WO1999027099A1 - Orf, a substrate for extracellular signal-regulated kinase, erk-6, and related methods - Google Patents

Abstract

The present invention relates to ORF polypeptide, nucleic acids encoding such polypeptide, cells, tissues and animals containing such nucleic acids, antibodies to such polypeptide, assays utilizing such polypeptide, and methods relating to all of the foregoing. Methods for treatment, diagnosis, and screening are provided for ORF related diseases or conditions characterized by an abnormal interaction between an ORF polypeptide and an ORF binding partner.

Description

DESCRIPTION

ORF, A SUBSTRATE FOR EXTRACELLULAR SIGNAL-REGULATED KINASE, ERK-6, AND RELATED METHODS

Introduction The present invention relates generally to a newly identified protein kinase substrate and related products and methods .

Background of the Invention

The following description of the background of the invention is provided to aid in understanding the invention, but is not admitted to describe or constitute prior art to the invention.

It is important for most organisms to sense extracellular signals and generate an appropriate biological response. A wide variety of these cellular functions, mediated by cell signaling, gene expression and mitosis, are regulated by the reversible phosphorylation of proteins on serine and threonine residues. Mitogen-activated protein (MAP) kinases, also called extracellular signal-regulated kinases (ERK) , are proline- directed kinases which phosphorylate sites containing the core consensus motif Ser/Thr-Pro (S/T-P) . Once activated, many of these enzymes translocate to the cell nucleus to regulate the activity of transcription factors ( see, Treisman, R. , Current Opinion in Cell Biology 8:205-215, 1996, for review). These kinases were initially identified in mammalian cells as enzymes that require tyrosine and threonine phosphorylation for activation (Anderson, N., et al., Nature 343:651-653, 1990), a process mediated by a dual specificity MAPK kinase (MAPKK) . The MAPKK, also called MEK, is subject to regulation through tyrosine phosphorylation by a MAPKK kinase (MAPKKK or MEKK) . This sequential cascade of activation defines modules of three consecutive protein kinases, the most distal being a member of the ERK family. Three distinct modules have been described in mammalian cells, which appear to be linked to separate signal transduction pathways resulting in the final activation of either p42/p44^MAPK,

or stress-activated protein kinases (SAPKs) also called Jun kinases.

Depending on the cellular context, the preferential activation of one of the MAPK cascades upon extracellular stimulation will elicit a specific cellular response such as proliferation, differentiation or apoptosis. The best characterized cascade, Raf/MEK/ERKl and ERK2, can be recruited by numerous receptors of several classes, including receptor tyrosine kinases, seven transmembrane receptors and cytokine receptors. This module has been shown to be involved in the control of cell proliferation and differentiation (Marshall, C.J., et al., Curr . Opin. Genet. Dev. 4:82-89, 1994). The SAPK/JNKs and pSδ/HOG^^ cassettes are strongly activated in response to a variety of chemical and environmental stress stimuli (Derijard, B., et al., Cell 76:1025-1037, 1994; Rouse, J., et al., Cell 78:1027-1037, 1994; Freshney, N. ., et al., Cell 78:1039-1049, 1994). More specifically the SAPK/.JNKS lie downstream of Rho family small G proteins and are responsive to UV radiation, while pSδ/HOG^^ are induced by inflammatory cytokines .

A question central to the understanding of the function of ERK proteins is the characterization of the substrates they phosphorylate, following their activation and translocation to the nuclei. Powerful genetic methods combined to biochemical approaches have allowed the identification of target genes and transcription factors for some pathways (see, Treisman, R., Current Opinion in Cell Biology 8:205-215, 1996, for review), and showed that the activation of MAPK modules results in changes in the transcriptional pattern of the cell. Among the known targets, some are shared between the different pathways such as ELK-1, a member of the Ternary Complex Factor (TCF) family of ETS-domain proteins that is a substrate for ERK1/2, JNK/SAPK as well as p38 (Gille, H., et al., Nature 358:414-417 1992; Gille, H., et al., Curr. Biol. 5:1191-1200, 1995; Marais, R., et al., Cell 73:381-393, 1993; Whitmarsh, A.J., et al . , Science 269:403-407, 1995; Zinck, R. , et al., Mol. Cell. Biol. 15:4930-4938, 1995). Similarly, The ATF-2 transcription factor is phosphorylated and regulated by both JNK/SAPK (Gupta, S., et al., Science 267:389-393, 1995; Livingstone, C, et al., EMBO J. 14:1785-1797, 1995; Van Dam, H. , et al . , EMBO J. 14:1798-1811, 1995) and p38 (Raingeaud, J. , et al., J. Biol. Chem. 270:7420-7426, 1995). Other targets show a greater degree of specificity such as the activation domain of cJun that is a substrate for JNK/SAPK (Hibi, M. , et al., Genes & Dev. 7:2135-2148, 1993; Derijard, B., et al., Cell 76:1025- 1037, 1994) . One way by which the targets are specified is via interaction between ERK and their substrates. For example, JNK/SAPK isoforms exhibit differential affinities for a sequence amino-terminal to the phosphorylation sites in cJun (Kallunki, T., et al . , Genes & Dev. 8:2996-3007, 1994; Gupta, S., et al., EMBO J. 15:2760-2770, 1996). Similarly, phosphorylation of ATF-2 by either p38 or JNK/SAPKs also requires a binding domain distinct from the phosphorylation sites (Gupta, S., et al., Science 267:389-393, 1995; Livingstone, C, et al., EMBO J. 14:1785-1797, 1995). The known repertoire of substrate is not restricted to transcription factor since the p38 kinase was independently characterized upon its ability to phosphorylate the MAPK- activated protein kinase-2 (MAPKAP) (Rouse, J., et al., Cell 78:1027-1037, 1994; Freshney, N. ., et al., Cell 78:1039-1049, 1994) .

A new MAP kinase, called ERK6, has recently been cloned that belongs to the pSδ/HOG^^ subfamily of proteins (Lechner, C, et al., Proc. Natl. Acad. Sci. U.S.A. 93:4355-4359, 1996). Although distinct from the p38 isoforms, ERK6 shares with its closest relatives a TGY sequence in the activation domain suggesting that they are responsive to similar inductors, including osmotic shock. Predominantly expressed in skeletal muscle, the ERK6 kinase has been shown to be able to facilitate terminal differentiation of myoblast.

Due to potential importance of ERK6 in regulating signal transduction pathways and therefore regulating disease, there exists a need in the art to discover new methodologies by which the function of ERK6 is modulated.

Summary of the Invention

Disclosed herein is a newly discovered substrate, which we have named ORF, for a MAP kinase, called ERK6, which itself was only recently discovered. The properties of this protein are described below. The present invention concerns the ORF polypeptide, nucleic acids encoding such a polypeptide, cells, tissues and animals containing such nucleic acids, antibodies to the polypeptide, assays utilizing the polypeptide, and methods relating to all of the foregoing.

Thus, in a first aspect, the invention features an isolated, enriched, or purified nucleic acid molecule encoding an ORF polypeptide.

By "isolated" in reference to nucleic acid it is meant a polymer of 14, 17, 21 or more nucleotides conjugated to each other, including DNA or RNA that is isolated from a natural source or that is synthesized. The isolated nucleic acid of the present invention is unique in the sense that it is not found in a pure or separated state in nature. Use of the term "isolated" indicates that a naturally occurring sequence has been removed from its normal cellular (i.e., chromosomal) environment. Thus, the sequence may be in a cell-free solution or placed in a different cellular environment. The term does not imply that the sequence is the only nucleotide sequence present, but that it is essentially free (at least about 90 - 95% pure) of non-nucleotide material naturally associated with it and thus is meant to be distinguished from isolated chromosomes.

By the use of the term "enriched" in reference to nucleic acid it is meant that the specific DNA or RNA sequence constitutes a significantly higher fraction (2 - 5 fold) of the total DNA or RNA present in the cells or solution of interest than in normal or diseased cells or in the cells from which the sequence was taken. This could be caused by a person by preferential reduction in the amount of other DNA or RNA present, or by a preferential increase in the amount of the specific DNA or RNA sequence, or by a combination of the two. However, it should be noted that "enriched" does not imply that there are no other DNA or RNA sequences present, just that the relative amount of the sequence of interest has been significantly increased.

The term "significant" here is used to indicate that the level of increase is useful to the person making such an increase, and generally means an increase relative to other nucleic acids of about at least 2 fold, more preferably at least 5 to 10 fold or even more. The term also does not imply that there is no DNA or RNA from other sources. The other source of DNA may, for example, comprise DNA from a yeast or bacterial genome, or a cloning vector such as pUC19. This term distinguishes the sequence from naturally occurring enrichment events, such as viral infection, or tumor type growths, in which the level of one mRNA may be naturally increased relative to other species of mRNA. That is, the term is meant to cover only those situations in which a person has intervened to elevate the proportion of the desired nucleic acid.

It is also advantageous for some purposes that a nucleotide sequence be in purified form. The term "purified" in reference to nucleic acid does not require absolute purity (such as a homogeneous preparation) ; instead, it represents an indication that the sequence is relatively more pure than in the natural environment (compared to the natural level this level should be at least 2-5 fold greater, e . g. , in terms of mg/ml) . Individual clones isolated from a cDNA library may be purified to electrophoretic homogeneity. The claimed DNA molecules obtained from these clones can be obtained directly from total DNA or from total RNA. The cDNA clones are not naturally occurring, but rather are preferably obtained via manipulation of a partially purified naturally occurring substance (messenger RNA) . The construction of a cDNA library from mRNA involves the creation of a synthetic substance (cDNA) and pure individual cDNA clones can be isolated from the synthetic library by clonal selection of the cells carrying the cDNA library. Thus, the process which includes the construction of a cDNA library from mRNA and isolation of distinct cDNA clones yields an approximately 10⁶-fold purification of the native message. Thus, purification of at least one order of magnitude, preferably two or three orders, and more preferably four or five orders of magnitude is expressly contemplated. The term is also chosen to distinguish clones already in existence which may encode ORF but which have not been isolated from other clones in a library of clones. Thus, the term covers clones encoding ORF which are isolated from other non-ORF clones.

The term "nucleic acid molecule" describes a polymer of deoxyribonucleotides (DNA) or ribonucleotides (RNA) . The nucleic acid molecule may be isolated from a natural source by cDNA cloning or subtractive hybridization or synthesized manually. The natural source may be mammalian (human) blood, semen, or tissue. The nucleic acid molecule may be synthesized manually by the triester synthetic method or by using an automated DNA synthesizer. Both these and other nucleic acid synthesis techniques are well-known in the art.

The term "cDNA cloning" refers to hybridizing a small nucleic acid molecule, a probe, to genomic cDNA that is bound to a membrane. The probe hybridizes (binds) to complementary sequences of cDNA.

The term "hybridize" refers to a method of interacting a nucleic acid sequence with a DNA or RNA molecule in solution or on a solid support, such as nitrocellulose, nylon or some combination of these materials. If a nucleic acid sequence binds to the DNA or RNA molecule with high affinity, it is said to "hybridize" to the DNA or RNA molecule. The strength of the interaction between the probing sequence and its target can be assessed by varying the stringency of the hybridization conditions. Various low or high stringency hybridization conditions may be used depending upon the specificity and selectivity desired. Stringency is controlled by varying salt or denaturant concentrations. Those skilled in the art will recognize how hybridization conditions can be varied to vary specificity and selectivity. Under highly stringent hybridization conditions only highly complementary nucleic acid sequences hybridize. Preferably, such conditions prevent hybridization of nucleic acids having one or two mismatches out of 20 contiguous nucleotides.

As a general guideline, high stringency conditions (hybridization at 50-65 °C, 5X SSPC, 50% formamide, wash at 50- 65 °C, 0.5X SSPC) can be used to obtain hybridization between nucleic acid sequences having regions which are greater than about 90% complementary. Low stringency conditions

(hybridization at 35-37 °C, 5X SSPC, 40-45% formamide, wash at

42 °C SSPC) can be used so that sequences having regions which are greater than 35-45% complementarity will hybridize to the probe. These conditions only represent examples of stringency conditions and those skilled in the art recognize that these conditions may be changed depending on the particular mode of practice. By "ORF polypeptide" it is meant an amino acid sequence substantially similar to the sequence shown in SEQ ID NO:l or fragments thereof (preferably functional fragments) . A sequence that is substantially similar will preferably have at least 90% identity (more preferably at least 95% and most preferably 99-100%) to the sequence of SEQ ID NO:l, or a fragment thereof.

The ORF polypeptides of the present invention preferably have a substantially similar biological activity to the protein encoded by the full length nucleic acid sequence set forth in SEQ ID NO:l. By "biological activity" it is meant an activity of the ORF protein in a cell. Examples of biological activities include, but are not limited to, catalytic activity, binding a natural binding partner, and becoming phosphorylated by ERK6.

By "substantially similar biological activity" it is meant polypeptide function which is similar to that of the ORF protein in a cell. For example, a polypeptide with substantially similar biological activity to the ORF polypeptide will bind the same natural binding partners or will undergo the same catalytic activity as the ORF polypeptide. Such biological activities may be measured, for example, using the techniques described in the examples below and using conventional techniques well known in the art.

By "identity" is meant a property of sequences that measures their similarity or relationship. Identity is measured by dividing the number of identical residues in the two sequences by the total number of residues and multiplying the product by 100. Thus, two copies of exactly the same sequence have 100% identity, but sequences that are less highly conserved and have deletions, additions, or replacements have a lower degree of identity. Those skilled in the art will recognize that several computer programs are available for determining sequence identity.

An ORF polypeptide can be encoded by a full-length nucleic acid sequence or any portion of the full-length nucleic acid sequence. In preferred embodiments the isolated nucleic acid comprises, consists essentially of, or consists of a nucleic acid sequence set forth in SEQ ID NO: 2, a nucleic acid sequence that hybridizes to the nucleic acid sequence set forth in SEQ ID NO: 2, or a functional derivative (as defined below) of either of the foregoing.

In a preferred embodiment, the invention features an isolated, enriched, or purified nucleic acid molecule encoding an ORF polypeptide, where the nucleic acid molecule comprises a nucleotide sequence that: a) encodes a polypeptide having the full length amino acid sequence set forth in SEQ ID NO:l; b) is the complement of the nucleotide sequence of (a) ; c) hybridizes under highly stringent conditions to the nucleotide molecule of (a) and encodes a naturally occurring ORF protein; d) encodes an ORF protein having the full length amino acid sequence of the sequence set forth in SEQ ID NO:l except that it lacks one or more of the following segments of amino acid residues: 1-23, 24-58, 59-92, 93-126, 127-160, 161-182, 183- 248, or 249-262; e) is the complement of the nucleotide sequence of (d) ; f) encodes a polypeptide having the amino acid sequence set forth in SEQ ID NO:l from amino acid residues 1- 23, 24-58, 59-92, 93-126, 127-160, 161-182, 183-248, or 249- 262; g) is the complement of the nucleotide sequence of (f) ; h) encodes a polypeptide having the full length amino acid sequence set forth in SEQ ID NO:l except that it lacks one or more of the domains selected from the group consisting of an N-terminal domain, TPRl domain, TPR2 domain, TPR3 domain, TPR4 domain, HLH domain, and a C-terminal domain; or i) is the complement of the nucleotide sequence of (h) . In preferred embodiments the nucleic acid sequence also includes a vector or promoter effective to initiate transcription in a host cell. The term "complement" refers to two nucleotides that can form multiple favorable interactions with one another. For example, adenine is complementary to thymidine as they can form two hydrogen bonds. Similarly, guanine and cytosine are complementary since they can form three hydrogen bonds. A nucleotide sequence is the complement of another nucleotide sequence if all of the nucleotides of the first sequence are complementary to all of the nucleotides of the second sequence.

The term "domain" refers to a region of a polypeptide which contains a particular function. For instance, N-terminal or C-terminal domains of signal transduction proteins can serve functions including, but not limited to, binding molecules that localize the signal transduction molecule to different regions of the cell or binding other signaling molecules directly responsible for propagating a particular cellular signal. Some domains can be expressed separately from the rest of the protein and function by themselves, while others must remain part of the intact protein to retain function. The latter are termed functional regions of proteins and also relate to domains .

The term "N-terminal domain" refers to a portion of the full length amino acid sequences spanning from the amino terminus to the start of the TPRl domain.

The term "TPR domain" and "HLH domain" define structural regions of the ORF protein, based on amino acid similarity. The term "TPR" stands for Tetratrico Peptide Repeat. There are four such domains in the ORF polypeptide, termed TPRl, TPR2, TPR3, and TPR4. Each TPR domain is a 34-amino acid sequence. There is an underlying pattern of both amino acid identity and similarity between the TPR domains. The TPR motifs have the ability to mediate homotypic interactions, such as in CDC27, or to directly interact with other TPR or non TPR proteins, like CDC27, CYC8, and CDC23.

The term "HLH" stands for Helix-Loop-Helix. HLH domains heterodimerize with HLH domain of other proteins.

The term "C-terminal domain" refers to a portion of the full length amino acid molecules that begins at the end of the

HLH domain and ends at the carboxy terminal amino acid, which is the last amino acid encoded before the stop codon in the nucleic acid sequence.

Functional regions of the ORF polypeptide may be identified by aligning its amino acid sequence with amino acid sequences of other polypeptides with known functional regions.

If regions of the ORF polypeptide share high amino acid identity with the amino acid sequences of known functional regions, then the ORF polypeptide can be determined to contain these functional regions by those skilled in the art. The functional regions can be determined, for example, by using computer programs and sequence information available to those skilled in the art.

The term "vector" relates to a single or double stranded circular nucleic acid molecule that can be transfected or transformed into cells and replicate independently or within a cell genome. A vector can be cut and thereby linearized upon treatment with restriction enzymes. An assortment of vectors, restriction enzymes, and the knowledge of the nucleotide sequences that the restriction enzymes operate upon are readily available to those skilled in the art. A nucleic acid molecule encoding an ORF polypeptide can be inserted into a vector by cutting the vector with restriction enzymes and ligating the two pieces together.

The term "promoter" describes a nucleotide sequence that is incorporated into a vector that, once inside an appropriate cell, may facilitate transcription factor and/or polymerase binding and subsequent transcription of portions of the vector DNA into mRNA. The promoter element precedes the SI end of the nucleic acid molecule of the first aspect of the invention such that the latter is transcribed into mRNA. Recombinant cell machinery then translates mRNA into a polypeptide.

In a preferred embodiment, the invention features an isolated, enriched, or purified nucleic acid molecule encoding an ORF polypeptide, where the nucleic acid molecule is isolated, enriched, or purified from a human.

The term "nucleic acid probe" refers to a nucleic acid molecule that is complementary to and can bind a nucleic acid sequence encoding an amino acid sequence substantially similar to that set forth in SEQ ID NO: 2. Thus, the nucleic acid probe contains nucleic acid that will hybridize to a sequence set forth in SEQ ID NO: 2 or a functional derivative thereof.

In a preferred embodiment the nucleic acid is an isolated conserved or unique region, for example those useful for the design of hybridization probes to facilitate identification and cloning of additional polypeptides, or for the design of PCR probes to facilitate cloning of additional polypeptides.

By "conserved nucleic acid regions", it is meant regions present on two or more nucleic acids encoding an ORF polypeptide, to which a particular nucleic acid sequence can hybridize under lower stringency conditions. Preferably, conserved regions differ by no more than 5 out of 20 contiguous nucleotides .

By "unique nucleic acid region" it is meant a sequence present in a full length nucleic acid coding for an ORF polypeptide that is not present in a sequence coding for any other known naturally occurring polypeptide. Such regions preferably comprise 12, 14, 17, 21 or more contiguous nucleotides present in the full length nucleic acid encoding an ORF polypeptide. In particular, a unique nucleic acid region is preferably of human origin.

The invention also features a nucleic acid probe for the detection of a nucleic acid encoding an ORF polypeptide in a sample.

In preferred embodiments the nucleic acid probe hybridizes to nucleic acid encoding at least 4 contiguous amino acids of the sequence set forth in SEQ ID NO:l or a functional derivative thereof. Various low or high stringency hybridization conditions may be used depending upon the specificity and selectivity desired. Under highly stringent hybridization conditions only highly complementary nucleic acid sequences hybridize. Preferably, such conditions prevent hybridization of nucleic acids having 1 or 2 mismatches out of 20 contiguous nucleotides.

Methods for using the probes include detecting the presence or amount of ORF RNA in a sample by contacting the sample with a nucleic acid probe under conditions such that hybridization occurs and detecting the presence or amount of the probe bound to ORF RNA. The nucleic acid duplex formed between the probe and a nucleic acid sequence coding for an ORF polypeptide may be used in the identification of the sequence of the nucleic acid detected (for example see, Nelson et al., in Nonisotopic DNA Probe Techniques, p. 275 Academic Press, San Diego (Kricka, ed., 1992) hereby incorporated by reference herein in its entirety, including any drawings) . Kits for performing such methods may be constructed to include a container having disposed therein a nucleic acid probe. In another aspect, the invention features a recombinant cell or tissue containing a purified nucleic acid encoding an ORF polypeptide or an ORF domain polypeptide. In such cells, the nucleic acid may be under the control of its genomic regulatory elements, or may be under the control of exogenous regulatory elements including an exogenous promoter. By "exogenous" it is meant a promoter that is not normally coupled transcriptionally to the coding sequence for the ORF polypeptide in its native state. The term "recombinant" refers to an organism that has a new combination of genes or nucleic acid molecules. A new combination of genes or nucleic acid molecules can be introduced to an organism using a wide array of nucleic acid manipulation techniques available to those skilled in the art. The invention features a method for identifying human cells containing an ORF polypeptide or a related sequence. The method involves identifying the novel polypeptide in human cells using techniques that are routine and standard in the art, such as those described herein for identifying ORF (e.g., cloning, Southern or Northern blot analysis, in si tu hybridization, PCR amplification, etc.).

The invention also features recombinant nucleic acid, preferably in a cell or an organism. The recombinant nucleic acid may contain a sequence set forth in SEQ ID NO: 2 or a functional derivative thereof and a vector or a promoter effective to initiate transcription in a host cell. The recombinant nucleic acid can alternatively contain a transcriptional initiation region functional in a cell, a sequence complimentary to an RNA sequence encoding an ORF polypeptide and a transcriptional termination region functional in a cell.

Another aspect of the invention features an isolated, enriched, or purified ORF polypeptide.

By "isolated" in reference to a polypeptide is meant a polymer of 6, 12, 18 or more amino acids conjugated to each other, including polypeptides that are isolated from a natural source or that are synthesized. The isolated polypeptides of the present invention are unique in the sense that they are not found in a pure or separated state in nature. Use of the term "isolated" indicates that a naturally occurring sequence has been removed from its normal cellular environment. Thus, the sequence may be in a cell-free solution or placed in a different cellular environment. The term does not imply that the sequence is the only amino acid chain present, but that it is essentially free (about 90 - 95% pure at least) of material naturally associated with it.

By the use of the term "enriched" in reference to a polypeptide it is meant that the specific amino acid sequence constitutes a significantly higher fraction (2 - 5 fold) of the total of amino acids present in the cells or solution of interest than in normal or diseased cells or in the cells from which the sequence was taken. This could be caused by a person by preferential reduction in the amount of other amino acids present, or by a preferential increase in the amount of the specific amino acid sequence of interest, or by a combination of the two. However, it should be noted that "enriched" does not imply that there are no other amino acid sequences present, just that the relative amount of the sequence of interest has been significantly increased. The term significant here is used to indicate that the level of increase is useful to the person making such an increase, and generally means an increase relative to other amino acids of about at least 2 fold, more preferably at least 5 to 10 fold or even more. The term also does not imply that there is no amino acid from other sources.

The other source amino acid may, for example, comprise amino acid encoded by a yeast or bacterial genome, or a cloning vector such as pUC19. The term is meant to cover only those situations in which a person has intervened to elevate the proportion of the desired nucleic acid.

It is also advantageous for some purposes that an amino acid sequence be in purified form. The term "purified" in reference to a polypeptide does not require absolute purity (such as a homogeneous preparation) ; instead, it represents an indication that the sequence is relatively purer than in the natural environment (compared to the natural level this level should be at least 2-5 fold greater, e.g., in terms of mg/ml) . Purification of at least one order of magnitude, preferably two or three orders, and more preferably four or five orders of magnitude is expressly contemplated. The substance is preferably free of contamination at a functionally significant level, for example 90%, 95%, or 99% pure. In a preferred embodiment, the invention features an isolated, enriched, or purified fragment of the protein encoded by the full length sequence set forth in SEQ ID N0:1.

By "fragment" it is meant an amino acid sequence that is less than the full-length amino acid sequence. A fragment is preferably a functional fragment. The full-length amino acid sequences of ORF is shown in SEQ ID N0:1. Examples of fragments include ORF domains, ORF mutants, ORF-specific epitopes, and the shortest unique fragment of ORF.

By an "ORF mutant" it is meant an ORF polypeptide which differs from the native sequence in that one or more amino acids have been changed, added or deleted. Changes in amino acids may be conservative or non-conservative. By "conservative" it is meant the substitution of an amino acid for one with similar properties such as charge, hydrophobicity, structure, etc. Examples of polypeptides encompassed by this term include, but are not limited to, (1) chimeric proteins which comprise a portion of an ORF polypeptide sequence fused to a non-ORF polypeptide sequence, (2) ORF protein lacking a specific domain, for example the TPR or the HLH domain, and (3) ORF protein having a point mutation. An ORF mutant will retain some useful function such as, for example, binding to a natural binding partner, catalytic activity, or the ability to bind to an ORF specific antibody (as defined below) .

By "ORF-specific epitope" it is meant a sequence of amino acids that is both antigenic and unique to ORF, respectively. An ORF-specific epitope can be used to produce ORF-specific antibodies .

By "shortest unique fragment of ORF" it is meant the shortest sequence of amino acids that is unique to ORF. By "recombinant ORF polypeptide" it is meant to include a polypeptide produced by recombinant DNA techniques such that it is distinct from a naturally occurring polypeptide either in its location (e.g., present in a different cell or tissue than found in nature), purity or structure. Generally, such a recombinant polypeptide will be present in a cell in an amount different from that normally observed in nature.

In a preferred embodiment, the invention features an isolated, enriched or purified ORF polypeptide or ORF polypeptide fragment, where the polypeptide comprises an amino acid sequence having: (a) the full length amino acid sequence set forth in SEQ ID NO:l; (b) the full length amino acid sequence of sequence set forth in SEQ ID N0:1 except that it lacks one or more of the following segments of amino acid residues 1-23, 24-58, 59-92, 93-126, 127-160, 161-182, 183-248, or 249-262; (c) the amino acid sequence set forth in SEQ ID NO:l from amino acid residues 1-23, 24-58, 59-92, 93-126, 127- 160, 161-182, 183-248, or 249-262; (d) the full length amino acid sequence set forth in SEQ ID NO:l except that it lacks one or more of the domains selected from the group consisting of an N-terminal domain, TPRl domain, TPR2 domain, TPR3 domain, TPR4 domain, HLH domain, and a C-terminal domain.

In another preferred embodiment, the invention features an isolated, enriched or purified ORF polypeptide or ORF polypeptide fragment, where the ORF polypeptide interacts with ERK6 protein kinase.

In yet another aspect the invention features an antibody

(e.g., a monoclonal or polyclonal antibody) having specific binding affinity to an ORF polypeptide or ORF polypeptide fragment. By "specific binding affinity" is meant that the antibody binds to target (ORF) polypeptide with greater affinity than it binds to other polypeptides under specified conditions. Antibodies or antibody fragments are polypeptides which contain regions that can bind other polypeptides. The term "specific binding affinity" describes an antibody that binds to an ORF polypeptide with greater affinity than it binds to other polypeptides under specified conditions .

The term "polyclonal" refers to antibodies that are heterogenous populations of antibody molecules derived from the sera of animals immunized with an antigen or an antigenic functional derivative thereof. For the production of polyclonal antibodies, various host animals may be immunized by injection with the antigen. Various adjuvants may be used to increase the immunological response, depending on the host species . "Monoclonal antibodies" are substantially homogenous populations of antibodies to a particular antigen. They may be obtained by any technique which provides for the production of antibody molecules by continuous cell lines in culture. Monoclonal antibodies may be obtained by methods known to those skilled in the art. See, for example, Kohler, et al., Na ture 256:495-497 (1975), and U . S . Patent No. 4,376,110.

The term "antibody fragment" refers to a portion of an antibody, often the hypervariable region and portions of the surrounding heavy and light chains, that displays specific binding affinity for a particular molecule. A hypervariable region is a portion of an antibody that physically binds to the polypeptide target.

Antibodies or antibody fragments having specific binding affinity to an ORF polypeptide may be used in methods for detecting the presence and/or amount of an ORF polypeptide in a sample by probing the sample with the antibody under conditions suitable for ORF-antibody immunocomplex formation and detecting the presence and/or amount of the antibody conjugated to the ORF polypeptide. Diagnostic kits for performing such methods may be constructed to include antibodies or antibody fragments specific for ORF as well as a conjugate of a binding partner of the antibodies or the antibodies themselves.

An antibody or antibody fragment with specific binding affinity to an ORF polypeptide can be isolated, enriched, or purified from a prokaryotic or eukaryotic organism. Routine methods known to those skilled in the art enable production of antibodies or antibody fragments, in both prokaryotic and eukaryotic organisms. Purification, enrichment, and isolation of antibodies, which are polypeptide molecules, are described above.

Antibodies having specific binding affinity to an ORF polypeptide may be used in methods for detecting the presence and/or amount of an ORF polypeptide in a sample by contacting the sample with the antibody under conditions such that an immunocomplex forms and detecting the presence and/or amount of the antibody conjugated to the ORF polypeptide. Diagnostic kits for performing such methods may be constructed to include a first container containing the antibody and a second container having a conjugate of a binding partner of the antibody and a label, such as, for example, a radioisotope. The diagnostic kit may also include notification of an FDA approved use and instructions therefor.

In another aspect the invention features a hybridoma which produces an antibody having specific binding affinity to an ORF polypeptide. By "hybridoma" is meant an immortalized cell line which is capable of secreting an antibody, for example an ORF antibody. In preferred embodiments the ORF antibody comprises a sequence of amino acids that is able to specifically bind an ORF polypeptide. In yet another aspect the invention features a method for identifying a substance capable of modulating ORF activity comprising the steps of contacting an ORF polypeptide with a test substance and determining whether the substance alters the activity of ORF. The term "modulates" refers to the ability of a compound to alter the function of ORF. A modulator preferably activates or inhibits the activity of ORF depending on the concentration of the compound exposed to ORF.

The term "activates" refers to increasing the cellular activity of ORF. ORF activity is preferably the interaction with a natural binding partner.

The term "inhibit" refers to decreasing the cellular activity of ORF. ORF activity is preferably the interaction with a natural binding partner.

The term "modulates" also refers to altering the function of ORF by increasing or decreasing the probability that a complex forms between ORF and a natural binding partner. A modulator preferably increases the probability that such a complex forms between ORF and the natural binding partner, more preferably increases or decreases the probability that a complex forms between ORF and the natural binding partner depending on the concentration of the compound exposed to ORF, and most preferably decreases the probability that a complex forms between ORF and the natural binding partner.

The term "complex" refers to an assembly of at least two molecules bound to one another. Signal transduction complexes often contain at least two protein molecules bound to one another. For instance, a protein tyrosine receptor protein kinase, GRB2, SOS, RAF, and RAS assemble to form a signal transduction complex in response to a mitogenic ligand. The term "natural binding partner" refers to polypeptides or nucleic acids that bind to ORF in cells. A change in the interaction between ORF and a natural binding partner can manifest itself as an increased or decreased probability that the interaction forms, or an increased or decreased concentration of ORF/natural binding partner complex.

The term "contacting" as used herein refers to mixing a solution comprising the test compound with a liquid medium bathing the cells of the methods. The solution comprising the compound may also comprise another component, such as dimethylsulfoxide (DMSO) , which facilitates the uptake of the test compound or compounds into the cells of the methods. The solution comprising the test compound may be added to the medium bathing the cells by utilizing a delivery apparatus, such as a pipet-based device or syringe-based device.

In another aspect, the invention features a method for identifying a substance capable of modulating ORF activity in a cell comprising the steps of expressing an ORF polypeptide in a cell; adding a test substance to said cell; and monitoring a change in cell phenotype or the interaction between an ORF polypeptide and a natural binding partner. The term "cell phenotype" refers to the outward appearance of a cell or tissue or the function of the cell or tissue. Examples of cell phenotype include, but are not limited to, cell size (reduction or enlargement), cell proliferation (increased or decreased numbers of cells) , cell differentiation (a change or absence of a change in cell shape) , cell survival, apoptosis (cell death) , or the utilization of a metabolic nutrient (e.g., glucose uptake).

Changes or the absence of changes in cell phenotype are readily measured by techniques known in the art. In another aspect, the invention features a method of treating disease by administering to a patient in need of such treatment a substance that modulates the activity of ORF.

In a preferred embodiment, the invention features a method of treating disease by administering to a patient in need of such treatment a substance that modulates the activity of ORF, where the disease is selected from the group comprising dermatomyositis, polymyositis, inclusion body myositis, sarcoid myopathy, AZT myopathy, myocardial infarction, and ischemia/reperfusion. The summary of the invention described above is non-limiting and other features and advantages of the invention will be apparent from the following detailed description, and from the claims. Description of Figures

Figure 1 shows the alignment of the internal 34-amino acid repeats of ORF. Numbers indicate the position of the first amino acid in each repeat. Conserved residues for each position are displayed in grey boxes. Both consensus for ORF internal repeats and tetratricopeptide repeat (TPR) for other proteins (Sikorski et al. (1990) and Boguski et al. (1990), Chen et al., 1994) are shown. 0 indicates hydrophobic amino acids and domains A and B are predicted to form amphipatic α- helices.

Figure 2 is an amino acid sequence comparison of the HLH domains of ORF (aa 183 to 248) with those of Myf-6 (S12385) , myogenin (A41128), MyoD (P15172), c-myc (153224), drosophila E-spl m5 (P13096), hairy 1 (A53027), drosophila Dpn (A46231), M-twist (X99268), and Id2A (JC2007). Sequences have been aligned for optimal homology. Amino acids that are identical to those of the ORF sequence are displayed in grey boxes.

Detailed Description of the Invention

The present invention relates to the isolation and characterization of a new substrate protein for ERK6, which we have called ORF, nucleotide sequences encoding ORF, various products and assay methods that can be used to identify compounds useful for the diagnosis and treatment of various ORF related diseases and conditions, for example dermatomyositis, polymyositis, inclusion body myositis, sarcoid myopathy, AZT myopathy, myocardial infarction, and ischemia/reperfusion. Polypeptides derived from ORF and nucleic acids encoding such polypeptides may be produced using well known and standard synthesis techniques when given the sequences presented herein. The insert of clone ORF encodes a 222 amino acid fragment and was used to screen two human cDNA libraries from adult skeletal muscle and placental tissues, from which two cDNA of respectively 2.6 kb and 5.5 kb were obtained. The sequence of the 2.6 kb insert revealed a 262 residue open reading frame, encoding a 29.4 kDa protein. The second clone had identical coding sequence, but differed in having extra 3' noncoding sequences .

The N-terminal region of ORF (aa 24 to 160) has strong homologies with proteins that contain the tetratrico peptide repeat (TPR) motif. The TPR motif is a 34-amino acid sequence occurring several times in the protein with an underlying pattern of both amino acid identity and similarity. Within this N-terminal region, 4 putative repeats sharing identities with the consensus sequence are found. The TPR motifs have the ability to mediate homotypic interactions, such as in CDC27, or to directly interact with other TPR or non TPR proteins, like CDC27, CYC8, and CDC23.

In addition to the tandem of TPR motifs, a second structurally distinct region is present in the C-terminal domain of ORF (residues 183 to 248) . The basic region of ORF, located at the N-terminal moiety, contains a helix- destabilizing proline residue as do Hairy and Dpn proteins, and is highly degenerated in the same way as Id proteins are in terms of sequence homology. In contrast, residues determining the hydrophobic core essential for protein dimerization are well conserved in ORF, with the highest level of homology seen within the helix 2 of c-myc and Myf-6.

The polypeptide and nucleotide sequences of the invention can be used, for example, to generate antibodies for use as diagnostic kits, or to create recombinant cell lines that can be used to identify modulators of ORF activity. Moreover, the sequences of the invention can be used to obtain full-length sequences of ORF from additional species, in particular humans, using techniques well known in the art and also described below.

I. Nucleic Acids Encoding ORF Polypeptides

A first aspect of the invention features nucleic acid sequences encoding an ORF polypeptide. Included within the scope of this invention are the functional equivalents of the herein-described isolated nucleic acid molecules. Functional equivalents or derivatives can be obtained in several ways. The degeneracy of the genetic code permits substitution of certain codons by other codons which specify the same amino acid and hence would give rise to the same protein. The nucleic acid sequence can vary substantially since, with the exception of methionine and tryptophan, the known amino acids can be coded for by more than one codon. Thus, portions or all of the ORF gene could be synthesized to give a significantly different nucleic acid sequence that encodes the amino acid sequence of SEQ ID NO:l.

In addition, the nucleic acid sequence may comprise a nucleotide sequence which results from the addition, deletion or substitution of at least one nucleotide to the 5 ' -end and/or the 3 ' -end of the nucleic acid formula shown in SEQ ID NO: 2, or a derivative thereof. Any nucleotide or polynucleotide may be used in this regard, provided that its addition, deletion or substitution does not alter the amino acid sequence of SEQ ID NO:l which is encoded by the nucleotide sequence. For example, the present invention is intended to include any nucleic acid sequence resulting from the addition of ATG as an initiation codon at the 5 ' -end of an ORF nucleic acid sequence or its functional derivative, or from the addition of TTA, TAG or TGA as a termination codon at the 3 ' -end of the inventive nucleotide sequence or its derivative. Moreover, the nucleic acid molecule of the present invention may, as necessary, have restriction endonuclease recognition sites added to its 5 ' -end and/or 3' -end.

Such functional alterations of a given nucleic acid sequence afford an opportunity to promote secretion and/or processing of heterologous proteins encoded by foreign nucleic acid sequences fused thereto. All variations of the nucleotide sequence of the ORF genes and fragments thereof permitted by the genetic code are, therefore, included in this invention.

Further, it is possible to delete codons or to substitute one or more codons by codons other than degenerate codons to produce a structurally modified polypeptide, but one which has substantially the same utility or activity of the polypeptide produced by the unmodified nucleic acid molecule. As recognized in the art, the two polypeptides are functionally equivalent, as are the two nucleic acid molecules which give rise to their production, even though the differences between the nucleic acid molecules are not related to degeneracy of the genetic code.

Functional equivalents or derivatives of ORF can also be obtained using nucleic acid molecules encoding one or more functional domains of the ORF polypeptide. Other functional domains of these proteins include, but are not limited to, the N-terminal domain, the TPR domains, the HLH domain, and the C-terminal domain. Nucleic acid sequences encoding these domains are shown in SEQ ID NO: 2.

II. A Nucleic Acid Probe for the Detection of ORF

A nucleic acid probe of the present invention may be used to probe an appropriate chromosomal or cDNA library by usual hybridization methods to obtain another nucleic acid molecule of the present invention. A chromosomal DNA or cDNA library may be prepared from appropriate cells according to recognized methods in the art (e.g. "Molecular Cloning: A Laboratory Manual", second edition, edited by Sambrook, Fritsch, & Maniatis, Cold Spring Harbor Laboratory, 1989) .

In the alternative, chemical synthesis is carried out in order to obtain nucleic acid probes having nucleotide sequences which correspond to N-terminal and C-terminal portions of the amino acid sequence of the polypeptide of interest. Thus, the synthesized nucleic acid probes may be used as primers in a polymerase chain reaction (PCR) carried out in accordance with recognized PCR techniques, essentially according to PCR Protocols, "PCR Protocols, A Guide to Methods and Applications", edited by Innis et al., Academic Press, 1990, utilizing the appropriate chromosomal or cDNA library to obtain the fragment of the present invention. One skilled in the art can readily design such probes based on the sequence disclosed herein using methods of computer alignment and sequence analysis known in the art (e.g. "Molecular Cloning: A Laboratory Manual", second edition, edited by Sambrook, Fritsch, & Maniatis, Cold Spring Harbor Laboratory, 1989) . The hybridization probes of the present invention can be labeled by standard labeling techniques such as with a radiolabel, enzyme label, fluorescent label, biotin-avidin label, chemiluminescence, and the like. After hybridization, the probes may be visualized using known methods .

The nucleic acid probes of the present invention include RNA as well as DNA probes and nucleic acids modified in the sugar, phosphate or even the base portion as long as the probe still retains the ability to specifically hybridize under conditions as disclosed herein. Such probes are generated using techniques known in the art. The nucleic acid probe may be immobilized on a solid support. Examples of such solid supports include, but are not limited to, plastics such as polycarbonate, complex carbohydrates such as agarose and sepharose, acrylic resins, such as polyacrylamide and latex beads, and nitrocellulose. Techniques for coupling nucleic acid probes to such solid supports are well known in the art.

The test samples suitable for nucleic acid probing methods of the present invention include, for example, cells or nucleic acid extracts of cells, or biological fluids. The sample used in the above-described methods will vary based on the assay format, the detection method and the nature of the tissues, cells or extracts to be assayed. Methods for preparing nucleic acid extracts of cells are well known in the art and can be readily adapted in order to obtain a sample which is compatible with the method utilized.

III. A Probe Based Method And Kit For Detecting ORF

One method of detecting the presence of ORF in a sample comprises (a) contacting the sample with one of the above-described nucleic acid probes, under conditions such that hybridization occurs, and (b) detecting the presence of the probe bound to a nucleic acid molecule in the sample. One skilled in the art would select the nucleic acid probe according to techniques known in the art as described above. Samples to be tested include but should not be limited to RNA samples of human tissue.

A kit for detecting the presence of ORF in a sample comprises at least one container having disposed therein an above-described nucleic acid probe. The kit may further comprise other containers comprising one or more of the following: wash reagents and reagents capable of detecting the presence of bound nucleic acid probe. Examples of detection reagents include, but are not limited to radiolabelled probes, enzymatically labeled probes (horseradish peroxidase, alkaline phosphatase) , and affinity labeled probes (biotin, avidin, or steptavidin) .

In detail, a compartmentalized kit includes any kit in which reagents are contained in separate containers. Such containers include small glass containers, plastic containers or strips of plastic or paper. Such containers allow the efficient transfer of reagents from one compartment to another compartment such that the samples and reagents are not cross-contaminated and the agents or solutions of each container can be added in a quantitative fashion from one compartment to another. Such containers will include a container which will accept the test sample, a container which contains the probe or primers used in the assay, containers which contain wash reagents (such as phosphate buffered saline, Tris-buffers, and the like) , and containers which contain the reagents used to detect the hybridized probe, bound antibody, amplified product, or the like. One skilled in the art will readily recognize that the nucleic acid probes described in the present invention can readily be incorporated into one of the established kit formats which are well known in the art. IV. DNA Constructs Comprising an ORF Nucleic Acid Molecule and Cells Containing These Constructs

The present invention also relates to a recombinant DNA molecule comprising, 5' to 3', a promoter effective to initiate transcription in a host cell and one of the above-described nucleic acid molecules. In addition, the present invention relates to a recombinant DNA molecule comprising a vector and a nucleic acid molecule described herein. The present invention also relates to a nucleic acid molecule comprising a transcriptional region functional in a cell, a sequence complimentary to an RNA sequence encoding an amino acid sequence corresponding to an ORF polypeptide, or functional derivative, and a transcriptional termination region functional in said cell. The above-described molecules may be isolated and/or purified DNA molecules.

The present invention also relates to a cell or organism that contains an ORF nucleic acid molecule, as described herein, and thereby is capable of expressing a peptide. The polypeptide may be purified from cells which have been altered to express the polypeptide. A cell is said to be "altered to express a desired polypeptide" when the cell, through genetic manipulation, is made to produce a protein which it normally does not produce or which the cell normally produces at lower levels. One skilled in the art can readily adapt procedures for introducing and expressing either genomic, cDNA, or synthetic sequences into either eukaryotic or prokaryotic cells .

A nucleic acid molecule, such as DNA, is said to be "capable of expressing" a polypeptide if it contains nucleotide sequences which contain transcriptional and translational regulatory information and such sequences are "operably linked" to nucleotide sequences which encode the polypeptide. An' operable linkage is a linkage in which the regulatory DNA sequences and the DNA sequence sought to be expressed are connected in such a way as to permit gene sequence expression. The precise nature of the regulatory regions needed for gene sequence expression may vary from organism to organism, but will in general include a promoter region which, in prokaryotes, contains both the promoter (which directs the initiation of RNA transcription) as well as the DNA sequences which, when transcribed into RNA, will signal synthesis initiation. Such regions will normally include those 5 ' -non-coding sequences involved with initiation of transcription and translation, such as the TATA box, capping sequence, CAAT sequence, and the like. If desired, the non-coding region 3' to the sequence encoding an ORF gene may be obtained by the above-described cloning methods. This region may be retained for its transcriptional termination regulatory sequences, such as termination and polyadenylation. Thus, by retaining the 3 '-region naturally contiguous to the DNA sequence encoding an ORF gene, the transcriptional termination signals may be provided. Where the transcriptional termination signals are not satisfactorily functional in the expression host cell, then a 3' region functional in the host cell may be substituted. Two DNA sequences (such as a promoter region sequence and an ORF sequence) are said to be operably linked if the nature of the linkage between the two DNA sequences does not (1) result in the introduction of a frame-shift mutation, (2) interfere with the ability of the promoter region sequence to direct the transcription of the second sequence, for example an ORF gene sequence, or (3) interfere with the ability of the second sequence to be transcribed by the promoter region sequence. Thus, a promoter region would be operably linked to a DNA sequence if the promoter were capable of effecting transcription of that DNA sequence. Thus, transcriptional and translational signals recognized by an appropriate host are necessary to express an ORF gene.

The present invention encompasses the expression of an ORF gene (or a functional derivative thereof) in either prokaryotic or eukaryotic cells. Prokaryotic hosts are, generally, very efficient and convenient for the production of recombinant proteins and are, therefore, one type of preferred expression system for these genes. Prokaryotes most frequently are represented by various strains of E. coli. However, other microbial strains may also be used, including other bacterial strains.

In prokaryotic systems, plasmid vectors that contain replication sites and control sequences derived from a species compatible with the host may be used. Examples of suitable plasmid vectors may include pBR322, pUC118, pUC119 and the like; suitable phage or bacteriophage vectors may include λgtlO, λgtll and the like; and suitable virus vectors may include pMAM-neo, pKRC and the like. Preferably, the selected vector of the present invention has the capacity to replicate in the selected host cell. Recognized prokaryotic hosts include bacteria such as E. coli and those from genera such as Bacillus, Streptomyces, Pseudomonas, Salmonella, Serratia, and the like. However, under such conditions, the polypeptide will not be glycosylated. The prokaryotic host must be compatible with the replicon and control sequences in the expression plasmid.

To express ORF (or a functional derivative thereof) in a prokaryotic cell, it is necessary to operably link the gene sequence to a functional prokaryotic promoter. Such promoters may be either constitutive or, more preferably, regulatable (i.e., inducible or derepressible) . Examples of constitutive promoters include the int promoter of bacteriophage 1, the bla promoter of the b-lactamase gene sequence of pBR322, and the CAT promoter of the chloramphenicol acetyl transferase gene sequence of pPR325, and the like. Examples of inducible prokaryotic promoters include the major right and left promoters of bacteriophage 1 (P_L and P_R) , the trp, recA, lacZ, lad, and gal promoters of E. coli, the a-amylase (Ulmanen, et at., J. Bacteriol. 162:176-182, 1985) and the sigma-28-specific promoters of B. subtilis (Gilman, et al., Gene sequence 32:11-20, 1984), the promoters of the bacteriophages of Bacillus (Gryczan, In: The Molecular Biology of the Bacilli, Academic Press, Inc., NY, 1982), and Streptomyces promoters (Ward, et at., Mol. Gen. Genet. 203:468-476, 1986). Prokaryotic promoters are reviewed by Glick, J. Ind. Microbiot. 1:277-282, 1987; Cenatiempo, Biochimie 68 : 505-516, 1966; and Gottesman, Ann. Rev. Genet. 16:415-442, 1984.

Proper expression in a prokaryotic cell also requires the presence of a ribosome binding site upstream of the gene sequence-encoding sequence. Such ribosome binding sites are disclosed (see, for example, Gold, et at., Ann. Rev. Microbiol. 35:365-404, 1981). The selection of control sequences, expression vectors, transformation methods, and the like, are dependent on the type of host cell used to express the gene.

As used herein, "cell", "cell line", and "cell culture" may be used interchangeably and all such designations include progeny. Thus, the words "transformants" or "transformed cells" include the primary subject cell and cultures derived therefrom, without regard to the number of transfers. It is also understood that all progeny may not be precisely identical in DNA content, due to deliberate or inadvertent mutations. However, as defined, mutant progeny have the same functionality as that of the originally transformed cell.

Host cells which may be used in the expression systems of the present invention are not strictly limited, provided that they are suitable for use in the expression of the ORF peptide of interest. Suitable hosts may often include eukaryotic cells. Preferred eukaryotic hosts include, for example, yeast, fungi, insect cells, and mammalian cells, either in vivo or in tissue culture. Mammalian cells which may be useful as hosts include HeLa cells, cells of fibroblast origin such as VERO, 3T3 or CHO-Kl, or cells of lymphoid origin (such as 32D cells) and their derivatives. Preferred mammalian host cells include SP2/0 and J558L, as well as neuroblastoma cell lines such as IMR 332 and PC12 which may provide better capacities for correct post-translational processing. In addition, plant cells are also available as hosts, and control sequences compatible with plant cells are available, such as the cauliflower mosaic virus 35S and 19S, and nopaline synthase promoter and polyadenylation signal sequences. Another preferred host is an insect cell, for example the Drosophila larvae. Using insect cells as hosts, the Drosophila alcohol dehydrogenase promoter can be used (Rubin, Science 240:1453-1459, 1988). Alternatively, baculovirus vectors can be engineered to express large amounts of ORF in insects cells (Jasny, Science 238:1653, 1987; Miller, et al.. In: Genetic Engineering, 1986; Setlow, J.K., et al . , eds . , Plenum, Vol. 8, pp. 277-297) .

Any of a series of yeast gene sequence expression systems can be utilized which incorporate promoter and termination elements from the actively expressed gene sequences coding for glycolytic enzymes; the systems are produced in large quantities when yeast are grown in mediums rich in glucose. Known glycolytic gene sequences can also provide very efficient transcriptional control signals. Yeast provides substantial advantages in that it can also carry out post-translational peptide modifications. A number of recombinant DNA strategies exist which utilize strong promoter sequences and high copy number of plasmids which can be utilized for production of the desired proteins in yeast. Yeast recognizes leader sequences on cloned mammalian gene sequence products and secretes peptides bearing leader sequences (i.e., pre-peptides) . For a mammalian host, several possible vector systems are available for the expression of ORF.

A particularly prefered yeast expression system is that utilizing Schizosaccharmocyces pombe. This system is useful for studying the activity of members of the Src family (Superti-Furga, et al., EMBO J. 12:2625, 1993) and other non-receptor-TKs, the function of which is often regulated by the activity of tyrosine phosphatases,

A wide variety of transcriptional and translational regulatory sequences may be employed, depending upon the nature of the host. The transcriptional and translational regulatory signals may be derived from viral sources, such as adenovirus, bovine papilloma virus, cytomegalovirus, simian virus, or the like, where the regulatory signals are associated with a particular gene sequence which has a high level of expression. Alternatively, promoters from mammalian expression products, such as actin, collagen, myosin, and the like, may be employed. Transcriptional initiation regulatory signals may be selected which allow for repression or activation, so that expression of the gene sequences can be modulated. Of interest are regulatory signals which are temperature-sensitive so that by varying the temperature, expression can be repressed or initiated, or are subject to chemical (such as metabolite) regulation.

Expression of ORF in eukaryotic hosts requires the use of eukaryotic regulatory regions. Such regions will, in general, include a promoter region sufficient to direct the initiation of RNA synthesis. Preferred eukaryotic promoters include, for example, the promoter of the mouse metallothionein I gene sequence (Hamer, et al., J. Mol. Appl. Gen. 1:273-288, 1982); the TK promoter of Herpes virus (McKnight, Cell 31:355-365, 1982); the SV40 early promoter (Benoist, et al., Nature

(London) 290:304-310, 1981); and the yeast gal4 gene sequence promoter (Johnston, et al., Proc. Natl. Acad. Sci. (USA)

79:6971-6975, 19δ2; Silver , et al., Proc. Natl. Acad. Sci.

(USA) 81:5951-5955, 1984). Translation of eukaryotic mRNA is initiated at the codon which encodes the first methionine. For this reason, it is preferable to ensure that the linkage between a eukaryotic promoter and a DNA sequence which encodes ORF (or a functional derivative thereof) does not contain any intervening codons which are capable of encoding a methionine (i.e., AUG) . The presence of such codons results either in the formation of a fusion protein (if the AUG codon is in the same reading frame as the coding sequence) or a frame-shift mutation (if the AUG codon is not in the same reading frame as an ORF coding sequence) . An ORF nucleic acid molelcule and an operably linked promoter may be introduced into a recipient prokaryotic or eukaryotic cell either as a nonreplicating DNA (or RNA) molecule, which may either be a linear molecule or, more preferably, a closed covalent circular molecule (a plasmid) . Since such molecules are incapable of autonomous replication, the expression of the gene may occur through the transient expression of the introduced sequence. Alternatively, permanent or stable expression may occur through the integration of the introduced DNA sequence into the host chromosome.

A vector may be employed which is capable of integrating the desired gene sequences into the host cell chromosome. Cells which have stably integrated the introduced DNA into their chromosomes can be selected by also introducing one or more markers which allow for selection of host cells which contain the expression vector. The marker may provide for prototrophy to an auxotrophic host, biocide resistance, e.g., antibiotics, or heavy metals, such as copper, or the like. The selectable marker gene sequence can either be directly linked to the DNA gene sequences to be expressed, or introduced into the same cell by co-transfection. Additional elements may also be needed for optimal synthesis of single chain binding protein mRNA. These elements may include splice signals, as well as transcription promoters, enhancers, and termination signals. cDNA expression vectors incorporating such elements include those described by Okayama, Mol. Cell. Bio. 3:280, 1983.

The introduced nucleic acid molecule can be incorporated into a plasmid or viral vector capable of autonomous replication in the recipient host. Any of a wide variety of vectors may be employed for this purpose. Factors of importance in selecting a particular plasmid or viral vector include: the ease with which recipient cells that contain the vector may be recognized and selected from those recipient cells which do not contain the vector; the number of copies of the vector which are desired in a particular host; and whether it is desirable to be able to "shuttle" the vector between host cells of different species.

Preferred prokaryotic vectors include plasmids such as those capable of replication in E. coil (such as, for example, pBR322, ColEl, pSClOl, pACYC 184, pVX) . Such plasmids are, for example, disclosed by Sambrook ( c . f. "Molecular Cloning: A Laboratory Manual", second edition, edited by Sambrook, Fritsch, & Maniatis, Cold Spring Harbor Laboratory, (1989) ) . Bacillus plasmids include pC194, pC221, pT127, and the like. Such plasmids are disclosed by Gryczan (In: The Molecular Biology of the Bacilli, Academic Press, NY (1982), pp. 307-329) . Suitable Streptomyces plasmids include plJlOl (Kendall, et al., J. Bacteriol. 169:4177-4183, 1987), and streptomyces bacteriophages such as fC31 (Chater, et al., In: Sixth International Symposium on Actinomycetales Biology, Akademiai Kaido, Budapest, Hungary (1986), pp. 45-54). Pseudomonas plasmids are reviewed by John, et al., Rev. Infect. Dis. 8:693-704, 1986, and Izaki, Jpn. J. Bacteriol. 33:729-742, 1978. Preferred eukaryotic plasmids include, for example, BPV, vaccinia, SV40, 2-micron circle, and the like, or their derivatives. Such plasmids are well known in the art

(Botstein, et al., Miami Wntr. Symp. 19:265-274, 1982); Broach,

In: "The Molecular Biology of the Yeast Saccharomyces : Life Cycle and Inheritance", Cold Spring Harbor Laboratory, Cold Spring Harbor, NY, p. 445-470 (1981); Broach, Cell 26:203-204, 1982); Bollon et at., J. Clin. Hematol. Oncol. 10:39-48, 1980); Maniatis, In: Cell Biology: A Comprehensive Treatise, Vol. 3, Gene Sequence Expression, Academic Press, NY, pp. 563-608 (1980) .

Once the vector or nucleic acid molecule containing the construct (s) has been prepared for expression, the DNA construct (s) may be introduced into an appropriate host cell by any of a variety of suitable means, i.e., transformation, transfection, conjugation, protoplast fusion, electroporation, particle gun technology, calcium phosphate-precipitation, direct microinjection, and the like. After the introduction of the vector, recipient cells are grown in a selective medium, which selects for the growth of vector-containing cells. Expression of the cloned gene molecule (s) results in the production of ORF or fragments or functional derivatives thereof. This can take place in the transformed cells as such, or following the induction of these cells to differentiate (for example, by administration of bromodeoxyuracil to neuroblastoma cells or the like) . A variety of incubation conditions for the transformed cells can be used to foster expression of the polypeptides of the present invention. The most preferred conditions are those which mimic physiological conditions.

V. ORF Polypeptide

Also a feature of the invention is ORF polypeptide. A variety of methodologies known in the art can be utilized to obtain the polypeptide of the present invention. It may be purified from tissues or cells which naturally produce it. Alternatively, the above-described isolated nucleic acid sequences can be used to express the protein of the invention recombinantly.

Any eukaryotic organism can be used as a source for the polypeptide of the invention, as long as the source organism naturally contains such a polypeptide. As used herein, "source organism" refers to the original organism from which the amino acid sequence is derived, regardless of the organism the protein is expressed in and ultimately isolated from.

One skilled in the art can readily follow known methods for isolating proteins in order to obtain the peptide free of natural contaminants. These include, but are not limited to: size-exclusion chromatography, HPLC, ion-exchange chromatography, and immuno-affinity chromatography.

An ORF protein, like all proteins, is comprised of distinct functional units or domains. In eukaryotes, protein sorted through the so-called vesicular pathway (bulk flow) usually has a signal sequence (also called a leader peptide) in the N- terminus, which is cleaved off after the translocation through the ER (endoplasmic reticulum) membrane. Some N-terminal signal sequences are not cleaved off, remaining as transmembrane segments, but it does not mean the protein is retained in the ER; it can be further sorted and included in vesicles. Non-receptor proteins generally function to transmit signals within the cell, either by providing sites for protein: protein interactions or by having some catalytic activity (contained within a catalytic domain), often both. Methods of predicting the existence of these various domains are well known in the art. Protein: protein interaction domains can be identified by comparison to other proteins. The SH2 domain, for example is a protein domain of about 100 amino acids first identified as a conserved sequence region between the proteins Src and Fps (Sadowski, et al, Mol. Cell. Bio. 6:4396, 1986). Similar sequences were later found in many other intracellular signal-transducing proteins. SH2 domains function as regulatory modules of intracellular signalling cascades by interacting with high affinity to phosphotyrosine-containing proteins in a sequence specific and strictly phosphorylation-dependent manner (Mayer and Baltimore, Trends Cell. Biol. 3:8, 1993). Kinase or phosphatase catalytic domains can be identified by comparison to other known catalytic domains with kinase or phosphatase activity. See, for example Hanks and Hunter, FASEB J. 9:576-595, 1995.

Primary sequence analysis of the ORF amino acid sequence (shown in SEQ ID NO:l) reveals that it does not contain a signal sequence or transmembrane domain, and it is, therefore, an intracellular and a nuclear protein. Comparison to known protein sequences reveals that ORF is comprised of several unique domains. These include a 23 amino acid N-terminal domain (shown from amino acid number 1 - 23 of SEQ. ID. NO:l), a 136 amino acid TPR domain, which includes TPRl, TPR2, TPR3, and TPR4 domains (shown from amino acid number 24 - 160 of SEQ. ID. NO:l), a 65 amino acid HLH domain (shown from amino acid number 183 - 248 of SEQ. ID. N0:1), and a C-terminal domain (shown from amino acid number 249 - 262 of SEQ. ID. N0:1).

The domains of ORF have a variety of uses. An example of such a use is to make a polypeptide consisting of an ORF domain and a heterologous protein such as glutathione S-transferase

(GST) . Such a polypeptide can be used in a biochemical assay for ORF catalytic activity useful for studying ORF substrate specificity or for identifying substances that can modulate ORF activity. Alternatively, one skilled in the art could create an ORF polypetide lacking at least one of the major domains.

Such a polypeptide, when expressed in a cell, may be able to form complexes with the natural binding partner (s) of ORF but may be unable to establish transcription. (See, as an example,

Gishizky, et al, PNAS :10δδ9, 1995).

VI . An Antibody Having Binding Affinity to an ORF Polypeptide and Hybridomas Producing The Antibody

The present invention also relates to an antibody having specific binding affinity to an ORF polypeptide. The polypeptide may have the amino acid sequence set forth in SEQ ID N0:1, or a be fragment thereof, or at least 4 contiguous amino acids thereof. Such an antibody may be identified by comparing its binding affinity to the desired polypeptide, for example an ORF polypeptide, with its binding affinity to another (non-ORF) polypeptide. Those which bind selectively to the desired polypeptide would be chosen for use in methods requiring a distinction between the desired polypeptide and other polypeptides. Such methods could include, but should not be limited to, the analysis of altered expression of the desired polypeptide in tissue containing other polypeptides and assay systems using whole cells.

An ORF polypeptide of the present invention can be used to produce antibodies or hybridomas. One skilled in the art will recognize that if an antibody is desired, such a peptide would be generated as described herein and used as an immunogen. The antibodies of the present invention include 36

monoclonal and polyclonal antibodies, as well fragments of these antibodies, and humanized forms. Humanized forms of the antibodies of the present invention may be generated using one of the procedures known in the art such as chimerization or CDR grafting. The present invention also relates to a hybridoma which produces the above-described monoclonal antibody, or binding fragment thereof. A hybridoma is an immortalized cell line which is capable of secreting a specific monoclonal antibody. In general, techniques for preparing monoclonal antibodies and hybridomas are well known in the art (Campbell, "Monoclonal Antibody Technology: Laboratory Techniques in Biochemistry and Molecular Biology, " Elsevier Science Publishers, Amsterdam, The Netherlands, 1964; St. Groth et al., J. Immunol. Methods 35:1-21, 1980). Any animal (mouse, rabbit, and the like) which is known to produce antibodies can be immunized with the selected polypeptide. Methods for immunization are well known in the art. Such methods include subcutaneous or intraperitoneal injection of the polypeptide. One skilled in the art will recognize that the amount of polypeptide used for immunization will vary based on the animal which is immunized, the antigenicity of the polypeptide and the site of injection.

The polypeptide may be modified or administered in an adjuvant in order to increase the peptide antigenicity. Methods of increasing the antigenicity of a polypeptide are well known in the art. Such procedures include coupling the antigen with a heterologous protein (such as globulin or β-galactosidase) or through the inclusion of an adjuvant during immunization.

For monoclonal antibodies, spleen cells from the immunized animals are removed, fused with myeloma cells, such as SP2/0-Agl4 myeloma cells, and allowed to become monoclonal antibody producing hybridoma cells. Any one of a number of methods well known in the art can be used to identify the hybridoma cell which produces an antibody with the desired characteristics. These include screening the hybridomas with an ELISA assay, western blot analysis, or radioimmunoassay (Lutz, et al., Exp. Cell Res. 175:109-124, 1988). Hybridomas secreting the desired antibodies are cloned and the class and subclass is determined using procedures known in the art (Campbell, "Monoclonal Antibody Technology: Laboratory Techniques in Biochemistry and Molecular Biology", supra, 1984) .

For polyclonal antibodies, antibody containing antisera is isolated from the immunized animal and is screened for the presence of antibodies with the desired specificity using one of the above-described procedures. The above-described antibodies may be detectably labeled. Antibodies can be detectably labeled through the use of radioisotopes, affinity labels (such as biotin, avidin, and the like), enzymatic labels (such as horse radish peroxidase, alkaline phosphatase, and the like) fluorescent labels (such as FITC or rhodamine, and the like), paramagnetic atoms, and the like. Procedures for accomplishing such labeling are well-known in the art, for example, see (Stemberger, et al., J. Histochem. Cytochem. 18:315, 1970; Bayer, et at., Meth. Enzym. 62:308, 1979; Engval, et al., Immunot. 109:129, 1972; Goding, J. Immunol. Meth. 13:215, 1976). The labeled antibodies of the present invention can be used for in vitro, in vivo, and in situ assays to identify cells or tissues which express a specific peptide.

The above-described antibodies may also be immobilized on a solid support. Examples of such solid supports include plastics such as polycarbonate, complex carbohydrates such as agarose and sepharose, acrylic resins and such as polyacrylamide and latex beads. Techniques for coupling antibodies to such solid supports are well known in the art

(Weir et al., "Handbook of Experimental Immunology" 4th Ed.,

^•Blackwell Scientific Publications, Oxford, England, Chapter 10,

1986; Jacoby, et al., Meth. Enzym. 34, Academic Press, N.Y., 1974) . The immobilized antibodies of the present invention can be used for in vi tro, in vivo, and in situ assays as well as in immunochromotography.

Furthermore, one skilled in the art can readily adapt currently available procedures, as well as the techniques, methods and kits disclosed above with regard to antibodies, to generate peptides capable of binding to a specific peptide sequence in order to generate rationally designed antipeptide peptides, for example see Hurby et al., "Application of Synthetic Peptides: Antisense Peptides", In Synthetic Peptides, A User's Guide, W.H. Freeman, NY, pp. 289-307(1992), and Kaspczak, et al., Biochemistry 28:9230-8, 1989.

VII. An Antibody Based Method And Kit For Detecting ORF

The present invention encompasses a method of detecting an ORF polypeptide in a sample comprising incubating a test sample with one or more of the antibodies of the present invention and determining whether the antibody binds to the test sample. The method can include the steps of, for example: (a) contacting the sample with an above-described antibody, under conditions such that immunocomplexes form, and (b) detecting the presence of said antibody bound to the polypeptide. Altered levels, either an increase or decrease, of ORF in a sample as compared to normal levels may indicate an abnormality or disorder.

Conditions for incubating an antibody with a test sample vary. Incubation conditions depend on the format employed in the assay, the detection methods employed, and the type and nature of the antibody used in the assay. One skilled in the art will recognize that any one of the commonly available immunological assay formats (such as radioimmunoassays, enzyme-linked immunosorbent assays, diffusion based Ouchterlony, or rocket immunofluorescent assays) can readily be adapted to employ the antibodies of the present invention. Examples of such assays can be found in Chard, "An Introduction to Radioimmunoassay and Related Techniques" Elsevier Science Publishers, Amsterdam, The Netherlands (1986); Bullock et al., "Techniques in Immunocytochemistry, " Academic Press, Orlando, FL Vol. 1(1982), Vol. 2 (1983), Vol. 3 (1985); Tijssen, "Practice and Theory of Enzyme Immunoassays : Laboratory Techniques in Biochemistry and Molecular Biology, " Elsevier Science Publishers, Amsterdam, The Netherlands (1985) .

The immunological assay test samples of the present invention include cells, protein or membrane extracts of cells, or biological fluids such as blood, serum, plasma, or urine.

The test sample used in the above-described method will vary based on the assay format, nature of the detection method and the tissues, cells or extracts used as the sample to be assayed. Methods for preparing protein extracts or membrane extracts of cells are well known in the art and can be readily adapted in order to obtain a sample which is compatable with the system utilized.

A kit contains all the necessary reagents to carry out the previously described methods of detection. The kit may comprise: (i) a first container containing an above-described antibody, and (ii) second container containing a conjugate comprising a binding partner of the antibody and a label. In another preferred embodiment, the kit further comprises one or more other containers comprising one or more of the following: wash reagents and reagents capable of detecting the presence of bound antibodies. Examples of detection reagents include, but are not limited to, labeled secondary antibodies, or in the alternative, if the primary antibody is labeled, the chromophoric, enzymatic, or antibody binding reagents which are capable of reacting with the labeled antibody. The compartmentalized kit may be as described above for nucleic acid probe kits. One skilled in the art will recognize that the antibodies described in the present invention can readily be incorporated into one of the established kit formats which are well known in the art. VIII. Isolation of Natural Binding Partners of ORF

The present invention also relates to methods of detecting natural binding partners capable of binding to an ORF polypeptide. A natural binding partner of ORF may be, for example, a substrate protein which is dephosphorylated as part of a signaling cascade. The binding parter(s) may be present within a complex mixture, for example, serum, body fluids, or cell extracts.

In general, methods for identifying natural binding partners comprise incubating a substance with a first polypeptide, ORF for the invention described herein, and detecting the presence of a substance bound to the first polypeptide. Preferred methods include the two-hybrid system of Fields and Song (supra) and co-immunoprecipitation wherein the first polypeptide is allowed to bind to a natural binding partner, then the polypeptide complex is immunoprecipitated using antibodies specific for the first polypeptide. The natural binding partner can then be isolated and identified by techniques well known in the art.

IX. Identification of and Uses for Substances Capable of Modulating ORF Activity

The present invention also relates to a method of detecting a substance capable of modulating ORF activity. Such substances can either enhance activity (agonists) or inhibit activity (antagonists) . Agonists and antagonists can be peptides, antibodies, products from natural sources such as fungal or plant extracts or small molecular weight organic compounds. In general, small molecular weight organic compounds are preferred. Examples of classes of compounds that can be tested for ORF modulating activity are, for example but not limited to, thiazoles (see, for example US applications 60/033,522 filed December 19, 1996, and 08/660,900 filed June 7, 1996), and naphthopyrones (US patent number 5,602,171, issued February 11, 1997) . In general the method comprises incubating cells that produce ORF in the presence of a test substance and detecting changes in the level of ORF activity or ORF binding partner activity. A change in activity may be manifested by increased or decreased binding of an ORF polypeptide to a natural binding partner or increased or decreased biological response in cells. Biological responses can include, for example, proliferation, differentiation, survival, or motility. The substance thus identified would produce a change in activity indicative of the agonist or antagonist nature of the substance. Once the substance is identified it can be isolated using techniques well known in the art, if not already available in a purified form.

The present invention also encompasses a method of agonizing (stimulating) or antagonizing ORF associated activity in a mammal comprising administering to said mammal an agonist or antagonist to ORF in an amount sufficient to effect said agonism or antagonism. Also encompassed in the present application is a method of treating diseases in a mammal with an agonist or antagonist of ORF-related activity comprising administering the agonist or antagonist to a mammal in an amount sufficient to agonize or antagonize ORF associated function (s). The particular compound can be administered to a patient either by itself or in a pharmaceutical composition where it is mixed with suitable carriers or excipient (s) . In treating a patient, a therapeutically effective dose of the compound is administered. A therapeutically effective dose refers to that amount of the compound that results in amelioration of symptoms or a prolongation of survival in a patient.

Toxicity and therapeutic efficacy of such compounds can be determined by standard pharmaceutical procedures in cell cultures or experimental animals. Cell culture assays and animal studies can be used for determining the LD₅₀ (the dose lethal to 50% of a population) and the ED₅₀ (the dose therapeutically effective in 50% of a population) . The dose ratio between toxic and therapeutic effects is the therapeutic index, which can be expressed as the ratio LD50/ED5₀. Compounds which exhibit large therapeutic indices are preferred. The data obtained from these cell culture assays and animal studies can be used in formulating a range of dosages for use in human. The dosage of such compounds lies preferably within a range of circulating concentrations that include the ED₅₀ with little or no toxicity. The dosage may vary within this range depending upon the dosage form employed and the route of administration utilized.

For any compound used in the method of the invention, the therapeutically effective dose can be estimated initially from cell culture assays by determining an IC₅₀ (i.e., the concentration of the test compound which achieves a half-maximal disruption of the protein complex, or a half-maximal inhibition of the cellular level and/or activity of a cellular component, ex. ORF) . A dose can then be formulated in animal models to achieve a circulating plasma concentration range that includes the IC₅₀ as determined in cell culture. Such information can be used to more accurately determine useful doses in humans. Levels in plasma may be measured, for example, by HPLC. The exact formulation, route of administration and dosage can be chosen by the individual physician in view of the patient's condition. (See e.g. Fingl et al., 1975, in "The Pharmacological Basis of Therapeutics", Ch. 1 pi) .

It should be noted that the attending physician would know how to and when to terminate, interrupt, or adjust administration due to toxicity, or to organ dysfunctions. Conversely, the attending physician would also know to adjust treatment to higher levels if the clinical response were not adequate (precluding toxicity) . The magnitude of an administrated dose in the management of the oncogenic disorder of interest will vary with the severity of the condition to be treated and to the route of administration. The severity of the condition may, for example, be evaluated, in part, by standard prognostic evaluation methods. Further, the dose and perhaps dose frequency, will also vary according to the age, body weight, and response of the individual patient. A program comparable to that discussed above may be used in veterinary medicine.

Depending on the specific conditions being treated, such agents may be formulated and administered systemically or locally. Techniques for formulation and administration may be found in "Remington's Pharmaceutical Sciences," 1990, lδth ed., Mack Publishing Co., Easton, PA. Suitable routes may include oral, rectal, transdermal, vaginal, transmucosal, or intestinal administration; parenteral delivery, including intramuscular, subcutaneous, intramedullary injections, as well as intrathecal, direct intraventricular, intravenous, intraperitoneal, intranasal, or intraocular injections, just to name a few.

For injection, the agents of the invention may be formulated in aqueous solutions, preferably in physiologically compatible buffers such as Hanks 's solution, Ringer's solution, or physiological saline buffer. For such transmucosal administration, penetrants appropriate to the barrier to be permeated are used in the formulation. Such penetrants are generally known in the art.

Use of pharmaceutically acceptable carriers to formulate the compounds herein disclosed for the practice of the invention into dosages suitable for systemic administration is within the scope of the invention. With proper choice of carrier and suitable manufacturing practice, the compositions of the present invention, in particular those formulated as solutions, may be administered parenterally, such as by intravenous injection. The compounds can be formulated readily using pharmaceutically acceptable carriers well known in the art into dosages suitable for oral administration. Such carriers enable the compounds of the invention to be formulated as tablets, pills, capsules, liquids, gels, syrups, slurries, suspensions and the like, for oral ingestion by a patient to be treated. Particlar formulations suitable for parenteral administration of hydrophobic compounds can be found in US Patent No. 5,610,173, issued March 11, 1997 and US Provisional Application Serial No. 60/039,870 , filed March 05, 1997, both of which are hereby incorporated by reference herein in their entirety, including any figures and drawings.

Agents intended to be administered intracellularly may be administered using techniques well known to those of ordinary skill in the art. For example, such agents may be encapsulated into liposomes, then administered as described above. Liposomes are spherical lipid bilayers with aqueous interiors. All molecules present in an aqueous solution at the time of liposome formation are incorporated into the aqueous interior. The liposomal contents are both protected from the external microenvironment and, because liposomes fuse with cell membranes, are efficiently delivered into the cell cytoplasm. Small organic molecules may be directly administered intracellularly due to their hydrophobicity.

Pharmaceutical compositions suitable for use in the present invention include compositions wherein the active ingredients are contained in an amount effective to achieve its intended purpose. Determination of an effective amount is well within the capability of those skilled in the art, especially in light of the detailed disclosure provided herein. In addition to the active ingredients, these pharmaceutical compositions may contain suitable pharmaceutically acceptable carriers comprising excipients and auxiliaries which facilitate processing of the active compounds into preparations which can be used pharmaceutically. The preparations formulated for oral administration may be in the form of tablets, dragees, capsules, or solutions.

The pharmaceutical compositions of the present invention may be manufactured in a manner that is itself known, e.g., by means of conventional mixing, dissolving, granulating, dragee-making, levigating, emulsifying, encapsulating, entrapping or lyophilizing processes. Pharmaceutical formulations for parenteral administration include aqueous solutions of the active compounds in water-soluble form. Additionally, suspensions of the active compounds may be prepared as appropriate oily injection suspensions. Suitable lipophilic solvents or vehicles include fatty oils such as sesame oil, or synthetic fatty acid esters, such as ethyl oleate or triglycerides, or liposomes. Aqueous injection suspensions may contain substances which increase the viscosity of the suspension, such as sodium carboxymethyl cellulose, sorbitol, or dextran. Optionally, the suspension may also contain suitable stabilizers or agents which increase the solubility of the compounds to allow for the preparation of highly concentrated solutions.

Pharmaceutical preparations for oral use can be obtained by combining the active compounds with solid excipient, optionally grinding a resulting mixture, and processing the mixture of granules, after adding suitable auxiliaries, if desired, to obtain tablets or dragee cores. Suitable excipients are, in particular, fillers such as sugars, including lactose, sucrose, mannitol, or sorbitol; cellulose preparations such as, for example, maize starch, wheat starch, rice starch, potato starch, gelatin, gum tragacanth, methyl cellulose, hydroxypropylmethyl-cellulose, sodium carboxymethyl- ellulose, and/or polyvinylpyrrolidone (PVP) . If desired, disintegrating agents may be added, such as the cross-linked polyvinyl pyrrolidone, agar, or alginic acid or a salt thereof such as sodium alginate.

Dragee cores are provided with suitable coatings. For this purpose, concentrated sugar solutions may be used, which may optionally contain gum arabic, talc, polyvinyl pyrrolidone, carbopol gel, polyethylene glycol, and/or titanium dioxide, lacquer solutions, and suitable organic solvents or solvent mixtures. Dyestuffs or pigments may be added to the tablets or dragee coatings for identification or to characterize different combinations of active compound doses. Pharmaceutical preparations which can be used orally include push-fit capsules made of gelatin, as well as soft, sealed capsules made of gelatin and a plasticizer, such as glycerol or sorbitol. The push-fit capsules can contain the active ingredients in admixture with filler such as lactose, binders such as starches, and/or lubricants such as talc or magnesium stearate and, optionally, stabilizers. In soft capsules, the active compounds may be dissolved or suspended in suitable liquids, such as fatty oils, liquid paraffin, or liquid polyethylene glycols. In addition, stabilizers may be added.

X. Transgenic Animals

Also contemplated by the invention are transgenic animals useful for the study of ORF activity in complex in vivo systems. A "transgenic animal" is an animal having cells that contain DNA which has been artificially inserted into a cell, which DNA becomes part of the genome of the animal which develops from that cell. Preferred transgenic animals are primates, mice, rats, cows, pigs, horses, goats, sheep, dogs and cats. The transgenic DNA may encode a human ORF polypeptide. Native expression in an animal may alternatively be reduced by providing an amount of antisense RNA or DNA effective to reduce expression of the target gene.

A variety of methods are available for the production of transgenic animals associated with this invention. DNA sequences encoding ORF can be injected into the pronucleus of a fertilized egg before fusion of the male and female pronuclei, or injected into the nucleus of an embryonic cell

(eg., the nucleus of a two-cell embryo) following the initiation of cell division (Brinster, et al., Proc. Nat. Acad.

Sci. USA 82 : 4438, 1985) . Embryos can be infected with viruses, especially retroviruses, modified to carry inorganic-ion receptor nucleotide sequences of the invention.

Pluripotent stem cells derived from the inner cell mass of the embryo and stabilized in culture can be manipulated in culture to incorporate nucleotide sequences of the invention. A transgenic animal can be produced from such cells through implantation into a blastocyst that is implanted into a foster mother and allowed to come to term. Animals suitable for transgenic experiments can be obtained from standard commercial sources such as Charles River (Wilmington, MA) , Taconic (Germantown, NY), Harlan Sprague Dawley (Indianapolis, IN), etc.

The procedures for manipulation of the rodent embryo and for microinjection of DNA into the pronucleus of the zygote are well known to those of ordinary skill in the art (Hogan, et al., supra). Microinjection procedures for fish, amphibian eggs and birds are detailed in Houdebine and Chourrout, Experientia 47: 897-905, 1991). Other procedures for introduction of DNA into tissues of animals are described in

U.S. Patent No., 4,945,050 (Sandford et al., July 30, 1990).

By way of example only, to prepare a transgenic mouse, female mice are induced to superovulate. After being allowed to mate, the females are sacrificed by C0₂ asphyxiation or cervical dislocation and embryos are recovered from excised oviducts. Surrounding cumulus cells are removed. Pronuclear embryos are then washed and stored until the time of injection.

Randomly cycling adult female mice are paired with vasectomized males. Recipient females are mated at the same time as donor females. Embryos then are transferred surgically. The procedure for generating transgenic rats is similar to that of mice. See Hammer, et al., Cell 63:1099-1112, 1990).

Methods for the culturing of embryonic stem (ES) cells and the subsequent production of transgenic animals by the introduction of DNA into ES cells using methods such as electroporation, calcium phosphate/DNA precipitation and direct injection also are well known to those of ordinary skill in the art. (See, for example, Teratocarcinomas and Embryonic Stem Cells, A Practical Approach, E.J. Robertson, ed. , IRL Press, 1987). In cases involving random gene integration, a clone containing the sequence (s) of the invention is co-transfected with a gene encoding resistance. Alternatively, the gene encoding neomycin resistance is physically linked to the sequence (s) of the invention. Transfection and isolation of desired clones are carried out by any one of several methods well known to those of ordinary skill in the art (E.J. Robertson, supra) . DNA molecules introduced into ES cells can also be integrated into the chromosome through the process of homologous recombination. (See Capecchi, Science 244: 1288, 1989.) Methods for positive selection of the recombination event (i.e., neo resistance) and dual positive-negative selection (i.e., neo resistance and gancyclovir resistance) and the subsequent identification of the desired clones by PCR have been described by Capecchi, supra and Joyner et al., Nature 338: 153, 1989), the teachings of which are incorporated by reference herein. The final phase of the procedure is to inject targeted ES cells into blastocysts and to transfer the blastocysts into pseudopregnant females. The resulting chimeric animals are bred and the offspring are analyzed by Southern blotting to identify individuals that carry the transgene. Procedures for the production of non-rodent mammals and other animals have been discussed by others. (See Houdebine and Chourrout, supra; Pursel, et al., Science 244:1281, 1989; Si ms, et al., Bio/Technology 6:179, 1988.) Thus, the invention provides transgenic, nonhuman mammals containing a transgene encoding an ORF polypeptide or a gene effecting the expression of an ORF polypeptide. Such transgenic nonhuman mammals are particularly useful as an in vivo test system for studying the effects of introducing an ORF polypeptide, or for regulating the expression of an ORF polypeptide (i.e., through the introduction of additional genes, antisense nucleic acids, or ribozymes) .

XI . Gene Therapy

ORF nucleic acid sequences, both mutated and non-mutated, will also be useful in gene therapy (reviewed in Miller, Nature 357:455-460, 1992). Miller states that advances have resulted in practical approaches to human gene therapy that have demonstrated positive initial results. The basic science of gene therapy is described in Mulligan, Science 260:926, 1993. As used herein "gene therapy" is a form of gene transfer and is included within the definition of gene transfer as used herein and specifically refers to gene transfer to express a therapeutic product from a cell in vivo or in vi tro . Gene transfer can be performed ex vivo on cells which are then transplanted into a patient, or can be performed by direct administration of the nucleic acid or nucleic acid-protein complex into the patient.

In one preferred embodiment, an expression vector containing an ORF coding sequence or an ORF mutant coding sequence, as described above, is inserted into cells, the cells are grown in vi tro and then infused in large numbers into patients. In another preferred embodiment, a DNA segment containing a promoter of choice (for example a strong promoter) is transferred into cells containing an endogenous ORF in such a manner that the promoter segment enhances expression of the endogenous ORF gene (for example, the promoter segment is transferred to the cell such that it becomes directly linked to the endogenous ORF gene) .

The gene therapy may involve the use of an adenovirus containing ORF cDNA targeted to an appropriate cell type, systemic ORF increase by implantation of engineered cells, injection with ORF virus, or injection of naked ORF DNA into appropriate cells or tissues, for example adipose tissue.

Expression vectors derived from viruses such as retroviruses, vaccinia virus, adenovirus, adeno-associated virus, herpes viruses, other RNA viruses, or bovine papilloma virus, may be used for delivery of nucleotide sequences (eg., cDNA) encoding recombinant ORF protein into the targeted cell population (eg., tumor cells or fat cells). Methods which are well known to those skilled in the art can be used to construct recombinant viral vectors containing coding sequences. See, for example, the techniques described in Maniatis et al., Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory, N.Y. (1989), and in Ausubel et al., Current Protocols in Molecular Biology, Greene Publishing Associates and Wiley Interscience, N.Y. (1989). Alternatively, recombinant nucleic acid molecules encoding protein sequences can be used as naked DNA or in reconstituted system eg., liposomes or other lipid systems for delivery to target cells (See eg., Feigner et al., Na ture 337:387-8, 1989). Several other methods for the direct transfer of plasmid DNA into cells exist for use in human gene therapy and involve targeting the DNA to receptors on cells by complexing the plasmid DNA to proteins. See, Miller, supra.

In its simplest form, gene transfer can be performed by simply injecting minute amounts of DNA into the nucleus of a cell, through a process of microinjection. (Capecchi MR, Cell

22:479-68, 1980). Once recombinant genes are introduced into a cell, they can be recognized by the cell's normal mechanisms for transcription and translation, and a gene product will be expressed. Other methods have also been attempted for introducing DNA into larger numbers of cells. These methods include: transfection, wherein DNA is precipitated with CaPO< and taken into cells by pinocytosis (Chen C. and Okayama H, Mol. Cell Biol. 7:2745-52, 1987); electroporation, wherein cells are exposed to large voltage pulses to introduce holes into the membrane (Chu G., et al., Nucleic Acids Res.,

15:1311-26, 1987); lipofection/liposome fusion, wherein DNA is packaged into lipophilic vesicles which fuse with a target cell

(Feigner PL., et al., Proc. Natl. Acad. Sci. USA. 84:7413-7, 1987); and particle bombardment using DNA bound to small projectiles (Yang NS., et al., Proc. Natl. Acad. Sci. 87:9568-72, 1990). Another method for introducing DNA into cells is to couple the DNA to chemically modified proteins.

It has also been shown that adenovirus proteins are capable of destabilizing endosomes and enhancing the uptake of DNA into cells. The admixture of adenovirus to solutions containing DNA complexes, or the binding of DNA to polylysine covalently attached to adenovirus using protein crosslinking agents substantially improves the uptake and expression of the recombinant gene. (Curiel, et al., Am. J. Respir. Cell. Mol. Biol., 6:247-52, 1992).

As used herein "gene transfer" means the process of introducing a foreign nucleic acid molecule into a cell. Gene transfer is commonly performed to enable the expression of a particular product encoded by the gene. The product may include a protein, polypeptide, antisense DNA or RNA, or enzymatically active RNA. Gene transfer can be performed in cultured cells or by direct administration into animals. Generally gene transfer involves the process of nucleic acid contact with a target cell by non-specific or receptor mediated interactions, uptake of nucleic acid into the cell through the membrane or by endocytosis, and release of nucleic acid into the cytoplasm from the plasma membrane or endosome. Expression may require, in addition, movement of the nucleic acid into the nucleus of the cell and binding to appropriate nuclear factors for transcription.

In another preferred embodiment, a vector having nucleic acid sequences encoding an ORF is provided in which the nucleic acid sequence is expressed only in specific tissue. Methods of achieving tissue-specific gene expression as set forth in International Publication No. WO 93/09236, filed November 3, 1992 and published May 13, 1993.

In all of the preceding vectors set forth above, a further aspect of the invention is that the nucleic acid sequence contained in the vector may include additions, deletions or modifications to some or all of the sequence of the nucleic acid, as defined above.

In another preferred embodiment, an ORF nucleic acid is used in gene replacement. "Gene replacement" as used herein means supplying a nucleic acid sequence which is capable of being expressed in vivo in an animal and thereby providing or augmenting the function of an endogenous gene which is missing or defective in the animal. Methods of introducing the nucleic acid into the animal to be treated are as described above.

Examples

The examples below are non-limiting and are merely representative of various aspects and features of the present invention. The examples below demonstrate the isolation, and characterization of the novel protein ORF.

Example 1: Cloning of ORF and Structural Motifs

Materials and Methods:

Yeast two-hybrid screen

Yeast strain L40, containing "bait" plasmid pBTM116*-ERK6 K-M encoding the LexA DNA binding domain (DBD) fused to the ERK6 K-M mutant, was transformed with a human adult skeletal muscle Matchmaker cDNA library (Clontech) by the lithium acetate method (Vojtek, A.B., et al., Cell 74:205-214, 1993). One million transformants were selected for growth on plates lacking histidine. His+ colonies were subsequently analyzed for β-galactosidase activity. cDNA library plasmids derived from double-positive yeast colonies were tested for bait specificity by retransformation with a plasmid encoding the Lex

DBD fused to laminin. The partial ORF cDNA was used to screen additional skeletal muscle and placenta human cDNA libraries.

The full length human ORF cDNA described here was isolated from a human skeletal muscle cDNA library.

Plasmids pRK5 ERK6 containing the coding region of hERK was described by Lechner, C, et al., Proc. Natl. Acad. Sci. U.S.A.

93:4355-4359, 1996. To introduce an amino acid change in the

ATP binding site of MAPK (ERK6 K-M) , codon 56 of the ERK6 cDNA (AAG, encoding K) was changed to ATG (encoding M) by site directed mutagenesis using the Muta-gene system (Bio-Rad) . The HA epitope tagged ERK6 was generated by inserting the coding sequence TATGATGTTCCTGATTATGCTAGCCTC between codon 1 and 2 of ERK6. The plasmid pBTM116* was linearized with Ncol, its cohesive ends were filled in with T4 DNA polymerase and after redigestion with BamHl it was ligated with the Smal-Bglll fragment of ERK6 K-M cDNA to create bait plasmid. A 2.565 kb EcoRI-Xhol cDNA encoding ORF was subcloned into the mammalian expression vector pCDNA3. The PCR fragments containing ORF or its deletion forms were subcloned into pGEX-5Xl (Pharmacia) to create vectors expressing GST fusion proteins. The coding sequence of GFP harboring the S35T mutation was amplified by PCR and, after digestion with BamHl and EcoRI, was ligated with the BamHl and EcoRI linearized pCDNA3 vector. The resulting pCDNA3-GFP vector was then digested with EcoRI and Xhol and ligated with an EcoRI-Xhol ORF cDNA insert from pCDNA3-0RF to create pCDNA3-GFP-ORF.

Cell culture and transfections

COS1 and HEK-293 cells were maintained in Dulbecco's modified Eagle's medium DMEM supplemented with 10 % foetal calf serum. lxlO⁵ cells were seeded per 6 cm dish and transfected 4 hours later with 3 μg of DNA using the calcium phosphate precipitation method as described by Chen, C. and Okayama, H., Mol. Cell. Biol., 7:2745-2752, 1987. When indicated, cells were treated with 2 mM pervanadate or 0.6 M α-sorbitol for 20 min before lysis. Cells were lysed on ice in 200 μl buffer containing 50 mM HEPES pH7.5, 150 mM NaCl, 20 mM sodium pyrophosphate, 1 % sucrose monolaurate, 10 % glycerol, 2 mM EDTA, 2 mM sodium orthovanadate, 1 mM phenylmethylsulfonyl fluoride 1 μg/ml aprotinin and 1 μg/ml leupeptin. The cell lysate was centrifuged for 10 min at 4 °C and diluted in sample buffer. Samples were boiled for 5 min, vortexed and 10 μl were loaded on SDS-polyacrylamide gels. Prokaryotic Expression of Fusion Proteins

GST fusion proteins were produced in the pLys (BL21DE3) strain of Escherichia coli using the pGEX expression system. For purification of fusion peptides, bacterial sonicates were applied to glutathione-sepharose beads (Pharmacia) , washed and eluted as described by the manufacturer. Eluted proteins were dialyzed against a buffer containing lx PBS, 0.1 % Triton X-100 and 20 % glycerol.

In Vitro Binding Assays For in vi tro binding, 200 μl of the indicated cellular lysate was added to 100 μl HNSG buffer (20 mM HEPES, pH 7.5, 150 mM NaCl, 0.1% sucrose monolaurate and 10% glycerol, 2 mM sodium orthovanadate, 1 mM phenylmethylsulfonyl fluoride) . 4 μl GST-agarose beads containing 0.5 μg of GST fusion protein was added and the suspension was incubated 3 hr at 4°C. The agarose beads were washed three times with HNSG buffer. Bound proteins were eluted with sample buffer and resolved by 10 % SDS-PAGE.

Western blotting and antibodies Following SDS-polyacrylamide electrophoresis, the proteins were transferred to Nitro-cellulose membranes

(Schleicher & Schuell) and immunoblotted. For immunoblot detection, the ECL system from Amersham was utilised. Anti- phosphotyrosine antibody 4G10 was from Santa Cruz, anti-ERK6 antibody AS-19 anti haemaglutinin-tag antibody were described by Lechner, C, et al . , Proc. Natl. Acad. Sci. U.S.A. 93:4355- 4359, 1996. Antiserum against ORF was raised in rabbits injected with the purified recombinant GST-ORF (aa 102-267) fusion peptide produced in E.coli.

Determination of expression by Northern analysis

Filter from Clontech containing 2 μg of poly (A) + RNA from various human tissues was used for ORF expression pattern analysis. Total RNA was extracted from mouse C2C12 cells according to Puissant, C. and Houdebine, L.M., Biotechniques 8:146-149, 1990, and poly (A) + RNA was prepared as described by Aviv, H. and Leder, P. Proc. Natl. Acad. Sci. USA. 69:1408- 1412, 1972. A total of 0.5 μg of poly (A) + RNA was loaded on a 1.2 % agarose/2.2 M formaldehyde gel and after separation blotted onto nitrocellulose. Filters were hybridized with a ³²P labeled random-primed probe corresponding to the coding region of human or mouse ORF. The hybridization and subsequent washes were performed under high-stringency conditions according to the standard procedures (Sambrook, J. , et al., "Molecular Cloning: A Laboratory Manual"; 2nd edn; Cold Spring Harbor Laboratory Press; Cold Spring, Harbor, NY (1989) . Integrity and amount of poly (A) + RNA were controlled by rehybridization of blots with GAPDH or b-actin.

Results

To identify proteins that interact with hERKδ, a yeast two-hybrid screen (Fields, S. and 0. Song, Nature 340:245-246, 1989) was performed with a human adult skeletal muscle library using a catalytically inactive form of the kinase as a bait. The dominant negative form of the kinase, defined by an amino acid substitution in the ATP binding domain (K52M) , was chosen in order to minimize interferences on the activity of the reporter genes and to prevent phosphorylation of potential candidates. One clone out of the 10⁶ screened was isolated for its ability to interact with ERK6 but not with the unrelated protein laminin and was subsequently called Osmotic Responsive Factor (ORF) .

The insert of clone ORF encodes a 222 amino acid fragment and was used to screen two human cDNA libraries from adult skeletal muscle and placental tissues, from which we obtained two cDNA of respectively 2.6 kb and 5.5 kb. The sequence of the 2.6 kb insert revealed a 262 residues open reading frame

(SEQ ID NO:2), encoding a 29.4 kDa protein. The second clone had identical coding sequence, but differed in having extra 3' noncoding sequences. The encoded protein contains three 56

occurrences of the MAPK consensus phosphorylation site, which are serine-proline (aa 197-198) and threonine-proline (aa 89- 90; 251-252) .

A search in the databases revealed that the N-terminal region of ORF (aa 24 to 160) has strong homologies with proteins that contain the tetratrico peptide repeat (TPR) motif, as originally described by Sikorski, R.S., et al., Cell 60:307-317, 1990, and Boguski, M.S., et al., Nature 346:114, 1990. The TPR motif is a 34-amino acid sequence occurring several times in the protein with an underlying pattern of both amino acid identity and similarity. We found within this N- terminal region 4 putative repeats sharing identities with the consensus sequence, as shown in reverse print.

A second structurally distinct region is present in the C-terminal domain of ORF (residues 183 to 248) . According to both Chou-Fasman and Garnier-Osguthorpe-Robson algorithms, this stretch of the protein is likely to adopt a secondary Helix- Loop-Helix domain, defined by Murre, C, et al., Cell 56:777- 783, 1989. Alignment of this region with members of the HLH family of proteins showed some conservation among residues determining the hydrophobic core essential for protein dimerization, with he highest level of homology seen within the Helix 2 of Myf-6, myogenin and c-myc. This dimerization domain is often coupled in its N-terminal to a basic region that mediates DNA binding. The adjoining region of ORF contains a helix-destabilizing residue and is highly degenerated. The lack of a conserved basic region in ORF protein resembles the situation described for Id proteins that can heterodimerize with other bHLH proteins, such as E47, but generate complexes that cannot bind to DNA.

Example 2: In Vitro Interaction Between ORF and ERK6

To investigate the nature of ERK6-ORF interaction, we developed an in vitro binding assay using bacterially produced

GST-ORF fusion protein in pull-down experiments. To facilitate the detection of ERK6, the protein was tagged in its N-terminal end and transiently expressed in HEK-293 cells. ERK6 showed detectable binding to GST-ORF. The binding was strictly dependent on the presence of ORF, with no signal observed with GST alone. ERK6 has recently been shown to be responsive to osmotic shock (Cuenda, A., et al., EMBO J. 16:295-305, 1997). In addition, we previously reported that treatment of the cells with orthovanadate induces tyrosine phosphorylation of ERK6 (Lechner, C, et al., Proc. Natl. Acad. Sci. U.S.A. 93:4355- 4359, 1996) . We therefore investigated whether these different isoforms bind ORF with similar affinities. Both osmotic shock and sodium pervanadate treatment induced a shift in ERK6 electrophoretic mobility, with a more pronounced effect seen upon hypertonic stress. Surprisingly, whereas osmotic shock strengthened the binding of ERK6 to GST-ORF, sodium pervanadate pretreatment generated the opposite effect. These results suggest that ERK6 responds differently to hypertonic and pervanadate treatment.

We then examined the interaction of HA-ERK6 with a series of mutant ORF expressed as GST fusion proteins. A minimal region, defined by the TPR motif number 4 and the hinge that separates the tandem of TPR motifs from the HLH domain (GST-ORF 127-182), was shown to interact efficiently with the kinase. Deletion of the TPR4 motif within this core region generates a peptide (GST-ORF 161-182) that does not detectably bind to ERK6. No ERK6 binding with the C-terminal half of ORF (GST-ORF 198-262) , composed of the HLH domain and a short peptide, was detected. These results suggest that the ORF factor contains an anchor region defined by the TPR 4 motif associated with a short hinge that is specifically recognized and bound by ERK6.

Example 3 : Activation of ERK6 is followed by rapid modification of ORF

The finding that ERK6 interacts specifically with ORF prompted us to look for potential physiological correlates. In particular we examined the effect of hypertonic stress on transiently expressed ERK6 and ORF proteins. For this investigation, we co-transfected HEK-293 cells with plasmid DNAs expressing either ORF alone (pCDNA3-ORF) or ERK6 (pRK5- ERK6) . Expression of ORF was monitored by western blot using antibodies raised against a GST fusion protein containing the C-terminal 165 amino acids of ORF. This antiserum recognized a band with a mobility on SDS-PAGE corresponding to an apparent molecular mass of 30 kDa. With lysate of mock transfected cells this band was still detected but only after overexposure of the filter, suggesting that it represents the ORF gene product. Cells were incubated in a hypertonic media (300 % osmolarity) for a total of 25 min, time upon which the media was switched to an isotonic medium to prevent cell lysis. A shift in ERK6 apparent molecular weight that correlated with an increase in its phosphotyrosine content was detected after 5 minutes of treatement, and reached a maximum after 30 min. ERK6 phosphotyrosine content progressively decreased after change of media, as seen 15 min after switching media, and returned to basal level after 60 min. In parallel, we monitored the expression of ORF protein which is, at time 0 and 5 min, predominantly expressed as a 30 kDa form. At time 30 and 40 min, the relative amount of 30 to 32 kDa ORF proteins start to change in favor of the 32 kDa isoform. The amount of 32 kDa progressively decreased in favor of the 30 kDa form 180 min after switching cells to an isotonic buffer. In absence of exogenous ERK6, exposure to hypertonic media did not change the ratio between the 30 and 32 kDa forms of ORF

We then tested the ability of a dominant negative mutant of ERK6, ERK6 K-M, to shift the apparent molecular weight of ORF. The catalytically inactive ERK6 failed to change the ratio of 30/32 kDa forms of ORF. Instead, in some experiments minor isoforms of the ORF protein are present in resting cells, regardless of ERK6 expression. In addition pretreatment of the cells with sodium pervanadate generated a new isoform of ORF protein. The generation of the pervanadate induced isoform was independent of ERK6 and was not prevented by ERK6 K-M. This latter result suggests that the ERK6/ORF complex is responsive to osmotic shock, but that ORF responsiveness to pervanadate is mediated through other kinases from HEK293.

Example 4: Expression pattern and sub cellular localization of ORF

To investigate expression of ORF mRNA in different tissues, Northern-blot experiment was performed on a panel of poly (A) + RNAs from various human tissues. Three mRNA species of 5.5, 2.6 and 0.9 kb are detected upon hybridization of the blot. The 2.6 and 5.5 kb species are predominantly expressed in heart, brain, skeletal muscle and pancreas, but they are also detected at a much lower level in placenta, lung, liver and kidney. In contrast, the 0.9 kb mRNA was found only in placenta. It is at present unclear whether this transcript results from alternative splicing, alternative polyadenylation, or whether it indicates the existence of a closely related gene.

Since we observed that ERK6 mRNA level increased in differentiated C2C12 cells (Lechner, C, et al., Proc. Natl. Acad. Sci. U.S.A. 93:4355-4359, 1996), we investigated the possibility that expression of both ERK6 and ORF genes occurs at the same stage of muscle differentiation. We monitored the expression of ORF gene in C2C12 cells using a probe corresponding to the mouse homologue of ORF. A single 5.5 kb transcript was expressed in C2C12 myotubes, but was not detected in dividing myoblast. The same blot was reprobed with a GAPDH specific probe to normalize the amount of mRNA and confirm the specificity of ORF mRNA induction during differentiation. We next examined the sub cellular distribution of ORF by fusing it to the C-terminus of the green fluorescent protein

(GFP) . After transient expression in COS cells, the fusion protein was then visualized by fluorescence with a confocal microscope. A bright fluorescence was observed in the nuclei, with the exception of the nucleolar structures. Coexpression of the ERK6 kinase did not significantly affect the nuclear distribution of ORF. Similarly, we observed no relocalization of GFP-ORF when hypertonic media was applied to the cells. The GFP protein alone was found exclusively in the cytoplasm, suggesting that ORF redirects the protein to the nuclei. Similar results were obtained with HEK293 recipient cells. This result is in agreement with the presence of two stretches of basic residues in the N-terminal end of the protein (aa 45- 48; 173-176) that are reminiscent of a nuclear localization signal domain.

One skilled in the art would readily appreciate that the present invention is well adapted to carry out the objects and obtain the ends and advantages mentioned, as well as those inherent therein. The molecular complexes and the methods, procedures, treatments, molecules, specific compounds described herein are presently representative of preferred embodiments are exemplary and are not intended as limitations on the scope of the invention. Changes therein and other uses will occur to those skilled in the art which are encompassed within the spirit of the invention are defined by the scope of the claims.

It will be readily apparent to one skilled in the art that varying substitutions and modifications may be made to the invention disclosed herein without departing from the scope and spirit of the invention. All patents and publications mentioned in the specification are indicative of the levels of those skilled in the art to which the invention pertains. All patents and publications are herein incorporated by reference to the same extent as if each individual publication was specifically and individually indicated to be incorporated by reference.

The invention illustratively described herein suitably may be practiced in the absence of any element or elements, limitation or limitations which is not specifically disclosed herein. Thus, for example, in each instance herein any of the terms "comprising", "consisting essentially of" and "consisting of" may be replaced with either of the other two terms. The terms and expressions which have been employed are used as terms of description and not of limitation, and there is no intention that in the use of such terms and expressions of excluding any equivalents of the features shown and described or portions thereof, but it is recognized that various modifications are possible within the scope of the invention claimed.

In addition, where features or aspects of the invention are described in terms of Markush groups, those skilled in the art will recognize that the invention is also thereby described in terms of any individual member or subgroup of members of the Markush group. For example, if X is described as selected from the group consisting of bromine, chlorine, and iodine, claims for X being bromine and claims for X being bromine and chlorine are fully described.

Other embodiments are within the following claims.

Claims

Claims

1. An isolated, enriched or purified nucleic acid molecule encoding an ORF polypeptide.

2. The nucleic acid molecule of claim 1, wherein said nucleic acid molecule comprises a nucleotide sequence that

(a) encodes a polypeptide having the full length amino acid sequence set forth in SEQ ID N0:1;

(b) is the complement of the nucleotide sequence of (a) ;

(c) hybridizes under highly stringent conditions to the nucleotide molecule of (a) and encodes a naturally occurring

ORF polypeptide;

(d) encodes an ORF polypeptide having the full length amino acid sequence of the sequence set forth in SEQ ID N0:1 except that it lacks one or more of the following segments of amino acid residues: 1-23, 24-58, 59-92, 93-126, 127-160, 161- 182, 183-248, or 249-262;

(e) is the complement of the nucleotide sequence of (d) ;

(f) encodes a polypeptide having the amino acid sequence set forth in SEQ ID N0:1 from amino acid residues 1-23, 24-58, 59-92, 93-126, 127-160, 161-182, 183-248, or 249-262;

(g) is the complement of the nucleotide sequence of (f) ; (h) encodes a polypeptide having the full length amino acid sequence set forth in SEQ ID NO:l except that it lacks one or more of the domains selected from the group consisting of an N-terminal domain, TPRl domain, TPR2 domain, TPR3 domain, TPR4 domain, HLH domain, and a C-terminal domain; or

(i) is the complement of the nucleotide sequence of (h) .

3. The nucleic acid molecule of claim 1, further comprising a vector or promoter effective to initiate transcription in a host cell.

4. The nucleic acid molecule of claim 1 or claim 2, wherein said nucleic acid molecule is isolated, enriched, or purified from a human.

5. A nucleic acid probe for the detection of nucleic acid encoding an ORF polypeptide in a sample.

6. The probe of claim 5 wherein said polypeptide comprises at least 4 contiguous amino acids of the amino acid sequence shown in SEQ ID NO:l.

7. A recombinant cell comprising a nucleic acid molecule encoding an ORF polypeptide.

8. The cell of claim 7, wherein said polypeptide is a fragment of the protein encoded by the full length amino acid sequence set forth in SEQ ID N0:1.

9. An isolated, enriched or purified ORF polypeptide.

10. The polypeptide of claim 9, wherein said polypeptide is a fragment of the protein encoded by the full length amino acid sequence set forth in SEQ ID N0:1.

11. The polypeptide of claim 9, wherein said polypeptide comprises an amino acid sequence having (a) the full length amino acid sequence set forth in SEQ ID NO:l;

(b) the full length amino acid sequence of the sequence set forth in SEQ ID N0:1 except that it lacks one or more of the following segments of amino acid residues: 1-23, 24-58, 59- 92, 93-126, 127-160, 161-182, 183-248, or 249-262;

(c) the amino acid sequence set forth in SEQ ID NO:l from amino acid residues 1-23, 24-58, 59-92, 93-126, 127-160, 161-182, 183-24╬┤, or 249-262; or (d) the full length amino acid sequence set forth in SEQ

ID NO:l except that it lacks one or more of the domains selected from the group consisting of an N-terminal domain,

TPRl domain, TPR2 domain, TPR3 domain, TPR4 domain, HLH domain, and a C-terminal domain.

12. The polypeptide of claim 11, wherein said ORF polypeptide interacts with ERK6 protein kinase.

13. An antibody or antibody fragment having specific binding affinity to an ORF polypeptide or an ORF domain polypeptide.

14. A hybridoma which produces an antibody having specific binding affinity to an ORF polypeptide.

15. A method for identifying a substance capable of modulating ORF activity comprising the steps of: (a) contacting an ORF polypeptide with a test substance; and

(b) determining whether said substance alters the activity of said polypeptide.

16. A method for identifying a substance capable of modulating ORF activity in a cell comprising the steps of:

(a) expressing an ORF polypeptide in a cell;

(b) adding a test substance to said cell; and

(c) monitoring a change in cell phenotype or the interaction between an ORF polypeptide and a natural binding partner.

17. A method of treating disease by administering to a patient in need of such treatment a substance that modulates the activity of ORF.

18. The method of claim 17, wherein said disease is selected from the group consisting of dermatomyositis, polymyositis, inclusion body myositis, sarcoid myopathy, AZT myopathy, myocardial infarction, and ischemia/reperfusion.