Classifications

• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
  • C12N9/88—Lyases (4.)
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
  • C12N15/09—Recombinant DNA-technology
  • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
  • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
  • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
  • C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
  • C12N15/8242—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits
  • C12N15/8243—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits involving biosynthetic or metabolic pathways, i.e. metabolic engineering, e.g. nicotine, caffeine
  • C12N15/8245—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits involving biosynthetic or metabolic pathways, i.e. metabolic engineering, e.g. nicotine, caffeine involving modified carbohydrate or sugar alcohol metabolism, e.g. starch biosynthesis
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
  • C12N15/09—Recombinant DNA-technology
  • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
  • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
  • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
  • C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
  • C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
• • Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
  • Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
  • Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
  • Y02A40/00—Adaptation technologies in agriculture, forestry, livestock or agroalimentary production
  • Y02A40/10—Adaptation technologies in agriculture, forestry, livestock or agroalimentary production in agriculture
  • Y02A40/146—Genetically Modified [GMO] plants, e.g. transgenic plants

Definitions

• This invention relates to the expression of fructose 1,6 bisphosphate aldolase (FDA) in transgenic plants to increase or improve plant growth and development, yield, vigor, stress tolerance, carbon allocation and storage into various storage pools, and distribution of starch.
• FDA fructose 1,6 bisphosphate aldolase
• Transgenic plants expressing FDA have increased carbon assimilation, export and storage in plant source and sink organs, which results in growth, yield and quality improvements in crop plants.
• Atmospheric carbon fixation (photosynthesis) by plants represents the major source of energy to support processes in all living organisms.
• the primary sites of photosynthetic activity generally referred to as “source organs”, are mature leaves and, to a lesser extent, green stems.
• the major carbon products of source leaves are starch, which represents the transitory storage form of carbohydrate in the chloroplast, and sucrose, which represents the predominant form of carbon transport in higher plants.
• Other plant parts named “sink organs” e.g., roots, fruit, flowers, seeds, tubers, and bulbs) are generally not autotrophic and depend on import of sucrose or other major translocatable carbohydrates for their growth and development.
• the storage sinks deposit the imported metabolites as sucrose and other oligosaccharides, starch and other polysaccharides, proteins, and triglycerides.
• the primary products of the Calvin Cycle are glyceraldehyde 3-phosphate (G3P) and dihydroxyacetone phosphate (DHAP), also known as triose phosphates (triose-P).
• G3P glyceraldehyde 3-phosphate
• DHAP dihydroxyacetone phosphate
• triose-P trihydroxyacetone phosphate
• FBP fructose 1,6 bisphosphate
• FDA fructose 1 ,6 bisphosphate aldolase
• the acidic isoenzyme appears to be chloroplastic and comprises about 85% of the total leaf aldolase activity.
• the basic isoenzyme is cytosolic. Both isoenzymes appear to be encoded by the nuclear genome and are encoded by different genes (Lebherz et al., 1984).
• the chloroplast FDA is an essential enzyme in the Calvin Cycle, where its activity generates metabolites for starch biosynthesis. Removal of more than 40% of the plastidic aldolase enzymatic activity by antisense technology reduced leaf starch accumulation as well as soluble proteins and chlorophyll levels but also reduced plant growth and root formation (Sonnewald et al., 1994).
• the cytosolic FDA is part of the sucrose biosynthetic pathway where it catalyzes the reaction of FBP production.
• cytosolic FDA is also a key enzyme in the glycolytic and gluconeogenesis pathways in both source and sink plant tissues. In the potato industry, production of higher starch and uniform solids tubers is highly desirable and valuable.
• the current potato varieties that are used for french fry production suffer from a non-uniform deposition of solids between the tuber pith (inner core) and the cortex (outer core).
• French fry strips that are taken from pith tissue are higher in water content when compared to outer cortex french fry strips; cortex tissue typically displays a solids level of twenty-four percent whereas pith tissue typically displays a solids level of seventeen percent. Consequently, in the french fry production process, the pith strips need to be blanched, dried, and par-fried for longer times to eliminate the excess water. Adequate processing of the pith fries results in the over-cooking of fries from the high solids cortex.
• the blanching, drying, and par frying times of the french fry processor need to be adjusted accordingly to accommodate the low solids pith strips and the high solids cortex strips.
• a higher solids potato with a more uniform distribution of starch from pith to cortex would allow for a more uniform finished fty product, with higher plant throughput and cost savings due to reduced blanch, dry and par-fry times.
• various fructose 1,6 bisphosphate aldolases have been previously characterized, it has been discovered that overexpression of the enzyme in a transgenic plant provides advantageous results in the plant such as increasing the assimilation, export and storage of carbon, increasing the production of oils and/or proteins in the plant and improving tuber solids uniformity.
• the present invention provides structural DNA constructs that encode a fructose 1 ,6 bisphosphate aldolase (FDA) enzyme and that are useful in increasing carbon assimilation, export, and storage in plants.
• FDA fructose 1 ,6 bisphosphate aldolase
• a method of producing genetically transformed plants that have elevated carbon assimilation, storage, export, and improved solids uniformity comprising the steps of: (a) Inserting into the genome of a plant a recombinant, double-stranded DNA molecule comprising
• RNA sequence that encodes a fructose 1 ,6 bisphosphate aldolase enzyme
• RNA sequence that functions in plant cells to cause transcriptional termination and the addition of polyadenylated nucleotides to the 3' end of the RNA sequence
• the structural DNA sequence that causes the production of an RNA sequence that encodes a fructose 1,6 bisphosphate aldolase enzyme is coupled with a chloroplast transit peptide to facilitate transport of the enzyme to the plastid.
• an improved means for increasing carbon assimilation, storage and export in the source tissues of various plants is provided.
• Further means of improved carbon accumulation in sinks (such as roots, tubers, seeds, stems, and bulbs) are provided, thus increasing the size of various sinks (larger roots, tubers, etc.) and subsequently increasing yield and crop productivity.
• the increased carbon availability to these sinks would also improve composition and use efficiency in the sink (oil, protein, starch and/or sucrose production, and/or solids uniformity).
• Potatoes used for the production of french fries and other products suffer from a non-uniform distribution of solids between the tuber pith (inner core) and the cortex (outer core).
• french fry strips from the pith regions of such tubers have a low solids content and a high water content in comparison to cortex strips from the same tubers. Therefore, the french fry processor attempts to adjust the processing parameters so that the final inner strips are sufficiently cooked while the outer cortex strips are not overcooked. The results of such adjustments, however, are highly variable and may lead to poor quality product.
• Transgenic potatoes expressing fda will provide to the french-fry and potato chip processor a raw product that consistently displays a higher tuber solids uniformity with acceptable agronomic traits.
• inner pith fry strips from higher solids uniformity tubers will require less time to blanch, less time to dry to a specific solids content, and less time to par-fry before freezing and shipping to retail and institutional end-users.
• the present invention provides 1) a higher quality, more uniform finish fry product in which french fries from all tuber regions, when processed, are nearly the same, 2) a higher through-put in the french fry processing plant due to lower processing times, and 3) processor cost savings due to lower energy input required for lower blanch, dry, and par-fry times.
• a raw tuber product that displays a higher solids uniformity will also produce a potato chip that has a reduced saddle curl, and a reduced tendency for center bubble, which are undesirable qualities in the potato chip industry. Reduced fat content would also result; this would contribute to improved consumer appeal and lower oil use (and costs) for the processor.
• the increase in solids uniformity will also translate to an increase in overall tuber solids. For both the french fry and chipping industries, this overall tuber solids increase will also result in higher throughput in the processing plant due to lower processing times, and cost savings due to lower energy input for blanching, drying, par-frying, and finish frying.
• Figure 1 shows the nucleotide sequence and deduced amino acid sequence of a fructose 1,6 bisphosphate aldolase gene from E. coli (S ⁇ Q ID No:l).
• Figure 2 shows a plasmid map for plant transformation vector pMON 17524.
• Figure 3 shows a plasmid map for plant transformation vector pMON 17542.
• Figure 4 shows the change in diurnal fluctuations of sucrose, glucose, and starch levels in tobacco leaves expressing the fda transgene (pMON17524) and control (pMON17227). The light period is from 7:00 to 19:00 hours. Only fully expanded and non-senescing leaves were sampled.
• Figure 5 shows a plasmid map for plant transformation vector pMON 13925.
• Figure 6 shows a plasmid map for plant transformation vector pMON17590.
• Figure 7 shows a plasmid map for plant transformation vector pMON13936.
• Figure 8 shows a plasmid map for plant transformation vector pMON 17581.
• Figure 9 shows potato tuber cross-sections of improved solids uniformity Segal Russet Burbank lines (top row) versus unimproved nontransgenic Russet Burbank (bottom row).
• This invention is directed to a method for producing plant cells and plants demonstrating an increased or improved growth and development, yield, quality, starch storage uniformity, vigor, and/or stress tolerance.
• the method utilizes a DNA sequence encoding an fda (fructose 1.6 bisphosphate aldolase) gene integrated in the cellular genome of a plant as the result of genetic engineering and causes expression of the FDA enzyme in the transgenic plant so produced.
• Plants that overexpress the FDA enzyme exhibit increased carbon flow through the Calvin Cycle and increased atmospheric carbon assimilation during early photoperiod resulting in an increase in photosynthetic efficiency and an increase in starch production.
• Such plants exhibit higher levels of sucrose production by the leaf and the ability to achieve a net increase in carbon export during a given photoperiod.
• This increase in source capacity leads to increased plant growth that in turn generates greater biomass and/or increases the size of the sink and ultimately providing greater yields of the transgenic plant.
• This greater biomass or increased sink size may be evidenced in different ways or plant parts depending on the particular plant species or growing conditions of the plant overexpressing the FDA enzyine.
• increased size resulting from overexpression of FDA may be seen in the seed, fruit, stem, leaf, tuber, bulb or other plant part depending upon the plant species and its dominant sink during a particular growth phase and upon the environmental effects caused by certain growing conditions, e.g. drought, temperature or other stresses.
• Transgenic plants overexpressing FDA may therefore have increased carbon assimilation, export and storage in plant source and sink organs, which results in growth, yield, and uniformity and quality improvements.
• Plants overexpressing FDA may also exhibit desirable quality traits such as increased production of starch, oils and/or proteins depending upon the plant species overexpressing the FDA.
• overexpression of FDA in a particular plant species may affect or alter the direction of the carbon flux thereby directing metabolite utilization and storage either to starch production, protein production or oil production via the role of FDA in the giycolysis and gluconeogenesis metabolic pathways.
• the mechanism whereby the expression of exogenous FDA modifies carbon relationships is believed to derive from source-sink relationships.
• the leaf tissue is a sucrose source, and if more sucrose resulting from the activity of increased FDA expression is transported to a sink, it results in increased storage carbon (sugars, starch, oil, protein, etc.) or nitrogen (protein, etc.) per given weight of the sink tissue.
• RNA polymerase enzyme messenger RNA
• RNA polymerase enzyme RNA polymerase enzyme
• 3' non-translated region which adds polyadenylate nucleotides to the 3' end of the RNA.
• Transcription of DNA into mRNA is regulated by a region of DNA usually referred to as the promoter.
• the promoter region contains a sequence of bases that signals RNA polymerase to associate with the DNA and to initiate the transcription of mRNA using one of the DNA strands as a template to make a corresponding complimentary strand of RNA. This RNA is then used as a template for the production of the protein encoded therein by the cells protein biosynthetic machinery.
• promoters that are active in plant cells have been described in the literature. These include the nopaline synthase (NOS) and octopine synthase (OCS) promoters (which are carried on tumor-inducing plasmids of Agrobacterium tumefaciens), the caulimovirus promoters such as the cauliflower mosaic virus (CaMV) 19S and 35S and the figwort mosaic virus (FMV) 35S-promoters, the light-inducible promoter from the small subunit of ribulose-l,5-bisphosphate carboxylase (ssRUBISCO), a very abundant plant polypeptide, and the chlorophyll a/b binding protein gene promoters, etc.
• NOS nopaline synthase
• OCS octopine synthase
• promoters have been used to create various types of DNA constructs that have been expressed in plants; see, e.g., PCT publication WO 84/02913. Promoters that are known to or are found to cause transcription of DNA in plant cells can be used in the present invention. Such promoters may be obtained from a variety of sources such as plants and plant viruses and include, but are not limited to. the enhanced CaMV35S promoter and promoters isolated from plant genes such as ssRUBISCO genes. As described below, it is preferred that the particular promoter selected should be capable of causing sufficient expression to result in the production of an effective amount of fructose 1 ,6 bisphosphate aldolase enzyme to cause the desired increase in carbon assimilation, export or storage.
• Expression of the double-stranded DNA molecules of the present invention can be driven by a constitutive promoter, expressing the DNA molecule in all or most of the tissues of the plant. Alternatively, it may be preferred to cause expression of the fda gene in specific tissues of the plant, such as leaf, stem, root, tuber, seed, fruit, etc.
• the promoter chosen will have the desired tissue and developmental specificity. Those skilled in the art will recognize that the amount of fructose 1,6 bisphosphate aldolase needed to induce the desired increase in carbon assimilation, export, or storage may vary with the type of plant.
• promoter function should be optimized by selecting a promoter with the desired tissue expression capabilities and approximate promoter strength and selecting a transformant that produces the desired fructose 1,6 bisphosphate aldolase activity or the desired change in metabolism of carbohydrates in the target tissues.
• This selection approach from the pool of transformants is routinely employed in expression of heterologous structural genes in plants because there is variation between transformants containing the same heterologous gene due to the site of gene insertion within the plant genome (commonly referred to as "position effect").
• promoters that are known to cause transcription (constitutively or tissue- specific) of DNA in plant cells
• other promoters may be identified for use in the current invention by screening a plant cDNA library for genes that are selectively or preferably expressed in the target tissues of interest and then isolating the promoter regions by methods known in the art.
• the promoters utilized in the double-stranded DNA molecules of the present invention have relatively high expression in these specific tissues.
• chloroplast glutamine synthetase GS2 from pea (Edwards et al., 1990), the chloroplast fructose- 1 ,6-bisphosphatase (FBPase) from wheat (Lloyd et al., 1991), the nuclear photosynthetic ST-LSl from potato (Stockhaus et al., 1989), and the phenylalanine ammonia-lyase (PAL) and chalcone synthase (CHS) genes from Arabidopsis thaliana (Leyva et al., 1995).
• PAL phenylalanine ammonia-lyase
• CHS chalcone synthase
• RUBISCO ribulose-l,5-bisphosphate carboxylase
• the cab gene encoding the chlorophyll a/b-binding protein of PSII, isolated from pine (cab6; Yamamoto et al., 1994), wheat (Cab-1; Fejes et al., 1990), spinach (CAB-1; Luebberstedt et al., 1994), and rice (cablR: Luan et al., 1992); the pyruvate orthophosphate dikinase (PPDK) from maize (Matsuoka et al, 1993); the tobacco Lhcbl*2 gene (Cerdan et al., 1997); the Arabidopsis thaliana SUC2 sucrose-H+ symporter gene (Truernit et al., 1995); and the
• chlorophyll a/b-binding proteins have been studied and described in the literature, such as LhcB and PsbP from white mustard (Sinapis alba; Kretsch et al., 1995).
• Homologous promoters to those described here may also be isolated from and tested in the target or related crop plant by standard molecular biology procedures.
• the promoters utilized in the double- stranded DNA molecules of the present invention have relatively high expression in these specific tissues.
• tuber-specific or tuber-enhanced expression A number of genes with tuber-specific or tuber-enhanced expression are known, including the class I patatin promoter (Bevan et al., 1986; Jefferson et al., 1990); the potato tuber ADPGPP genes, both the large and small subunits (Muller et al., 1990); sucrose synthase (Salanoubat and Belliard, 1987.
• the promoter for ⁇ - conglycinin (Tierney, 1987) or other seed-specific promoters, such as the napin and phaseolin promoters, can be used to over-express an fda gene specifically in seeds.
• the zeins are a group of storage proteins found in maize endosperm. Genomic clones for zein genes have been isolated (Pedersen et al., 1982), and the promoters from these clones, including the 15 kDa, 16 kDa, 19 kDa, 22 kDa, 27 kDa, and gamma genes, could also be used to express an fda gene in the seeds of maize and other plants.
• promoters known to function in maize, wheat, or rice include the promoters for the following genes: waxy, Brittle, Shrunken 2, branching enzymes I and II, starch synthases, debranching enzymes, oleosins, glutelins, and sucrose synthases.
• promoters for maize endosperm expression, as well as in wheat and rice, of an fda gene is the promoter for a glutelin gene from rice, more particularly the Osgt-1 promoter (Zheng et al., 1993); the maize granule-bound starch synthase (waxy) gene (zmGBS); the rice small subunit ADPGPP promoter (osAGP) ;and the zein promoters, particularly the maize 27 kDa zein gene promoter (zm27) (see, generally, Russell et al., 1997).
• promoters suitable for expression of an fda gene in wheat include those for the genes for the ADPglucose pyrophosphorylase (ADPGPP) subunits, for the granule bound and other starch synthases, for the branching and debranching enzymes, for the embryogenesis- abundant proteins, for the gliadins, and for the glutenins.
• promoters in rice include those for the genes for the ADPGPP subunits, for the granule bound and other starch synthases, for the branching enzymes, for the debranching enzymes, for sucrose synthases, and for the glutelins.
• a particularly preferred promoter is the promoter for rice glutelin, Osgt-1.
• Examples of such promoters for barley include those for the genes for the ADPGPP subunits, for the granule bound and other starch synthases, for the branching enzymes, for the debranching enzymes, for sucrose synthases, for the hordeins, for the embryo globulins, and for the aleurone-specific proteins.
• the solids content of root tissue may be increased by expressing an fda gene behind a root-specific promoter.
• An example of such a promoter is the promoter from the acid chitinase gene (Samac et al., 1990). Expression in root tissue could also be accomplished by utilizing the root-specific subdomains of the CaMV35S promoter that have been identified (Benfey et al., 1989).
• the RNA produced by a DNA construct of the present invention may also contain a 5' non-translated leader sequence.
• This sequence can be derived from the promoter selected to express the gene and can be specifically modified so as to increase translation of the mRNA.
• the 5' non-translated regions can also be obtained from viral RNAs, from suitable eukaryotic genes, or from a synthetic gene sequence.
• the present invention is not limited to constructs, as presented in the following examples, wherein the non-translated region is derived from the 5' non-translated sequence that accompanies the promoter sequence. Rather, the non-translated leader sequence can be derived from an unrelated promoter or coding sequence.
• an intron is preferably included in the gene construct to facilitate or enhance expression of the coding sequence.
• suitable introns include the HSP70 intron and the rice actin intron, both of which are known in the art.
• Another suitable intron is the castor bean catalase intron (Suzuki et al., 1994) Polyadenylation signal
• the 3' non-translated region of the chimeric plant gene contains a polyadenylation signal that functions in plants to cause the addition of polyadenylate nucleotides to the 3' end of the RNA.
• suitable 3' regions are (1) the 3' transcribed, non- translated regions containing the polyadenylation signal of Agrobacterium tumor-inducing (Ti) plasmid genes, such as the nopaline synthase (NOS) gene, and (2) plant genes like the soybean storage protein genes and the small subunit of the ribulose-l,5-bisphosphate carboxylase (ssRUBISCO) gene.
• the fda gene may be fused to a chloroplast transit peptide, in order to target the FDA protein to the plastid.
• chloroplast and plastid are intended to include the various forms of plastids including amyloplasts.
• Many plastid-localized proteins are expressed from nuclear genes as precursors and are targeted to the plastid by a chloroplast transit peptide (CTP), which is removed during the import steps.
• CTP chloroplast transit peptide
• chloroplast proteins examples include the small subunit of ribulose-l,5-biphosphate carboxylase (ssRUBISCO, SSU), 5- enolpyruvateshikimate-3-phosphate synthase (EPSPS), ferredoxin, ferredoxin oxidoreductase, the light-harvesting-complex protein I and protein II, and thioredoxin F. It has been demonstrated that non-plastid proteins may be targeted to the chloroplast by use of protein fusions with a CTP and that a CTP sequence is sufficient to target a protein to the plastid.
• Aldolase enzymes are divided into two classes, designated class I and class II (Witke and Gotz, 1993).
• cytosolic enzyme from maize (GenBank Accession S07789;S10638), cytosolic enzyme from rice (GenBank Accession JQ0543), cytosolic enzyme from spinach (GenBank Accession S31091 ;S22093), from Arabidopsis thaliana (GenBank Accession S11958), from spinach chloroplast (GenBank Accession S31090;A21815;S22092), from yeast (S.
• subtilis (GenBank Accession S55426; D32354: E32354; D41835), from garden pea (GenBank Accession S29048; S34411), from garden pea chloroplast (GenBank Accession S29047; S34410), from maize (GenBank Accession S05019), from Chlamydomonas reinhardtii (GenBank Accession S48639; S58485; S58486; S34367), from Corynebacterium glutamicum (GenBank Accession S09283; X17313), from
• Campylobacter jejuni (GenBank Accession S52413), from Haemophilus influenzae (strain Rd KW20) (GenBank Accession C64074), from Streptococcus pneumonia (GenBank Accession AJ005697), from rice (GenBank Accession X53130), and from the maize anaerobically regulated gene (GenBank Accession XI 2872).
• the class I enzymes may be isolated from higher eukaryotes, such as animals and plants, and in some prokaryotes, including Peptococcus aerogens, (Lebherz and Rutter, 1973), Lactobacillus casei (London and Kline, 1973), Escherichia coli (Stribling and Perham, 1973), Mycobacterium smegmatis (Bai et al., 1975), and most staphylococcal species (Gotz et al., 1979).
• Peptococcus aerogens (Lebherz and Rutter, 1973), Lactobacillus casei (London and Kline, 1973), Escherichia coli (Stribling and Perham, 1973), Mycobacterium smegmatis (Bai et al., 1975), and most staphylococcal species (Gotz et al., 1979).
• the gene for the FDA enzyme may be obtained by known methods and has already been done so for several organisms, such as rabbit (Lai et al., 1974), human (Besmond et al, 1983), rat (Tsutsumi et al., 1984), Trypanosoma brucei (Clayton, 1985), and Arabidopsis thaliana (Chopra et al., 1990).
• These class I enzymes are invariably tetrameric proteins with a total molecular weight of about 160 kDa and function by imine formation between the substrate and a lysine residue in the active site (Alfounder et al., 1989).
• the class II type aldolases are normally dimeric with molecular mass of approximately 80 kDa, and their activity depends on divalent metal ions.
• the class II enzymes may be isolated from prokaryotes, such as blue-green algae and bacteria, and eukaryotic green algae and fungi (Baldwin et al., 1978).
• the gene for the FDA class II enzyme may be obtained by known methods and has already been done so from several organisms including Saccharomyces cerevisiae (Jack and Harris, 1971), Bacillus stear other mophilus (Jack, 1973), and Escherichia coli (Baldwin et al., 1978).
• Such sequences can be readily isolated by methods well known in the art, for example by nucleic acid hybridization. The hybridization properties of a given pair of nucleic acids are an indication of their similarity or identity. Nucleic acid sequences can be selected on the basis of their ability to hybridize with known fda sequences. Low stringency conditions may be used to select sequences with less homology or identity.
• High stringency conditions may be used to select for nucleic acid sequences with higher degrees of identity to the disclosed sequences.
• Conditions typically employed may include about 0.02 M to about 0.15 M sodium chloride, about 0.5% to about 5% casein, about 0.02% SDS or about 0.1% N- laurylsarcosine, about 0.001 M to about 0.03 M sodium citrate, at hybridization temperatures between about 50°C and about 70°C. More preferably, high stringency conditions are about 0.02 M sodium chloride, about 0.5% casein, about 0.02% SDS, about 0.001 M sodium citrate, at a temperature of about 50°C.
• nucleic acid hybridization can be performed to isolate fda sequences having similarity to fda sequences known in the art and are not limited to those explicitly disclosed herein.
• such an approach is used to isolate fda sequences having greater than about 60% identity with the disclosed E.colifda sequence, more preferably greater than about 70% identity, most preferably greater than about 80% identity.
• Chlamydomonas mundana, and Chlamydomomas rheinhardi produce either a class I or a class II aldolase (Cremona, 1968; Russell and Gibbs, 1967; Guerrini et al., 1971).
• the isolation of a class llfda gene from E. coli is described in the following examples. Its DNA sequence is given as S ⁇ Q ID NO:l and shown in Figure 1. The amino acid sequence is shown in S ⁇ Q ID NO:2 and shown in Figure 1. This gene can be . used as isolated by inserting it into plant expression vectors suitable for the transformation method of choice as described.
• the E. coli FDA enzyme has an apparent pH optimum range near pH 7-9 and retains activity in the lower pH range of 5-7 (Baldwin et al., 1978; Alfounder et al, 1989).
• fructose 1 ,6 bisphosphate aldolase activity may be isolated and used in the present invention.
• a carbohydrate metabolizing enzyme considered in this invention includes any sequence of amino acids, such as protein, polypeptide. or peptide fragment, that demonstrates the ability to catalyze a reaction involved in the synthesis or degradation of starch or sucrose.
• amino acids such as protein, polypeptide. or peptide fragment
• These can be sequences obtained from a heterologous source, such as algae, bacteria, fungi, and protozoa, or endogenous plant sequences, by which is meant any sequence that can be naturally found in a plant cell, including native (indigenous) plant sequences as well as sequences from plant viruses or plant pathogenic bacteria.
• carbohydrate metabolizing enzyme gene sequences may also be modified using standard techniques such as site-specific mutation or PCR, or modification of the sequence may be accomplished by producing a synthetic nucleic acid sequence and will still be considered a carbohydrate biosynthesis enzyme nucleic acid sequence of this invention.
• "wobble" positions in codons may be changed such that the nucleic acid sequence encodes the same amino acid sequence, or alternatively, codons can be altered such that conservative amino acid substitutions result. In either case, the peptide or protein maintains the desired enzymatic activity and is thus considered part of this invention.
• a nucleic acid sequence to a carbohydrate metabolizing enzyme may be a DNA or RNA sequence, derived from genomic DNA, cDNA, mRNA, or may be synthesized in whole or in part.
• the structural gene sequences may be cloned, for example, by isolating genomic DNA from an appropriate source and amplifying and cloning the sequence of interest using a polymerase chain reaction (PCR).
• PCR polymerase chain reaction
• the gene sequences may be synthesized, either completely or in part, especially where it is desirable to provide plant-preferred sequences.
• all or a portion of the desired structural gene may be synthesized using codons preferred by a selected plant host. Plant-preferred codons may be determined, for example, from the codons used most frequently in the proteins expressed in a particular plant host species. Other modifications of the gene sequences may result in mutants having slightly altered activity.
• the gene sequence of the fda gene can be changed without changing the protein sequence in such a manner as may increase expression and thus even more positively affect carbohydrate content in transformed plants.
• a preferred manner for making the changes in the gene sequence is set out in PCT Publication WO 90/10076.
• a gene synthesized by following the methodology set out therein may be introduced into plants as described below and result in higher levels of expression of the FDA enzyme. This may be particularly useful in monocots such as maize, rice, wheat, sugarcane, and barley. Combinations with other transgenes
• fda in transgenic plants may be enhanced by combining it with other genes that positively affect carbohydrate assimilation or content, such as a gene encoding for a sucrose phosphorylase as described in PCT Publication WO 96/24679, or ADPGPP genes such as the E. coli glgC gene and its mutant glgCl ⁇ .
• PCT Publication WO 91/19806 discloses how to incorporate the latter gene into many plant species in order to increase starch or solids.
• Another gene that can be combined with fda to increase carbon assimilation, export or storage is a gene encoding for sucrose phosphate synthase (SPS).
• SPS sucrose phosphate synthase
• PCT Publication WO 92/16631 discloses one such gene and its use in transgenic plants.
• Plant transformation/regeneration In developing the nucleic acid constructs of this invention, the various components of the construct or fragments thereof will normally be inserted into a convenient cloning vector, e.g., a plasmid that is capable of replication in a bacterial host, e.g., E. coli.
• a convenient cloning vector e.g., a plasmid that is capable of replication in a bacterial host, e.g., E. coli.
• Numerous vectors exist that have been described in the literature, many of which are commercially available.
• the cloning vector with the desired insert may be isolated and subjected to further manipulation, such as restriction digestion, insertion of new fragments or nucleotides, ligation, deletion, mutation, resection, etc.
• a recombinant DNA molecule of the invention typically includes a selectable marker so that transformed cells can be easily identified and selected from non- transformed cells. Examples of such include, but are not limited to, a neomycin phosphotransferase (nptll) gene (Potrykus et al., 1985), which confers kanamycin resistance. Cells expressing the nptll gene can be selected using an appropriate antibiotic such as kanamycin or G418.
• nptll neomycin phosphotransferase
• selectable markers include the bar gene, which confers bialaphos resistance; a mutant EPSP synthase gene (tlinchee et al., 1988), which confers glyphosate resistance; a nitrilase gene, which confers resistance to bromoxynil (Stalker et al., 1988); a mutant acetolactate synthase gene (ALS), which confers imidazolinone or sulphonylurea resistance (European Patent Application 154,204, 1985); and a methotrexate resistant DHFR gene (Thillet et al., 1988).
• Plants that can be made to have enhanced carbon assimilation, increased carbon export and partitioning by practice of the present invention include, but are not limited to, Acacia, alfalfa, aneth, apple, apricot, artichoke, arugula, asparagus, avocado, banana, barley, beans, beet, blackberry, blueberry, broccoli, brussels sprouts, cabbage, canola, cantaloupe, carrot, cassava, cauliflower, celery, cherry, cilantro, citrus, Clementines, coffee, corn, cotton, cucumber, Douglas fir, eggplant, endive, escarole, eucalyptus, fennel, figs, gourd, grape, grapefruit, honey dew, jicama, kiwifruit, lettuce, leeks, lemon, lime, Loblolly pine, mango, melon, mushroom, nut, oat, oil seed rape, okra, onion, orange, an ornamental plant, papaya, parsley, pea, peach
• a double-stranded DNA molecule of the present invention containing an fda gene can be inserted into the genome of a plant by any suitable method.
• Suitable plant transformation vectors include those derived from a Ti plasmid of Agrobacterium tumefaciens, as well as those disclosed, e.g., by Herrera-Estrella et al. (1983), Bevan (1984), Klee et al. (1985) and EPO publication 120.516.
• Ri root-inducing
• alternative methods can be used to insert the DNA constructs of this invention into plant cells. Such methods may involve, for example, the use of liposomes, electroporation. chemicals that increase free DNA uptake, free DNA delivery via microprojectile bombardment, and transformation using viruses or pollen. DNA may also be inserted into the chloroplast genome (Darnell et al, 1998).
• a plasmid expression vector suitable for the introduction of an fda gene in monocots using microprojectile bombardment is composed of the following: a promoter that is specific or enhanced for expression in the starch storage tissues in monocots, generally the endosperm, such as promoters for the zein genes found in the maize endosperm (Pedersen et al., 1982); an intron that provides a splice site to facilitate expression of the gene, such as the Hsp70 intron (PCT Publication W093/19189); and a 3' polyadenylation sequence such as the nopaline synthase 3' sequence (NOS 3'; Fraley et al., 1983).
• a promoter that is specific or enhanced for expression in the starch storage tissues in monocots generally the endosperm, such as promoters for the zein genes found in the maize endosperm (Pedersen et al., 1982)
• This expression cassette may be assembled on high copy replicons suitable for the production of large quantities of DNA.
• a particularly useful Agrobacterium-hased plant transformation vector for use in transformation of dicotyledonous plants is plasmid vector pMON530 (Rogers et al., 1987).
• Plasmid pMON530 is a derivative of pMON505 prepared by transferring the 2.3 kb Stul- Hindlll fragment of pMON316 (Rogers et al., 1987) into pMON526.
• Plasmid pMON526 is a simple derivative of pMON505 in which the Smal site is removed by digestion with Xmal, treatment with Klenow polymerase and ligation.
• Plasmid pMON530 retains all the properties of pMON505 and the CaMV35S-NOS expression cassette and now contains a unique cleavage site for Smal between the promoter and polyadenylation signal.
• Binary vector pMON505 is a derivative of pMON200 (Rogers et al, 1987) in which the Ti plasmid homology region, LIH, has been replaced with a 3.8 kb Hindlll to Smal segment of the mini RK2 plasmid, pTJS75 (Schmidhauser and Helinski, 1985). This segment contains the RK2 origin of replication, oriV, and the origin of transfer, oriT, for conjugation into Agrobacterium using the tri-parental mating procedure (Horsch and Klee, 1986).
• Plasmid pMON505 retains all the important features of pMON200 including the synthetic multi-linker for insertion of desired DNA fragments, the chimeric NOS/NPTII'/NOS gene for kanamycin resistance in plant cells, the spectinomycin/streptomycin resistance determinant for selection in E. coli and A. tumefaciens, an intact nopaline synthase gene for facile scoring of transformants and inheritance in progeny, and a pBR322 origin of replication for ease in making large amounts of the vector in E. coli. Plasmid pMON505 contains a single T-DNA border derived from the right end of the pTiT37 nopaline-type T-DNA.
• Ti plasmid cassette vector is pMON 17227.
• This vector is described in PCT Publication WO 92/04449 and contains a gene encoding an enzyme conferring glyphosate resistance (denominated CP4), which is an excellent selection marker gene for many plants, including potato and tomato.
• the gene is fused to the Arabidopsis EPSPS chloroplast transit peptide (CTP2) and expressed from the FMV promoter as described therein.
• CTP2 Arabidopsis EPSPS chloroplast transit peptide
• Choice of methodology for the regeneration step is not critical, with suitable protocols being available for hosts from Leguminosae (alfalfa, soybean, clover, etc.), Umbelliferae (carrot, celery, parsnip), Cruciferae (cabbage, radish, canola/rapeseed, etc.), Cucurbitaceae (melons and cucumber), Gramineae (wheat, barley, rice, maize, etc.), Solanaceae (potato, tobacco, tomato, peppers), various floral crops, such as sunflower, and nut-bearing trees, such as almonds, cashews, walnuts, and pecans. See, e.g., Ammirato et al.
• promoter refers to a nucleic acid sequence, usually found upstream (5') to a coding sequence, that controls expression of the coding sequence by controlling production of messenger RNA (mRNA) by providing the recognition site for RNA polymerase or other factors necessary for start of transcription at the correct site.
• mRNA messenger RNA
• a promoter or promoter region includes variations of promoters derived by means of ligation to various regulatory sequences, random or controlled mutagenesis, and addition or duplication of enhancer sequences.
• the promoter region disclosed herein, and biologically functional equivalents thereof, are responsible for driving the transcription of coding sequences under their control when introduced into a host as part of a suitable recombinant vector, as demonstrated by its .ability to produce mRNA.
• Regeneration refers to the process of growing a plant from a plant cell (e.g., plant protoplast or explant).
• Transformation refers to a process of introducing an exogenous nucleic acid sequence (e.g., a vector, recombinant nucleic acid molecule) into a cell or protoplast in which that exogenous nucleic acid is incorporated into a chromosome or is capable of autonomous replication.
• a “transformed cell” is a cell whose DNA has been altered by the introduction of an exogenous nucleic acid molecule into that cell.
• the term “gene” refers to chromosomal DNA, plasmid DNA, cDNA, synthetic
• DNA or other DNA that encodes a peptide, polypeptide, protein, or RNA molecule, and regions flanking the coding sequence involved in the regulation of expression.
• Identity refers to the degree of similarity between two nucleic acid or protein sequences.
• An alignment of the two sequences is performed by a suitable computer program.
• a widely used and accepted computer program for performing sequence alignments is CLUSTALW vl.6 (Thompson et al., 1994).
• the number of matching bases or amino acids is divided by the total number of bases or amino acids and multiplied by 100 to obtain a percent identity. For example, if two 580 base pair sequences had 145 matched bases, they would be 25 percent identical. If the two compared sequences are of different lengths, the number of matches is divided by the shorter of the two lengths.
• C-terminal region refers to the region of a peptide, polypeptide, or protein chain from the middle thereof to the end that carries the amino acid having a free carboxyl group.
• DNA segment heterologous to the promoter region means that the coding DNA segment does not exist in nature in the same gene with the promoter to which it is now attached.
• encoding DNA refers to chromosomal DNA, plasmid DNA, cDNA, or synthetic DNA that encodes any of the enzymes discussed herein.
• the term "genome” as it applies to bacteria encompasses both the chromosome and plasmids within a bacterial host cell. Encoding DNAs of the present invention introduced into bacterial host cells can therefore be either chromosomally integrated or plasmid- localized.
• the term "genome” as it applies to plant cells encompasses noj only chromosomal DNA found within the nucleus, but organelle DNA found within subcellular components of the cell. DNAs of the present invention introduced into plant cells can therefore be either chromosomally integrated or organelle-localized.
• microbe or “microorganism” refer to algae, bacteria, fungi, and protozoa.
• mutein refers to a mutant form of a peptide, polypeptide, or protein.
• N-terminal region refers to the region of a peptide, polypeptide, or protein chain from the amino acid having a free amino group to the middle of the chain.
• “Overexpression” refers to the expression of a polypeptide or protein encoded by a DNA introduced into a host cell, wherein said polypeptide or protein is either not normally present in the host cell, or wherein said polypeptide or protein is present in said host cell at a higher level than that normally expressed from the endogenous gene encoding said polypeptide or protein.
• plastid refers to the class of plant cell organelles that includes amyloplasts, chloroplasts. chromoplasts, elaioplasts, eoplasts, etioplasts, leucoplasts, and proplastids. These organelles are self-replicating and contain what is commonly referred to as the "chloroplast genome,” a circular DNA molecule that ranges in size from about 120 kb to about 217 kb, depending upon the plant species, and which usually contains an inverted repeat region.
• simple carbohydrate substrate means a monosaccharide or an oligosaccharide but not a polysaccharide; simple carbohydrate substrate includes glucose, fructose, sucrose, lactose. More complex carbohydrate substrates commonly used in media such as corn syrup, starch, and molasses can be broken down to simple carbohydrate substrates.
• solids refers to the nonaqueous component of a tuber (such as in potato) or a fruit (such as in tomato) comprised mostly of starch and other polysaccharides, simple carbohydrates, nonstructural carbohydrated, amino acids, and other organic molecules.
• the E. coli fda gene sequence (SEQ ID NO: 1) was obtained from Genbank (Accession Number XI 4682) and nucleotide primers with homology to the 5' and 3' end were designed for PCR amplification. E. coli chromosomal DNA was extracted and the E. coli fda gene was amplified by PCR using the 5' oligonucleotide 5'GGGGCCATGGCTAAGATTTTTGATTTCGTA3' (SEQ ID NO:3) and the 3' oligonucleotide 5'CCCCGAGCTCTTACAGAACGTCGATCGCGTTCAG3' (SEQ ID NO:3)
• the PCR cycling conditions were as follows: 94 C, 5 min (1 cycle); addition of polymerase; 94 ° C, 1 min.. 60 ° C, 1 min., 72 ° C, 2 min.30 sec. (35 cycles).
• the 1.08 kb PCR product was gel purified and ligated into an E.coli expression vector, pMON5723, to form a vector construct that was used for transformation of frozen competent E.coli JM101 cells.
• the pMON5723 vector contains the E.coli recA promoter and the T7 gene 10 leader (G10L) sequences, which enable high level expression in E.coli (Wong et al., 1988).
• the fda gene sequence was subsequently cloned into another E.coli expression vector, under the control of the taq promoter. Induction with IPTG of JM101 cells transformed with this vector showed the same 40 kDa overexpressed protein band.
• This new clone was used in an enzyme assay for FDA activity.
• Cells transformed with this vector construct were grown in a liquid culture, induced with IPTG, and grown for another 3 hours. Subsequently, a 3 mL cell culture was spun down, dissolved in 1.00mM Tris and sonicated. The cell pellet was spun down, and the crude cell extract supernatant was assayed for FDA activity, using a coupled enzymatic assay as described by Baldwin et al. (1978). This assay was routinely performed at 30 C.
• the reaction was performed in a 1 mL final volume in excess presence of the enzymes triosephosphate isomerase (TIM) and alpha-glycerophosphate dehydrogenase (GDH) in a reaction mixture containing final concentrations of lOOmM Tris pH 8.0, 4.75 mM fructose 1,6 bisphosphate, 0.15 mM NADH, 500 U/mL TIM, and 30 U/mL GDH.
• TIM triosephosphate isomerase
• GDH alpha-glycerophosphate dehydrogenase
• E.coli fructose 1 ,6 bisphosphate aldolase was targeted to the plastid in plants in order to assess its influence on carbohydrate metabolism and starch biosynthesis in these plant organelles.
• a vector was constructed in which the aldolase was fused to the Arabidopsis small subunit transit peptide (CTP1) (Stark et al, 1992) or the maize small subunit CTP (Russell et al., 1993), creating constructs in which the CTV-fda fusion gene was located between the 35S promoter from the figwort mosaic virus (P-FMV35S; Gowda et al., 1989) and the 3'- nontranslated region of the nopaline synthase gene (NOS 3'; Fraley et al., 1983) sequences.
• CTP1 Arabidopsis small subunit transit peptide
• P-FMV35S figwort mosaic virus
• NOS 3' Fraley et al., 1983
• the vector construct containing the expression cassette [P- FMV/CTPl/ ⁇ /NOS3'] was subsequently used for tobacco protoplast transformation, which was performed as described in Fromm et al. (1987), with the following modifications.
• Tobacco cultivar Xanthi line D (Txd) cell suspensions were grown in 250- mL flasks, at 25°C and 138 rpm in the dark.
• a sub-culture volume of 9 mL was removed and added to 40 mL of fresh Txd media containing MS salts, 3% sucrose, 0.2 g/L inositol, 0.13 g/L asparagine, 80 ⁇ L of a 50 mg/mL stock of PCPA, 5 ⁇ L of a 1 mg/mL stock of kinetin, and 1 mL of lOOOx vitamins (1.3 g/L nicotinic acid, 0.25 g/L thiamine, 0.25 g/L pyridoxine HCL, and 0.25 g/L calcium pantothenate) every 3 to 4 days.
• Protoplasts were isolated from 1 -day-old suspension cells that came from a 2-day- old culture. Sixteen milliliters of cells were added to 40 mL of fresh Txd media and allowed to grow 24 hours prior to digestion and isolation of the protoplasts. The centrifugation stage for the enzyme mix has been eliminated. The electroporation buffer and protoplast isolation media were filter sterilized rather than autoclaved. The electroporation buffer did not have 4 mM CaCl2 added. The suspension cells were digested in enzyme for 1 hour. Protoplasts were counted on a hemacytometer, counting only the protoplasts that look intact and circular.
• Bio-rad Gene Pulser cuvettes catalog # 165-2088 with a 0.4-cm gap and a maximum volume of 0.8 mL were used for the electroporations. Fifty to 100 ⁇ g of DNA containing the gene of interest along with 5 ⁇ g of internal control DNA containing the luciferase gene were added per cuvette. The final protoplast density at electroporation was 2xl ⁇ 6/mL and electroporater settings were a 500 ⁇ Farad capacitance and 140 volts on the Bio-rad Gene Pulser. Protoplasts were put on ice after resuspension in electroporation buffer and remained on ice in cuvettes until 10 minutes after electroporation.
• Protoplasts were added to 7 mL of Txd media + 0.4 M mannitol and conditioning media after electroporation. At this stage coconut water was no longer used. The protoplasts were grown in 1- hour day/night photoperiod regime at 26°C and were spun down and assayed or frozen 20-24 hours after electroporation.
• the expression cassette [P-FMV/CTPl//tf ⁇ /NOS3'] was subsequently cloned into the Notl site of pMON 17227 (described in PCT Publication WO 92/04449), in the same orientation as the selectable marker expression cassette, to form the plant transformation vector pMON17524, as shown in Figure 2 (SEQ ID NO: 5).
• An additional construct was made and used for tobacco protoplast transformation, fusing the fda gene to the Arabidopsis EPSPS transit peptide (CTP2), which is described in US patent 5,463,175.
• the transit peptide was cloned (through the Sphl site) into the Sphl site located immediately upstream from the N-terminus of the fda gene sequence in the CTP ⁇ -fda fusion (described above).
• This new CTP2-fda fusion gene was then cloned into a vector between the FMV promoter and the NOS 3' sequences.
• expression was detected of a protein migrating at approximately 40 kDa, which is the molecular weight of the aldolase subunit and the size of the protein also observed after overexpression of the aldolase in E. coli.
• the Notl cassette [P-FMV/CTP2//d ⁇ /NOS3'] from this construct was then cloned into the Notl site of pMON 17227, in the same orientation as the selectable marker expression cassette, to form the plant transformation vector pMON 17542, which is shown in Figure 3 (S ⁇ Q ID NO:6).
• fda gene sequence (without being coupled to a transit peptide) was cloned into a vector backbone, between the FMV promoter and the NOS 3' sequences.
• Using this construct for tobacco protoplast transformation also showed expression of a protein of the same size, migrating at approximately 40 kDa. fda expression in tobacco plants
• leaf samples were also taken from these plants and analyzed for diurnal changes in leaf nonstructural carbohydrates.
• Five hundred milligrams to 1 g fresh tobacco leaf tissue samples were harvested and extracted in 5 mL of hot Na-phosphate buffer (40 g/L NaH 2 PO 4 and 10 g/L Na 2 H 2 PO 4 in double de-ionized water) by homogenization with a Polytron. Test tubes were then placed in an 85°C water bath for 15 minutes. Tubes were centrifuged for 12 minutes at 3000 rpm and the supernatants saved for soluble sugar analysis. The pellet was resuspended in 5 mL of hot Na-phosphate buffer mixed with a Vortex and centrifuged as described above. The supernatant was carefully removed and added to the previous supernatant fraction for soluble sugar (sucrose and glucose) analysis by YSI using appropriate membranes. The starch was extracted from the pellet using the Megazyme Kit (Megazyme,
• a second set of transgenic tobacco plants transformed with the construct pMON 17542 were grown in the greenhouse.
• Tobacco plants containing a vector without the CTV-fda sequences, pMON 17227 were used as negative control.
• pMON17542-lines screened for expression by Western blot analysis 18 were high expressors (>0.01% of the total cellular protein) and 15 lines were low expressors ( ⁇ 0.01%).
• Fifteen plants containing the null vector, pMON17227 were used as control.
• Fully expanded leaves from plants expressing the fda transgene and negative controls were tested for sucrose export by collecting phloem exudate from excised leaf systems.
• the phloem exudation technique is described in Groussol et al. (1986). Leaves were harvested at 11:30 AM and placed in an exudation medium, containing 5 mM EDTA at pH 6.0, and allowed to exude for a period of 4 hours under full light and high humidity. The exudation solution was immediately analyzed for sucrose level, as described above in the carbohydrate analysis method. As seen in Table 2, a significant increase in sucrose export out of source leaves was observed in plants expressing the fda transgene.
• sucrose export by ⁇ -expressing leaves is an illustration of an increase in source capacity, very likely due to an increased carbon flow through the Calvin Cycle (in response to increased triose-P utilization) and thus an increase in net carbon utilization by the leaf.
• the increase in sucrose loading in the phloem correlates with the level of fda expression.
• Roots from 5 high and 7 low expressing lines and 6 control plants were excised and washed carefully then placed in a 65°C drying oven for at least 48 hours. Roots were removed from the oven and allowed to equilibrate in the laboratory for 2 hours before dry weight determination.
• Vectors containing the fda gene with and without the plastid targeting peptide were made for transformation in corn and are also suitable for other monocots, including rice, wheat, barley, sugarcane, triticale, etc.
• a construct was made in which the fda gene sequence was fused to the backbone of a vector containing the enhanced CaMV 35S promoter (e35S; Kay et al., 1987), the HSP70 intron (US patent 5,593,874), and the NOS3' polyadenylation sequence (Fraley et al., 1983).
• pMON30460 contains an expression cassette for the selectable marker neomycin phosphotransferase typell gene (nptll) [P-35S/NPTII /NOS3'] and a unique Notl site for cloning the gene of interest.
• the final vector (pMON13925) was constructed so that the gene of interest and the selectable marker gene were cloned in the same orientation.
• a vector fragment containing the expression cassettes for these gene sequences could be excised from the bacterial selector (Kan) and ori, gel purified, and used for plant transformation.
• fda gene sequence for the chloroplast-targeted expression of the fda gene in corn plants, a construct was made in which the fda gene sequence, coupled to the maize RUBISCO small subunit CTP (Russell et al., 1993), was fused to the backbone of a vector containing the enhanced (CaMV) 35S promoter, the HSP70 intron, and the NOS3' polyadenylation sequences.
• the fda gene sequence was cloned into a vector (in the same orientation as the selectable marker cassette " [P-35S/NPTII /NOS3']) containing the glutelin gene promoter P-osgtl (Zheng et al., 1993), the HSP70 intron, and the NOS3' polyadenylation sequences to form the vector pMON 13936, as shown in Figure 7.
• Transgenic maize plants transformed with the vectors pMON13925 (described above) or pMON17590 (described above) were produced using microprojectile bombardment, a procedure well-known to the art (Fromm, 1990; Gordon-Kamm et al., 1990; Walters et al., 1992). Embryogenic callus initiated from immature maize embryos was used as a target tissue. Plasmid DNA at lmg/mL in TE buffer was precipitated onto M10 tungsten particles using a calcium chloride / spermidine procedure, essentially as described by Klein et al. (1988).
• the plasmids also contained the neomycin phosphotransferase II gene (nptll) driven by the 35S promoter from Cauliflower Mosaic Virus.
• nptll neomycin phosphotransferase II gene driven by the 35S promoter from Cauliflower Mosaic Virus.
• the embryogenic callus target tissue was pretreated on culture medium osmotically buffered with 0.2M mannitol plus 0.2M sorbitol for approximately four hours prior to bombardment (Vain et al., 1993). Tissue was bombarded two times with the DNA-coated tungsten particles using the gunpowder version of the BioRad Particle Delivery System (PDS) 1000 device.
• PDS BioRad Particle Delivery System
• tissue was subcultured onto a medium of the same composition except that it contained no mannitol or sorbitol, and it contained an appropriate aminoglycoside antibiotic, such as G418", to select for those cells that contained and expressed the 35S/nptII gene. Actively growing tissue sectors were transferred to fresh selective medium approximately every 3 weeks. About 3 months after bombardment, plants were regenerated from surviving embryogenic callus essentially as described by Duncan and Widholm (1988). Aldolase activity from transgenic maize
• Aldolase enzyme was extracted from the leaf tissue by grinding the leaf tissue at 4°C in 1.2 mL of the extraction buffer (100 mM Hepes, pH 8.0, 5 mM MgCl 2 , 5 " mM MnCl 2 , 100 mM KC1, 10 mM DTT, 1% BSA, 1 mM PMSF, 10 . ⁇ g/mL leupeptin, 10 ⁇ g/mL aprotinin). The extract was centrifuged at 15,000 x g, at 4 C for 3 minutes, and the non-desalted supernatant was assayed for enzyme activity.
• the extraction buffer 100 mM Hepes, pH 8.0, 5 mM MgCl 2 , 5 " mM MnCl 2 , 100 mM KC1, 10 mM DTT, 1% BSA, 1 mM PMSF, 10 . ⁇ g/mL leupeptin, 10 ⁇ g/mL aprotin
• a phenotype was visible in the primary transformants (RO plants) expressing the E. coli FDA when the protein was targeted to the chloroplast.
• the leaves were chlorotic but seed set was normal.
• Rl plants were grown in both field and in greenhouse experiments. Starch was not detectable in the leaves using an iodine staining and pollination was delayed. It is believed that the phenotype in these com plants may be the result of the promoter (e35S) used in both the pMON 17590 and pMON13925 vectors not being preferred for causing FDA expression in com.
• e35S is believed to cause mesophyll enhanced expression and the Calvin Cycle in a C4 plant such as com occurs predominantly in the bundle sheath cells
• a promoter directing enhanced expression in the bundle sheath cells such as the ssRUBISCO promoter
• Vectors containing such a promoter and driving expression of FDA have been prepared and are being tested in maize.
• the maize RuBISCO small subunit (PmzSSU, a bundle sheath cell- specific promoter) has been used to construct vectors for cell-specific fda expression in maize.
• a class I aldolase (fdal), an fda without an iron sulfur cluster and with different properties fxomjdall, was utilized to improve carbon metabolism in C4 crops (e.g. maize) .
• the gene for the class I aldolase was amplified from the genome of Staphylococcus aureus and activity was comfirmed. Transformation vectors were then constructed to express both classes of aldolase (fdal and fd ⁇ ll) in a cell-specific manner in maize.
• cassettes have been made: pMON13899: PmzSSU/hsp70/mzSSU CTP/fd ⁇ l pMON13990PmzSSU/hsp70/mzSSU CTP/t / ⁇ /7 pMON13988:P35S/hsp70//rf /.
• the vector pMON 13936 uses the rice gtl promoter to drive expression of aldolase in the cytoplasm of the endosperm cells.
• Another vector uses the same promoter with the maize RuBISCO small subunit transit peptide to localize the protein in the amyloplasts. Homozygous lines of the cytosolic aldolase transformants have been identified (Homozygosity of 37 plants was confirmed using western blot analysis) and seed from these plants were collected for grain composition analysis (moisture, protein, starch, and oil).
• the plant expression vector, pMON17542 (described earlier), in which the fda gene is expressed behind the FMV promoter and the aldolase enzyme is fused to the chloroplast transit peptide CTP2, was used for Agrobacterium-mediated potato transformation.
• a second potato transformation vector was constructed by cloning the Notl cassette [P-FMV/CTP2//d ⁇ /NOS3'] (described earlier) into the unique Notl site of . pMON23616.
• pMON23616 is a potato transformation vector containing the nopaline-type T-DNA right border region (Fraley et al., 1985), an expression cassette for the neomycin phosphotransferase typell gene [P-35S/NPTII /NOS3'] (selectable marker), a unique Notl site for cloning the gene expression cassette of interest, and the T-DNA left border region (Barker et al., 1983).
• Cloning of the Notl cassette [P-FMV/CTP2//tf ⁇ /NOS3'j (described earlier) into the Notl site of pMON23616 results in the potato transformation vector pMON 17581, as shown in Figure 8.
• the vector pMON17581 was constructed such that the gene of interest and the selectable marker gene were transcribed in the same direction.
• Potato plant transformation vector pMON 17581 was constructed such that the gene of interest and the selectable marker gene were transcribed in the same direction.
• the plant transformation vectors were mobilized into the ABI Agrobacterium strain. Mating of the plant vector into the ABI strain was done by the triparental conjugation system using the helper plasmid pRK2013 (Ditta et al., 1980).
• the vector pMON 17542 was used for potato transformation via Agrobacterium transformation of Russet Burbank potato callus, following the method described in PCT Publication WO 96/03513 for glyphosate selection of transformed lines. After transformation with the vector pMONl 7542, transgenic potato plantlets that came through selection on glyphosate were screened for expression of E. coli aldolase by leaf Western blot analysis. Out of 1 12 independent lines assayed.
• HS31-638 is a Russet Burbank potato line previously transformed with the mutant ADPglucose pyrophosphorylase (glgCI ⁇ ) gene from E.coli (U.S. Patent 5,498,830).
• the potato callus was transformed following the method described in PCT Publication WO 96/03513, substituting kanamycin (administered at a concentration of 150-200 mg/L) for glyphosate as a selective agent.
• transgenic potato plants were screened for expression of the fda gene by assaying leaf punches from tissue culture plantlets.
• Western blot analysis using antibodies raised against the E. coli aldolase) of leaf tissue from the pMON 17581 -transformed lines identified 12 expressing lines out of 56 lines screened. Expression was detected of a protein migrating at approximately 40 kDa, which is the molecular weight of the E. coli (classll) aldolase subunit and the size of the protein observed after overexpression of the aldolase in E. coli.
• Increas of Tubers (Tubers over (% of Total Weight) e over 30g 30g)
• This table summarizes the tuber yield and specific gravity for all seven lines grown in the greenhouse. The results indicate that, in comparison to the control, all but one of the fda lines show an increase in overall tuber yield, and that in four lines, there is a corresponding increase in percentage of tubers that weigh more than 30 g. For combined tubers over 30 g, the percent of total weight is near that of the control, and for two lines is greater than the control. This indicates that five out of the six of the lines show higher overall yield and are not making smaller tubers. In other words, with the increase in overall yield, there is a corresponding increase in percentage of bigger tubers (over 30 g). However, there is no increase in specific gravity of the tubers.
• leaf samples were taken from 6 of the highest / / ⁇ -expressing potato lines, obtained after transformation with pMON17542, and assayed for aldolase activity.
• Aldolase was extracted from 0.2 g of leaf tissue by grinding at 4°C in 1.2 mL of the extraction buffer: 100 mM Hepes, pH 8.0, 5 mM MgCl 2 , 5 mM MnCl 2 , 100 mM KCl, 10 mM DTT, 1% BSA, ImM PMSF, 10 ⁇ g/mL leupeptin, 10 ⁇ g/mL aprotinin. The extract was assayed for aldolase activity as described earlier.
• Russet Burbank lines expressing fda (potato lines designated "Maestro"), obtained after transformation with pMON 17542, and fifteen Russet Burbank Simple Solid lines, also containing g/gC16 (PCT Publication WO 91/19806 and US Patent 5,498,830), expressing fda (potato lines designated "Segal”), obtained after transformation with pMON 17581, were field tested at two different sites. For each field site, 36 plants per line (three repetitions of 12 plants per line) were evaluated for tuber solids distribution. At harvest, tubers were pre-sorted at each field site into a ten to twelve ounce category, and nine tubers from each replicated plot were analyzed in groups of three.
• starch distribution was evaluated by removing the center longitudinal slice (13 mm) from each tuber. Slices were then peeled and laid flat on a cutting board where the inner tuber region (pith region) was removed by a 14-mm cork punch. The tissue from pith to cortex (perimedullary region) was removed by an up-to-a 2-inch cork punch. The remaining cortex tissue was approximately an 8-mm wide ring from the outermost region of the slice.
• the degree of solids uniformity is determined by calculating the pith to cortex solids ratio (pith solids divided by cortex solids). The three groups of three tubers per plot were averaged, at which point the average of three plot replications was calculated per field site.
• Tables 8 and 9 represent the data from one field site (site 1) for Segal and Maestro, respectively, and illustrate that the majority of Segal and Maestro lines have higher pith to cortex solids ratios than that of 68.4% for the Russet Burbank control, with some lines approaching an 82% pith to cortex solids ratio.
• Tables 10 and 1 1 represent the data from another field site (site 2) for Segal and Maestro, respectively, and also illustrate that the majority of Maestro and Segal lines have higher pith to cortex solids ratios than that of the Russet Burbank control, with some lines approaching an 88% pith to cortex solids ratio.
• the Russet Burbank control had an atypical, abnormally high pith-to-cortex solids uniformity ratio of 79.3%, which was most likely due to environmental growing conditions.
• the site 2 results demonstrate that expression in Russet Burbank potato of E.
• coli fda increases tuber solids uniformity even in a growing season when tuber solids uniformity is already extremely high in nontransgenic Russet Burbank. That is, the fda gene continues to perform when agricultural conditions are already conducive to an abnormally high solids uniformity level.
• TACGGCGTAG TAAAAATGAA CATCGATACC GATACCCAAT GGGCAACCTG GGAAGGCGTT 900
• Val Leu Glu Thr Ala Ala Lys Val Lys Ala Pro Val lie Val Gin 50 55 60
• AAAAGACATC CACCGAAGAC TTAAAGTTAG TGGGCATCTT TGAAAGTAAT 10551 CTTGTCAACA TCGAGCAGCT GGCTTGTGGG GACCAGACAA AAAAGGAATG

Priority Applications (10)

Applications Claiming Priority (2)

Publications (1)

Family

ID=21962657

Family Applications (1)

Country Status (16)

Cited By (20)

Families Citing this family (7)

Citations (3)

• 1998
  • 1998-06-16 WO PCT/US1998/012447 patent/WO1998058069A1/en not_active Application Discontinuation
  • 1998-06-16 EA EA200000029A patent/EA200000029A1/ru unknown
  • 1998-06-16 TR TR1999/03157T patent/TR199903157T2/xx unknown
  • 1998-06-16 JP JP50465099A patent/JP2001520522A/ja active Pending
  • 1998-06-16 NZ NZ501781A patent/NZ501781A/en unknown
  • 1998-06-16 CA CA002294525A patent/CA2294525A1/en not_active Abandoned
  • 1998-06-16 IL IL13353298A patent/IL133532A0/xx unknown
  • 1998-06-16 AU AU81445/98A patent/AU735383B2/en not_active Ceased
  • 1998-06-16 EP EP98931283A patent/EP1002114A1/en not_active Withdrawn
  • 1998-06-16 CN CN98808178A patent/CN1267333A/zh active Pending
  • 1998-06-16 HU HU0004228A patent/HUP0004228A3/hu unknown
  • 1998-06-16 PL PL98337581A patent/PL337581A1/xx unknown
  • 1998-06-16 BR BR9810171-4A patent/BR9810171A/pt not_active Application Discontinuation
  • 1998-06-17 AR ARP980102895A patent/AR020307A1/es not_active Application Discontinuation
  • 1998-06-17 ZA ZA985261A patent/ZA985261B/xx unknown
• 1999
  • 1999-12-15 NO NO996218A patent/NO996218L/no not_active Application Discontinuation

Patent Citations (3)

Non-Patent Citations (6)

Also Published As

Similar Documents

Legal Events