WO2001012819A2 - Protein phosphatases and diagnosis and treatment of phosphatase-related disorders - Google Patents
Protein phosphatases and diagnosis and treatment of phosphatase-related disorders Download PDFInfo
- Publication number
- WO2001012819A2 WO2001012819A2 PCT/US2000/022158 US0022158W WO0112819A2 WO 2001012819 A2 WO2001012819 A2 WO 2001012819A2 US 0022158 W US0022158 W US 0022158W WO 0112819 A2 WO0112819 A2 WO 0112819A2
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- seq
- phosphatase
- amino acid
- cancer
- set forth
- Prior art date
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/34—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving hydrolase
- C12Q1/42—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving hydrolase involving phosphatase
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P1/00—Drugs for disorders of the alimentary tract or the digestive system
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P1/00—Drugs for disorders of the alimentary tract or the digestive system
- A61P1/16—Drugs for disorders of the alimentary tract or the digestive system for liver or gallbladder disorders, e.g. hepatoprotective agents, cholagogues, litholytics
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P11/00—Drugs for disorders of the respiratory system
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P13/00—Drugs for disorders of the urinary system
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P13/00—Drugs for disorders of the urinary system
- A61P13/12—Drugs for disorders of the urinary system of the kidneys
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P15/00—Drugs for genital or sexual disorders; Contraceptives
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P17/00—Drugs for dermatological disorders
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P21/00—Drugs for disorders of the muscular or neuromuscular system
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P25/00—Drugs for disorders of the nervous system
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P25/00—Drugs for disorders of the nervous system
- A61P25/18—Antipsychotics, i.e. neuroleptics; Drugs for mania or schizophrenia
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P27/00—Drugs for disorders of the senses
- A61P27/02—Ophthalmic agents
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P35/00—Antineoplastic agents
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P7/00—Drugs for disorders of the blood or the extracellular fluid
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P9/00—Drugs for disorders of the cardiovascular system
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P9/00—Drugs for disorders of the cardiovascular system
- A61P9/04—Inotropic agents, i.e. stimulants of cardiac contraction; Drugs for heart failure
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
- C12N5/10—Cells modified by introduction of foreign genetic material
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/14—Hydrolases (3)
- C12N9/16—Hydrolases (3) acting on ester bonds (3.1)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
- C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y301/00—Hydrolases acting on ester bonds (3.1)
- C12Y301/03—Phosphoric monoester hydrolases (3.1.3)
- C12Y301/03016—Phosphoprotein phosphatase (3.1.3.16), i.e. calcineurin
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y301/00—Hydrolases acting on ester bonds (3.1)
- C12Y301/03—Phosphoric monoester hydrolases (3.1.3)
- C12Y301/03048—Protein-tyrosine-phosphatase (3.1.3.48)
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/68—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
- G01N33/6893—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids related to diseases not provided for elsewhere
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K2039/505—Medicinal preparations containing antigens or antibodies comprising antibodies
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N2500/00—Screening for compounds of potential therapeutic value
- G01N2500/02—Screening involving studying the effect of compounds C on the interaction between interacting molecules A and B (e.g. A = enzyme and B = substrate for A, or A = receptor and B = ligand for the receptor)
Definitions
- the present invention relates to polypeptides.
- the invention concerns phosphatase polypeptides, nucleotide sequences encoding the polypeptides, various products and assay methods that can be used for identifying compounds useful for the diagnosis and treatment of various phosphatase-related diseases and conditions, for example cell proliferative disorders.
- Cellular signal transduction is a fundamental mechanism whereby external stimuli that regulate diverse cellular processes are relayed to the interior of cells.
- One of the key biochemical mechanisms of signal transduction involves the reversible phosphorylation of proteins by protein kinases, which enables regulation of the activity of mature proteins by altering their structure and function.
- the best characterized eukaryotic protein kinases phosphorylate proteins on the alcohol moiety of serine, threonine and tyrosine residues. These kinases largely fall into two groups, those specific for phosphorylating serines and threonines, and those specific for phosphorylating tyrosines.
- the phosphorylation state of a given substrate also is regulated by the protein phosphatases, a class of proteins responsible for removal of the phosphate group added to a given substrate by a protein kinase.
- the protein phosphatases can also be classified as being specific for either serine/threonine or tyrosine. Protein phosphatases thus are a large family of enzymes that catalyze the dephosphorylation of proteins modified by phosphorylation of the hydroxyl-containing amino acids serine, threonine or tyrosine.
- Some members of this family are able to dephosphorylate only tyrosine (the protein tyrosine phosphatases), whereas others are able to dephosphorylate tyrosine as well as serine and threonine (dual-specificity phosphatases) .
- These proteins share a 250-300 amino acid domain that comprises the common catalytic core structure.
- Related phosphatases are clustered into distinct subfamilies of tyrosine phosphatases, dual-specificity phosphatases, and myotubularin-like phosphatases (Fauman EB, et al., Trends Biochem Sci. 1996 Nov;21 (11) : 413-7; Martell KJ, et al . , Mol Cells. 1998 Feb 28 ; 8 (1) : 2-11) .
- MTM MTM-like proteins.
- PTEN PTEN-like protein also is described. Classification of novel proteins as new members of established families has proven highly accurate not only in predicting motifs present in the remaining non-catalytic portion of each protein, but also in their regulation, substrates, and signaling pathways.
- Phosphatases have been implicated as regulating a variety of cellular responses, including response to growth factors, cytokines and hormones, oxidative-, UV-, or irradiation-related stress pathways, inflammatory signals (i.e. TNF) , apoptotic stimuli (i.e. Fas), T and B cell costimulation, the control of cytoskeletal architecture, and cellular transformation (see The Protein Phosphatase Factsbook, Nick Tonks, Shirish Shenolikar , Harry Charbonneau, Academic Pr, 2000)
- Phosphatases also possess a variety of non-catalytic domains that are believed to interact with upstream regulators. Examples include proline-rich domains for interaction with SH3-containing proteins, or specific domains for interaction with Rac, Rho, and Rab small G- proteins. These interactions may provide a mechanism for cross-talk between distinct biochemical pathways in response to external stimuli such as the activation of a variety of cell surface receptors, including tyrosine kinases, cytokine receptors, TNF receptor, Fas, T cell receptors, CD28, or CD40.
- the present invention relates to polypeptides, nucleic acids encoding such polypeptides, vectors, cells, tissues and animals containing such nucleic acids, antibodies to the polypeptides, assays utilizing the polypeptides, and methods relating to all of the foregoing.
- the polypeptides of the present invention are phosphatases.
- phosphatases include MKP-like proteins, CDC14-like proteins, PTEN-like proteins, and myotubularin (MTM) -like proteins. Classification of proteins as new members of established families has proven highly accurate not only in predicting motifs present in the remaining non-catalytic portion of each protein, but also in their regulation, substrates, and signaling pathways.
- an aspect of the invention features isolated, enriched, or purified nucleic acid molecules encoding polypeptides, preferably phosphatases.
- the invention includes an isolated, enriched or purified nucleic acid molecule encoding a phosphatase, wherein said nucleic acid molecule comprises a nucleotide sequence that (a) encodes a polypeptide having the amino acid sequence set forth in SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO:8, SEQ ID NO:10, SEQ ID NO:12, SEQ ID NO:14, SEQ ID NO:16, SEQ ID NO:18, SEQ ID NO:20, SEQ ID NO:22, SEQ ID NO:24, SEQ ID NO:26, SEQ ID NO:28, SEQ ID NO:30, SEQ ID NO:32, SEQ ID NO:34, SEQ ID NO:42, SEQ ID NO:38 or SEQ ID NO : 40 ;
- (b) is the complement of the nucleotide sequence of (a); (c) hybridizes under highly stringent conditions to the molecule of (b) and encodes a naturally occurring polypeptide;
- (d) encodes a polypeptide having the full length amino acid sequence set forth in SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO:6, SEQ ID NO:10, SEQ ID NO:12, SEQ ID NO:14, SEQ ID NO:16, SEQ ID NO:18, SEQ ID NO:20, SEQ ID NO:22, SEQ ID NO:26, SEQ ID NO:28, SEQ ID NO:30, SEQ ID NO:32, SEQ ID NO:34, SEQ ID NO:38, SEQ ID NO:40 or SEQ ID NO:42, except that it lacks at least one or more, but not all, of the contiguous set of numbered amino acid residues as set forth in the respective domain delimitations in any of the Figures;
- (e) is the complement of the nucleotide sequence of (d); (f) the amino acid sequence set forth in at least one of the respective sets of numbered amino acid residues set forth in any Figure;
- (g) is the complement of the nucleotide sequence of (f); (h) encodes a polypeptide having the full length amino acid sequence set forth in SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:10, SEQ ID NO: 12, SEQ ID NO:14, SEQ ID NO:16, SEQ ID NO:18, SEQ ID NO:20, SEQ ID NO:22, SEQ ID NO:26, SEQ ID NO:28, SEQ ID NO:30, SEQ ID NO:32, SEQ ID NO:34, SEQ ID NO:38, SEQ ID NO:40 or SEQ ID NO:42, except that it lacks one or more, but not all, of the domains selected from the group consisting of an N-terminal domain, a phosphatase domain and a C-terminal domain; (i) is the complement of the nucleotide sequence of (h);
- (j) has the nucleotide sequence set forth in SEQ ID NO:l, SEQ ID NO:3, SEQ ID NO:5, SEQ ID NO:7, SEQ ID NO:9, SEQ ID NO:ll, SEQ ID NO:13, SEQ ID NO:15, SEQ ID NO:17, SEQ ID NO:19, SEQ ID NO:21, SEQ ID NO:23, SEQ ID NO:25, SEQ ID NO:27, SEQ ID NO:29, SEQ ID NO:31, SEQ ID NO:33, SEQ ID NO:41, SEQ ID NO:37 or SEQ ID NO:39; or
- (k) is the complement of the nucleotide sequence set forth in (j).
- the nucleic acid is isolated, purified or enriched from a mammal, most preferably from a human .
- a phosphatase having an amino acid by administering to a patient an agent that modulates activity of a phosphatase having an amino acid according to the present invention, such as those identified in the attached figures in view of the teachings contained herein.
- an agent that modulates activity of a phosphatase having an amino acid due to the broad functional implications of various phosphatase families, such treatment may be effectuated to a wide range of diseases, including cancer, pathophysiological hypoxia, cardiovascular disorders, Papillon-Lefevre syndrome, Cowden disease, ectordermal dysplasia, Moebius syndrome, Bjornstad syndrome, Bannayan Zonana syndrome, schizophrenia and hamartomas .
- Treatment to various type of cancers as exemplified in
- Example 3 The method of the present invention may be used to treat breast cancer, urogenital cancer, prostate cancer, head and neck cancer, lung cancer, synovial sarcomas, renal cell carcinoma, non-small cell lung cancer, hepatocellular carcinoma, pancreatic endocrine tumors, stomach cancer, gliobastoma, colorectal cancer, and thyroid cancer.
- microarray expression analysis is performed to establish expression profiles of various phosphatase genes according to the invention, and thereby identify the ones whose expression correlates with certain diseased conditions . It should be appreciated that many ways of comparison and correlation analysis may be carried out based on expression data generated in the way similar to that described in Example 3, which become apparent to one skilled in the art based on the above discussion and which therefore fall in the scope of the invention. Inferences derived from those comparison and correlation analysis may similarly be used in substantiating the treatment method according to this invention.
- phosphatase genes are differentially expressed in certain diseased conditions, thereby form targets of the treatment method according to the present invention. That is, modulators or agents that are capable of regulating their activities, either in vivo or in vitro, may be identified and used in the treatment of the given diseased conditions.
- a phosphatase in a sample as a diagnostic tool for a disease or disorder using nucleotide probes derived from the phosphatase gene sequences disclosed in the present invention, such as those disclosed herein.
- diagnostic measures may be used for a wide range of diseases, including cancer, pathophysiological hypoxia, cardiovascular disorders, Papillon-Lefevre syndrome, Cowden disease, ectordermal dysplasia, Moebius syndrome, Bjornstad syndrome, Bannayan Zonana syndrome, schizophrenia and hamartomas. Of particular importance is diagnose of various type of cancers.
- the diagnostic method of the present invention may be used to test for breast cancer, urogenital cancer, prostate cancer, head and neck cancer, lung cancer, synovial sarcomas, renal cell carcinoma, non-small cell lung cancer, hepatocellular carcinoma, pancreatic endocrine tumors, stomach cancer, gliobastoma, colorectal cancer, and thyroid cancer .
- a phosphatase gene is determined in order to effect accurate diagnoses. Such determinations can be accomplished by performing microarray expression analysis according to one embodiment of this invention.
- the phosphatase genes whose expression correlates with certain diseased conditions may be identified by the procedure described herein.
- comparison and correlation analysis may be carried out based on expression data generated in the way similar to that described here; they also necessarily fall in the scope of the present invention. Inferences derived from those comparison and correlation analysis may similarly be used in substantiating the diagnostic method according to this invention.
- One scenario to be noted is when pairs of samples of normal tissues and diseased tissues are used to make the expression arrays, the data generated will specifically demonstrate which phosphatase genes are differentially expressed in certain diseased conditions, therefore may serve as diagnostic markers used in the aforementioned diagnostic method.
- a phosphatase in a sample as a diagnostic tool for a disease or disorder by comparing a nucleic acid target region of the phosphatase genes disclosed in the present invention, such genes encoding the amino acid sequences listed in Figure 2, with a control region; and then detecting differences in sequence or amount between the target region and control region as an indication of the disease or disorder.
- This method also may be used for diagnosing a wide range of diseases, including cancer, pathophysiological hypoxia, cardiovascular disorders, Papillon-Lefevre syndrome, Cowden disease, ectordermal dysplasia, Moebius syndrome, Bjornstad syndrome, Bannayan Zonana syndrome, schizophrenia and hamartomas.
- this particular method may similarly be used to test for breast cancer, urogenital cancer, prostate cancer, head and neck cancer, lung cancer, synovial sarcomas, renal cell carcinoma, non-small cell lung cancer, hepatocellular carcinoma, pancreatic endocrine tumors, stomach cancer, gliobastoma, colorectal cancer, and thyroid cancer.
- a target region can be any particular region of interest in a phosphatase gene, such as an upstream regulatory region. Variations of sequence in an upstream regulatory region in a family of phosphatase often have functional implications some of which may be significant in bringing about certain diseased conditions. Changes of the amount of a target region, e.g., changes of number of copies of a regulatory region such as a receptor-binding site, in certain phosphatase genes, may also represent mechanisms of functional differentiation and hence may be connected to certain diseased states. Detection of such differences in sequence and amount of a target region compared to a control region therefore may effectively lead to detection of a diseased condition.
- microarray studies may be used to identify the potential connections between a diseased condition and variations of a target region among a set of phosphatase genes.
- nucleic acid probes may be made that correspond to a given target region and a control region, respectively, of a phosphatase gene of interest.
- Samples from normal and diseased tissues are used to make microarray as discussed supra and in Example 3. Hybridization of these probes to the array so made will yield comparative profiles of the region of interest in the normal and diseased condition, and thus may derive a definition of differences of the target region and control region that is characterized of the disease in question.
- Such definition in turn may serve as an indication of the diseased condition as used in the second-mentioned diagnostic method according to the present invention. It should be appreciated that many equivalent or similar methods may be used in carrying out the diagnosis according to the invention which would become apparent to the skilled person in the art based on the example provided here, and therefore, they are covered in the scope of this invention. The invention is further illuminated by the following explanations.
- isolated in reference to a nucleic acid is meant, for example, a polymer of 14, 17, 21, 35, 50, 75, 100 or more nucleotides conjugated to each other, including DNA or RNA that is isolated from a natural source or that is synthesized.
- the isolated nucleic acid of the present invention is unique in the sense that it is not found in a pure or separated state in nature. Use of the term
- isolated indicates that a naturally occurring sequence has been removed from its normal cellular (e.g., chromosomal) environment. Thus, the sequence may be in a cell-free solution or placed in a different cellular environment. The term does not imply that the sequence is the only nucleotide sequence present, but that it is substantially free (about 90 - 95% pure at least) of non-nucleotide material naturally associated with it and thus is meant to be distinguished from isolated chromosomes.
- enriched in reference to nucleic acid is meant that the specific DNA or RNA sequence constitutes a significantly higher fraction (2 - 5 fold) of the total DNA or RNA present in the cells or solution of interest than in normal or diseased cells or in the cells from which the sequence was taken. This could be caused by a person or device by preferential reduction in the amount of other DNA or RNA present, or by a preferential increase in the amount of the specific DNA or RNA sequence, or by a combination of the two.
- “enriched” does not necessarily imply that there are no other DNA or RNA sequences present, just that the relative amount of the sequence of interest has been significantly increased.
- the term "significant" here is used to indicate that the level of increase is useful to the person making such an increase, and generally means an increase relative to other nucleic acids of about at least 2 fold, more preferably at least 5 to 10 fold or even more.
- the term also does not imply that there is no DNA or RNA from other sources.
- the other source DNA may, for example, comprise DNA from a yeast or bacterial genome, or a cloning vector such as pUC19. This term distinguishes the sequence from naturally occurring enrichment events, such as viral infection, or tumor type growths, in which the level of one mRNA may be naturally increased relative to other species of mRNA. That is, the term is meant to cover only those situations in which a person has intervened to elevate the proportion of the desired nucleic acid.
- nucleotide sequence be in purified form.
- purified in reference to nucleic acid does not require absolute purity (such as a homogeneous preparation) ; instead, it represents an indication that the sequence is relatively purer than in the natural environment (compared to the natural level this level should be at least 2-5 fold greater, e.g., in terms of mg/ml) .
- Individual clones isolated from a cDNA library may be purified to electrophoretic homogeneity.
- the claimed DNA molecules obtained from these clones can be obtained directly from total DNA or from total RNA.
- the cDNA clones are not naturally occurring, but rather are preferably obtained via manipulation of a partially purified naturally occurring substance (messenger RNA) .
- the construction of a cDNA library from mRNA involves the creation of a synthetic substance (cDNA) and pure individual cDNA clones can be isolated from the synthetic library by clonal selection of the cells carrying the cDNA library.
- the process which includes the construction of a cDNA library from mRNA and isolation of distinct cDNA clones preferably yields more than approximately 100 fold purification and more preferably yields an approximately 106-fold purification of the native message.
- purification of at least one order of magnitude, preferably two or three orders, and more preferably four or five orders of magnitude is expressly contemplated.
- the term is also chosen to distinguish clones already in existence which may encode phosphatases but which have not been isolated from other clones in a library of clones.
- nucleic acids that hybridize to any of the above sequences or functional derivatives (as defined below) of any of the above are also contemplated as part of the invention.
- the nucleic acid may be isolated from a natural source by cDNA cloning, enrichment hybridization and/or subtractive hybridization techniques; the natural source may be mammalian (human) blood, semen, or tissue and the nucleic acid may be synthesized by the triester or other method or by using an automated DNA synthesizer.
- hybridize refers to a method of interacting a nucleic acid sequence with a DNA or RNA molecule in solution or on a solid support, such as cellulose or nitrocellulose. If a nucleic acid sequence binds to the DNA or RNA molecule with high affinity, it is said to "hybridize” to the DNA or RNA molecule.
- the strength of the interaction between the probing sequence and its target can be assessed by varying the stringency of the hybridization conditions. Various low or high stringency hybridization conditions may be used depending upon the specificity and selectivity desired (see for example, Berger et al .
- hybridization assay conditions at least as stringent as the following: hybridization in 50% formamide, 5X SSC, 50 mM NaH 2 P0 4 , pH 6.8, 0.5% SDS, 0.1 mg/mL sonicated salmon sperm DNA, and 5X Denhart solution at 42 °C overnight; washing with 2X SSC, 0.1% SDS at 45 °C; and washing with 0.2X SSC, 0.1% SDS at 45 °C. More higly stringent conditions include 0. IX SSC, 0.05% SDS and 55 °C for the second wash.
- the nucleic acid is an isolated conserved or unique region, for example those useful for the design of hybridization probes to facilitate identification and cloning of additional polypeptides, or for the design of PCR probes to facilitate cloning of additional polypeptides.
- conserved nucleic acid regions it is meant regions present on two or more nucleic acids encoding a polypeptide, preferably a phosphatase polypeptide, to which a particular nucleic acid sequence can hybridize under lower stringency conditions. Examples of lower stringency conditions suitable for screening for nucleic acids encoding phosphatase polypeptides are provided in Abe, et al . J. Biol. Chem.
- conserved regions differ by no more than 5 out of 20 continguous nucleotides.
- unique nucleic acid region it is meant a sequence present in a full length nucleic acid coding for a phosphatase polypeptide that is not present in a sequence coding for any other known naturally occurring polypeptide. Such regions preferably comprise 14, 17, 21, 35, 50, 75, 100 or more contiguous nucleotides present in the full length nucleic acid encoding a phosphatase polypeptide.
- a unique nucleic acid region is preferably of human origin.
- a unique nucleic acid region may be identified by aligning the full length sequence of interest with a previously known sequence. The two sequences will each have a number of contiguous nucleotides that are identical to one another. A unique nucleic acid region will contain these contiguous nucleotides and one or more additional contiguous nucleotides from the full length sequence of interest.
- the invention also features a nucleic acid probe for the detection of a nucleic acid encoding a phosphatase polypeptide in a sample.
- the nucleic acid probe contains nucleic acid that will hybridize specifically to a sequence of, for example, at least 14, 17, 21, 35, 50, 75, 100 or more continguous nucleotides set forth in SEQ ID NO:l, SEQ ID NO:3, SEQ ID NO:5, SEQ ID NO:7, SEQ ID NO:9, SEQ ID NO:ll, SEQ ID NO:13, SEQ ID NO:15, SEQ ID NO:17, SEQ ID NO:19, SEQ ID NO:21, SEQ ID NO:23, SEQ ID NO:25, SEQ ID NO:27, SEQ ID NO:29, SEQ ID NO:31, SEQ ID NO:33, SEQ ID NO: 41, SEQ ID NO:37 or SEQ ID NO:39 or a complement or a functional derivative thereof.
- the probe is preferably at least 14, 17, 21, 35, 50
- the nucleic acid probe hybridizes to a nucleic acid encoding a polypeptide having the amino acid sequence set forth in at least one of the respective sets of numbered amino acid residues set forth in any Figure.
- Various low or high stringency hybridization conditions may be used depending upon the specificity and selectivity desired, as recited above. Under highly stringent hybridization conditions only highly complementary nucleic acid sequences hybridize. Preferably, such conditions prevent hybridization of nucleic acids having 1 or 2 mismatches out of 20 contiguous nucleotides.
- Methods for using the probes include detecting the presence or amount of phosphatase RNA in a sample by contacting the sample with a nucleic acid probe under conditions such that hybridization occurs and detecting the presence or amount of the probe bound to phosphatase RNA.
- the nucleic acid duplex formed between the probe and a nucleic acid sequence coding for a phosphatase polypeptide may be used in the identification of the sequence of the nucleic acid detected (for example see, Nelson et al., in Nonisotopic DNA Probe Techniques, p. 275 Academic Press, San Diego (Kricka, ed., 1992) hereby incorporated by reference herein in its entirety, including any drawings) .
- Kits for performing such methods may be constructed to include a container means having disposed therein a nucleic acid probe .
- the invention also features recombinant nucleic acid, preferably in a cell or an organism.
- the recombinant nucleic acid may contain a sequence encoding any of the posphatases set forth, or functional derivatives thereof, and a vector or a promoter effective to initiate transcription in a host cell.
- the recombinant nucleic acid can alternatively contain a transcriptional initiation region functional in a cell, a sequence complimentary to an RNA sequence encoding a phosphatase polypeptide and a transcriptional termination region functional in a cell.
- Another aspect of the invention features an isolated, enriched or purified polypeptide.
- the isolated, enriched or purified polypeptide is a phosphatase polypeptide.
- the polypeptide of the present invention comprises an amino acid sequence having
- the amino acid sequence set forth in at least one of the respective sets of numbered amino acid residues set forth in any Figure (d) the amino acid sequence set forth in SEQ ID NO: 2, SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:10, SEQ ID NO:12, SEQ ID NO:14, SEQ ID NO:16, SEQ ID NO:18, SEQ ID NO:20, SEQ ID NO:22, SEQ ID NO:26, SEQ ID NO:28, SEQ ID NO:30, SEQ ID NO:32 or SEQ ID NO:34, SEQ ID NO:38, SEQ ID NO:40 or SEQ ID NO: 42, except that it lacks at least one, but not all, of the following domains: an N-terminal domain, a C-terminal domain or a phosphatase domain.
- the phosphatase is isolated, purified or enriched from a mammal, most preferably from a human.
- phosphatase polypeptide it is meant an amino acid sequence substantially similar to the sequence shown in SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:8, SEQ ID NO:10, SEQ ID NO:12, SEQ ID NO:14, SEQ ID NO:16, SEQ ID NO:18, SEQ ID NO:20, SEQ ID NO:22, SEQ ID NO:24, SEQ ID NO:26, SEQ ID NO:28, SEQ ID NO:30, SEQ ID NO:32, SEQ ID NO:34, SEQ ID NO:42, SEQ ID NO:38 or SEQ ID NO:40, or fragments thereof.
- a sequence that is substantially similar will preferably have at least 90% identity (more preferably at least 95% and most preferably 99-100%) to the sequence of SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:8, SEQ ID NO:10, SEQ ID NO:12, SEQ ID NO:14, SEQ ID NO:16, SEQ ID NO:18, SEQ ID NO:20, SEQ ID NO:22, SEQ ID NO:24, SEQ ID NO:26, SEQ ID NO:28, SEQ ID NO:30, SEQ ID NO:32, SEQ ID NO:34, SEQ ID NO:42, SEQ ID NO:38 or SEQ ID NO:40.
- identity is meant a property of sequences that measures their similarity or relationship. Identity is measured by dividing the number of identical residues in the two sequences by the total number of residues and multiplying the product by 100. Thus, two copies of exactly the same sequence have 100% identity, but sequences that are less highly conserved and have deletions, additions, or replacements have a lower degree of identity. Those skilled in the art will recognize that several computer programs are available for determining sequence identity. Using standard parameters, for example Gapped BLAST or PSI-BLAST (Altschul, et al. (1997) Nucleic Acids Res. 25:3389-3402), BLAST (Altschul, et al . (1990) J. Mol. Biol. 215:403-410), and Smith-Waterman (Smith, et al. (1981) J. Mol. Biol. 147:195- 197) .
- isolated in reference to a polypeptide is meant, for example, a polymer of 6, 12, 18, 24, 30, 36, 50, 75, 100 or more amino acids conjugated to each other, including polypeptides that are isolated from a natural source or that are synthesized.
- the isolated polypeptides of the present invention are unique in the sense that they are not found in a pure or separated state in nature.
- Use of the term “isolated” indicates that a naturally occurring sequence has been removed from its normal cellular environment. Thus, the sequence may be in a cell-free solution or placed in a different cellular environment. The term does not imply that the sequence is the only amino acid chain present, but that it is essentially free (about 90 - 95% pure at least) of material naturally associated with it.
- enriched in reference to a polypeptide it is meant that the specific amino acid sequence constitutes a significantly higher fraction (2 - 5 fold) of the total of amino acids present in the cells or solution of interest than in normal or diseased cells or in the cells from which the sequence was taken. This could be caused by a person by preferential reduction in the amount of other amino acids present, or by a preferential increase in the amount of the specific amino acid sequence of interest, or by a combination of the two.
- enriched does not imply that there are no other amino acid sequences present, just that the relative amount of the sequence of interest has been significantly increased.
- the term significant here is used to indicate that the level of increase is useful to the person making such an increase, and generally means an increase relative to other amino acids of about at least 2 fold, more preferably at least 5 to 10 fold or even more.
- the term also does not imply that there is no amino acid from other sources.
- the other amino acid may, for example, comprise amino acid encoded by a yeast or bacterial genome, or a cloning vector such as pUC19. The term is meant to cover only those situations in which a person has intervened to elevate the proportion of the desired nucleic acid.
- an amino acid sequence be in purified form.
- purified in reference to a polypeptide does not require absolute purity (such as a homogeneous preparation); instead, it represents an indication that the sequence is relatively purer than in the natural environment (compared to the natural level this level should be at least 2-5 fold greater, e.g., in terms of mg/ml) .
- Purification of at least one order of magnitude, preferably two or three orders, and more preferably four or five orders of magnitude is expressly contemplated.
- the substance is preferably free of contamination at a functionally significant level, for example at least 90%, 95%, or 99% pure.
- the invention features an isolated, enriched, or purified polypeptide fragment, preferably a phosphatase polypeptide fragment.
- a phosphatase polypeptide fragment it is meant an amino acid sequence that is less than the full-length phosphatase amino acid sequence shown in SEQ ID NO:2, SEQ ID N0:4, SEQ ID NO:6, SEQ ID NO:8, SEQ ID NO:10, SEQ ID NO: 12, SEQ ID NO:14, SEQ ID NO:16, SEQ ID NO:18, SEQ ID NO:20, SEQ ID NO:22, SEQ ID NO:24, SEQ ID NO:26, SEQ ID NO:28, SEQ ID NO:30, SEQ ID NO:32, SEQ ID NO:34, SEQ ID NO:42, SEQ ID NO:38 or SEQ ID NO: 40.
- fragments include phosphatase domains, phosphatase mutants and phosphatase-specific epitopes or recombinant phosphatase polypeptide.
- a domain it is meant a portion of the polypeptide having homology to one or more known proteins wherein the sequence predicts some common function, interaction or activity.
- Polypeptide domains of the present invention include C-terminal domains, N-terminal domains and phosphatase domains (i.e., the catalytic domain as provided, alternatively, throghout the disclosure) .
- phosphatase domain refers to the region of the protein phosphatase that is responsible for excising a phosphate from a phosphorylated protein.
- N-terminal domain refers to the extracatalytic region located between the initiator methionine, or first amino acid if the N-terminal domain is partial, and the catalytic domain of the protein phosphatase.
- the N-terminal domain can be identified following a Smith-Waterman alignment of the protein sequence against the non-redundant protein database to define the N- terminal boundary of the catalytic domain. Depending on its length, the N-terminal domain may or may not play a regulatory role in phosphatase function.
- the C-terminal domain refers to the region located between the catalytic domain and the carboxy-terminal amino acid residue of the phosphatase.
- the C-terminal domain can be identified following a Smith-Waterman alignment of the protein sequence against the non-redundant protein database to define the C-terminal boundary of the catalytic domain.
- the C-terminal domain may or may not play a regulatory role in phosphatase function. In the present invention, either the N-terminal or C-terminal domain may encompass unidentified domains responsible for additional protein function.
- phosphatase mutant a phosphatase polypeptide which differs from the native sequence in that one or more amino acids have been changed, added and/or deleted. Changes in amino acids may be conservative or non- conservative. By “conservative” it is meant the substitution of an amino acid for one with similar properties such as charge, hydrophobicity, structure, etc.
- polypeptides encompassed by this term include, but are not limited to, (1) chimeric proteins which comprise a portion of a phosphatase polypeptide sequence fused to a non-phosphatase polypeptide sequence, for example a polypeptide sequence of hemagglutinin (HA) , (2) phosphatase proteins lacking a specific domain, for example the catalytic domain, and (3) phosphatase proteins having a point mutation.
- a phosphatase mutant will retain some useful function such as, for example, binding to a natural binding partner, catalytic activity, or the ability to bind to a phosphatase-specific antibody (as defined below) .
- phosphatase-specific epitope it is meant a sequence of amino acids that is both antigenic and unique to a phosphatase. Phosphatase-specific epitopes can be used to produce phosphatase-specific antibodies, as more fully described below.
- recombinant phosphatase polypeptide it is meant to include a polypeptide produced by recombinant DNA techniques such that it is distinct from a naturally occurring polypeptide either in its location (e.g., present in a different cell or tissue than found in nature) , purity or structure. Generally, such a recombinant polypeptide will be present in a cell in an amount different from that normally observed in nature.
- an antibody e.g. , a monoclonal or polyclonal antibody having specific binding affinity to a polypeptide or polypeptide fragment, the polypeptide preferably being a phosphatase.
- specific binding affinity is meant that the antibody binds to phosphatase polypeptides with greater affinity than it binds to other polypeptides under specified conditions.
- the antibody of the present invention has specific binding affinity to a phosphatase or a fragment thereof, wherein said phosphatase or fragment thereof has the amino acid sequence set forth in at least one of the respective sets of numbered amino acid residues set forth in any Figure.
- Antibodies having specific binding affinity to a phosphatase polypeptide may be used in methods for detecting the presence and/or amount of a phosphatase polypeptide in a sample by contacting the sample with the antibody under conditions such that an immunocomplex forms and detecting the presence and/or amount of the antibody conjugated to the phosphatase polypeptide.
- Diagnostic kits for performing such methods may be constructed to include a first container containing the antibody and a second container having a conjugate of a binding partner of the antibody and a label, such as, for example, a radioisotope .
- the diagnostic kit may also include notification of an FDA approved use and instructions therefor.
- the invention features a hybridoma which produces an antibody having specific binding affinity to a polypeptide of the present invention.
- hybrida is meant an immortalized cell line which is capable of secreting an antibody, for example a phosphatase antibody.
- the phosphatase antibody comprises a sequence of amino acids that is able to specifically bind the phosphatase molecules of the present invention.
- the invention encompasses a recombinant cell or tissue containing a purified nucleic acid coding for a polypeptide, preferably a phosphatase polypeptide.
- the recombinant cell of the present invention comprises a nucleic acid molecule, wherein said nucleic acid molecule encodes a phosphatase having the the amino acid sequence set forth in at least one of the respective sets of numbered amino acid residues set forth in any Figure or a functional equivalent thereof.
- the nucleic acid may be under the control of its genomic regulatory elements, or may be under the control of exogenous regulatory elements including an exogenous promoter.
- exogenous it is meant a promoter that is not normally coupled transcriptionally to the coding sequence for the phosphatase polypeptide in its native state.
- the invention features a method for identifying human cells containing a polypeptide or a related sequence.
- the method involves identifying the polypeptide in human cells using techniques that are routine and standard in the art, such as those described herein for identifying phosphatase (e.g., cloning, Southern or Northern blot analysis, in situ hybridization, PCR amplification, etc.).
- the invention also features methods of screening cells for natural binding partners of polypeptides.
- natural binding partner it is meant a protein that interacts with a polypeptide, preferably a phosphatase.
- Binding partners include ligands, agonists, antagonists and downstream signaling molecules such as adaptor proteins and may be identified by techniques well known in the art such as co- immunoprecipitation or by using, for example, a two-hybrid screen. (Fields and Song, U.S. Patent No. 5,283,173, issued February 1, 1994 and, incorporated be reference herein.)
- the present invention also features the purified, isolated or enriched versions of the polypeptides identified by the methods described above.
- the invention provides an assay to identify substances that modulate the activity of a polypeptide, preferably a phosphatase, comprising the steps of (a) contacting at least one phosphatase having the amino acid sequence set forth in at least one of the respective numbered amino acid residues as set forth in any Figure; (b) measuring an activity of the phosphatase; and
- Such assays may be performed in vitro or in vivo and can be obtained by modifying existing assays, such as the assays described in WO 96/40276, published December 19, 1996 and WO 96/14433, published May 17, 1996 (both incorporated herein by reference including any drawings) .
- Other possibilities include testing for phosphatase activity on standard substrates.
- the substances so identified may be enhancers or inhibitors of phosphatase activity and can be peptides, natural products (such as those isolated from fungal strains, for example) or small molecular weight chemical compounds.
- a preferred substance will be a compound with a molecular weight of less than 5,000, more preferably less than 1,000, most preferably less than 500.
- the assay and substances contemplated by the invention are discussed in more detail below.
- Another aspect of the invention is a method for identifying a substance that modulates a phosphatase activity in a cell comprising the steps of
- inhibitors of phosphatase activity can be tested as treatments for cell proliferative disorders such as leukemia or lymphoma using subcutaneous xenograph models in mice.
- a method for treating a disease or disorder comprising the step of administering to a patient in need of such a treatment a substance that modulates an activity of a polypeptide, preferably a phosphatase, having the amino acid sequence set forth in at least one of the respective numbered amino acid residues as set forth in any Figure.
- the disease or disorder may be cancer, pathophysiological hypoxia such as seen in cardiac disfunction and vascular disorders including atherosclerosis, stenosis and stroke, myopathies, congenital muscle disorders, Papillon-Lefevre syndrome, Cowden disease, ectodermal dysplasia, Moebius syndrome, Bjornstad syndrome, Bannayan-Zonana syndrome, glioblastoma, schizophrenia and hamartomas.
- pathophysiological hypoxia such as seen in cardiac disfunction and vascular disorders including atherosclerosis, stenosis and stroke, myopathies, congenital muscle disorders, Papillon-Lefevre syndrome, Cowden disease, ectodermal dysplasia, Moebius syndrome, Bjornstad syndrome, Bannayan-Zonana syndrome, glioblastoma, schizophrenia and hamartomas.
- the cancer may be breast cancer, glioblastoma, urogenital cancer, prostate cancer, head and neck cancer, lung cancer, synovial sarcomas, renal cell carcinoma, non-small cell lung cancer, hepatocellular carcinoma, pancreatic endocrine tumors, stomach cancer, colorectal cancer and thyroid cancer.
- Phosphatase activity may be stimulated and the method may modulate activity in vitro.
- a method for detection of a polypeptide, preferably a phosphatase, in a sample as a diagnostic tool for a disease or disorder comprising the steps of (a) contacting said sample with a nucleic acid probe which hybridizes under hybridization assay conditions to a nucleic acid which encodes a polypeptide having the amino acid sequence set forth in at least one of the respective sets of numbered amino acid residues set forth in any Figure; and
- the disease or disorder may be cancer, pathophysiological hypoxia such as seen in cardiac disfunction and vascular disorders including atherosclerosis, stenosis and stroke, myopathies, congenital muscle disorders, Papillon-Lefevre syndrome, Cowden disease, ectodermal dysplasia, Moebius syndrome, Bjornstad syndrome, Bannayan-Zonana syndrome, glioblastoma, schizophrenia and hamartomas.
- pathophysiological hypoxia such as seen in cardiac disfunction and vascular disorders including atherosclerosis, stenosis and stroke, myopathies, congenital muscle disorders, Papillon-Lefevre syndrome, Cowden disease, ectodermal dysplasia, Moebius syndrome, Bjornstad syndrome, Bannayan-Zonana syndrome, glioblastoma, schizophrenia and hamartomas.
- the cancer may be breast cancer, glioblastoma, urogenital cancer, prostate cancer, head and neck cancer, lung cancer, synovial sarcomas, renal cell carcinoma, non- small cell lung cancer, hepatocellular carcinoma, pancreatic endocrine tumors, stomach cancer, colorectal cancer and thyroid cancer.
- a method for detection of a polypeptide, preferably a phosphatase, in a sample as a diagnostic tool for a disease or disorder wherein said method comprises the steps of
- the disease or disorder may be cancer, pathophysiological hypoxia such as seen in cardiac disfunction and vascular disorders including atherosclerosis, stenosis and stroke, myopathies, congenital muscle disorders, Papillon-Lefevre syndrome, Cowden disease, ectodermal dysplasia, Moebius syndrome, Bjornstad syndrome, Bannayan-Zonana syndrome, glioblastoma, schizophrenia and hamartomas.
- pathophysiological hypoxia such as seen in cardiac disfunction and vascular disorders including atherosclerosis, stenosis and stroke, myopathies, congenital muscle disorders, Papillon-Lefevre syndrome, Cowden disease, ectodermal dysplasia, Moebius syndrome, Bjornstad syndrome, Bannayan-Zonana syndrome, glioblastoma, schizophrenia and hamartomas.
- the cancer may be breast cancer, glioblastoma, urogenital cancer, prostate cancer, head and neck cancer, lung cancer, synovial sarcomas, renal cell carcinoma, non- small cell lung cancer, hepatocellular carcinoma, pancreatic endocrine tumors, stomach cancer, colorectal cancer and thyroid cancer.
- Figure 1 shows a comparison of phosphatase polynucleotides of the invention. From left to right, each of the columns stands, respectively, for: a &b) the designation given each sequence by the inventors, c) the species of the isolated sequence, d & e) the SEQ ID NO:of the nucleotide and amino acid sequence, respectively, f) whether the ORF is full-length (FL) or encodes a full-length catalytic domain (CAT) , g) , h) and i) the Super-Family, Group and Family of the phosphatase, as defined by the text of the specificaton, j) and k) sequence length in nucleotides and amino acids, respectively, 1-n) ORF start and end and ORF length, respectively, o-r) DNA repeats, SNP position, chromosomal localization and whether "Expression" patterns are set forth in the specification;
- Figure 2 shows a comparison of phosphatases of the invention. From left to right, columns a) through e) are identical to those in Figure 1, above. Columns f) and g) recite the Group and Family, respectively, of the genes. Columns h) and i) identify the start and end of catalytic domains. Columns j) and k) recite the start and end of rhodanase domains. Columns 1) through q) recite nraa
- Figure 3 shows results from expression profiles. From left to right, columns a) and b) indicate the sample and source. Column c) identifies the tag, and d) the cell type. Column e) provides illustative comments. Columns f) through k) respectively identify the tumor-sym, normal-sym, tumor- lo, tumor cells, normal and p53. Column 1) provides activ values.
- Figure 4 shows nucleotide sequences according to the invention.
- Figure 5 shows amino acid sequences according to the invention .
- the present invention relates to the isolation and characterization of new polypeptides, nucleotide sequences encoding these polypeptides, various products and assay methods that can be used to identify compounds useful for the diagnosis and treatment of various polypeptide-related diseases and conditions, for example cancer.
- Polypeptides, preferably phosphatases, and nucleic acids encoding such polypeptides may be produced using well-known and standard synthesis techniques when given the sequences presented herein.
- the polypeptides described in the present invention belong to the dual-specificity group of protein phosphatases. This classification employs on the conserved core amino acid sequence motifs that make up the catalytic domain of this class of phosphatases.
- the unique signature motifs of the catalytic domain of the dual-specificity class of phosphatases is responsible for the ability of these enzymes to dephosphorylate phosphoserine/phosphothreonine as well phosphotyrosine residues.
- the dual-specificity group of protein phosphatases is divided into family members that include the Cdcl4 phosphatases, MAP kinase phosphatases (MKP) , myotubularins (MTM) , a subclass of the MTM represented by Sbf1 that act as anti-phosphatases, low molecular weight (LMW) Cdc25-like phosphatases and PTEN, the lipid phosphatases.
- MLMW low molecular weight
- the phosphatases featured in the present invention belong to the following distinct families of dual-specificity phosphatases: Cdcl4, MKP4, MTM, MTM- like SBF1 class of antiphosphatases and PTEN.
- a description of the structural and functional characteristics for the known family prototypes, together with a summary of the closest homologs of each phosphatase taken from data presented in Figure 3 is presented below.
- Cdcl4 family of dual-specific phosphatases is named after its founding member, the Cdcl4 phosphatase from Saccharomyces cerevisiae, an enzyme that plays a key role in the regulation of the mitotic exit pathway of the cell cycle.
- Cdcl4Al AF064102
- Cdcl4Bl AF064105
- the catalytic domains of these phosphatases (138 and 135 amino acids in length, respectively) exhibit 72% sequence identity.
- Flanking the catalytic region are relatively long N-terminal (195 and 230 amino acids in Cdcl4Al and Cdcl4Bl, respectively) and C- terminal domains (291 and 132 amino acids in Cdcl4Al and Cdcl4Bl, respectively) .
- the N-terminal domain of Cdcl4 appears to be highly conserved between human as well as distant evolutionary homologs, showing 65%, 41% and 35% sequence identity over 178, 193 and 193 amino acids to human Cdcl4Bl, C. elegans (U28739) and yeast (Q00684) Cdcl4, respectively.
- the C-terminal domain of Cdcl4 exhibits a lower level of sequence conservation than the N-terminal domain, i.e. 35% identity over 151 amino acids between human Cdcl4Al and Cdcl4Bl and no detectable homology to the equivalent regions from yeast and C. elegans Cdcl4.
- the functional significance of the highly conserved N-terminal domain of Cdcl4 is .unknown but it is possible that this domain participates in protein-protein interactions that regulate the activity as well as subcellular distribution of Cdcl4 as described next.
- Cdcl4 is part of a nucleolar protein complex called RENT (regulator of nucleolar silencing and telophase) that contains the proteins Netl (also called Cfi) and Sir2. From Gl through anaphase Cdcl4 is found sequestered in the nucleolus where its enzymatic activity is inhibited by Netl. In late anaphase Cdcl4 dissociates from the RENT complex in a step dependent on the GTPase Teml (Shou W. et al . (1999) Cell 16: 233-44) . The released Cdcl4 relocalizes to the nucleus where it inactivates the mitotic CDKs.
- RENT regulatory of nucleolar silencing and telophase
- Cdcl4-mediated CDK inactivation is believed to occur via two mechanisms.
- APC anaphase-promoting complex
- Cdcl4 stimulates Clb breakdown by dephosphorylating the APC- specific factor Cdhl.2 (also called Hctl) .
- Cdcl4 binds to CDKs inhibiting their activity.
- Cdcl4 activates Sicl transcription by dephosphorylating the Sicl transcription factor Swi5.
- Cdcl4 enhances the stability of the Sicl protein by dephosphorylating it (Visintin, R.et al . (1999) Nature 398:818-23) .
- the 154 amino acid partial murine AA023073 (SEQ ID. NO:2) is thought to be closest to Z83760, a putative open reading frame (ORF) from the ascidian organism ciona intestinalis, with 68% identity over 59 amino acids corresponding to the catalytic domain.
- the next closest homolog to AA023073 is believed to be human Cdcl4B2 (AF064105) with 40% identity over 65 amino acids.
- AA023073 has the conserved features of a dual-specificity phosphatase including a catalytic cysteine.
- a human orthologue of the murine AA023073 exists in the form of the EST AF086553 with 94% amino acid sequence identity to AA023073 over 115 amino acids.
- the putative phosphatase encoded by AA023073 is predicted to be a catalytically active phosphatase. Based on its homology to Cdcl4, AA023073 may function in mitotic regulation.
- MKP MAP kinase phosphatases
- DUS1 also known as MPK- 1, CL100, PTPN-10, erp, VH1 or 3CH134
- DUS3 also known as VHR
- DUS4 also known as HVH2, TYPl, MKP2 or VH2
- DUS5 also known as HVH3, B23, VH3 .
- DUS6 also known as PYST1, MKP3, rVH6
- DUS7 also known as PYST2
- CDKN3 also known as CDKN3, KAP, CIP2 or CDI1
- VH5 and STYX.
- Structurally MKPs consist of two domains, an N- and a C-terminal catalytic domain.
- the N-terminal domain ranges in size from about 147 to about 206 amino acids and exhibits limited homology (28-47%) among the various family members.
- the N-terminal region of MKP' s features two pockets of homology termed CH2 domains as well as a 126 amino acid rhodanase-like motif; these features are conserved with the Cdc25 phosphatase and serve an unknown function.
- the catalytic domain of the MKP family members varies in size from about 147 to about 206 amino acids and displays 40-74% amino acid sequence identity.
- MKP phosphatases are capable of inactivating through a dephosphorylation reaction kinases that participate in the MAPK pathways.
- the ERK (extracellular signal-regulated kinase) , JNK/SAPK (c-Jun N-terminal kinase/stress-activated protein kinase) and p38 MAP kinase pathways mediate the signal transduction events that are responsible for cell division, differentiation or apoptosis in response to extracellular ligands (Cobb M.H., Prog Biophys. Mol. Biol. (1999) 71:479-500).
- Full MAP kinase enzymatic activation requires the concomitant phosphorylation by selective upstream dual-specificity kinases of threonine and tyrosine residues residing in the activation loop of the MAP kinases.
- MKP family dual- specificity phosphatases mediate MAP kinase inactivation by dephosphorylating these threonine and tyrosine residues. This mechanism provides negative feedback regulation to the MAP kinase pathways.
- MKPs may play a significant role in human cancer by attenuating MAP kinase cascades involved in cellular transformation.
- MKPs appear to be as ubiquitous in their phylogenetic distribution as their MAP kinase counterparts with multiple members present in yeast (e.g. YVH1), C. elegans ( e.g. Y042), Drosophila, ( e.g. puckered ), plants ( e.g. DsPTPl) and mammals.
- the primary mode of action of MKPs isolated from different species appears to be MAPK dephosphorylation thereby providing negative feedback to the MAPK signal transduction pathways .
- MKPs may play an important role during pathophysiological hypoxia as suggested by the induction of MKP-1 gene expression under low oxygen conditions (Laderroute, K. R. (1999) J. Biol. Chem. 274:12890-12897).
- Tumor hypoxia is directly linked to the onset of angiogenesis during malignant progression (Hanahan, D. et al. (1996) Cell 86:353-364 and Mazure, N.M. et al. (1996) Cancer Res. 56:3436-3440).
- HSF-1 heat shock transcription factor-1
- MKP-1 transcripts and protein have been shown to be upregulated in early-stage carcinomas well as in multiple stages of breast and prostate carcinomas ( e.g. Leav, I. et al . (1996) Lab. Invest. 75: 361-370) .
- MKP-1 The role of enhanced MKP-1 expression in cancer has not been elucidated. Since hypoxic conditions are known to trigger apoptosis via the activation of the JNK pathway (reviewed in Ip, Y.T. et al . (1998) Curr. Opin . Cell Biol. 10:205-219) and MAPK phosphatases provide negative feedback to this pathway, it is conceivable that MKP-1 supports tumor growth by blocking apoptosis. The dephosphorylation and subsequent inactivation of ERK-1 and ERK-2 by MAPK phosphatases may also be responsible for suppressing angiogenic vascular endothelial cell proliferation by angiostatin ( Redlitz, A. et al . (1999) J. Vase. Res 36:28- 34) .
- angiostatin Redlitz, A. et al . (1999) J. Vase. Res 36:28- 34
- the MKP phosphatases of the present invention may have as their primary function negative feedback regulation of MAPK signal transduction. Since there is precedence for selectivity in the mechanism of action at the level of substrate recognition, subcellular localization and tissue distribution among the known MKPs, the MKPs described may display similar selectivity. The MKPs may also play a role in suppressing apoptosis by blocking the JNK/SAPK pathway during pathological hypoxia such as that occurring in angiogenic tumors. The development of specific phosphatase inhibitors that target the anti-apoptotic MKPs may prove valuable as an approach to cancer therapy.
- SGP033 The 176 amino acid human protein coded for by SGP033 (AA Seq ID#26) is 50% identical to the known human dual specificity phosphatase MKPl-like (NP_008957) . It has two regions of repeat DNA (323-341, 541-559, Figure 1) . SGP033 (AA Seq ID#26) has been mapped to human chromosomal region 2q33-q37.2.
- the 163 amino acid murine protein AA030322 (AA Seq ID#04) is 31% identical to the human MKPl-like phosphatase NP_008957. It is the murine orthologue to human SGP033 (AA Seq ID#26) , with 80% identity in 158 aa overlap. AA030322 (NA Seq ID#03) contains a repeat region at nucleotide position 95-114.
- the 184 amino acid full length human gene AA374753 (AA SEQ ID#12) shares 56% amino acid identity to the dual specificity phosphatase CG10089, a gene product from Drosophila melanogaster . This gene is expressed in fetal brain, testis and thy us .
- the 184 amino acid gene AA103595 (AA SEQ ID #6) is the murine orthologue of human AA374753 (AA SEQ ID #12) with 94% identity over 184 amino acids.
- the 198 amino acid full length human LOC51207 (AA SEQ ID#18) is closely related to the public sequence DUS13 protein phosphatase NP_057448 [Homo sapiens], with 99% identity over 198 amino acids. LOC51207 maps to human chromosome 10q21.3.
- the 198 amino acid full length murine AA144705 (AA SEQ ID#08) is the murine orthologue to the 198 amino acid full-length human LOC51207 (AA SEQ ID#18) with 88% identity over 198 amino acids.
- the 217 amino acid full length human AI031656 (AA SEQ ID#28) is closest to the predicted ORF AAF67187, MAP kinase phosphatase-1 [Drosophila melanogaster] , with 41% identity over 78 amino acids. The expression is higher in tumor samples than in normal samples.
- the 220 amino acid murine AA274457 (AA SEQ ID#10) is closely related to the 217 amino acid human AI031656 (AA SEQ ID# 28) with 84% identity over 212 amino acids.
- NA SEQ ID#29 maps to chromosome lq32.1 and has a repeat region between nucleotides 102-152.
- the 218 amino acid murine AA396428 (AA SEQ ID#14) is closest to the 482 amino acid human MKP5 (AA SEQ ID#30) with 95% identity over 154 amino acids. It is the murine MKP5.
- the 340 amino acid human YVH1 (AA923158, AA SEQ ID#24) is identical to the 340 amino acid public sequence NP_009171. This gene maps to chromosomal position Iq21-q22.
- the 339 amino acid murine AA422661 (AA SEQ ID#16) is closest to the 340 amino acid human YVH1 (AA SEQ ID# 24) with 84% identity over 339 amino acids.
- AA813123 (AA SeqID#20) is 95% identical over 190 amino acids to the public sequence AAD33910, MKP-like protein phosphatase [Homo sapiens].
- AA813123 (NA SeqID#19) has two repeat regions (11-28; 187- 204), and the gene maps to human chromosomal position Xpll.4-ql2.
- the 188 amino acid human gene AA915932 (AA Seq ID#22) is 50% identical to the public sequence NP_008957, MKP-1 like [Homo sapiens] .
- the DNA sequence (NA Seq ID#21) has a repeat region at position 410-427, and the gene maps to human chromosome 22ql2.1-qter .
- NP_060746 has- a repeat region at sequence 915-938; it maps to human chromosome Ilql2-ql3.2 and is expressed at a high level in fetal brain and testis.
- MTMs have been shown to be capable of dephosphorylating phosphoserine and phosphotyrosine residues (Laporte, J. et al. (1998) Human Molecular Genetics, 7:1703-1712).
- Structurally MTMs consist of a central 200 amino acid catalytic region flanked by N-terminal and C-terminal domains that range in size between 250-400 and 50-300, respectively, among the mammalian, yeast and elegans MTMs.
- Sbfl contains a similar domain structure as MTM except that its 200 amino acid central MTM catalytic-like region is flanked by a much longer N-terminal domain (1160 amino acids) and by a similar size C-terminal domain (335 amino acids) .
- MTM family members including Sbfl
- the N- and C-terminal domains conserve two and one, pockets of homology, respectively.
- the functional role of the conserved regions is unknown.
- the lack of a predicted transmembrane domain in any of the MTMs as well as in Sbfl suggests that these proteins localize to and function within the intracellular environment.
- the tissue distribution of all the known human MTMs is ubiquitous except for MTMR7 appears to be confined to brain (Laporte, J. et al. (1998) Hum. Mol. Genetics 7:1703-1712).
- Sbfl an important subclass of the MTM family of dual-specificity phosphatases represented by Sbfl is enzy atically inactive and may function biologically as an anti-phosphatase, an activity which may be responsible for its oncogenic potential (Cui, X. et al. (1998) Nature Genetics 18:331-337).
- Sbfl lacks the conserved HCSDGW signature motif required for catalysis having instead the sequence GLEDGW.
- Sbfl contains a helix-turn- helix region located between 68-92 residues C-terminal to the GLEDGW motif.
- This motif defines the SID (SET protein- interaction domain) domain which mediates the interaction between Sbfl and SET-binding factors such as the proto- oncogene Hrx, the mammalian homoloque of drosophila trithorax (Trx) .
- SET Sud3-9, Enhancer-of zeste, Trithorax
- -binding factors such as human Hrx and drosophila Trx and enhancer of zeste are proteins that participate in gene regulation (Cui, X. et al . (1998) Nature Genetics 18:331-337).
- the mechanism of anti-phosphatase action by Sbfl may involve direct competition with MTMs for substrates or, alternatively, this protein may function as an adaptor molecule with affinity for phosphorylated proteins.
- MTM1 myotubularin
- XLMTM X-linked myotubular myopathy
- MTM1 is conserved from yeast [i.e. scMTMH in S. cerevisiae (Z49610)] to mammals with 8 MTM family members identified in humans (Laporte J, et al . Hum Mol Genet.
- MTM mutations may not be limited to MTM1 since other human MTM genes are located in chromosomal loci associated with a wide range of conditions.
- human MTMR2 (llq22) maps within the locus for Papillon-Lefevre syndrome (PLS) (OMIM 245000), a syndrome associated with premature periodontal destruction of the teeth;
- human MTMR6 (13ql2) is a candidate for ectodermal dysplasia (OMIM 129500) and Moebius syndrome (OMIM 157900) .
- studies with murine syntenic counterparts of various human MTM genes reveal additional potential disease association for this class of phosphatases.
- Human MTMR3 corresponds to the mouse mutants belted and dilution-peru, human MTMR5 to gray tremor (gt) and human MTMR7 to disorganization (ds) and wobbler-lethal (wl) (Laporte, J. et al (1998) Human Mol. Genetics 7: 1703- 1712) .
- MTM1 genes are associated with disease.
- the pathological consequences of MTM mutations may not be limited to MTM1 since other human MTM genes are located in chromosomal loci associated with a wide range of conditions.
- human MTMR2 (llq22) maps within the locus for Papillon-Lefevre syndrome (PLS) (OMIM 245000) , a syndrome associated with premature periodontal destruction of the teeth;
- human MTMR6 13ql2 is a candidate for ectodermal dysplasia (OMIM 129500) and Moebius syndrome (OMIM 157900) .
- Human MTMR3 corresponds to the mouse mutants belted (bt) and dilution-peru (dp) , human MTMR5 to gray tremor (gt) and human MTMR7 to disorganization (ds) and wobbler-lethal (wl) (Laporte, J. et al . (1998) Human Mol. Genetics 7: 1703-1712).
- AA232238 and AA251929 belong to the Sbfl MTM-like family of anti-phosphatases .
- the potential ORFs encoded by these genes lack the canonical HCS motif required for catalytic activity in dual-specificity phosphatases, yet they display homology to MTM' s as summarized below.
- AA232384 and AA251929 may possess a SID domain at an equivalent position as found in Sbfl that may participate in binding to SET domain proteins.
- the third MTM-like gene human AA663875, lacks a catalytic domain but bears strong homology to the N-terminal domain of the MTM-like protein (CAB38778.1) that contains the catalytic HCS signature motif. Hence, AA663875 is predicted to encode an enzymatically active MTM-like phosphatase.
- the 400 amino acid full-length human AA23238 (SEQ ID NO: 34) is thought to be closest to MTM6 (AF072928) and MTMl (AF002223) with 43 and 42% sequence identity over 114 and 126 amino acids, respectively.
- the 52 amino acid partial human AA251929 (SEQ ID NO: 36) is believed to be closest to human MTM3 (U58034) with 49% identity over 41 amino acids.
- the 138 amino acid partial human AA663875 (SEQ ID NO: 38) is thought to be closest to an MTM-like ORF predicted from human chromosome X at qll.2-12 (CAB38778.1) with 48% identity over 89 amino acids.
- the MTM phosphatase and MTM-like antiphosphatases described in the present invention are likely to play central roles in the regulation of signalling pathways involved in cell differentiation, cell division and apoptosis .
- the tumor suppressor PTEN (also known as MMAC1 or TEP1) is the prototypical member of the PTEN family of a new and unusual class of enzymes that act as lipid phosphatases. PTEN was first discovered as a tumor suppressor gene isolated from human glioblastomas (Li, J. et al. (1997) Science 275:1943-1947) and named after recognizing its homology to tensin and auxillin. The PTEN gene (10q23) is mutated in patients with Cowden disease (CD) (OMIM 158350) and Bannayan-Zonana syndrome (153480), conditions characterized by multiple hamartomas. CD patients are at increased risk of developing malignancies of multiple tissue origins including breast, urogenital, digestive and thyroid (e.g. Nelen, M.R. (1999) Europ . J. Hum Genet . 7:267-73).
- CD Cowden disease
- 153480 Bannayan-Zonana syndrome
- PTEN expression inhibits the growth and tumorigenicity of human glioblastoma cells (Li, D.M. et al . (1998) Proc. Nat. Acad. Sci. 95: 15406-15411).
- the growth suppression activity of PTEN is mediated by its ability to block cell cycle progression in the GI phase.
- PTEN modulates GI cell cycle progression through negative regulation of the PI3- kinase (PI3K) /Akt pathway by dephosphorylating the phospholipid phosphatidylinositol (3, 4 , 5) -triphosphate (PIP3) , the activator of AKT.
- PI3K PI3- kinase
- Akt phospholipid phosphatidylinositol
- PTEN is phylogenetically conserved having close homologs in yeast (YNL128W) , C. elegans (daf-18, CAA10315) (Mihaylova V. T. et al . (1999) Proc Natl Acad Sci. 96:7427- 32) and mammals.
- DAF-18 acts as a negative regulator of the DAF-2 and AGE-1 (PI3K/Akt) signaling pathway, consistent with the notion that DAF-18 acts a phosphatidylinositol 3, 4, 5-triphosphate phosphatase in vivo.
- PTEN1 U92436
- PTEN2 AF01083
- the activity of PTEN as a phosphoinositide phosphatase is likely to play a pivotal role in the attenuation of diverse signalling downstream pathways.
- the 357 amino acid human AA493915 (AA SEQ ID#40) is 65% identical over 357 amino acids to human TPTE, or "transmembrane phosphatase with tensin homology", NP_037447.
- the novel PTEN-like phosphatase represented by human AA493915 may have, like PTEN, tumor suppressor function.
- AA493915 (AA SEQ ID#40) may prove valuable in signalling events that mediate cell growth and apoptosis as well as in the design of novel therapeutic agents to treat cancer. Exression of AA493915 in many tissues including cerebellum, pituitary, prostate, fetal brain and fetal lung, as shown in Figure 3.
- polypeptide and nucleotide sequences of the invention can be used, therefore, to identify modulators of cell growth and survival which are useful in developing therapeutics for various cell proliferative disorders and conditions, and in particular cancers related to inappropriate phosphatase activity.
- Assays to identify compounds that act intracellularly to enhance or inhibit phosphatase activity can be developed by creating genetically engineered cell lines that express phosphatase nucleotide sequences, as is more fully discussed below.
- nucleic acid sequences encoding a polypeptide. Included within the scope of this invention are the functional equivalents of the herein-described isolated nucleic acid molecules. Functional equivalents or derivatives can be obtained in several ways. The degeneracy of the genetic code permits substitution of certain codons by other codons which specify the same amino acid and hence would give rise to the same protein.
- the nucleic acid sequence can vary substantially since, with the exception of methionine and tryptophan, the known amino acids can be coded for by more than one codon.
- portions or all of the polypeptide genes could be synthesized to give a nucleic acid sequence significantly different from that shown in SEQ ID NO:l, SEQ ID NO: 3, SEQ ID NO:5, SEQ ID NO : 7 , SEQ ID NO:9, SEQ ID NO:ll, SEQ ID NO:13, SEQ ID NO:15, SEQ ID NO:17, SEQ ID NO:19, SEQ ID NO:21, SEQ ID NO:23, SEQ ID NO:25, SEQ ID NO:27, SEQ ID NO:29, SEQ ID NO:31, SEQ ID NO:33, SEQ ID NO:41, SEQ ID NO: 37 or SEQ ID NO: 39.
- the encoded amino acid sequence thereof would, however, be preserved.
- nucleic acid sequence may comprise a nucleotide sequence which results from the addition, deletion or substitution of at least one nucleotide to the 5 • -end and/or the 3 ' -end of the nucleic acid formula shown in any of SEQ ID N0:1, SEQ ID NO:3, SEQ ID NO:5, SEQ ID NO:7, SEQ ID NO:9, SEQ ID NO:ll, SEQ ID NO:13, SEQ ID NO:15, SEQ ID NO:17, SEQ ID NO:19, SEQ ID NO:21, SEQ ID NO:23, SEQ ID NO:25, SEQ ID NO:27, SEQ ID NO:29, SEQ ID NO:31, SEQ ID NO:33, SEQ ID NO:41, SEQ ID NO:37 or SEQ ID NO:39 or a derivative thereof.
- nucleotide or polynucleotide may be used in this regard, provided that its addition, deletion or substitution does not alter the amino acid sequence of SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:8, SEQ ID NO:10, SEQ ID NO:12, SEQ ID NO:14, SEQ ID NO:16, SEQ ID NO:18, SEQ ID NO:20, SEQ ID NO:22, SEQ ID NO:24, SEQ ID NO:26, SEQ ID NO:28, SEQ ID NO:30, SEQ ID NO:32, SEQ ID NO:34, SEQ ID NO:42, SEQ ID NO:38 or SEQ ID NO:40 which is encoded by the nucleotide sequence.
- the present invention is intended to include any nucleic acid sequence resulting from the addition of ATG as an initiation codon at the 5 ' -end of the nucleic acid sequence or its functional derivative, or from the addition of TTA, TAG or TGA as a termination codon at the 3 ' -end of the inventive nucleotide sequence or its derivative.
- the nucleic acid molecule of the present invention may, as necessary, have restriction endonuclease recognition sites added to its 5 ' -end and/or 3 '-end.
- Such functional alterations of a given nucleic acid sequence afford an opportunity to promote secretion and/or processing of heterologous proteins encoded by foreign nucleic acid sequences fused thereto. All variations of the nucleotide sequence of the phosphatase genes and fragments thereof permitted by the genetic code are, therefore, included in this invention.
- the two polypeptides are functionally equivalent, as are the two nucleic acid molecules which give rise to their production, even though the differences between the nucleic acid molecules are not related to degeneracy of the genetic code.
- Functional equivalents or derivatives of polypeptides can also be obtained using nucleic acid molecules encoding one or more functional domains of the polypeptide.
- the catalytic domain of phosphatases function as an enzymatic remover of phosphate molecules bound onto tyrosine and/or serine/threonine amino acids and a nucleic acid sequence encoding the catalytic domain alone or linked to other heterologous nucleic acid sequences can be considered a functional derivative of phosphatases.
- a nucleic acid probe of the present invention may be used to probe an appropriate chromosomal or cDNA library by art recognized hybridization methods to obtain another nucleic acid molecule of the present invention.
- a chromosomal DNA or cDNA library may be prepared from appropriate cells according to recognized methods in the art (e.g. "Molecular Cloning: A Laboratory Manual", second edition, edited by Sambrook, Fritsch, & Maniatis, Cold Spring Harbor Laboratory, 1989) .
- nucleic acid probes having nucleotide sequences which correspond to N-terminal and C-terminal portions of the amino acid sequence of the polypeptide of interest.
- the synthesized nucleic acid probes may be used as primers in a polymerase chain reaction (PCR) carried out in accordance with recognized PCR techniques, essentially according to PCR Protocols, "A Guide to Methods and Applications", edited by Michael et al . , Academic Press, 1990, utilizing the appropriate chromosomal or cDNA library to obtain the fragment of the present invention.
- PCR polymerase chain reaction
- hybridization probes of the present invention can be labeled by standard labeling techniques such as with a radiolabel, enzyme label, fluorescent label, biotin-avidin label, chemiluminescence, and the like. After hybridization, the probes may be visualized using known methods.
- the nucleic acid probes of the present invention include RNA as well as DNA probes and nucleic acids modified in the sugar phosphate or even the base portion as long as the probe still retains the ability to specifically hybridize under conditions as disclosed herein. Such probes are generated using techniques known in the art.
- the nucleic acid probe may be immobilized on a solid support. Examples of such solid supports include, but are not limited to, plastics such as polycarbonate, complex carbohydrates such as agarose and sepharose, acrylic resins, such as polyacrylamide and latex beads, and nitrocellulose.
- test samples suitable for nucleic acid probing methods of the present invention include, for example, cells or nucleic acid extracts of cells, or biological fluids.
- the sample used in the above-described methods will vary based on the assay format, the detection method and the nature of the tissues, cells or extracts to be assayed. Methods for preparing nucleic acid extracts of cells are well known in the art and can be readily adapted in order to obtain a sample which is compatible with the method utilized.
- a Probe Based Method And Kit For Detecting Polypeptides One method of detecting the presence of polypeptides in a sample comprises (a) contacting the sample with the above- described nucleic acid probe, under conditions such that hybridization occurs, and (b) detecting the presence of the probe bound to the nucleic acid molecule.
- One skilled in the art would select the nucleic acid probe according to techniques known in the art as described above. Samples to be tested include but should not be limited to RNA samples of human tissue. In preferred embodiments, high stringency hybridization conditions are used.
- a kit for detecting the presence of a polypeptide in a sample comprises at least one container having disposed therein the above-described nucleic acid probe.
- the kit may further comprise other containers comprising one or more of the following: wash reagents and reagents capable of detecting the presence of bound nucleic acid probe.
- detection reagents include, but are not limited, to radiolabelled probes, enzymaticly labeled probes (e.g. horseradish peroxidase, alkaline phosphatase) , and affinity labeled probes (e.g. biotin, avidin, or steptavidin) .
- a compartmentalized kit includes any kit in which reagents are contained in separate containers.
- Such containers include small glass containers, plastic containers or strips of plastic or paper.
- Such containers allow the efficient transfer of reagents from one compartment to another compartment such that the samples and reagents are not cross-contaminated and the agents or solutions of each container can be added in a quantitative fashion from one compartment to another.
- Such containers will include a container which will accept the test sample, a container which contains the probe or primers used in the assay, containers which contain wash reagents (such as phosphate buffered saline, Tris-buffers, and the like) , and containers which contain the reagents used to detect the hybridized probe, bound antibody, amplified product, or the like.
- wash reagents such as phosphate buffered saline, Tris-buffers, and the like
- the present invention also relates to a recombinant DNA molecule comprising, 5' to 3 ' , a promoter effective to initiate transcription in a host cell and the above- described nucleic acid molecules.
- the present invention relates to a recombinant DNA molecule comprising a vector and a nucleic acid molecule described herein.
- the present invention also relates to a nucleic acid molecule comprising a transcriptional region functional in a cell, a sequence complimentary to an RNA sequence encoding an amino acid sequence corresponding to a polypeptide or functional derivative, and a transcriptional termination region functional in said cell.
- the above-described molecules may be isolated and/or purified DNA molecules.
- the present invention also relates to a cell or organism that contains a nucleic acid molecule as described herein and thereby is capable of expressing a peptide.
- the polypeptide may be purified from cells which have been altered to express the polypeptide.
- a cell is said to be "altered to express a desired polypeptide" when the cell, through genetic manipulation, is made to produce a protein which it normally does not produce or which the cell normally produces at lower levels.
- One skilled in the art can readily adapt procedures for introducing and expressing either genomic, cDNA, or synthetic sequences into either eukaryotic or prokaryotic cells.
- a nucleic acid molecule such as DNA, is said to be "capable of expressing" a polypeptide if it contains nucleotide sequences which contain transcriptional and translational regulatory information and such sequences are “operably linked” to nucleotide sequences which encode the polypeptide.
- An operable linkage is a linkage in which the regulatory DNA sequences and the DNA sequence sought to be expressed are connected in such a way as to permit gene sequence expression.
- the precise nature of the regulatory regions needed for gene sequence expression may vary from organism to organism, but will in general include a promoter region which, in prokaryotes, contains both the promoter (which directs the initiation of RNA transcription) as well as the DNA sequences which, when transcribed into RNA, will signal synthesis initiation.
- Such regions will normally include those 5 ' -non-coding sequences involved with initiation of transcription and translation, such as the TATA box, capping sequence, CAAT sequence, and the like.
- the non-coding region 3' to the sequence encoding a polypeptide gene may be obtained by the above- described cloning methods. This region may be retained for its transcriptional termination regulatory sequences, such as termination and polyadenylation. Thus, by retaining the 3 '-region naturally contiguous to the DNA sequence encoding a polypeptide gene, the transcriptional termination signals may be provided. Where the transcriptional termination signals are not satisfactorily functional in the expression host cell, then a 3' region functional in the host cell may be substituted.
- Two DNA sequences are said to be operably linked if the nature of the linkage between the two DNA sequences does not (1) result in the introduction of a frame-shift mutation, (2) interfere with the ability of the promoter region sequence to direct the transcription of a phosphatase gene sequence, or (3) interfere with the ability of the phosphatase gene sequence to be transcribed by the promoter region sequence.
- a promoter region would be operably linked to a DNA sequence if the promoter were capable of effecting transcription of that DNA sequence.
- transcriptional and translational signals recognized by an appropriate host are necessary.
- the present invention encompasses the expression of a gene (or a functional derivative thereof) in either prokaryotic or eukaryotic cells.
- Prokaryotic hosts are, generally, very efficient and convenient for the production of recombinant proteins and are, therefore, one type of preferred expression system for a gene.
- Prokaryotes most frequently are represented by various strains of E. coli. However, other microbial strains may also be used, including other bacterial strains.
- plasmid vectors that contain replication sites and control sequences derived from a species compatible with the host may be used.
- suitable plasmid vectors may include pBR322, pUC118, pUC119 and the like;
- suitable phage or bacteriophage vectors may include ⁇ gtlO, ⁇ gtll and the like;
- suitable virus vectors may include pMAM-neo, pKRC and the like.
- the selected vector of the present invention has the capacity to replicate in the selected host cell.
- prokaryotic hosts include bacteria such as E. coli and those from genera such as Bacillus, Streptomyces, Pseudomonas, Salmonella, Serratia, and the like. However, under such conditions, the polypeptide will not be glycosylated.
- the prokaryotic host must be compatible with the replicon and control sequences in the expression plasmid. To express a polypeptide (or a functional derivative thereof) in a prokaryotic cell, it is necessary to operably link a polypeptide sequence to a functional prokaryotic promoter.
- Such promoters may be either constitutive or, more preferably, regulatable ( e.g., inducible or derepressible) .
- constitutive promoters include the int promoter of bacteriophage ⁇ , the bla promoter of the ⁇ -lactamase gene sequence of pBR322, and the CAT promoter of the chloramphenicol acetyl transferase gene sequence of pPR325, and the like.
- inducible prokaryotic promoters include the major right and left promoters of bacteriophage ⁇ (PL and PR) , the trp, recA, lacZ, lad, and gal promoters of E. coli, the ⁇ -amylase (Ulmanen et al., J. Bacteriol. 162:176-182, 1985) and the ⁇ -28-specific promoters of B. subtilis (Gilman et al . , Gene sequence 32:11-20(1984)), the promoters of the bacteriophages of
- ribosome binding sites are disclosed, for example, by Gold et al . (Ann. Rev. Microbiol. 35:365-404, 1981).
- the selection of control sequences, expression vectors, transformation methods, and the like, are dependent on the type of host cell used to express the gene .
- cell As used herein, “cell”, “cell line”, and “cell culture” may be used interchangeably and all such designations include progeny.
- the words “transformants” or “transformed cells” include the primary subject cell and cultures derived therefrom, without regard to the number of transfers. It is also understood that all progeny may not be precisely identical in DNA content, due to deliberate or inadvertent mutations. However, as defined, mutant progeny have the same functionality as that of the originally transformed cell.
- Host cells which may be used in the expression systems of the present invention are not strictly limited, provided that they are suitable for use in the expression of the peptide of interest. Suitable hosts may often include eukaryotic cells. Preferred eukaryotic hosts include, for example, yeast, fungi, insect cells, mammalian cells either in vivo, or in tissue culture. Mammalian cells which may be useful as hosts include HeLa cells, cells of fibroblast origin such as VERO, 3T3 or CH0-K1, or cells of lymphoid origin (such as 32D cells) and their derivatives.
- eukaryotic hosts include, for example, yeast, fungi, insect cells, mammalian cells either in vivo, or in tissue culture.
- Mammalian cells which may be useful as hosts include HeLa cells, cells of fibroblast origin such as VERO, 3T3 or CH0-K1, or cells of lymphoid origin (such as 32D cells) and their derivatives.
- Preferred mammalian host cells include SP2/0 and J558L, as well as neuroblastoma cell lines such as IMR 332 and PC12 which may provide better capacities for correct post-translational processing.
- plant cells are also available as hosts, and control sequences compatible with plant cells are available, such as the cauliflower mosaic virus 35S and 19S, and nopaline synthase promoter and polyadenylation signal sequences.
- Another preferred host is an insect cell, for example the Drosophila larvae. Using insect cells as hosts, the Drosophila alcohol dehydrogenase promoter can be used. Rubin, Science 240:1453-1459, 1988).
- baculovirus vectors can be engineered to express large amounts of a phosphatase in insects cells (Jasny, Science 238:1653, 1987); Miller et al . , In: Genetic Engineering
- yeast gene sequence expression systems can be utilized which incorporate promoter and termination elements from the actively expressed gene sequences coding for glycolytic enzymes which are produced in large quantities when yeast are grown in mediums rich in glucose.
- Known glycolytic gene sequences can also provide very efficient transcriptional control signals.
- Yeast provides substantial advantages in that it can also carry out post-translational peptide modifications.
- Yeast recognizes leader sequences on cloned mammalian gene sequence products and secretes peptides bearing leader sequences ( e.g., pre-peptides) .
- a phosphatase For a mammalian host, several possible vector systems are available for the expression of a phosphatase.
- a particularly preferred yeast expression system is that utilizing Schizosaccharmocyces pombe. This system is useful for studying the activity of members of the Src family (Superti-Furga, et al . EMBO J. 12:2625, 1993) and other NR-TKs.
- Src family Superti-Furga, et al . EMBO J. 12:2625, 1993
- a wide variety of transcriptional and translational regulatory sequences may be employed, depending upon the nature of the host.
- the transcriptional and translational regulatory signals may be derived from viral sources, such as adenovirus, bovine papilloma virus, cytomegalovirus, simian virus, or the like, where the regulatory signals are associated with a particular gene sequence which has a high level of expression.
- viral sources such as adenovirus, bovine papilloma virus, cytomegalovirus, simian virus, or the like
- promoters from mammalian expression products such as actin, collagen, myosin, and the like
- Transcriptional initiation regulatory signals may be selected which allow for repression or activation, so that expression of the gene sequences can be modulated.
- regulatory signals which are temperature-sensitive so that by varying the temperature, expression can be repressed or initiated, or are subject to chemical (such as metabolite) regulation.
- eukaryotic regulatory regions Such regions will, in general, include a promoter region sufficient to direct the initiation of RNA synthesis.
- Preferred eukaryotic promoters include, for example, the promoter of the mouse metallothionein I gene sequence (Hamer et al., J. Mol. Appl. Gen. 1:273-288, 1982); the TK promoter of Herpes virus (McKnight, Cell 31:355-365, 1982); the SV40 early promoter (Benoist et al., Nature (London) 290:304-310, 1981) ; the yeast gal4 gene sequence promoter (Johnston et al., Proc. Natl. Acad. Sci. (USA) 79:6971-6975, 1982); Silver et al . , Proc. Natl. Acad. Sci. (USA) 81:5951-5955, 1984) .
- eukaryotic mRNA Translation of eukaryotic mRNA is initiated at the codon which encodes the first methionine. For this reason, it is preferable to ensure that the linkage between a eukaryotic promoter and a DNA sequence which encodes a polypeptide (or a functional derivative thereof) does not contain any intervening codons which are capable of encoding a methionine (e.g., AUG) . The presence of such codons results either in a formation of a fusion protein (if the AUG codon is in the same reading frame as a coding sequence) or a frame-shift mutation (if the AUG codon is not in the same reading frame as a coding sequence) .
- AUG methionine
- a polypeptide nucleic acid molecule and an operably linked promoter may be introduced into a recipient prokaryotic or eukaryotic cell either as a nonreplicating DNA (or RNA) molecule, which may either be a linear molecule or, more preferably, a closed covalent circular molecule (a plasmid) . Since such molecules are incapable of autonomous replication, the expression of the gene may occur through the transient expression of the introduced sequence. Alternatively, permanent or stable expression may occur through the integration of the introduced DNA sequence into the host chromosome.
- a vector may be employed which is capable of integrating the desired gene sequences into the host cell chromosome.
- Cells which have stably integrated the introduced DNA into their chromosomes can be selected by also introducing one or more markers which allow for selection of host cells which contain the expression vector.
- the marker may provide for prototrophy to an auxotrophic host, biocide resistance, e.g., antibiotics, or heavy metals, such as copper, or the like.
- the selectable marker gene sequence can either be directly linked to the DNA gene sequences to be expressed, or introduced into the same cell by co-transfection. Additional elements may also be needed for optimal synthesis of single chain binding protein mRNA. These elements may include splice signals, as well as transcription promoters, enhancers, and termination signals. cDNA expression vectors incorporating such elements include those described by Okayama, Mol. Cell. Bio. 3:280, 1983.
- the introduced nucleic acid molecule can be incorporated into a plasmid or viral vector capable of autonomous replication in the recipient host. Any of a wide variety of vectors may be employed for this purpose. Factors of importance in selecting a particular plasmid or viral vector include: the ease with which recipient cells that contain the vector may be recognized and selected from those recipient cells which do not contain the vector; the number of copies of the vector which are desired in a particular host; and whether it is desirable to be able to "shuttle" the vector between host cells of different species .
- Preferred prokaryotic vectors include plasmids such as those capable of replication in E. coil (such as, for example, pBR322, ColEl, pSClOl, pACYC 184, ⁇ VX.
- Such plasmids are, for example, disclosed by Sambrook (cf. "Molecular Cloning: A Laboratory Manual", second edition, edited by Sambrook, Fritsch, & Maniatis, Cold Spring Harbor Laboratory, (1989)).
- Bacillus plasmids include pC194, pC221, pT127, and the like. Such plasmids are disclosed by Gryczan (In: The Molecular Biology of the Bacilli, Academic Press, NY (1982), pp. 307-329).
- Suitable Streptomyces plasmids include plJlOl (Kendall et al . , J. Bacteriol.
- Preferred eukaryotic plasmids include, for example, BPV, vaccinia, SV40, 2-micron circle, and the like, or their derivatives.
- Such plasmids are well known in the art (Botstein et al., Miami Wntr. Symp. 19:265-274, 1982); Broach, In: "The Molecular Biology of the Yeast Saccharomyces: Life Cycle and Inheritance", Cold Spring Harbor Laboratory, Cold Spring Harbor, NY, p. 445-470 (1981); Broach, Cell 28:203-204, 1982); Bollon et at., J. Clin. Hematol. Oncol. 10:39-48, 1980); Maniatis, In: Cell Biology: A Comprehensive Treatise, Vol. 3, Gene Sequence Expression, Academic Press, NY, pp. 563-608 (1980) .
- the DNA construct (s) may be introduced into an appropriate host cell by any of a variety of suitable means, e.g., transformation, transfection, conjugation, protoplast fusion, electroporation, particle gun technology, calcium phosphate- precipitation, direct microinjection, and the like.
- recipient cells are grown in a selective medium, which selects for the growth of vector- containing cells. Expression of the cloned gene molecule (s) results in the production of polypeptides or fragments or functional derivatives thereof.
- a variety of incubation conditions can be used to form the peptide of the present invention. The most preferred conditions are those which mimic physiological conditions.
- polypeptides preferably phosphatases.
- a variety of methodologies known in the art can be utilized to obtain the polypeptides of the present invention. They may be purified from tissues or cells which naturally produce them. Alternatively, the above-described isolated nucleic acid sequences can be used to express a protein recombinantly .
- source organism refers to the original organism from which the amino acid sequence is derived, regardless of the organism the protein is expressed in and ultimately isolated from.
- a phosphatase protein like all proteins, is comprised of distinct functional units or domains.
- proteins sorted through the so-called vesicular pathway are sorted through the so-called vesicular pathway.
- Non- receptor proteins generally function to transmit signals within the cell, either by providing sites for protein :protein interactions or by having some catalytic activity (contained within a catalytic domain) , often both. Methods of predicting the existence of these various domains are well known in the art.
- Protein rprotein interaction domains can be identified by comparison to other proteins.
- the SH2 domain for example is a protein domain of about 100 amino acids first identified as a conserved sequence region between the proteins Src and Fps (Sadowski, et al . , Mol. Cell. Bio. 6:4396, 1986). Similar sequences were later found in many other intracellular signal-transducing proteins. SH2 domains function as regulatory modules of intracellular signaling cascades by interacting with high affinity to phosphotyrosine-containing proteins in a sequence specific and strictly phosphorylation-dependent manner (Mayer and Baltimore, Trends Cell. Biol. 3:8, 1993).
- Kinase or phosphatase catalytic domains can be identified by comparison to other known catalytic domains with kinase or phosphatase activity. See, for example Hanks and Hunter, FASEB J. 9:576-595, 1995.
- Phosphatase domains have a variety of uses.
- An example of such a use is to make a polypeptide consisting of the phosphatase catalytic domain and a heterologous protein such as glutathione S-transferase (GST) .
- GST glutathione S-transferase
- Such a polypeptide can be used in a biochemical assay for phosphatase catalytic activity useful for studying phosphatase substrate specificity or for identifying substances that can modulate phosphatase catalytic activity.
- one skilled in the art could create a polypeptide lacking at least one of three major domains, a extracellular domain, transmembrane domain or intracellular domain.
- Such a polypeptide when expressed in a cell, is able to form complexes with the natural binding partner (s) of phosphatases but unable to transmit any signal further downstream into the cell, e.g., it would be signaling incompetent and thus would be useful for studying the biological relevance of phosphatase activity.
- s natural binding partner
- the present invention also relates to an antibody having specific binding affinity to a polypeptide.
- the polypeptide may have the amino acid sequence set forth in SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:8, SEQ ID NO:10, SEQ ID NO:12, SEQ ID NO:14, SEQ ID NO:16, SEQ ID NO:18, SEQ ID NO:20, SEQ ID NO:22, SEQ ID NO:24, SEQ ID NO:26, SEQ ID NO:28, SEQ ID NO:30, SEQ ID NO:32, SEQ ID NO:34, SEQ ID NO:42, SEQ ID NO:38 or SEQ ID NO:40, or a be fragment thereof, or at least 6, 12, 18, 24, 30, 36, 50, 75, 100 contiguous amino acids thereof.
- Such an antibody may be identified by comparing its binding affinity to a first polypeptide with its binding affinity to a second polypeptide. Those which bind selectively to the second polypeptide, such as a phosphatase, would be chosen for use in methods requiring a distinction between phosphatases or phosphatases and other polypeptides. Such methods could include, but should not be limited to, the analysis of altered phosphatase expression in tissue containing other polypeptides and assay systems using whole cells. A peptide of the present invention can be used to produce antibodies or hybridomas . One skilled in the art will recognize that if an antibody is desired, such a peptide would be generated as described herein and used as an immunogen.
- the antibodies of the present invention include monoclonal and polyclonal antibodies, as well fragments of these antibodies, and humanized forms. Humanized forms of the antibodies of the present invention may be generated using one of the procedures known in the art such as chimerization or CDR grafting.
- the present invention also relates to a hybridoma which produces the above-described monoclonal antibody, or binding fragment thereof.
- a hybridoma is an immortalized cell line which is capable of secreting a specific monoclonal antibody. In general, techniques for preparing monoclonal antibodies and hybridomas are well known in the art
- Any animal which is known to produce antibodies can be immunized with the selected polypeptide.
- Methods for immunization are well known in the art. Such methods include subcutaneous or intraperitoneal injection of the polypeptide.
- One skilled in the art will recognize that the amount of polypeptide used for immunization will vary based on the animal which is immunized, the antigenicity of the polypeptide and the site of injection.
- the polypeptide may be modified or administered in an adjuvant in order to increase the peptide antigenicity.
- Such procedures include coupling the antigen with a heterologous protein (such as globulin or D- galactosidase) or through the inclusion of an adjuvant during immunization.
- a heterologous protein such as globulin or D- galactosidase
- spleen cells from the immunized animals are removed, fused with myeloma cells, such as SP2/0-Agl4 myeloma cells, and allowed to become monoclonal antibody producing hybridoma cells.
- myeloma cells such as SP2/0-Agl4 myeloma cells
- Any one of a number of methods well known in the art can be used to identify the hybridoma cell which produces an antibody with the desired characteristics. These include screening the hybridomas with an ELISA assay, western blot analysis, or radioi munoassay (Lutz, et al., Exp. Cell Res. 175:109-124, 1988).
- Hybridomas secreting the desired antibodies are cloned and the class and subclass is determined using procedures known in the art (Campbell, "Monoclonal Antibody Technology: Laboratory Techniques in Biochemistry and Molecular Biology", supra, 1984) .
- antibody-containing antisera is isolated from the immunized animal and is screened for the presence of antibodies with the desired specificity using one of the above-described procedures.
- the above- described antibodies may be detectably labeled.
- Antibodies can be detectably labeled through the use of radioisotopes, affinity labels (such as biotin, avidin, and the like), enzymatic labels (such as horse radish peroxidase, alkaline phosphatase, and the like) fluorescent labels (such as FITC or rhodamine, and the like) , paramagnetic atoms, and the like.
- affinity labels such as biotin, avidin, and the like
- enzymatic labels such as horse radish peroxidase, alkaline phosphatase, and the like
- fluorescent labels such as FITC or rhodamine, and the like
- the labeled antibodies of the present invention can be used for in vitro, in vivo, and in in situ assays to identify cells or tissues which express a specific peptide.
- the above-described antibodies may also be immobilized on a solid support.
- solid supports include plastics such as polycarbonate, complex carbohydrates such as agarose and sepharose, acrylic resins and such as polyacrylamide and latex beads. Techniques for coupling antibodies to such solid supports are well known in the art (Weir et al., "Handbook of Experimental Immunology” 4th Ed., Blackwell Scientific Publications, Oxford, England, Chapter 10, 1986; Jacoby et al., Meth. Enzym. 34, Academic Press, N.Y., 1974).
- the immobilized antibodies of the present invention can be used for in vitro, in vivo, and in situ assays as well as in immunochromotography.
- the present invention encompasses a method of detecting a polypeptide in a sample, comprising: (a) contacting the sample with an above-described antibody, under conditions such that immunocomplexes form, and (b) detecting the presence of said antibody bound to the polypeptide.
- the methods comprise incubating a test sample with one or more of the antibodies of the present invention and assaying whether the antibody binds to the test sample. Altered levels, either an increase or decrease, of a polypeptide in a sample as compared to normal levels may indicate disease.
- Incubation conditions vary. Incubation conditions depend on the format employed in the assay, the detection methods employed, and the type and nature of the antibody used in the assay.
- immunological assay formats such as radioimmunoassays, enzyme-linked immunosorbent assays, diffusion based Ouchterlony, or rocket immunofluorescent assays
- any one of the commonly available immunological assay formats can readily be adapted to employ the antibodies of the present invention.
- the immunological assay test samples of the present invention include cells, protein or membrane extracts of cells, or biological fluids such as blood, serum, plasma, or urine.
- the test sample used in the above-described method will vary based on the assay format, nature of the detection method and the tissues, cells or extracts used as the sample to be assayed. Methods for preparing protein extracts or membrane extracts of cells are well known in the art and can be readily be adapted to the present invention.
- a kit contains all the necessary reagents to carry out the previously described methods of detection.
- the kit may comprise: (i) a first container containing an above- described antibody, and (ii) second container containing a conjugate comprising a binding partner of the antibody and a label.
- the kit further comprises one or more other containers comprising one or more of the following: wash reagents and reagents capable of detecting the presence of bound antibodies.
- detection reagents include, but are not limited to, labeled secondary antibodies, or in the alternative, if the primary antibody is labeled, the chromophoric, enzymatic, or antibody binding reagents which are capable of reacting with the labeled antibody.
- the compartmentalized kit may be as described above for nucleic acid probe kits.
- the antibodies described in the present invention can readily be incorporated into one of the established kit formats which are well known in the art.
- the present invention also relates to methods of detecting natural binding partners capable of binding to a polypeptide.
- a natural binding partner of a polypeptide may be, for example, a substrate protein which is dephosphorylated as part of a signaling cascade.
- the binding parter(s) may be present within a complex mixture, for example, serum, body fluids, or cell extracts.
- methods for identifying natural binding partners comprise incubating a substance with a phosphatase and detecting the presence of a substance bound to the phosphatase.
- Preferred methods include the two-hybrid system of Fields and Song (supra) and co- immunoprecipitation .
- the present invention also relates to a method of detecting a substance capable of modulating polypeptide activity.
- substances can either enhance activity (agonists) or inhibit activity (antagonists) .
- Agonists and antagonists can be peptides, antibodies, products from natural sources such as fungal or plant extracts or small molecular weight organic compounds. In general, small molecular weight organic compounds are preferred. Examples of classes of compounds that can be tested for phosphatase modulating activity are, for example but not limited to, non-peptidyl compounds disclosed in Taylor, S. et al .
- the method comprises contacting at least one polypeptide of the present invention with a test substance, measuring an activity of the polypeptide and determining whether the test substance modulates the activity of the polypeptide.
- a change in activity may be manifested by increased or decreased phosphorylation of a phosphatase polypeptide or increased or decreased phosphorylation of a phosphatase substrate.
- the substance thus identified would produce a change in activity indicative of the agonist or antagonist nature of the substance.
- the method also comprises incubating cells that produce phosphatases in the presence of a test substance and detecting changes in the level of phosphatase activity or phosphatase binding partner activity.
- a change in activity may be manifested by increased or decreased phosphorylation of a phosphatase polypeptide, increased or decreased phosphorylation of a phosphatase substrate, or increased or decreased biological response in cells.
- Biological responses can include, for example, proliferation, differentiation, survival, or motility.
- the substance thus identified would produce a change in activity indicative of the agonist or antagonist nature of the substance. Once the substance is identified it can be isolated using techniques well known in the art, if not already available in a purified form.
- the present invention also relates to a method for treating a disease or disorder comprising the step of administering to a patient in need of such a treatment a substance that modulates phosphatases of the present invention.
- Toxicity and therapeutic efficacy of substances, or compounds can be determined by standard pharmaceutical procedures in cell cultures or experimental animals. The dose ratio between toxic and therapeutic effects is the therapeutic index and it can be expressed as the ratio LD50/ED50. Compounds which exhibit large therapeutic indices are preferred.
- the data obtained from these cell culture assays and animal studies can be used in formulating a range of dosage for use in humans. The dosage of such compounds lies preferably within a range of circulating concentrations that include the ED50 with little or no toxicity.
- the dosage may vary within this range depending upon the dosage form employed and the route of administration utilized.
- the therapeutically effective dose can be estimated initially from cell culture assays.
- a dose can be formulated in animal models to achieve a circulating plasma concentration range that includes the IC50 as determined in cell culture (e.g., the concentration of the test compound which achieves a half-maximal disruption of the protein complex, or a half-maximal inhibition of the cellular level and/or activity of a complex component) .
- IC50 as determined in cell culture
- levels in plasma may be measured, for example, by HPLC.
- the exact formulation, route of administration and dosage can be chosen by the individual physician in view of the patient's condition. (See e.g. Fingl et al . , 1975, in "The Pharmacological Basis of Therapeutics", Ch. 1 pi) . It should be noted that the attending physician would know how to and when to terminate, interrupt, or adjust administration due to toxicity, or to organ dysfunctions. Conversely, the attending physician would also know to adjust treatment to higher levels if the clinical response were not adequate (precluding toxicity) .
- the magnitude of an administrated dose in the management of the oncogenic disorder of interest will vary with the severity of the condition to be treated and with the route of administration. The severity of the condition may, for example, be evaluated, in part, by standard prognostic evaluation methods. Further, the dose and perhaps dose frequency, will also vary according to the age, body weight, and response of the individual patient. A program comparable to that discussed above may be used in veterinary medicine .
- Such agents may be formulated and administered systemically or locally.
- Techniques for formulation and administration may be found in "Remington's Pharmaceutical Sciences," 1990, 18th ed., Mack Publishing Co., Easton, PA. Suitable routes may include oral, rectal, transdermal, vaginal, transmucosal, or intestinal administration; parenteral delivery, including intramuscular, subcutaneous, intramedullary injections, as well as intrathecal, direct intraventricular, intravenous, intraperitoneal, intranasal, or intraocular injections, just to name a few.
- the agents of the invention may be formulated in aqueous solutions, preferably in physiologically compatible buffers such as Hanks ' s solution, Ringer's solution, or physiological saline buffer.
- physiologically compatible buffers such as Hanks ' s solution, Ringer's solution, or physiological saline buffer.
- penetrants appropriate to the barrier to be permeated are used in the formulation.
- penetrants are generally known in the art.
- Use of pharmaceutically acceptable carriers to formulate the compounds herein disclosed for the practice of the invention into dosages suitable for systemic administration is within the scope of the invention. With proper choice of carrier and suitable manufacturing practice, the compositions of the present invention, in particular, those formulated as solutions, may be administered parenterally, such as by intravenous injection.
- the compounds can be formulated readily using pharmaceutically acceptable carriers well known in the art into dosages suitable for oral administration.
- Such carriers enable the compounds of the invention to be formulated as tablets, pills, capsules, liquids, gels, syrups, slurries, suspensions and the like, for oral ingestion by a patient to be treated.
- Agents intended to be administered intracellularly may be administered using techniques well known to those of ordinary skill in the art. For example, such agents may be encapsulated into liposomes, then administered as described above. Liposomes are spherical lipid bilayers with aqueous interiors. All molecules present in an aqueous solution at the time of liposome formation are incorporated into the aqueous interior. The liposomal contents are both protected from the external microenvironment and, because liposomes fuse with cell membranes, are efficiently delivered into the cell cytoplasm. Additionally, due to their hydrophobicity, small organic molecules may be directly administered intracellularly.
- compositions suitable for use in the present invention include compositions wherein the active ingredients are contained in an effective amount to achieve its intended purpose. Determination of the effective amounts is well within the capability of those skilled in the art, especially in light of the detailed disclosure provided herein.
- these pharmaceutical compositions may contain suitable pharmaceutically acceptable carriers comprising excipients and auxiliaries which facilitate processing of the active compounds into preparations which can be used pharmaceutically.
- the preparations formulated for oral administration may be in the form of, for example, tablets, dragees, capsules, or solutions.
- compositions of the present invention may be manufactured in a manner that is itself known, e.g., by means of conventional mixing, dissolving, granulating, dragee-making, levigating, emulsifying, encapsulating, entrapping or lyophilizing processes.
- compositions for parenteral administration include aqueous solutions of the active compounds in water-soluble form. Additionally, suspensions of the active compounds may be prepared as appropriate oily injection suspensions. Suitable lipophilic solvents or vehicles include fatty oils such as sesame oil, or synthetic fatty acid esters, such as ethyl oleate or triglycerides, or liposomes. Aqueous injection suspensions may contain substances which increase the viscosity of the suspension, such as sodium carboxymethyl cellulose, sorbitol, or dextran. Optionally, the suspension may also contain suitable stabilizers or agents which increase the solubility of the compounds to allow for the preparation of highly concentrated solutions.
- compositions for oral use can be obtained by combining the active compounds with solid excipients, optionally grinding a resulting mixture, and processing the mixture of granules, after adding suitable auxiliaries, if desired, to obtain tablets or dragee cores.
- suitable excipients are, in particular, fillers such as sugars, including lactose, sucrose, mannitol, or sorbitol; cellulose preparations such as, for example, maize starch, wheat starch, rice starch, potato starch, gelatin, gum tragacanth, methyl cellulose, hydroxypropylmethyl- cellulose, sodium carboxymethylcellulose, and/or polyvinylpyrrolidone (PVP) .
- disintegrating agents may be added, such as the cross-linked polyvinyl pyrrolidone, agar, or alginic acid or a salt thereof such as sodium alginate.
- Dragee cores are provided with suitable coatings.
- suitable coatings For this purpose, concentrated sugar solutions may be used, which may optionally contain gum arabic, talc, polyvinyl pyrrolidone, carbopol gel, polyethylene glycol, and/or titanium dioxide, lacquer solutions, and suitable organic solvents or solvent mixtures.
- Dyestuffs or pigments may be added to the tablets or dragee coatings for identification or to characterize different combinations of active compound doses.
- Pharmaceutical preparations which can be used orally include push-fit capsules made of gelatin, as well as soft, sealed capsules made of gelatin and a plasticizer, such as glycerol or sorbitol.
- the push-fit capsules can contain the active ingredients in admixture with filler such as lactose, binders such as starches, and/or lubricants such as talc or magnesium stearate and, optionally, stabilizers.
- filler such as lactose, binders such as starches, and/or lubricants such as talc or magnesium stearate and, optionally, stabilizers.
- the active compounds may be dissolved or suspended in suitable liquids, such as fatty oils, liquid paraffin, or liquid polyethylene glycols .
- stabilizers may be added.
- Therapeutically effective doses for the compounds described herein can be estimated initially from cell culture and animal models. For example, a dose can be formulated in animal models to achieve a circulating concentration range that initially takes into account the IC 50 as determined in cell culture assays. The animal model data can be used to more accurately determine useful doses in humans .
- Plasma half-life and biodistribution of the drug and metabolites in the plasma, tumors and major organs can also be determined to facilitate the selection of drugs most appropriate to inhibit a disorder. Such measurements can be carried out.
- HPLC analysis can be performed on the plasma of animals treated with the drug and the location of radiolabeled compounds can be determined using detection methods such as X-ray, CAT scan and MRI .
- Compounds that show potent inhibitory activity in the screening assays, but have poor pharmacokinetic characteristics, can be optimized by altering the chemical structure and retesting. In this regard, compounds displaying good pharmacokinetic character- istics can be used as a model.
- Toxicity studies can also be carried out by measuring the blood cell composition.
- toxicity studies can be carried out in a suitable animal model as follows: 1) the compound is administered to mice (an untreated control mouse should also be used); 2) blood samples are periodically obtained via the tail vein from one mouse in each treatment group; and 3) the samples are analyzed for red and white blood cell counts, blood cell composition and the percent of lymphocytes versus polymorphonuclear cells . A comparison of results for each dosing regime with the controls indicates if toxicity is present.
- the expected daily dose of a hydrophobic pharmaceutical agent is between 1 to 500 mg/day, preferably 1 to 250 mg/day, and most preferably 1 to 50 mg/day. Drugs can be delivered less frequently provided plasma levels of the active moiety are sufficient to maintain therapeutic effectiveness.
- Plasma levels should reflect the potency of the drug. Generally, the more potent the compound the lower the plasma levels necessary to achieve efficacy.
- Examples of classes of compounds or compounds that may have phosphatase modulating activity are, for example but not limited to, non-peptidyl compounds disclosed in Taylor, S. et al. (1998) Bioorganic and Medicinal Chemistry, 6:1457- 1468, which is incorporated by reference, herein, compounds disclosed in Burke, Jr. et al . (1997) Current Pharmaceutical Design 3:291-304 and Burke, Jr. et al . (1998) Biopolymers, 47:225-241.
- XI Method for Detection of a Phosphatase in a Sample as a Diagnostic Tool for a Disease or Disorder
- the invention also relates to a method for detection of a phosphatase in a sample as a diagnostic tool for a disease or disorder.
- the method may be practiced by contacting the sample with a nucleic acid probe which hybridizes under hybridization assay conditions to a nucleic acid molecule which encodes a phosphatase of the invention and detecting the presence or amount of a probe: target region as an indication of the disease.
- the method may also be practiced by comparing a nucleic acid target region encoding a phosphatase of the invention in a sample, to a control region and detecting differences in sequence or amount between the target region and the control region as an indication of the disease or disorder.
- the disease or disorder may be cancer, pathophysiological hypoxia such as seen in cardiac disfunction and vascular disorders including atherosclerosis, stenosis and stroke, myopathies, congenital muscle disorders, Papillon-Lefevre syndrome, Cowden disease, ectodermal dysplasia, Moebius syndrome, Bjornstad syndrome, Bannayan-Zonana syndrome, glioblastoma, schizophrenia and hamartomas.
- pathophysiological hypoxia such as seen in cardiac disfunction and vascular disorders including atherosclerosis, stenosis and stroke, myopathies, congenital muscle disorders, Papillon-Lefevre syndrome, Cowden disease, ectodermal dysplasia, Moebius syndrome, Bjornstad syndrome, Bannayan-Zonana syndrome, glioblastoma, schizophrenia and hamartomas.
- the cancer may be breast cancer, glioblastoma, urogenital cancer, , prostate cancer, head and neck cancer, lung cancer, synovial sarcomas, renal cell carcinoma, non- small cell lung cancer, hepatocellular carcinoma, pancreatic endocrine tumors, stomach cancer, colorectal cancer and thyroid cancer.
- transgenic Animals Also contemplated by the invention are transgenic animals useful for the study of phosphatases activity in complex in vivo systems. A variety of methods are available for the production of transgenic animals associated with this invention.
- DNA sequences encoding phosphatases which can be injected into the pronucleus of a fertilized egg before fusion of the male and female pronuclei, or injected into the nucleus of an embryonic cell (e.g.., the nucleus of a two-cell embryo) following the initiation of cell division (Brinster, et al . , Proc. Nat. Acad. Sci. USA 82: 4438,
- Embryos can be infected with viruses, especially retroviruses, modified to carry inorganic-ion receptor nucleotide sequences of the invention.
- Pluripotent stem cells derived from the inner cell mass of the embryo and stabilized in culture can be manipulated in culture to incorporate nucleotide sequences of the invention.
- a transgenic animal can be produced from such cells through implantation into a blastocyst that is implanted into a foster mother and allowed to come to term. Animals suitable for transgenic experiments can be obtained from standard commercial sources such as Charles River (Wilmington, MA) , Taconic (Germantown, NY) , Harlan Sprague Dawley (Indianapolis, IN), etc.
- transgenic mouse female mice are induced to superovulate. After being allowed to mate, the females are sacrificed by C0 2 asphyxiation or cervical dislocation and embryos are recovered from excised oviducts. Surrounding cumulus cells are removed. Pronuclear embryos are then washed and stored until the time of injection. Randomly cycling adult female mice are paired with vasectomized males. Recipient females are mated at the same time as donor females . Embryos then are transferred surgically. The procedure for generating transgenic rats is similar to that of mice. See Hammer, et al., Cell 63:1099-1112, 1990).
- a clone containing the sequence (s) of the invention is co- transfected with a gene encoding resistance.
- the gene encoding neomycin resistance is physically linked to the sequence (s) of the invention.
- Transfection and isolation of desired clones are carried out by any one of several methods well known to those of ordinary skill in the art (E.J. Robertson, supra).
- DNA molecules introduced into ES cells can also be integrated into the chromosome through the process of homologous recombination. Capecchi, Science 244: 1288-1292 (1989).
- the invention provides transgenic, nonhuman mammals containing a transgene encoding a phosphatase polypeptide or a gene effecting the expression of a phosphatase polypeptide.
- transgenic nonhuman mammals are particularly useful as an in vivo test system for studying the effects of introducing a phosphatase polypeptide, regulating the expression of a phosphatase polypeptide (e.g., through the introduction of additional genes, antisense nucleic acids, or ribozymes) .
- transgenic animal is an animal having cells that contain DNA which has been artificially inserted into a cell, which DNA becomes part of the genome of the animal which develops from that cell.
- Preferred transgenic animals are primates, mice, rats, cows, pigs, horses, goats, sheep, dogs and cats.
- the transgenic DNA may encode for a human phosphatase polypeptide. Native expression in an animal may be reduced by providing an amount of anti-sense RNA or DNA effective to reduce expression of the receptor.
- an expression vector containing a phosphatase coding sequence or a phosphatase mutant coding sequence as described above is inserted into cells, the cells are grown in vitro and then infused in large numbers into patients.
- a DNA segment containing a promoter of choice (for example a strong promoter) is transferred into cells containing an endogenous gene sequence in such a manner that the promoter segment enhances expression of the endogenous phosphatase gene (for example, the promoter segment is transferred to the cell such that it becomes directly linked to the endogenous phosphatase gene) .
- the gene therapy may involve the use of an adenovirus containing phosphatase cDNA targeted to an appropriate cell type, systemic phosphatase increase by implantation of engineered cells, injection with a phosphatase virus, or injection of naked phosphatase DNA into appropriate cells or tissues, for example neurons.
- Expression vectors derived from viruses such as retroviruses, vaccinia virus, adenovirus, adeno-associated virus, herpes viruses, several RNA viruses, or bovine papilloma virus, may be used for delivery of nucleotide sequences (e.g., cDNA) encoding a recombinant phosphatase protein into the targeted cell population (e.g., tumor cells or neurons) .
- recombinant viral vectors containing coding sequences can be used to construct recombinant viral vectors containing coding sequences. See, for example, the techniques described in Maniatis et al . , Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory, N.Y. (1989), and in Ausubel et al . , Current Protocols in Molecular Biology, Greene Publishing Associates and Wiley Interscience, N.Y. (1989) .
- recombinant nucleic acid molecules encoding protein sequences can be used as naked DNA or in a reconstituted system, e.g.., liposomes or other lipid systems for delivery to target cells (See e.g.., Feigner et al .
- transfection wherein DNA is precipitated with CaP0 and taken into cells by pinocytosis (Chen C. and Okayama H, Mol. Cell Biol. 7:2745-52, 1987); electroporation, wherein cells are exposed to large voltage pulses to introduce holes into the membrane (Chu G., et al., Nucleic Acids Res., 15:1311-26, 1987); lipofection/liposome fusion, wherein DNA is packaged into lipophilic vesicles which fuse with a target cell (Feigner PL., et al . , Proc. Natl. Acad. Sci. USA. 84:7413-7, 1987)); and particle bombardment using DNA bound to small projectiles (Yang NS . et al., Proc. Natl. Acad. Sci. 87:9568-72, 1990).
- Another method for introducing DNA into cells is to couple the DNA to chemically modified proteins.
- adenovirus proteins are capable of destabilizing endosomes and enhancing the uptake of DNA into cells.
- the admixture of adenovirus to solutions containing DNA complexes, or the binding of DNA to polylysine covalently attached to adenovirus using protein crosslinking agents substantially improves the uptake and expression of the recombinant gene.
- Gene transfer means the process of introducing a foreign nucleic acid molecule into a cell. Gene transfer is commonly performed to enable the expression of a particular product encoded by the gene.
- the product may include a protein, polypeptide, anti-sense DNA or RNA, or enzymatically active RNA.
- Gene transfer can be performed in cultured cells or by direct administration into animals. Generally gene transfer involves the process of nucleic acid contact with a target cell by non-specific or receptor mediated interactions, uptake of nucleic acid into the cell through the membrane or by endocytosis, and release of nucleic acid into the cytoplasm from the plasma membrane or endosome. Expression may require, in addition, movement of the nucleic acid into the nucleus of the cell and binding to appropriate nuclear factors for transcription.
- gene therapy is a form of gene transfer and is included within the definition of gene transfer as used herein and specifically refers to gene transfer to express a therapeutic product from a cell in vivo or in vitro. Gene transfer can be performed ex vivo on cells which are then transplanted into a patient, or can be performed by direct administration of the nucleic acid or nucleic acid-protein complex into the patient.
- a vector having nucleic acid sequences encoding a phosphatase in which the nucleic acid sequence is expressed only in specific tissue.
- Methods of achieving tissue-specific gene expression as set forth in International Publication No. WO 93/09236, filed November 3, 1992 and published May 13, 1993.
- the nucleic acid sequence contained in the vector may include additions, deletions or modifications to some or all of the sequence of the nucleic acid, as defined above.
- a method of gene replacement is set forth. "Gene replacement" as used herein means supplying a nucleic acid sequence which is capable of being expressed in vivo in an animal and thereby providing or augmenting the function of an endogenous gene which is missing or defective in the animal.
- Figure 3 discloses amino acid sequence alignments performed with the predicted ORF for the novel protein phosphatases against the non-redundant protein database (NRP database) as well as a database built with the novel phosphatases presented in this filing (Repository or "R”). Alignments were performed using the Smith-Waterman algorithm with a PAM 100 matrix table and gap open and extension penalties of 14 and 1, respectively.
- Figure 3 discloses "% Identity”, “length of match”, “Dbase” and “Hit sp”, “Dbase hit” and “Hit Ace” refers to the calculated percent identity of each query against the best hits, along with the database source, species, description, and accession number of the match.
- CHR localization The chromosomal locations (CHR localization) for 8 of the 20 novel protein phosphatases are shown in Figure 1.
- AA813123 For example, searching Unigene with AA813123, an EST for a MKP-like phosphatase (SEQ ID#19) , the following information is retrieved: X: DXS1061-DXS1039. The location of this gene on an "ideogram" of the cytogenetic map of chromosome X is also provided, showing that AA813123 maps to Xpll.4-ql2.
- the nucleic acid for the gene of interest is used as a query against databases, such as dbsts and htgs (described at http: //www.ncbi .nlm.nih.gov/BLAST/blast_databases .html) containing sequences that have been mapped already.
- the nucleic acid sequence is searched using BLAST-2 at NCBI (http : //www . ncbi . nlm. nih . gov/cgi-bin/BLAST/nph-newblast ) and is used to query either dbsts or htgs .
- Stanford University maintains a useful site for chromosomal mapping from STS data
- Seq ID#25 SGP033 maps to 2q33-q37.2
- Seq ID#29 MKP5 has been mapped to lq32.1
- This region may be involved in renal collecting duct carcinoma (Steiner G, et al. Cancer Res. 1996 Nov 1; 56 (21) : 5044-6) . This region has also been implicated in microcephaly and Van der Woude syndrome. (Kenwrick, et al, S, Hum Mol Genet. 1993 Sep; 2 (9) : 1461-2) .
- Seq_ID_23 YVH1 maps to Iq21.2-q21.3
- Seq ID#19 AA813123 maps to Xpll.4-ql2
- Translocations involving Xpll have been associated with various human cancers. For example, most synovial sarcomas are characterized by a specific chromosomal translocation between Xpll and 18qll.2. (Willeke, et al., Eur J Cancer 1998;34 (13) :2087-93) . Perot et al . reported (Cancer Genet Cytogenet (1999)110:54-6) two cases of papillary renal cell carcinoma (RCC) with a translocation between Xpll and lq21 in two female patients aged 9 and 29 years.
- RRCC papillary renal cell carcinoma
- Seq ID#21 AA915932 maps to 22ql2.1-qter
- Seq ID#31 NP_060746 maps to Ilql2-ql3.2 This region has been implicated in adrenocortical carcinoma characterized by a high frequency of chromosomal gains and high-level amplifications. (Dohna M, et al . , Genes Chromosomes Cancer. 2000 Jun 28 (2) : 145-52) .
- Seq ID#37 MTMR7 (AA663875) maps to 8p22
- AB020861 represents a human genomic DNA of 8p21.3-p22, and is annotated (Nakamura,Y. and Isomura,M., (in press) http : //www . ncbi . nlm. nih .
- cDNA libraries derived from a variety of sources were immobilized onto nylon membranes and probed with 32P-labeled cDNA fragments derived from the gene(s) of interest.
- the sources of RNA are listed in Figure 3. They are: 1) Biochain Institute (Hayward, CA ; http : //www . biochain . com/main 3. html ) ; 2) Clontech (Palo Alto, CA, http : //www . clontech . com/ ) ; 3) mammalian cell lines used by the National Cancer Institute (NCI) Developmental Therapeutics Program (http: //dtp.nci . nih. gov/; can be orderred from ATCC: http: //www. atec . org/catalogs .html) ; 4)
- tissue culture cell pellet from 10 100 mm dish (a) in 10ml solution D. Lyse cells by pipetting up and down.
- the pellet at the bottom of the tube contains the RNA.
- the protocol can be scaled up or down accordingly
- Oligotex mRNA Midi Kit (Qiagen) . Glycogen 2mg/mL in DEPC treated H 2 0 1. Thaw total RNA stored at -80°C.
- Yield should be 20-25 ⁇ g mRNA from 1.0 mg of total RNA.
- RNA or mRNA was used as template in a reverse transcription reaction to generate single-stranded cDNAs (ss cDNA) that were tagged with specific sequences at each end.
- ss cDNA single-stranded cDNAs
- An oligo dT primer containing a specific sequence CDS:
- a primer SII: AAGCAGTGGTAACAACGCAGAGTACGCGGG or ML2G:
- the synthesized cDNAs contain specific sequence tags at both the 5' and the 3' end.
- the 5' and the 3' ends are tagged with the same sequence (CDS and SMII) it is referred to as "symmetric”.
- CDS and ML2G the 5' end is tagged with a different sequence than the 3' end (CDS and ML2G) is referred to as "asymmetric".
- a double- stranded "cDNA library” is then generated by PCR amplification using the 3' PCR and ML2 primers (3' PCR: AAGCAGTGGTAACAACGCAGAGT and ML2 : AAGTGGCAACAGAGATAACGCGT) that anneal to the added sequence tags.
- Primer PCR 23-mer AAGCAGTGGTAACAACGCAGAGT Primer ML2 23-mer AAGTGGCAACAGAGATAACGCGT 100 mM dATP, dCTP, dGTP, dTTP (Pharmacia #27-2050, - 2060, -2070,-2080) Advantage 2 DNA polymerase (Clontech #8430-2)
- Single or double stranded cDNAs are linearly amplified by PCR in the presence of fluorescent nucleotides to obtain double stranded cDNA probes. The optimal cycles needed during amplification should have been predetermined for each sample.
- Single stranded cDNA is linearly amplified by PCR to obtain double stranded cDNA.
- the linearity of the amplification is monitored by fluorescence in a real time PCR machine.
- step 2 using 5.0 ⁇ L of template, omitting the Syber Green dye and adjusting the H 2 0 to 35 ⁇ L. Amplify for 2 cycles less than the determined number from step 4.
- Syber Green is light sensitive.
- the linear up slope of the fluorescence is the linear range of amplification.
- the optimal cycle number is the highest number within the linear portion of the curve. It is better to determine this number rather conservatively.
- This step generates almost unlimited amounts of cDNA that can be used in generating fluorescent probes which in some cases might be desirable. If starting material is not in limited quantities, this step can be omitted and proceed in generating fluorescent probes directly from ss cDNA.
- the blots were exposed to phosphorimaging cassettes and the intensity of the signal was quantified.
- the intensity of the spots was quantified using AIS software, Version 4.0, Rev 1.1, used in the ⁇ DEFAULT" mode. (Imaging Research, Inc, St Catherines, Ontario, CA) .
- the amount of the DNA on the arrays was also quantified by treating non-denatured or denatured arrays with Syber Green I or Syber Green II (Molecular Probes, http://www.probes.com/), respectively (1:100,000 in 50 mM Tris, pH8.0) for 2 minutes.
- sample the name of the sample
- source where the sample was obtained
- tag sym or asym depending on whether symmetric or asymmetric probe was used (see below for definitions of symmetic vs asymmetric)
- type lists tissue type (abbreviations: heme- henotopoietic; pro - prostate; OV - ovarian; end - endocrine; mel - melanoma; neuro - neurological; leu - leukenia; col - colon, MG - mammary gland; "comments”, comments on tissue source; “Tumor sym”, indicates that the tissue is derived from a tumor, “sym” refers to the fact that the 5' and 3' primers used to make the sample are the same; “Normal Sym”, indicates normal tissue was used to make the sample,
- SEQ_ID_21_AA915932 SEQ_ID_27_AI031656, SEQ_ID_31_NP_060746 (G77-8-14), SEQ_ID_33_NP_060232 (AA232384), SEQ_ID_37_MTMR7 (AA663875), and SEQ_ID_39_AA493915.
- phosphatase gene sequences used include: SEQ_ID_11_AA374753, SEQ_ID_21_AA915932, SEQ_ID_27_AI031656, SEQ_ID_31_NP_060746 G77-8-14, SEQ_ID_33_NP_060232 AA232384, SEQ_ID_37_MTMR7 , and AA663875, SEQ_ID_39_AA493915.
- samples from normal tissues, tumor tissues, various cell lines, and P53 wild type and mutant were used to make the expression array.
- the relative gene expression levels of the tested phosphatase genes in various tissue sources were quantitated by measuring Syber Green I staining of hybridized signals.
- the numerical readings recorded in the figure were normalized to the hybridization result from ds cDNA or undenatured probes, after subtracting the background counts .
- the relevant expression levels in Figure 3 constitutes expression profiles of the phosphatase genes of interest in various tissue sources.
- Such expression profile data guides application of the treatment regime according to the present invention.
- the levels of expression of SEQ_ID_11_AA374753, SEQ_ID_21_AA915932, SEQ_ID_27_AI031656, SEQ_ID_33_NP_060232 AA232384 and SEQ_ID_39_AA493915 are- zero.
- SEQ_ID_31_NP_060746 G77-8-14 (203) is marginal.
- the level of expression of SEQ_ID_37_MTMR7 AA663875 is significantly higher (2107) .
- Such horizontal comparison reveals that the phosphatase gene encoded by SEQ_ID_37_MTMR7 AA663875 is implicated in renal cancer. That is, manipulation of the function activities of this gene may affect the cancerous condition of renal cancer.
- SEQ_ID_37_MTMR7 AA663875 encodes homo sapiens myotubularin related protein 7, a MTM-like phosphotase as shown in Figure 2.
- a method of treating the cancer condition connected to renal cancer according to the present invention can be, for example, to administer to the patient an agent that is capable of modulating the activities of the phosphotase activity of homo sapiens myobubularin related protein 7.
- the expression analysis according to the preferred embodiment of this invention thus confers specificity and effectiveness to the method of treatment disclosed. These data also find applicability in a diagnostic setting.
- the entry primary renal cell adenocarcinoma (NCI 786-0) in Figure 3, the level of expression of SEQ_ID_37_MTMR7 AA663875 is significantly higher (2107) compared to all other tested phosphotase genes (SEQ_ID_11_AA374753, SEQ_ID_21_AA915932, SEQ_ID_33_NP_060232 AA232384, SEQ_ID_27_AI031656, SEQ_ID_31_NP_060746 G77-8-14, and SEQ_ID_39_AA493915) .
- SEQ_ID_37_MTMR7 AA663875 This comparison thus demonstrates that a fair level of expression of the phosphatase gene encoded by SEQ_ID_37_MTMR7 AA663875 correlates with the renal cancer condition.
- This gene may therefore be used as a diagnostic marker of the renal cancer condition, with certain reliability level. It is recommended, in this connection, that diagnostic tests to be run based on multiple markers to validate the test result and to increase the confidence level of the diagnosis derived as such.
- Figure 2 reveals that SEQ_ID_37_MTMR7 AA663875 encodes homo sapiens myobubularin related protein 7, a MTM- like phosphotase.
- a method of diagnosing the cancer condition connected to neuroblastoma according to the present invention is, therefore, to contact a test sample, which may be collected from a patient, with a nucleotide probe which is capable of hybridizing to the nucleic acid sequence which encodes homo sapiens myobubularin related protein 7; and then to detect the presence of the hybridized probe: target pairs and to quantify the level of such hybridization as an indication of the cancer condition connected to neuroblastoma.
- the expression analysis according to the preferred embodiment of this invention thus confers specificity and effectiveness to the diagnostic method disclosed.
- the invention is meant to also cover the final formulation formed by the combination of these excipients.
- the invention includes formulations in which one to all of the added excipients undergo a reaction during formulation and are no longer present in the final formulation, or are present in modified forms.
Abstract
Description
Claims
Priority Applications (4)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
AU69038/00A AU6903800A (en) | 1999-08-13 | 2000-08-11 | Novel protein phosphatases and diagnosis and treatment of phosphatase-related disorders |
EP00957413A EP1212433A2 (en) | 1999-08-13 | 2000-08-11 | Protein phosphatases and diagnosis and treatment of phosphatase-related disorders |
CA002377662A CA2377662A1 (en) | 1999-08-13 | 2000-08-11 | Novel protein phosphatases and diagnosis and treatment of phosphatase-related disorders |
JP2001516906A JP2003507016A (en) | 1999-08-13 | 2000-08-11 | Diagnosis and treatment of novel protein phosphatases and phosphatase-related diseases |
Applications Claiming Priority (2)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
US14900599P | 1999-08-13 | 1999-08-13 | |
US60/149,005 | 1999-08-13 |
Publications (2)
Publication Number | Publication Date |
---|---|
WO2001012819A2 true WO2001012819A2 (en) | 2001-02-22 |
WO2001012819A3 WO2001012819A3 (en) | 2002-01-24 |
Family
ID=22528389
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
PCT/US2000/022158 WO2001012819A2 (en) | 1999-08-13 | 2000-08-11 | Protein phosphatases and diagnosis and treatment of phosphatase-related disorders |
Country Status (5)
Country | Link |
---|---|
EP (1) | EP1212433A2 (en) |
JP (1) | JP2003507016A (en) |
AU (1) | AU6903800A (en) |
CA (1) | CA2377662A1 (en) |
WO (1) | WO2001012819A2 (en) |
Cited By (17)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO2001064911A2 (en) * | 2000-02-29 | 2001-09-07 | Millennium Pharmaceuticals, Inc. | 18232, a dual specificity phosphatase |
WO2001073060A2 (en) * | 2000-03-24 | 2001-10-04 | Millennium Pharmaceuticals, Inc. | 18221, dual specificity phosphatase and uses thereof |
WO2002010363A2 (en) * | 2000-07-28 | 2002-02-07 | Incyte Genomics, Inc. | Protein phosphatases |
WO2002020747A2 (en) * | 2000-09-11 | 2002-03-14 | Bayer Aktiengesellschaft | Regulation of human tyrosine phosphatase-like enzyme |
WO2002020732A2 (en) * | 2000-09-07 | 2002-03-14 | Bayer Aktiengesellschaft | Regulation of human map kinase phosphatase-like enzyme |
WO2002024740A2 (en) * | 2000-09-19 | 2002-03-28 | Ceptyr, Inc. | Dsp-15 dual-specificity phosphatase |
WO2002042436A2 (en) * | 2000-11-20 | 2002-05-30 | Pe Corporation (Ny) | Isolated human phosphatase proteins, nucleic acid molecules encoding them, and uses thereof |
WO2003044161A2 (en) * | 2001-11-15 | 2003-05-30 | Tularik Inc. | Gene amplification and overexpression in cancer |
WO2003083102A2 (en) * | 2002-03-28 | 2003-10-09 | Qlt Inc. | Cancer associated protein phosphatases and their uses |
WO2002090530A3 (en) * | 2001-01-18 | 2003-11-20 | Incyte Genomics Inc | Kinases and phosphatases |
WO2004028554A2 (en) * | 2002-09-27 | 2004-04-08 | DeveloGen Aktiengesellschaft für entwicklungsbiologische Forschung | Skrp, astray, string, vacm associated with metabolic control |
US20050214888A1 (en) * | 2001-10-31 | 2005-09-29 | Masahiko Morita | Methods of eavaluating phosphatase inhibitors |
WO2006069306A2 (en) * | 2004-12-22 | 2006-06-29 | Henry M. Jackson Foundation For The Advancement Ofmilitary Medicine | A knockout mouse for the tumor suppressor gene anx7 |
US7153678B2 (en) | 2000-12-20 | 2006-12-26 | Bristol-Myers Squibb | Polynucleotides encoding the novel human phosphatase, RET31, and variants thereof |
EP1772517A2 (en) * | 1999-07-02 | 2007-04-11 | Ceptyr, Inc. | DSP-3 dual specificity phosphatase |
US9580513B2 (en) | 2008-08-08 | 2017-02-28 | Agency For Science, Technology And Research (A*Star) | VHZ for diagnosis and treatment of cancers |
US9790503B2 (en) | 2007-08-10 | 2017-10-17 | Agency For Science, Technology And Research (A*Star) | VHZ for diagnosis and treatment of cancer |
Citations (13)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO1999002704A2 (en) * | 1997-07-08 | 1999-01-21 | Cold Spring Harbor Laboratory | Dual specifically phosphatase and methods of use |
WO2000006728A2 (en) * | 1998-07-28 | 2000-02-10 | Incyte Pharmaceuticals, Inc. | Phosphorylation effectors |
WO2000018890A2 (en) * | 1998-09-30 | 2000-04-06 | Millennium Pharmaceuticals, Inc. | Protein phosphatase molecules and uses therefor |
WO2000055332A2 (en) * | 1999-03-18 | 2000-09-21 | Incyte Pharmaceuticals, Inc. | Human regulators of intracellular phosphorylation |
WO2000056899A1 (en) * | 1999-03-24 | 2000-09-28 | Ceptyr, Inc. | Dsp-2 dual-specificity map kinase phosphatase |
WO2000060099A1 (en) * | 1999-04-07 | 2000-10-12 | Ceptyr, Inc. | Dsp-4 dual-specificity map kinase phosphatase |
WO2000060098A1 (en) * | 1999-04-07 | 2000-10-12 | Ceptyr, Inc. | Dsp-7 dual-specificity map kinase phosphatase |
WO2000063393A1 (en) * | 1999-04-20 | 2000-10-26 | Ceptyr, Inc. | Dsp-8 dual-specificity map kinase phosphatase |
WO2000065069A1 (en) * | 1999-04-27 | 2000-11-02 | Ceptyr, Inc. | Dsp-5 dual-specificity map kinase phosphatase |
WO2000065068A1 (en) * | 1999-04-23 | 2000-11-02 | Ceptyr, Inc. | Dsp-10 dual-specificity map kinsase phosphatase |
WO2001002582A1 (en) * | 1999-07-02 | 2001-01-11 | Ceptyr, Inc. | Dsp-3 dual-specificity phosphatase |
WO2001005983A1 (en) * | 1999-07-20 | 2001-01-25 | Ceptyr, Inc. | Dsp-11 dual-specificity map kinase phosphatase |
WO2001020004A2 (en) * | 1999-09-15 | 2001-03-22 | Incyte Genomics, Inc. | Protein phosphatase and kinase proteins |
-
2000
- 2000-08-11 JP JP2001516906A patent/JP2003507016A/en active Pending
- 2000-08-11 CA CA002377662A patent/CA2377662A1/en not_active Abandoned
- 2000-08-11 WO PCT/US2000/022158 patent/WO2001012819A2/en not_active Application Discontinuation
- 2000-08-11 EP EP00957413A patent/EP1212433A2/en not_active Withdrawn
- 2000-08-11 AU AU69038/00A patent/AU6903800A/en not_active Abandoned
Patent Citations (14)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO1999002704A2 (en) * | 1997-07-08 | 1999-01-21 | Cold Spring Harbor Laboratory | Dual specifically phosphatase and methods of use |
WO2000006728A2 (en) * | 1998-07-28 | 2000-02-10 | Incyte Pharmaceuticals, Inc. | Phosphorylation effectors |
WO2000018890A2 (en) * | 1998-09-30 | 2000-04-06 | Millennium Pharmaceuticals, Inc. | Protein phosphatase molecules and uses therefor |
WO2000055332A2 (en) * | 1999-03-18 | 2000-09-21 | Incyte Pharmaceuticals, Inc. | Human regulators of intracellular phosphorylation |
WO2000056899A1 (en) * | 1999-03-24 | 2000-09-28 | Ceptyr, Inc. | Dsp-2 dual-specificity map kinase phosphatase |
WO2000060098A1 (en) * | 1999-04-07 | 2000-10-12 | Ceptyr, Inc. | Dsp-7 dual-specificity map kinase phosphatase |
WO2000060099A1 (en) * | 1999-04-07 | 2000-10-12 | Ceptyr, Inc. | Dsp-4 dual-specificity map kinase phosphatase |
WO2000063393A1 (en) * | 1999-04-20 | 2000-10-26 | Ceptyr, Inc. | Dsp-8 dual-specificity map kinase phosphatase |
WO2000065068A1 (en) * | 1999-04-23 | 2000-11-02 | Ceptyr, Inc. | Dsp-10 dual-specificity map kinsase phosphatase |
WO2000065069A1 (en) * | 1999-04-27 | 2000-11-02 | Ceptyr, Inc. | Dsp-5 dual-specificity map kinase phosphatase |
WO2001002582A1 (en) * | 1999-07-02 | 2001-01-11 | Ceptyr, Inc. | Dsp-3 dual-specificity phosphatase |
WO2001002581A1 (en) * | 1999-07-02 | 2001-01-11 | Ceptyr, Inc. | Dsp-3 dual-specificity phosphatase |
WO2001005983A1 (en) * | 1999-07-20 | 2001-01-25 | Ceptyr, Inc. | Dsp-11 dual-specificity map kinase phosphatase |
WO2001020004A2 (en) * | 1999-09-15 | 2001-03-22 | Incyte Genomics, Inc. | Protein phosphatase and kinase proteins |
Non-Patent Citations (59)
Cited By (34)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
EP1772517A2 (en) * | 1999-07-02 | 2007-04-11 | Ceptyr, Inc. | DSP-3 dual specificity phosphatase |
EP1772517A3 (en) * | 1999-07-02 | 2007-04-18 | Ceptyr, Inc. | DSP-3 dual specificity phosphatase |
US7504223B2 (en) | 1999-08-05 | 2009-03-17 | Henry M. Jackson Foundation For The Advancement Of Military Medicine, Inc. | Knockout mouse for the tumor suppressor gene ANX7 |
WO2001064911A3 (en) * | 2000-02-29 | 2002-04-18 | Millennium Pharm Inc | 18232, a dual specificity phosphatase |
WO2001064911A2 (en) * | 2000-02-29 | 2001-09-07 | Millennium Pharmaceuticals, Inc. | 18232, a dual specificity phosphatase |
US6420153B1 (en) | 2000-02-29 | 2002-07-16 | Millennium Pharmaceuticals, Inc. | 18232, a novel dual specificity phosphatase and uses therefor |
WO2001073060A3 (en) * | 2000-03-24 | 2002-04-04 | Millennium Pharm Inc | 18221, dual specificity phosphatase and uses thereof |
WO2001073060A2 (en) * | 2000-03-24 | 2001-10-04 | Millennium Pharmaceuticals, Inc. | 18221, dual specificity phosphatase and uses thereof |
WO2002010363A3 (en) * | 2000-07-28 | 2003-01-23 | Incyte Genomics Inc | Protein phosphatases |
WO2002010363A2 (en) * | 2000-07-28 | 2002-02-07 | Incyte Genomics, Inc. | Protein phosphatases |
WO2002020732A2 (en) * | 2000-09-07 | 2002-03-14 | Bayer Aktiengesellschaft | Regulation of human map kinase phosphatase-like enzyme |
WO2002020732A3 (en) * | 2000-09-07 | 2002-08-15 | Bayer Ag | Regulation of human map kinase phosphatase-like enzyme |
WO2002020747A3 (en) * | 2000-09-11 | 2003-02-13 | Bayer Ag | Regulation of human tyrosine phosphatase-like enzyme |
WO2002020747A2 (en) * | 2000-09-11 | 2002-03-14 | Bayer Aktiengesellschaft | Regulation of human tyrosine phosphatase-like enzyme |
WO2002024740A3 (en) * | 2000-09-19 | 2002-12-05 | Ceptyr Inc | Dsp-15 dual-specificity phosphatase |
WO2002024740A2 (en) * | 2000-09-19 | 2002-03-28 | Ceptyr, Inc. | Dsp-15 dual-specificity phosphatase |
US6825021B2 (en) | 2000-09-19 | 2004-11-30 | Ceptyr, Inc. | DSP-15 dual-specificity phosphatase |
WO2002042436A3 (en) * | 2000-11-20 | 2003-02-27 | Pe Corp Ny | Isolated human phosphatase proteins, nucleic acid molecules encoding them, and uses thereof |
WO2002042436A2 (en) * | 2000-11-20 | 2002-05-30 | Pe Corporation (Ny) | Isolated human phosphatase proteins, nucleic acid molecules encoding them, and uses thereof |
US7153678B2 (en) | 2000-12-20 | 2006-12-26 | Bristol-Myers Squibb | Polynucleotides encoding the novel human phosphatase, RET31, and variants thereof |
US7358074B2 (en) | 2000-12-20 | 2008-04-15 | Bristol-Myers Squibb Company | Human phosphatase RET31, and variants thereof |
WO2002090530A3 (en) * | 2001-01-18 | 2003-11-20 | Incyte Genomics Inc | Kinases and phosphatases |
US7402406B2 (en) | 2001-10-31 | 2008-07-22 | Astellas Pharma Inc. | Methods of evaluating phosphatase inhibitors |
US20050214888A1 (en) * | 2001-10-31 | 2005-09-29 | Masahiko Morita | Methods of eavaluating phosphatase inhibitors |
WO2003044161A3 (en) * | 2001-11-15 | 2004-12-02 | Tularik Inc | Gene amplification and overexpression in cancer |
WO2003044161A2 (en) * | 2001-11-15 | 2003-05-30 | Tularik Inc. | Gene amplification and overexpression in cancer |
WO2003083102A2 (en) * | 2002-03-28 | 2003-10-09 | Qlt Inc. | Cancer associated protein phosphatases and their uses |
WO2003083102A3 (en) * | 2002-03-28 | 2004-04-22 | Kinetek Pharmaceuticals Inc | Cancer associated protein phosphatases and their uses |
WO2004028554A3 (en) * | 2002-09-27 | 2004-07-22 | Develogen Ag | Skrp, astray, string, vacm associated with metabolic control |
WO2004028554A2 (en) * | 2002-09-27 | 2004-04-08 | DeveloGen Aktiengesellschaft für entwicklungsbiologische Forschung | Skrp, astray, string, vacm associated with metabolic control |
WO2006069306A3 (en) * | 2004-12-22 | 2006-10-26 | Jackson H M Found Military Med | A knockout mouse for the tumor suppressor gene anx7 |
WO2006069306A2 (en) * | 2004-12-22 | 2006-06-29 | Henry M. Jackson Foundation For The Advancement Ofmilitary Medicine | A knockout mouse for the tumor suppressor gene anx7 |
US9790503B2 (en) | 2007-08-10 | 2017-10-17 | Agency For Science, Technology And Research (A*Star) | VHZ for diagnosis and treatment of cancer |
US9580513B2 (en) | 2008-08-08 | 2017-02-28 | Agency For Science, Technology And Research (A*Star) | VHZ for diagnosis and treatment of cancers |
Also Published As
Publication number | Publication date |
---|---|
JP2003507016A (en) | 2003-02-25 |
AU6903800A (en) | 2001-03-13 |
EP1212433A2 (en) | 2002-06-12 |
WO2001012819A3 (en) | 2002-01-24 |
CA2377662A1 (en) | 2001-02-22 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
EP1073723B1 (en) | Ste20-related protein kinases | |
US20060234344A1 (en) | Protein kinases | |
US20070202107A1 (en) | Novel kinases | |
US20050125852A1 (en) | Novel kinases | |
WO2001012819A2 (en) | Protein phosphatases and diagnosis and treatment of phosphatase-related disorders | |
US20060292573A1 (en) | Human orthologues of WART | |
WO2001046394A2 (en) | Mammalian protein phosphatases | |
US20080009610A1 (en) | Diagnosis and treatment of PTP related disorders | |
CA2331889A1 (en) | Nek-related and bub1-related protein kinases | |
US20040157306A1 (en) | Mammalian protein phosphatases | |
US6844177B2 (en) | Diagnosis and treatment of PTP04 related disorders | |
US20040132155A1 (en) | Mammalian protein phosphatases | |
US20020090703A1 (en) | Mammalian protein phosphatases | |
US20050084877A1 (en) | Mammalian protein phosphatases | |
US6342593B1 (en) | Diagnosis and treatment of ALP related disorders | |
EP1533378A2 (en) | Tyrosine kinase substrate protein Tks7 | |
WO1999027099A1 (en) | Orf, a substrate for extracellular signal-regulated kinase, erk-6, and related methods | |
CA2395093A1 (en) | Mammalian protein phosphatases | |
EP1299525A2 (en) | Mammalian protein phosphatases | |
WO2003042390A1 (en) | Mammalian protein phosphatases |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
AK | Designated states |
Kind code of ref document: A2 Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CN CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW |
|
AL | Designated countries for regional patents |
Kind code of ref document: A2 Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG |
|
121 | Ep: the epo has been informed by wipo that ep was designated in this application | ||
DFPE | Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101) | ||
AK | Designated states |
Kind code of ref document: A3 Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CN CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW |
|
AL | Designated countries for regional patents |
Kind code of ref document: A3 Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG |
|
WWE | Wipo information: entry into national phase |
Ref document number: 2377662 Country of ref document: CA |
|
WWE | Wipo information: entry into national phase |
Ref document number: 2000957413 Country of ref document: EP |
|
WWP | Wipo information: published in national office |
Ref document number: 2000957413 Country of ref document: EP |
|
WWE | Wipo information: entry into national phase |
Ref document number: 10049515 Country of ref document: US |
|
REG | Reference to national code |
Ref country code: DE Ref legal event code: 8642 |
|
WWW | Wipo information: withdrawn in national office |
Ref document number: 2000957413 Country of ref document: EP |