IDENTIFICATION OF cDNAs ASSOCIATED WITH BENIGN PROSTATIC
HYPERPLASIA
INVENTORS: William E. Munger, Prakash Kulkarni and Robert R. Getzenberg
RELATED APPLICATION
This application is related to U.S. Provisional Application 60/223,511, all of which is herein incorporated by reference in its entirety.
FIELD OF THE INVENTION
The invention relates generally to the changes in gene expression in prostate tissue removed from male patients with benign prostatic hyperplasia (BPH). The invention specifically relates to a novel human gene which is differentially expressed in BPH tissue compared to normal prostate tissue.
BACKGROUND OF THE INVENTION
BPH is the most common benign tumor in men over the age of 60. It is estimated that one in four men living to the age of 80 will require treatment for this disease. BPH is usually noted clinically after the age of 50, the incidence increasing with age, but as many as two thirds of men between the ages of 40 and 49 demonstrate histological evidence of the disease.
The anatomic location of the prostate at the bladder neck enveloping the urethra plays an important role in the pathology of BPH, including bladder outlet obstruction. Two prostate components are thought to play a role in bladder outlet obstruction. The first is the relative increased prostate tissue mass. The second component is the prostatic smooth muscle tone.
The causative factors of BPH in man has been intensively studied (See Ziada et al, (1999) Urology 53:1-6). In general, the two most important factors appear to be aging and the presence of functional testes. Although these factors appear to be key to the development of BPH, both appear to be nonspecific.
Little is known about the molecular changes in prostate cells associated with the development and progression of BPH. It has been demonstrated that the expression levels of a number of individual genes are changed compared to normal prostate cells.
These changes in gene expression include a decreased level of Wilm's tumor gene (WT- 1) and increased expression of insulin growth factor II (IGF-II) (Dong et al, (1997) J. Clin. Endocrin. Metab. 82:2198-2203).
While the changes in the expression levels of a number of individual genes have been identified, the investigation of the global changes in gene expression has not been reported. Accordingly, there exists a need for the investigation of the changes in global gene expression levels as well as the need for the identification of new molecular markers associated with the development and progression of BPH. Furthermore, if intervention is expected to be successful in halting or slowing down BPH, means of accurately assessing the early manifestations of BPH need to be established. One way to accurately assess the early manifestations of BPH is to identify markers which are uniquely associated with disease progression. Likewise, the development of therapeutics to prevent or stop the progression of BPH relies on the identification of genes responsible for BPH growth and function.
SUMMARY OF THE INVENTION
The present invention is based on the discovery of a new gene family that is differentially expressed in BPH tissue compared to normal prostate tissue. The invention includes isolated nucleic acid molecules selected from the group consisting of an isolated nucleic acid molecule that encodes the amino acid sequence of SEQ ED NO: 2, an isolated nucleic acid molecule that encodes a fragment of at least 6 amino acids of SEQ ID NO: 2, an isolated nucleic acid molecule which hybridizes to the complement of a nucleic acid molecule comprising SEQ ID NO: 1 and an isolated nucleic acid molecule which hybridizes to the complement of a nucleic acid molecule that encodes the amino acid sequence of SEQ ID NO: 2. Nucleic acid molecules of the invention may have 50%-60% nucleotide sequence identity to SEQ ID NO: 1, preferably about 70-75% sequence identity, more preferably about 80-85% sequence identity, and even more preferably at least about 90% sequence identity to SEQ ID NO: 1. The present invention further includes the nucleic acid molecules operably linked to one or more expression control elements, including vectors comprising the isolated nucleic acid molecules. The invention further includes host cells transformed
to contain the nucleic acid molecules of the invention. Also provided are methods for producing a protein comprising the step of culturing a host cell transformed with a nucleic acid molecule of the invention under conditions in which the protein is expressed. The invention further provides an isolated polypeptide selected from the group consisting of an isolated polypeptide comprising the amino acid sequence of SEQ ID NO: 2, an isolated polypeptide comprising a fragment of at least 10 amino acids of SEQ ID NO: 2, an isolated polypeptide comprising conservative amino acid substitutions of SEQ ID NO: 2 and an isolated polypeptide comprising naturally occurring amino acid sequence variants of SEQ ID NO: 2. Polypeptides of the invention also include polypeptides with an amino acid sequence having at least about 50%), 60%, 70%) or 75% amino acid sequence identity with the sequence set forth in SEQ ID NO: 2, more preferably at least about 80%>, even more preferably at least about 90%), and most preferably at least about 95% sequence identity with the sequence set forth in SEQ ID NO: 2.
The invention further provides an isolated antibody that specifically binds to a polypeptide of the invention, including monoclonal and polyclonal antibodies. The invention further provides methods of identifying an agent which modulates the expression of a nucleic acid encoding a protein of the invention, comprising the steps of: exposing cells which express the nucleic acid to the agent; and determining whether the agent modulates expression of said nucleic acid, thereby identifying an agent which modulates the expression of a nucleic acid encoding the protein.
The invention further provides methods of identifying an agent which modulates at least one activity of a protein of the invention, comprising the steps of: exposing cells which express the protein to the agent; and determining whether the agent modulates at least one activity of said protein, thereby identifying an agent which modulates at least one activity of the protein.
The invention further provides methods of identifying binding partners for a protein of the invention, comprising the steps of: exposing said protein to a potential binding partner and determining if the potential binding partner binds to said protein, thereby identifying binding partners for the protein.
The present invention further provides methods of modulating the expression of a nucleic acid encoding a protein of the invention, comprising the step of: administering an effective amount of an agent which modulates the expression of a nucleic acid encoding the protein of the invention. The invention also provides methods of modulating at least one activity of a protein of the invention, comprising the step of: administering an effective amount of an agent which modulates at least one activity of the protein of the invention.
The present invention further includes non-human transgenic animals modified to contain the nucleic acid molecules of the invention or mutated nucleic acid molecules such that expression of the encoded polypeptides of the invention is prevented.
The invention further provides methods of diagnosing BPH or other disease states, comprising the steps of: acquiring a tissue, blood, urine or other sample from a subject; and determining the level of expression of a nucleic acid molecule of the invention or polypeptide of the invention.
BRIEF DESCRIPTION OF THE DRAWINGS
Figure 1 Figure 1 shows the expression of JT43780 across a panel of prostate tissue samples from normal subjects, subjects diagnosed with BPH that are not symptomatic, subjects diagnosed with BPH that also have cancer, and subjects diagnosed with BPH that are symptomatic.
Figure 2 Figure 2 shows a Northern blot, in which the expression level of
JT43780 was measured across a panel of normal tissues (ClonTech human mRNA blot) using the READS probe for detection and the Church-Gilbert hybridization buffer. The samples in each lane are as follows: M) RNA marker; 1) heart; 2) brain; 3) placenta; 4) lung; 5) liver; 6) skeletal muscle; 7) kidney; 8) pancreas
Figure 3 Figure 3 shows the results of semi-quantitative PCR for the expression of JT43780 in various tissues. The samples in each lane are as follows: M) DNA Marker; 1) brain; 2) heart; 3) skeletal muscle; 4) kidney; 5) leukocytes; 6) liver; 7) lung; 8) spleen; 9) testis; 10) prostate; N) negative control. The samples in the left
panel were amplified by 25 cycles (O); the samples in the right panels by 30 cycles ( ).
Figure 4 Figure 4 is a hydrophobicity/hydrophilicity plot of the protein encoded by the open reading frame of JT43780 (SEQ ID NO: 2). Analysis was done using the methods of Goldman et al. and of Kyte-Doolittle.
DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENT I. General Description The present invention is based in part on the identification of a new gene family that is differentially expressed in human BPH tissue compared to normal human prostate tissue. This gene family corresponds to the human cDNA of SEQ ID NO: 1. Genes that encode the human protein of SEQ ID NO: 2 may also be found in other animal species, particularly mammalian species. The protein and nucleic acids of the invention may be used as diagnostic agents to detect BPH. The protein of the present invention can also serve as a target for agents that can be used to modulate the expression or activity of the protein. For example, agents may be identified that modulate biological processes associated with prostate growth, including the hyperplastic process of BPH. The present invention is further based on the development of methods for isolating binding partners that bind to the protein. Probes based on the protein are used as capture probes to isolate potential binding partners, such as other proteins. Dominant negative proteins, DNAs encoding these proteins, antibodies to these proteins, peptide fragments of these proteins or mimics of these proteins may be introduced into cells to affect function. Additionally, the protein provides novel targets for the screening of synthetic small molecules and combinatorial or naturally occurring compound libraries to discover novel therapeutics to regulate prostate function.
II. Specific Embodiments
A. The Proteins Associated with BPH
The present invention provides isolated proteins, allelic variants of the
proteins, and conservative amino acid substitutions of the proteins. As used herein, the "protein" or "polypeptide" refers, in part, to a protein that has the human amino acid sequence depicted in SEQ ID NO: 2. The terms also refer to naturally occurring allelic variants and proteins that have a slightly different amino acid sequence than that specifically recited above. Allelic variants, though possessing a slightly different amino acid sequence than those recited above, will still have the same or similar biological functions associated with these proteins.
As used herein, the family of proteins related to the human amino acid sequence of SEQ ID NO: 2 refers to proteins that have been isolated from organisms in addition to humans. The methods used to identify and isolate other members of the family of proteins related to these proteins are described below.
The proteins of the present invention are preferably in isolated form. As used herein, a protein is said to be isolated when physical, mechanical or chemical methods are employed to remove the protein from cellular constituents that are normally associated with the protein. A skilled artisan can readily employ standard purification methods to obtain an isolated protein.
The proteins of the present invention further include insertion, deletion or conservative amino acid substitution variants of SEQ ID NO: 2. As used herein, a conservative variant refers to alterations in the amino acid sequence that do not adversely affect the biological functions of the protein. A substitution, insertion or deletion is said to adversely affect the protein when the altered sequence prevents or disrupts a biological function associated with the protein. For example, the overall charge, structure or hydrophobic/hydropbilic properties of the protein can be altered without adversely affecting a biological activity. Accordingly, the amino acid sequence can be altered, for example to render the peptide more hydrophobic or hydrophilic, without adversely affecting the biological activities of the protein.
Ordinarily, the allelic variants, the conservative substitution variants, and the members of the protein family, will have an amino acid sequence having at least about 50%), 60%, 70% or 75% amino acid sequence identity with the sequence set forth in SEQ ID NO: 2, more preferably at least about 80%, even more preferably at least about 90%, and most preferably at least about 95% sequence identity. Identity or homology with respect to such sequences is defined herein as the percentage of amino
acid residues in the candidate sequence that are identical with the known peptides, after aligning the sequences and introducing gaps, if necessary, to achieve the maximum percent homology, and not considering any conservative substitutions as part of the sequence identity (see section B for the relevant parameters). Fusion proteins, or N-terminal, C-terminal or internal extensions, deletions, or insertions into the peptide sequence shall not be construed as affecting homology.
Thus, the proteins of the present invention include molecules having the amino acid sequence disclosed in SEQ ID NO: 2; fragments thereof having a consecutive sequence of at least about 3, 4, 5, 6, 10, 15, 20, 25, 30, 35 or more amino acid residues of these proteins; amino acid sequence variants wherein one or more amino acid residues has been inserted N- or C-terminal to, or within, the disclosed coding sequence; and amino acid sequence variants of the disclosed sequence, or their fragments as defined above, that have been substituted by another residue. Such fragments, also referred to as peptides or polypeptides, may contain antigenic regions, functional regions of the protein identified as regions of the amino acid sequence which correspond to known protein domains, as well as regions of pronounced hydrophilicity. The regions are all easily identifiable by using commonly available protein sequence analysis software such as Mac Vector (Oxford Molecular). Contemplated variants further include those containing predetermined mutations by, e.g., homologous recombination, site-directed or PCR mutagenesis, and the corresponding proteins of other animal species, including but not limited to rabbit, mouse, rat, porcine, bovine, ovine, equine and non-human primate species, and the alleles or other naturally occurring variants of the family of proteins; and derivatives wherein the protein has been covalently modified by substitution, chemical, enzymatic, or other appropriate means with a moiety other than a naturally occurring amino acid (for example a detectable moiety such as an enzyme or radioisotope). As described below, members of the family of proteins can be used: (1) to identify agents which modulate at least one activity of the protein; (2) to identify binding partners for the protein, (3) as an antigen to raise polyclonal or monoclonal antibodies, and (4) as a therapeutic agent or target, and (5) as a diagnostic agent.
B. Nucleic Acid Molecules
The present invention further provides nucleic acid molecules that encode the protein having SEQ ID NO: 2 and the related proteins herein described, preferably in isolated form. As used herein, "nucleic acid" is defined as RNA or DNA that encodes a protein or peptide as defined above, is complementary to a nucleic acid sequence encoding such peptides, hybridizes to such a nucleic acid and remains stably bound to it under appropriate stringency conditions, or encodes a polypeptide sharing at least about 50%, 60%, 70%> or 75% sequence identity, preferably at least about 80%, more preferably at least about 85%, and even more preferably at least about 90%» or 95% or more identity with the peptide sequences. Alternatively, nucleic acid molecules will have at least about 50%, 60%, 70% or 75% nucleotide sequence identity to SEQ ID NO: 1, preferably about 80%>, more preferably about 85%>, and even more preferably 90%) or 95% nucleotide sequence identity to SEQ ID NO: 1, particularly over the open reading frame of SEQ ID NO: 1. Specifically contemplated are genomic DNA, cDNA, mRNA and antisense molecules, as well as nucleic acids based on alternative backbones or including alternative bases whether derived from natural sources or synthesized. Such hybridizing or complementary nucleic acids, however, are defined further as being novel and unobvious over any prior art nucleic acid including that which encodes, hybridizes under appropriate stringency conditions, or is complementary to nucleic acid encoding a protein according to the present invention. Homology or identity at the nucleotide or amino acid sequence level is determined by BLAST (Basic Local Alignment Search Tool) analysis using the algorithm employed by the programs blastp, blastn, blastx, tblastn and tblastx (Karlin et al, (1990) Proc. Natl. Acad. Sci. USA 87: 2264-2268 and Altschul (1993) J. Mol. Evol. 36: 290-300, fully incorporated by reference) which are tailored for sequence similarity searching. The approach used by the BLAST program is to first consider similar segments between a query sequence and a database sequence, then to evaluate the statistical significance of all matches that are identified and finally to summarize only those matches which satisfy a preselected threshold of significance. For a discussion of basic issues in similarity searching of sequence databases, see Altschul et al, (1994) (Nature Genetics 6: 119-129) which is fully incorporated by reference. The search parameters for histogram, descriptions, alignments, expect (i.e., the
statistical significance threshold for reporting matches against database sequences), cutoff, matrix and filter are at the default settings. The default scoring matrix used by blastp, blastx, tblastn, and tblastx is the BLOSUM62 matrix (Henikoff et al, (1992) Proc. Natl. Acad. Sci. USA 89: 10915-10919, fully incorporated by reference). For blastn, the scoring matrix is set by the ratios of M (i.e., the reward score for a pair of matching residues) to N (i.e., the penalty score for mismatching residues), wherein the default values for M and N are 5 and -4, respectively. Four blastn parameters were adjusted as follows: Q=10 (gap creation penalty); R=10 (gap extension penalty); wink=l (generates word hits at every wink"1 position along the query); and gapw=16 (sets the window width within which gapped alignments are generated). The equivalent Blastp parameter settings were Q=9; R=2; wink=l; and gapw=32. A Bestfit comparison between sequences, available in the GCG package version 10.0, uses DNA parameters GAP=50 (gap creation penalty) and LEN=3 (gap extension penalty) and the equivalent settings in protein comparisons are GAP=8 and LEN=2. "Stringent conditions" are those that (1) employ low ionic strength and high temperature for washing, for example, 0.015 M NaCl/0.0015 M sodium citrate/0.1% SDS at 50°C, or (2) employ during hybridization a denaturing agent such as formamide, for example, 50% (vol/vol) formamide with 0.1 %> bovine serum albumin/0.1% Ficoll/0.1%> polyvinylpyrrolidone/50 mM sodium phosphate buffer at pH 6.5 with 750 mM NaCl, 75 mM sodium citrate at 42°C. Another example is hybridization in 50% formamide, 5x SSC (0.75 MNaCl, 0.075 M sodium citrate), 50 mM sodium phosphate (pH 6.8), 0.1% sodium pyrophosphate, 5χ Denhardt's solution, sonicated salmon sperm DNA (50 μg/ml), 0.1 % SDS, and 10% dextran sulfate at 42°C, with washes at 42°C in 0.2x SSC and 0.1% SDS. A skilled artisan can readily determine and vary the stringency conditions appropriately to obtain a clear and detectable hybridization signal. Preferred molecules are those that hybridize under the above conditions to the complement of SEQ LD NO: 1 and which encode a functional protein. Even more preferred hybridizing molecules are those that hybridize under the above conditions to the complement strand of the open reading frame of SEQ ID NO: 1.
As used herein, a nucleic acid molecule is said to be "isolated" when the nucleic acid molecule is substantially separated from contaminant nucleic acid
molecules encoding other polypeptides.
The present invention further provides fragments of the encoding nucleic acid molecule. As used herein, a fragment of an encoding nucleic acid molecule refers to a small portion of the entire protein coding sequence. The size of the fragment will be determined by the intended use. For example, if the fragment is chosen so as to encode an active portion of the protein, the fragment will need to be large enough to encode the functional region(s) of the protein. For instance, fragments which encode peptides corresponding to predicted antigenic regions may be prepared (see Figure 4). If the fragment is to be used as a nucleic acid probe or PCR primer, then the fragment length is chosen so as to obtain a relatively small number of false positives during probing/priming (see the discussion in Section H).
Fragments of the encoding nucleic acid molecules of the present invention (i.e., synthetic oligonucleotides) that are used as probes or specific primers for the polymerase chain reaction (PCR), or to synthesize gene sequences encoding proteins of the invention, can easily be synthesized by chemical techniques, for example, the phosphotriester method of Matteucci et al, (1981) (J. Am. Chem. Soc. 103: 3185- 3191) or using automated synthesis methods. In addition, larger DNA segments can readily be prepared by well known methods, such as synthesis of a group of oligonucleotides that define various modular segments of the gene, followed by ligation of oligonucleotides to build the complete modified gene.
The encoding nucleic acid molecules of the present invention may further be modified so as to contain a detectable label for diagnostic and probe purposes. A variety of such labels are known in the art and can readily be employed with the encoding molecules herein described. Suitable labels include, but are not limited to, biotin, radiolabeled nucleotides and the like. A skilled artisan can readily employ any such label to obtain labeled variants of the nucleic acid molecules of the invention.
Modifications to the primary structure itself by deletion, addition, or alteration of the amino acids incorporated into the protein sequence during translation can be made without destroying the activity of the protein. Such substitutions or other alterations result in proteins having an amino acid sequence encoded by a nucleic acid falling within the contemplated scope of the present invention.
C. Isolation of Other Related Nucleic Acid Molecules
As described above, the identification and characterization of the human nucleic acid molecule having SEQ ID NO: 1 allows a skilled artisan to isolate nucleic acid molecules that encode other members of the protein family in addition to the sequences herein described. Further, the presently disclosed nucleic acid molecules allow a skilled artisan to isolate nucleic acid molecules that encode other members of the family of proteins in addition to the protein having SEQ ID NO: 2.
Essentially, a skilled artisan can readily use the amino acid sequence of SEQ ID NO: 2 to generate antibody probes to screen expression libraries prepared from appropriate cells. Typically, polyclonal antiserum from mammals such as rabbits immunized with the purified protein (as described below) or monoclonal antibodies can be used to probe a mammalian cDNA or genomic expression library, such as lambda gtll library, to obtain the appropriate coding sequence for other members of the protein family. The cloned cDNA sequence can be expressed as a fusion protem, expressed directly using its own control sequences, or expressed by constructions using control sequences appropriate to the particular host used for expression of the enzyme.
Alternatively, a portion of the coding sequence herein described can be synthesized and used as a probe to retrieve DNA encoding a member of the protein family from any mammalian organism. Oligomers containing approximately 18-20 nucleotides (encoding about a 6-7 amino acid stretch) are prepared and used to screen genomic DNA or cDNA libraries to obtain hybridization under stringent conditions or conditions of sufficient stringency to eliminate an undue level of false positives. Additionally, pairs of oligonucleotide primers can be prepared for use in a polymerase chain reaction (PCR) to selectively clone an encoding nucleic acid molecule. A PCR denature/anneal/extend cycle for using such PCR primers is well known in the art and can readily be adapted for use in isolating other encoding nucleic acid molecules.
Nucleic acid molecules encoding other members of the protein family may also be identified in existing genomic or other sequence information using any available computational method, including but not limited to: PSI-BLAST (Altschul, et al. (1997) Nucleic Acids Res. 25:3389-3402); PHI-BLAST (Zhang, et al. (1998),
Nucleic Acids Res. 26:3986-3990), 3D-PSSM (Kelly et al. (2000) J. Mol. Biol. 299(2): 499-520); and other computational analysis methods (Shi et al. (1999) Biochem. Biophys. Res. Commun. 262(l):132-8 and Matsunami et. al. (2000) Nature 404(6778):601-4).
D. rDNA molecules Containing a Nucleic Acid Molecule
The present invention further provides recombinant DNA (rDNA) molecules that contain a coding sequence. As used herein, a rDNA molecule is a DNA molecule that has been subjected to molecular manipulation in situ. Methods for generating rDNA molecules are well known in the art, for example, see Sambrook et al, Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory Press (1989). In the preferred rDNA molecules, a coding DNA sequence is operably linked to expression control sequences and/or vector sequences.
The choice of vector and/or expression control sequences to which one of the protein family encoding sequences of the present invention is operably linked depends directly, as is well known in the art, on the functional properties desired, e.g., protein expression, and the host cell to be transformed. A vector contemplated by the present invention is at least capable of directing the replication or insertion into the host chromosome, and preferably also expression, of the structural gene included in the rDNA molecule.
Expression control elements that are used for regulating the expression of an operably linked protein encoding sequence are known in the art and include, but are not limited to, inducible promoters, constitutive promoters, secretion signals, and other regulatory elements. Preferably, the inducible promoter is readily controlled, such as being responsive to a nutrient in the host cell's medium.
In one embodiment, the vector containing a coding nucleic acid molecule will include a pro aryotic replicon, i.e., a DNA sequence having the ability to direct autonomous replication and maintenance of the recombinant DNA molecule extrachromosomally in a prokaryotic host cell, such as a bacterial host cell, transformed therewith. Such replicons are well known in the art. In addition, vectors that include a prokaryotic replicon may also include a gene whose expression confers a detectable marker such as a drug resistance. Typical bacterial drug resistance genes
are those that confer resistance to ampicillin, kanamycin, chloramphenicol, or tetracycline.
Vectors that include a prokaryotic replicon can further include a prokaryotic or bacteriophage promoter capable of directing the expression (transcription and translation) of the coding gene sequences in a bacterial host cell, such as E. coli. A promoter is an expression control element formed by a DNA sequence that permits binding of RNA polymerase and transcription to occur. Promoter sequences compatible with bacterial hosts are typically provided in plasmid vectors containing convenient restriction sites for insertion of a DNA segment of the present invention. Typical of such vector plasmids are pUC8, pUC9, pBR322 and pBR329 available from BioRad Laboratories, (Richmond, CA), pPL and pKK223 available from Pharmacia (Piscataway, NJ).
Expression vectors compatible with eukaryotic cells, preferably those compatible with vertebrate cells, can also be used to form rDNA molecules that contain a coding sequence. Eukaryotic cell expression vectors, including viral vectors, are well known in the art and are available from several commercial sources. Typically, such vectors are provided containing convenient restriction sites for insertion of the desired DNA segment. Typical of such vectors are pSVL and pKSV- 10 (Pharmacia), pBPV-l/pML2d (International Biotechnologies, Inc.), pTDTl (ATCC, #31255), the vector pCDM8 described herein, and the like eukaryotic expression vectors.
Eukaryotic cell expression vectors used to construct the rDNA molecules of the present invention may further include a selectable marker that is effective in a eukaryotic cell, preferably a drug resistance selection marker. A preferred drug resistance marker is the gene whose expression results in neomycin resistance, i.e., the neomycin phosphotransferase (neo) gene. (Southern et al, (1982) J. Mol. Anal. Genet. 1 : 327-341) Alternatively, the selectable marker can be present on a separate plasmid, and the two vectors are introduced by co-transfection of the host cell, and selected by culturing in the appropriate drug for the selectable marker.
E. Host Cells Containing an Exogenously Supplied Coding Nucleic Acid Molecule
The present invention further provides host cells transformed with a nucleic acid molecule that encodes a protein of the present invention. The host cell can be either prokaryotic or eukaryotic. Eukaryotic cells useful for expression of a protem of the invention are not limited, so long as the cell line is compatible with cell culture methods and compatible with the propagation of the expression vector and expression of the gene product. Preferred eukaryotic host cells include, but are not limited to, yeast, insect and mammalian cells, preferably vertebrate cells such as those from a mouse, rat, monkey or human cell line. Preferred eukaryotic host cells include
Chinese hamster ovary (CHO) cells available from the ATCC as CCL61, NTH Swiss mouse embryo cells (NDH/3T3) available from the ATCC as CRL 1658, baby hamster kidney cells (BHK), and the like eukaryotic tissue culture cell lines.
Any prokaryotic host can be used to express a rDNA molecule encoding a protein of the invention. The preferred prokaryotic host is E. coli.
Transformation of appropriate cell hosts with a rDNA molecule of the present invention is accomplished by well known methods that typically depend on the type of vector used and host system employed. With regard to transformation of prokaryotic host cells, electroporation and salt treatment methods are typically employed, see, for example, Cohen et al, (1972) Proc. Natl. Acad. Sci. USA 69: 2110; and Sambrook et al, (1989) Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory Press. With regard to transformation of vertebrate cells with vectors containing rDNAs, electroporation, cationic lipid or salt treatment methods are typically employed, see, for example, Graham et al, (1973) Virol. 52, 456; Wigler et al, (1979) Proc. Natl. Acad. Sci. USA 76, 1373-1376.
Successfully transformed cells, i.e., cells that contain a rDNA molecule of the present invention, can be identified by well known techniques including the selection for a selectable marker. For example, cells resulting from the introduction of a rDNA of the present invention can be cloned to produce single colonies. Cells from those colonies can be harvested, lysed and their DNA content examined for the presence of the rDNA using a method such as that described by Southern, J Mol. Biol. 98:503, 1975 or Berent et al, (1985) Biotech. 3: 208, or the proteins produced from the cell
assayed via an immunological method.
F. Production of Recombinant Proteins using a rDNA Molecule
The present invention further provides methods for producing a protein of the invention using nucleic acid molecules herein described. In general terms, the production of a recombinant form of a protein typically involves the following steps:
First, a nucleic acid molecule is obtained that encodes a protein of the invention, such as a nucleic acid molecule comprising, consisting essentially of or consisting of SEQ ID NO: 1 or nucleotides 183-536 of SEQ ID NO: 1. If the encoding sequence is uninterrupted by introns, as is this open-reading-frame, it is directly suitable for expression in any host.
The nucleic acid molecule is then preferably placed in operable linkage with suitable control sequences, as described above, to form an expression unit containing the protein open reading frame. The expression unit is used to transform a suitable host and the transformed host is cultured under conditions that allow the production of the recombinant protein. Optionally the recombinant protein is isolated from the medium or from the cells; recovery and purification of the protein may not be necessary in some instances where some impurities may be tolerated.
Each of the foregoing steps can be done in a variety of ways. For example, the desired coding sequences may be obtained from genomic fragments and used directly in appropriate hosts. The construction of expression vectors that are operable in a variety of hosts is accomplished using appropriate replicons and control sequences, as set forth above. The control sequences, expression vectors, and transformation methods are dependent on the type of host cell used to express the gene and were discussed in detail earlier. Suitable restriction sites can, if not normally available, be added to the ends of the coding sequence so as to provide an excisable gene to insert into these vectors. A skilled artisan can readily adapt any host/expression system known in the art for use with the nucleic acid molecules of the invention to produce recombinant protein.
G. Methods to Identify Binding Partners
Another embodiment of the present invention provides methods for use in
isolating and identifying binding partners of proteins of the invention. In general, a protein of the invention is mixed with a potential binding partner or an extract or fraction of a cell under conditions that allow the association of potential binding partners with the protein of the invention. After mixing, peptides, polypeptides, proteins or other molecules that have become associated with a protein of the invention are separated from the mixture. The binding partner that bound to the protein of the invention can then be removed and further analyzed. To identify and isolate a binding partner, the entire protein, for instance a protein comprising the entire amino acid sequence of SEQ ID NO: 2, can be used. Alternatively, a fragment of the protein can be used.
As used herein, a cellular extract refers to a preparation or fraction which is made from a lysed or disrupted cell. The prefereed source of cellular extracts will be cells derived from human prostate tissue, for instance, biopsy tissue or tissue culture cells. Alternatively, cellular extracts may be prepared from normal human prostate tissue or available cell lines, particularly prostate derived cell lines.
A variety of methods can be used to obtain an extract of a cell. Cells can be disrupted using either physical or chemical disruption methods. Examples of physical disruption methods include, but are not limited to, sonication and mechanical shearing. Examples of chemical lysis methods include, but are not limited to, detergent lysis and enzyme lysis. A skilled artisan can readily adapt methods for preparing cellular extracts in order to obtain extracts for use in the present methods. Once an extract of a cell is prepared, the extract is mixed with the protein of the invention under conditions in which association of the protein with the binding partner can occur. A variety of conditions can be used, the most preferred being conditions that closely resemble conditions found in the cytoplasm of a human cell. Features such as osmolarity, pH, temperature, and the concentration of cellular extract used, can be varied to optimize the association of the protein with the binding partner.
After mixing under appropriate conditions, the bound complex is separated from the mixture. A variety of techniques can be utilized to separate the mixture. For example, antibodies specific to a protein of the invention can be used to immunoprecipitate the binding partner complex. Alternatively, standard chemical separation techniques such as chromatography and density/sediment centrifugation
can be used.
After removal of non-associated cellular constituents found in the extract, the binding partner can be dissociated from the complex using conventional methods. For example, dissociation can be accomplished by altering the salt concentration or pH of the mixture.
To aid in separating associated binding partner pairs from the mixed extract, the protein of the invention can be immobilized on a solid support. For example, the protein can be attached to a nitrocellulose matrix or acrylic beads. Attachment of the protein to a solid support aids in separating peptide/binding partner pairs from other constituents found in the extract. The identified binding partners can be either a single protein or a complex made up of two or more proteins. Alternatively, binding partners may be identified using a Far- Western assay according to the procedures of Takayama et al, (1997) Methods Mol. Biol. 69:171-184 or Sauder et al, (1996) J. GenNirol. 77:991-996 or identified through the use of epitope tagged proteins or GST fusion proteins.
Alternatively, the nucleic acid molecules of the invention can be used in a yeast two-hybrid system. The yeast two-hybrid system has been used to identify other protein partner pairs and can readily be adapted to employ the nucleic acid molecules herein described.
H. Methods to Identify Agents that Modulate the Expression a Nucleic Acid Encoding the Genes Associated BPH
Another embodiment of the present invention provides methods for identifying agents that modulate the expression of a nucleic acid encoding a protein of the invention such as a protein having the amino acid sequence of SEQ LD NO: 2. Such assays may utilize any available means of monitoring for changes in the expression level of the nucleic acids of the invention. As used herein, an agent is said to modulate the expression of a nucleic acid of the invention if it is capable of up- or down-regulating expression of the nucleic acid in a cell. In one assay format, cell lines that contain reporter gene fusions between the open reading frame defined by nucleotides 183-536 of SEQ ID NO: 1, and/or the 5' and/or 3' regulatory sequences and any assayable fusion partner may be prepared.
Numerous assayable fusion partners are known and readily available including the firefly luciferase gene and the gene encoding chloramphenicol acetyltransferase (Alam et al, (1990) Anal. Biochem. 188: 245-254). Cell lines containing the reporter gene fusions are then exposed to the agent to be tested under appropriate conditions and time. Differential expression of the reporter gene between samples exposed to the agent and control samples identifies agents which modulate the expression of a nucleic acid encoding a protein having the sequence of SEQ ID NO: 2.
Additional assay formats may be used to monitor the ability of the agent to modulate the expression of a nucleic acid encoding a protein of the invention, such as the protein having SEQ ID NO: 2. For instance, mRNA expression may be monitored directly by hybridization to the nucleic acids of the invention. Cell lines are exposed to the agent to be tested under appropriate conditions and time and total RNA or mRNA is isolated by standard procedures such those disclosed in Sambrook et al, (1989) Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory Press).
Probes to detect differences in RNA expression levels between cells exposed to the agent and control cells may be prepared from the nucleic acids of the invention. It is preferable, but not necessary, to design probes which hybridize only with target nucleic acids under conditions of high stringency. Only highly complementary nucleic acid hybrids form under conditions of high stringency. Accordingly, the stringency of the assay conditions determines the amount of complementarity which should exist between two nucleic acid strands in order to form a hybrid. Stringency should be chosen to maximize the difference in stability between the probe:target hybrid and probe:non-target hybrids. Probes may be designed from the nucleic acids of the invention through methods known in the art. For instance, the G+C content of the probe and the probe length can affect probe binding to its target sequence. Methods to optimize probe specificity are commonly available in Sambrook et al, (1989) Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory Press) or Ausubel et al, (1995) Current Protocols in Molecular Biology, Greene Publishing Co.
Hybridization conditions are modified using known methods, such as those described by Sambrook et al. and Ausubel et al. as required for each probe.
Hybridization of total cellular RNA or RNA enriched for polyA RNA can be accomplished in any available format. For instance, total cellular RNA or RNA enriched for polyA RNA can be affixed to a solid support and the solid support exposed to at least one probe comprising at least one, or part of one of the sequences of the invention under conditions in which the probe will specifically hybridize. Alternatively, nucleic acid fragments comprising at least one, or part of one of the sequences of the invention can be affixed to a solid support, such as a silicon chip or a porous glass wafer. The wafer can then be exposed to total cellular RNA or polyA RNA from a sample under conditions in which the affixed sequences will specifically hybridize. Such glass wafers and hybridization methods are widely available, for example, those disclosed by Beattie, (1995) WO 95/11755. By examining for the ability of a given probe to specifically hybridize to an RNA sample from an untreated cell population and from a cell population exposed to the agent, agents which up or down regulate the expression of a nucleic acid encoding the protein having the sequence of SEQ ID NO: 2 are identified.
Hybridization for qualitative and quantitative analysis of mRNAs may also be carried out by using a RNase Protection Assay (i.e., RPA, see Ma et al. (1996) Methods 10: 273-238). Briefly, an expression vehicle comprising cDNA encoding the gene product and a phage specific DNA dependent RNA polymerase promoter (e.g., T7, T3 or SP6 RNA polymerase) is linearized at the 3' end of the cDNA molecule, downstream from the phage promoter, wherein such a linearized molecule is subsequently used as a template for synthesis of a labeled antisense transcript of the cDNA by in vitro transcription. The labeled transcript is then hybridized to a mixture of isolated RNA (i.e., total or fractionated mRNA) by incubation at 45 °C overnight in a buffer comprising 80%. formamide, 40 mM Pipes, pH 6.4, 0.4 M NaCl and 1 mM EDTA. The resulting hybrids are then digested in a buffer comprising 40 μg/ml ribonuclease A and 2 μg/ml ribonuclease. After deactivation and extraction of extraneous proteins, the samples are loaded onto urea/polyacrylamide gels for analysis. In another assay to identify agents which effect the expression of the instant gene products, cells or cell lines are first identified which express the gene products of the invention physiologically (e.g., using assays of tissue distribution via Northern
blot, although RPAs may serve the identical purpose of expression selection). Cells and/or cell lines so identified would be expected to comprise the necessary cellular machinery such that the fidelity of modulation of the transcriptional apparatus is maintained with regard to exogenous contact of agent with appropriate surface transduction mechanisms and or the cytosolic cascades. Further, such cells or cell lines are transduced or transfected with an expression vehicle (e.g., a plasmid or viral vector) construct comprising an operable non-translated 5'-promoter containing end of the structural gene encoding the instant gene products fused to one or more antigenic fragments, which are peculiar to the instant gene products, wherein said fragments are under the transcriptional control of said promoter and are expressed as polypeptides whose molecular weight can be distinguished from the naturally occurring polypeptides or may further comprise an immunologically distinct tag or other detectable marker. Such a process is well known in the art (see Maniatis).
Cells or cell lines transduced or transfected as outlined above are then contacted with agents under appropriate conditions; for example, the agent comprises a pharmaceutically acceptable excipient and is contacted with cells comprised in an aqueous physiological buffer such as phosphate buffered saline (PBS) at physiological pH, Eagles balanced salt solution (BSS) at physiological pH, PBS or BSS comprising serum or conditioned media comprising PBS or BSS and/or serum incubated at 37°C. Said conditions may be modulated as deemed necessary by one of skill in the art. Subsequent to contacting the cells with the agent, said cells are disrupted and the polypeptides of the lysate are fractionated such that a polypeptide fraction is pooled and contacted with an antibody to be further processed by immunological assay (e.g., ELISA, immunoprecipitation or Western blot). The pool of proteins isolated from the "agent-contacted" sample is then compared with a control sample where only the excipient is contacted with the cells and an increase or decrease in the immunologically generated signal from the "agent-contacted" sample compared to the control is used to distinguish the effectiveness of the agent.
I. Methods to Identify Agents that Modulate at Least One Activity of the BPH Associated Proteins
Another embodiment of the present invention provides methods for identifying
agents that modulate at least one activity of a protein of the invention such as the protein having the amino acid sequence of SEQ ID NO: 2. Such methods or assays may utilize any means of monitoring or detecting the desired activity.
In one format, the relative amounts of a protein of the invention between a cell population that has been exposed to the agent to be tested compared to an un-exposed control cell population may be assayed. In this format, probes such as specific antibodies are used to monitor the differential expression of the protein in the different cell populations. Cell lines or populations are exposed to the agent to be tested under appropriate conditions and time. Cellular lysates may be prepared from the exposed cell line or population and a control, unexposed cell line or population. The cellular lysates are then analyzed with the probe.
Antibody probes are prepared by immunizing suitable mammalian hosts in appropriate immunization protocols using the peptides, polypeptides or proteins of the invention if they are of sufficient length, or, if desired to enhance immunogenicity, conjugated to suitable carriers. Methods for preparing immunogenic conjugates with carriers such as BSA, KLH, or other carrier proteins are well known in the art. In some circumstances, direct conjugation using, for example, carbodiimide reagents may be effective; in other instances linking reagents such as those supplied by Pierce Chemical Co. (Rockford, IL), may be desirable to provide accessibility to the hapten. The hapten peptides can be extended at either the amino or carboxy terminus with a cysteine residue or interspersed with cysteine residues, for example, to facilitate linking to a carrier. Administration of the immunogens is conducted generally by injection over a suitable time period and with use of suitable adjuvants, as is generally understood in the art. During the immunization schedule, titers of antibodies are taken to determine adequacy of antibody formation.
While the polyclonal antisera produced in this way may be satisfactory for some applications, use of monoclonal preparations is preferred for pharmaceutical compositions. Immortalized cell lines which secrete the desired monoclonal antibodies may be prepared using the standard method of Kohler and Milstein (Nature (1975) 256 :495-497) or modifications which effect immortalization of lymphocytes or spleen cells, as is generally known. The immortalized cell lines secreting the desired antibodies are screened by immunoassay in which the antigen is the peptide hapten,
polypeptide or protein. When the appropriate immortalized cell culture secreting the desired antibody is identified, the cells can be cultured either in vitro or by production in ascites fluid.
The desired monoclonal antibodies are then recovered from the culture supernatant or from the ascites supernatant. Fragments of the monoclonals or the polyclonal antisera which contain the immunologically significant portion can be used as antagonists, as well as the intact antibodies. Use of immunologically reactive fragments, such as the Fab, Fab', or F(ab')2 fragments is often preferable, especially in a therapeutic context, as these fragments are generally less immunogenic than the whole immunoglobulin.
The antibodies or fragments may also be produced, using current technology, by recombinant means. Antibody regions that bind specifically to the desired regions of the protein can also be produced in the context of chimeras with multiple species origin, such as humanized antibodies. Agents that are assayed in the above method can be randomly selected or rationally selected or designed. As used herein, an agent is said to be randomly selected when the agent is chosen randomly without considering the specific sequences involved in the association of a protein of the invention alone or with its associated substrates, binding partners, etc. An example of randomly selected agents is the use a chemical library or a peptide combinatorial library, or a growth broth of an organism.
As used herein, an agent is said to be rationally selected or designed when the agent is chosen on a nonrandom basis which takes into account the sequence of the target site and/or its conformation in connection with the agent's action. Agents can be rationally selected or rationally designed by utilizing the peptide sequences that make up these sites. For example, a rationally selected peptide agent can be a peptide whose amino acid sequence is identical to or a derivative of any functional consensus site.
The agents of the present invention can be, as examples, peptides, small molecules, vitamin derivatives, as well as carbohydrates. Dominant negative proteins, DNAs encoding these proteins, antibodies to these proteins, peptide fragments of these proteins or mimics of these proteins may be introduced into cells to affect
function. "Mimic" used herein refers to the modification of a region or several regions of a peptide molecule to provide a structure chemically different from the parent peptide but topographically and functionally similar to the parent peptide (see Grant GA. in: Molecular Biology and Biotechnology. Meyers, ed., pp. 659-664, VCH Publishers, Inc., New York, NY, 1995). A skilled artisan can readily recognize that there is no limit as to the structural nature of the agents of the present invention.
The peptide agents of the invention can be prepared using standard solid phase (or solution phase) peptide synthesis methods, as is known in the art. In addition, the DNA encoding these peptides may be synthesized using commercially available oligonucleotide synthesis instrumentation and produced recombinantly using standard recombinant production systems. The production using solid phase peptide synthesis is necessitated if non-gene-encoded amino acids are to be included.
Another class of agents of the present invention are antibodies immunoreactive with critical positions of proteins of the invention. Antibody agents are obtained by immunization of suitable mammalian subjects with peptides, containing as antigenic regions, those portions of the protein intended to be targeted by the antibodies.
J. Uses for Agents that Modulate at Least One Activity of the BPH Proteins.
As provided in the Examples, the proteins and nucleic acids of the invention, such as the protein having the amino acid sequence of SEQ ID NO: 2, are differentially expressed in BPH tissue compared to normal tissue. Agents that modulate or up-or-down-regulate the expression of the protein or agents, such as agonists or antagonists of at least one activity of the protein, may be used to modulate biological and pathologic processes associated with the protein's function and activity. As used herein, a subject can be any mammal, so long as the mammal is in need of modulation of a pathological or biological process mediated by a protein of the invention. The term "mammal" is meant as an individual belonging to the class Mammalia. The invention is particularly useful in the treatment of human subjects. Pathological processes refer to a category of biological processes which produce a deleterious effect. For example, expression of a protein of the invention may be associated with prostate cell growth or hyperplasia. As used herein, an agent is said to modulate a pathological process when the agent reduces the degree or severity
of the process. For instance, BPH may be prevented or disease progression modulated by the administration of agents which up- or down-regulate or modulate in some way the expression or at least one activity of a protein of the invention.
The agents of the present invention can be provided alone, or in combination with other agents that modulate a particular pathological process. For example, an agent of the present invention can be administered in combination with other known drugs. As used herein, two agents are said to be administered in combination when the two agents are administered simultaneously or are administered independently in a fashion such that the agents will act at the same time. The agents of the present invention can be administered via parenteral, subcutaneous, intravenous, intramuscular, intraperitoneal, transdermal, or buccal routes. Alternatively, or concurrently, admimstration may be by the oral route. The dosage administered will be dependent upon the age, health, and weight of the recipient, kind of concurrent treatment, if any, frequency of treatment, and the nature of the effect desired.
The present invention further provides compositions containing one or more agents which modulate expression or at least one activity of a protein of the invention. While individual needs vary, determination of optimal ranges of effective amounts of each component is within the skill of the art. Typical dosages comprise 0.1 to 100 μg/kg body wt. The preferred dosages comprise 0.1 to 10 μg/kg body wt. The most preferred dosages comprise 0.1 to 1 μg/kg body wt.
In addition to the pharmacologically active agent, the compositions of the present invention may contain suitable pharmaceutically acceptable carriers comprising excipients and auxiliaries which facilitate processing of the active compounds into preparations which can be used pharmaceutically for delivery to the site of action. Suitable formulations for parenteral administration include aqueous solutions of the active compounds in water-soluble form, for example, water-soluble salts. In addition, suspensions of the active compounds as appropriate oily injection suspensions may be administered. Suitable lipophilic solvents or vehicles include fatty oils, e.g., sesame oil, or synthetic fatty acid esters, e.g., ethyl oleate or triglycerides. Aqueous injection suspensions may contain substances which increase the viscosity of the suspension, and the substances may include, for example, sodium
carboxymethyl cellulose, sorbitol, and/or dextran. Optionally, the suspension may also contain stabilizers. Liposomes can also be used to encapsulate the agent for delivery into the cell.
The pharmaceutical formulation for systemic administration according to the invention may be formulated for enteral, parenteral or topical administration. Indeed, all three types of formulations may be used simultaneously to achieve systemic administration of the active ingredient. Suitable formulations for oral administration include hard or soft gelatin capsules, pills, tablets, including coated tablets, elixirs, suspensions, syrups or inhalations and controlled release forms thereof. In practicing the methods of this invention, the compounds of this invention may be used alone or in combination, or in combination with other therapeutic or diagnostic agents. In certain prefened embodiments, the compounds of this invention may be coadministered along with other compounds typically prescribed for these conditions according to generally accepted medical practice. The compounds of this invention can be utilized in vivo, ordinarily in mammals, such as humans, sheep, horses, cattle, pigs, dogs, cats, rats and mice, or in vitro.
K. Transgenic Animals
Transgenic animals containing mutant, knock-out or modified genes corresponding to the cDNA sequence of SEQ ID NO: 1 , or the open reading frame encoding SEQ ID NO: 2, are also included in the invention. Transgenic animals are genetically modified animals into which recombinant, exogenous or cloned genetic material has been experimentally transferred. Such genetic material is often referred to as a "transgene." The nucleic acid sequence of the transgene, in this case a form of SEQ ID NO: 1 , may be integrated either at a locus of a genome where that particular nucleic acid sequence is not otherwise normally found or at the normal locus for the transgene. The transgene may consist of nucleic acid sequences derived from the genome of the same species or of a different species than the species of the target animal. The term "germ cell line transgenic animal" refers to a transgenic animal in which the genetic alteration or genetic information was introduced into a germ line cell, thereby conferring the ability of the transgenic animal to transfer the genetic
information to offspring. If such offspring in fact possess some or all of that alteration or genetic information, then they too are transgenic animals.
The alteration or genetic information may be foreign to the species of animal to which the recipient belongs, foreign only to the particular individual recipient, or may be genetic information already possessed by the recipient. In the last case, the altered or introduced gene may be expressed differently than the native gene. Transgenic animals can be produced by a variety of different methods including transfection, electroporation, microinjection, gene targeting in embryonic stem cells and recombinant viral and retroviral infection (see, e.g., U.S. Patent No. 4,736,866; U.S. Patent No. 5,602,307; Mullins et al, (1993) Hypertension 22: 630- 633; Brenin et al, (1997) Surg. Oncol. 6: 99-110; Tuan, ed., Recombinant Gene Expression Protocols, Methods in Molecular Biology No. 62, Humana Press, 1997). A number of recombinant or transgenic mice have been produced, including those which express an activated oncogene sequence (U.S. Patent No. 4,736,866); express simian SV40 T-antigen (U.S. Patent No. 5,728,915); lack the expression of interferon regulatory factor 1 (IRF-1) (U.S. Patent No. 5,731,490); exhibit dopaminergic dysfunction (U.S. Patent No. 5,723,719); express at least one human gene which participates in blood pressure control (U.S. Patent No. 5,731,489); display greater similarity to the conditions existing in naturally occurring Alzheimer's disease (U.S. Patent No. 5,720,936); have a reduced capacity to mediate cellular adhesion (U.S. Patent No. 5,602,307); possess a bovine growth hormone gene (Clutter et al, (1996) Genetics 143: 1753-1760); or, are capable of generating a fully human antibody response (McCarthy (1997) Lancet 349: 405).
While mice and rats remain the animals of choice for most transgenic experimentation, in some instances it is preferable or even necessary to use alternative animal species. Transgenic procedures have been successfully utilized in a variety of non-murine animals, including sheep, goats, pigs, dogs, cats, monkeys, chimpanzees, hamsters, rabbits, cows and guinea pigs (see, e.g., Kim et al, (1997) Mol. Reprbd. Dev. 46: 515-526; Houdebine (1995) Reprod. Nurr. Dev. 35: 609-617; Petters (1994) Reprod. Fertil. Dev. 6: 643-645; Schnieke et al, (1997) Science 278: 2130-2133; and Amoah (1997) J. Animal Science 75: 578-585).
The method of introduction of nucleic acid fragments into recombination
competent mammalian cells can be by any method which favors co-transformation of multiple nucleic acid molecules. Detailed procedures for producing transgenic animals are readily available to one skilled in the art, including the disclosures in U.S. Patent No. 5,489,743 and U.S. Patent No. 5,602,307.
L. Diagnostic Methods
As the genes and proteins of the invention are differentially expressed in BPH tissue compared to normal prostate tissue, the genes and proteins of the invention may be used to diagnose or monitor BPH, prostate function, or to track disease progression. One means of diagnosing BPH using the nucleic acid molecules or proteins of the invention involves obtaining prostate tissue from living subjects. Obtaining tissue samples from living sources is problematic for tissues such as prostate. However, due to the nature of the treatment paradigms for BPH, biopsy may be necessary. When possible, urine, blood or peripheral lymphocyte samples may be used as the tissue sample in the assay.
The use of molecular biological tools has become routine in forensic technology. For example, nucleic acid probes may be used to determine the expression of a nucleic acid molecule comprising all or at least part of the sequences of SEQ ID NO: 1 in forensic/pathology specimens. Further, nucleic acid assays may be carried out by any means of conducting a transcriptional profiling analysis. In addition to nucleic acid analysis, forensic methods of the invention may target the proteins of the invention, particularly a protein comprising SEQ ID NO: 2, to determine up- or down-regulation of the genes (Shiverick et al, (1975) Biochim Biophys Acta 393: 124-133). Methods of the invention may involve treatment of tissues with collagenases or other proteases to make the tissue amenable to cell lysis (Semenov et al, (1987) Biull Eksp Biol Med 104: 113-116). Further, it is possible to obtain biopsy samples from different regions of the prostate for analysis.
Assays to detect nucleic acid or protein molecules of the invention may be in any available format. Typical assays for nucleic acid molecules include hybridization or PCR based formats. Typical assays for the detection of proteins, polypeptides or peptides of the invention include the use of antibody probes in any available format
such as in situ binding assays, etc. See Harlow & Lane, Antibodies - A Laboratory Manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 1988. In preferred embodiments, assays are carried-out with appropriate controls.
The above methods may also be used in other diagnostic protocols, including protocols and methods to detect disease states in other tissues or organs, for example the tissues in which gene expression is detected (see Figures 1-3).
Without further description, it is believed that one of ordinary skill in the art can, using the preceding description and the following illustrative examples, make and utilize the compounds of the present invention and practice the claimed methods. The following working examples therefore, specifically point out preferred embodiments of the present invention, and are not to be construed as limiting in any way the remainder of the disclosure.
EXAMPLES
Example 1
Identification of Differentially Expressed BPH mRNA
BPH and normal prostate tissue was obtained from human biopsy samples.
Total cellular RNA was prepared from the these tissues using the procedure of Newburger et al, J. Biol. Chem. (1981) 266(24): 16171-7 and Newburger et al, Proc.
Natl. Acad. Sci. USA (1988) 85:5215-5219.
Synthesis of cDNA was performed as previously described by Prashar et al. in
WO 97/05286 and in Prashar et al, Proc. Natl. Acad. Sci. USA (1996) 93:659-663.
Briefly, cDNA was synthesized according to the protocol described in the GIBCO/BRL kit for cDNA synthesis. The reaction mixture for first-strand synthesis included 6 μg of total RNA, and 200 ng of a mixture of 1-base anchored oligo(dT) primers with all three possible anchored bases
(ACGTAATACGACTCACTATAGGGCGAATTGGGTCGACTTTTTTTTTTTTTT
TTT nl (SEQ LD NO:3) wherein nl=A or C or G) along with other components for first-strand synthesis reaction except reverse transcriptase. This mixture was incubated at 65°C for 5 min, chilled on ice and the process repeated. Alternatively, the reaction mixture may include lOμg of total RNA, and 2 pmol of 1 of the 2-base
anchored oligo(dT) primers a heel such as RP5.0 (CTCTCAAGGATCTTACCGCTT18AT (SEQ ID NO:4)), or RP6.0 (TAATACCGCGCCACATAGCAT18CG (SEQ ID NO:5)), or RP9.2 (CAGGGTAGACGACGCTACGCT18GA (SEQ ID NO: 6)) along with other components for first-strand synthesis reaction except reverse transcriptase. This mixture was then layered with mineral oil and incubated at 65°C for 7 min followed by 50°C for another 7 min. At this stage, 2μl of Superscript® reverse transcriptase (200 units/μl; GIBCO/BRL) was added quickly and mixed, and the reaction continued for 1 hr at 45-50°C. Second-strand synthesis was performed at 16°C for 2 hr. At the end of the reaction, the cDNAs were precipitated with ethanol and the yield of cDNA was calculated. In our experiments, 200 ng of cDNA was obtained from lOμg of total RNA.
The adapter oligonucleotide sequences were Al (TAGCGTCCGGCGCAGCGACGGCCAG (SEQ ID NO: 7)) and A2 (GATCCTGGCCGTCGGCTGTCTGTCGGCGC (SEQ ID NO: 8)). One microgram of oligonucleotide A2 was first phosphorylated at the 5' end using T4 polynucleotide kinase (PNK). After phosphorylation, PNK was heat-denatured, and lμg of the oligonucleotide Al was added along with 10x annealing buffer (1 M NaCl/100 mM Tris-HCl, pH8.0/10 mM EDTA, pH8.0) in a final vol. of 20μl. This mixture was then heated at 65°C for 10 min followed by slow cooling to room temperature for 30 min, resulting in formation of the Y adapter at a final concentration of 100 ng/μl. About 20 ng of the cDNA was digested with 4 units of Bgl II in a final vol of 10 μl for 30 min at 37°C. Two microliters (4 ng of digested cDNA) of this reaction mixture was then used for ligation to 100 ng ( 50-fold) of the Y-shaped adapter in a final vol. of 5 μl for 16 hr at 15°C. After ligation, the reaction mixture was diluted with water to a final vol. of 80 μl (adapter ligated cDNA concentration, 50 pg/μl) and heated at 65°C for 10 min to denature T4 DNA ligase, and 2-μl aliquots (with 100 pg of cDNA) were used for PCR.
The following sets of primers were used for PCR amplification of the adapter ligated 3' -end cDNAs: GAAGCCGAGACGTCGGTCG(T)1S nl, n2 (SEQ ID NO: 9) (wherein nl, n2 = AA, AC, AG AT CA CC CG CT GA GC GG and GT) as the 3* primer with Al as the 5' primer or alternatively P 5.0, RP 6.0, or RP 9.2 used as 3'
primers with primer Al .1 serving as the 5' primer. To detect the PCR products on the display gel, 24 pmol of oligonucleotide Al or Al.l was 5'-end-labeled using 15 μl of [ -32 PjATP (Amersham; 3000 Ci/mmol) and PNK in a final volume of 20 μl for 30 min at 37°C. After heat denaturing PNK at 65 °C for 20 min, the labeled oligonucleotide was diluted to a final concentration of 2μM in 80 μl with unlabeled oligonucleotide Al.l. The PCR mixture (20 μl) consisted of 2 1 ( 100 pg) of the template, 2 μl of 10x PCR buffer (100 mM Tris-HCL pH 8.3/500 mM KCl), 2 μl of 15 mM MgCl2 to yield 1.5 mM final Mg2+ concentration optimum in the reaction mixture, 200 μM dNTPs, 200 nM each 5' and 3' PCR primers, and 1 unit of Amplitaq Gold®. Primers and dNTPs were added after preheating the reaction mixture containing the rest of the components at 85°C. This "hot start" PCR was done to avoid artefactual amplification arising out of arbitrary annealing of PCR primers at lower temperatures during transition from room temperature to 94°C in the first PCR cycle. The PCR consisted of 5 cycles of 94°C for 30 sec, 55°C for 2 min, and 72°C for 60 sec followed by 25 cycles of 94°C for 30 sec, 60°C for 2 min, and 72°C for 60 sec. A higher number of cycles resulted in smeary gel patterns. PCR products (2.5 1) were analyzed on 6% polyacrylamide sequencing gels. For double or multiple digestion following adapter ligation, 13.2 1 of the ligated cDNA sample was digested with a secondary restriction enzyme(s) in a final vol of 20 μl. From this solution, 3 μl was used as template for PCR. This template vol of 3 μl carried 100 pg of the cDNA and 10 mM MgCL, (from the 10x enzyme buffer), which diluted to the optimum of 1.5 mM in the final PCR vol of 20 μl. Since Mg2+ comes from the restriction enzyme buffer, it was not included in the reaction mixture when amplifying secondarily cut cDNA. Individual cDNA fragments corresponding to mRNA species were separated by denaturing polyacrylamide gel electrophoresis and visualized by autoradiography. Fragments were identified in tissue samples from BPH tissue corresponding to a mRNA species which was differentially expressed when compared to control prostate tissue. This band or fragment was extracted from the display gels as described by Liang et al. (1995 Curr. Opin. frnmunol. 7:274-280), reamplified using the 5' and 3' primers, and subcloned into pCR-Script with high efficiency using the PCR-Script cloning kit from Stratagene. Plasmids were sequenced by cycle sequencing on an automated sequencer. Alternatively, bands were extracted (cored)
from the display gels, PCR amplified and sequenced directly without subcloning.
Example 2
Cloning of a Full Length human cDNA (JT43780) Corresponding to a Differentially Expressed Fragment
The full length cDNA having SEQ LD NO: 1 was obtained by the oligo-pulling method. Briefly, a gene-specific oligo was designed based on the sequence of the extracted fragment in Example 1. The oligo was labeled with biotin and used to hybridize with 2 μg of single strand plasmid DNA (cDNA recombinants) from a human cDNA library following the procedures of Sambrook et al. The hybridized cDNAs were separated by streptavidin-conjugated beads and eluted by heating. The eluted cDNA was converted to double strand plasmid DNA and used to transform E. coli cells (DH10B) and the longest cDNA was screened. After positive selection was confirmed by PCR using gene-specific primers, the cDNA clone was subjected to DNA sequencing.
The nucleotide sequence of a full-length cDNA corresponding to the differentially expressed band is set forth in SEQ ID NO: 1. The cDNA comprises 1659 base pairs with an open reading frame encoding a protein of 118 amino acids (SEQ ID NO:2). Figure 4 shows the results of various hydrophobicity/hydrophilicity analyses of the amino acid sequence of SED ID NO:2.
Example 3
Northern Blot and PCR Analysis The tissue distribution of RNA encoding the protein of SEQ ID NO: 2 was analyzed by Northern blot as well as PCR expression analysis of RNA isolated from various tissues. RNA was isolated from human kidney, adrenal, pancreas, salivary gland, liver, prostate, thyroid, cerebellum, fetal brain, fetal liver, placenta, spinal tissue, colon, small intestine, stomach, bone marrow, thymus, spleen, heart, lung, testis, uterus, trachea, mammary gland, glomeruli, medulla and cortex tissue using standard procedures. Northern blots were prepared using a probe derived from SEQ ID NO: 1 with hybridization conditions as described by Sambrook et al. The
ClonTech Human mRNA blot was used with the PCR-labeling READS fragment probe. Church-Gilbert hybridization buffer was used, and the blot was hybridized overnight. See Figure 2. PCR analysis was also performed using primers derived from SEQ ID NO: 1 using AmpliTaq Gold PCR® amplification kits (Perkin Elmer).
Quantitative Analysis of Expression Levels
Figures 1 and 3 show the results of the semi-quantitative PCR analysis of expression levels of mRNA corresponding to SEQ ID NO: 1 in various disease and normal human tissue samples. Real time PCR detection was accomplished by the use of the ABI PRISM 7700 Sequence Detection System. The 7700 measures the fluorescence intensity of the sample each cycle and is able to detect the presence of specific amplicons within the PCR reaction. Each sample was assayed for the level of GAPDH and mRNA corresponding to SEQ ID NO: 1. GAPDH detection was performed using Perkin Elmer part no. 402869 according to the manufacturer's directions. Primers were designed from SEQ ID NO: 1 using Primer Express®, to efficiently find primers and probes for specific sequences. These primers were used in conjunction with SYBR green (Molecular Probes), a nonspecific double stranded DNA dye, to measure the expression level mRNA corresponding to SEQ ID NO: 1, which was normalized to the GAPDH level in each sample. This analysis indicates that mRNA species corresponding to SEQ ID NO:l are differentially expressed in prostate tissue isolated from patients with BPH compared to normal, nondiseased human prostate tissue (Figure 1). Tissue distribution analysis of various normal human tissues indicates that the gene is expressed in a variety of tissues (see Figure 3).
Differentially Expressed mRNA in Renal Disease
The gene and protein of the invention can be used to distinguish among various types of prostate disease diagnostically and prognostically, or to track disease progress. As shown by the quantitative PCR data for the extended patient panel (Figure 1), the gene of the invention is differentially regulated in various prostate diseases, such as BPH. In addition, the gene of the invention is differentially expressed in various BPH states, such as in patients that have cancer, patients that are
symptomatic, and patients that are not symptomatic. Therefore, measuring the total amount of transcript as well as the relative expression level of the gene may be used to stratify patients diagnostically and prognostically.
Although the present invention has been described in detail with reference to examples above, it is understood that various modifications can be made without departing from the spirit of the invention. Accordingly, the invention is limited only by the following claims. All cited patents, patent applications and publications referred to in this application are herein incorporated by reference in their entirety.