ED NO: 186, SEQ ED NO: 187, SEQ ED NO: 188, SEQ ED NO:189, SEQ ED NO:190, SEQ ED NO:191, SEQ ED NO:199, SEQ ED NO:193, SEQ ED NO:194, SEQ ED NO:195, SEQ ED NO:196, SEQ ED NO:197, SEQ ID NO:198,
  • SEQ ID NO:224, SEQ ED NO:225, SEQ ED NO:226, SEQ ED NO:227, SEQ ID NO:228, SEQ ED NO:229, SEQ ED NO:230, SEQ HD NO:231, SEQ HD NO:232, SEQ ID NO:233, SEQ ED NO:234, SEQ ED NO:235, SEQ ED NO:236, SEQ ED NO:237, SEQ ED NO:238, SEQ HD NO:239, SEQ ED NO:240, SEQ ED NO:241, and SEQ ED NO:242 will have at least 75% identity (preferably 90%, more preferably at least 95% and most preferably 99-
  • SEQ ID NO: 122 SEQ ED NO: 123, SEQ ED NO: 124, SEQ ID NO: 125, SEQ ED NO: 126, SEQ ID NO:127, SEQ HD NO:128, SEQ ID NO:129, SEQ HD NO:130, SEQ ID NO:131, SEQ ID NO:132, SEQ HD NO:133, SEQ ID NO:134, SEQ ED NO:135, SEQ ED NO:136, SEQ ED NO:137, SEQ ED NO:138, SEQ ED NO:139, SEQ ED NO:140, SEQ ED NO:141, SEQ ID NO: 122, SEQ ED NO: 123, SEQ ED NO: 124, SEQ ID NO: 125, SEQ ED NO: 126, SEQ ID NO:127, SEQ HD NO:128, SEQ ID NO:129, SEQ HD NO:130, SEQ ID NO:131, SEQ ID NO:132, SEQ HD NO:133, SEQ ID NO:134, S
  • SEQ ED NO:142 SEQ ED NO:143, SEQ ED NO:144, SEQ ED NO:145, SEQ ID NO:146, SEQ ID NO: 147, SEQ ED NO: 148, SEQ ED NO: 149, SEQ ED NO: 150, SEQ ED NO:151, SEQ ED NO: 152, SEQ ID NO: 153, SEQ ID NO: 154, SEQ ID NO: 155, SEQ ID NO: 156, SEQ ID NO:157, SEQ HD NO:158, SEQ HD NO:159, SEQ HD NO:160, SEQ ID NO:161, SEQ ID NO:162, SEQ ID NO:163, SEQ ID NO:164, SEQ ID NO:165.
  • SEQ HD NO:166 SEQ ID NO:
  • SEQ ID NO:202 SEQ ED NO:203, SEQ ED NO:204, SEQ ED NO:205, SEQ ID NO:206, SEQ ID NO:207, SEQ ED NO:208, SEQ ED NO:209, SEQ ID NO:210, SEQ ID NO:211, SEQ ID NO:212, SEQ ED NO:213, SEQ ED NO:214, SEQ ED NO:215, SEQ ED NO:216, SEQ ID NO:217, SEQ ED NO:218, SEQ ED NO:219, SEQ ED NO:220, SEQ ED NO:221, SEQ ID NO:222, SEQ ED NO:223, SEQ ED NO:224, SEQ ED NO:225, SEQ ED NO:226, SEQ ID NO:210, SEQ ID NO:211, SEQ ID NO:212, SEQ ED NO:213, SEQ ED NO:214, SEQ ED NO:215, SEQ ED NO:216, SEQ ID NO
  • (b) is the complement of the nucleotide sequence of (a); (c) hybridizes under highly stringent conditions to the nucleotide molecule of (a) and encodes a naturally occurring kinase polypeptide; (d) encodes a kinase polypeptide having an amino acid sequence selected from the group consisting of those set forth in SEQ ID NO: 122, SEQ ED NO:123, SEQ ID NO:124, SEQ ID NO:125, SEQ ID NO:126,
  • SEQ DD NO:142 SEQ ID NO: 143, SEQ ED NO: 144, SEQ ED NO: 145, SEQ ED NO: 146, SEQ HD NO:147, SEQ ED NO:148, SEQ ED NO:149, SEQ ED NO:150, SEQ ED NO:151, SEQ ED NO: 152, SEQ ED NO: 153, SEQ ED NO: 154, SEQ ED NO: 155, SEQ ID NO: 156, SEQ ED NO:157, SEQ ED NO:158, SEQ ED NO:159, SEQ ED NO:160, SEQ ID NO:161, SEQ ED NO:162, SEQ ED NO:163, SEQ ED NO:164, SEQ ED NO:165.
  • SEQ ID NO:166 SEQ ID NO:166,
  • SEQ ED NO:199 SEQ DD NO:193, SEQ DD NO:194, SEQ ED NO:195, SEQ ID NO:196, SEQ H NO:197, SEQ ED NO:198, SEQ ED NO:199, SEQ HD NO:200, SEQ ED NO:201, SEQ ED NO:202, SEQ ED NO:203, SEQ HD NO:204, SEQ ID NO:205, SEQ ED NO:206, SEQ HD NO:207, SEQ ED NO:208, SEQ ED NO:209, SEQ ED NO:210, SEQ ED NO:211, SEQ E) NO:212, SEQ ID NO:213, SEQ HD NO:214, SEQ ED NO:215, SEQ ED NO:216,
  • SEQ DD NO:217, SEQ ED NO:218, SEQ ED NO:219, SEQ ED NO:220, SEQ ED NO:221, SEQ ED NO:222, SEQ ED NO:223, SEQ ED NO:224, SEQ ED NO:225, SEQ ID NO:226, SEQ ED NO:227, SEQ ED NO:228, SEQ ED NO:229, SEQ ID NO:230, SEQ ID NO:231, SEQ ED NO:232, SEQ ED NO:233, SEQ ED NO:234, SEQ ED NO:235, SEQ ID NO:236, SEQ ED NO:237, SEQ ED NO:238, SEQ ID NO:239, SEQ ID NO:240, SEQ ID NO:241 , and SEQ ID NO:242 will have at least 75% identity (preferably 90%, more preferably at least 95% and most preferably 99- 100%) to the sequence of SEQ ID NO: : 122, SEQ ID NO
  • nucleotide sequence is the complement of another nucleotide sequence if all of the nucleotides of the first sequence are complementary to all of the nucleotides of the second sequence.
  • domain refers to a region of a polypeptide that contains a particular function.
  • N-terminal or C-terminal domains of signal transduction proteins can serve functions including, but not limited to, binding molecules that localize the signal transduction molecule to different regions of the cell or binding other signaling molecules directly responsible for propagating a particular cellular signal.
  • Some domains can be expressed separately from the rest of the protein and function by themselves, while others must remain part of the intact protein to retain function. The latter are termed functional regions of proteins and also relate to domains.
  • N-terminal domain refers to the extracatalytic region located between the initiator methionine and the catalytic domain of the protein kinase.
  • the N-terminal domain can be identified following a Smith-Waterman alignment of the protein sequence against the non-redundant protein database to define the N-terminal boundary of the catalytic domain.
  • the N-terminal domain may or may not play a regulatory role in kinase function.
  • PAK65 An example of a protein kinase whose N-terminal domain has been shown to play a regulatory role is PAK65, which contains a CRIB motif used for Cdc42 and rac binding (Burbelo, P.D. et al. (1995) J. Biol. Chem.
  • the N-terminal domain of a protein kinase of the invention is that portion of the protein kinase to the amino-terminal side of the kinase domain where the kinase domain is identified in Table 2, herein. Further, in some cases, portions of the N-terminal domains of the protein kinases of the invention have not been identified since the entire sequence is not available. However, with the methods described herein, the full-length sequences of the kinases of the invention can be determined and using the approaches described herein the N-terminal domain can be identified.
  • catalytic domain refers to a region of the protein kinase that is typically 25-300 amino acids long and is responsible for carrying out the phosphate transfer reaction from a high-energy phosphate donor molecule such as ATP or GTP to itself (autophosphorylation) or to other proteins (exogenous phosphorylation).
  • the catalytic domain of protein kinases is made up of 12 subdomains that contain highly conserved amino acid residues, and are responsible for proper polypeptide folding and for catalysis.
  • the catalytic domain can be identified following a Smith- Waterman alignment of the protein sequence against the non-redundant protein database.
  • the catalytic/kinase domains of the protein kinases of the invention are identified in Table 2, herein. Further, in some cases, the complete sequence of the catalytic/kinase domains of the protein kinases of the invention may not have been provided since the entire sequence is not available. However, with the methods described herein, the full-length sequences of the kinases of the invention can be determined, and using the approaches described herein, the catalytic/kinase domain can be identified.
  • catalytic activity as used herein, defines the rate at which a kinase catalytic domain phosphorylates a substrate.
  • Catalytic activity can be measured, for example, by determining the amount of a substrate converted to a phosphorylated product as a function of time. Catalytic activity can be measured by methods of the invention by holding time constant and determining the concentration of a phosphorylated substrate after a fixed period of time. Phosphorylation of a substrate occurs at the active-site of a protein kinase.
  • the active-site is normally a cavity in which the substrate binds to the protein kinase and is phosphorylated.
  • substrate refers to a molecule phosphorylated by a kinase of the invention.
  • Kinases phosphorylate substrates on serine/threonine or tyrosine amino acids.
  • the molecule may be another protein or a polypeptide.
  • C-terminal domain refers to the region located between the catalytic domain and the carboxy-terminal amino acid residue of the protein kinase.
  • the C- terminal domain can be identified by using a Smith-Waterman alignment of the protein sequence against the non-redundant protein database to define the C-terminal boundary of the catalytic domain or of any functional C-terminal exfracatalytic domain.
  • the C-terminal domain may or may not play a regulatory role in kinase function.
  • PAK3 An example of a protein kinase whose C-terminal domain may play a regulatory role is PAK3 which contains a heterotrimeric G b subunit- binding site near its C-terminus (Leeuw, T.
  • the C- terminal domain of a protein kinase of the invention is that portion of the protein kinase to the carboxy-terminal side of the kinase domain where the kinase domain is identified in Table 2, herein.
  • the C-terminal domains of the protein kinases of the invention have not been provided since the entire sequence is not available. However, with the methods described herein, the full-length sequences of the kinases of the invention can be determined, and using the approaches described herein, the C-terminal domain can be identified.
  • the term "signal transduction pathway" refers to the molecules that propagate an extracellular signal through the cell membrane to become an intracellular signal.
  • the polypeptide molecules involved in signal transduction processes are typically receptor and non-receptor protein tyrosine kinases, receptor and non-receptor protein phosphatases, SRC homology 2 and 3 domains, phosphotyrosine binding proteins (SRC homology 2 (SH2) and phosphotyrosine binding
  • PTB and PH domain containing proteins proline-rich binding proteins (SH3 domain containing proteins), nucleotide exchange factors, and transcription factors.
  • oiled-coil structure region refers to a polypeptide sequence that has a high probability of adopting a coiled-coil structure as predicted by computer algorithms such as COILS (Lupas, A. (1996) Meth. Enzymology 266:513-525).
  • Coiled-coils are formed by two or three amphipathic ⁇ -helices in parallel. Coiled-coils can bind to coiled-coil domains of other polypeptides resulting in homo- or heterodimers (Lupas, A. (1991) Science 252: 1162-1164). Coiled-coil-dependent oligomerization has been shown to be necessary for protein function including catalytic activity of serine/threonine kinases (Roe, J. et al. (1997) J. Biol. Chem. 272:5838-5845). Coiled-coil regions in the proteins of the invention can be identified using these methods. They may be present as sub-domains of the N-terminal, kinase, or C-terminal domains of the polypeptides of the invention.
  • proline-rich region refers to a region of a protein kinase whose proline content over a given amino acid length is higher than the average content of this amino acid found in proteins (i.e., >10%). Proline-rich regions are easily discemable by visual inspection of amino acid sequences and quantitated by standard computer sequence analysis programs such as the DNAStar program EditSeq. Proline-rich regions have been demonstrated to participate in regulatory protein -protein interactions. Among these interactions, those that are most relevant to this invention involve the "PxxP" proline rich motif found in certain protein kinases (i.e., human PAK1) and the SH3 domain of the adaptor molecule Nek (Galisteo, M.L. et al. (1996) J. Biol. Chem. 271 :20997-21000).
  • spacer region refers to a region of the protein kinase located between predicted functional domains.
  • the spacer region has no detectable homology to any amino acid sequence in the database, and can be identified by using a Smith-Waterman alignment of the protein sequence against the non-redundant protein database to define the C- and N-terminal boundaries of the flanking functional domains.
  • Spacer regions may or may not play a fundamental role in protein kinase function. Precedence for the regulatory role of spacer regions in kinase function is provided by the role of the src kinase spacer in inter-domain interactions (Xu, W. et al. (1997) Nature 385:595-602). Spacer regions in the proteins of the invention can be identified using these methods. They may be present as sub-domains of the N-terminal, kinase, or C-terminal domains of the polypeptides of the invention.
  • Insert refers to a portion of a protein kinase that is absent from a close homolog. Inserts may or may not by the product alternative splicing of exons. Inserts can be identified by using a Smith- Waterman sequence alignment of the protein sequence against the non-redundant protein database, or by means of a multiple sequence alignment of homologous sequences using the DNAStar program Megalign. Inserts may play a functional role by presenting a new interface for protein-protein interactions, or by interfering with such interactions. Insert regions in the proteins of the invention can be identified using these methods.
  • C-terminal tail refers to a C-terminal domain of a protein kinase, that by homology extends or protrudes past the C-terminal amino acid of its closest homolog.
  • C-terminal tails can be identified by using a Smith-Waterman sequence alignment of the protein sequence against the non-redundant protein database, or by means of a multiple sequence alignment of homologous sequences using the DNAStar program Megalign. Depending on its length, a C-terminal tail may or may not play a regulatory role in kinase function.
  • C-terminal tail regions in the proteins of the invention can be identified using these methods. They may be present as sub-domains of the N- terminal, kinase, or C-terminal domains of the polypeptides of the invention.
  • Various low or high stringency hybridization conditions may be used depending upon the specificity and selectivity desired. These conditions are well-known to those skilled in the art. Under stringent hybridization conditions only highly complementary nucleic acid sequences hybridize.
  • such conditions prevent hybridization of nucleic acids having more than 1 or 2 mismatches out of 20 contiguous nucleotides, more preferably, such conditions prevent hybridization of nucleic acids having more than 1 or 2 mismatches out of 50 contiguous nucleotides, most preferably, such conditions prevent hybridization of nucleic acids having more than 1 or 2 mismatches out of 100 contiguous nucleotides. In some instances, the conditions may prevent hybridization of nucleic acids having more than 5 mismatches in the full-length sequence.
  • stringent hybridization assay conditions hybridization assay conditions at least as stringent as the following: hybridization in 50% formamide, 5X SSC, 50 mM NaH 2 P0 4 , pH 6.8, 0.5% SDS, 0.1 mg/mL sonicated salmon sperm DNA, and 5X Denhart solution at 42 °C overnight; washing with 2X SSC, 0.1% SDS at 45 °C; and washing with 0.2X SSC, 0.1% SDS at 45 °C.
  • the second wash can be done with 0.1X SSC at a temperature up to 70 °C (pg.
  • the invention features isolated, enriched, or purified nucleic acid molecules encoding kinase polypeptides, further comprising a vector or promoter effective to initiate transcription in a host cell.
  • the invention also features recombinant nucleic acid, preferably in a cell or an organism.
  • the recombinant nucleic acid may contain a sequence selected from the group consisting of those set forth in SEQ
  • SEQ ID NO:l SEQ ID NO:2, SEQ ED NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ED NO:7, SEQ ED NO:8, SEQ ED NO:9, SEQ ED NO: 10, SEQ ID NO:l 1, SEQ ID NO:12, SEQ ED NO:13, SEQ ED NO: 14, SEQ ED NO:15, SEQ ED NO:16, SEQ ED NO:17, SEQ ED NO: 18, SEQ ED NO: 19, SEQ ED NO:20, SEQ ED NO:21, SEQ ED NO:22, SEQ ED NO:23, SEQ ED NO:24, SEQ ED NO:25, SEQ ED NO:26, SEQ ED NO:27, SEQ ED
  • the recombinant nucleic acid can alternatively contain a transcriptional initiation region functional in a cell, a sequence complementary to an RNA sequence encoding a kinase polypeptide and a transcriptional termination region functional in a cell. Specific vectors and host cell combinations are discussed herein.
  • the recombinant nucleic acid can also contain the full-length sequence encoding the protein kinase, or a domain, for example.
  • vector relates to a single or double-stranded circular nucleic acid molecule that can be transfected into cells and replicated within or independently of a cell genome.
  • a circular double-stranded nucleic acid molecule can be cut and thereby linearized upon treatment with restriction enzymes.
  • restriction enzymes An assortment of nucleic acid vectors, restriction enzymes, and the knowledge of the nucleotide sequences cut by restriction enzymes are readily available to those skilled in the art.
  • a nucleic acid molecule encoding a kinase can be inserted into a vector by cutting the vector with restriction enzymes and ligating the two pieces together.
  • transfecting defines a number of methods to insert a nucleic acid vector or other nucleic acid molecules into a cellular organism. These methods involve a variety of techniques, such as treating the cells with high concentrations of salt, an electric field, detergent, or DMSO to render the outer membrane or wall of the cells permeable to nucleic acid molecules of interest or use of various viral transduction strategies.
  • promoter refers to nucleic acid sequence needed for gene sequence expression. Promoter regions vary from organism to organism, but are well known to persons skilled in the art for different organisms. For example, in prokaryotes, the promoter region contains both the promoter (which directs the initiation of RNA transcription) as well as the DNA sequences which, when transcribed into RNA, will signal synthesis initiation. Such regions will normally include those 5 '-non-coding sequences involved with initiation of transcription and translation, such as the TATA box, capping sequence, CAAT sequence, and the like.
  • the isolated nucleic acid comprises, consists essentially of, or consists of a nucleic acid sequence set forth in SEQ ID NO:l, SEQ ED NO:2, SEQ ED NO:3, SEQ ED NO:4, SEQ ED NO:5, SEQ ED NO:6, SEQ ED NO:7, SEQ ED NO:8, SEQ ED NO:9, SEQ ED NO: 10, SEQ ED NO: 11, SEQ ED NO: 12, SEQ ED NO: 13, SEQ ED NO:14, SEQ ED NO:15, SEQ ED NO:16, SEQ ED NO:17, SEQ ED NO:18, SEQ ED NO:19, SEQ ED NO:20, SEQ ED NO:21, SEQ ED NO:22, SEQ ED NO:23, SEQ ED NO:24, SEQ
  • SEQ ED NO:l 15 SEQ LD NO:l 16, SEQ HD N0:117, SEQ HD N0:118, SEQ ID N0:119, SEQ ED NO:120, and SEQ ED N0:121, or the corresponding full-length sequence, encodes an amino acid sequence selected from the group consisting of those set forth in SEQ ID NO: 122, SEQ ED NO: 123, SEQ ED NO: 124, SEQ ED NO: 125, SEQ ED NO: 126, SEQ ID NO:127, SEQ ED NO:128, SEQ ID NO:129, SEQ HD NO:130, SEQ HD NO:131, SEQ HD
  • SEQ ED NO:182 SEQ ED NO:183, SEQ ID NO:184, SEQ HD NO:185, SEQ ID NO:186, SEQ ID NO:187, SEQ HD NO:188, SEQ ID NO:189, SEQ HD NO:190, SEQ HD NO:191, SEQ ED NO:199, SEQ ID NO:193, SEQ ED NO:194, SEQ ED NO:195, SEQ ID NO:196, SEQ ID NO:197, SEQ ED NO:198, SEQ ED NO:199, SEQ ID NO:200, SEQ ID NO:201, SEQ ID NO:202, SEQ ID NO:203, SEQ ED NO:204, SEQ ID NO:205, SEQ ID NO:206, SEQ ID NO:207, SEQ ED NO:208, SEQ ED NO:209, SEQ ID NO:210, SEQ ID N0:211, SEQ ID NO:212, SEQ ID NO:213, SEQ ED NO:214, SEQ ED NO:215, S
  • SEQ ED NO:158 SEQ ED NO:159, SEQ ED NO:160, SEQ ED NO:161, SEQ ED NO:162, SEQ ID NO:163, SEQ ED NO:164, SEQ ED NO:165.
  • SEQ ED NO:208 SEQ ED NO:209, SEQ ED NO:210, SEQ ED NO:211, SEQ ID NO:212, SEQ ID NO:213, SEQ ED NO:214, SEQ ED NO:215, SEQ ED NO:216, SEQ ED NO:217, SEQ ID NO:218, SEQ ED NO:219, SEQ ED NO:220, SEQ ED NO:221, SEQ ED NO:222, SEQ ID NO:223, SEQ ED NO:224, SEQ ED NO:225, SEQ ED NO:226, SEQ ED NO:227, SEQ ED NO:228, SEQ HD NO:229, SEQ ED NO:230, SEQ ED NO:231, SEQ ED NO:232, SEQ ED NO:233, SEQ ED NO:234, SEQ ED NO:235, SEQ ED NO:236, SEQ ID NO:237, SEQ ED NO:238, SEQ ED NO
  • the nucleic acid may be isolated from a natural source by cDNA cloning or by subtractive hybridization.
  • the natural source may be mammalian, preferably human, blood, semen, or tissue, and the nucleic acid may be synthesized by the triester method or by using an automated DNA synthesizer.
  • mice refers preferably to such organisms as mice, rats, rabbits, guinea pigs, sheep, and goats, more preferably to cats, dogs, monkeys, and apes, and most preferably to humans.
  • the nucleic acid is a conserved or unique region, for example those useful for: the design of hybridization probes to facilitate identification and cloning of additional polypeptides, the design of PCR probes to facilitate cloning of additional polypeptides, obtaining antibodies to polypeptide regions, and designing antisense oligonucleotides.
  • conserved nucleic acid regions regions present on two or more nucleic acids encoding a kinase polypeptide, to which a particular nucleic acid sequence can hybridize under lower stringency conditions. Examples of lower stringency conditions suitable for screening for nucleic acid encoding kinase polypeptides are provided in Berger et al. (1987) Guide to Molecular Cloning Techniques, Meth. Enzym. vol. 152, hereby incorporated by reference herein in its entirety, including any drawings, figures, or tables. Preferably, conserved regions differ by no more than 5 out of 20 nucleotides, even more preferably 2 out of 20 nucleotides or most preferably 1 out of 20 nucleotides.
  • nucleic acid region is meant a sequence present in a nucleic acid coding for a kinase polypeptide that is not present in a sequence coding for any other naturally occurring polypeptide.
  • Such regions preferably encode 10 (preferably 25, more preferably 50, most preferably 75) or more contiguous amino acids selected from the group consisting of those set forth in SEQ ID NO:122, SEQ ID NO:123, SEQ ID NO:124, SEQ ED NO:125, SEQ ED NO:126, SEQ ED NO:127, SEQ ID NO:128, SEQ ID NO:129, SEQ ED NO:130, SEQ ED N0:131, SEQ DD NO:132, SEQ DD NO:133, SEQ ED NO:134, SEQ ED NO:135, SEQ ED NO:136, SEQ ED NO:137, SEQ ED NO:138, SEQ ID NO:139, SEQ ED NO:140, SEQ ED N0:141, SEQ ED NO:142
  • SEQ ED NO:166 SEQ DD NO:167, SEQ DD NO:168, SEQ ID NO:169, SEQ ED NO:170, SEQ DD N0:171, SEQ DD NO:172, SEQ HD NO:173, SEQ ID NO:174,
  • a unique nucleic acid region is preferably of mammalian origin and preferably human.
  • a second aspect of the invention features a nucleic acid probe for the detection of nucleic acid encoding a kinase polypeptide in a sample, wherein said polypeptide is selected from the group consisting of SEQ ID NO:122, SEQ ED NO:123, SEQ ID NO:124, SEQ ED NO: 125, SEQ ED NO: 126, SEQ ED NO: 127, SEQ ED NO: 128, SEQ ED NO: 129,
  • SEQ ED NO: 165 SEQ ED NO: 166, SEQ HD NO: 167, SEQ ID NO: 168, SEQ ID NO: 169, SEQ ED NO:170, SEQ ID NO:171, SEQ ED NO:172, SEQ ID NO:173, SEQ ID NO:174, SEQ ED NO:175, SEQ ID NO:176, SEQ HD NO:177, SEQ HD NO:178, SEQ ID NO:179, SEQ ED NO: 180, SEQ ED NO: 181, SEQ ED NO: 182, SEQ ED NO: 183, SEQ ED NO: 184, SEQ ED NO:185, SEQ ID NO:186, SEQ HD NO:187, SEQ ED NO:188, SEQ ED NO:189,
  • SEQ ED NO:215 SEQ HD NO:216, SEQ HD NO:217, SEQ ED NO:218, SEQ ID NO:219, SEQ ED NO:220, SEQ ED NO:221, SEQ ED NO:222, SEQ ID NO:223, SEQ ID NO:224, SEQ HD NO:225, SEQ HD NO:226, SEQ ID NO:227, SEQ ID NO:228, SEQ ID NO:229, SEQ ED NO:230, SEQ ID NO:231, SEQ ED NO:232, SEQ ED NO:233, SEQ ID NO:234, SEQ ED NO:235, SEQ ED NO:236, SEQ ED NO:237, SEQ ID NO:238, SEQ ID NO:239,
  • the nucleic acid probe encodes a kinase polypeptide that is a fragment of the protein encoded by an amino acid sequence selected from the group consisting of those set forth in SEQ ED NO: 122, SEQ ED NO:123, SEQ ED NO:124, SEQ ED NO:125, SEQ ED NO:126, SEQ ED NO:127, SEQ ED NO:128, SEQ ED NO:129, SEQ ED NO:130, SEQ ED NO:131, SEQ ED NO:132,
  • the nucleic acid probe contains a nucleotide base sequence that will hybridize to a sequence selected from the group consisting of those set forth in SEQ ID NO:l, SEQ ED NO:2, SEQ ED NO:3, SEQ ED NO:4, SEQ ED NO:5, SEQ ED NO:6, SEQ ED NO:7, SEQ ED NO:8, SEQ ID NO:9, SEQ ED NO:10, SEQ ED NO:l l, SEQ ED NO:12, SEQ ED NO:13, SEQ ID NO:14, SEQ
  • SEQ ED NO: 15 SEQ ED NO: 16, SEQ ED NO: 17, SEQ ED NO: 18, SEQ ED NO: 19, SEQ ID NO:20, SEQ ED NO:21, SEQ ED NO:22, SEQ ID NO:23, SEQ ID NO:24, SEQ ED NO:25, SEQ ED NO:26, SEQ ED NO:27, SEQ ED NO:28, SEQ ED NO:29, SEQ ED NO:30, SEQ ED NO:31, SEQ ED NO:32, SEQ ED NO:33, SEQ ED NO:34, SEQ ID NO:35, SEQ ID NO:36, SEQ ED NO:37, SEQ ED NO:38, SEQ ED NO:39, SEQ ED NO:40, SEQ ID NO:41 ,
  • SEQ ID NO: 105 SEQ ED NO: 106, SEQ ED NO: 107, SEQ ED NO: 108, SEQ ED NO: 109, SEQ ID NO:110, SEQ DD N0:111, SEQ ED NO:112, SEQ ED N0:113, SEQ ED N0:114, SEQ ID N0:115, SEQ E N0:116, SEQ N0:117, SEQ ED N0:118, SEQ ED N0:119, SEQ ID NO:120, and SEQ ED N0:121, or the corresponding full-length sequence, or a functional derivative thereof.
  • the nucleic acid probe hybridizes to nucleic acid encoding at least 6, 12, 75, 90, 105, 120, 150, 200, 250, 300 or 350 contiguous amino acids of a sequence selected from the group consisting of those set forth in SEQ ED N0.122, SEQ ED NO:123, SEQ ID NO:124, SEQ ID NO:125, SEQ ID NO:126, SEQ ID NO:127, SEQ ED NO:128, SEQ ED NO:129, SEQ ED NO:130, SEQ ED NO:131, SEQ ID
  • SEQ ED NO: 157 SEQ ED NO: 158, SEQ ED NO: 159, SEQ ED NO: 160, SEQ ED NO: 161, SEQ ID NO:162, SEQ ED NO:163, SEQ ED NO:164, SEQ ED NO:165.
  • SEQ ED NO:182 SEQ ED NO:183, SEQ ED NO:184, SEQ ID NO:185, SEQ ID NO:186, SEQ ID NO:187, SEQ ED NO:188, SEQ ED NO:189, SEQ ED NO:190, SEQ ID NO:191, SEQ ID NO: 199, SEQ ED NO: 193, SEQ ED NO: 194, SEQ ED NO: 195, SEQ ED NO: 196, SEQ ED NO:197, SEQ ED NO:198, SEQ ED NO:199, SEQ ED NO:200, SEQ ED NO:201, SEQ ED NO:202, SEQ ED NO:203, SEQ ED NO:204, SEQ ED NO:205, SEQ ID NO:206, SEQ ID NO:
  • Methods for using the probes include detecting the presence or amount of kinase RNA in a sample by contacting the sample with a nucleic acid probe under conditions such that hybridization occurs and detecting the presence or amount of the probe bound to kinase RNA.
  • the nucleic acid duplex formed between the probe and a nucleic acid sequence coding for a kinase polypeptide may be used in the identification of the sequence of the nucleic acid detected (Nelson et al., in Nonisotopic DNA Probe Techniques, Academic Press, San Diego, Kricka, ed., p. 275, 1992, hereby incorporated by reference herein in its entirety, including any drawings, figures, or tables).
  • Kits for performing such methods may be constructed to include a container means having disposed therein a nucleic acid probe.
  • the invention describes a recombinant cell or tissue comprising a nucleic acid molecule encoding a kinase polypeptide selected from the group consisting of SEQ ED NO:122, SEQ ED NO:123, SEQ ED NO:124, SEQ ED NO:125, SEQ ID NO:126,
  • SEQ ED NO: 152 SEQ ED NO: 153, SEQ ID NO.T54, SEQ ED NO: 155, SEQ ED NO: 156, SEQ ED NO: 157, SEQ ED NO: 158, SEQ ED NO: 159, SEQ HD NO: 160, SEQ ED NO: 161, SEQ ED NO:162, SEQ ED NO:163, SEQ ED NO:164, SEQ ED NO:165.
  • SEQ ED NO:212 SEQ ED NO:213, SEQ ED NO:214, SEQ ED NO:215, SEQ ED NO:216, SEQ ED NO:217, SEQ ED NO:218, SEQ ED NO:219, SEQ ED NO:220, SEQ ID NO:221, SEQ ED NO:222, SEQ ED NO:223, SEQ ED NO:224, SEQ ID NO:225, SEQ ED NO:226, SEQ ED NO:227, SEQ ID NO:228, SEQ ED NO:229, SEQ ID NO:230, SEQ ID NO:231, SEQ ED NO:232, SEQ ED NO:233, SEQ ID NO:234, SEQ D NO:235, SEQ ID NO:236,
  • the nucleic acid may be under the control of the genomic regulatory elements, or may be under the control of exogenous regulatory elements including an exogenous promoter.
  • exogenous it is meant a promoter that is not normally coupled in vivo transcriptionally to the coding sequence for the kinase polypeptides.
  • the polypeptide is preferably a fragment of the protein encoded by an amino acid sequence selected from the group consisting of those set forth in SEQ ID NO: 122, SEQ ID NO: 123, SEQ ID NO: 124, SEQ HD NO: 125, SEQ ED NO: 126, SEQ ED NO: 127, SEQ ID NO:128, SEQ ED NO:129, SEQ ED NO:130, SEQ ED NO:131, SEQ ED NO:132, SEQ ID NO: 122, SEQ ID NO: 123, SEQ ID NO: 124, SEQ HD NO: 125, SEQ ED NO: 126, SEQ ED NO: 127, SEQ ID NO:128, SEQ ED NO:129, SEQ ED NO:130, SEQ ED NO:131, SEQ ED NO:132, SEQ ID NO: 122, SEQ ID NO: 123, SEQ ID NO: 124, SEQ HD NO: 125, SEQ ED NO: 126, SEQ ED
  • SEQ ED NO: 158 SEQ ED NO: 159, SEQ ED NO: 160, SEQ ED NO: 161, SEQ ED NO: 162, SEQ ID NO:163, SEQ ED NO:164, SEQ ED NO:165.
  • fragment an amino acid sequence present in a kinase polypeptide.
  • a sequence comprises at least 10, 20, 40, 50, 75, 100, 200, or 300 contiguous amino acids a sequence selected from the group consisting of those set forth in SEQ ID NO:122, SEQ ID NO:123, SEQ ID NO:124, SEQ ED NO:125, SEQ ED NO:126, SEQ ED NO:127, SEQ ID NO:128, SEQ DD NO:129,
  • SEQ ED NO: 155 SEQ ED NO: 156, SEQ ED NO: 157, SEQ ED NO: 158, SEQ ED NO: 159, SEQ ED NO:160, SEQ ED NO:161, SEQ ED NO:162, SEQ ED NO:163, SEQ HD NO:164, SEQ ED NO:165.
  • SEQ ED NO:205 SEQ ED NO:206, SEQ ID NO:207, SEQ ID NO:208, SEQ ID NO:209, SEQ ED NO:210, SEQ ED NO:211, SEQ ID NO:212, SEQ ID NO:213, SEQ ID NO:214, SEQ HD NO:215, SEQ HD NO:216, SEQ HD NO:217, SEQ HD NO:218, SEQ HD NO:219, SEQ ED NO:220, SEQ HD NO:221, SEQ HD NO:222, SEQ HD NO:223, SEQ ID NO:224, SEQ HD NO:225, SEQ ED NO:226, SEQ ED NO:227, SEQ HD NO:228, SEQ ⁇ D NO:229, SEQ HD NO:230, SEQ ⁇ D NO:231, SEQ HD NO:232, SEQ ⁇ D NO:233, SEQ ID NO:234, SEQ ED NO:235, SEQ ED NO:236, SEQ ED NO:237,
  • SEQ ID NO:240 SEQ ID NO:241, and SEQ ID NO:242, or of the corresponding full- length amino acid sequence, or a functional derivative thereof.
  • the invention features an isolated, enriched, or purified kinase polypeptide selected from the group consisting of SEQ ID NO:122, SEQ ID NO:123, SEQ ED NO:124, SEQ ED NO:125, SEQ ID NO:126, SEQ HD NO:127, SEQ ID NO:128, SEQ
  • ED NO:154 SEQ ED NO:155, SEQ ED NO:156, SEQ ED NO:157, SEQ ED NO:158, SEQ ED NO:159, SEQ ED NO:160, SEQ ED NO:161, SEQ ED NO:162, SEQ ED NO:163, SEQ ED NO:164, SEQ ED NO:165.
  • ED NO:229 SEQ ED NO:230, SEQ ED NO:231, SEQ ED NO:232, SEQ ID NO:233, SEQ ID NO:234, SEQ ED NO:235, SEQ ED NO:236, SEQ ED NO:237, SEQ ID NO:238, SEQ ED NO:239, SEQ ED NO:240, SEQ ID NO:241, and SEQ ID NO:242.
  • isolated in reference to a polypeptide is meant a polymer of amino acids (2 or more amino acids) conjugated to each other, including polypeptides that are isolated from a natural source or that are synthesized.
  • the isolated polypeptides of the present invention are unique in the sense that they are not found in a pure or separated state in nature.
  • Use of the term “isolated” indicates that a naturally occurring sequence has been removed from its normal cellular environment. Thus, the sequence may be in a cell-free solution or placed in a different cellular environment. The term does not imply that the sequence is the only amino acid chain present, but that it is essentially free (about 90 - 95% pure at least) of non-amino acid material naturally associated with it.
  • enriched in reference to a polypeptide is meant that the specific amino acid sequence constitutes a significantly higher fraction (2 - 5 fold) of the total amino acid sequences present in the cells or solution of interest than in normal or diseased cells or in the cells from which the sequence was taken. This could be caused by a person by preferential reduction in the amount of other amino acid sequences present, or by a preferential increase in the amount of the specific amino acid sequence of interest, or by a combination of the two. However, it should be noted that enriched does not imply that there are no other amino acid sequences present, just that the relative amount of the sequence of interest has been significantly increased.
  • the term significant here is used to indicate that the level of increase is useful to the person making such an increase, and generally means an increase relative to other amino acid sequences of about at least 2-fold, more preferably at least 5- to 10-fold or even more.
  • the term also does not imply that there is no amino acid sequence from other sources.
  • the other source of amino acid sequences may, for example, comprise amino acid sequence encoded by a yeast or bacterial genome, or a cloning vector such as pUC19. The term is meant to cover only those situations in which man has intervened to increase the proportion of the desired amino acid sequence.
  • an amino acid sequence be in purified form.
  • purified in reference to a polypeptide does not require absolute purity (such as a homogeneous preparation); instead, it represents an indication that the sequence is relatively purer than in the natural environment. Compared to the natural level this level should be at least 2-5 fold greater (e.g., in terms of mg/mL). Purification of at least one order of magnitude, preferably two or three orders, and more preferably four or five orders of magnitude is expressly contemplated. The substance is preferably free of contamination at a functionally significant level, for example 90%, 95%, or 99% pure.
  • the kinase polypeptide is a fragment of the protein encoded by an amino acid sequence selected from the group consisting of those set forth in SEQ ED NO:122, SEQ ID NO:123, SEQ ID NO:124, SEQ ID NO:125, SEQ ID NO:126, SEQ ED NO:127, SEQ ED NO:128, SEQ ED NO:129, SEQ ED NO:130, SEQ ED NO:131, SEQ ED NO:132, SEQ ED NO:133, SEQ ED NO:134, SEQ ED NO:135, SEQ ID NO:136, SEQ ED NO:137, SEQ ED NO:138, SEQ ED NO:139, SEQ ED NO:140, SEQ ED NO:141,
  • SEQ ED NO: 142 SEQ ED NO: 143, SEQ ED NO: 144, SEQ ED NO: 145, SEQ ED NO: 146, SEQ ED NO:147, SEQ ED NO:148, SEQ ED NO:149, SEQ ED NO:150, SEQ ED NO:151, SEQ ED NO: 152, SEQ ED NO: 153, SEQ ED NO: 154, SEQ ED NO: 155, SEQ ED NO: 156, SEQ ED NO:157, SEQ ED NO:158, SEQ ED NO:159, SEQ ED NO:160, SEQ ED NO:161, SEQ ED NO: 162, SEQ ED NO: 163, SEQ ED NO: 164, SEQ ED NO: 165.
  • SEQ ID NO: 166 SEQ ID NO: 166,
  • SEQ ED NO:199 SEQ ED NO:193, SEQ ED NO:194, SEQ ED NO:195, SEQ ED NO:196, SEQ ED NO: 197, SEQ ED NO: 198, SEQ ED NO: 199, SEQ ED NO:200, SEQ ED NO:201, SEQ ED NO:202, SEQ ED NO:203, SEQ ED NO:204, SEQ ED NO:205, SEQ ED NO:206, SEQ ED NO:207, SEQ ED NO:208, SEQ ED NO:209, SEQ ED NO:210, SEQ ED NO:211, SEQ ED NO:212, SEQ HD NO:213, SEQ HD NO:214, SEQ ID NO:215, SEQ ID NO:216,
  • the kinase polypeptide contains at least 10, 20, 40, 50, 75, 100, 200, or 300 contiguous amino acids a sequence selected from the group consisting of those set forth in SEQ ID NO: 122, SEQ ID NO:123, SEQ ED NO:124, SEQ ED NO:125, SEQ ED NO: 126, SEQ ED NO:127, SEQ ED NO:128, SEQ ID NO:129, SEQ HD NO:130, SEQ HD NO:131, SEQ ED NO: 132, SEQ ED NO: 133, SEQ ED NO: 134, SEQ ED NO: 135, SEQ ED NO: 136, SEQ ED NO:137, SEQ ED NO:138, SEQ ED NO:139, SEQ ED NO:140, SEQ ID NO:141, SEQ ID NO: 122, SEQ ID NO:123, SEQ ED NO:124, SEQ ED NO:125, SEQ ED NO: 126, SEQ ED NO:127, S
  • SEQ ED NO:142 SEQ ED NO:143, SEQ ED NO:144, SEQ ED NO:145, SEQ ED NO:146, SEQ ID NO: 147, SEQ ED NO: 148, SEQ ED NO: 149, SEQ ID NO: 150, SEQ ID NO: 151, SEQ ID NO:152, SEQ ED NO:153, SEQ ED NO:154, SEQ ED NO:155, SEQ ID NO:156, SEQ ID NO:157, SEQ ED NO:158, SEQ ED NO:159, SEQ ID NO:160, SEQ ID NO:161, SEQ ID NO:162, SEQ ED NO:163, SEQ ED NO:164, SEQ ED NO:165.
  • SEQ ED NO:166 SEQ ID NO:
  • ED NO:242 or the corresponding full-length amino acid sequence, or a functional derivative thereof.
  • the kinase polypeptide comprises an amino acid sequence having (a) an amino acid sequence selected from the group consisting of those set forth in SEQ ID NO:122, SEQ ED NO:123, SEQ ED NO:124, SEQ ED NO:125, SEQ
  • SEQ ED NO: 126 SEQ ED NO: 127, SEQ ED NO: 128, SEQ ED NO: 129, SEQ ED NO: 130, SEQ ED NO:131, SEQ ED NO:132, SEQ ED NO:133, SEQ ED NO:134, SEQ ID NO:135, SEQ ED NO:136, SEQ ED NO:137, SEQ ED NO:138 , SEQ ED NO:139, SEQ ID NO:140, SEQ ED NO:141, SEQ ED NO:142, SEQ ED NO:143 , SEQ ED NO:144, SEQ ED NO:145, SEQ ED NO: 146, SEQ ED NO: 147, SEQ DD NO: 148 , SEQ ED NO: 149, SEQ ID NO: 150, SEQ ED NO:151, SEQ ED NO:152, SEQ ED NO:153 , SEQ ED NO: 154, SEQ ID NO: 155, SEQ ED NO:
  • SEQ ED NO: 160 SEQ ED NO: 161, SEQ ED NO: 162 , SEQ ED NO: 163, SEQ ID NO: 164, SEQ ED NO: 165.
  • ED NO: 195 SEQ ED NO: 196, SEQ ED NO: 197, SEQ ED NO: 198, SEQ ID NO: 199, SEQ ED NO:200, SEQ ED NO:201, SEQ ED NO:202, SEQ ED NO:203, SEQ ID NO:204, SEQ ED NO:205, SEQ ED NO:206, SEQ ED NO:207, SEQ ED NO:208, SEQ ID NO:209, SEQ ED NO:210, SEQ ED NO:211, SEQ ED NO:212, SEQ ED NO:213, SEQ ED NO:214, SEQ ED NO:215, SEQ ED NO:216, SEQ ED NO:217, SEQ ED NO:218, SEQ ED NO:219, SEQ
  • ED NO:220 SEQ DD NO:221, SEQ HD NO:222, SEQ ED NO:223, SEQ ED NO:224, SEQ ED NO:225, SEQ ED NO:226, SEQ ED NO:227, SEQ ED NO:228, SEQ ED NO:229, SEQ ED NO:230, SEQ ED NO:231, SEQ ED NO:232, SEQ ED NO:233, SEQ ED NO:234, SEQ ED NO:235, SEQ ED NO:236, SEQ ED NO:237, SEQ ED NO:238, SEQ ED NO:239, SEQ ID NO:240, SEQ ED NO:241, and SEQ ED NO:242, except that it lacks one or more, but not all, of a domain selected from the group consisting of an N-terminal domain, a catalytic domain, a C-terminal domain, a coiled-coil structure region, a proline-rich region, a spacer
  • SEQ ED NO:174 SEQ ED NO:175, SEQ ED NO:176, SEQ ED NO:177, SEQ ID NO:178, SEQ ED NO:179, SEQ ED NO:180, SEQ ED NO:181, SEQ ED NO:182, SEQ ID NO:183, SEQ ED NO:184, SEQ ED NO:185, SEQ ED NO:186, SEQ ED NO:187, SEQ ED NO:188, SEQ ED NO:189, SEQ ED NO:190, SEQ ED NO:191, SEQ ED NO:199, SEQ ID NO:193, SEQ ED NO:194, SEQ ED NO:195, SEQ ED NO:196, SEQ ED NO:197, SEQ ED NO:198,
  • the polypeptide can be isolated from a natural source by methods well-known in the art.
  • the natural source may be mammalian, preferably human, blood, semen, or tissue, and the polypeptide may be synthesized using an automated polypeptide synthesizer.
  • the isolated, enriched, or purified kinase polypeptide is preferably selected from the group consisting of those set forth in SEQ ID NO:122, SEQ ED NO:123, SEQ ED NO:124, SEQ ED NO:125, SEQ ED NO:126, SEQ ED NO:127, SEQ ED NO:128, SEQ ID NO:129, SEQ ED NO:130, SEQ ED NO:131, SEQ ED NO:132, SEQ ED NO:133, SEQ ED NO:134, SEQ ED NO:135, SEQ ED NO:136, SEQ ED NO:137, SEQ ED NO:138, SEQ ED NO:139, SEQ
  • SEQ ED NO: 165 SEQ ED NO: 166, SEQ ID NO: 167, SEQ ID NO: 168, SEQ ID NO: 169, SEQ ED NO:170, SEQ ED NO:171, SEQ ED NO:172, SEQ ED NO:173, SEQ ID NO:174, SEQ ED NO:175, SEQ ED NO:176, SEQ ID NO:177, SEQ ED NO:178, SEQ ED NO:179, SEQ ED NO: 180, SEQ ED NO: 181, SEQ ID NO: 182, SEQ ED NO: 183, SEQ ID NO: 184, SEQ ID NO:185, SEQ ED NO:186, SEQ ED NO:187, SEQ ED NO:188, SEQ ED NO:189, SEQ
  • ED NO:225 SEQ ED NO:226, SEQ ID NO:227, SEQ ID NO:228, SEQ ID NO:229, SEQ ED NO:230, SEQ ED NO:231, SEQ DD NO:232, SEQ ID NO:233, SEQ ID NO:234, SEQ DD NO:235, SEQ ED NO:236, SEQ ED NO:237, SEQ ED NO:238, SEQ ID NO:239, SEQ ID NO:240, SEQ ED NO:241, and SEQ ID NO:242A.
  • the invention includes a recombinant kinase polypeptide selected from the group consisting of SEQ ID NO:122, SEQ ED NO:123, SEQ ED NO: 124, SEQ ED NO:125, SEQ ED NO:126, SEQ ED NO:127, SEQ ED NO:128, SEQ ID NO:129, SEQ ED NO:130, SEQ ED NO:131, SEQ ED NO:132, SEQ ED NO:133, SEQ ED NO:134, SEQ ED NO:135, SEQ ED NO:136, SEQ ED NO:137, SEQ ED NO:138, SEQ ED NO:139, SEQ H NO:140, SEQ ED NO:141, SEQ ED NO:142, SEQ ED NO:143, SEQ ED NO:144,
  • SEQ ED NO:220 SEQ ED NO:221, SEQ ID NO:222, SEQ ED NO:223, SEQ ID NO:224, SEQ ED NO:225, SEQ ED NO:226, SEQ ED NO:227, SEQ ID NO:228, SEQ ID NO:229, SEQ ED NO:230, SEQ ED NO:231, SEQ ID NO:232, SEQ ED NO:233, SEQ ID NO:234, SEQ ED NO:235, SEQ ED NO:236, SEQ ED NO:237, SEQ ED NO:238, SEQ ID NO:239, SEQ ED NO:240, SEQ ED NO:241, and SEQ ED NO:242.
  • recombinant kinase polypeptide is meant a polypeptide produced by recombinant DNA techniques such that it is distinct from a naturally occurring polypeptide either in its location (e.g., present in a different cell or tissue than found in nature), purity or structure. Generally, such a recombinant polypeptide will be present in a cell in an amount different from that normally observed in nature.
  • the invention features an antibody (e.g. , a monoclonal or polyclonal antibody) having specific binding affinity to a kinase polypeptide or a kinase polypeptide domain or fragment where the polypeptide is selected from the group consisting of SEQ ED NO: 122, SEQ ED NO: 123, SEQ ED NO: 124, SEQ ED NO: 125, SEQ ED NO:126, SEQ ED NO:127, SEQ ID NO:128, SEQ ID NO:129, SEQ ID NO:130, SEQ ED NO:131, SEQ ED NO:132, SEQ ED NO:133, SEQ ED NO:134, SEQ ED NO:135, SEQ DD NO:136, SEQ DD NO:137, SEQ ED NO:138, SEQ ED NO:139, SEQ ID NO:140, SEQ
  • the antibody binds specifically to domains of kinase polypeptides, that are defined supra.
  • binding affinity is meant that the antibody binds to the target kinase polypeptide with greater affinity than it binds to other polypeptides under specified conditions.
  • Antibodies or antibody fragments are polypeptides that contain regions that can bind other polypeptides.
  • the term “specific binding affinity” describes an antibody that binds to a kinase polypeptide with greater affinity than it binds to other polypeptides under specified conditions.
  • polyclonal refers to antibodies that are heterogenous populations of antibody molecules derived from the sera of animals immunized with an antigen or an antigenic functional derivative thereof.
  • various host animals may be immunized by injection with the antigen.
  • Various adjuvants may be used to increase the immunological response, depending on the host species.
  • Monoclonal antibodies are substantially homogenous populations of antibodies to a particular antigen. They may be obtained by any technique which provides for the production of antibody molecules by continuous cell lines in culture. Monoclonal antibodies may be obtained by methods known to those skilled in the art (Kohler et al. ,
  • antibody fragment refers to a portion of an antibody, often the hyper variable region and portions of the surrounding heavy and light chains, that displays specific binding affinity for a particular molecule.
  • a hyper variable region is a portion of an antibody that physically binds to the polypeptide target.
  • Antibodies or antibody fragments having specific binding affinity to a kinase polypeptide or domains of a kinase polypeptide of the invention may be used in methods for detecting the presence and/or amount of kinase polypeptide in a sample by probing the sample with the antibody under conditions suitable for kinase-antibody immunocomplex formation and detecting the presence and/or amount of the antibody conjugated to the kinase polypeptide. Diagnostic kits for performing such methods may be constructed to include antibodies or antibody fragments specific for the kinase as well as a conjugate of a binding partner of the antibodies or the antibodies themselves.
  • An antibody or antibody fragment with specific binding affinity to a kinase polypeptide of the invention can be isolated, enriched, or purified from a prokaryotic or eukaryotic organism. Routine methods known to those skilled in the art enable production of antibodies or antibody fragments, in both prokaryotic and eukaryotic organisms. Purification, enrichment, and isolation of antibodies, which are polypeptide molecules, are described above.
  • Antibodies having specific binding affinity to a kinase polypeptide of the invention may be used in methods for detecting the presence and/or amount of kinase polypeptide in a sample by contacting the sample with the antibody under conditions such that an immunocomplex forms and detecting the presence and/or amount of the antibody conjugated to the kinase polypeptide.
  • Diagnostic kits for performing such methods may be constructed to include a first container containing the antibody and a second container having a conjugate of a binding partner of the antibody and a label, such as, for example, a radioisotope. The diagnostic kit may also include notification of an FDA approved use and instructions therefor.
  • the invention features a hybridoma which produces an antibody having specific binding affinity to a kinase polypeptide or a kinase polypeptide domain, where the polypeptide is selected from the group consisting of SEQ ID NO: 122, SEQ ID NO: 123, SEQ ID NO: 124, SEQ ID NO: 125, SEQ ID NO: 126, SEQ ID NO: 127, SEQ ID NO:128, SEQ ED NO:129, SEQ ED NO:130, SEQ ED NO:131, SEQ ED NO:132, SEQ ID NO:133, SEQ ED NO:134, SEQ ED NO:135, SEQ ED NO:136, SEQ ID NO:137, SEQ ID NO:138, SEQ ED NO:139, SEQ ED NO:140, SEQ ED NO:141, SEQ ID NO:142, SEQ ID NO: 122, SEQ ID NO: 123, SEQ ID NO: 124, SEQ ID NO: 125, SEQ ID NO:
  • SEQ ED NO:143 SEQ ED NO:144, SEQ ED NO:145, SEQ ED NO:146, SEQ ED NO:147, SEQ ID NO:148, SEQ ED NO:149, SEQ ED NO:150, SEQ ED NO:151, SEQ ED NO:152, SEQ ID NO:153, SEQ ED NO:154, SEQ ED NO:155, SEQ ED NO:156, SEQ ED NO:157, SEQ ID NO:158, SEQ HD NO:159, SEQ ED NO:160, SEQ ED NO:161, SEQ ED NO:162, SEQ ID NO:163, SEQ ED NO:164, SEQ ED NO:165.
  • SEQ ED NO:203 SEQ ED NO:204, SEQ ED NO:205, SEQ ED NO:206, SEQ ED NO:207, SEQ ED NO:208, SEQ ED NO:209, SEQ ED NO:210, SEQ ED NO:211, SEQ ED NO:212, SEQ ED NO:213, SEQ ED NO:214, SEQ ED NO:215, SEQ ED NO:216, SEQ ED NO:217, SEQ ID NO:218, SEQ ED NO:219, SEQ ED NO:220, SEQ ID NO:221, SEQ ID NO:222, SEQ ID NO:223, SEQ ED NO:224, SEQ ID NO:225, SEQ ID NO:226, SEQ ID NO:227, SEQ ID
  • hybrida is meant an immortalized cell line that is capable of secreting an antibody, for example an antibody to a kinase of the invention.
  • the antibody to the kinase comprises a sequence of amino acids that is able to specifically bind a kinase polypeptide of the invention.
  • the invention features a kinase polypeptide binding agent able to bind to a kinase polypeptide selected from the group consisting of SEQ ED NO: 122, SEQ ED NO:123, SEQ ED NO:124, SEQ ED NO:125, SEQ ED NO:126, SEQ ED NO:127,
  • SEQ ED NO:153 SEQ DD NO:154, SEQ ED NO:155, SEQ ED NO:156, SEQ ID NO:157, SEQ ED NO:158, SEQ ED NO:159, SEQ ED NO:160, SEQ ID NO: 161, SEQ ID NO: 162, SEQ ED NO:163, SEQ ED NO:164, SEQ ED NO:165.
  • the binding agent is preferably a purified antibody that recognizes an epitope present on a kinase polypeptide of the invention.
  • Other binding agents include molecules that bind to kinase polypeptides and analogous molecules that bind to a kinase polypeptide. Such binding agents may be identified by using assays that measure kinase binding partner activity, such as those that measure PDGFR activity.
  • the invention also features a method for screening for human cells containing a kinase polypeptide of the invention or an equivalent sequence.
  • the method involves identifying the novel polypeptide in human cells using techniques that are routine and standard in the art, such as those described herein for identifying the kinases of the invention (e.g., cloning, Southern or Northern blot analysis, in situ hybridization, PCR amplification, etc.).
  • the invention features methods for identifying a substance that modulates kinase activity comprising the steps of: (a) contacting a kinase polypeptide selected from the group consisting of SEQ ID NO:122, SEQ ED NO:123, SEQ ID NO:124,
  • SEQ ED NO: 185 SEQ ED NO: 186, SEQ ED NO: 187, SEQ ID NO: 188, SEQ ID NO: 189, SEQ ED NO:190, SEQ ED NO:191, SEQ ID NO:199, SEQ ID NO:193, SEQ ID NO: 194, SEQ ED NO:195, SEQ ED NO:196, SEQ ED NO:197, SEQ ED NO:198, SEQ ID NO:199, SEQ ED NO:200, SEQ ED NO:201, SEQ ED NO:202, SEQ ID NO:203, SEQ ID NO:204, SEQ ED NO:205, SEQ ED NO:206, SEQ ED NO:207, SEQ ID NO:208, SEQ ID NO:209,
  • SEQ ED NO:235 SEQ ED NO:236, SEQ ED NO:237, SEQ ED NO:238, SEQ ED NO:239, SEQ ED NO:240, SEQ ED NO:241, and SEQ ED NO:242 with a test substance; (b) measuring the activity of said polypeptide; and (c) determining whether said substance modulates the activity of said polypeptide.
  • modulates refers to the ability of a compound to alter the function of a kinase of the invention.
  • a modulator preferably activates or inhibits the activity of a kinase of the invention.
  • the term "activates” refers to increasing the cellular activity of the kinase.
  • the term inhibit refers to decreasing the cellular activity of the kinase.
  • Kinase activity is preferably the interaction with a natural binding partner.
  • modulates also refers to altering the function of kinases of the invention by increasing or decreasing the probability that a complex forms between the kinase and a natural binding partner.
  • a modulator preferably increases the probability that such a complex forms between the kinase and the natural binding partner, more preferably increases or decreases the probability that a complex forms between the kinase and the natural binding partner depending on the concentration of the compound exposed to the kinase, and most preferably decreases the probability that a complex forms between the kinase and the natural binding partner.
  • complex refers to an assembly of at least two molecules bound to one another.
  • Signal transduction complexes often contain at least two protein molecules bound to one another.
  • GRB2 protein tyrosine receptor protein kinase
  • SOS, RAF, and RAS assemble to form a signal transduction complex in response to a mitogenic ligand.
  • natural binding partner refers to polypeptides, lipids, small molecules, or nucleic acids that bind to kinases in cells.
  • a change in the interaction between a kinase and a natural binding partner can manifest itself as an increased or decreased probability that the interaction forms, or an increased or decreased concentration of kinase/natural binding partner complex.
  • contacting refers to mixing a solution comprising the test compound with a liquid medium bathing the cells of the methods.
  • the solution comprising the compound may also comprise another component, such as dimethyl sulfoxide (DMSO), which facilitates the uptake of the test compound or compounds into the cells of the methods.
  • DMSO dimethyl sulfoxide
  • the solution comprising the test compound may be added to the medium bathing the cells by utilizing a delivery apparatus, such as a pipet-based device or syringe-based device.
  • the invention features methods for identifying a substance that modulates kinase activity in a cell comprising the steps of: (a) expressing a kinase polypeptide in a cell, wherein said polypeptide is selected from the group consisting of SEQ ID NO: 122, SEQ ED NO: 123, SEQ ED NO: 124, SEQ ID NO: 125, SEQ ID NO: 126, SEQ ED NO:127, SEQ ED NO:128, SEQ ED NO:129, SEQ ID NO:130, SEQ ID NO:131, SEQ ED NO:132, SEQ ED NO:133, SEQ ED NO:134, SEQ ED NO:135, SEQ ID NO:136,
  • expressing refers to the production of kinases of the invention from a nucleic acid vector containing kinase genes within a cell.
  • the nucleic acid vector is transfected into cells using well known techniques in the art as described herein.
  • the invention provides methods for treating a disease or abnormal condition by administering to a patient in need of such treatment a substance that modulates the activity of a polypeptide selected from the group consisting of SEQ ED NO: 122, SEQ ED NO: 123, SEQ ED NO: 124, SEQ ED NO: 125, SEQ ED NO: 126, SEQ ED
  • the disease is selected from the group consisting of immune- related diseases and disorders, cardiovascular disease, neurodegenerative disorders, and cancer. Also included are metabolic disorders, such as diabetes mellitus, and reproductive disorders, such as infertility.
  • the disease or disorder is selected from the group consisting of rheumatoid arthritis, artherosclerosis, autoimmune disorders, and organ transplantation.
  • the disease or disorder is selected from the group consisting of immune-related diseases and disorders, myocardial infarction, cardiomyopathies, stroke, renal failure, and oxidative stress-related neurodegenerative disorders.
  • the immune-related diseases and disorders are selected from the group consisting of rheumatoid arthritis, chronic inflammatory bowel disease, chronic inflammatory pelvic disease, multiple sclerosis, asthma, osteoarthritis, psoriasis, atherosclerosis, rhinitis, autoimmunity, and organ transplantation.
  • Substances useful for treatment of disorders or diseases preferably show positive results in one or more in vitro assays for an activity corresponding to treatment of the disease or disorder in question
  • Substances that modulate the activity of the polypeptides preferably include, but are not limited to, antisense oligonucleotides and inhibitors of protein kinases.
  • preventing refers to decreasing the probability that an organism contracts or develops an abnormal condition.
  • treating refers to having a therapeutic effect and at least partially alleviating or abrogating an abnormal condition in the organism.
  • a therapeutic effect refers to the inhibition or activation factors causing or contributing to the abnormal condition.
  • a therapeutic effect relieves to some extent one or more of the symptoms of the abnormal condition.
  • a therapeutic effect can refer to one or more of the following: (a) an increase in the proliferation, growth, and or differentiation of cells; (b) inhibition (i.e., slowing or stopping) of cell death; (c) inhibition of degeneration; (d) relieving to some extent one or more of the symptoms associated with the abnormal condition; and (e) enhancing the function of the affected population of cells.
  • Compounds demonstrating efficacy against abnormal conditions can be identified as described herein.
  • abnormal condition refers to a function in the cells or tissues of an organism that deviates from their normal functions in that organism.
  • An abnormal condition can relate to cell proliferation, cell differentiation or cell survival.
  • An abnormal condition may also include irregularities in cell cycle progression, i.e., irregularities in normal cell cycle progression through mitosis and meiosis.
  • Abnormal cell proliferative conditions include cancers such as fibrotic and mesangial disorders, abnormal angiogenesis and vasculogenesis, wound healing, psoriasis, diabetes mellitus, and inflammation.
  • Abnormal differentiation conditions include, but are not limited to neurodegenerative disorders, slow wound healing rates, and slow tissue grafting healing rates.
  • Abnormal cell survival conditions relate to conditions in which programmed cell death (apoptosis) pathways are activated or abrogated.
  • a number of protein kinases are associated with the apoptosis pathways. Aberrations in the function of any one of the protein kinases could lead to cell immortality or premature cell death.
  • aberration in conjunction with the function of a kinase in a signal transduction process, refers to a kinase that is over- or under-expressed in an organism, mutated such that its catalytic activity is lower or higher than wild-type protein kinase activity, mutated such that it can no longer interact with a natural binding partner, is no longer modified by another protein kinase or protein phosphatase, or no longer interacts with a natural binding partner.
  • administering relates to a method of incorporating a compound into cells or tissues of an organism.
  • the abnormal condition can be prevented or treated when the cells or tissues of the organism exist within the organism or outside of the organism.
  • Cells existing outside the organism can be maintained or grown in cell culture dishes.
  • many techniques exist in the art to administer compounds including (but not limited to) oral, parenteral, dermal, injection, and aerosol applications.
  • multiple techniques exist in the art to administer the compounds including (but not limited to) cell microinjection techniques, transformation techniques, and carrier techniques.
  • the abnormal condition can also be prevented or treated by administering a compound to a group of cells having an aberration in a signal transduction pathway to an organism.
  • the effect of administering a compound on organism function can then be monitored.
  • the organism is preferably a mouse, rat, rabbit, guinea pig, or goat, more preferably a monkey or ape, and most preferably a human.
  • the invention features methods for detection the expression of a polypeptide in a sample as a diagnostic tool for diseases or disorders, wherein the method comprises the steps of: (a) contacting the sample with a nucleic acid probe which hybridizes under hybridization assay conditions to a nucleic acid target region of a kinase polypeptide selected from the group consisting of SEQ ID NO: 122, SEQ ED NO: 123, SEQ
  • ED NO:149 SEQ ED NO:150, SEQ ID NO:151, SEQ ID NO:152, SEQ ID NO:153, SEQ ED NO:154, SEQ ED NO:155, SEQ ED NO:156, SEQ ID NO:157, SEQ ID NO:158, SEQ ID NO:159, SEQ ED NO:160, SEQ ED N0:161, SEQ ID NO:162, SEQ ID NO:163, SEQ ED NO:164, SEQ HD NO:165.
  • said probe comprising the nucleic acid sequence encoding the polypeptide, fragments thereof, and the complements of the sequences and fragments; and (b) detecting the presence or amount of the probe:target region hybrid as an indication of the disease.
  • the disease or disorder is selected from the group consisting of rheumatoid arthritis, artherosclerosis, autoimmune disorders, organ transplantation, myocardial infarction, cardiomyopathies, stroke, renal failure, oxidative stress-related neurodegenerative disorders, metabolic disorder including diabetes, reproductive disorders including infertility, and cancer.
  • the kinase "target region” is a nucleotide base sequence selected from the group consisting of those set forth in SEQ ID NO:l, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ED NO:5, SEQ ED NO:6, SEQ ED NO:7, SEQ ID NO:8, SEQ ED NO:9, SEQ ED NO:10, SEQ ED NO:l l, SEQ ED NO:12, SEQ ED NO:13, SEQ ED NO:14, SEQ ID NO:15, SEQ ED NO:16, SEQ ED NO:17, SEQ ED NO:18, SEQ ED NO:19, SEQ ED NO:20,
  • nucleic acid probe will specifically hybridize.
  • Specific hybridization indicates that in the presence of other nucleic acids the probe only hybridizes detectably with the kinase of the invention's target region.
  • Putative target regions can be identified by methods well known in the art consisting of alignment and comparison of the most closely related sequences in the database.
  • the nucleic acid probe hybridizes to a kinase target region encoding at least 6, 12, 75, 90, 105, 120, 150, 200, 250, 300 or 350 contiguous amino acids of the sequence set forth in SEQ ID NO:122, SEQ ED NO: 123, SEQ ED NO:124, SEQ ED NO:125, SEQ ED NO:126, SEQ ED NO:127, SEQ ID NO:128, SEQ ID NO:129, SEQ ID NO:130, SEQ ED NO:131, SEQ ED N0.132, SEQ ID NO:133, SEQ ID NO:134, SEQ ED NO:135, SEQ ID NO:136, SEQ ID NO:137, SEQ ED NO:138, SEQ ID NO:139, SEQ ED NO:140, SEQ ED NO:141, SEQ ED NO:142, SEQ ED NO:143, SEQ ID NO:122, SEQ ED NO: 123, SEQ ED NO:124, SEQ ED NO:125
  • SEQ ED NO:166 SEQ HD NO:167, SEQ DD NO:168, SEQ ID NO:169, SEQ ID NO:170, SEQ ID N0:171, SEQ ID NO:172, SEQ ED NO:173, SEQ ID NO:174, SEQ HD NO:175, SEQ HD NO:176, SEQ ED NO:177, SEQ ID NO:178, SEQ ID NO:
  • Hybridization conditions should be such that hybridization occurs only with the kinase genes in the presence of other nucleic acid molecules. Under stringent hybridization conditions only highly complementary nucleic acid sequences hybridize.
  • such conditions prevent hybridization of nucleic acids having more than 1 or 2 mismatches out of 20 contiguous nucleotides.
  • Hybridization conditions should be such that hybridization occurs only with the genes in the presence of other nucleic acid molecules. Under stringent hybridization conditions only highly complementary nucleic acid sequences hybridize.
  • such conditions prevent hybridization of nucleic acids having 1 or 2 mismatches out of 20 contiguous nucleotides. Such conditions are defined supra.
  • the diseases for which detection of kinase genes in a sample could be diagnostic include diseases in which kinase nucleic acid (DNA and/or RNA) is amplified in comparison to normal cells.
  • amplification is meant increased numbers of kinase DNA or RNA in a cell compared with normal cells.
  • kinases are typically found as single copy genes.
  • the chromosomal location of the kinase genes may be amplified, resulting in multiple copies of the gene, or amplification.
  • Gene amplification can lead to amplification of kinase RNA, or kinase RNA can be amplified in the absence of kinase DNA amplification.
  • RNA can be the detectable presence of kinase RNA in cells, since in some normal cells there is no basal expression of kinase RNA. In other normal cells, a basal level of expression of kinase exists, therefore in these cases amplification is the detection of at least 1 -2-fold, and preferably more, kinase RNA, compared to the basal level.
  • the diseases that could be diagnosed by detection of kinase nucleic acid in a sample preferably include cancers.
  • the test samples suitable for nucleic acid probing methods of the present invention include, for example, cells or nucleic acid extracts of cells, or biological fluids.
  • the samples used in the above-described methods will vary based on the assay format, the detection method and the nature of the tissues, cells or extracts to be assayed. Methods for preparing nucleic acid extracts of cells are well known in the art and can be readily adapted in order to obtain a sample that is compatible with the method utilized.
  • Another aspect of the invention involves a method of agonizing (stimulating) or antagonizing a target of the invention and a natural binding partner associated activity in a mammal comprising administering to said mammal an agonist or antagonist to one of the above disclosed polypeptides in an amount sufficient to effect said agonism or antagonism.
  • a method of treating diseases in a mammal with an agonist or antagonist of the protein of the present invention activity comprising administering the agonist or antagonist to a mammal in an amount sufficient to agonize or antagonize associated functions is also encompassed in the present application.
  • indolinone compounds form classes of acid resistant and membrane permeable organic molecules.
  • WO 96/22976 published August 1, 1996 by Ballinari et al. describes hydrosoluble indolinone compounds that harbor tetralin, naphthalene, quinoline, and indole substituents fused to the oxindole ring. These bicyclic substituents are in turn substituted with polar groups including hydroxylated alkyl, phosphate, and ether substituents.
  • substances capable of modulating kinase activity include, but are not limited to, tyrphostins, quinazolines, quinoxolines, and quinolines.
  • the quinazolines, tyrphostins, quinolines, and quinoxolines referred to above include well known compounds such as those described in the literature.
  • representative publications describing quinazolines include Barker et al., EPO Publication No. 0 520 722 Al; Jones et al., U.S. Patent No. 4,447,608; Kabbe et al., U.S. Patent No. 4,757,072; Kaul and Vougioukas, U.S. Patent No.
  • oxindolinones such as those described in U.S. patent application Serial No. 08/702,232 filed August 23, 1996, incorporated herein by reference in its entirety, including any drawings.
  • Therapeutically effective doses for the compounds described herein can be estimated initially from cell culture and animal models. For example, a dose can be formulated in animal models to achieve a circulating concentration range that initially takes into account the IC50 as determined in cell culture assays. The animal model data can be used to more accurately determine useful doses in humans.
  • Plasma half-life and biodistribution of the drug and metabolites in the plasma, tumors and major organs can also be determined to facilitate the selection of drugs most appropriate to inhibit a disorder. Such measurements can be carried out.
  • HPLC analysis can be performed on the plasma of animals treated with the drug and the location of radiolabeled compounds can be deter-mined using detection methods such as X-ray, CAT scan and MRI.
  • detection methods such as X-ray, CAT scan and MRI.
  • Compounds that show potent inhibitory activity in the screening assays, but have poor pharmacokinetic characteristics can be optimized by altering the chemical structure and retesting. In this regard, compounds displaying good pharmacokinetic characteristics can be used as a model.
  • Toxicity studies can also be carried out by measuring the blood cell composition.
  • toxicity studies can be carried out in a suitable animal model as follows: 1) the compound is administered to mice (an untreated control mouse should also be used); 2) blood samples are periodically obtained via the tail vein from one mouse in each treatment group; and 3) the samples are analyzed for red and white blood cell counts, blood cell composition and the percent of lymphocytes versus polymo ⁇ honuclear cells. A comparison of results for each dosing regime with the controls indicates if toxicity is present.
  • the expected daily dose of a hydrophobic pharmaceutical agent is between 1 to 500 mg/day, preferably 1 to 250 mg/day, and most preferably 1 to 50 mg/day.
  • Drugs can be delivered less frequently provided plasma levels of the active moiety are sufficient to maintain therapeutic effectiveness. Plasma levels should reflect the potency of the drug. Generally, the more potent the compound the lower the plasma levels necessary to achieve efficacy.
  • the invention features a method for detection of a kinase polypeptide in a sample as a diagnostic tool for a disease or disorder, wherein the method comprises: (a) comparing a nucleic acid target region encoding the kinase polypeptide in a sample, where the kinase polypeptide is selected from the group consisting of SEQ ID NO: 1
  • the disease or disorder is selected from the group consisting of immune-related diseases and disorders, organ transplantation, myocardial infarction, cardiovascular disease, stroke, renal failure, oxidative stress-related neurodegenerative disorders, and cancer.
  • Immune-related diseases and disorders include, but are not limited to, those discussed previously.
  • comparing refers to identifying discrepancies between the nucleic acid target region isolated from a sample, and the control nucleic acid target region.
  • the discrepancies can be in the nucleotide sequences, e.g. insertions, deletions, or point mutations, or in the amount of a given nucleotide sequence. Methods to determine these discrepancies in sequences are well-known to one of ordinary skill in the art.
  • control nucleic acid target region refers to the sequence or amount of the sequence found in normal cells, e.g. cells that are not diseased as discussed previously.
  • the term also includes anti-sense molecules drawn thereto.
  • FIGURES Figures 1A to IBB shows the amino acid sequences of SEQ ED NO:122, SEQ ID NO:123, SEQ ED NO:124, SEQ ED NO:125, SEQ ED NO:126, SEQ ID NO:127, SEQ ID NO:
  • SEQ ED NO:2308 SEQ ED NO:239, SEQ ED NO:240, SEQ ED NO:241, and SEQ ED NO:242.
  • Figures 2 A to 2MMMM shows the nucleic acid sequences of SEQ ID NO:l, SEQ
  • SEQ ED NO:8 SEQ ED NO:9, SEQ ID NO: 10, SEQ ID NO:l 1, SEQ ED NO: 12, SEQ ID NO:13, SEQ ED NO: 14, SEQ ED NO:15, SEQ DD NO:16, SEQ ID NO:17, SEQ ID NO:18,
  • the present invention relates in part to kinase polypeptides, nucleic acids encoding such polypeptides, cells containing such nucleic acids, antibodies to such polypeptides, assays utilizing such polypeptides, and methods relating to all of the foregoing.
  • the present invention is based upon the isolation and characterization of new kinase polypeptides.
  • the polypeptides and nucleic acids may be produced using well-known and standard synthesis techniques when given the sequences presented herein.
  • nucleic acid molecules Included within the scope of this invention are the functional equivalents of the herein-described isolated nucleic acid molecules.
  • the degeneracy of the genetic code permits substitution of certain codons by other codons that specify the same amino acid and hence would give rise to the same protein.
  • the nucleic acid sequence can vary substantially since, with the exception of methionine and tryptophan, the known amino acids can be coded for by more than one codon.
  • portions or all of the kinase genes of the invention could be synthesized to give a nucleic acid sequence significantly different from one selected from the group consisting of those set forth in SEQ ID NO:l, SEQ ED NO:2, SEQ D NO:3, SEQ ED NO:4, SEQ ID NO:5, SEQ ED NO:6, SEQ ID NO:
  • the nucleic acid sequence may comprise a nucleotide sequence which results from the addition, deletion or substitution of at least one nucleotide to the 5 '-end and/or the 3'-end of the nucleic acid sequence shown in SEQ ID NO:l, SEQ ED NO:2, SEQ ED NO:3, SEQ ED NO:4, SEQ ED NO:5, SEQ ED NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ED NO:9, SEQ ED NO:10, SEQ ED N0:11, SEQ ED N0:12, SEQ ED N0:13, SEQ ED N0:14, SEQ ED N0:15, SEQ ED N0:16, SEQ ED N0:17, SEQ ED N0:18, SEQ ED N0:19, SEQ ED NO:20, SEQ ED N0:21, SEQ ED NO:22, SEQ ED NO:23, SEQ ID NO:24, SEQ
  • SEQ ED N0:114 SEQ ED N0:115, SEQ ED N0:116, SEQ ED NO:117, SEQ ED N0:118, SEQ ID N0:119, SEQ ED NO:120, and SEQ ED N0:121, or a derivative thereof.
  • Any nucleotide or polynucleotide may be used in this regard, provided that its addition, deletion or substitution does not alter the amino acid sequence of SEQ ID NO:122, SEQ ED NO:123, SEQ ED NO:124, SEQ ED NO:125, SEQ ED NO:126, SEQ ED NO:127, SEQ ED NO:128,
  • SEQ ED NO:154 SEQ ED NO:155, SEQ ED NO:156, SEQ ID NO:157, SEQ ID NO:158, SEQ ED NO:159, SEQ ED NO:160, SEQ ED NO:161, SEQ ED NO:162, SEQ ED NO:163, SEQ ED NO:164, SEQ ED NO:165.
  • SEQ ED NO:214 SEQ ED NO:215, SEQ ED NO:216, SEQ ID NO:217, SEQ ID NO:218, SEQ DD NO:219, SEQ ED NO:220, SEQ ED NO:221, SEQ ED NO:222, SEQ ID NO:223, SEQ ED NO:224, SEQ ED NO:225, SEQ ED NO:226, SEQ ID NO:227, SEQ ED NO:228, SEQ ED NO:229, SEQ ED NO:230, SEQ ED NO:231, SEQ ID NO:232, SEQ ID NO:233, SEQ ED NO:234, SEQ ED NO:235, SEQ ED NO:236, SEQ ED NO:237, SEQ ED NO:238,
  • the present invention is intended to include any nucleic acid sequence resulting from the addition of ATG as an initiation codon at the 5'- end of the inventive nucleic acid sequence or its derivative, or from the addition of TTA, TAG or TGA as a termination codon at the 3 '-end of the inventive nucleotide sequence or its derivative.
  • the nucleic acid molecule of the present invention may, as necessary, have restriction endonuclease recognition sites added to its 5 '-end and/or 3'- end.
  • nucleic acid sequence affords an opportunity to promote secretion and or processing of heterologous proteins encoded by foreign nucleic acid sequences fused thereto, for example.
  • All variations of the nucleotide sequence of the kinase genes of the invention and fragments thereof permitted by the genetic code are, therefore, included in this invention.
  • nucleic acid molecules of the invention are provided as a partial sequence only (Fig. 2A through 2QQ).
  • nucleic acid sequence coding for homologous proteins are also part of the invention.
  • the characteristics of the protein kinase nucleic acid sequences of the invention are provided in Table 1.
  • the protein kinases fall into 10 known groups: AGC, CAMK, CKI, CMGC, dsPK, EEFK, LEvIK, MLK, STE and TK.
  • AGC AGC
  • CAMK CKI
  • CMGC CMGC
  • dsPK EEFK
  • LEvIK MLK
  • STE and TK TK
  • a nucleic acid probe of the present invention may be used to probe an appropriate chromosomal or cDNA library by usual hybridization methods to obtain other nucleic acid molecules of the present invention.
  • a chromosomal DNA or cDNA library may be prepared from appropriate cells according to recognized methods in the art (cf. "Molecular Cloning: A Laboratory Manual", second edition, Cold Spring Harbor Laboratory, Sambrook, Fritsch, & Maniatis, eds., 1989).
  • nucleic acid probes having nucleotide sequences that correspond to N-terminal, kinase or C- terminal portions, for example, of the amino acid sequence of the polypeptide of interest.
  • the synthesized nucleic acid probes may be used as primers in a polymerase chain reaction (PCR) carried out in accordance with recognized PCR techniques, essentially according to PCR Protocols, "A Guide to Methods and Applications", Academic Press, Michael, et al, eds., 1990, utilizing the appropriate chromosomal or cDNA library to obtain the fragment of the present invention.
  • PCR polymerase chain reaction
  • the hybridization probes of the present invention can be labeled by standard labeling techniques such as with a radiolabel, enzyme label, fluorescent label, biotin-avidin label, chemiluminescence, and the like. After hybridization, the probes may be visualized using known methods.
  • the nucleic acid probes of the present invention include RNA, as well as DNA probes, such probes being generated using techniques known in the art.
  • the nucleic acid probe may be immobilized on a solid support.
  • solid supports include, but are not limited to, plastics such as polycarbonate, complex carbohydrates such as agarose and sepharose, and acrylic resins, such as polyacrylamide and latex beads. Techniques for coupling nucleic acid probes to such solid supports are well known in the art.
  • test samples suitable for nucleic acid probing methods of the present invention include, for example, cells or nucleic acid extracts of cells, or biological fluids.
  • the samples used in the above-described methods will vary based on the assay format, the detection method and the nature of the tissues, cells or extracts to be assayed. Methods for preparing nucleic acid extracts of cells are well known in the art and can be readily adapted in order to obtain a sample that is compatible with the method utilized.
  • One method of detecting the presence of nucleic acids of the invention in a sample comprises (a) contacting said sample with the above-described nucleic acid probe under conditions such that hybridization occurs, and (b) detecting the presence of said probe bound to said nucleic acid molecule.
  • One skilled in the art would select the nucleic acid probe according to techniques known in the art as described above. Samples to be tested include but should not be limited to RNA samples of human tissue.
  • a kit for detecting the presence of nucleic acids of the invention in a sample comprises at least one container means having disposed therein the above-described nucleic acid probe.
  • the kit may further comprise other containers comprising one or more of the following: wash reagents and reagents capable of detecting the presence of bound nucleic acid probe.
  • detection reagents include, but are not limited to radiolabelled probes, enzymatic labeled probes (horseradish peroxidase, alkaline phosphatase), and affinity labeled probes (biotin, avidin, or steptavidin).
  • a compartmentalized kit includes any kit in which reagents are contained in separate containers.
  • Such containers include small glass containers, plastic containers or strips of plastic or paper.
  • Such containers allow the efficient transfer of reagents from one compartment to another compartment such that the samples and reagents are not cross-contaminated and the agents or solutions of each container can be added in a quantitative fashion from one compartment to another.
  • Such containers will include a container which will accept the test sample, a container which contains the probe or primers used in the assay, containers which contain wash reagents (such as phosphate buffered saline, Tris-buffers, and the like), and containers which contain the reagents used to detect the hybridized probe, bound antibody, amplified product, or the like.
  • wash reagents such as phosphate buffered saline, Tris-buffers, and the like
  • the present invention also relates to a recombinant DNA molecule comprising, 5 ' to 3 ', a promoter effective to initiate transcription in a host cell and the above-described nucleic acid molecules.
  • the present invention relates to a recombinant DNA molecule comprising a vector and an above-described nucleic acid molecule.
  • the present invention also relates to a nucleic acid molecule comprising a transcriptional region functional in a cell, a sequence complementary to an RNA sequence encoding an amino acid sequence corresponding to the above-described polypeptide, and a transcriptional termination region functional in said cell.
  • the above-described molecules may be isolated and/or purified DNA molecules.
  • the present invention also relates to a cell or organism that contains an above- described nucleic acid molecule and thereby is capable of expressing a polypeptide.
  • the polypeptide may be purified from cells that have been altered to express the polypeptide.
  • a cell is said to be "altered to express a desired polypeptide" when the cell, through genetic manipulation, is made to produce a protein which it normally does not produce or which the cell normally produces at lower levels.
  • One skilled in the art can readily adapt procedures for introducing and expressing either genomic, cDNA, or synthetic sequences into either eukaryotic or prokaryotic cells.
  • a nucleic acid molecule such as DNA, is said to be "capable of expressing" a polypeptide if it contains nucleotide sequences which contain transcriptional and translational regulatory information and such sequences are “operably linked” to nucleotide sequences which encode the polypeptide.
  • An operable linkage is a linkage in which the regulatory DNA sequences and the DNA sequence sought to be expressed are connected in such a way as to permit gene sequence expression.
  • the precise nature of the regulatory regions needed for gene sequence expression may vary from organism to organism, but shall in general include a promoter region which, in prokaryotes, contains both the promoter (which directs the initiation of RNA transcription) as well as the DNA sequences which, when transcribed into RNA, will signal synthesis initiation. Such regions will normally include those 5 '-non-coding sequences involved with initiation of transcription and translation, such as the TATA box, capping sequence, CAAT sequence, and the like.
  • the non-coding region 3' to the sequence encoding a kinase of the invention may be obtained by the above-described methods.
  • This region may be retained for its transcriptional termination regulatory sequences, such as termination and polyadenylation.
  • the transcriptional termination signals may be provided. Where the transcriptional termination signals are not satisfactorily functional in the expression host cell, then a 3' region functional in the host cell may be substituted.
  • Two DNA sequences are said to be operably linked if the nature of the linkage between the two DNA sequences does not (1) result in the introduction of a frame- shift mutation, (2) interfere with the ability of the promoter region sequence to direct the transcription of a gene sequence encoding a kinase of the invention, or (3) interfere with the ability of the gene sequence of a kinase of the invention to be transcribed by the promoter region sequence.
  • a promoter region would be operably linked to a DNA sequence if the promoter were capable of effecting transcription of that DNA sequence.
  • the present invention encompasses the expression of a gene encoding a kinase of the invention (or a functional derivative thereof) in either prokaryotic or eukaryotic cells.
  • Prokaryotic hosts are, generally, very efficient and convenient for the production of recombinant proteins and are, therefore, one type of preferred expression system for kinases of the invention.
  • Prokaryotes most frequently are represented by various strains of E. coli. However, other microbial strains may also be used, including other bacterial strains.
  • plasmid vectors that contain replication sites and control sequences derived from a species compatible with the host may be used.
  • suitable plasmid vectors may include pBR322, pUCl 18, pUCl 19 and the like; suitable phage or bacteriophage vectors may include ⁇ gtlO, ⁇ gtl 1 and the like; and suitable virus vectors may include pMAM-neo, pKRC and the like.
  • the selected vector of the present invention has the capacity to replicate in the selected host cell.
  • prokaryotic hosts include bacteria such as E. coli, Bacillus, Streptomyces, Pseudomonas, Salmonella, Serratia, and the like. However, under such conditions, the polypeptide will not be glycosylated.
  • the prokaryotic host must be compatible with the replicon and control sequences in the expression plasmid.
  • To express a kinase of the invention (or a functional derivative thereof) in a prokaryotic cell it is necessary to operably link the sequence encoding the kinase of the invention to a functional prokaryotic promoter.
  • Such promoters may be either constitutive or, more preferably, regulatable (i.e., inducible or derepressible).
  • constitutive promoters include the int promoter of bacteriophage ⁇ , the bla promoter of the ⁇ - lactamase gene sequence of pBR322, and the cat promoter of the chloramphenicol acetyl transferase gene sequence of pPR325, and the like.
  • inducible prokaryotic promoters include the major right and left promoters of bacteriophage ⁇ (P L and P R ), the trp, recA, ⁇ acZ, ⁇ acl, and gal promoters of E. coli, the ⁇ -amylase (Ulmanen et al., J. Bacteriol. 162:176-182, 1985) and the ⁇ -28-specific promoters of B. subtilis (Gilman et al, Gene Sequence 32:11-20, 1984), the promoters of the bacteriophages of Bacillus
  • ribosome-binding sites are disclosed, for example, by Gold et al. (Ann. Rev. Microbiol. 35:365-404, 1981).
  • control sequences are dependent on the type of host cell used to express the gene.
  • “cell”, “cell line”, and “cell culture” may be used interchangeably and all such designations include progeny.
  • progeny include the primary subject cell and cultures derived therefrom, without regard to the number of transfers. It is also understood that all progeny may not be precisely identical in DNA content, due to deliberate or inadvertent mutations. However, as defined, mutant progeny have the same functionality as that of the originally transformed cell.
  • Host cells which may be used in the expression systems of the present invention are not strictly limited, provided that they are suitable for use in the expression of the kinase polypeptide of interest. Suitable hosts may often include eukaryotic cells. Preferred eukaryotic hosts include, for example, yeast, fungi, insect cells, mammalian cells either in vivo, or in tissue culture. Mammalian cells which may be useful as hosts include HeLa cells, cells of fibroblast origin such as VERO or CHO-K1, or cells of lymphoid origin and their derivatives. Preferred mammalian host cells include SP2/0 and J558L, as well as neuroblastoma cell lines such as EMR 332, which may provide better capacities for correct post-translational processing.
  • plant cells are also available as hosts, and control sequences compatible with plant cells are available, such as the cauliflower mosaic virus 35S and 19S, and nopaline synthase promoter and polyadenylation signal sequences.
  • Another preferred host is an insect cell, for example the Drosophila larvae. Using insect cells as hosts, the Drosophila alcohol dehydrogenase promoter can be used (Rubin, Science 240:1453-1459, 1988).
  • baculovirus vectors can be engineered to express large amounts of kinases of the invention in insect cells (Jasny, Science 238:1653, 1987; Miller et al, In: Genetic Engineering, Vol. 8, Plenum, Setlow et al, eds., pp. 277-297 ',
  • yeast expression systems Any of a series of yeast expression systems can be utilized which inco ⁇ orate promoter and termination elements from the actively expressed sequences coding for glycolytic enzymes that are produced in large quantities when yeast are grown in mediums rich in glucose. Known glycolytic gene sequences can also provide very efficient transcriptional control signals. Yeast provides substantial advantages in that it can also carry out post-translational modifications. A number of recombinant DNA strategies exist utilizing strong promoter sequences and high copy number plasmids which can be utilized for production of the desired proteins in yeast. Yeast recognizes leader sequences on cloned mammalian genes and secretes peptides bearing leader sequences (i.e., pre- peptides). Several possible vector systems are available for the expression of kinases of the invention in a mammalian host.
  • transcriptional and translational regulatory sequences may be employed, depending upon the nature of the host.
  • the transcriptional and translational regulatory signals may be derived from viral sources, such as adenovirus, bovine papilloma virus, cytomegalovirus, simian virus, or the like, where the regulatory signals are associated with a particular gene sequence which has a high level of expression.
  • promoters from mammalian expression products such as actin, collagen, myosin, and the like, may be employed.
  • Transcriptional initiation regulatory signals may be selected which allow for repression or activation, so that expression of the gene sequences can be modulated.
  • regulatory signals which are temperature- sensitive so that by varying the temperature, expression can be repressed or initiated, or are subject to chemical (such as metabolite) regulation.
  • eukaryotic regulatory regions Such regions will, in general, include a promoter region sufficient to direct the initiation of RNA synthesis.
  • Preferred eukaryotic promoters include, for example, the promoter of the mouse metallothionein I gene sequence (Hamer et al, J. Mol. Appl. Gen. 1:273-288, 1982); the TK promoter of He ⁇ es virus (McKnight, Cell 31 :355-365, 1982); the SV40 early promoter (Benoist et al, Nature (London) 290:304-31, 1981); and the yeast gal4 gene sequence promoter (Johnston et al, Proc. Natl. Acad. Sci. (USA) 79:6971-6975, 1982; Silver et al, Proc. Natl. Acad. Sci. (USA)
  • a nucleic acid molecule encoding a kinase of the invention and an operably linked promoter may be introduced into a recipient prokaryotic or eukaryotic cell either as a nonreplicating DNA or RNA molecule, which may either be a linear molecule or, more preferably, a closed covalent circular molecule. Since such molecules are incapable of autonomous replication, the expression of the gene may occur through the transient expression of the introduced sequence. Alternatively, permanent expression may occur through the integration of the introduced DNA sequence into the host chromosome.
  • a vector may be employed which is capable of integrating the desired gene sequences into the host cell chromosome.
  • Cells which have stably integrated the introduced DNA into their chromosomes can be selected by also introducing one or more markers which allow for selection of host cells which contain the expression vector.
  • the marker may provide for prototrophy to an auxotrophic host, biocide resistance, e.g., antibiotics, or heavy metals, such as copper, or the like.
  • the selectable marker gene sequence can either be directly linked to the DNA gene sequences to be expressed, or introduced into the same cell by co-transfection. Additional elements may also be needed for optimal synthesis of mRNA. These elements may include splice signals, as well as transcription promoters, enhancers, and termination signals.
  • cDNA expression vectors inco ⁇ orating such elements include those described by Okayama (Mol. Cell. Biol. 3:280-, 1983).
  • the introduced nucleic acid molecule can be inco ⁇ orated into a plasmid or viral vector capable of autonomous replication in the recipient host.
  • a plasmid or viral vector capable of autonomous replication in the recipient host.
  • Any of a wide variety of vectors may be employed for this pu ⁇ ose. Factors of importance in selecting a particular plasmid or viral vector include: the ease with which recipient cells that contain the vector may be recognized and selected from those recipient cells which do not contain the vector; the number of copies of the vector which are desired in a particular host; and whether it is desirable to be able to "shuttle" the vector between host cells of different species.
  • Preferred prokaryotic vectors include plasmids such as those capable of replication in E. coli (such as, for example, pBR322, ColEl, pSClOl, pACYC 184, ⁇ VX; "Molecular Cloning: A Laboratory Manual", 1989, supra).
  • Bacillus plasmids include pC 194, pC221 , pT127, and the like (Gryczan, In: The Molecular Biology of the Bacilli, Academic Press, NY, pp. 307-329, 1982).
  • Suitable Streptomyces plasmids include plJlOl (Kendall et al, J. Bacteriol.
  • Preferred eukaryotic plasmids include, for example, BPV, vaccinia, SV40, 2- micron circle, and the like, or their derivatives. Such plasmids are well known in the art (Botstein et al, Miami Wntr. Symp. 19:265-274, 1982; Broach, In: "The Molecular Structure of plasmids."
  • the DNA construct(s) may be introduced into an appropriate host cell by any of a variety of suitable means, i.e., transformation, transfection, conjugation, protoplast fusion, electroporation, particle gun technology, calcium phosphate- precipitation, direct microinjection, and the like.
  • recipient cells are grown in a selective medium, which selects for the growth of vector- containing cells. Expression of the cloned gene(s) results in the production of a kinase of the invention, or fragments thereof.
  • the polypeptides may be purified from tissues or cells that naturally produce the polypeptides.
  • the above-described isolated nucleic acid fragments could be used to express the kinases of the invention in any organism.
  • the samples of the present invention include cells, protein extracts or membrane extracts of cells, or biological fluids. The samples will vary based on the assay format, the detection method, and the nature of the tissues, cells or extracts used as the sample. Any eukaryotic organism can be used as a source for the polypeptides of the invention, as long as the source organism naturally contains such polypeptides.
  • source organism refers to the original organism from which the amino acid sequence of the subunit is derived, regardless of the organism the subunit is expressed in and ultimately isolated from.
  • source organism refers to the original organism from which the amino acid sequence of the subunit is derived, regardless of the organism the subunit is expressed in and ultimately isolated from.
  • One skilled in the art can readily follow known methods for isolating proteins in order to obtain the polypeptides free of natural contaminants. These include, but are not limited to: size-exclusion chromatography, HPLC, ion-exchange chromatography, and immuno-affinity chromatography.
  • polypeptides of the invention include the full-length polypeptides that can be identified from the full-length or partial sequences encoded by SEQ ID NO: 122,
  • polypeptides of the invention include the domains of these polypeptides, including, but not limited to, the N-terminal, kinase/catalytic, and C- terminal domains.
  • the characteristics of the protein kinase nucleic acid sequences of the invention are provided in Table 1.
  • the protein kinases fall into 10 known groups: AGC, CAMK, CKI, CMGC, dsPK, EEFK, LEVIK, MLK, STE and TK.
  • AGC AGC
  • CAMK CKI
  • CMGC CMGC
  • dsPK EEFK
  • LEVIK MLK
  • STE and TK TK
  • the present invention relates to an antibody having binding affinity to a kinase of the invention.
  • the polypeptide may have an amino acid sequence selected from the group consisting of those set forth in SEQ ED NO:122, SEQ ED NO:123, SEQ ED NO:124, SEQ ED NO:125, SEQ ED NO:126, SEQ ED NO:127, SEQ ED NO:128, SEQ ID NO:129, SEQ ED NO:130, SEQ ED NO:131, SEQ ED NO:132, SEQ ED NO:133, SEQ ED NO:134, SEQ
  • the antibody may bind to a part of the polypeptide not provided in the sequences above, but that is present in the full-length sequence of the polypeptide and that is easily obtained using methods standard in the art. Further, the antibody may bind specifically to particular domains of one or more of the kinases of the invention, including, but not, limited to, the N-terminal, kinase/catalytic, or C-terminal domains.
  • the present invention also relates to an antibody having specific binding affinity to a kinase or kinase domain of the invention.
  • an antibody may be isolated by comparing its binding affinity to a kinase of the invention with its binding affinity to other polypeptides.
  • Those that bind selectively to a kinase of the invention would be chosen for use in methods requiring a distinction between a kinase of the invention and other polypeptides.
  • Such methods could include, but should not be limited to, the analysis of altered kinase expression in tissue containing other polypeptides.
  • the kinases of the present invention can be used in a variety of procedures and methods, such as for the generation of antibodies, for use in identifying pharmaceutical compositions, and for studying DNA/protein interaction.
  • the kinases of the present invention can be used to produce antibodies or hybridomas.
  • One skilled in the art will recognize that if an antibody is desired, such a peptide could be generated as described herein and used as an immunogen.
  • the antibodies of the present invention include monoclonal and polyclonal antibodies, as well fragments of these antibodies, and humanized forms. Humanized forms of the antibodies of the present invention may be generated using one of the procedures known in the art such as chimerization or CDR grafting.
  • the present invention also relates to a hybridoma that produces the above- described monoclonal antibody, or binding fragment thereof.
  • a hybridoma is an immortalized cell line that is capable of secreting a specific monoclonal antibody.
  • the polypeptide may be modified or administered in an adjuvant in order to increase the peptide antigenicity.
  • Methods of increasing the antigenicity of a polypeptide are well known in the art. Such procedures include coupling the antigen with a heterologous protein (such as globulin or ⁇ -galactosidase) or through the inclusion of an adjuvant during immunization.
  • a heterologous protein such as globulin or ⁇ -galactosidase
  • an adjuvant during immunization For monoclonal antibodies, spleen cells from the immunized animals are removed, fused with myeloma cells, such as SP2/0-Agl4 myeloma cells, and allowed to become monoclonal antibody producing hybridoma cells.
  • any one of a number of methods well known in the art can be used to identify the hybridoma cell that produces an antibody with the desired characteristics. These include screening the hybridomas with an ELISA assay, western blot analysis, or radioimmunoassay (Lutz et al, Exp. Cell Res. 175:109-124, 1988). Hybridomas secreting the desired antibodies are cloned and the class and subclass are determined using procedures known in the art (Campbell, "Monoclonal Antibody Technology: Laboratory Techniques in Biochemistry and Molecular Biology", supra, 1984).
  • antibody-containing antisera is isolated from the immunized animal and is screened for the presence of antibodies with the desired specificity using one of the above-described procedures.
  • the above-described antibodies may be detectably labeled.
  • Antibodies can be detectably labeled through the use of radioisotopes, affinity labels (such as biotin, avidin, and the like), enzymatic labels (such as horse radish peroxidase, alkaline phosphatase, and the like) fluorescent labels (such as FITC or rhodamine, and the like), paramagnetic atoms, and the like. Procedures for accomplishing such labeling are well-known in the art, for example, see Stemberger et al, J.
  • the labeled antibodies of the present invention can be used for in vitro, in vivo, and in situ assays to identify cells or tissues that express a specific peptide.
  • the above-described antibodies may also be immobilized on a solid support.
  • solid supports include plastics such as polycarbonate, complex carbohydrates such as agarose and sepharose, acrylic resins and such as polyacrylamide and latex beads. Techniques for coupling antibodies to such solid supports are well known in the art (Weir et al, "Handbook of Experimental Immunology” 4th Ed., Blackwell Scientific Publications, Oxford, England, Chapter 10, 1986; Jacoby et al, Meth. Enzym. 34, Academic Press, N.Y., 1974).
  • the immobilized antibodies of the present invention can be used for in vitro, in vivo, and in situ assays as well as in immunochromotography.
  • Anti-peptide peptides can be generated by replacing the basic amino acid residues found in the peptide sequences of the kinases of the invention with acidic residues, while maintaining hydrophobic and uncharged polar groups. For example, lysine, arginine, and/or histidine residues are replaced with aspartic acid or glutamic acid and glutamic acid residues are replaced by lysine, arginine or histidine.
  • the present invention also encompasses a method of detecting a kinase polypeptide in a sample, comprising: (a) contacting the sample with an above-described antibody, under conditions such that immunocomplexes form, and (b) detecting the presence of said antibody bound to the polypeptide.
  • the methods comprise incubating a test sample with one or more of the antibodies of the present invention and assaying whether the antibody binds to the test sample. Altered levels of a kinase of the invention in a sample as compared to normal levels may indicate disease.
  • Incubation conditions vary. Incubation conditions depend on the format employed in the assay, the detection methods employed, and the type and nature of the antibody used in the assay.
  • immunological assay formats such as radioimmunoassays, enzyme-linked immunosorbent assays, diffusion based Ouchterlony, or rocket immunofluorescent assays
  • Examples of such assays can be found in Chard ("An Introduction to Radioimmunoassay and Related Techniques" Elsevier Science Publishers, Amsterdam, The Netherlands, 1986), Bullock et al.
  • the immuno logical assay test samples of the present invention include cells, protein or membrane extracts of cells, or biological fluids such as blood, serum, plasma, or urine.
  • the test samples used in the above-described method will vary based on the assay format, nature of the detection method and the tissues, cells or extracts used as the sample to be assayed. Methods for preparing protein extracts or membrane extracts of cells are well known in the art and can be readily be adapted in order to obtain a sample which is testable with the system utilized.
  • kits contains all the necessary reagents to carry out the previously described methods of detection.
  • the kit may comprise: (i) a first container means containing an above-described antibody, and (ii) second container means containing a conjugate comprising a binding partner of the antibody and a label.
  • the kit further comprises one or more other containers comprising one or more of the following: wash reagents and reagents capable of detecting the presence of bound antibodies.
  • detection reagents include, but are not limited to, labeled secondary antibodies, or in the alternative, if the primary antibody is labeled, the chromophoric, enzymatic, or antibody binding reagents that are capable of reacting with the labeled antibody.
  • the compartmentalized kit may be as described above for nucleic acid probe kits.
  • One skilled in the art will readily recognize that the antibodies described in the present invention can readily be inco ⁇ orated into one of the established kit formats that are well known in the art.
  • the present invention also relates to a method of detecting a compound capable of binding to a protein kinase of the invention, comprising incubating the compound with a kinase of the invention and detecting the presence of the compound bound to the kinase.
  • the compound may be present within a complex mixture, for example, serum, body fluid, or cell extracts.
  • the present invention also relates to a method of detecting an agonist or antagonist of kinase activity or kinase binding partner activity comprising incubating cells that produce a kinase of the invention in the presence of a compound and detecting changes in the level of kinase activity or kinase binding partner activity.
  • the compounds thus identified would produce a change in activity indicative of the presence of the compound.
  • the compound may be present within a complex mixture, for example, serum, body fluid, or cell extracts. Once the compound is identified it can be isolated using techniques well known in the art.
  • the present invention also encompasses a method of agonizing (stimulating) or antagonizing kinase associated activity in a mammal comprising administering to said mammal an agonist or antagonist to a kinase of the invention in an amount sufficient to effect said agonism or antagonism.
  • a method of treating diseases in a mammal with an agonist or antagonist of kinase activity comprising administering the agonist or antagonist to a mammal in an amount sufficient to agonize or antagonize kinase associated functions is also encompassed in the present application.
  • substances capable of modulating kinase activity include, but are not limited to, ty ⁇ hostins, quinazolines, quinoxolines, and quinolines.
  • the quinazolines, ty ⁇ hostins, quinolines, and quinoxolines referred to above include well known compounds such as those described in the literature.
  • representative publications describing quinazolines include Barker et al, EPO Publication No. 0 520 722 Al; Jones et al, U.S. Patent No.4,447,608; Kabbe et al, U.S. Patent No. 4,757,072; Kaul and Vougioukas, U.S. Patent No. 5, 316,553; Kreighbaum and Comer, U.S. Patent No.
  • Ty ⁇ hostins are described in Allen et al. , Clin. Exp. Immunol. 91 :141-156 (1993); Anafi et al. Blood 82:12:3524-3529 (1993); Baker et al, J. Cell Sci. 102:543-555 (1992);
  • kinase classification and protein domains often reflect pathways, cellular roles, or mechanisms of up- or down-stream regulation.
  • disease-relevant genes often occur in families of related genes. For example if one member of a kinase family functions as an oncogene, a tumor suppressor, or has been found to be disrupted in an immune, neurologic, cardiovascular, or metabolic disorder, frequently other family members may play a related role.
  • the expression analysis organizes kinases into groups that are transcriptionally upregulated in tumors and those that are more restricted to specific tumor types such as melanoma or prostate. This analysis also identifies genes that are regulated in a cell cycle dependent manner, and are therefore likely to be involved in maintaining cell cycle checkpoints, entry, progression, or exit from mitosis, oversee DNA repair, or are involved in cell proliferation and genome stability. Expression data also can identify genes expressed in endothelial sources or other tissues that suggest a role in angiogenesis, thereby implicating them as targets for control of diseases that have an angiogenic component, such as cancer, endometriosis, retinopathy and macular degeneration, and various ischemic or vascular pathologies.
  • a proteins' role in cell survival can also be suggested based on restricted expression in cells subjected to external stress such as oxidative damage, hypoxia, drugs such as cisplatinum, or irradiation.
  • Metastases- associated genes can be implicated when expression is restricted to invading regions of a tumor, or is only seen in local or distant metastases compared to the primary tumor, or when a gene is upregulated during cell culture models of invasion, migration, or motility.
  • Chromosomal location can identify candidate targets for a tumor amplicon or a tumor-suppressor locus.
  • kinases Summaries of prevelant tumor amplicons are available in the literature, and can identify tumor types to experimentally be confirmed to contain amplified copies of a kinase gene which localizes to an adjacent region. Based on these criteria several kinases immediately stand out as being of potential therapeutic relevance.
  • the protein kinases can be divided into the following disease- relevant categories (nucleotide Seq ID #s in parentheses):
  • Tumor associated Mok (SEQ ID NO:NO:57), EPK2, AA316804 (SEQ ID NO:l 1), AA435956 (SEQ ID NO:NO:48), AA278842 (SEQ ED NO:88), AA599286 (SEQ ED NO:89), AA826850 (SEQ ID NO:3), HRI (SEQ ED NO:73), MLK4 AA232253 (SEQ ID NO:57), EPK2, AA316804 (SEQ ID NO:l 1), AA435956 (SEQ ID NO:NO:48), AA278842 (SEQ ED NO:88), AA599286 (SEQ ED NO:89), AA826850 (SEQ ID NO:3), HRI (SEQ ED NO:73), MLK4 AA232253 (SEQ
  • CAMKKB SEQ ED NO:66
  • PTK9L SEQ ID NO:22
  • DRAK2 SEQ ID NO:29
  • AI025291 SEQ ED NO:94
  • DRAK1 (SEQ ED NO:31), MAK-V (SEQ ED NO:40), TRAD (SEQ ID NO:44), MOK (SEQ ID NO:57), AA08847 (SEQ ID NO:78), HGP_66444466 (SEQ ED NO:79), RSK4 (SEQ ED NO: 16).
  • DNA can be injected into the pronucleus of a fertilized egg before fusion of the male and female pronuclei, or injected into the nucleus of an embryonic cell (e.g., the nucleus of a two-cell embryo) following the initiation of cell division (Brinster et al, Proc. Nat. Acad. Sci. USA 82: 4438-4442, 1985).
  • Embryos can be infected with viruses, especially retroviruses, modified to carry inorganic-ion receptor nucleotide sequences of the invention.
  • Pluripotent stem cells derived from the inner cell mass of the embryo and stabilized in culture can be manipulated in culture to inco ⁇ orate nucleotide sequences of the invention.
  • a transgenic animal can be produced from such cells through implantation into a blastocyst that is implanted into a foster mother and allowed to come to term. Animals suitable for transgenic experiments can be obtained from standard commercial sources such as Charles River (Wilmington, MA), Taconic (Germantown, NY), Harlan Sprague Dawley (Indianapolis, IN), etc. The procedures for manipulation of the rodent embryo and for microinjection of
  • DNA into the pronucleus of the zygote are well known to those of ordinary skill in the art (Hogan et al, supra). Microinjection procedures for fish, amphibian eggs and birds are detailed in Houdebine and Chourrout (Experientia 47: 897-905, 1991). Other procedures for introduction of DNA into tissues of animals are described in U.S. Patent No., 4,945,050 (Sanford et al, July 30, 1990).
  • transgenic mouse female mice are induced to superovulate. Females are placed with males, and the mated females are sacrificed by C0 asphyxiation or cervical dislocation and embryos are recovered from excised oviducts. Surrounding cumulus cells are removed. Pronuclear embryos are then washed and stored until the time of injection. Randomly cycling adult female mice are paired with vasectomized males. Recipient females are mated at the same time as donor females. Embryos then are transferred surgically. The procedure for generating transgenic rats is similar to that of mice (Hammer et al, Cell 63:1099-1112, 1990).
  • a clone containing the sequence(s) of the invention is co-transfected with a gene encoding resistance.
  • the gene encoding neomycin resistance is physically linked to the sequence(s) of the invention.
  • DNA molecules introduced into ES cells can also be integrated into the chromosome through the process of homologous recombination (Capecchi, Science 244: 1288-1292, 1989).
  • Methods for positive selection of the recombination event (i.e., neo resistance) and dual positive-negative selection (i.e., neo resistance and gancyclovir resistance) and the subsequent identification of the desired clones by PCR have been described by Capecchi, supra and Joyner et al. (Nature 338: 153-156, 1989), the teachings of which are inco ⁇ orated herein in their entirety including any drawings.
  • the final phase of the procedure is to inject targeted ES cells into blastocysts and to transfer the blastocysts into pseudopregnant females.
  • the resulting chimeric animals are bred and the offspring are analyzed by Southern blotting to identify individuals that carry the transgene.
  • Procedures for the production of non-rodent mammals and other animals have been discussed by others (Houdebine and Chourrout, supra; Pursel et al, Science 244:1281- 1288, 1989; and Simms et al, Bio/Technology 6:179-183, 1988).
  • the invention provides transgenic, nonhuman mammals containing a transgene encoding a kinase of the invention or a gene effecting the expression of the kinase.
  • Such transgenic nonhuman mammals are particularly useful as an in vivo test system for studying the effects of introduction of a kinase, or regulating the expression of a kinase (i.e., through the introduction of additional genes, antisense nucleic acids, or ribozymes).
  • transgenic animal is an animal having cells that contain DNA which has been artificially inserted into a cell, which DNA becomes part of the genome of the animal which develops from that cell.
  • Preferred transgenic animals are primates, mice, rats, cows, pigs, horses, goats, sheep, dogs and cats.
  • the transgenic DNA may encode human
  • Native expression in an animal may be reduced by providing an amount of anti-sense RNA or DNA effective to reduce expression of the receptor.
  • an expression vector containing protein kinase coding sequence is inserted into cells, the cells are grown in vitro, and then are infused in large numbers into patients.
  • a DNA segment containing a promoter of choice (for example a strong promoter) is transferred into cells containing an endogenous gene encoding kinases of the invention in such a manner that the promoter segment enhances expression of the endogenous kinase gene (for example, the promoter segment is transferred to the cell such that it becomes directly linked to the endogenous kinase gene).
  • the gene therapy may involve the use of an adeno virus containing kinase cDNA targeted to a tumor, systemic kinase increase by implantation of engineered cells, injection with kinase-encoding virus, or injection of naked kinase DNA into appropriate tissues.
  • Target cell populations may be modified by introducing altered forms of one or more components of the protein complexes in order to modulate the activity of such complexes. For example, by reducing or inhibiting a complex component activity within target cells, an abnormal signal transduction event(s) leading to a condition may be decreased, inhibited, or reversed. Deletion or missense mutants of a component, that retain the ability to interact with other components of the protein complexes but cannot function in signal transduction may be used to inhibit an abnormal, deleterious signal transduction event.
  • Expression vectors derived from viruses such as retroviruses, vaccinia virus, adenovirus, adeno-associated virus, he ⁇ es viruses, several RNA viruses, or bovine papilloma virus, may be used for delivery of nucleotide sequences (e.g., cDNA) encoding recombinant kinase of the invention protein into the targeted cell population (e.g., tumor cells).
  • viruses such as retroviruses, vaccinia virus, adenovirus, adeno-associated virus, he ⁇ es viruses, several RNA viruses, or bovine papilloma virus.
  • recombinant viral vectors containing coding sequences can be used to construct recombinant viral vectors containing coding sequences (Maniatis et al, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory, N.Y., 1989; Ausubel et al, Current Protocols in Molecular Biology, Greene Publishing Associates and Wiley Interscience, N.Y., 1989).
  • recombinant nucleic acid molecules encoding protein sequences can be used as naked DNA or in a reconstituted system e.g., liposomes or other lipid systems for delivery to target cells (e.g., Feigner et al, Nature 337:387-8, 1989).
  • Several other methods for the direct transfer of plasmid DNA into cells exist for use in human gene therapy and involve targeting the DNA to receptors on cells by complexing the plasmid DNA to proteins (Miller, supra).
  • gene transfer can be performed by simply injecting minute amounts of DNA into the nucleus of a cell, through a process of microinjection (Capecchi,
  • Another method for introducing DNA into cells is to couple the DNA to chemically modified proteins.
  • adenovirus proteins are capable of destabilizing endosomes and enhancing the uptake of DNA into cells.
  • the admixture of adenovirus to solutions containing DNA complexes, or the binding of DNA to polylysine covalently attached to adenovirus using protein crosslinking agents substantially improves the uptake and expression of the recombinant gene (Curiel et al, Am. J. Respir. Cell. Mol. Biol., 6:247-52, 1992).
  • Gene transfer means the process of introducing a foreign nucleic acid molecule into a cell. Gene transfer is commonly performed to enable the expression of a particular product encoded by the gene.
  • the product may include a protein, polypeptide, anti-sense DNA or RNA, or enzymatically active RNA.
  • Gene transfer can be performed in cultured cells or by direct administration into animals. Generally gene transfer involves the process of nucleic acid contact with a target cell by non-specific or receptor mediated interactions, uptake of nucleic acid into the cell through the membrane or by endocytosis, and release of nucleic acid into the cytoplasm from the plasma membrane or endosome. Expression may require, in addition, movement of the nucleic acid into the nucleus of the cell and binding to appropriate nuclear factors for transcription.
  • gene therapy is a form of gene transfer and is included within the definition of gene transfer as used herein and specifically refers to gene transfer to express a therapeutic product from a cell in vivo or in vitro. Gene transfer can be performed ex vivo on cells which are then transplanted into a patient, or can be performed by direct administration of the nucleic acid or nucleic acid-protein complex into the patient.
  • a vector having nucleic acid sequences encoding a protein kinase polypeptide of the invention in which the nucleic acid sequence is expressed only in specific tissue.
  • Methods of achieving tissue-specific gene expression are set forth in International Publication No. WO 93/09236, filed November 3, 1992 and published May 13, 1993.
  • nucleic acid sequence contained in the vector may include additions, deletions or modifications to some or all of the sequence of the nucleic acid, as defined above.
  • Gene replacement means supplying a nucleic acid sequence which is capable of being expressed in vivo in an animal and thereby providing or augmenting the function of an endogenous gene that is missing or defective in the animal.
  • the proper dosage depends on various factors such as the type of disease being treated, the particular composition being used, and the size and physiological condition of the patient.
  • Therapeutically effective doses for the compounds described herein can be estimated initially from cell culture and animal models. For example, a dose can be formulated in animal models to achieve a circulating concentration range that initially takes into account the IC 50 as determined in cell culture assays. The animal model data can be used to more accurately determine useful doses in humans.
  • Plasma half-life and biodistribution of the drug and metabolites in the plasma, tumors, and major organs can be also be determined to facilitate the selection of drugs most appropriate to inhibit a disorder.
  • Such measurements can be carried out.
  • HPLC analysis can be performed on the plasma of animals treated with the drug and the location of radiolabeled compounds can be determined using detection methods such as X-ray, CAT scan, and MRI.
  • Compounds that show potent inhibitory activity in the screening assays, but have poor pharmacokinetic characteristics, can be optimized by altering the chemical structure and retesting. In this regard, compounds displaying good pharmacokinetic characteristics can be used as a model.
  • Toxicity studies can also be carried out by measuring the blood cell composition.
  • toxicity studies can be carried out in a suitable animal model as follows: 1) the compound is administered to mice (an untreated control mouse should also be used); 2) blood samples are periodically obtained via the tail vein from one mouse in each treatment group; and 3) the samples are analyzed for red and white blood cell counts, blood cell composition, and the percent of lymphocytes versus polymo ⁇ honuclear cells. A comparison of results for each dosing regime with the controls indicates if toxicity is present.
  • further studies can be carried out by sacrificing the animals (preferably, in accordance with the American Veterinary Medical Association guidelines Report of the American Veterinary Medical Assoc.
  • a hydrophobic pharmaceutical agent is between 1 to 500 mg/day, preferably 1 to 250 mg/day, and most preferably 1 to 50 mg/day.
  • Drugs can be delivered less frequently provided plasma levels of the active moiety are sufficient to maintain therapeutic effectiveness. Plasma levels should reflect the potency of the drug. Generally, the more potent the compound the lower the plasma levels necessary to achieve efficacy.
  • EXAMPLE 1 Isolation of cDNA clones Encoding Novel Mammalian Protein Kinases Materials and Methods Identification from cDNA databases and isolation of clones encoding novel protein kinases
  • Novel kinases were identified from the public EST databases using a Hidden Markov model, abbreviated HMM (Krogh, A., Brown, M., Mian, I. S., Sjolander, K., and Haussler, D. 1994.
  • Hidden Markov models in computational biology Applications to protein modeling. J. Mol. Biol, 235:1501-1531).
  • the model was built with 70 mammalian and yeast kinase catalytic domain sequences. These sequences were chosen from a comprehensive collection of kinases such that no two sequences had more than 50% sequence identity.
  • ESTs were translated in six open reading frames and were searched against the model.
  • ESTs that had a score of at least 10 against the HMM were then masked for repetitive sequences and vectors and were clustered using MSA. The resulting contigs were searched against known kinases to identify EST clones that encode novel kinases.
  • N A,C,G ot T
  • DNA were made using a standard 6-frame translation.
  • the second method for genomic sequence-based extensions made use of tBlastn searches of the homologue or orthologue to the partial kinase against the cDNA databases listed in Table 7.
  • the recognition of significant hits in these databases made possible to identify bridging partial cDNA clones.
  • the iterative application of the two methods made possible the assemblage of the virtual full-length sequence for a large number of the kinases presented in this application. All tblastn searches were conducted using a blosum62 matrix, a penalty for a nucleotide mismatch of -3 and reward for a nucleotide match of 1.
  • Human AA826850 (SEQ ID NO: 3, SEQ ED NO: 124) Blastn analysis of the partial AA826850 sequence revealed an extension to encompass the complete ORF in the Incyte EST 238299.1. A frame-shift correction at position 595 of this EST (marked by X in NA sequence) generated an uninterrupted ORF.
  • Human AA960957 (SEQ ID NO: 4, SEQ ED NO: 125) Since the initial filing of this application, the partial AA960957 sequence appeared in the public database as the full-length gene for a protein kinase encoded by a gene that maps adjacent to the eve (AJ250839) (ellis-van creveld syndrome and weyers acrodental dysostosis) gene from 4pl6.1.
  • Human 5R79-46-l_h (SEQ ID NO: 5, SEQ ED NO:126)
  • the 1684 bp insert of this EST contains a 1369 bp intron at the 3' end.
  • Blastx and SW analysis of the 315 bp coding region revealed homology to the extracatalytic C2 domain of PKC.
  • This EST may or may not encode a kinase.
  • HI 9102 may encode a dual catalytic kinase given the homology to S6 kinase.
  • Analysis of genomic sequence upstream of the 5' end of H19102 revealed a non-kinase gene oriented in the same polarity as H19102 suggestive of the start Met for H19102 being close to the 5' end of the H19102 sequence. From this analysis it is deduced that the second catalytic domain of H19102, if present, is most likely located within the 47334-185,215 bp region of the genomic sequence of AC005726.
  • Human AA887783 (SEQ ED NO:21, SEQ ED NO: 142) Blastn analysis of the partial AA887783 sequence revealed an extension to encompass the nearly complete ORF through the assembly of three partial clones: Incyte 415390R6 and the NCBI EST's AA887783 and N94726. Since the initial filing of this application, the nearly full-length virtual AA887783 sequence appeared in the public database as the full-length gene encoding SGK3 (AFl 69035), a serum- and glucocorticoid-induced protein kinase (Kobayashi,T. et al (1999) Biochemical J. 344, 189- 197.
  • a cDNA clone encoding the full-length ORF of R47805 was isolated using R47805 as a screening probe.
  • a full-length form for R47805 has also appeared in the public database as
  • PTK9L (NM_007284), an A6-related protein kinase.
  • AA021445 and KIAA0999 have 15 copies of a CAG repeat. Trinucleotide repeats are often found in genes that linked to neurodegenerative diseases.
  • Human 2R22-55-1 (SEQ ED NO:33, SEQ ED NO: 153) Blastn analysis revealed an extension in the Incyte EST clone 321074.1 to encompass the complete ORF corresponding to 2R22-55-1.
  • AA542015_m Human orthologue of AA542015_m (SEQ ID NO: 42, SEQ ED NO: 162) fBlastn analysis identified KLAA1297 (AB037718). Blastn extended the KIAA1297 sequence to provide the C-terminus through the Incyte 224074.1 EST.
  • the partial ORF consists of a dual catalytic domain flanked by 6 Ig domains and 2 fibronectin repeats. Based on homology to the bt drosophila protein (AAF59316.1), the human form of AA542015 is expected to be missing 16 Ig domains.
  • the full-length ORF for R19772 was isolated by screening a cDNA library using a probe derived from R19772. Since the initial filing of this application, the R19772 sequence appeared in the public database as the full-length gene encoding Trio (Duet) (ABOl 1422). CDNA library screening revealed multiple isoforms for this gene which are summarized in the Table below.
  • Human AA397553 (SEQ ID NO: 51, SEQ ID NO: 171) Since the initial filing of this application, the partial AA397553 sequence appeared in the public database as the full-length gene encoding CRK7 (AF227198), a novel CDC2- related protein kinase that colocalizes with interchromatin granule clusters.
  • Human AA789239 (SEQ ED NO: 52, SEQ ED NO: 172)
  • Human AA557536 (SEQ ED NO:56, SEQ ED NO: 176) Blastn analysis revealed an extension to encompass full-length ORF for AA557536. The full ORF was reconstructed from AA557536, celera 11000504061899 and the Incyte 097089.1 EST. An 85bp intron was removed from AA557536. Human N34132 (SEQ ED NO: 63, SEQ ED NO: 183)
  • the 5' 790 bp of the KIAA0344 cDNA (encoding the 58 N-terminal protein sequence) were found to be divergent with respect to the extended 2.32 kb N34132 contig.
  • Evidence that the extended N34132 contig (2.3 lkb) and KIAA0344 (AB002342) belong to the same gene is the following.
  • blast analysis of the nucleotide sequences for N34132 and KIAA0344 against the NRN database confirmed that these cDNA's are transcribed from the same genomic locus defined by two overlapping BACs (AC004765 and AC004803) from chromosome 12pl3.3.
  • Human 5R69-17-2 (SEQ ID NO:67, SEQ ED NO: 187) The full-length ORF for 5R69-17-2 was isolated by screening a cDNA library using a probe derived from 5R69-17-2.
  • R43524 Blastn analysis revealed an extension to encompass the complete catalytic region and the C-terminus of R43524. Since the initial filing of this application, the partial R43524 sequence appeared in the public database as the full-length gene encoding the heme-regulated initiation factor 2-alpha kinase (HRI) (AF181071).
  • HRI 2-alpha kinase
  • Tblastn identified the Incyte 211475.1 as the potential full-length human orthologue of murine AA 139478
  • the full-length ORF for AA232253 was isolated by screening a cDNA library using a probe derived from AA232253. Since the initial filing of this application, the AA232253 sequence appeared in the public database as the full-length gene encoding SLK (ABOl 1422). SLK is a stress-regulated mixed lineage kinase-like protein that activation of Rac and induction of apoptosis. cDNA library screening revealed multiple isoforms for this gene which are summarized in the Table below.
  • Human AI052250 (SEQ ID NO:87, SEQ ID NO:206) Blastn analysis revealed an extension to encompass the full-length ORF for AI052250.
  • the full ORF was reconstructed from Incyte 396868.1, the public partial cDNA FLJ10074 (minus intron) and the public ESTs and the public ESTs AI052250 and H97685, AI499220 and M62021.
  • Human AA278842 SEQ ID NO:88, SEQ ED NO:206
  • a nearly full-length cDNA (FL4F12) for AA278842 was isolated by screening a cDNA library using a probe derived from AA278842.
  • a full-length virtual ORF was generated using FL4F12 and AA278842.
  • Human AI086865 (SEQ ID NO:l 12, SEQ ED NO:231) Genescan and Genewise analyses of genomic sequence revealed an extension to encompass the full-length ORF for AI086865.
  • the full-length ORF was reconstructed from Celera 17000102901516, Incyte 243269.1 and public AL1377531.
  • Human AA836348 (SEQ ID NO: 113, SEQ ID NO:232)
  • the full-length ORF for R86668 was isolated by screening a cDNA library using a probe derived from R86668. Since the initial filing of this application, the R8668 sequence appeared in the public database as the full-length gene mitogen-activated protein kinase kinase kinase 6 (MAP3K6) (NM_00467).
  • MAP3K6 mitogen-activated protein kinase kinase kinase 6
  • the full-length virtual ORF for 2R41-9-4 was generated using genomic sequence to provide the Nterminus for the partial ORF predicted from clone 2R41-9-4
  • Table 1 documents the results from the analysis of the nucleic acid sequence data. From left to right the data presented is as follows. "Gene name” refers to the EST or PCR fragment that defined the novel kinase. "Species” refers to the organism the sequence was derived from. “ED#” refers to the nucleic acid and amino acid sequence ED number designation from this patent. "Kinase family "and “Kinase group” refers to the protein kinase classification defined by sequence homology and based on previously established phylogenetic analysis [Hardie, G. and Hanks S. The Protein Kinase Book, Academic Press (1995) and Hunter T. and Plowman, G.
  • ORF Start refers to the open reading frame range and length as calculated by standard nucleic acid translation programs such as MapDraw (DNAStar).
  • DNAStar maps to regions of low complexity sequence or repetitive elements such as Alu, LINE, SINE, and LTR sequences.
  • CHR localization for 37 of the 110 novel protein kinases is shown on Table 1 (NA, not available). The methods for determining chromosomal position are outlined below, in Example 2.
  • Table 2 documents the results from the analysis of the amino acid sequence data. From left to right the data presented is as follows. "Gene name” refers to the EST or PCR fragment that defined the novel kinase. "Species” refers to the organism the sequence was derived from. “ED#” refers to the nucleic acid and amino acid sequence ID number designation from this patent. "Kinase family "and “Kinase group” refers to the protein kinase classification defined by sequence homology and based on previously established phylogenetic analysis [Hardie, G. and Hanks S. The Protein Kinase Book, Academic Press (1995) and Hunter T. and Plowman, G. Trends in Biochemical Sciences (1977) 22:18-22 and Plowman G.D.
  • Proteins in which the profile recognizes a full length catalytic domain have a “Profile Start” of 1 and a “Profile End” of 261.
  • the boundaries of the catalytic domain within the overall protein are noted in the "Kinase Domain Start” and "Kinase Domain End” columns.
  • HMM Hidden Markov model
  • Protein sequences containing potential pest motifs were identified using the program PESTfmd (www.at.embnet.org/embnet/tools/bio/PESTfind/).
  • PEST regions in proteins are by definition sequences that tend to be rich in proline, glutamic or aspartic acid, argininine and histidine; they have been associated with increased protein turnover rates (Rogers S. et al. (1986) Science 234, 364-368.
  • the algorithm defines PEST sequences as hydrophilic stretches of amino acids greater than or equal to 12 residues in length. Such regions contain at least one P, one E or D and one S or T.
  • PESTfmd produces a score ranging form about -50 to +50.
  • a score above zero denotes a possible PEST region; a value greater than +5 defines a high probability that there is a PEST domain.
  • N34132 SEQ ID NO:183
  • regions scoring 0.5 or higher were considered to have potential coiled-coil domain region.
  • the amino acid positions within N34231 scoring for potential coil-coil regions are shown below. Table 11 coiled-coil domains predicted for N34132
  • PEST domains were identified in N34132 using PESTfmd, a value greater than +5 defines a high probability that there is a PEST domain.
  • the amino acid positions within N34132 scoring for potential PEST regions are shown below.
  • the nucleic acid for the gene of interest is used as a query against databases, such as dbsts and htgs (described at http://www.ncbi.nlm.nih.gov/BLAST/blast_databases.html) containing sequences that have been mapped already.
  • the nucleic acid sequence is searched using BLAST-2 at NCBI (http://www.ncbi.nlm.nih.gov/cgi-bin BLAST/nph-newblast) and is used to query either dbsts or htgs.
  • Stanford University maintains a useful site for chromosomal mapping from STS data
  • htgs are often resolved immediately because the genomic region hit is annotated in the htgs entry. If an exact match match is found (defined roughly as 99% identity over a region of about 100 base pairs or longer, excluding any repetitive sequence), then the mapped position of the entry in the database is assigned to the original kinase query. Once a cytogenetic region has been identified by one of these approaches, disease association is established by searching OMIM (see above for URL) with the cytogenetic location. OMIM maintains a searchable catalog of cytogenetic map locations organized by disease.
  • Table 1 Three of the novel protein kinases were mapped to regions associated with cancer amplicons, as shown on this table. The regions were also cross-checked with the Mendelian Inheritance in Man database, which tracks genetic information for many human diseases, including cancer. References for association of the mapped sites with chromosomal abnormalities found in human cancer can be found in: Knuutila, et al., Am J
  • Peptide sequences to extra-catalytic regions of novel kinases are chosen which are not homologous to other known kinases based on a Smith Waterman homology search against the non-redundant protein database and predicted to be antigenic based on the DNAStar Protean program. These peptides are conjugated to KLH using Glutaraldehyde.
  • Rabbits are immunized with the KLH-peptide conjugates by four injections three weeks apart. The rabbits are bled ten and fourteen days following the third injection and bled out ten days after the fourth. The serum is checked against the peptide by ELISA.
  • cDNA libraries derived from a variety of sources were immobilized onto nylon membranes and probed with 32P-labeled cDNA fragments derived from the gene(s) of interest.
  • RNA or mRNA was used as template in a reverse transcription reaction to generate single-stranded cDNAs (ss cDNA) that were tagged with specific sequences at each end.
  • the synthesized cDNAs contain specific sequence tags at both the 5' and the 3' end.
  • the 5' and the 3' ends are tagged with the same sequence (CDS and SMII) it is referred to as "symmetric.”
  • CDS and ML2G the 5' end is tagged with a different sequence than the 3' end (CDS and ML2G) is referred to as "asymmetric"
  • a double-stranded "cDNA library” is then generated by PCR amplification using the 3 'PCR and ML2 primers (3' PCR: AAGCAGTGGTAACAACGCAGAGT and ML2: AAGTGGCAACAGAGATAACGCGT) that anneal to the added sequence tags.
  • the amplified "cDNA libraries" were manually arrayed onto nylon membranes with a 384 pin replicator.
  • the DNA was denatured by alkali treatment, neutralized and cross-linked by UV light.
  • the arrays were pre-hybridized with Express Hyb (Clontech) and hybridized with 32P labeled probes generated by random hexamer priming of cDNA fragments corresponding to the genes of interest. After washing, the blots were exposed to phosphorimaging cassettes and the intensity of the signal was quantified.
  • the amount of the DNA on the arrays was also quantified by treating non-denatured or denatured arrays with Syber Green I or Syber Green II respectively (1 : 100,000 in 50mM Tris, pH8.0) for 2 minutes. After washing with 50mM Tris, pH8.0, the fluorescent emission was detected with a phosphorimager (Molecular Dynamics) and quantified. The amount of the arrayed DNA was used to normalize the hybridization signal and the corrected values are tabulated in Table 3.
  • tissue tissue type of the cDNA
  • Tumor sym indicates that the tissue is derived from a tumor
  • sym refers to the fact that the 5' and 3' primers used to make the sample are the same
  • Normal Sym indicates normal tissue was used to make the sample, with symmetric primers as described above
  • Tuor lo indicates that primary tumor tissue was used to make the cDNA
  • Tuor cells indicates that these cDNA samples were made from cultured tumor cells
  • Normal indicates that these samples are derived from normal tissue or cell lines
  • Endos indicates that these samples are derived from endothelium-related tissue sources
  • p53 refers to the status, mutant or wild-type, of the p53 gene in the source samples.
  • SEQ ED NO:3 (AA826850), SEQ ED NO:5 (TBKl), SEQ ED NO:6 (AA305176), SEQ ED NO:8 (AA256100), SEQ ED NO:9 (CAB43292), SEQ ED NO: 11 (EPK2), SEQ ED NO:12 (PKNbeta), SEQ ED NO:14 (H19102), SEQ ID NO:16 (RSK4),
  • SEQ ED NO:17 AAD30182
  • SEQ ID NO:20 SEQ ID NO:20
  • SEQ ED NO:22 PTK9L
  • SEQ ID NO:26 SEQ ID NO:26
  • SEQ ID NO:26 SEQ ID NO:26
  • SEQ ID NO:29 SEQ ID NO:31 (DRAK1)
  • SEQ ID NO:032 AAOl 5726
  • SEQ ED NO:40 MAK-V
  • SEQ ED NO:044 TRAD
  • SEQ ID NO:044 TRAD
  • SEQ ID NO:044 TRAD
  • SEQ ED NO:45 SEQ ED NO:454060
  • SEQ ED NO:47 AA234451
  • SEQ ID NO:48 AA436054
  • SEQ ID NO:49 AA626859
  • SEQ ED NO:51 KAA0904
  • 293T cells were transiently transfected with HA- p38 or co-transfected with Flag- tagged wt MLK4A, kinase-dead MLK4A, wild-type MLK4B or kinase-dead MLK4B using Lipofectamine 2000 (Lifetech). Cells were lysed 36 hr post-transfection. Cell lysates normalized to contain equivalent amounts of HA-p38 were immunoprecipitated with anti-HA antibody (Mab HA-11, Babco). Immunoprecipitates were split in two portions, one portion was Western-blotted with anti- HA antibody and the other with a phospho-specific p38 antibody (Promega) to detect activated levels of p38. Activation of Erkl and Jnkl was measured similarly. (This example applies to AA232253 (SEQ ID NO:82, SEQ E NO:201).)
  • 293T cells were transiently transfected with HA-Racl or co-transfected with Flag- tagged Duet C, Duet E, Dbl and HA-Tiam-1. Cells were lysed 36 hour post-transfection. Cell lysates normalized to contain equivalent amounts of Rac 1 were affinity precipitated with immobilized GST-PBD (p21 -binding domain of Pak3). Bound proteins were Western blotted and probed with anti-HA antibody to detect levels of activated Racl .
  • the invention is meant to also cover the final formulation formed by the combination of these excipients.
  • the invention includes formulations in which one to all of the added excipients undergo a reaction during formulation and are no longer present in the final formulation, or are present in modified forms.
  • features or aspects of the invention are described in terms of

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Engineering & Computer Science (AREA)
  • Medicinal Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Veterinary Medicine (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Biomedical Technology (AREA)
  • Molecular Biology (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Genetics & Genomics (AREA)
  • Microbiology (AREA)
  • Biochemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • Neurology (AREA)
  • Biotechnology (AREA)
  • Neurosurgery (AREA)
  • Hospice & Palliative Care (AREA)
  • Immunology (AREA)
  • Heart & Thoracic Surgery (AREA)
  • Cardiology (AREA)
  • Psychiatry (AREA)
  • Peptides Or Proteins (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Investigating Or Analysing Biological Materials (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Enzymes And Modification Thereof (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Medicines Containing Material From Animals Or Micro-Organisms (AREA)
PCT/US2000/014842 1999-05-28 2000-05-26 Protein kinases Ceased WO2000073469A2 (en)

Priority Applications (5)

Application Number Priority Date Filing Date Title
EP00936414A EP1180151A2 (en) 1999-05-28 2000-05-26 Protein kinases
CA002383244A CA2383244A1 (en) 1999-05-28 2000-05-26 Protein kinases
JP2001500781A JP2003501038A (ja) 1999-05-28 2000-05-26 蛋白質キナーゼ
AU51734/00A AU5173400A (en) 1999-05-28 2000-05-26 Protein kinases
US11/377,316 US20060234344A1 (en) 1999-05-28 2006-03-17 Protein kinases

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US13650399P 1999-05-28 1999-05-28
US60/136,503 1999-05-28

Related Child Applications (1)

Application Number Title Priority Date Filing Date
US11/377,316 Division US20060234344A1 (en) 1999-05-28 2006-03-17 Protein kinases

Publications (2)

Publication Number Publication Date
WO2000073469A2 true WO2000073469A2 (en) 2000-12-07
WO2000073469A3 WO2000073469A3 (en) 2001-11-29

Family

ID=22473127

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2000/014842 Ceased WO2000073469A2 (en) 1999-05-28 2000-05-26 Protein kinases

Country Status (6)

Country Link
US (1) US20060234344A1 (enExample)
EP (1) EP1180151A2 (enExample)
JP (1) JP2003501038A (enExample)
AU (1) AU5173400A (enExample)
CA (1) CA2383244A1 (enExample)
WO (1) WO2000073469A2 (enExample)

Cited By (89)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2001023579A1 (en) * 1999-09-28 2001-04-05 Lexicon Genetics Incorporated Human kinase proteins and polynucleotides encoding the same
WO2001025433A3 (en) * 1999-10-07 2001-11-29 Genentech Inc Novel polypeptides, their nucleic acids, and methods for their use in angiogenesis and vascularization
WO2001036474A3 (en) * 1999-11-16 2002-01-10 Rigel Pharmaceuticals Inc Srik a novel cell cycle protein associated with rip3
WO2001038503A3 (en) * 1999-11-24 2002-01-31 Sugen Inc Novel human protein kinases and protein kinase-like enzymes
WO2001059081A3 (en) * 2000-02-09 2002-02-14 Millennium Pharm Inc Methods for using 20893, a human protein kinase
WO2001042285A3 (en) * 1999-12-10 2002-03-07 Incyte Genomics Inc Extracellular matrix and cell adhesion proteins as well as genes encoding them
WO2001060991A3 (en) * 2000-02-17 2002-03-21 Incyte Genomics Inc Human kinases
WO2001085921A3 (en) * 2000-05-12 2002-04-04 Merck Patent Gmbh Human serine-threonine kinase-4
WO2001081558A3 (en) * 2000-04-25 2002-04-11 Millennium Pharm Inc 13295 novel protein kinase molecules and uses therefor
WO2001085954A3 (en) * 2000-05-12 2002-04-18 Merck Patent Gmbh Serine-threonine kinase-3
WO2001064908A3 (en) * 2000-02-29 2002-05-10 Millennium Pharm Inc 14790, a protein kinase and uses therefor
WO2001044444A3 (en) * 1999-12-14 2002-05-10 Glaxo Wellcome Kabushiki Kaish A protein kinase (ikk4) involved in the phosphorylation of ikb
US6387676B1 (en) 1998-08-04 2002-05-14 Immunex Corporation Human cDNAs encoding polypeptides having kinase functions
US6410294B1 (en) * 2000-12-13 2002-06-25 Pe Corporation (Ny) Isolated human kinase proteins, nucleic acid molecules encoding human kinase proteins, and uses thereof
WO2001081557A3 (en) * 2000-04-25 2002-08-22 Lexicon Genetics Inc Human kinase proteins and polynucleotides encoding the same
WO2002022795A3 (en) * 2000-09-14 2002-08-29 Pe Corp Ny Isolated human kinase proteins, nucleic acid molecules and uses thereof
WO2001096547A3 (en) * 2000-06-15 2002-08-29 Incyte Genomics Inc Human kinases
WO2002012456A3 (en) * 2000-08-03 2002-09-19 Ontario Inc 1149336 Ampk-related serine/threonine kinase, designated snark
WO2002018553A3 (en) * 2000-08-31 2002-09-19 Applera Corp Isolated human kinase proteins, nucleic acid molecules encoding human kinase proteins, and uses thereof
WO2002033096A3 (en) * 2000-10-16 2002-09-19 Bayer Ag Regulation of human serine-threonine protein kinase
US6458561B1 (en) 2000-03-13 2002-10-01 Incyte Genomics, Inc. Human NIM1 kinase
WO2002016563A3 (en) * 2000-08-18 2002-10-31 Millennium Pharm Inc 14189, a human kinase and uses thereof
US6476210B2 (en) * 2000-10-12 2002-11-05 Lexicon Genetics Incorporated Human kinases and polynucleotides encoding the same
EP1261721A1 (en) * 2000-03-08 2002-12-04 MERCK PATENT GmbH Human extracellular signal regulated kinases
WO2002053749A3 (en) * 2001-01-03 2002-12-05 Bayer Ag Regulation of human serine-threonine protein kinase
WO2002061060A3 (en) * 2001-01-31 2002-12-12 Pe Corp Ny Two splice variants of the human pftaire serine/threonine kinase
WO2002099096A1 (en) * 2001-06-07 2002-12-12 Bayer Aktiengesellschaft Regulation of human serine/threonine protein kinase-like enzyme
WO2002070678A3 (en) * 2001-02-05 2002-12-19 Bayer Ag Regulation of human serine/threonine protein kinase
WO2001079488A3 (en) * 2000-04-13 2003-01-30 Millennium Pharm Inc 14257,protein kinase molecules and uses therefor
WO2002048333A3 (en) * 2000-12-12 2003-01-30 Lexicon Genetics Inc Novel human kinases and uses thereof
WO2002016588A3 (en) * 2000-08-21 2003-01-30 Millennium Pharm Inc 15985, a human serine/threonine protein kinase family membe r and uses thereof
WO2002016567A3 (en) * 2000-08-24 2003-01-30 Applera Corp Isolated human kinase proteins, nucleic acid molecules encoding human kinase proteins, and uses thereof
WO2003008582A1 (en) * 2001-07-19 2003-01-30 The New Industry Research Organization Novel human-origin protein binding to sphingosine kinase 1 and polynucleotide encoding the protein
WO2001090160A3 (en) * 2000-05-26 2003-02-27 Bayer Ag REGULATION OF HUMAN p78-LIKE SERINE/THREONINE KINASE
WO2002048328A3 (en) * 2000-12-14 2003-02-27 Pe Corp Ny Isolated human kinase proteins, their encoding nucleic acid molecules, and uses thereof
WO2002033056A3 (en) * 2000-10-16 2003-03-13 Bayer Ag Regulation of human serine-threonine protein kinase
WO2002099094A3 (en) * 2001-06-07 2003-03-20 Bayer Ag Human serine/threonine protein kinase-like enzyme
WO2002055681A3 (en) * 2001-01-11 2003-03-27 Bayer Aktiengesellschaft Regulation of human tau-tubulin kinase
WO2002024921A3 (en) * 2000-09-25 2003-04-03 Millennium Pharm Inc 3700, a novel human protein kinase and uses therefor
WO2002059288A3 (en) * 2001-01-23 2003-04-10 Pe Corp Ny Isolated human kinase proteins, nucleic acid molecules encoding human kinase proteins, and uses thereof
WO2002010402A3 (en) * 2000-07-28 2003-04-17 Chiron Corp Isolation of drosophila and human polynucleotides encoding par-1 kinase, polypeptides encoded by the polynucleotides and methods utilizing the polynucleotides and polypeptides
EP1206576A4 (en) * 1999-06-30 2003-05-07 Millennium Pharm Inc NEW KINASES AND APPLICATIONS THEREOF
DE10102797A1 (de) * 2001-01-22 2003-05-08 Deutsches Krebsforsch HIPK-Kinasen und deren Verwendung zur Beeinflussung der Zellteilung und Zellproliferation
WO2002092760A3 (en) * 2001-05-10 2003-05-08 Amgen Inc SERINE THREONINE KINASE MEMBER, h2520-40
WO2003046167A1 (en) * 2001-11-27 2003-06-05 Bayer Healthcare Ag Regulation of human serine/threonine protein kinase
US6605456B1 (en) 1998-08-04 2003-08-12 Immunex Corporation Nucleic acids encoding IKR-2, a protein kinase related to the I kappa B kinases
WO2002002780A3 (en) * 2000-07-05 2003-08-28 Merck Patent Gmbh Human serine-threonine kinase
WO2001090155A3 (en) * 2000-05-24 2003-10-02 Curagen Corp Novx proteins and nucleic acids encoding same. diagnostic and therapeutic uses
US6630336B2 (en) 2000-06-09 2003-10-07 Applera Corporation Isolated human kinase proteins, nucleic acid molecules encoding human kinase proteins, and uses thereof
WO2002068617A3 (en) * 2000-12-19 2003-10-30 Pe Corp Ny Isolated human kinase proteins, nucleic acid molecules encoding human kinase proteins, and uses thereof
WO2002024947A3 (en) * 2000-09-20 2003-12-04 Kinetek Pharmaceuticals Inc Cancer associated protein kinases and their uses
EP1227156A3 (en) * 2001-01-30 2004-01-02 Aeomica, Inc. A human protein kinase domain-containing protein
WO2003037257A3 (en) * 2001-10-31 2004-01-22 Millennium Pharm Inc Methods and compositions for the diagnosis and treatment of cellular proliferation disorders using 20750
WO2002046382A3 (en) * 2000-12-08 2004-02-26 Pe Corp Ny Isolated human kinase proteins, nucleic acid molecules encoding human kinase proteins, and uses thereof
EP1393742A1 (en) * 2002-08-14 2004-03-03 atugen AG Use of protein kinase N beta
WO2004018669A1 (ja) * 2002-08-21 2004-03-04 Proteinexpress Co., Ltd. 塩誘導性キナーゼ2及びその用途
WO2004019973A1 (en) * 2002-08-14 2004-03-11 Atugen Ag Use of protein kinase n beta
US6716616B1 (en) 1999-09-28 2004-04-06 Lexicon Genetics Incorporated Human kinase proteins and polynucleotides encoding the same
WO2003076577A3 (en) * 2002-03-05 2004-05-06 Applera Corp Isolated human kinase proteins, nucleic acid molecules encoding human kinase proteins, and uses thereof
WO2002099048A3 (en) * 2001-06-05 2004-07-22 Exelixis Inc LIMKs AS MODIFIERS OF THE p53 PATHWAY AND METHODS OF USE
EP1484408A1 (en) * 1999-09-28 2004-12-08 Lexicon Genetics Incorporated Human kinase proteins and polynucleotides encoding the same
WO2003057835A3 (en) * 2001-12-28 2004-12-09 Univ Columbia Pak5-related compositions and methods
EP1430070A4 (en) * 2001-09-05 2005-01-26 Millennium Pharm Inc NOVEL CARK PROTEIN AND NUCLEIC ACID MOLECULES AND THEIR USE
US6852519B2 (en) 2000-06-06 2005-02-08 Applera Corporation Isolated human kinase proteins, nucleic acid molecules encoding human kinase proteins, and uses thereof
EP1358320A4 (en) * 2000-12-22 2005-04-27 Millennium Pharm Inc PROTEIN KINASE MOLECULES 68730 AND 69112, AND USES THEREOF
EP1580282A1 (en) * 2004-03-25 2005-09-28 Ken-Shwo Dai Use of human RPS6KA6-related gene variant for diagnosing T cell lymphoblastic lymphoma
US7001752B1 (en) 1999-05-28 2006-02-21 Immunex Corporation Murine and human kinases
US7033790B2 (en) 2001-04-03 2006-04-25 Curagen Corporation Proteins and nucleic acids encoding same
US7037891B2 (en) 1997-05-21 2006-05-02 Children's Medical Center Corporation Methods of modulating G-protein-coupled receptor kinase-associated signal transduction
EP1676917A3 (en) * 2000-12-12 2006-07-12 Lexicon Genetics Incorporated Novel human kinases and uses thereof
US7122361B2 (en) 2002-10-10 2006-10-17 Wyeth Compositions employing a novel human kinase
EP1339866A4 (en) * 2000-11-09 2006-10-25 Univ Virginia HUMAN SPECIMENS SERIN / THREONINE KINASE
EP1343876B1 (en) * 2000-12-11 2007-02-14 Children's Medical Center Corporation Modulators of activity of g-protein-coupled receptor kinases
US7198930B2 (en) 2000-02-29 2007-04-03 Millennium Pharmaceuticals, Inc. Human protein kinase, phosphatase, and protease family members and uses thereof
WO2005056802A3 (en) * 2003-12-12 2007-04-19 Cancer Rec Tech Ltd Materials and methods relating to cell cycle control
US7208306B2 (en) 2002-10-24 2007-04-24 Wyeth Compositions employing a novel human protein phosphatase
WO2006061130A3 (de) * 2004-12-10 2007-04-26 Sanofi Aventis Deutschland Verwendung der serum-/glucocorticoid regulierten kinase
US7214502B2 (en) 2000-03-24 2007-05-08 Millennium Pharmaceuticals, Inc. 3714, 16742, 23546, and 13887 novel protein kinase molecules and uses therefor
EP1549749A4 (en) * 2002-10-10 2007-08-22 Wyeth Corp COMPOSITIONS, ORGANISMS AND METHODS USING A NEW HUMAN KINASE
US7285643B2 (en) 1999-05-28 2007-10-23 Immunex Corporation Antibodies to novel murine and human kinases
US7297525B2 (en) 2002-11-27 2007-11-20 Wyeth Composition employing a novel human kinase
US7368113B2 (en) * 2000-12-21 2008-05-06 The Trustees Of The University Of Pennsylvania Hormonally up-regulated, neu-tumor-associated kinase
EP1443117B1 (en) * 2000-11-09 2010-08-11 University Of Virginia Patent Foundation Human testis specific serine/threonine kinase
US7790157B2 (en) * 1998-12-11 2010-09-07 Millennium Pharmaceuticals, Inc. Methods of modulating CARK protein activity
WO2011042030A1 (en) * 2009-10-06 2011-04-14 Tallinn University Of Technology Inhibition or activation of serine/threonine ulk3 kinase activity
US20120014937A1 (en) * 2003-04-30 2012-01-19 Incyte Corporation Human Beta-Adrenergic receptor kinase polypeptide and methods
US8232256B2 (en) 2006-07-21 2012-07-31 Silence Therapeutics Ag Means for inhibiting the expression of protein kinase 3
US8399637B2 (en) * 2006-08-24 2013-03-19 The Trustees Of The University Of Pennsylvania Nucleic acids encoding proteins for modulating Na,K-ATPase
US9387262B2 (en) 2004-12-27 2016-07-12 Silence Therapeutics Gmbh Coated lipid complexes and their use

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2025006571A1 (en) * 2023-06-26 2025-01-02 University Of Kentucky Research Foundation Targeted destruction of pask by peptide-based degron

Family Cites Families (29)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
DE69331994T2 (de) * 1992-08-31 2003-02-20 Massachusetts Institute Of Technology, Cambridge Dna kodierend für die häm-regulierte kinase des eukaryontischen initiationsfaktors 2-alpha
WO1997033909A2 (en) * 1996-03-15 1997-09-18 Corixa Corporation Compounds and methods for immunotherapy and immunodiagnosis of prostate cancer
DE69736326T2 (de) * 1996-06-10 2007-07-19 Immunex Corp., Seattle Il-1/tnf-alpha-activated kinase (itak), und verfahren zu ihrer herstellung und verwendung
US5863729A (en) * 1996-07-09 1999-01-26 Washington University DNA sequences encoding human TcAK1 kinase
US5863780A (en) * 1996-09-12 1999-01-26 Incyte Pharmaceuticals, Inc. Human Protein Kinases
AU6031398A (en) * 1997-01-21 1998-08-07 Genetics Institute Inc. Secreted proteins and polynucleotides encoding them
EP0972011A4 (en) * 1997-02-07 2003-04-16 Merck & Co Inc CYCLIN-DEPENDENT PROTEIN KINASE
US6479274B1 (en) * 1997-02-13 2002-11-12 Amrad Operations Pty., Ltd. DNA molecules encoding human HELA2 or testisin serine proteinases
DE19708173A1 (de) * 1997-02-28 1998-09-03 Dade Behring Marburg Gmbh Zellvolumenregulierte humane Kinase h-sgk
US5965420A (en) * 1997-03-05 1999-10-12 Smithkline Beecham Corporation Human protein kinases hYAK3
US5885803A (en) * 1997-06-19 1999-03-23 Incyte Pharmaceuticals, Inc. Disease associated protein kinases
JP2001516009A (ja) * 1997-07-17 2001-09-25 ルードヴィッヒ インスティテュート フォー キャンサー リサーチ ガン関連核酸及びポリペプチド
AU1991899A (en) * 1997-12-19 1999-07-12 Karolinska Innovations Ab Molecules associated with the human fused gene
AU1691499A (en) * 1997-12-26 1999-07-19 Asahi Kasei Kogyo Kabushiki Kaisha Novel kinase
US6432668B1 (en) * 1997-12-30 2002-08-13 Chiron Corporation Polynucleotides encoding human cyclin-dependent kinase (hPFTAIRE)
US5962232A (en) * 1998-01-30 1999-10-05 Incyte Pharmaceuticals, Inc. Protein kinase molecules
EP1073756A4 (en) * 1998-03-26 2003-01-22 Gene Logic Inc IDENTIFICATION OF A cDNA ASSOCIATED WITH HUMAN HEART ISCHEMISTRY
WO1999050395A1 (fr) * 1998-03-27 1999-10-07 Helix Research Institute Serine-threonine proteine-kinase exprimee dans le rein
CA2327259A1 (en) * 1998-05-05 1999-11-11 Incyte Pharmaceuticals, Inc. Human transcriptional regulator molecules
WO1999058558A2 (en) * 1998-05-13 1999-11-18 Incyte Pharmaceuticals, Inc. Cell signaling proteins
JP2002517241A (ja) * 1998-06-11 2002-06-18 アストラゼネカ アクチボラグ ヒト受容体チロシンキナーゼ
WO2000006728A2 (en) * 1998-07-28 2000-02-10 Incyte Pharmaceuticals, Inc. Phosphorylation effectors
US6262228B1 (en) * 1998-08-17 2001-07-17 Tularik Inc. IRAK3 polypeptides and methods
US6183962B1 (en) * 1998-09-09 2001-02-06 Millennium Pharmaceuticals, Inc. Protein kinase molecules and uses therefor
US6013455A (en) * 1998-10-15 2000-01-11 Incyte Pharmaceuticals, Inc. Protein kinase homologs
WO2000035946A1 (en) * 1998-12-14 2000-06-22 The University Of Dundee Methods
CA2296792A1 (en) * 1999-02-26 2000-08-26 Genset S.A. Expressed sequence tags and encoded human proteins
EP1192257A2 (en) * 1999-03-18 2002-04-03 Incyte Pharmaceuticals, Inc. Human regulators of intracellular phosphorylation
WO2000058473A2 (en) * 1999-03-31 2000-10-05 Curagen Corporation Nucleic acids including open reading frames encoding polypeptides; 'orfx'

Cited By (128)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7037891B2 (en) 1997-05-21 2006-05-02 Children's Medical Center Corporation Methods of modulating G-protein-coupled receptor kinase-associated signal transduction
US6387676B1 (en) 1998-08-04 2002-05-14 Immunex Corporation Human cDNAs encoding polypeptides having kinase functions
US6605456B1 (en) 1998-08-04 2003-08-12 Immunex Corporation Nucleic acids encoding IKR-2, a protein kinase related to the I kappa B kinases
US6867013B2 (en) 1998-08-04 2005-03-15 Immunex Corporation Methods of screening for antagonists and agonists of polypeptides having kinase functions
US7790157B2 (en) * 1998-12-11 2010-09-07 Millennium Pharmaceuticals, Inc. Methods of modulating CARK protein activity
US6987000B2 (en) * 1998-12-11 2006-01-17 Millennium Pharmaceuticals, Inc. Cark protein and nucleic acid molecules and uses therefor
US7371380B2 (en) * 1998-12-11 2008-05-13 Millennium Pharmaceuticals, Inc. Anti-Cark antibodies and uses therefor
US7001752B1 (en) 1999-05-28 2006-02-21 Immunex Corporation Murine and human kinases
US7285643B2 (en) 1999-05-28 2007-10-23 Immunex Corporation Antibodies to novel murine and human kinases
EP1206576A4 (en) * 1999-06-30 2003-05-07 Millennium Pharm Inc NEW KINASES AND APPLICATIONS THEREOF
US6716616B1 (en) 1999-09-28 2004-04-06 Lexicon Genetics Incorporated Human kinase proteins and polynucleotides encoding the same
EP1484408A1 (en) * 1999-09-28 2004-12-08 Lexicon Genetics Incorporated Human kinase proteins and polynucleotides encoding the same
WO2001023579A1 (en) * 1999-09-28 2001-04-05 Lexicon Genetics Incorporated Human kinase proteins and polynucleotides encoding the same
AU783147B2 (en) * 1999-10-07 2005-09-29 Curagen Corporation Novel polypeptides, their nucleic acids, and methods for their use in angiogenesis and vascularization
WO2001025433A3 (en) * 1999-10-07 2001-11-29 Genentech Inc Novel polypeptides, their nucleic acids, and methods for their use in angiogenesis and vascularization
US6428980B1 (en) 1999-11-16 2002-08-06 Rigel Pharmaceuticals, Inc. Nucleic acids encoding RIP3 associated cell cycle proteins
WO2001036474A3 (en) * 1999-11-16 2002-01-10 Rigel Pharmaceuticals Inc Srik a novel cell cycle protein associated with rip3
WO2001038503A3 (en) * 1999-11-24 2002-01-31 Sugen Inc Novel human protein kinases and protein kinase-like enzymes
WO2001042285A3 (en) * 1999-12-10 2002-03-07 Incyte Genomics Inc Extracellular matrix and cell adhesion proteins as well as genes encoding them
WO2001044444A3 (en) * 1999-12-14 2002-05-10 Glaxo Wellcome Kabushiki Kaish A protein kinase (ikk4) involved in the phosphorylation of ikb
WO2001059081A3 (en) * 2000-02-09 2002-02-14 Millennium Pharm Inc Methods for using 20893, a human protein kinase
WO2001060991A3 (en) * 2000-02-17 2002-03-21 Incyte Genomics Inc Human kinases
WO2001064908A3 (en) * 2000-02-29 2002-05-10 Millennium Pharm Inc 14790, a protein kinase and uses therefor
US7282360B2 (en) 2000-02-29 2007-10-16 Millennium Pharmaceuticals, Inc. Human protein kinase, phosphatase, and protease family members and uses thereof
US7198929B2 (en) 2000-02-29 2007-04-03 Millennium Pharmaceuticals 14790, a novel protein kinase molecule and uses therefor
US6864078B2 (en) 2000-02-29 2005-03-08 Millennium Pharmaceuticals, Inc. 14790, novel protein kinase molecule and uses therefor
US7198930B2 (en) 2000-02-29 2007-04-03 Millennium Pharmaceuticals, Inc. Human protein kinase, phosphatase, and protease family members and uses thereof
EP1261721A1 (en) * 2000-03-08 2002-12-04 MERCK PATENT GmbH Human extracellular signal regulated kinases
US6458561B1 (en) 2000-03-13 2002-10-01 Incyte Genomics, Inc. Human NIM1 kinase
US7214502B2 (en) 2000-03-24 2007-05-08 Millennium Pharmaceuticals, Inc. 3714, 16742, 23546, and 13887 novel protein kinase molecules and uses therefor
WO2001079488A3 (en) * 2000-04-13 2003-01-30 Millennium Pharm Inc 14257,protein kinase molecules and uses therefor
US6908758B2 (en) 2000-04-25 2005-06-21 Lexicon Genetics Incorporated Human kinase proteins and polynucleotides encoding the same
WO2001081557A3 (en) * 2000-04-25 2002-08-22 Lexicon Genetics Inc Human kinase proteins and polynucleotides encoding the same
WO2001081558A3 (en) * 2000-04-25 2002-04-11 Millennium Pharm Inc 13295 novel protein kinase molecules and uses therefor
US6617147B2 (en) 2000-04-25 2003-09-09 Lexicon Genetics Incorporated Human kinase proteins and polynucleotides encoding the same
WO2001085921A3 (en) * 2000-05-12 2002-04-04 Merck Patent Gmbh Human serine-threonine kinase-4
WO2001085954A3 (en) * 2000-05-12 2002-04-18 Merck Patent Gmbh Serine-threonine kinase-3
WO2001090155A3 (en) * 2000-05-24 2003-10-02 Curagen Corp Novx proteins and nucleic acids encoding same. diagnostic and therapeutic uses
WO2001090160A3 (en) * 2000-05-26 2003-02-27 Bayer Ag REGULATION OF HUMAN p78-LIKE SERINE/THREONINE KINASE
US6858420B2 (en) 2000-06-06 2005-02-22 Applera Corporation Isolated human kinase proteins, nucleic acid molecules encoding human kinase proteins, and uses thereof
US6852519B2 (en) 2000-06-06 2005-02-08 Applera Corporation Isolated human kinase proteins, nucleic acid molecules encoding human kinase proteins, and uses thereof
US6630336B2 (en) 2000-06-09 2003-10-07 Applera Corporation Isolated human kinase proteins, nucleic acid molecules encoding human kinase proteins, and uses thereof
WO2001096547A3 (en) * 2000-06-15 2002-08-29 Incyte Genomics Inc Human kinases
WO2002002780A3 (en) * 2000-07-05 2003-08-28 Merck Patent Gmbh Human serine-threonine kinase
WO2002010402A3 (en) * 2000-07-28 2003-04-17 Chiron Corp Isolation of drosophila and human polynucleotides encoding par-1 kinase, polypeptides encoded by the polynucleotides and methods utilizing the polynucleotides and polypeptides
WO2002012456A3 (en) * 2000-08-03 2002-09-19 Ontario Inc 1149336 Ampk-related serine/threonine kinase, designated snark
US7759085B2 (en) 2000-08-18 2010-07-20 Millennium Pharmaceuticals, Inc. 14189, a novel human kinase and uses thereof
US6759221B1 (en) 2000-08-18 2004-07-06 Millennium Pharmaceuticals, Inc. 14189, a novel human kinase and uses thereof
WO2002016563A3 (en) * 2000-08-18 2002-10-31 Millennium Pharm Inc 14189, a human kinase and uses thereof
WO2002016588A3 (en) * 2000-08-21 2003-01-30 Millennium Pharm Inc 15985, a human serine/threonine protein kinase family membe r and uses thereof
WO2002016567A3 (en) * 2000-08-24 2003-01-30 Applera Corp Isolated human kinase proteins, nucleic acid molecules encoding human kinase proteins, and uses thereof
US6630337B2 (en) 2000-08-24 2003-10-07 Applera Corporation Isolated human kinase proteins, nucleic acid molecules encoding human kinase proteins, and uses thereof
US6733978B2 (en) 2000-08-24 2004-05-11 Applera Corporation Isolated human kinase proteins, nucleic acid molecules encoding human kinase proteins, and uses thereof
WO2002018553A3 (en) * 2000-08-31 2002-09-19 Applera Corp Isolated human kinase proteins, nucleic acid molecules encoding human kinase proteins, and uses thereof
US6555352B2 (en) 2000-08-31 2003-04-29 Applera Corporation Isolated human kinase proteins, nucleic acid molecules encoding human kinase proteins, and uses thereof
WO2002022795A3 (en) * 2000-09-14 2002-08-29 Pe Corp Ny Isolated human kinase proteins, nucleic acid molecules and uses thereof
US6780626B2 (en) 2000-09-14 2004-08-24 Applera Corporation Isolated human kinase proteins, nucleic acid molecules encoding human kinase proteins, and uses thereof
WO2002024947A3 (en) * 2000-09-20 2003-12-04 Kinetek Pharmaceuticals Inc Cancer associated protein kinases and their uses
WO2002024921A3 (en) * 2000-09-25 2003-04-03 Millennium Pharm Inc 3700, a novel human protein kinase and uses therefor
WO2002031129A3 (en) * 2000-10-12 2003-02-06 Lexicon Genetics Inc Human kinases and polynucleotides encoding the same
US6476210B2 (en) * 2000-10-12 2002-11-05 Lexicon Genetics Incorporated Human kinases and polynucleotides encoding the same
US6610537B2 (en) 2000-10-12 2003-08-26 Lexicon Genetics Incorporated Human kinases and polynucleotides encoding the same
WO2002033056A3 (en) * 2000-10-16 2003-03-13 Bayer Ag Regulation of human serine-threonine protein kinase
WO2002033096A3 (en) * 2000-10-16 2002-09-19 Bayer Ag Regulation of human serine-threonine protein kinase
US7150976B2 (en) 2000-10-16 2006-12-19 Bayer Healthcare Ag Regulation of human serine-threonine protein kinase
EP1339866A4 (en) * 2000-11-09 2006-10-25 Univ Virginia HUMAN SPECIMENS SERIN / THREONINE KINASE
EP1443117B1 (en) * 2000-11-09 2010-08-11 University Of Virginia Patent Foundation Human testis specific serine/threonine kinase
WO2002046382A3 (en) * 2000-12-08 2004-02-26 Pe Corp Ny Isolated human kinase proteins, nucleic acid molecules encoding human kinase proteins, and uses thereof
EP1343876B1 (en) * 2000-12-11 2007-02-14 Children's Medical Center Corporation Modulators of activity of g-protein-coupled receptor kinases
WO2002048333A3 (en) * 2000-12-12 2003-01-30 Lexicon Genetics Inc Novel human kinases and uses thereof
US6902924B2 (en) 2000-12-12 2005-06-07 Lexicon Genetics Incorporated Human kinases and polynucleotides encoding the same
US6579710B2 (en) 2000-12-12 2003-06-17 Lexicon Genetics Incorporated Human kinases and polynucleotides encoding the same
AU2002232642B2 (en) * 2000-12-12 2007-02-01 Lexicon Pharmaceuticals, Inc. Novel human kinases and uses thereof
EP1676917A3 (en) * 2000-12-12 2006-07-12 Lexicon Genetics Incorporated Novel human kinases and uses thereof
US6410294B1 (en) * 2000-12-13 2002-06-25 Pe Corporation (Ny) Isolated human kinase proteins, nucleic acid molecules encoding human kinase proteins, and uses thereof
WO2002048328A3 (en) * 2000-12-14 2003-02-27 Pe Corp Ny Isolated human kinase proteins, their encoding nucleic acid molecules, and uses thereof
WO2002068617A3 (en) * 2000-12-19 2003-10-30 Pe Corp Ny Isolated human kinase proteins, nucleic acid molecules encoding human kinase proteins, and uses thereof
US7368113B2 (en) * 2000-12-21 2008-05-06 The Trustees Of The University Of Pennsylvania Hormonally up-regulated, neu-tumor-associated kinase
EP1358320A4 (en) * 2000-12-22 2005-04-27 Millennium Pharm Inc PROTEIN KINASE MOLECULES 68730 AND 69112, AND USES THEREOF
WO2002053749A3 (en) * 2001-01-03 2002-12-05 Bayer Ag Regulation of human serine-threonine protein kinase
US7049118B2 (en) 2001-01-03 2006-05-23 Bayer Healthcare Ag Regulation of human serine-threonine protein kinase
WO2002055681A3 (en) * 2001-01-11 2003-03-27 Bayer Aktiengesellschaft Regulation of human tau-tubulin kinase
DE10102797A1 (de) * 2001-01-22 2003-05-08 Deutsches Krebsforsch HIPK-Kinasen und deren Verwendung zur Beeinflussung der Zellteilung und Zellproliferation
WO2002059288A3 (en) * 2001-01-23 2003-04-10 Pe Corp Ny Isolated human kinase proteins, nucleic acid molecules encoding human kinase proteins, and uses thereof
US6686176B2 (en) * 2001-01-23 2004-02-03 Applera Corporation Isolated human kinase proteins, nucleic acid molecules encoding human kinase proteins, and uses thereof
EP1227156A3 (en) * 2001-01-30 2004-01-02 Aeomica, Inc. A human protein kinase domain-containing protein
WO2002061060A3 (en) * 2001-01-31 2002-12-12 Pe Corp Ny Two splice variants of the human pftaire serine/threonine kinase
WO2002070678A3 (en) * 2001-02-05 2002-12-19 Bayer Ag Regulation of human serine/threonine protein kinase
US7033790B2 (en) 2001-04-03 2006-04-25 Curagen Corporation Proteins and nucleic acids encoding same
WO2002092760A3 (en) * 2001-05-10 2003-05-08 Amgen Inc SERINE THREONINE KINASE MEMBER, h2520-40
WO2002099048A3 (en) * 2001-06-05 2004-07-22 Exelixis Inc LIMKs AS MODIFIERS OF THE p53 PATHWAY AND METHODS OF USE
EP1474687A4 (en) * 2001-06-05 2005-11-16 Exelixis Inc MARKS AS MODIFIERS OF THE P53 PATH AND METHOD OF USE
US8153384B2 (en) 2001-06-05 2012-04-10 Exelixis, Inc. Marks as modifiers of the p53 pathway and methods of use
WO2002099096A1 (en) * 2001-06-07 2002-12-12 Bayer Aktiengesellschaft Regulation of human serine/threonine protein kinase-like enzyme
WO2002099094A3 (en) * 2001-06-07 2003-03-20 Bayer Ag Human serine/threonine protein kinase-like enzyme
WO2003008582A1 (en) * 2001-07-19 2003-01-30 The New Industry Research Organization Novel human-origin protein binding to sphingosine kinase 1 and polynucleotide encoding the protein
EP1430070A4 (en) * 2001-09-05 2005-01-26 Millennium Pharm Inc NOVEL CARK PROTEIN AND NUCLEIC ACID MOLECULES AND THEIR USE
WO2003037257A3 (en) * 2001-10-31 2004-01-22 Millennium Pharm Inc Methods and compositions for the diagnosis and treatment of cellular proliferation disorders using 20750
WO2003046167A1 (en) * 2001-11-27 2003-06-05 Bayer Healthcare Ag Regulation of human serine/threonine protein kinase
WO2003057835A3 (en) * 2001-12-28 2004-12-09 Univ Columbia Pak5-related compositions and methods
US7482138B2 (en) 2001-12-28 2009-01-27 The Trustees Of Columbia University In The City Of New York PAK5-related compositions and methods
WO2003076577A3 (en) * 2002-03-05 2004-05-06 Applera Corp Isolated human kinase proteins, nucleic acid molecules encoding human kinase proteins, and uses thereof
US7189551B2 (en) 2002-03-20 2007-03-13 Bioptik Technology, Inc. Human RPS6KA6-related gene variant associated with lung cancers
AU2010200822B2 (en) * 2002-08-14 2013-10-10 Silence Therapeutics Gmbh Use of protein kinase N beta
EP1393742A1 (en) * 2002-08-14 2004-03-03 atugen AG Use of protein kinase N beta
KR101295939B1 (ko) 2002-08-14 2013-09-09 사일런스 테라퓨틱스 아게 단백질 키나아제 n 베타의 용도
EP3040081A3 (en) * 2002-08-14 2016-07-20 Silence Therapeutics GmbH Use of protein kinase n beta
WO2004019973A1 (en) * 2002-08-14 2004-03-11 Atugen Ag Use of protein kinase n beta
KR101173794B1 (ko) * 2002-08-14 2012-08-16 사일런스 테라퓨틱스 아게 단백질 키나아제 n 베타의 용도
US9078855B2 (en) 2002-08-14 2015-07-14 Silence Therapeutics Gmbh Further use of protein kinase N beta
EP2055310A1 (en) * 2002-08-14 2009-05-06 Silence Therapeutics Aktiengesellschaft Further use of protein kinase N beta
AU2003260399B2 (en) * 2002-08-14 2009-12-03 Silence Therapeutics Gmbh Use of protein kinase N beta
US7713943B2 (en) 2002-08-14 2010-05-11 Silence Therapeutics Aktiengesellschaft (Ag) Further use of protein kinase N beta
WO2004018669A1 (ja) * 2002-08-21 2004-03-04 Proteinexpress Co., Ltd. 塩誘導性キナーゼ2及びその用途
US7407792B2 (en) 2002-10-10 2008-08-05 Wyeth Compositions, organisms and methodologies employing a novel human kinase
US7122361B2 (en) 2002-10-10 2006-10-17 Wyeth Compositions employing a novel human kinase
EP1549749A4 (en) * 2002-10-10 2007-08-22 Wyeth Corp COMPOSITIONS, ORGANISMS AND METHODS USING A NEW HUMAN KINASE
US7208306B2 (en) 2002-10-24 2007-04-24 Wyeth Compositions employing a novel human protein phosphatase
US7297525B2 (en) 2002-11-27 2007-11-20 Wyeth Composition employing a novel human kinase
US20120014937A1 (en) * 2003-04-30 2012-01-19 Incyte Corporation Human Beta-Adrenergic receptor kinase polypeptide and methods
US8779106B2 (en) 2003-04-30 2014-07-15 Incyte Corporation Antibodies to human β-adrenergic receptor kinase
WO2005056802A3 (en) * 2003-12-12 2007-04-19 Cancer Rec Tech Ltd Materials and methods relating to cell cycle control
EP1580282A1 (en) * 2004-03-25 2005-09-28 Ken-Shwo Dai Use of human RPS6KA6-related gene variant for diagnosing T cell lymphoblastic lymphoma
WO2006061130A3 (de) * 2004-12-10 2007-04-26 Sanofi Aventis Deutschland Verwendung der serum-/glucocorticoid regulierten kinase
US9387262B2 (en) 2004-12-27 2016-07-12 Silence Therapeutics Gmbh Coated lipid complexes and their use
US8232256B2 (en) 2006-07-21 2012-07-31 Silence Therapeutics Ag Means for inhibiting the expression of protein kinase 3
US8399637B2 (en) * 2006-08-24 2013-03-19 The Trustees Of The University Of Pennsylvania Nucleic acids encoding proteins for modulating Na,K-ATPase
WO2011042030A1 (en) * 2009-10-06 2011-04-14 Tallinn University Of Technology Inhibition or activation of serine/threonine ulk3 kinase activity

Also Published As

Publication number Publication date
US20060234344A1 (en) 2006-10-19
WO2000073469A3 (en) 2001-11-29
EP1180151A2 (en) 2002-02-20
JP2003501038A (ja) 2003-01-14
AU5173400A (en) 2000-12-18
CA2383244A1 (en) 2000-12-07

Similar Documents

Publication Publication Date Title
US20060234344A1 (en) Protein kinases
EP1073723B1 (en) Ste20-related protein kinases
EP1051500B1 (en) Diagnosis and treatment of aur1 and/or aur2 related disorders
US20040197792A1 (en) Novel Kinases
US20050125852A1 (en) Novel kinases
CA2394803A1 (en) Novel human protein kinases and protein kinase-like enzymes
US20060140954A1 (en) Novel human protein kinases and protein kinase-like enzymes
EP1212433A2 (en) Protein phosphatases and diagnosis and treatment of phosphatase-related disorders
US6495353B1 (en) Human orthologues of wart
CA2331889A1 (en) Nek-related and bub1-related protein kinases
US20080009610A1 (en) Diagnosis and treatment of PTP related disorders
US20040087783A1 (en) Diagnosis and treatment of SAD related disorders
US20040219139A1 (en) Diagnosis and treatment of ALK-7 related disorders
US6844177B2 (en) Diagnosis and treatment of PTP04 related disorders
US20030211989A1 (en) Novel human protein kinases and protein kinase-like enzymes
US7029912B1 (en) Tyrosine kinase substrate(Tks) proteins
US6342593B1 (en) Diagnosis and treatment of ALP related disorders
EP1595946A2 (en) STE20-related protein kinases
US20060019294A1 (en) Tyrosine kinase substrate (Tks) proteins
EP1533378A2 (en) Tyrosine kinase substrate protein Tks7
WO1999027099A1 (en) Orf, a substrate for extracellular signal-regulated kinase, erk-6, and related methods

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A2

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY CA CH CN CR CU CZ DE DK DM EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW

AL Designated countries for regional patents

Kind code of ref document: A2

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
WWE Wipo information: entry into national phase

Ref document number: 2000936414

Country of ref document: EP

Ref document number: 2383244

Country of ref document: CA

ENP Entry into the national phase

Ref document number: 2001 500781

Country of ref document: JP

Kind code of ref document: A

AK Designated states

Kind code of ref document: A3

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY CA CH CN CR CU CZ DE DK DM EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW

AL Designated countries for regional patents

Kind code of ref document: A3

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG

WWP Wipo information: published in national office

Ref document number: 2000936414

Country of ref document: EP

REG Reference to national code

Ref country code: DE

Ref legal event code: 8642

WWW Wipo information: withdrawn in national office

Ref document number: 2000936414

Country of ref document: EP