CA2323574A1 - Identification of a cdna associated with ischemia in human heart tissue - Google Patents

Abstract

A new gene that is up-regulated in ischemic heart tissue is described. Also described are nucleic acid molecules that contain the new gene. These nucleic acid molecules may be operably linked to one or more expression control elements to produce, for example, a vector for transforming host cells. By culturing such host cells under proper conditions, protein from the new gene may be expressed and purified.

Description

IDENTIFICATION OF A cDNA ASSOCIATED WITH ISCHEMIA IN HUMAN
HEART TISSUE
FIELD OF THE INVENTION
The invention relates generally to the changes in gene expression in ischemic heart tissue compared to normal human heart tissue. The invention relates specifically to a novel human gene which is up-regulated in ischemic human heart tissue. This application is related to U.S. Provisional Application Serial No. 60/079,377, filed March 26, 1998, which is incorporated herein by reference.
BACKGROUND OF THE INVENTION
Cardiovascular disease is a general diagnostic category consisting of several separate diseases. Coronary heart disease and cerebrovascular disease are major components of cardiovascular disease with 478,530 dying of coronary heart disease and 144,070 dying of cerebrovascular disease in the U.S. in 1991. See Cecil Textbook of Medicine, Bennet and Plum Eds., W.B. Saunders Co., 1996. Many of the acute fon~ns of coronary heart disease are caused by coronary artery abnormalities such as coronary atherosclerosis. Among the more common causes and contributing factors in sudden cardiac death are chmnic ischemic heart disease and ischemic cardiomyopathy.
Chronic ischemic heart disease and ischemic cardiomyopathy are caused in part by episodes of insufficient myocardial oxygen supply. Myocardial oxygen supply is governed by coronary blood flow and the ability of the myocardium to extract oxygen from the blood delivered to it. Unlike other organs, the heart always extracts oxygen with near maximal efficiency from the blood. Even under situations of minimal demand, there is little potential for enhanced oxygen extraction to counter increased oxygen demands.
Coronary blood flow, on the other hand, can increase several-fold in normal subjects as a result of coronary arterial vasodiladon. Coronary arterial vasodilation is regulated by the coronary endothelium which releases vasodilatory substances, most importantly nitric oxide.
In atherosclerotic coronary heart disease, endothelial dysfunction may diminish production of vasodilatory substances, such as nitric oxide. Myocardial ischemia results when autoregulatory vasodilation is prevented, whether by flow-limiting coronary arterial stenosis or by endothelial dysfunction. In both cases, arterial blood flow can no longer increase proportional to rising oxygen demands. In other situations, myocardial ischemia may occur when oxygen demands are constant but there is a primacy decrease in coronary blood flow mediated via coronary artery spasm, rapid evolution of the underlying atherosclerotic plaque leading to a reduced coronary arterial lumen caliber, andlor intermittent microvascular plugging by platelet aggregates.
At the molecular level, ischemia is characterized by the differential expression of numerous genes compared to normal heart tissue. For instance, in human heart failure caused by ischemic cardiomyopathy, expression of the Vii,- and (32-adrenergic receptors of the adenyl cyclase signal transduction system is impaired by reductions in the expression of mRNA for each receptor (Ihl-Vahl et al., 1996, J. Mol. Cell. Cardiol. 28:1-10).
Ischemic injury is also known to lead to the differential expression of heat shock and immediate early genes such as hsp70, c fos, c jun, jun-B as well the genes encoding angiotensin receptor subtypes (Plumier et al., 1996, J. Mol. Cell. Cardiol.
28:1251-1260;
Wharton et al., 1998, J. Pharmoc. Experiment. Therap. 284(1) 323-336; and Heads et al.
1995, J. Mol. Cell. Cardiol. 27:2133-2148).
The identification of new genes that are differentially expressed in ischemic heart tissue will allow for the development of numerous diagnostic and therapeutic applications such as molecular probes and new agents which modulate the activity or expression of these genes.
SUMMARY OF THE INVENTION
The present invention is based on our discovery of a new gene which is up-regulated in ischemic heart tissue. The invention includes isolated nucleic acid molecules selected from the group consisting of an isolated nucleic acid molecule that encodes the amino acid sequence of SEQ ID No.2, an isolated nucleic acid molecule that encodes a fragment of at least 10 amino acids of SEQ ID No.2, an isolated nucleic acid molecule which hybridizes to a nucleic acid molecule comprising SEQ ID No. 1 under conditions of sufficient stringency to produce a clear signal and an isolated nucleic acid molecule which hybridizes to a nucleic acid molecule that encodes the amino acid sequence of SEQ ID No.

2 under conditions of sufficient stringency to produce a clear signal.
The present invention further includes the nucleic acid molecules operably linked to one or more expression control elements, including a vector comprising the isolated nucleic acid molecules. The invention further includes host cells transformed to contain the nucleic acid molecules of the invention and methods for producing a protein comprising the step of culturing a host cell transformed with the nucleic acid molecule of the invention under conditions in which the protein is expressed.
The invention further provides an isolated polypeptide selected from the group consisting of an isolated polypeptide comprising the amino acid sequence of SEQ ID No.2, an isolated polypeptide comprising a fragment of at least 10 amino acids of SEQ ID No.2, an isolated polypeptide comprising conservative amino acid substitutions of SEQ ID No.2 and naturally occurring amino acid sequence variants of SEQ ID No.2.
The invention further provides an isolated antibody that binds to a polypeptide of the invention, including monoconal and polyclonal antibodies.
The invention further provides methods of identifying an agent which modulates the expression of a nucleic acid encoding the protein having the sequence of SEQ ID No.2 comprising the steps of exposing cells which express the nucleic acid to the agent and determining whether the agent modulates expression of said nucleic acid, thereby identifying an agent which modulates the expression of a nucleic acid encoding the protein having the sequence of SEQ ID No.2.
The invention further provides methods of identifying an agent which modulates at least one activity of a protein comprising the sequence of SEQ ID No.2 comprising the steps of exposing cells which express the protein to the agent and determining whether the agent modulates at least on activity of said protein, thereby identifying an agent which modulates at least one activity of a protein comprising the sequence of SEQ TD
No.2.
The invention further provides methods of identifying binding partners for a protein comprising the sequence of SEQ ID No. 2, comprising the steps of exposing said protein to a potential binding partner and determining if the potential binding partner binds to said protein, thereby identifying binding partners for a protein comprising the sequence of SEQ ID No. 2 The present invention further provides methods of modulating the expression of a nucleic acid encoding the protein having the sequence of SEQ ID No.2 comprising the step of administering an effective amount of an agent which modulates the expression of a nucleic acid encoding the protein having the sequence of SEQ ll~ No.2. The invention also provides methods of modulating at least one activity of a protein comprising the sequence of SEQ ID No.2 comprising the step of administering an effective amount of an agent which modulates at least one activity of a protein comprising the sequence of SEQ
)D No.2.
BRIEF DESCRIPTION OF THE DRAWINGS
Figure 1 is a section of an autoradiograph of the expression profile generated from cDNAs made with RNA isolated from ischemic and control, non-ischemic heart tissue.
Figure 2 Figure 2 shows the potential binding, phosphorylation and enzymatic sites of the protein of SEQ ID No.2.
Figure 3 is a Northern blot of RNA isolated from various tissues.
Figure 4 Figure 4 is a PCR-expression analysis of RNA isolated from various tissues.
DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENT
I. General Description The present invention is based in part on identifying a new gene that is differentially regulated or expressed in human ischemic heart tissue compared to normal human heart.tissue. This gene, which may be distantly related to human myosin light chain kinases, encodes a protein predicted to consist of 819 amino acids.
The protein can serve as a target for agents that can be used to modulate the expression or activity of the protein. For example, agents may be identified which modulate biological processes associated with ischemic injury to the heart such as chronic ischemic heart disease and ischemic cardiomyopathy. Agents may also be identified which modulate the biological processes associated with recovery to ischemic injury to the heart.
The present invention is further based on the development of methods for isolating binding partners that bind to the protein. Probes based on the protein are used as capture probes to isolate potential binding partners, such as other proteins. Dominant negative WO 99/49062 PCT/US99l06662 proteins, DNAs encoding these proteins, antibodies to these proteins, peptide fragments of these proteins or mimics of these proteins may be introduced into cells to affect function.
Additionally, these proteins provide a novel target for screening of synthetic small molecules and combinatorial or naturally occurring compound libraries to discover novel therapeutics to regulate heart function.
II. Specific Embodiments A. The Protein Associated with Ischemic Heart Tissue The present invention provides isolated protein, allelic variants of the protein, and conservative amino acid substitutions of the protein. As used herein, the protein or polypeptide refers to a protein that has the human amino acid sequence of that depicted in SEQ ID No.2. The invention includes naturally occurring allelic variants and proteins that have a slightly different amino acid sequence than that specifically recited above. Allelic variants, though possessing a slightly different amino acid sequence than those recited above, will still have the same or similar biological functions associated with the 819 amino acid protein.
As used herein, the family of proteins related to the 819 amino acid pmtein refer to proteins that have been isolated from organisms in addition to humans. The methods used to identify and isolate other members of the family of proteins related to the 819 amino acid protein are described below.
The proteins of the present invention are preferably in isolated form. As used herein, a protein is said to be isolated when physical, mechanical or chemical methods are employed to remove the protein from cellular constituents that are normally associated with the protein. A skilled artisan can readily employ standard purification methods to obtain an isolated protein.
The proteins of the present invention further include conservative variants of the proteins herein described. As used herein, a conservative variant refers to alterations in the amino acid sequence that do not adversely affect the biological functions of the protein. A
substitution, insertion or deletion is said to adversely affect the protein when the altered sequence prevents or disrupts a biological function associated with the protein. For example, the overall charge, structure or hydrophobic/hydrophilic properties of the protein can be altered without adversely affecting a biological activity. Accordingly, the amino acid sequence can be altered, for example, to render the peptide more hydrophobic or more hydrophilic, without adversely affecting the biological activities of the protein.
Ordinarily, the allelic variants, the conservative substitution variants, the members of the protein family, will have an amino acid sequence having at least 75%
amino acid sequence identity with the human sequence set forth in SEQ ID No.2, more preferably at least 80%, even more preferably at least 90%, and most preferably at least 95%. Identity or homology with respect to such sequences is defined herein as the percentage of amino acid residues in the candidate sequence that are identical with the known peptides, after aligning the sequences and introducing gaps, if necessary, to achieve the rnaximum~percent homology, and not considering any conservative substitutions as part of the sequence identity. N-terminal, C-terminal or internal extensions, deletions, or insertions into the peptide sequence shall not be construed as affecting homology.
Thus, the proteins of the present invention include molecules having the amino acid sequence disclosed in SEQ ID No.2; fragments thereof having a consecutive sequence of at least about 3, 5, 10 or 15 amino acid residues of the 819 amino acid protein; amino acid sequence variants of such sequence wherein an amino acid residue has been inserted N- or C-terminal to, or within, the disclosed sequence; and amino acid sequence variants of the disclosed sequence, or their fragments as defined above, that have been substituted by another residue. Contemplated variants further include those containing predetermined mutations by, e.g., homologous recombination, site-directed or PCR
mutagenesis, and the corresponding proteins of other animal species, including but not limited to rabbit, rat, marine, porcine, bovine, ovine, equine and non-human primate species, and the alleles or other naturally occurring variants of the family of proteins; and derivatives wherein the protein has been covalently modified by substitution, chemical, enzymatic, or other appropriate means with a moiety other than a naturally occurring amino acid {for example a detectable moiety such as an enzyme or radioisotope).
As described below, members of the family of proteins can be used: 1 ) to identify agents which modulate at least one activity of the protein, including agents which may modulate phosphorylation mediated by the protein, 2) in methods of identifying binding partners for the protein, 3) as an antigen to raise polyclonal or monoclonal antibodies, and 4) as a therapeutic agent.

_7_ B. Nucleic Acid Molecules The present invention further provides nucleic acid molecules that encode the protein having SEQ ID No.2 and the related proteins herein described, preferably in isolated form. As used herein, "nucleic acid" is defined as RNA or DNA that encodes a peptide as defined above, or is complementary to nucleic acid sequence encoding such peptides, or hybridizes to such nucleic acid and remains stably bound to it under appropriate stringency conditions, or encodes a polypeptide sharing at least 75% sequence identity, preferably at least 80%, and more preferably at least 85%, with the peptide sequences. Specifically contemplated are genomic DNA, cDNA, mRNA and antisense molecules, as well as nucleic acids based on alternative backbone or including alternative bases whether derived from natural sources or synthesized. Such hybridizing or complementary nucleic acids, however, are defined further as being novel and unobvious over any prior art nucleic acid including that which encodes, hybridizes under appropriate stringency conditions, or is complementary to nucleic acid encoding a protein according to the present invention.
"Stringent conditions" are those that (1) employ low ionic strength and high temperature for washing, for example, 0.01 SM NaC1/0.0015M sodium titrate/0.1 % SDS at 50°C., or {2) employ during hybridization a denaturing agent such as formamide, for example, 50% {vol/vol) formamide with 0.1 % bovine serum albumin/0.1 %
Fico11/0. l polyvinylpyrrolidone/50 mM sodium phosphate buffer at pH 6.5 with 750 mM NaCI, mM sodium citrate at 42°C. Another example is use of 50% formatnide, 5 x SSC (0.75M
NaCI, 0.075 M sodium citrate), 50 mM sodium phosphate (pH fi.8), 0.1 % sodium pyrophosphate, 5 x Denhardt's solution, sonicated salmon sperm DNA (50 pg/ml), 0.1%
SDS, and 10% dextran sulfate at 42°C., with washes at 42°C. in 0.2 x SSC and 0.1% SDS.
A skilled artisan can readily determine and vary the stringency conditions appropriately to obtain a clear and detectable hybridization signal.
As used herein, a nucleic acid molecule is said to be "isolated" when the nucleic acid molecule is substantially separated from contaminant nucleic acid encoding other polypeptides from the source of nucleic acid.
The present invention further provides fragments of the encoding nucleic acid molecule. As used herein, a fragment of an encoding nucleic acid molecule refers to a small portion of the entire protein encoding sequence. The size of the fragment will be determined _g_ by the intended use. For example, if the fragment is chosen so as to encode an active portion of the protein, the fragment will need to be large enough to encode the functional regions) of the protein. If the fiagment is to be used as a nucleic acid probe or PCR
primer, then the fragment length is chosen so as to obtain a relatively small .number of false positives during probing/priming.
Fragments of the encoding nucleic acid molecules of the present invention (i.e., synthetic oligonucleotides) that are used as probes or specific primers for the polymerase chain reaction (PCR), or to synthesize gene sequences encoding proteins of the invention can easily be synthesized by chemical techniques, for example, the phosphotriester method of Matteucci et al., (J. Am. Chem. Soc. 103:3185-3191, 1981) or using automated synthesis methods. 1n addition, larger DNA segments can readily be prepared by well known methods, such as synthesis of a group of oligonucleotides that define various modular segments of the gene, followed by ligation of oligonucleotides to build the complete modified gene.
The encoding nucleic acid molecules of the present invention may further be 1 S modified so as to contain a detectable label for diagnostic and probe purposes. A variety of such labels are known in the art and can readily be employed with the encoding molecules herein described. Suitable labels include, but are not limited to, biotin, radiolabeled nucleotides and the like. A skilled artisan can employ any of the art known labels to obtain a labeled encoding nucleic acid molecule.
Modifications to the primary structure itself by deletion, addition, or alteration of the amino acids incorporated into the protein sequence during translation can be made without destroying the activity of the protein. Such substitutions or other alterations result in proteins having an amino acid sequence encoded by a nucleic acid falling within the contemplated scope of the present invention.
C. Isolation of Other Related Nucleic Acid Molecules As described above, the identification of the human nucleic acid molecule having SEQ
lD No. l allows a skilled artisan to isolate nucleic acid molecules that encode other members of the protein family in addition to the human sequence herein described.
Further, the presently disclosed nucleic acid molecules allow a skills artisan to isolate nucleic acid molecules that encode other members of the family of proteins in addition to the 819 amino acid protein having SEQ ID No.2.

_9_ Essentially, a skilled artisan can readily use the amino acid sequence of SEQ
ID No.2 to generate antibody probes to screen expression libraries prepared from appropriate cells.
Typically, polyclonal antisenun from mammals such as rabbits immunized with the purified protein (as described below) or monoclonal antibodies can be used to probe a mammalian cDNA or genomic expression library, such as lambda gtll library, to obtain the appropriate coding sequence for other members of the protein family. The cloned cDNA
sequence can be expressed as a fusion protein, expressed directly using its own control sequences, or expressed by constructions using control sequences appropriate to the particular host used for expression of the enzyme.
Alternatively, a portion of the coding sequence herein described can be synthesized and used as a probe to retrieve DNA encoding a member of the protein family from any mammalian organism. Uligomers containing approximately 18-20 nucleotides (encoding about a 6-7 amino acid stretch) are prepared and used to screen genomic DNA or cDNA
libraries to obtain hybridization under stringent conditions or conditions of sufficient stringency to eliminate an undue level of false positives.
Additionally, pairs of oligonucleotide primers can be prepared for use in a polymerase chain reaction (PCR) to selectively clone an encoding nucleic acid molecule. A
PCR
denature/anneaUextend cycle for using such PCR primers is well known in the art and can readily be adapted for use in isolating other encoding nucleic acid molecules.
D. rDNA molecules Containing a Nucleic Acid Molecule The present invention further provides recombinant DNA molecules (rDNAs) that contain a coding sequence. As used herein; a rDNA molecule is a DNA molecule that has been subjected to molecular manipulation in situ. Methods for generating rDNA
molecules are well known in the art. See for example, Sambrook et al., ~I~folecular Cloning (1989). In the preferred rDNA molecules, a coding DNA sequence is operably linked to expression control sequences and/or vector sequences.
The choice of vector and/or expression control sequences to which one of the protein family encoding sequences of the present invention is operably linked depends directly, as is well known in the art, on the functional properties desired, e.g., protein expression, and the host cell to be transformed. A vector contemplated by the present invention is at least capable of directing the replication or insertion into the host chromosome, and preferably also expression, WO 99!49062 PCT/US99/06662 of the structural gene included in the rDNA molecule.
Expression control elements that are used for regulating the expression of an operably linked protein encoding sequence are known in the art and include, but are not limited to, inducible promoters, constitutive promoters, secretion signals, and other regulatory elements.
Preferably, the inducible promoter is readily controlled, such as being responsive to a nutrient in the host cell's m~ium.
In one embodiment, the vector containing a coding nucleic acid molecule will include a prokaryotic replicon, i.e., a DNA sequence having the ability to direct autonomous replication and maintenance of the recombinant DNA molecule extrachromosomally in a prokaryotic host cell, such as a bacterial host cell, transformed therewith. Such replicons are well known in the art. In addition, vectors that include a prokaryotic replicon may also include a gene whose expression confers a detectable marker such as a drug resistance. Typical bacterial drug resistance genes are those that confer resistance to ampicillin or tetracycline.
Vectors that include a prokaryotic replicon can further include a prokaryotic or bacteriophage promoter capable of directing the expression (transcription and translation) of the coding gene sequences in a bacterial host cell, such as E. coli. A
promoter is an expression control element formed by a DNA sequence that permits binding of RNA
polymerise and transcription to occur. Promoter sequences compatible with bacterial hosts are typically provided in plasmid vectors containing convenient restriction sites for insertion of a DNA
segment of the present invention. Typical of such vector plasrnids are pUCB, pUC9, pBR322 and pBR329 available from Biorrd Laboratories, (Richmond; CA), pPL and pKK223 available from Pharmacia, Piscataway, N.J.
Expression vectors compatible with eukaryotic cells, preferably those compatible with vertebrate cells, can also be used to form a rDNA molecules the contains a coding sequence.
Eukaryotic cell expression vectors are well known in the art and are available from several commercial sources. Typically, such vectors are provided containing convenient restriction sites for insertion of the desired DNA segment. Typical of such vectors are pSVL and pKSV-10 (Pharmacia), pBPV-1/pML2d (International Biotechnologies, Inc.), pTDTl (ATCC, #31255), the vector pCDM8 described herein, and the like eukaryotic expression vectors.
Eukaryotic cell expression vectors used to construct the rDNA molecules of the present invention may further include a selectable marker that is effective in an eukaryotic cell, preferably a drug resistance selection marker. A preferred drug resistance marker is the gene whose expression results in neomycin resistance, i.e., the neomycin phosphotransferase (neo) gene. (Southern et al., J. Mol. Anal. Genet. 1:327-341, 1982.) Alternatively, the selectable marker can be present on a separate plasmid, and the two vectors are introduced by co-transfection of the host cell, and selected by culturing in the appropriate drug for the selectable marker.
E. Host Cells Containing an Exogenously SuppUed Coding Nucleic Acid Molecule The present invention further provides host cells transformed with a nucleic acid molecule that encodes a protein of the present invention. The host cell can be either prokaryotic or eukaryotic. Eukaryotic cells useful for expression of a protein of the invention are not limited, so long as the cell line is compatible with cell culture methods and compatible with the propagation of the expression vector and expression of the gene product. Preferred eukaryotic host cells include, but are not limited to, yeast, insect and mammalian cells, preferably vertebrate cells such as those from a mouse, rat, monkey or human cell line.
Preferred eukaryotic host cells include Chinese hamster ovary (CHO) cells available from the ATCC as CCL61, N»i Swiss mouse embryo cells NIH/3T3 available from the ATCC as CRL
1658, baby hamster kidney cells (BHK), and the like eukaryotic tissue culture cell lines.
Any prokaryotic host can be used to express a rDNA molecule encoding a protein of the invention. The prefen~ed prokaryotic host is E. coli.
Transformation of appropriate cell hosts with a rDNA molecule of the present invention is accomplished by well known methods that typically depend on the type of vector used and host system employed. With regard to transformation of prokaryotic host cells, electroporation and salt treatment methods are typically employed; see, for example, Cohen et al., Proc. Natl. Acad. Sci. USA 69:2110, 1972; and Maniatis et al., IVIolecular Cloniy,g. A
Laboratory M, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY (1982).
With regard to transformation of vertebrate cells with vectors containing rDNAs, electroporation, cationic lipid or salt treatment methods are typically employed; see, for example, Graham et al., Virol. 52:456,1973; Wigler et al., Proc. Natl. Acad. Sci. USA 76:1373-76, 1979.
Successfully transformed cells, i.e., cells that contain a rDNA molecule of the present invention, can be identified by well known techniques including the selection for a selectable marker. For example, cells resulting from the introduction of an rDNA of the present invention can be cloned to produce single colonies. Cells from those colonies can be harvested, lysed and their DNA content examined for the presence of the rDNA using a method such as that described by Southern, J. Mol. Biol. 98:503, 1975, or Berent et al., Biotech.
3:208, 1985 or the proteins produced from the cell assayed via an imrnunological method.
F. Production of Recombinant Proteins using a rDNA Molecule The present invention further provides methods for producing a protein of the invention using nucleic acid molecules herein described. In general terms, the production of a recombinant form of a protein typically involves the following steps:
First, a nucleic acid molecule is obtained that encodes a protein of the invention, such as the nucleic acid molecule depicted in SEQ 1D No. 1, or nucleotides 136-2592 of SEQ ID
No.l. If the encoding sequence is uninterrupted by introns, it is directly suitable for expression in any host.
The nucleic acid molecule is then preferably placed in operable linkage with suitable 1 S control sequences, as described above, to form an expression unit containing the protein open reading frame. The expression unit is used to transform a suitable host and the transformed host is cultured under conditions that allow the production of the recombinant protein.
Optionally the recombinant protein is isolated from the medium or from the cells; recovery and purification of the protein may not be necessary in some instances where some impurities may be tolerated.
Each of the foregoing steps can be done in a variety of ways. For example, the desired coding s~uences may be obtained from genomic fragments and used directly in appropriate hosts. The construction of expression vectors that are operable in a variety of hosts is accomplished using appropriate replicons and control sequences, as set forth above. The control sequences, expression vectors, and transformation methods are dependent on the type of host cell used to express the gene and were discussed in detail earlier.
Suitable restriction sites can, if not normally available, be added to the ends of the coding sequence so as to provide an excisable gene to insert into these vectors. A skilled artisan can readily adapt any host/expression system known in the art for use with the nucleic acid molecules of the invention to produce recombinant protein.

G. Methods to Identify Binding Partners Another embodiment of the present invention provides methods for use in isolating and identifying binding partners of proteins of the invention. In detail, a protein of the invention is mixed with a potential binding partner or an extract or fraction of a cell under conditions that allow the association of potential binding partners with the protein of the invention. After mixing, peptides, polypeptides, proteins or other molecules that have become associated with a protein of the invention are separated from the mixture. The binding partner that bound to the protein of the invention can then be removed and further analyzed. To identify and isolate a binding partner, the entire protein, for instance the entire 819 amino acid protein of SEQ ID No.2 can be used. Alternatively, a fragment of the protein can be used.
As used herein, a cellular extract refers to a preparation or fraction which is made from a lysed or disrupted cell. The preferred source of cellular extracts will be cells derived from human heart tissue, for instance, ischemic human heart tissue.
Alternatively, cellular extracts may be prepared from normal human heart tissue or available cell lines, particularly heart or muscle derived cell lines.
A variety of methods can be used to obtain an extract of a cell. Cells can be disrupted using either physical or chemical disruption methods. Examples of physical disruption methods include, but are not limited to, sonication and mechanical shearing.
Examples of chemical lysis methods include, but are not limited to, detergent lysis and enzyme lysis. A skilled artisan can readily adapt methods for preparing cellular extracts in order to obtain extracts for use in the present methods.
Once an extract of a cell is prepared, the extract is mixed with the protein of the invention under conditions in which association of the protein with the binding partner can occur. A variety of conditions can be used, the most preferred being conditions that closely resemble conditions found in the cytoplasm of a human cell. Features such as osmolarity, pH, temperature, and the concentration of cellular extract used, can be varied to optimize the association of the protein with the binding partner.
After mixing under appropriate conditions, the bound complex is separated from the mixture. A variety of techniques can be utilized to separate the mixture.
For example, antibodies specific to a protein of the invention can be used to immunoprecipitate the binding partner complex. Alternatively, standard chemical separation techniques such as chromatography and density/sediment centrifugation can be used.
After removal of nonassociated cellular constituents found in the extract, the binding partner can be dissociated from the complex using conventional methods. For example, dissociation can be accomplished by altering the salt concentration or pH of the mixture.
To aid in separating associated binding partner pairs from the mixed extract, the protein of the invention can be immobilized on a solid support. For example, the pmtein can be attached to a nitrocellulose matrix or acrylic beads. Attachment of the protein to a solid support aids in separating peptide/binding partner pairs from other constituents found in the extract. The identified binding partners can be either a single protein or a complex made up of two or more proteins.
Alternatively, the nucleic acid molecules of the invention can be used in a yeast two-hybrid system. The yeast two-hybrid system has been used to identify other protein partner pairs and can readily be adapted to employ the nucleic acid molecules herein described.
H. Methods to Identify Agents that Modulate the Expression a Nucleic Acid Encoding the Ischemic Heart Associated Protein Another embodiment of the present invention provides methods for identifying agents that modulate the expression of a nucleic acid encoding a protein of the invention such as a protein having the amino acid sequence of SEQ ID No. 2. Such assays may utilize any available means of monitoring for changes in the expression level of the nucleic acids of the invention. As used herein, an agent is said to modulate the expression of a nucleic acid of the invention, for instance a nucleic acid encoding the protein having the sequence of SEQ 117 No.2, if it is capable of up- or down-regulating expression of the nucleic acid in a cell.
In one assay format, cell lines that contain reporter gene fusions between the open reading frame defined by nucleotides 136-2592 of SEQ ID No. l and any assayable fusion partner may be prepared. Numerous assayable fusion partners are known and readily available including the firefly luciferase gene and the gene encoding chloramphenicol acetyltransferase (Alam et al. (1990) Anal. Biochem. 188:245-254). Cell lines containing the reporter gene fusions are then exposed to the agent to be tested under appropriate conditions and time. Differential expression of the reporter gene between samples exposed to the agent and contml samples identifies agents which modulate the expression of a nucleic acid encoding the protein having the sequence of SEQ ID No.2.
Additional assay formats may be used to monitor the ability of the agent to modulate the expression of a nucleic acid encoding a protein of the invention such as the protein having SEQ ID No.2. For instance, mRNA expression may be monitored directly by hybridization to the nucleic acids of the invention. Cell lines are exposed to the agent to be tested under appropriate conditions and time and total RNA or mRNA is isolated by standard procedures such those disclosed in Sambmok et al. (Molecular Cloning:
A
Laboratory Manual, 2nd Ed. Clod Spring Harbor Laboratory Press, 1989).
Probes to detect differences in RNA expression levels between cells exposed to the agent and control cells may be prepared from the nucleic acids of the invention. It is preferable, but not necessary, to design probes which hybridize only with target nucleic acids under conditions of high stringency. Only highly complementary nucleic-acid hybrids form under conditions of high stringency. Accordingly, the stringency of the assay conditions determines the amount of complementarity which should exist between two nucleic acid strands in order to form a hybrid. Stringency should be chosen to maximize the difference instability between the probeaarget hybrid and potential probe:non-target hybrids.
Probes may be designed from the nucleic acids of the invention through methods known in the art. For instance, the G+C content of the probe and the probe length can affect probe binding to its target sequence. Methods to optimize probe specificity are commonly available in Sambrook et al. (Molecular Cloning: A Laboratory Approach, Cold Spring Harbor Press, NY, 1989) or Ausubel et al. (Current Protocols in Molecular Biology, Greene Publishing Co., NY, 1995).
Hybridization conditions are modified using known methods, such as those described by Sambrook et al. and Ausubel et al. as required for each probe.
Hybridization of total cellular RNA or RNA enriched for polyA RNA can be accomplished in any available format. For instance, total cellular RNA or RNA enriched for polyA
RNA can be affixed to a solid support and the solid support exposed to at least one probe comprising at least one, or part of one of the sequences of the invention under conditions in which the probe will specifically hybridize. Alternatively, nucleic acid fragments comprising at least WO 99149062 PCT/US991066b2 one, or part of one of the sequences of the invention can be affixed to a solid support, such as a porous glass wafer. The glass wafer can then be exposed to total cellular RNA or polyA RNA from a sample under conditions in which the affixed sequences will specifically hybridize. Such glass wafers and hybridization methods, such as those disclosed by Beattie (WO 95/11755), are widely available. By examining for the ability of a given probe to specifically hybridize to an RNA sample from an untreated cell population and from a cell population exposed to the agent, agents which up or down regulate the expression of a nucleic acid encoding the protein having the sequence of SEQ
ID No.2 are identified.
I. Methods to Identify Agents that Modulate at Least One Activity of the Ischemic Heart Associated Protein Another embodiment of the present invention provides methods for identifying agents that modulate at least one activity of a protein of the invention such as the protein having the amino acid sequence of SEQ 1D No.2. Such methods or assays may utilize any means of monitoring or detecting the desired activity.
In one format, the relative amounts of a protein of the invention between a cell population that has been exposed to the agent to be tested compared to an un-exposed control cell population may be assayed. In this format, probes such as specific antibodies are used to monitor the differential expression of the protein in the different cell populations. Cell lines or populations are exposed to the agent to be tested under appropriate conditions and time. Cellular lysates may be prepared from the exposed cell line or population and a control, unexposed cell line or population. The cellular lysates are then analyzed with the probe.
Antibody pmbes are prepared by immunizing suitable mammalian hosts in appropriate immunization protocols using the peptides, polypeptides or proteins of the invention if they are of sufficient length, or, if desired, or if required to enhance immunogenicity, conjugated to suitable carriers. Methods for preparing immunogenic conjugates with carners such as BSA, KLH, or other carrier proteins are well known in the art. In some circumstances, direct conjugation using, for example, carbodiimide reagents may be effective; in other instances linking reagents such as those supplied by Pierce Chemical Co., Rockford, IL, may be desirable to provide accessibility to the hapten. The WO 99!49062 PCTlUS99/06662 hapten peptides can be extended at either the amino or carboxy terminus with a Cys residue or interspersed with cysteine residues, for example, to facilitate linking to a carrier.
Administration of the immunogens is conducted generally by injection over a suitable time period and with use of suitable adjuvants, as is generally understood in the art. During the immunization schedule, titers of antibodies are taken to determine adequacy of antibody formation.
While the polyclonal antisera produced in this way may be satisfactory for some applications, for pharmaceutical compositions, use of monoclonal preparations is preferred. Immortalized cell lines which secrete the desired monoclonal antibodies may be prepared using the standard method of Kohler and Milstein or modifications which effect immortalization of lymphocytes or spleen cells, as is generally known. The immortalized cell lines secreting the desired antibodies are screened by immunoassay in which the antigen is the peptide hapten, polypeptide or protein. When the appropriate immortalized cell culture secreting the desired antibody is identified, the cells can be cultured either in 1 S vitro or by production in ascites fluid.
The desired monoclonal antibodies are then recovered from the culture supernatant or from the ascites supernatant. Fragments of the monoclonals or the polyclonal antisera which contain the immunologically significant portion can be used as antagonists, as well as the intact antibodies. Use of immunologically reactive fragments, such as the Fab, Fab', of F(ab')i fragments is often preferable, especially in a therapeutic context, as these fragments are generally less immunogenic than the whole immunoglobulin.
The antibodies or fragments may also be produced, using current technology, by recombinant means. Regions that bind specifically to the desired regions of receptor can also be produced in the context of chimeras with multiple species origin.
In an alternative format, a specific activity of a protein of the invention may be assayed, such as the ability of the protein to phosphorylate a substrate such as myosin.
Cell lines or populations are exposed under appropriate conditions to the agent to be tested. Agents which modulate the kinase activity of the protein of the invention are identified by assaying the kinase activity of the protein from the exposed cell line or population and a control, unexposed cell line or population, thereby identifying agents which modulate the kinase activity of the protein.
Kinase assays to measure the ability of the agent to modulate the kinase activity of a protein of the invention are widely available such as the assays disclosed by Mishima et al. (1996) .1. Biochem. 119:906-913) and Michnoff et al. (1986) J. Biol. Chem.
261:8320-8326. Alternative assay formats include actin-myosin motility assays such as those disclosed by Kohama et al. (1996) TIPS 17:284-287 or Warrick et al. (1987) Ann. Rev.
S Cell. Biol. 3:379-421.
Agents that are assayed in the above method can be randomly selected or rationally selected or designed. As used herein, an agent is said to be randomly selected when the agent is chosen randomly without considering the specific sequences involved in the association of the a protein of the invention alone or with its associated substrates, binding partners, etc. An example of randomly selected agents is the use a chemical library or a peptide combinatorial library, or a growth broth of an organism.
As used herein, an agent is said to be rationally selected or designed when the agent is chosen on a nonrandom basis which takes into account the sequence of the target site and/or its conformation in connection with the agent's action. As described in the Examples, there are proposed binding sites for ATP/GTP and calmodulin as well as cAMP/cGMP kinase sites, Tyre sites and Ser/Thr kinase (catalytic) sites in the protein having SEQ ID No.2. Agents can be rationally selected or rationally designed by utilizing the peptide sequences that make up these sites. For example, a rationally selected peptide agent can be a peptide whose amino acid sequence is identical to the ATP or calmodulin binding sites or domains.
The agents of the present invention can be, as examples, peptides, small molecules, vitamin derivatives, as well as carbohydrates. A skilled artisan can readily recognize that there is no limit as to the structural nature of the agents of the present invention.
The peptide agents of the invention can be prepared using standard solid phase (or solution phase) peptide synthesis methods, as is known in the art. In addition, the DNA
encoding these peptides may be synthesized using commercially available oligonucleotide synthesis instrumentation and produced recombinantly using standard recombinant production systems. The production using solid phase peptide synthesis is necessitated if non-gene-encoded amino acids are to be included.
Another class of agents of the present invention are antibodies immunoreactive with critical positions of proteins of the invention. Antibody agents are obtained by immunization of suitable mammalian subjects with peptides that contain as antigenic regions those portions of the protein intended to be targeted by the antibodies.
J. Uses for Agents that Modulate at Least One Activity of the Ischemic Heart Associated Protein As provided in the Examples, the proteins and nucleic acids of the invention, such as the protein having the amino acid sequence of SEQ ID No.l, are up-regulated in ischemic heart tissue. Agents that modulate or down-regulate the expression of the protein or agents such as agonists or antagonists of at least one activity of the protein may be used to modulate biological and pathologic processes associated with the protein's function and activity.
As used herein, a subject can be any mammal, so long as the mammal is in need of modulation of a pathological or biological process mediated by a protein of the invention.
The term "mammal" is meant an individual belonging to the class Mammalia. The invention is particularly useful in the treatment of human subjects.
As used herein, a biological or pathological process mediated by a protein of the invention may include binding of substrates such as ATP, GTP or calmodulin or phosphorylation of a substrate such as skeletal myosin.
Pathological processes refer to a category of biological processes which produce a deleterious effect. For example, expression or up-regulation of expression of a protein of the invention is associated with chronic ischemic heart disease and ischemic cardiomyopathy. As used herein, an agent is said to modulate a pathological process when the agent reduces the degree or severity of the process. For instance, chronic ischemic heart disease or ischemic cardiomyopathy may be prevented or disease progression modulated after an ischemic event by the administration of agents which reduce or modulate in some way the expression or at least one activity of a protein of the invention.
The agents of the present invention can be provided alone, or in combination with other agents that modulate a particular pathological process. For example, an agent of the present invention can be administered in combination with anti-thrombotic agents. As used herein, two agents are said to be administered in combination when the two agents are administered simultaneously or are administered independently in a fashion such that the agents will act at the same time.
The agents of the present invention can be administered via parenteral, subcutaneous, intravenous, intramuscular, intraperitoneal, transdermal, or buccal routes.
Alternatively, or concurrently, administration may be by the oral route. The dosage administered will be dependent upon the age, health, and weight of the recipient, kind of concurrent treatment, if any, frequency of treatment, and the nature of the effect desired.
The present invention further provides compositions containing one or more agents which modulate expression or at least one activity of a protein of the invention. While individual needs vary, determination of optimal ranges of effective amounts of each component is within the skill of the art. Typical dosages comprise 0.1 to 100 pg/kg body wt. The preferred dosages comprise 0.1 to 10 ~,g/kg body wt. The most preferred dosages comprise 0.1 to 1 pg/kg body wt.
In addition to the pharmacologically active agent, the compositions of the present invention may contain suitable pharmaceutically acceptable carriers comprising excipients and auxiliaries which facilitate processing of the active compounds into preparations which can be used pharmaceutically for delivery to the site of action.
Suitable formulations for parenteral administration include aqueous solutions of the active compounds in water-soluble form, for example, water-soluble salts. In addition, suspensions of the active compounds as appropriate oily injection suspensions may be administered. Suitable lipophilic solvents or vehicles include fatty oils, for example, sesame oil, or synthetic fatty acid esters, for example, ethyl oleate or triglycerides.
Aqueous injection suspensions may contain substances which increase the viscosity of the suspension include, for example, sodium carboxymethyl cellulose, sorbitol, andlor dextran.
Optionally, the suspension may also contain stabilizers. Liposomes can also be used to encapsulate the agent for delivery into the cell.
The pharmaceutical formulation for systemic administration according to the invention may be formulated for enterai, parenteral or topical administration.
Indeed, all three types of formulations may be used simultaneously to achieve systemic administration of the active ingredient.
Suitable formulations for oral administration include hard or soft gelatin capsules, pills, tablets, including coated tablets, elixirs, suspensions, syrups or inhalations and controlled release forms thereof.
In practicing the methods of this invention, the compounds of this invention may be used alone or in combination, or in combination with other therapeutic or diagnostic WO 99149062 PCT/US99/Obbb2 agents. In certain preferred embodiments, the compounds of this invention may be coadministered along with other compounds typically prescribed for these conditions according to generally accepted medical practice, such as anticoagulant agents, thrombolytic agents, or other antithrombotics, including platelet aggregation inhibitors, tissue plasminogen activators, urokinase, prourokinase, streptokinase, heparin, aspirin, or warfarin. The compounds of this invention can be utilized in vivo, ordinarily in mammals, such as humans, sheep, horses, cattle, pigs, dogs, cats, rats and mice, or in vitro.
K. Transgenic Animals Transgenic animals containing a mutant, knock-out or modified gene corresponding to the cDNA sequence of SEQ ID No. l or a construct to modify the expression level of the gene, for instance for up-regulating the expression, are also included in the invention. Transgenie animals are genetically modified animals into which recombinant, exogenous or cloned genetic material has been experimentally transferred.
Such genetic material is often referred to as a "transgene". The nucleic acid sequence of the transgene, in this case a form of SEQ ID No.l, may be integrated either at a locus of a genome where that particular nucleic acid sequence is not otherwise normally found or at the normal locus for the transgene. The transgene may consist of nucleic acid sequences derived from the genome of the same species or of a different species than the species of the target animal.
The term "germ cell line transgenic animal" refers to a transgenic animal in which the genetic alteration or genetic information was introduced into a germ line cell, thereby conferring the ability of the transgenic animal to transfer the genetic information to offspring. If such offspring in fact possess some or all of that alteration or genetic information, then they too are transgenic animals.
The alteration or genetic information may be foreign to the species of animal to which the recipient belongs, foreign only to the particular individual recipient, or may be genetic information already possessed by the recipient. In the last case, the altered or introduced gene may be expressed differently than the native gene.
Transgenic animals can be produced by a variety of different methods including transfection, electroporation, microinjection, gene targeting in embryonic stem cells and recombinant viral and retroviral infection (see, e.g., U.S. Patent No.
4,736,866; U.S. Patent WO 99/49062 PCT/US99/06bb2 No. 5,602,307; Mullins et al. (1993) Hypertension 22(4):630-633; Brenin et al.
(1997) Surg. Oncol. 6(2)99-110; Tuan (ed.), Recombinant Gene Expression Protocols, Methods in Molecular Biology No. 62, Humana Press (1997)).
A number of recombinant or transgenic mice have been produced, including those which express an activated oncogene sequence {U.S. Patent No. 4,736,866);
express simian SV 40 T-antigen (U.S. Patent No. 5,728,915); lack the expression of interferon regulatory factor 1 (IRF-1) (U.S. Patent No. 5,731,490); exhibit dopaminergic dysfunction (U.S. Patent No. 5,723,719); express at least one human gene which participates in blood pressure control (U.S. Patent No. 5,731,489); display greater similarity to the conditions existing in naturally occurnng Alzheimer's disease (U.S. Patent No.
5,720,936); have a reduced capacity to mediate cellular adhesion (U.S. Patent No. 5,602,307);
possess a bovine growth hormone gene (Clutter et al. (1996) Genetics 143{4):1753-1760);
or, are capable of generating a fully human antibody response (McCarthy (1997) The Lancet 349(9049):405).
I S While mice and rats remain the animals of choice for most transgenic experimentation, in some instances it is preferable or even necessary to use alternative animal species. Transgenic procedures have been successfully utilized in a variety of non-murine animals, including sheep, goats, pigs, dogs, cats, monkeys, chimpanzees, hamsters, rabbits, cows and guinea pigs (see, e.g., Kim et al. (1997) Mol. Reprod. Dev.
46(4):515-526; Houdebine (1995) Reprod. Nutr. Dev. 35(6):609-617; Petters (1994) Reprod.
Fertil.
Dev. 6(5):643-645; Schnieke et al. (1997) Science 278(5346):2130-2133; and Amoah (1997) J. Animal Science 75{2):578-585).
The method of introduction of nucleic acid fragments into recombination competent mammalian cells can be by any method which favors co-transformation of multiple nucleic acid molecules. Detailed procedures for producing transgenic animals are readily available to one skilled in the art, including the disclosures in U.S.
Patent No.
5,489,743 and U.S. Patent No. 5,602,307.
Without further description, it is believed that one of ordinary skill in the art can, using the preceding description and the following illustrative examples, make and utilize the compounds of the present invention and practice the claimed methods. The following working examples therefore, specifically point out preferred embodiments of the present invention, and are not to be construed as limiting in any way the remainder of the disclosure.
EXAMPLES
Identi~,cadon of Differentially Expressed Ischemic Heart mRNA
Heart tissue was obtained from five male patients with inotrope-dependent post-ischemic cardiomyopathy exhibiting severe myocyte and or cardiac hypertrophy with at least three years since their first myocardial infarction. Heart tissue was also obtained from 5 female patients with idiopathic dilated cardiomyopathy exhibiting severe myocyte and/or cardiac hypertrophy and CHF duration of at least 2 years.
Total cellular RNA was prepared from the heart tissue described above as well as from control, non-ischemic heart tissue using the procedure of Newburger et al. (1981) J. Biol. Chem. 266(24): 16171-7 and Newburger et al. (1988) Proc. Natl. Acad.
Sci. USA
85:5215-5219.
Synthesis of cDNA was performed as previously described by Prashar et al. in WO 97/05286 and in Prashar et al. (1996) Proc. Natl. Acad. Sci. USA 93:659-663.
Briefly, cDNA was synthesized according to the protocol described in the GIBCOBRL
kit for cDNA synthesis. The reaction mixture for first-strand synthesis included 6 pg of total RNA, and 200 ng of a mixture of 1-base anchored oligo(dT) primers with all three possible anchored bases (ACGTAATACGACTCACTATAGGGCGAATTGGGTCGACTTTTTTTTTTTTTTTTT
nl wherein nl=A/C or G) (SEQ ID No.3) along with other components for first-strand synthesis reaction except reverse transcriptase. This mixture was incubated at 65°C for Sm, chilled on ice and the process repeated. Alternatively, the reaction mixture may include l0pg of total RNA, and 2 pmol of 1 of the 2-base anchored oligo(dT) primers a heel such as RP5.0 {CTCTCAAGGATCTTACCGCTT,BAT) (SEQ ID No.4), or RP6.0 (TAATACCGCGCCACATAGCAT,BCG) (SEQ ID No.S), or RP9.2 {CAGGGTAGACGACGCTACGCT,BGA) (SEQ ID No.6) along with other components for first-strand synthesis reaction except reverse transcriptase. This mixture was then layered with mineral oil and incubated at 65 °C for 7 min followed by 50°C for another 7 min. At this stage, 2~c1 of Superscript reverse transcriptase (200 units/~cl;
GIBCOBRL) was added quickly and mixed, and the reaction continued for 1 hr at 45-50°C. Second-strand synthesis was performed at 16 °C for 2 hr. At the end of the reaction, the cDNAs were precipitated with ethanol and the yield of cDNA was calculated. In our experiments, 200 ng of cDNA was obtained from l0~cg of total RNA.
The adapter oligonucleotide sequences were A1 (TAGCGTCCGGCGCAGCGACGGCCAG) (SEQ ID No.7) and A2 (GATCCTGGCCGTCGGCTGTCTGTCGGCGC) (SEQ ID No.B). One microgram of oligonucleotide A2 was first phosphorylated at the 5' end using polynucleotide kinase (PNK). After phosphorylation, PNK was heated denatured, and 1/.cg of the oligonucleotide A1 was added along with lOX annealing buffer (1 M
NaCI/100 mM Tris-HCI, pH8.0/10 mM EDTA, pH8.0} in a final vol of 20 ~cl. This mixture was then heated at 65 °C for 10 min followed by slow cooling to room temperature for 30 min, resulting in formation of the Y adapter at a final concentration of 100 ngl~l.
About 20 ng of the cDNA was digested with 4 units of Bgl II in a final vol of l0,ul for 30 min at 37°C.
Two microliters (~4 ng of digested cDNA) of this reaction mixture was then used for ligation to 100 ng (~50-fold) of the Y-shaped adapter in a final vol of S,ul for 16 hr at 15 °C. After ligation, the reaction mixture was diluted with water to a final vol of 80 ~1 (adapter ligated cDNA concentration, ~ 50 pg/,ul) and heated at 65 °C
for 10 min to denature T4 DNA ligase, and 2-,ul aliquots (with ~ 100 pg of cDNA) were used for PCR.
The following sets of primers were used for PCR amplification of the adapter ligated 3' -end cDNAs:
TGAAGCCGAGACGTCGGTCG(T),$ nl, n2 (wherein nl, n2 = AA, AC, AG
AT CA CC CG CT GA GC GG and GT) (SEQ 117 No.9) as the 3' primer with A1 as the 5' primer or alternatively RP 5.0, RP 6.0, or RP 9.2 used as 3' primers with primer Ai.l serving as the S' primer. To detect the PCR products on the display gel, 24 pmol of oligonucleotide A1 or Al.l was 5' -end-labeled using 15 ~ul of [y 32 P]ATP
(Amersham;
3000 Ci/mmol) and PNK in a final volume of 20 ~1 for 30 min at 37°C.
After heat denaturing PNK at 65 °C for 20 min, the labeled oligonucleotide was diluted to a final concentration of 2 ~cM in 80 ~1 with unlabeled oligonucleotide Al .l. The PCR
mixture {201) consisted of 2 /.d (~ 100 pg) of the template, 2~c1 of lOx PCR buffer (100 mM
Tris~HCl, pH 8.3/500 mM KCl), 2 ~cl of 15 mM MgCl2 to yield 1.5 mM final Mgz+
concentration optimum in the reaction mixture, 200 ~cM dN'TPs, 200 nM each 5 ' and 3' PCR primers, and 1 unit of Amplitaq Gold. Primers and dNTPs were added after preheating the reaction mixture containing the rest of the components at 85 °C. This "hot start" PCR was done to avoid artefactual amplification arising out of arbitrary annealing of PCR primers at lower temperature during transition from room temperature to 94 °C in the first PCR cycle. PCR consisted of 5 cycles of 94°C for 30 sec, 55°C for 2 min, and 72°C
for 60 sec followed by 25 cycles of 94°C for 30 sec, 60°C for 2 min, and 72°C for 60 sec.
A higher number of cycles resulted in smeary gel patterns. PCR products (2.51) were analyzed on 6% polyacrylamide sequencing gel. For double ox multiple digestion following adapter Iigation, 13.2 ~cl of the ligated cDNA sample was digested with a secondary restriction enzymes) in a final vol of 20 ~cl. From this solution, 3~c1 was used as template for PCR. This template vol of 3 ,ul carried = 100 pg of the cDNA and 10 mM
MgClz (from the lOX enzyme buffer), which diluted to the optimum of 1.5 mM in the final PCR vol of 20 ~cl. Since Mg2+ comes from the restriction enzyme buffer, it was not included in the reaction mixture when amplifying secondarily cut cDNA.
Individual cDNA fragments corresponding to mRNA species were separated by denaturing polyacrylamide gel electrophoresis and visualized by autoradiography. Bands were extracted from the display gels as described by Liang et al. (1995 Curr. Opin.
Immunol.

7:274-280), reamplified using the 5' and 3' primers, and subcloned into pCR-Script with high efficiency using the PCR-Script cloning kit from Stratagene. Plasmids were sequenced by cycle sequencing on an ABI automated sequencer. Alternatively, bands were extracted (cored) from the display gels, PCR amplified and sequenced directly without subcloning.
Figure 1 presents a section of an autoradiogram of the expression profile generated from cDNAs made from RNA isolated from control and ischemic heart tissue.
Ci-25 is a band that corresponds to a cDNA derived from a mRNA species that is up-regulated in ischemic heart tissue in a female patient with idiopathic dilated cardiomyopathy exhibiting severe myocyte and/or cardiac hypertrophy and CHF
duration of at least 2 years. The band corresponding to Ci-25 was sequenced. The sequence of CI-25 is:
GGCTCACATCTGTAATCCCAGCACTTTGGGAGGCCAAGGTGGGCAGATTGCTG
GCCAACATGGTAAAACCCCATCTCTAAAGATATAAAAATTAGCTGGGCGTGGT
GGCGCATACCTGTAATCCCAGCTACTTGGGAGGCTAAGGCACAAGAATCACTT
AAACAGGAGGCGGGGGTTGCAGTGAGCTGAGATCACACCACTGCACTCCAGC

WO 99/49062 PGTlUS99/06662 CTGGGTGGCAGAGCAAAACTTTGTCCCCACCCCTGACAAAAAACAAACAAAC
AAACAAAACAAAAAAAAACCTGTCAATTCA (SEQ ID No.lO).
Cloning of a Full Length cDNA Corresponding to Ci-25 The full length cDNA corresponding to Ci-25 band was obtained by the oligo-pulling method. Briefly, a gene-specific oligo was designed based on cDNA
fragment Ci-25. The oligo was labeled with biotin and used to hybridize with 2 ug of single strand plasmid DNA (cDNA recombinants) from a human heart cDNA library following the procedures of Sambrook et al.. The hybridized cDNAs were separated by streptavidin-conjugated beads and eluted by heating. The eluted cDNA was converted to double strand plasmid DNA and used to transform E. toll cells (DH10B) and the longest cDNA was screened. After confirmed by PCR using gene-specific primers, the cDNA
clone was subjected to DNA sequencing.
The nucleotide sequence of the full-length cDNA corresponding to the differentially regulated Ci-25 band is set forth in SEQ ID No.l. The cDNA
comprises 5532 base pairs with an open reading frame encoding a protein predicted to contain 819 amino acids. The predicted amino acid sequence is presented in SEQ ID Nos. 1 and 2.
Comparison of the open reading to the sequences of known proteins and genes indicates that the gene may be distantly related to a known myosin light chain kinase gene as it exhibits 61% identity to a myosin light chain kinase at the nucleotide sequence level.
The tissue distribution of RNA encoding the differentially regulated gene encoding the protein of SEQ ID N0.2 was analyzed by Northern Blot as well as ,PCR
expression analysis of RNA isalated from various tissues. RNA was isolated from human heart, brain, placenta, lung, liver, skeletal muscle, kidney, leukocytes, testis and pancreas using standard procedures. Northern blots were prepared using a probe derived from SEQ ID
No.l with hybridization conditions as described by Sambrook et al. PCR
expression analysis was also performed using primers derived from SEQ ID No.l using AmpliTaq Gold PCR amplification kits (Perkin Elmer). Figure 3 is a Northern blot demonstrating the presence of specific RNA in heart and skeletal muscle. Figure 4 is a PCR
expression analysis demonstrating the presence of specific RNA in heart and testis.
Example 4 G_ enera_~tj.on ojf TT~~genic Mice Transgenic mice were generated using a gene corresponding to the cDNA sequence of SEQ >D No.l . Briefly, a cDNA fragment encoding the protein of SEQ >D No.2 was cloned into an alpha-MHC vector using standard techniques. The vector was then used to produce transgenic mice in accordance with standard techniques. Of the 22 resulting mice, six were confirmed by Southern blot to be transgene positive.
Although the present invention has been described in detail with reference to the examples above, it is understood that various modifications can be made without departing from the spirit of the invention. Accordingly, the invention is limited only by the following claims. All cited patents and publications referred to in this application are herein incorporated by reference in their entirety.

SEQUENCE LISTING
<110> Gene Logic, Inc., Larry Tiffany <120> Identification of a cDNA.Associated with Ischemia in Human Heart Disease, Yatindra PRASHAR, Inventor <130> genelogic5005heartdiseasegene <140> 09/
<141> 1999-03-26 <150> 60/079,377 <151> 1998-03-26 <160> 10 <170> PatentIn Ver. 2.0 <210> 1 <211> 5532 <212> DNA
<213> human gene expressed in ischemic heart disease <220>
<221> CDS
<222> (136)..(2592) <223> SEQ. ID. N0. 1 <400> 1 cgtggaggtt ggtgctgcca ggagtctgtc agctacggag gacaatgacc ttgcagacac 60 caccgcctga gtgagaacca ggggtctgtg cctctcctca ttccccgctc ttgcccttgt 120 caagcctgca ccagc atg tca gga acc tcc aag gag agt ctg ggg cat ggg 171 Met Ser Gly Thr Ser Lys Glu Ser Leu Gly His Gly ggg ctg cca ggg ttg ggc aag acc tgc tta aca acc atg gac aca aag 219 Gly Leu Pro Gly Leu Gly Lys Thr Cys Leu Thr Thr Met Asp Thr Lys ctg aac atg ctg aac gag aag gtg gac cag ctc ctg cac ttc caa gaa 267 Leu Asn Met Leu Asn Glu Lys Val Asp Gln Leu Leu His Phe Gln Glu gat gtc aca gag aag ttg cag agc atg tgc cga gac atg ggc cac ctg 315 Aep Val Thr Glu Lya Leu Gla 8er Met Cye Arg Aep Met Gly Hia Leu gag cgg ggc ctg cac agg ctg gag gcc tcc cgg gca ccg ggc ccg ggc 363 Glu Arg Gly Leu His Arg Leu Glu Ala Ser Arg Ala Pro Gly Pro Gly ggg get gat ggg gtt ccc cac att gac acc cag get ggg tgg ccc gag 911 Gly Ala Asp Gly Val Pro His Ile Asp Thr Gln Ala Gly Trp Pro Glu gtc ctg gag ctg gtg agg gcc atg cag cag gat gcg gcc cag cac ggt 459 Val Leu Glu Leu Val Arg Ala Met Gln Gln Asp Ala Ala Gln His Gly gcc agg ctg gag gcc ctc ttc agg atg gtg get gcg gtg gac agg gcc 507 Ala Arg Leu Glu Ala Leu Phe Arg Met Val Ala Ala Val Asp Arg Ala atc get ttg gtg ggg qcc acg ttc cag aaa tca aag gtg gcg gat ttc 555 Ile Ala Leu Val Gly Ala Thr Phe Gln Lys Ser Lys Val Ala Asp Phe ctc atg cag ggg cgt gtg ccc tgg agg aga ggc agc cca ggt gac agc 603 Leu Met Gln Gly Arg Val Pro Trp Arg Arg Gly Ser Pro Gly Asp Ser cct gag gag aat aaa gag cga gtg gaa gaa gag gga gga aaa cca aag 651 Pro Glu Glu Asn Lys Glu Arg Val Glu Glu Glu Gly Gly Lys Pro Lys cat gtg ctg agc acc agt ggg gtg cag tct gat gcc agg gag cct ggg 699 His Val Leu Ser Thr Ser Gly Val Gln Ser Asp Ala Arg Glu Pro Gly gaa gag agc cag aag gcg gac gtg ctg gag ggg aca gcg gag agg ctg 747 Glu Glu Ser Gln Lys Ala Asp Val Leu Glu Gly Thr Ala Glu Arg Leu ccc ccc atc aga gcg tca ggg ctg gga get gac ccc gcc cag gca gtg 795 Pro Pro Ile Arg Ala Ser Gly Leu Gly Ala Asp Pro Ala Gln Ala Val gtc tca ccg ggc cag gga gat ggt gtt cct ggc cca gcc cag gca ttc 893 Val Ser Pro Gly Gln Gly Asp Gly Val Pro Gly Pro Ala Gln Ala Phe cct ggc cac ctg ccc ctg ccc aca aag gtg gaa gcc aag get cct gag 891 Pro Gly His Leu Pro Leu Pro Thr Lys Val Glu Ala Lys Ala Pro Glu aca ccc agc gag aac ctc agg act ggc ctg gaa ttg get cca gca ccc 939 Thr Pro Ser Glu Asn Leu Arg Thr Gly Leu Glu Leu Ala Pro Ala Pro ggc agg gtc aat gtg gtc tcc ccg agc ctg gag gtt gca cca ggt gca 987 Gly Arg Val Asn Val Val Ser Pro Ser Leu Glu Val Ala Pro Gly Ala gga caa gga gca tcg tcc agc agg cct gac cct,gag ccc tta gag gaa 1035 Gly Gln Gly Ala Ser Ser Ser Arg Pro Asp Pro Glu Pro Leu Glu Glu 285 2.90 295 300 ggc acg agg ctg act cca ggg cct ggc cct cag tgc cca ggg cct cca 1083 Gly Thr Arg Leu Thr Pro Gly Pro Gly Pro Gln Cys Pro Gly Pro Pro ggg ctg cca gcc cag gcc agg gca acc cac agt ggt gga gaa aca cct 1131 Gly Leu Pro Ala Gln Ala Arg Ala Thr His Ser Gly Gly Glu Thr Pro cca agg atc tcc atc cac ata caa gag atg gat act cct ggg gag atg 1179 Pro Arg Ile Ser Ile His Ile Gln Glu Met Asp Thr Pro Gly Glu Met ctg atg aca ggc agg ggc agc ctt gga ccc acc ctc acc aca gag get 1227 Leu Met Thr Gly Arg Gly 5er Leu Gly Pro Thr Leu Thr Thr Glu Ala cca gca get gcc cag cca ggc aag cag ggc cca cct ggg acc ggg cgc 1275 Pro Ala Ala Ala Gln Pro Gly Lys Gln Gly Pro Pro Gly Thr Gly Arg tgc ctc caa gcc cct ggg act gag ccc gga gaa cag acc cct gaa gga 1323 Cys Leu Gln Ala Pro Gly Thr Glu Pro Gly Glu Gln Thr Pro Glu Gly gcc aga gag ctc tcc ccg ctg cag gag agc agc agc ccc ggg gga gtg 1371 Ala Arg Glu Leu Ser Pro Leu Gln Glu Ser Ser Ser Pro Gly Gly Val aag gca gag gag gag caa agg get ggg gcc gag cct ggc acg aga cca 1919 Lys Ala Glu Glu Glu Gln Arg Ala Gly Ala Glu Pro Gly Thr Arg Pro agc ttg gcc agg agt gac gac aat gac cac gag gtt ggg gcc ctg ggc 1467 Ser Leu Ala Arg Ser Asp Asp Asn Asp His Glu Val Gly Ala Leu Gly ctg cag cag ggc aaa agc cca ggg gcg gga aac cct gag cct gag cag 1515 Leu Gln Gln Gly Lys Ser Pro Gly Ala Gly Asn Pro Glu Pro Glu Gln gac tgt gca gcc agg get ccg gtg aga get gaa gca gta agg agg atg 1563 Asp Cys Ala Ala Arg Ala Pro Val Arg Ala Glu Ala Val Arg Arg Met ccc cca ggc gcc gag get ggc agc gtg gtt ctg gat gac agt ccg gcc 1611 Pro Pro Gly Ala Glu Ala Gly Ser Val Val Leu Asp Asp Ser Pro Ala cca cca get cct ttt gaa cac cgg gta gtg agc gtc aag gag acc tcc 1659 Pro Pro Ala Pro Phe Glu His Arg Val Val Ser Val Lys Glu Thr Ser atc tct gcg ggt tac gag gtg tgc cag cac gaa gtc ttg gga ggg ggt 170%
Ile Ser Ala Gly Tyr Glu Val Cys Gln His Glu Val Leu Gly Gly Gly cgg ttt ggc cag gtc cac agg tgc aca gag aag tcc aca ggc ctc cca 1755 Arg Phe Gly Gln Val His Arg Cys Thr Glu Lys Ser Thr Gly Leu Pro ctg get gcc aag atc atc aaa gtg aag agc gcc aag gac cgg gag gac 1803 Leu Ala Ala Lys Ile Ile Lys Val Lys Ser Ala Lys Asp Arg Glu Asp gtg aag aac gag atc aac atc atg aac cag ctc agc cac gtg aac ctg 1851 Val Lys Asn Glu Ile Asn Ile Met Asn Gln Leu Ser His Val Asn Leu atc cag ctc tat gac gcc ttc gag agc aag cac agc tgc acc ctt gtc 1899 Ile Gln Leu Tyr Asp Ala Phe Glu Ser Lys His Ser Cys Thr Leu Val atg gag tac gtg gac ggg ggt gag ctc ttc gac cgg atc aca gat gag 1997 Met G1u Tyr Val Asp Gly Gly Glu Leu Phe Asp Arg Ile Thr Asp Glu aag tac cac ctg act gag ctg gat gtg gtc ctg ttc acc agg cag atc 1995 Lys Tyr His Leu Thr Glu Leu Asp Val Val Leu Phe Thr Arg Gln Ile tgt gag ggt gtg cat tac ctg cac cag cac tac atc ctg cac ctg gac 2043 Cys Glu Gly Val His Tyr Leu His Gln His Tyr Ile Leu His Leu Asp ctc aag ccg gag aac ata ttg tgc gtc aat cag aca gga cat caa att 2091 Leu Lys Pro Glu Asn Ile Leu Cys Val Asn Gln Thr Gly His Gln Ile aag atc att gac ttt ggg ctg gcc aga agg tac aag cct cga gag aag 2139 Lys Ile Ile Asp Phe Gly Leu Ala Arg Arg Tyr Lys Pro Arg Glu Lys ctg aag gtg aac ttc ggc act cct gag ttc ctg gcc cca gaa gtc gtc 2187 Leu Lys Val Asn Phe Gly Thr Pro Glu Phe Leu Ala Pro Glu Val Val aat tat gag ttt gtc tca ttc ccc aca gac atg tgg agt gtg gga gtc 2235 Asn Tyr Glu Phe Val Ser Phe Pro Thr Asp Met Trp Ser Val Gly Va=

atc acc tac atg cta ctc agt ggc ttg tcc cca ttt cta ggg gaa aca 2283 Ile Thr Tyr Met Leu Leu Ser Gly Leu Ser Pro Phe Leu Gly Glu Ti:r 705 710 ~ 715 gat gca gag acc.atg aat ttc att gta aac tgt agc tgg gat ttt gay 2331 Asp Ala Glu Thr Met Asn Phe Ile Val Asn Cys Ser Trp Asp Phe Asp get gac acc ttt gaa ggg ctc tcg gag gag gcc aag gac ttt gtt tcc 2379 Ala Asp Thr Phe Glu Gly Leu Ser Glu Glu Ala Lys Asp Phe Val Ser cgg ttg ctg gtc aaa gag aag agc tgc aga atg agt gcc aca cag tgc 2427 Arg Leu Leu Val Lys Glu Lys Ser Cys Arg Met Ser Ala Thr Gln Cys ctg aaa cac gag tgg ctg aat aat ttg cct gcc aaa get tca aga tcc 2975 Leu Lys His Glu Trp Leu Asn Asn Leu Pro Ala Lys Ala Ser Arg Ser aaa act cgt ctc aaa tcc caa cta ctg ctg cag aaa tac ata get caa 2523 Lys Thr Arg Leu Lys Ser Gln Leu Leu Leu Gln Lys Tyr Ile Ala Gln aga aaa tgg aag aaa cat ttc tat gtg gtg act get gcc aac agg tt~ 2571 Arg Lys Trp Lys Lys His Phe Tyr Val Val Thr Ala Ala Asn Arg Lei agg aaa ttt cca act tct ccc taatcttcaa ctctgctgct ccaatgggtc 2622 Arg Lys Phe Pro Thr Ser Pro cagaaattac tgaggccagt ggtgaagtga agagatgact caaacattta aataatttgg 2682 ctttttggta ttattgattc cacttatttt gtaaaaatgg ttatggctgc tgccttcctt 2792 gtggatgaaa agtggctgta aagaagcttc ctaagaacgt ttttttctgc cttgtaagat 2802 cactacgtgt gaaatgctct gagtaccttt caaatatacc tacttttggt ggtaagtgta 2862 gggatgcttt aggtaggtac tttgcatctg tcgaatttaa attctaaact cacactgatt 2922 aaggaactca gtagactact ttgcaggggc catgttattc agtgttatct cctccagtac 2982 aaagaattcc tagaattttg atttgctcag gtgtgagctg acattttatt gtactacccc 3042 attcttgtgt taagccatgt ggatttagga cagtgatctt caaacttgct ttaacttatg 3102 ctcccttttg agaatcagca tcacttgaaa tgtcaaaata tgtcaactct catagccaaa 3162 tcagagaagt gatcattttg actgtgcttt ttaaatctcc acacacctcc acctctctcc 3222 taattctgcc tgtcttaacc cctctgtctt agttataaat ttctggtctt gtaagtctgg 3282 aagctgatag gcaatttatg aaagagataa gaatgtaatg aggttcagct ttctgagaaa 3392 cacagaaatg atacatcctg agacataaag gaaagctgct cttctgctgc ctcaggctgt 3902 agcactctca atgttgtcac tctacacata cactttctat atacatgtac agttgaccct 3462 tgaacagggt ttgaattgca gtcaacttaa atgtggattt tctttcacct ttgtcacccc 3522 tgagacagca acaccatgct ctcctcttca tcccactctg cagcctactc aacaggaaga 3582 tgatgaagat gaacaccttt atgatgatac actttcactt aatgaatagt aaacatatgt 3692 tttcctcctt atgattttag taacttttct ctagcttact ttattgtaag aatacagcta 3702 atttttgtat ttttagtgga gatagggttt tgccatgttg cccaacctgg tcttgagctc 3762 aagcgatcca cctgccccag cctcccaaag tgctgggatt ataggtgtga gccaccacac 3822 ccagcttcaa ctaacacatt tacgaacttg tatacatgta tatttagata ctttaccaac 3882 ttgtaaaatg gttaaaggag tactttatta tgaaaaaata tacaatcttt aaaatttcct 3942 tacttctaca tgatttttgt gctattccca tttttttcct caggtgagca gctttagtca 4002 atgttgtgaa ttttagattt taattagaca tgcaacagtt tcactacctt tcaggatttt 9062 tgtcctgtaa cagaggctct tgctttttga cagagaggta ggcaggtgga gaggttatcc 4122 tgctgctgca gttctcaagt tgttaagttt cctctggaag gctaaccctt gttgggaact 9182 aacagtttca ataccagcaa gtctaggcct gctccaagtt ggtcagctga agaatgaaca 9242 tcagaagaca cagctgctga aagttgtcct ttgatgagac agtgatagtg atttggtaaa 9302 atgtcttatt ttttaaatgt cagttatctt tctttaaaag gttttttgag ggcagcctcc 4362 agaaggagct agagagtata ttttatagtt ctattgtggt tcataccctg ttttcgactt 9422 aagattctgg agaatgctat gaaacatctc cccagaaaaa gacagttaat taccatatct 9482 agagcagcac tgcccaacaa aaatatagta caggctatac acataattaa aacatttcta 9542 gtagcttctc taacaaaacc cattgaaagt caattttaat aatttatata acttagtgta 9602 tcaaaaatat ttcaatatgt aatcaacata aaattgagat actttaccag ctactaggga 4662 ggctgaggca caagaatcac ttaaacagga ggcaggggtt gcagtgagct gagatcacac 9722 cactgcactc cagcctgggt ggcagagcaa aactttgtcc ccacccctga caaaaaacaa 9782 acaaacaaac aaaacaaaaa aaaacctgtc aattcagatg ctaggttttc atcagacgta 4842 cttaatctgt atttagattt cttaaaactt actgtggaaa atgtatttac atactcaagt 4902 tgtttgaaac ataactcact gttttccaat aactgaagta tccactttta catgtattaa 9962 aattaaataa aattagaaat tcagttctgc agttgcacta gccacatttt aagtgtttaa 5022 tagccacacg tggttagtgg catctatatt ggacagggca gatctagaga gaatcctgta 5082 tctaacaatt ttaatttttt tccctttatg ctgttattcc ttacctagag aaacaatttc 5142 cctccaaagt tcctttgagg ggtctgttta ggccaggcca acacaagtga cctatgtgga 5202 ttttagcatc ctttttttga aatttgaggt tttatgaagc ttgagttttt ctggatattt 5262 ttagtaattt gctggtgtgt acttagctca gatacttgat tgcaactgtg ttgggtcaac 5322 tatttctaat gggacttttc catttgcatg tacagtcact ggaaactgct gggcagagaa 5382 actctaaaag gtagttgggg cacacttttt ccacctgtca gattggtgaa gaattggtga 5442 WO 99149062 PCTNS99/Obbb2 ggctgtgggg aaaatggcat tctcccactt ttgatggata tgtatccaaa taaaagtcat 5502 tcccatgaaa aaaaaaaaaa aaaaaaaaaa 5532 <210> 2 <211> B19 <212> PRT
<213> human gene expressed in ischemic heart disease <400> 2 Met Ser Gly Thr Ser Lys Glu Ser Leu Gly His Gly Gly Leu Pro Gly Leu Gly Lys Thr Cys Leu Thr Thr Met Asp Thr Lys Leu Asn Met Leu Asn Glu Lys Val Asp Gln Leu Leu His Phe Gln Glu Asp Val Thr Glu Lys Leu Gln Ser Met Cys Arg Asp Met Gly His Leu Glu Arg Gly Leu His Arg Leu Glu Ala Ser Arg Ala Pro Gly Pro Gly Gly Ala Asp Gly Val Pro His Ile Asp Thr Gln Ala Gly Trp Pro Glu Val Leu Glu Leu g5 90 95 Val Arg Ala Met Gln Gln Asp Ala Ala Gln His Gly Ala Arg Leu Glu Ala Leu Phe Arg Met Val Ala Ala Val Asp Arg Ala Ile Ala Leu Va1 Gly Ala Thr Phe Gln Lys Ser Lys Val Ala Asp Phe Leu Met Gln Gly Arg Val Pro Trp Arg Arg Gly Ser Pro Gly Asp Ser Pro Glu Glu Asn Lys Glu Arg Val Glu Glu Glu Gly Gly Lys Pro Lys His Val Leu Ser Thr Ser Gly Val Gln Ser Asp Ala Arg Glu Pro Gly Glu Glu Ser Gln Lys Ala Asp Val Leu Glu Gly Thr Ala Glu Arg Leu Pro Pro Ile Arg Ala Ser Gly Leu Gly Ala Asp Pro Ala Gln Ala Val Val Ser Pro Gly Gln Gly Asp Gly Val Pro Gly Pro Ala Gln Ala Phe Pro Gly His Leu Pro Leu Pro Thr Lys Val Glu Ala Lys Ala Pro Glu Thr Pro Ser Glu Asn Leu Arg Thr Gly Leu Glu Leu Ala Pro Ala Pro Gly Arg Val Asn Val Val Ser Pro Ser Leu Glu Val Ala Pro Gly Ala Gly Gln Gly Ala Ser Ser Ser Arg Pro Asp Pro Glu Pro Leu Glu Glu Gly Thr Arg Leu Thr Pro Gly Pro Gly Pro Gln Cys Pro Gly Pro Pro Gly Leu Pro Ala Gln Ala Arg Ala Thr His Ser Gly Gly Glu Thr Pro Pro Arg Ile Ser Ile His Ile Gln Glu Met Asp Thr Pro Gly Glu Met Leu Met Thr Gly Arg Gly Ser Leu Gly Pro Thr Leu Thr Thr Glu Ala Pro Ala Ala Ala Gln Pro Gly Lys Gln Gly Pro Pro Gly Thr Gly Arg Cys Leu Gln Ala Pro Gly Thr Glu Pro Gly Glu Gln Thr Pro Glu Gly Ala Arg Glu Leu Ser Pro Leu Gln Glu Ser Ser Ser Pro Gly Gly Val Lys Ala Glu Glu Glu Gln Arg Ala Gly Ala Glu Pro Gly Thr Arg Pro Ser Leu Ala Arg Ser Asp Asp Asn Asp His Glu Val Gly Ala Leu Gly Leu Gln Gln Gly Lys Ser Pro Gly Ala Gly Asn Pro Glu Pro Glu Gln Asp Cys Ala Ala Arg Ala Pro Val Arg Ala Glu Ala Val Arg Arg Met Pro Pro Gly Ala Glu Ala Gly Ser Val Val Leu Asp Asp Ser Pro Ala Pro Pro Ala Pro Phe Glu His Arg Val Val Ser Val Lys Glu Thr Ser Ile Ser Ala Gly Tyr Glu Val Cys Gln His Glu Val Leu Gly Gly Gly Arg Phe Gly Gln Val His Arg Cys Thr Glu Lys Ser Thr Gly Leu Pro Leu Ala Ala Lys Ile Ile Lys Val Lys Ser Ala Lys Asp Arg Glu Asp Val Lys Asn Glu Ile Asn Ile Met Asn Gln Leu Ser His Val Asn Leu Ile Gln Leu Tyr Asp Ala Phe Glu Ser Lys His 5er Cys Thr Leu Val Met Glu Tyr Val Asp Gly Gly Glu Leu Phe Asp Arg Ile Thr Asp Glu Lys Tyr His Leu Thr Glu Leu Asp Val Val Leu Phe Thr Arg Gln Ile Cys Glu Gly Val His Tyr Leu His Gln His Tyr Ile Leu His Leu Asp Leu Lys Pro Glu Asn Ile Leu Cys Val Asn Gln Thr Gly His Gln Ile Lys Ile Ile Asp Phe Gly Leu Ala Arg Arg Tyr Lys Pro Arg Glu Lys Leu Lys Val Asn Phe Gly Thr Pro Glu Phe Leu Ala Pro Glu Val Val Asn Tyr Glu Phe Val Ser Phe Pro Thr Asp Met Trp Ser Val Gly Val Ile Thr Tyr Met Leu Leu Ser Gly Leu Ser Pro Phe Leu Gly Glu Thr Asp Ala Glu Thr Met Asn Phe Ile Val Asn Cys Ser Trp Asp Phe Asp Ala Asp Thr Phe Glu Gly Leu Ser Glu Glu Ala Lys Asp Phe Val Ser Arg Leu. Leu Val Lys Glu Lys Ser Cys Arg Met Ser Ala Thr Gln Cys Leu Lys, His Glu Trp Leu Asn Asn Leu Pro Ala Lys Ala Ser Arg Ser Lys Thr Arg Leu Lys Ser Gln Leu Leu Leu Gln Lys Tyr Ile Ala Gln Arg Lys Trp Lys Lys His Phe Tyr Val Val Thr Ala Ala Asn Arg Leu Arg Lys Phe Pro Thr Ser Pro <210> 3 <211> 55 <212> DNA
<213> oligo(dT) primer, 1-base anchored <400> 3 acgtaatacg actcactata gggcgaattg ggtcgacttt tttttttttt ttttv 55 <210> 4 <211> 40 <212> DNA
<213> oligo(dT) primer, 2-base anchored <400> 4 ctctcaagga tcttaccgct tttttttttt ttttttttat 40 <210> 5 <211> 40 <212> DNA
<213> oligo(dT) primer, 2-base anchored <400> 5 taataccgcg ccacatagca tttttttttt ttttttttcg 90 <210> 6 <211> 40 <212> DNA
<213> oligo(dT) primer, 2-base anchored <900> 6 cagggtagac gacgctacgc tttttttttt ttttttttga 90 <210> 7 <211> 25 <212> DNA
<213> adapter oligonucleotide sequence <900> 7 tagcgtccgg cgcagcgacg gccag 25 <210> 8 <211> 29 <212> DNA
<213> adapter oligonucleotide sequence <900> 8 gatcctggcc gtcggctgtc tgtcggcgc 29 <210> 9 <211> 40 <212> DNA
<213> pcr primer, adapter-ligated 3' end <400> 9 tgaagccgag acgtcggtcg tttttttttt ttttttttvn 90 <210> 10 <211> 293 <212> DNA
<213> sequence of Ci-25 band <400> 10 ggctcacatc tgtaatccca gcactttggg aggccaaggt gggcagattg ctggccaaca 60 tggtaaaacc ccatctctaa agatataaaa attagctggg cgtggtggcg catacctgta 120 atcccagcta cttgggaggc taaggcacaa gaatcactta aacaggaggc gggggttgca 180 gtgagctgag atcacaccac tgcactccag cctgggtggc agagcaaaac tttgtcccca 290 cccctgacaa aaaacaaaca aacaaacaaa acaaaaaaaa acctgtcaat tca 293

Claims (22)

WHAT IS CLAIMED:

1. An isolated nucleic acid molecule selected from the group consisting of an isolated nucleic acid molecule that encodes the amino acid sequence of SEQ ID
No.2, an isolated nucleic acid molecule that encodes a fragment of at last 10 amino acids of SEQ ID
No.2, an isolated nucleic acid molecule which hybridizes to a nucleic acid molecule comprising SEQ 117 No.1 under conditions of sufficient stringency to produce a clear signal and an isolated nucleic acid molecule which hybridizes to a nucleic acid molecule that encodes the amino acid sequence of SEQ ID No. 2 under conditions of sufficient stringency to produce a clear signal.

2. The isolated nucleic acid molecule of claim 1, wherein the nucleic acid molecule comprises the sequence of SEQ ID No.1.

3. The isolated nucleic acid molecule of claim 2, wherein the nucleic acid molecule consists of the sequence of SEQ ID No.1.

4. The isolated nucleic acid molecule of claim 1, wherein the nucleic acid molecule comprises nucleotides 136 M 2592 of SEQ ID No.1.

5. The isolated nucleic acid molecule of claim 2, wherein the nucleic acid molecule consists of nucleotides 136 to 2592 of SEQ ID No.1.

6. The isolated nucleic acid molecule of any one of claims 1-5, wherein said nucleic acid molecule is operably linked to one or more expression control elements.

7. A vector comprising an isolated nucleic acid molecule of any one of claims 1-5.

8. A host cell transformed to contain the nucleic acid molecule of any one claims 1-5.

9. A host cell comprising a vector of claim 7.

10. A host cell of claim 9, wherein said host is selected from the group consisting of prokaryotic hosts and eukaryotic hosts.

11. A method for producing a protein comprising the step of culturing a host cell transformed with the nucleic acid molecule of any one of claims 1-5 under conditions in which the protein is expressed.

12. The method of claim 11, wherein said host cell is selected from the group consisting of prokaryotic hosts and eukaryotic hosts.

13. An isolated polypeptide produced by the method of claim 11.

14. An isolated polypeptide selected from the group consisting of an isolated polypeptide comprising the amino acid sequence of SEQ ID No.2, an isolated polypeptide comprising a fragment of at least 10 amino acids of SEQ ID No.2, an isolated polypeptide comprising conservative amino acid substitutions of SEQ ID No.2 and naturally occurring amino acid sequence variants of SEQ ID No.2.

15. An isolated antibody that binds to a polypeptide of either claim 13 or 14.

16. The antibody of claim 14 wherein said antibody is a monoclonal or polyclonal antibody.

17. A method of identifying an agent which modulates the expression of a nucleic acid encoding the protein having the sequence of SEQ ID No.2 comprising the steps of exposing cells which express the nucleic acid to the agent; and determining whether the agent modulates expression of said nucleic acid, thereby identifying an agent which modulates the expression of a nucleic acid encoding the protein having the sequence of SEQ ID No.2.

18. A method of identifying an agent which modulates at least one activity of a protein comprising the sequence of SEQ ID No.2 comprising the steps of:

exposing cells which express the protein to the agent;
determining whether the agent modulates at least on activity of said protein, thereby identifying an agent which modulates at least one activity of a protein comprising the sequence of SEQ ID No.2.

19. The method of claim 19, wherein the agent modulates the ability of the protein to phosphorylate a substrate.

20. A method of identifying binding partners for a protein comprising the sequence of SEQ ID No. 2, comprising the steps of:
exposing said protein to a potential binding partner; and determining if the potential binding partner binds to said protein, thereby identifying binding partners for a protein comprising the sequence of SEQ ID
No. 2.

21. A method of modulating the expression of a nucleic acid encoding the protein having the sequence of SEQ ID No.2 comprising the step of:
administering an effective amount of an agent which modulates the expression of a nucleic acid encoding the protein having the sequence of SEQ ID No.2.

22. A method of modulating at least one activity of a protein comprising the sequence of SEQ ID No.2 comprising the step of:
administering an effective amount of an agent which modulates at least one activity of a protein comprising the sequence of SEQ ID No.2.