WO1998027230A1 - Methods and compositions for polypeptide engineering - Google Patents

Methods and compositions for polypeptide engineering Download PDF

Info

Publication number
WO1998027230A1
WO1998027230A1 PCT/US1997/024239 US9724239W WO9827230A1 WO 1998027230 A1 WO1998027230 A1 WO 1998027230A1 US 9724239 W US9724239 W US 9724239W WO 9827230 A1 WO9827230 A1 WO 9827230A1
Authority
WO
WIPO (PCT)
Prior art keywords
protein
dna
dna substrate
products
library
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US1997/024239
Other languages
English (en)
French (fr)
Inventor
Phillip A. Patten
Willem P. C. Stemmer
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Maxygen Inc
Original Assignee
Maxygen Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Family has litigation
First worldwide family litigation filed litigation Critical https://patents.darts-ip.com/?family=25084330&utm_source=google_patent&utm_medium=platform_link&utm_campaign=public_patent_search&patent=WO1998027230(A1) "Global patent litigation dataset” by Darts-ip is licensed under a Creative Commons Attribution 4.0 International License.
Application filed by Maxygen Inc filed Critical Maxygen Inc
Priority to CA2274319A priority Critical patent/CA2274319C/en
Priority to EP97953571A priority patent/EP0946755A4/en
Priority to IL13019097A priority patent/IL130190A0/xx
Priority to AU57292/98A priority patent/AU732146B2/en
Priority to JP52805498A priority patent/JP5008784B2/ja
Publication of WO1998027230A1 publication Critical patent/WO1998027230A1/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/10Processes for the isolation, preparation or purification of DNA or RNA
    • C12N15/102Mutagenizing nucleic acids
    • C12N15/1031Mutagenizing nucleic acids mutagenesis by gene assembly, e.g. assembly by oligonucleotide extension PCR
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00Medicinal preparations containing peptides
    • A61K38/16Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • A61K38/43Enzymes; Proenzymes; Derivatives thereof
    • A61K38/45Transferases (2)
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/43504Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from invertebrates
    • C07K14/43595Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from invertebrates from coelenteratae, e.g. medusae
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/52Cytokines; Lymphokines; Interferons
    • C07K14/54Interleukins [IL]
    • C07K14/545IL-1
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/52Cytokines; Lymphokines; Interferons
    • C07K14/555Interferons [IFN]
    • C07K14/56IFN-alpha
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K16/00Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/10Processes for the isolation, preparation or purification of DNA or RNA
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/10Processes for the isolation, preparation or purification of DNA or RNA
    • C12N15/102Mutagenizing nucleic acids
    • C12N15/1027Mutagenizing nucleic acids by DNA shuffling, e.g. RSR, STEP, RPR
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/10Processes for the isolation, preparation or purification of DNA or RNA
    • C12N15/1034Isolating an individual clone by screening libraries
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/10Processes for the isolation, preparation or purification of DNA or RNA
    • C12N15/1034Isolating an individual clone by screening libraries
    • C12N15/1037Screening libraries presented on the surface of microorganisms, e.g. phage display, E. coli display
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/10Processes for the isolation, preparation or purification of DNA or RNA
    • C12N15/1034Isolating an individual clone by screening libraries
    • C12N15/1058Directional evolution of libraries, e.g. evolution of libraries is achieved by mutagenesis and screening or selection of mixed population of organisms
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/52Genes encoding for enzymes or proenzymes
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/64General methods for preparing the vector, for introducing it into the cell or for selecting the vector-containing host
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/67General methods for enhancing the expression
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N7/00Viruses; Bacteriophages; Compositions thereof; Preparation or purification thereof
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/0004Oxidoreductases (1.)
    • C12N9/0069Oxidoreductases (1.) acting on single donors with incorporation of molecular oxygen, i.e. oxygenases (1.13)
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/10Transferases (2.)
    • C12N9/1003Transferases (2.) transferring one-carbon groups (2.1)
    • C12N9/1007Methyltransferases (general) (2.1.1.)
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14Hydrolases (3)
    • C12N9/16Hydrolases (3) acting on ester bonds (3.1)
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14Hydrolases (3)
    • C12N9/78Hydrolases (3) acting on carbon to nitrogen bonds other than peptide bonds (3.5)
    • C12N9/86Hydrolases (3) acting on carbon to nitrogen bonds other than peptide bonds (3.5) acting on amide bonds in cyclic amides, e.g. penicillinase (3.5.2)
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6811Selection methods for production or design of target specific oligonucleotides or binding molecules
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844Nucleic acid amplification reactions
    • C12Q1/6853Nucleic acid amplification reactions using modified primers or templates
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844Nucleic acid amplification reactions
    • C12Q1/686Polymerase chain reaction [PCR]
    • CCHEMISTRY; METALLURGY
    • C40COMBINATORIAL TECHNOLOGY
    • C40BCOMBINATORIAL CHEMISTRY; LIBRARIES, e.g. CHEMICAL LIBRARIES
    • C40B40/00Libraries per se, e.g. arrays, mixtures
    • C40B40/02Libraries contained in or displayed by microorganisms, e.g. bacteria or animal cells; Libraries contained in or displayed by vectors, e.g. plasmids; Libraries containing only microorganisms or vectors
    • CCHEMISTRY; METALLURGY
    • C40COMBINATORIAL TECHNOLOGY
    • C40BCOMBINATORIAL CHEMISTRY; LIBRARIES, e.g. CHEMICAL LIBRARIES
    • C40B40/00Libraries per se, e.g. arrays, mixtures
    • C40B40/04Libraries containing only organic compounds
    • C40B40/06Libraries containing nucleotides or polynucleotides, or derivatives thereof
    • C40B40/08Libraries containing RNA or DNA which encodes proteins, e.g. gene libraries
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/68Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/68Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
    • G01N33/6803General methods of protein analysis not limited to specific proteins or families of proteins
    • G01N33/6845Methods of identifying protein-protein interactions in protein mixtures
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2317/00Immunoglobulins specific features
    • C07K2317/50Immunoglobulins specific features characterized by immunoglobulin fragments
    • C07K2317/56Immunoglobulins specific features characterized by immunoglobulin fragments variable (Fv) region, i.e. VH and/or VL
    • C07K2317/565Complementarity determining region [CDR]
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2317/00Immunoglobulins specific features
    • C07K2317/60Immunoglobulins specific features characterized by non-natural combinations of immunoglobulin fragments
    • C07K2317/62Immunoglobulins specific features characterized by non-natural combinations of immunoglobulin fragments comprising only variable region components
    • C07K2317/622Single chain antibody (scFv)
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2795/00Bacteriophages
    • C12N2795/00011Details
    • C12N2795/14011Details ssDNA Bacteriophages
    • C12N2795/14041Use of virus, viral particle or viral elements as a vector
    • C12N2795/14043Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2795/00Bacteriophages
    • C12N2795/00011Details
    • C12N2795/14011Details ssDNA Bacteriophages
    • C12N2795/14111Inoviridae
    • C12N2795/14141Use of virus, viral particle or viral elements as a vector
    • C12N2795/14143Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector
    • CCHEMISTRY; METALLURGY
    • C40COMBINATORIAL TECHNOLOGY
    • C40BCOMBINATORIAL CHEMISTRY; LIBRARIES, e.g. CHEMICAL LIBRARIES
    • C40B50/00Methods of creating libraries, e.g. combinatorial synthesis
    • C40B50/06Biochemical methods, e.g. using enzymes or whole viable microorganisms

Definitions

  • Recursive sequence recombination entails performing iterative cycles of recombination and screening or selection to "evolve" individual genes, whole plasmids or viruses, multigene clusters, or even whole genomes (Stemmer, Bio/Technolo ⁇ v 13:549-553 (1995)). Such techniques do not require the extensive analysis and computation required by conventional methods for polypeptide engineering. Recursive sequence recombination allows the recombination of large numbers of mutations in a minimum number of selection cycles, in contrast to traditional, pairwise recombination events.
  • recursive sequence recombination (RSR) techniques provide particular advantages in that they provide recombination between mutations in any or all of these, thereby providing a very fast way of exploring the manner in which different combinations of mutations can affect a desired result.
  • DNA substrate molecule comprising: (a) digesting at least a first and second DNA substrate molecule, wherein the at least a first and second substrate molecules differ from each other in at least one nucleotide, with a restriction endonuclease;
  • a further aspect of the invention is a method for evolving a protein encoded by a DNA substrate molecule by recombining at least a first and second DNA substrate molecule, wherein the at least a first and second substrate molecules differ from each other in at least one nucleotide and comprise defined segments, the method comprising:
  • step (a) providing a set of oligonucleotide PCR primers, comprising at least one primer for each segment, wherein the primer sequence is complementary to at least one junction with another segment; (b) amplifying the segments of the at least a first and second DNA substrate molecules with the primers of step (a) in a polymerase chain reaction;
  • step (c) assembling the products of step (b) to generate a library of recombinant DNA substrate molecules
  • a further aspect of the invention is a method of enriching a population of DNA fragments for mutant sequences comprising:
  • a further aspect of the invention is a method for evolving a protein encoded by a DNA substrate molecule, by recombining at least a first and second DNA substrate molecule, wherein the at least a first and second substrate molecules share a region of sequence homology of about 10 to 100 base pairs and comprise defined segments, the method comprising: (a) providing regions of homology in the at least a first and second DNA substrate molecules by inserting an intron sequence between at least two defined segments;
  • a further aspect of the invention is a method for evolving a protein encoded by a DNA substrate molecule by recombining at least a first and second DNA substrate molecule, wherein the at least a first and second substrate molecules differ from each other in at least one nucleotide and comprise defined segments, the method comprising:
  • a further aspect of the invention is a method for optimizing expression of a protein by evolving the protein, wherein the protein is encoded by a DNA substrate molecule, comprising:
  • each oligonucleotide comprises at least two regions complementary to the DNA molecule and at least one degenerate region, each degenerate region encoding a region of an amino acid sequence of the protein;
  • a further aspect of the invention is a method for optimizing expression of a protein encoded by a DNA substrate molecule by evolving the protein, wherein the DNA substrate molecule comprises at least one lac operator and a fusion of a DNA sequence encoding the protein with a DNA sequence encoding a lac headpiece dimer, the method comprising:
  • a further aspect of the invention is a method for evolving functional expression of a protein encoded by a DNA substrate molecule comprising a fusion of a DNA sequence encoding the protein with a DNA sequence encoding filamentous phage protein to generate a fusion protein, the method comprising:
  • a further aspect of the invention is a method for optimizing expression of a protein encoded by a DNA substrate molecule comprising a fusion of a DNA sequence encoding the protein with a lac headpiece dimer, wherein the DNA substrate molecule is present on a first plasmid vector, the method comprising:
  • a further aspect of the invention is a method for optimizing expression of a protein encoded by a DNA substrate molecule comprising a fusion of a DNA sequence encoding the protein with a filamentous phage gene, wherein the fusion is carried on a phagemid comprising a library of chaperonin gene mutants, the method comprising:
  • a further aspect of the invention is a method for optimizing secretion of a protein in a host by evolving a gene encoding a secretory function, comprising:
  • a further aspect of the invention is a method for evolving an improved DNA polymerase comprising:
  • a further aspect of the invention is a method for evolving a DNA polymerase with an error rate greater than that of wild type DNA polymerase comprising:
  • a further aspect of the invention is a method for evolving a DNA polymerase, comprising:
  • a further aspect of the invention is a method for evolving a p-nitrophenol phosphonatase from a phosphonatase encoded by a DNA substrate molecule, comprising:
  • a further aspect of the invention is a method for evolving a protease encoded by a DNA substrate molecule comprising:
  • a further aspect of the invention is a method for screening a library of protease mutants displayed on a phage to obtain an improved protease, wherein a DNA substrate molecule encoding the protease is fused to DNA encoding a filamentous phage protein to generate a fusion protein, comprising:
  • a further aspect of the invention is a method for screening a library of protease mutants to obtain an improved protease, the method comprising:
  • a further aspect of the invention is a method for evolving an alpha interferon gene comprising:
  • a further aspect of the invention is a method for screening a library of mutants of a DNA substrate encoding a protein for an evolved DNA substrate, comprising:
  • a further aspect of the invention is a method for evolving a DNA substrate molecule encoding an interferon alpha, comprising: (a) providing a library of mutant alpha interferon genes, the library comprising an expression vector wherein the alpha interferon genes are expressed under the control of an inducible promoter;
  • step (d) recovering DNA encoding a mutant alpha interferon from host cells surviving step (c);
  • a further aspect of the invention is a method for evolving the serum stability or circulation half-life of a protein encoded by a DNA substrate molecule, the DNA substrate molecule comprising a fusion of a DNA sequence encoding the protein with a DNA sequence encoding a filamentous phage protein to generate a fusion protein, the method comprising:
  • a further aspect of the invention is a method for evolving a protein having at least two subunits, comprising:
  • a further aspect of the invention is a method for evolving the coupling of a mammalian 7-transmembrane receptor to a yeast signal transduction pathway, comprising: (a) expressing a library of mammalian G alpha protein mutants in a host cell, wherein the host cell expresses the mammalian 7-transmembrane receptor and a reporter gene, the receptor gene geing expressed under control of a pheromone responsive promoter;
  • a further aspect of the invention is a method for recombining at least a first and second DNA substrate molecule, comprising:
  • a further aspect of the invention is a method for evolving a DNA substrate sequence encoding a protein of interest, wherein the DNA substrate comprises a vector, the vector comprising single-stranded DNA, the method comprising:
  • Figure 1 depicts the alignment of oligo PCR primers for evolution of bovine calf intestinal alkaline phosphatase.
  • Figure 2 depicts the alignment of alpha interferon amino acid and nucleic acid sequences.
  • Figure 3 depicts the alignment of chimeric alpha interferon amino acid sequences.
  • the invention provides a number of strategies for evolving polypeptides through recursive recombination methods.
  • the strategies of the invention can generally be classified as “coarse grain shuffling” and “fine grain shuffling.” As described in detail below, these strategies are especially applicable in situations where some structural or functional information is available regarding the polypeptides of interest, where the nucleic acid to be manipulated is large, when selection or screening of many recombinants is cumbersome, and so on.
  • “Coarse grain shuffling” generally involves the exchange or recombination of segments of nucleic acids, whether defined as functional domains, exons, restriction endonuclease fragments, or otherwise arbitrarily defined segments.
  • “Fine grain shuffling” generally involves the introduction of sequence variation within a segment, such as within codons.
  • Coarse grain and fine grain shuffling allow analysis of variation occuring within a nucleic acid sequence, also termed "searching of sequence space.” Although both techniques are meritorious, the results are qualitatively different. For example, coarse grain searches are often better suited for optimizing multigene clusters such as polyketide operons, whereas fine grain searches are often optimal for optimizing a property such as protein expression using codon usage libraries.
  • the strategies generally entail evolution of gene(s) or segment(s) thereof to allow retention of function in a heterologous cell or improvement of function in a homologous or heterologous cell. Evolution is effected generally by a process termed recursive sequence recombination. Recursive sequence recombination can be achieved in many different formats and permutations of formats, as described in further detail below. These formats share some common principles. Recursive sequence recombination entails successive cycles of recombination to generate molecular diversity, i.e., the creation of a family of nucleic acid molecules showing substantial sequence identity to each other but differing in the presence of mutations.
  • Each recombination cycle is followed by at least one cycle of screening or selection for molecules having a desired characteristic.
  • the molecule(s) selected in one round form the starting materials for generating diversity in the next round.
  • recombination can occur in vivo or in vitro.
  • diversity resulting from recombination can be augmented in any cycle by applying prior methods of mutagenesis (e.g., error-prone PCR or cassette mutagenesis, passage through bacterial mutator strains, treatment with chemical mutagens, "spiking" with sequence diversity from homologous gene families) to either the substrates for or products of recombination.
  • mutagenesis e.g., error-prone PCR or cassette mutagenesis, passage through bacterial mutator strains, treatment with chemical mutagens, "spiking" with sequence diversity from homologous gene families
  • Gene is used herein broadly to refer to any segment or sequence of DNA associated with a biological function. Genes can be obtained from a variety of sources, including cloning from a source of interest or synthesizing from known or predicted sequence information, and may include sequences designed to have desired parameters.
  • Cells of particular interest include many bacterial cell types, both gram-negative and gram- positive, such as Rhodococcus, Stneptomycetes, Actinomycetes, Corynebacteria,
  • Cells of interest also include eukaryotic cells, particularly mammalian cells (e.g., mouse, hamster, primate, human), both cell lines and primary cultures.
  • eukaryotic cells particularly mammalian cells (e.g., mouse, hamster, primate, human), both cell lines and primary cultures.
  • Such cells include stem cells, including embryonic stem cells, zygotes, fibroblasts, lymphocytes, Chinese hamster ovary (CHO), mouse fibroblasts (NIH3T3), kidney, liver, muscle, and skin cells.
  • eukaryotic cells of interest include plant cells, such as maize, rice, wheat, cotton, soybean, sugarcane, tobacco, and arabidopsis; fish, algae, fungi (Penicillium, Fusarium, Aspergillus, Podospora, Neurospora), insects, yeasts (Picchia and Saccharomyces).
  • plant cells such as maize, rice, wheat, cotton, soybean, sugarcane, tobacco, and arabidopsis
  • fish algae, fungi (Penicillium, Fusarium, Aspergillus, Podospora, Neurospora), insects, yeasts (Picchia and Saccharomyces).
  • a preferred host has the ability to replicate vector DNA, express proteins of interest, and properly traffic proteins of interest.
  • Particularly advantageous hosts are E. coli, lactobacilli, Streptomycetes, Actinomycetes, fungi such as Saccaromyces cerivisiae or Pischia pastoris, Schneider cells, L-cells, COS cells, CHO cells, and transformed B cell lines such as SP2/0, J558, NS-1 and AG8-653.
  • the breeding procedure starts with at least two substrates that generally show substantial sequence identity to each other (i.e., at least about 50%, 70%, 80% or 90% sequence identity), but differ from each other at certain positions.
  • the difference can be any type of mutation, for example, substitutions, insertions and deletions.
  • different segments differ from each other in perhaps 5-20 positions.
  • the starting materials must differ from each other in at least two nucleotide positions. That is, if there are only two substrates, there should be at least two divergent positions. If there are three substrates, for example, one substrate can differ from the second as a single position, and the second can differ from the third at a different single position.
  • the starting DNA segments can be natural variants of each other, for example, allelic or species variants.
  • the segments can also be from nonallelic genes showing some degree of structural and usually functional relatedness (e.g., different genes within a superfamily such as the immunoglobulin superfamily).
  • the starting DNA segments can also be induced variants of each other.
  • one DNA segment can be produced by error-prone PCR replication of the other, or by substitution of a mutagenic cassette. Induced mutants can also be prepared by propagating one (or both) of the segments in a mutagenic strain.
  • the second DNA segment is not a single segment but a large family of related segments.
  • the different segments forming the starting materials are often the same length or substantially the same length. However, this need not be the case.
  • one segment can be a subsequence of another.
  • the segments can be present as part of larger molecules, such as vectors, or can be in isolated form.
  • the starting DNA segments are recombined by any of the recursive sequence recombination formats provided herein to generate a diverse library of recombinant DNA segments.
  • a library can vary widely in size from having fewer than 10 to more than 10 5 , 10 9 , or 10 12 members.
  • the starting segments and the recombinant libraries generated include full-length coding sequences and any essential regulatory sequences, such as a promoter and polyadenylation sequence, required for expression. However, if this is not the case, the recombinant DNA segments in the library can be inserted into a common vector providing the missing sequences before performing screening/selection.
  • the library of recombinant DNA segments generated already exists in a cell which is usually the cell type in which expression of the enzyme with altered substrate specificity is desired. If recursive sequence recombination is performed in vitro, the recombinant library is preferably introduced into the desired cell type before screening/selection.
  • the members of the recombinant library can be linked to an episome or virus before introduction or can be introduced directly.
  • the library is amplified in a first host, and is then recovered from that host and introduced to a second host more amenable to expression, selection, or screening, or any other desirable parameter.
  • the manner in which the library is introduced into the cell type depends on the DNA-uptake characteristics of the cell type, e.g., having viral receptors, being capable of conjugation, or being naturally competent. If the cell type is insusceptible to natural and chemical-induced competence, but susceptible to electroporation, one would usually employ electroporation. If the cell type is insusceptible to electroporation as well, one can employ biolistics.
  • the biolistic PDS-1000 Gene Gun uses helium pressure to accelerate DNA-coated gold or tungsten microcarriers toward target cells. The process is applicable to a wide range of tissues, including plants, bacteria, fungi, algae, intact animal tissues, tissue culture cells, and animal embryos.
  • A. In Vitro Formats One format for recursive sequence recombination utilizes a pool of related sequences. The sequences can be DNA or RNA and can be of various lengths depending on the size of the gene or DNA fragment to be recombined or reassembled. Preferably the sequences are from 50 bp to 100 kb.
  • the pool of related substrates can be fragmented, usually at random, into fragments of from about 5 bp to 5 kb or more.
  • the size of the random fragments is from about 10 bp to 1000 bp, more preferably the size of the DNA fragments is from about 20 bp to 500 bp.
  • the substrates can be digested by a number of different methods, such as DNAsel or RNAse digestion, random shearing or restriction enzyme digestion.
  • the concentration of nucleic acid fragments of a particular length is often less than 0.1 % or 1 % by weight of the total nucleic acid.
  • the number of different specific nucleic acid fragments in the mixture is usually at least about 100, 500 or 1000.
  • the mixed population of nucleic acid fragments are denatured by heating to about 80° C to 100° C, more preferably from 90° C to 96° C, to form single-stranded nucleic acid fragments.
  • Single-stranded nucleic acid fragments having regions of sequence identity with other single-stranded nucleic acid fragments can then be reannealed by cooling to 6°C to 75°C, and preferaDly from 40°C to 65°C. Renaturation can be accelerated by the addition of polyethylene glycol ("PEG”) or salt.
  • PEG polyethylene glycol
  • the salt concentration is preferably from 0 mM to 600 mM, more preferably the salt concentration is from 10 mM to 100 mM.
  • the salt may be such salts as (NH 4 ) 2 S0 4 , KCI, or NaCI.
  • concentration of PEG is preferably from 0% to 20%, more preferably from 5% to 10%.
  • the fragments that reanneal can be from different substrates.
  • the annealed nucleic acid fragments are incubated in the presence of a nucleic acid polymerase, such as Taq or Klenow, Mg ++ at 1mM - 20mM, and dNTP's (i.e. dATP, dCTP, dGTP and dTTP). If regions of sequence identity are large, Taq or other high- temperature polymerase can be used with an annealing temperature of between 45-65°C.
  • Klenow or other polymerases that are active at low temperature can be used, with an annealing temperature of between 6-30 °C.
  • the polymerase can be added to the random nucleic acid fragments prior to annealing, simultaneously with annealing or after annealing.
  • the cycle of denaturation, renaturation and incubation of random nucleic acid fragments in the presence of polymerase is sometimes referred to as "shuffling" of the nucleic acid in vitro.
  • This cycle is repeated for a desired number of times. Preferably the cycle is repeated from 2 to 100 times, more preferably the sequence is repeated from 10 to 40 times.
  • the resulting nucleic acids are a family of double-stranded polynucleotides of from about 50 bp to about 100 kb, preferably from 500 bp to 50 kb.
  • the population represents variants of the starting substrates showing substantial sequence identity thereto but also diverging at several positions. The population has many more members than the starting substrates.
  • the population of fragments resulting from recombination is preferably first amplified by PCR, then cloned into an appropriate vector and the ligation mixture used to transform host cells.
  • subsequences of recombination substrates can be generated by amplifying the full-length sequences under conditions which produce a substantial fraction, typically at least 20 percent or more, of incompletely extended amplification products.
  • the amplification products, including the incompletely extended amplification products are denatured and subjected to at least one additional cycle of reannealing and amplification.
  • At least one cycle of amplification can be conducted using a collection of overlapping single-stranded DNA fragments of related sequence, and different lengths. Each fragment can hybridize to and prime polynucleotide chain extension of a second fragment from the collection, thus forming sequence-recombined polynucleotides.
  • single-stranded DNA fragments of variable length can be generated from a single primer by Vent DNA polymerase on a first DNA template. The single stranded DNA fragments are used as primers for a second, Kunkel-type template, consisting of a uracil-containing circular single-stranded DNA. This results in multiple substitutions of the first template into the second (see Levichkin et al., Mol. Biology 29:572-577 (1995)).
  • Nucleic acid sequences can be recombined by recursive sequence recombination even if they lack sequence homology. Homology can be introduced using synthetic oligonucleotides as PCR primers.
  • all of the primers used to amplify one particular segment are synthesized to contain an additional sequence of 20-40 bases 5' to the gene (sequence A) and a different 20-40 base sequence 3' to the segment (sequence B).
  • An adjacent segment is amplified using a 5' primer which contains the complementary strand of sequence B (sequence B'), and a 3' primer containing a different 20-40 base sequence (C).
  • primers for the next adjacent segment contain sequences C (complementary to C) and D.
  • C complementary to C
  • D sequences C and D.
  • the amplified segments can then be mixed and subjected to primerless PCR.
  • domains within a polypeptide are shuffled, it may not be possible to introduce additional flanking sequences to the domains, due to the constraint of maintaining a continuous open reading frame.
  • the initial substrates for recombination are a collection of polynucleotides comprising variant forms of a gene.
  • the variant forms usually show substantial sequence identity to each other sufficient to allow homologous recombination between substrates.
  • the diversity between the polynucleotides can be natural (e.g., allelic or species variants), induced (e.g., error-prone PCR or error-prone recursive sequence recombination), or the result of in vitro recombination. Diversity can also result from resynthesizing genes encoding natural proteins with alternative codon usage. There should be at least sufficient diversity between substrates that recombination can generate more diverse products than there are starting materials.
  • the diverse substrates are incorporated into plasmids.
  • the plasmids are often standard cloning vectors, e.g., bacterial multicopy plasmids. However, in some methods to be described below, the plasmids include mobilization (MOB) functions.
  • the substrates can be incorporated into the same or different plasmids.
  • Plasmids containing diverse substrates are initially introduced into cells by any method (e.g., chemical transformation, natural competence, electroporation, biolistics, packaging into phage or viral systems).
  • the plasmids are present at or near saturating concentration (with respect to maximum transfection capacity) to increase the probability of more than one plasmid entering the same cell.
  • the plasmids containing the various substrates can be transfected simultaneously or in multiple rounds. For example, in the latter approach cells can be transfected with a first aliquot of plasmid, transfectants selected and propagated, and then infected with a second aliquot of plasmid.
  • telomere shortening occurs within cells containing multiple different plasmids merely by propagating the cells.
  • cells that receive only one plasmid are unable to participate in recombination and the potential contribution of substrates on such plasmids to evolution is not fully exploited (although these plasmids may contribute to some extent if they are progagated in mutator cells).
  • the rate of evolution can be increased by allowing all substrates to participate in recombination. Such can be achieved by subjecting transfected cells to electroporation.
  • the conditions for electroporation are the same as those conventionally used for introducing exogenous DNA into cells (e.g., 1 ,000-2,500 volts, 400 ⁇ F and a 1-2 mM gap). Under these conditions, plasmids are exchanged between cells allowing all substrates to participate in recombination. In addition the products of recombination can undergo further rounds of recombination with each other or with the original substrate. The rate of evolution can also be increased by use of conjugative transfer. To exploit conjugative transfer, substrates can be cloned into plasmids having MOB genes, and tra genes are also provided in cis or in trans to the MOB genes.
  • the effect of conjugative transfer is very similar to electroporation in that it allows plasmids to move between cells and allows recombination between any substrate and the products of previous recombination to occur, merely by propagating the culture.
  • the rate of evolution can also be increased by fusing cells to induce exchange of plasmids or chromosomes. Fusion can be induced by chemical agents, such as PEG, or viral proteins, such as influenza virus hemagglutinin, HSV-1 gB and gD.
  • the rate of evolution can also be increased by use of mutator host cells (e.g., Mut L, S, D, T, H in bacteria and Ataxia telangiectasia human cell lines).
  • the time for which cells are propagated and recombination is allowed to occur varies with the cell type but is generally not critical, because even a small degree of recombination can substantially increase diversity relative to the starting materials.
  • Cells bearing plasmids containing recombined genes are subject to screening or selection for a desired function. For example, if the substrate being evolved contains a drug resistance gene, one would select for drug resistance. Cells surviving screening or selection can be subjected to one or more rounds of screening/selection followed by recombination or can be subjected directly to an additional round of recombination. "Screening" as used herein is intended to include “selection" as a type of screen.
  • the next round of recombination can be achieved by several different formats independently of the previous round.
  • a further round of recombination can be effected simply by resuming the electroporation or conjugation-mediated intercellular transfer of plasmids described above.
  • a fresh substrate or substrates the same or different from previous substrates, can be transfected into cells surviving selection/screening.
  • the new substrates are included in piasmid vectors bearing a different selective marker and/or from a different incompatibility group than the original plasmids.
  • cells surviving selection/screening can be subdivided into two subpopulations, and plasmid DNA from one subpopulation transfected into the other, where the substrates from the plasmids from the two subpopulations undergo a further round of recombination.
  • the rate of evolution can be increased by employing DNA extraction, electroporation, conjugation or mutator cells, as described above.
  • DNA from cells surviving screening/selection can be extracted and subjected to in vitro recursive sequence recombination.
  • a second round of screening/selection is performed, preferably under conditions of increased stringency. If desired, further rounds of recombination and selection/screening can be performed using the same strategy as foi the second round. With successive rounds of recombination and selection/ screening, the surviving recombined substrates evolve toward acquisition of a desired phenotype.
  • the finai product of recombination that has acquired the desired phenotype differs from starting substrates at 0.1%-25% of positions and has evolved at a rate orders of magnitude in excess (e.g., by at least 10-fold, 100-fold, 1000-fold, or 10,000 fold) of the rate of evolution driven by naturally acquired mutation of about 1 mutation per 10 '9 positions per generation (see Anderson et al., Proc. Natl. Acad. Sci. U.S.A. 93:906-907 (1996)).
  • the "final product” may be transferred to another host more desirable for utilization of the "shuffled" DNA.
  • the strategy used for plasmid-plasmid recombination can also be used for virus-plasmid recombination; usually, phage-plasmid recombination.
  • virus-plasmid recombination usually, phage-plasmid recombination.
  • the initial substrates for recombination are cloned into both plasmid and viral vectors. It is usually not critical which substrate(s) is/are inserted into the viral vector and which into the plasmid, although usually the viral vector should contain different substrate(s) from the plasmid.
  • the plasmid (and the virus) typically contains a selective marker.
  • the plasmid and viral vectors can both be introduced into cells by transfection as described above.
  • a more efficient procedure is to transfect the cells with plasmid, select transfectants and infect the transfectants with virus. Because the efficiency of infection of many viruses approaches 100% of cells, most cells transfected and infected by this route contain both a plasmid and virus bearing different substrates. Homologous recombination occurs between plasmid and virus generating both recombined plasmids and recombined virus. For some viruses, such as filamentous phage, in which intracellular DNA exists in both double-stranded and single-stranded forms, both can participate in recombination.
  • recombination can be augmented by use of electroporation or conjugation to transfer plasmids between cells. Recombination can also be augmented for some types of virus by allowing the progeny virus from one cell to reinfect other cells.
  • virus infected-cells show resistance to superinfection. However, such resistance can be overcome by infecting at high multiplicity and/or using mutant strains of the virus in which resistance to superinfection is reduced.
  • the result of infecting plasmid-containing cells with virus depends on the nature of the virus. Some viruses, such as filamentous phage, stably exist with a plasmid in the cell and also extrude progeny phage from the cell.
  • viruses such as lambda having a cosmid genome
  • Other viruses can stably exist in a cell like plasmids without producing progeny virions.
  • Other viruses such as the T-phage and lytic lambda, undergo recombination with the plasmid but ultimately kill the host cell and destroy plasmid DNA.
  • cells containing recombinant plasmids and virus can be screened/selected using the same approach as for plasmid-plasmid recombination. Progeny virus extruded by cells surviving selection/screening can also be collected and used as substrates in subsequent rounds of recombination.
  • recombinant genes resulting from recombination reside only in the progeny virus. If the screening or selective assay requires expression of recombinant genes in a cell, the recombinant genes should be transferred from the progeny virus to another vector, e.g., a plasmid vector, and retransfected into cells before selection/screening is performed.
  • another vector e.g., a plasmid vector
  • the products of recombination are present in both cells surviving recombination and in phage extruded from these cells.
  • the dual source of recombinant products provides some additional options relative to the plasmid-plasmid recombination.
  • DNA can be isolated from phage particles for use in a round of in vitro recombination.
  • the progeny phage can be used to transfect or infect cells surviving a previous round of screening/selection, or fresh cells transfected with fresh substrates for recombination.
  • the principles described for plasmid-plasmid and plasmid-viral recombination can be applied to virus-virus recombination with a few modifications.
  • the initial substrates for recombination are cloned into a viral vector.
  • the same vector is used for all substrates.
  • the virus is one that, naturally or as a result of mutation, does not kill cells.
  • some viral genomes can be packaged in vitro or using a packaging cell line. The packaged viruses are used to infect cells at high multiplicity such that there is a high probability that a cell will receive multiple viruses bearing different substrates.
  • phagemid Smallbrook et al., Molecular Cloning. CSH Press, 1987 genomes such as lambda cosmids or M13, F1 or Fd phagemids
  • the phagemids behave as plasmids within the cell and undergo recombination simply by propagating within the cells. Recombination is particularly efficient between single-stranded forms of intracellular DNA. Recombination can be augmented by electroporation of cells.
  • cosmids containing recombinant genes can be recovered from surviving cells, e.g., by heat induction of a cos " lysogenic host cell, or extraction of DNA by standard procedures, followed by repackaging cosmid DNA in vitro.
  • viruses are filamentous phage
  • recombination of replicating form DNA occurs by propagating the culture of infected cells. Selection/screening identifies colonies of cells containing viral vectors having recombinant genes with improved properties, together with infectious particles (i.e., phage or packaged phagemids) extruded from such cells. Subsequent options are essentially the same as for plasmid-viral recombination. 4. Chromosome Recombination
  • This format can be used to especially evolve chromosomal substrates.
  • the format is particulariy preferred in situations in which many chromosomal genes contribute to a phenotype or one does not know the exact location of the chromosomal gene(s) to be evolved.
  • the initial substrates for recombination are cloned into a plasmid vector. If the chromosomal gene(s) to be evolved are known, the substrates constitute a family of sequences showing a high degree of sequence identity but some divergence from the chromosomal gene. If the chromosomal genes to be evolved have not been located, the initial substrates usually constitute a library of DNA segments of which only a small number show sequence identity to the gene or gene(s) to be evolved. Divergence between plasmid- borne substrate and the chromosomal gene(s) can be induced by mutagenesis or by obtaining the plasmid-borne substrates from a different species than that of the cells bearing the chromosome
  • the plasmids bearing substrates for recombination are transfected into cells having chromosomal gene(s) to be evolved. Evolution can occur simply by propagating the culture, and can be accelerated by transferring plasmids between cells by conjugation or electroporation. Evolution can be further accelerated by use of mutator host cells or by seeding a culture of nonmutator host cells being evolved with mutator host cells and inducing intercellular transfer of plasmids by electroporation or conjugation.
  • mutator host cells used for seeding contain a negative selectable marker to facilitate isolation of a pure culture of the nonmutator cells being evolved.
  • Selection/screening identifies cells bearing chromosomes and/or plasmids that have evolved toward acquisition of a desired function. Subsequent rounds of recombination and selection/screening proceed in similar fashion to those described for plasmid-plasmid recombination. For example, further recombination can be effected by propagating cells surviving recombination in combination with electroporation or conjugative transfer of plasmids. Alternatively, plasmids bearing additional substrates for recombination can be introduced into the surviving cells.
  • such plasmids are from a different incompatibility group and bear a different selective marker than the original plasmids to allow selection for cells containing at least two different plasmids.
  • plasmid and/or chromosomal DNA can be isolated from a subpopulation of surviving cells and transfected into a second subpopulation. Chromosomal DNA can be cloned into a plasmid vector before transfection. 5.
  • the virus is usually one that does not kill the cells, and is often a phage or phagemid.
  • the procedure is substantially the same as for plasmid-chromosome recombination.
  • Substrates for recombination are cloned into the vector.
  • Vectors including the substrates can then be transfected into cells or in vitro packaged and introduced into cells by infection.
  • Viral genomes recombine with host chromosomes merely by propagating a culture. Evolution can be accelerated by allowing intercellular transfer of viral genomes by electroporation, or reinfection of cells by progeny virions. Screening/selection identifies cells having chromosomes and/or viral genomes that have evolved toward acquisition of a desired function.
  • viral genomes can be transferred between cells surviving selection/recombination by electroporation.
  • viruses extruded from cells surviving selection/screening can be pooled and used to superinfect the cells at high multiplicity.
  • fresh substrates for recombination can be introduced into the cells, either on plasmid or viral vectors.
  • fine grain and “coarse grain” shuffling.
  • coarse grain methods allow one to exchange chunks of genetic material between substrate nucleic acids, thereby limiting diversity in the resulting recombinants to exchanges or substitutions of domains, restriction fragments, oligo-encoded blocks of mutations, or other arbitrarily defined segments, rather than introducing diversity more randomly across the substrate.
  • fine grain shuffling methods allow the generation of all possible recombinations, or permutations, of a given set of very closely linked mutations, including multiple permutations, within a single segment, such as a codon.
  • coarse grain or fine grain shuffling techniques are not performed as exhaustive searches of all possible mutations within a nucleic acid sequence. Rather, these techniques are utilized to provide a sampling of variation possible within a gene based on known sequence or structural information.
  • the size of the sample is typically determined by the nature of the screen or selection process. For example, when a screen is performed in a 96-well microtiter format, it may be preferable to limit the size of the recombinant library to about 100 such microtiter plates for convenience in screening.
  • the techniques described herein are especially useful in the recombination of genes from gene families, wherein diversity in nucleotide sequence is provided all or in part by naturally occurring differences in the nucleotide sequence of the genes in the family.
  • a "gene family” as used herein is intended to include genes with similar function, such as but not limited to interferons or interieukins; genes which are believed to be derived by descent from a common ancestor; and genes which encode proteins that are structurally homologous, such as four helix bundle proteins.
  • DNA or protein sequences can be aligned by computer algorithms, such as those described in the monograph on bioinformatics by Schomburg and Lessel (Schomburg and Lessel, Bioinformatics: From Nucleic Acids and Proteins to Cell Metabolism. October 9 - 11 , 1995, Braunschweig, Germany). These algorithms can determine the likelihood that two sequences, or subdomains of sequences, are related to each other by descent from a common ancestor. Sequences that are judged to be derived by descent from a common ancestor comprise a "homologous gene family", and DNA shuffling can be used to accelerate the evolution of these gene families.
  • restriction enzyme sites in nucleic acids to direct the recombination of mutations in a nucleic acid sequence of interest.
  • These techniques are particularly preferred in the evolution of fragments that cannot readily be shuffled by existing methods due to the presence of repeated DNA or other problematic primary sequence motifs. They are also preferred for shuffling large fragments (typically greater than 10 kb), such as gene clusters that cannot be readily shuffled and "PCR- amplified” because of their size. Although fragments up to 50 kb have been reported to be amplified by PCR (Barnes, Proc. Natl. Acad. Sci.
  • restriction endonucleases are of the Class II type (Sambrook et al., Molecular Cloning. CSH Press, 1987) and of these, preferably those which generate nonpalindromic sticky end overhangs such as Alwn I, Sfi I or BstX1. These enzymes generate nonpalindromic ends that allow for efficient ordered reassembly with DNA ligase.
  • restriction enzyme (or endonuclease) sites are identified by conventional restriction enzyme mapping techniques (Sambrook et al.,
  • the DNA substrate molecules to be digested can either be from in vivo replicated DNA, such as a plasmid preparation, or from PCR amplified nucleic acid fragments harboring the restriction enzyme recognition sites of interest, preferably near the ends of the fragment.
  • at least two variants of a gene of interest, each having one or more mutations are digested with at least one restriction enzyme determined to cut within the nucleic acid sequence of interest.
  • the restriction fragments are then joined with DNA ligase to generate full length genes having shuffled regions. The number of regions shuffled will depend on the number of cuts within the nucleic acid sequence of interest.
  • the shuffled molecules can be introduced into cells as described above and screened or selected for a desired property. Nucleic acid can then be isolated from pools (libraries) or clones having desired properties and subjected to the same procedure until a desired degree of improvement is obtained.
  • At least one DNA substrate molecule or fragment thereof is isolated and subjected to mutagenesis.
  • the pool or library of religated restriction fragments are subjected to mutagenesis before the digestion-ligation process is repeated.
  • "Mutagenesis" as used herein comprises such techniques known in the art as PCR mutagenesis, oligonucleotide-directed mutagenesis, site-directed mutagenesis, etc., and recursive sequence recombination by any of the techniques described herein. An example of the use of this format is in the manipulation of polyketide clusters.
  • Polyketide clusters (Khosla et al., TIBTECH 14, September 1996) are typically 10 to 100 kb in length, specifying multiple large polypeptides which assemble into very large multienzyme complexes. Due to the modular nature of these complexes and the modular nature of the biosynthetic pathway, nucleic acids encoding protein modules can be exchanged between different polyketide clusters to generate novel and functional chimeric polyketides.
  • the introduction of rare restriction endonuclease sites such as Sfil (eight base recognition, nonpalindromic overhangs) at nonessential sites between polypeptides or in introns engineered within polypeptides would provide "handles" with which to manipulate exchange of nucleic acid segments using the technique described above.
  • a further technique for recursively recombining mutations in a nucleic acid sequence utilizes "reassembly PCR".
  • This method can be used to assemble multiple segments that have been separately evolved into a full length nucleic acid template such as a gene.
  • This technique is performed when a pool of advantageous mutants is known from previous work or has been identified by screening mutants that may have been created by any mutagenesis technique known in the art, such as PCR mutagenesis, cassette mutagenesis, doped oligo mutagenesis, chemical mutagenesis, or propagation of the DNA template in vivo in mutator strains.
  • Boundaries defining segments of a nucleic acid sequence of interest preferably lie in intergenic regions, introns, or areas of a gene not likely to have mutations of interest.
  • oligonucleotide primers are synthesized for PCR amplification of segments of the nucleic acid sequence of interest, such that the sequences of the oligonucleotides overlap the junctions of two segments.
  • the overlap region is typically about 10 to 100 nucleotides in length.
  • Each of the segments is amplified with a set of such primers.
  • the PCR products are then "reassembled" according to assembly protocols such as those used in Sections IA-B above to assemble randomly fragmented genes.
  • PCR products are first purified away from the primers, by, for example, gel electrophoresis or size exclusion chromatography. Purified products are mixed together and subjected to about 1-10 cycles of denaturing, reannealing, and extension in the presence of polymerase and deoxynucleoside triphosphates (dNTP's) and appropriate buffer salts in the absence of additional primers ("self-priming"). Subsequent PCR with primers flanking the gene are used to amplify the yield of the fully reassembled and shuffled genes. This method is necessarily “coarse grain” and hence only recombines mutations in a blockwise fashion, an advantage for some searches such as when recombining allelic variants of multiple genes within an operon.
  • dNTP's polymerase and deoxynucleoside triphosphates
  • the resulting reassembled genes are subjected to mutagenesis before the process is repeated.
  • oligonucleotides that incorporate uracil into the primers are used for PCR amplification.
  • uracil is incorporated at one site in the oligonucleotide.
  • the products are treated with uracil glycosylase, thereby generating a single-stranded overhang, and are reassembled in an ordered fashion by a method such as disclosed by Rashtchian (Current Bioloov. 3:1-36 (1995)).
  • the PCR primers for amplification of segments of the nucleic acid sequence of interest are used to introduce variation into the gene of interest as follows. Mutations at sites of interest in a nucleic acid sequence are identified by screening or selection, by sequencing homologues of the nucleic acid sequence, and so on. Oligonucleotide PCR primers are then synthesized which encode wild type or mutant information at sites of interest. These primers are then used in PCR mutagenesis to generate libraries of full length genes encoding permutations of wild type and mutant information at the designated positions. This technique is typically advantagous in cases where the screening or selection process is expensive, cumbersome, or impractical relative to the cost of sequencing the genes of mutants of interest and synthesizing mutagenic oligonucleotides.
  • Mutant proteins resulting from application of the method are identified and assayed in a sequencing reaction to identify mutants with improved sequencing properties. This is typically done in a high throughput format (see, for example, Broach et al. Nature 384 (Supp): 14-16 (1996)) to yield, after screening, a small number, e.g., about 2 to 100, of candidate recombinants for further evaluation.
  • the mutant genes can then be sequenced to provide information regarding the location of the mutation.
  • mutagenic oligonucleotide primers can be synthesized from this information, and used in a reassembly reaction as described above to efficiently generate a library with an average of many mutations per gene.
  • One or more rounds of this protocol allows the efficient search for improved variants of the Taq polymerase.
  • C. Enrichment for Mutant Sequence Information In some embodiments of the invention, recombination reactions, such as those discussed above, are enriched for mutant sequences so that the multiple mutant spectrum, i.e. possible combinations of mutations, is more efficiently sampled. The rationale for this is as follows.
  • mutant clones with improved activity Assume that a number, n, of mutant clones with improved activity is obtained, wherein each clone has a single point mutation at a different position in the nucleic acid sequence. If this population of mutant clones with an average of one mutation of interest per nucleic acid sequence is then put into a recombination reaction, the resulting population will still have an average of one mutation of interest per nucleic acid sequence as defined by a Poisson distribution, leaving the multiple mutation spectrum relatively unpopulated. The amount of screening required to identify recombinants having two or more mutations can be dramatically reduced by the following technique.
  • the nucleic acid sequences of interest are obtained from a pool of mutant clones and prepared as fragments, typically by digestion with a restriction endonuclease , sonication, or by PCR amplification.
  • the fragments are denatured, then allowed to reanneal, thereby generating mismatched hybrids where one strand of a mutant has hybridized with a complementary strand from a different mutant or wild-type clone.
  • the reannealed products are then fragmented into fragments of about 20 - 100 bp, for example, by the use of DNAsel. This fragmentation reaction has the effect of segregating regions of the template containing mismatches (mutant information) from those encoding wild type sequence.
  • the mismatched hybrids can then be affinity purified using aptamers, dyes, or other agents which bind to mismatched DNA.
  • a preferred embodiment is the use of mutS protein affinity matrix (Wagner et al., Nucleic Acids Res, 23(19):3944-3948 (1995); Su et al., Proc. Natl. Acad. Sci. (U.S.A ⁇ 83:5057- 5061(1986)) with a preferred step of amplifying the affinity-purified material in vitro prior to an assembly reaction. This amplified material is then put into a assembly PCR reaction as decribed above. Optionally, this material can be titrated against the original mutant pool (e.g., from about 100% to 10% of the mutS enriched pool) to control the average number of mutations per clone in the next round of recombination.
  • Another application of this method is in the assembly of gene constructs that are enriched for polymorphic bases occurring as natural or selected allelic variants or as differences between homologous genes of related species. For example, one may have several varieties of a plant that are believed to have heritable variation in a trait of interest (e.g., drought resistance). It then is of interest to construct a library of these variant genes containing many mutations per gene. MutS selection can be applied in combination with the assembly techniques described herein to generate such a pool of recombinants that are highly enriched for polymorphic ("mutant") information. In some embodiments, the pool of recombinant genes is provided in a transgenic host. Recombinants can be further evolved by PCR amplification of the transgene from transgenic organisms that are determined to have an improved phenotype and applying the formats described in this invention to further evolve them.
  • a trait of interest e.g., drought resistance
  • the substrate molecules for recombination have uniformly low homoiogy, sporadically distributed regions of homology, or the region of homology is relatively small (for example, about 10 - 100 bp), such as phage displayed peptide ligands. These factors can reduce the efficiency and randomness of recombination in RSR.
  • this problem is addressed by the introduction of introns between coding exons in sequences encoding protein homologues.
  • introns can be used (Chong et al., J. Biol. Chem.. 271:22159-22168 (1996)).
  • a nucleic acid sequence such as a gene or gene family
  • the segments are preferably exons.
  • Introns are engineered between the segments.
  • the intron inserted between the first and second segments is at least about 10% divergent from the intron inserted between second and third segments
  • the intron inserted between second and third segments is at least about 10% divergent from the introns inserted between any of the previous segment pairs, and so on through segments n and n+1.
  • the introns between any given set of exons will thus initially be identical between all clones in the library, whereas the exons can be arbitrarily divergent in sequence.
  • the introns therefore provide homologous DNA sequences that will permit application of any of the described methods for RSR while the exons can be arbitrarily small or divergent in sequence, and can evolve to achieve an arbitrarily large degree of sequence divergence without a significant loss in efficiency in recombination. Restriction sites can also be engineered into the intronic nucleic acid sequence of interest so as to allow a directed reassemmbly of restriction fragments.
  • the starting exon DNA may be synthesized de novo from sequence information, or may be present in any nucleic acid preparation ( e.g., genomic, cDNA, libraries, and so on).
  • 1 to 10 nonhomologous introns can be designed to direct recombination of the nucleic acid sequences of interest by placing them between exons.
  • the sequence of the introns can be all or partly obtained from known intron sequence.
  • the introns are self-splicing. Ordered sets of introns and exon libraries are assembled into functional genes by standard methods (Sambrook et al., Molecular Cloning. CSH Press (1987)).
  • any of the formats for in vitro or in vivo recombination described herein can be applied for recursive exon shuffling.
  • a preferred format is to use nonpalindromic restriction sites such as Sfi I placed into the intronic sequences to promote shuffling. Pools of selected clones are digested with Sfi I and religated. The nonpalindromic overhangs promote ordered reassembly of the shuffled exons.
  • These libraries of genes can be expressed and screened for desired properties, then subjected to further recursive rounds of recombination by this process. In some embodiments, the libraries are subjected to mutagenesis before the process is repeated.
  • An example of how the introduction of an intron into a mammalian library format would be used advantageously is as follows.
  • An intron containing a lox (Sauer et al., Proc. Natl. Acad. Sci. (U.S.A.V 85:5166-5170 (1988)) site is arbitrarily introduced between amino acids 92 and 93 in each alpha interferon parental substrate.
  • a library of 10 4 chimeric interferon genes is made for each of the two exons (residues 1-92 and residues 93-167), cloned into a replicating plasmid vector, and introduced into target cells.
  • the number 10" is arbitrarily chosen for convenience in screening.
  • An exemplary vector for expression in mammalian cells would contain an SV40 origin, with the host cells expressing SV40 large T antigen, so as to allow transient expression of the interferon constructs.
  • the cells are challenged with a cytopathic virus such as vesicular stomatitis virus (VSV) in an interferon protection assay (e.g., Meister et al., J. Gen. Virol. 67:1633-1643, (1986)).
  • VSV vesicular stomatitis virus
  • the amplified plasmids are then transfected at high multiplicity (e.g. 10 micrograms of plasmid per 10 6 cells) into a ere expressing host that can support replication of that vector.
  • high multiplicity e.g. 10 micrograms of plasmid per 10 6 cells
  • the presence of ere in the host cells promotes efficient recombination at the lox site in the interferon intron, thus shuffling the selected sets of exons.
  • This population of cells is then used in a second round of selection by viral challenge and the process is applied recursively.
  • the ere recombinase is preferrably expressed transiently on a cotransfected molecule that cannot replicate in the host.
  • the method can be used with more than one intron, with recombination enhancing sequences other than cre/lox (e.g., int/xis, etc.), and with other vector systems such as but not limited to retroviruses, adenovirus or adeno- associated virus.
  • a search of a region of sequence space defined by a set of substrates, such as members of a gene family, having less than about 80%, more typically, less than about 50% homology is desired.
  • This region which can be part or all of a gene or a gene is arbitrarily delineated into segments.
  • the segment borders can be chosen randomly, based on correspondence with natural exons, based on structural considerations (loops, alpha helices, subdomains, whole domains, hydrophobic core, surface, dynamic simulations), and based on correlations with genetic mapping data.
  • the segments are then amplified by PCR with a poo! of "bridge" oligonucleotides at each junction.
  • bridge oligonucleotides
  • the set of five genes is broken into three segments A, B and C, and if there are five versions of each segment (A1 , A2, ... C4, C5), twenty five oligonucleotides are made for each strand of the A-B junctions where each bridge oligo has 20 bases of homology to one of the A and one of the B segments.
  • the number of required oligonucleotides can be reduced by choosing segment boundaries that are identical in some or all of the gene family members. Oligonucleotides are similarly synthesized for the B-C junction.
  • the family of A domains is amplified by PCR with an outside generic A primer and the pool of A-B junction oligonucleotides; the B domains with the A-B plus the B-C bridge oligonucleotides, and the C domains with the B-C bridge oligonucleotides plus a generic outside primer.
  • Full length genes are made then made by assembly PCR or by the dUTP/uracil glycosylase methods described above.
  • products from this step are subjected to mutagenesis before the process of selection and recombination is repeated, until a desired level of improvement or the evolution of a desired property is obtained. This is typically determined using a screening or selection as appropriate for the protein and property of interest.
  • sequence information from one or more substrate sequences is added to a given "parental" sequence of interest, with subsequent recombination between rounds of screening or selection.
  • this is done with site-directed mutagenesis performed by techniques well known in the art (Sambrook et al., Molecular Cloning. CSH Press (1987)) with one substrate as template and oligonucleotides encoding single or multiple mutations from other substrate sequences, e.g. homologous genes.
  • the selected recombinant(s) can be further evolved using RSR techniques described herein.
  • site-directed mutagenesis can be done again with another collection of oligonucleotides encoding homologue mutations, and the above process repeated until the desired properties are obtained.
  • degenerate oligonucleotides can be used that encode the sequences in both homologues.
  • One oligo may include many such degenerate codons and still allow one to exhaustively search all permutations over that block of sequence. An example of this is provided below for the evolution of alpha interferon genes.
  • homologue sequence space When the homologue sequence space is very large, it can be advantageous to restrict the search to certain variants.
  • computer modelling tools (Lathrop et al., J. Mol. BioL 255:641-665 (1996)) can be used to model each homologue mutation onto the target protein and discard any mutations that are predicted to grossly disrupt structure and function.
  • DNA substrate molecules are introduced into cells, wherein the cellular machinery directs their recombination.
  • a library of mutants is constructed and screened or selected for mutants with improved phenotypes by any of the techniques described herein.
  • the DNA substrate molecules encoding the best candidates are recovered by any of the techniques described herein, then fragmented and used to transfect a mammalian host and screened or selected for improved function.
  • the DNA substrate molecules are recovered from the mammalian host, such as by PCR, and the process is repeated until a desired level of improvement is obtained.
  • the fragments are denatured and reannealed prior to transfection, coated with recombination stimulating proteins such as recA, or co-transfected with a selectable marker such as Neo R to allow the positive selection for cells receiving recombined versions of the gene of interest.
  • recombination stimulating proteins such as recA
  • a selectable marker such as Neo R
  • this format is preferred for the in vivo affinity maturation of an antibody by RSR.
  • a library of mutant antibodies is generated, as described herein for the 48G7 affinity maturation. This library is FACS purified with ligand to enrich for antibodies with the highest 0.1 - 10% affinity.
  • the V regions genes are recovered by PCR, fragmented, and cotransfected or electorporated with a vector into which reassembled V region genes can recombine.
  • DNA substrate molecules are recovered from the cotranfected cells, and the process is repeated until the desired level of improvment is obtained.
  • Other embodiments include reassembling the V regions prior to the electroporation so that an intact V region exon can recombine into an antibody expression cassette. Further embodiments include the use of this format for other eukaryotic genes or for the evolution of whole viruses.
  • a gene of interest is cloned into a vector that generates single stranded DNA, such as a phagemid.
  • the resulting DNA substrate is mutagenzied by RSR in any method known in the art, transfected into host cells, and subjected to a screen or selection for a desired property or improved phenotype.
  • DNA from the selected or screened phagemids is amplified, by, for example, PCR or plasmid preparation. This DNA preparation contains the various mutant sequences that one wishes to permute.
  • This DNA is fragmented and denatured, and annealed with single-stranded DNA (ssDNA) phagemid template (ssDNA encoding the wild-type gene and vector sequences).
  • ssDNA single-stranded DNA
  • a preferred embodiment is the use of dut(-) ung(-) host strains such as CJ236 (Sambrook et al., Molecular Cloning CSH Press (1987)) for the preparation of
  • Gaps in annealed template are filled with DNA polymerase and ligated to form closed relaxed circles. Since multiple fragments can anneal to the phagemid, the newly synthesized strand now consists of shuffled sequences. These products are transformed into a mutS strain of E. coli which is dut+ ung+. Phagemid DNA is recovered from the transfected host and subjected again to this protocol until the desired level of improvement is obtained. The gene encoding the protein of interest in this library of recovered phagemid DNA can be mutagenzied by any technique, including RSR, before the process is repeated. III. Improved Protein Expression
  • protein expression is optimized by changing codons used in the gene of interest, based on the degeneracy of the genetic code. Typically, this is accomplished by synthesizing the gene using degenerate oligonucleotides.
  • the degenerate oligonucleotides have the general structure of about 20 nucleotides of identity to a DNA substrate molecule encoding a protein of interest, followed by a region of about 20 degenerate nucleotides which encode a region of the protein, followed by another region of about 20 nucleotides of identity.
  • the region of identity utilizes preferred codons for the host.
  • the oligonucleotides are identical to the DNA substrate at least one 5' and one 3' nucleotide, but have at least 85% sequence homology to the DNA substrate molecule, with the difference due to the use of degenerate codons.
  • a set of such degenerate oligonucleotides is used in which each oligonucleotide overlaps with another by the general formula n - 10, wherein n is the length of the oligonucleotide.
  • n is the length of the oligonucleotide.
  • Such oligonucleotides are typically about 20 - 1000 nucleotides in length.
  • the assembled genes are then cloned, expressed, and screened or selected for improved expression.
  • the assembled genes can be subjected to recursive recombination methods as descibed above until the desired improvement is achieved.
  • this technique can be used to evolve bovine intestinal alkaline phosphatase (BIAP) for active expression in E. coli.
  • BIAP bovine intestinal alkaline phosphatase
  • This enzyme is commonly used as a reporter gene in assay formats such as ELISA.
  • the cloned gene cannot be expressed in active form in a prokaryotic host such as E. coli in good yield.
  • Development of such an expression system would allow one to access inexpensive expression technology for BIAP and, importantly, for engineered variants with improved activity or chemical coupling properties (such as chemical coupling to antibodies).
  • a detailed example is provide in the Experimental Examples section.
  • B. Improved Folding In some embodiments of the invention, proteins of interest when overexpressed or expressed in heterologous hosts form inclusion bodies, with the majority of the expressed protein being found in insoluble aggregates. Recursive sequence recombination techniques can be used to optimize folding of such target proteins. There are several ways to improve folding, including mutating evolving the target protein of interest and evolving chaperon
  • the lac repressor "headpiece dimer” is a small protein containing two headpiece domains connected by a short peptide linker which binds the lac operator with sufficient affinity that polypeptide fusions to this headpiece dimer will remain bound to the plasmid that encodes them throughout an affinity purification process (Gates et al., J. Mol. Biol. 255:373-386 (1995)). This property can be exploited, as follows, to evolve mutant proteins of interest with improved folding properties.
  • the protein of interest can be mammalian, yeast, bacterial, etc.
  • a fusion protein between the lac headpiece dimer and a target protein sequence is constructed, for example, as disclosed by Gates (supra).
  • This construct containing at least one lac operator, is mutagenized by technologies common in the arts such as PCR mutagenesis, chemical mutagenesis, oligo directed mutagenesis (Sambrook et al., Molecular Cloning CSH Press (1987)).
  • the resulting library is transformed into a host cell, and expression of the fusion protein is induced, preferably with arabinose.
  • An extract or lysate is generated from a culture of the library expressing the construct.
  • Insoluble protein is fractionated from soluble protein/DNA complexes by centrifugation or affinity chromatography, and the yield of soluble protein/DNA complexes is quantitated by quantitative PCR (Sambrook et al., Molecular Cloning. CSH Press, 1987) of the plasmid.
  • a reagent that is specific for properly folded protein such as a monoclonal antibody or a natural ligand, is used to purify soluble protein/DNA complexes.
  • the plasmid DNA from this step is isolated, subjected to RSR and again expressed. These steps are repeated until the yield of soluble protein/DNA complexes has reached a desired level of improvement.
  • the mutagenzied library is then expressed in a phage display format, a phage stock is made, and these phage are affinity selected for those bearing functionally displayed fusion proteins using an affinity matrix containing a known ligand for the target protein.
  • DNA from the functionally selected phage is purified, and the displayed genes of interest are shuffled and recloned into the phage display format.
  • the selection, shuffling and recloning steps are repeated until the yield of phage with functional displayed protein has reached desired levels as defined, for example, by the fraction of phage that are retained on a ligand affinity matrix or the biological activity associated with the displayed phage.
  • Individual clones are then screened to identify candidate mutants with improved display properties, desired level of expression, and functional properties of interest (e.g., ability to bind a ligand or receptor, lymphokine activity, enzymatic activity, etc.).
  • a functional screen or selection is used to identify an evolved protein not expressed on a phage.
  • the target protein which cannot initially be efficiently expressed in a host of interest, is mutagenized and a functional screen or selection is used to identify cells expressing functional protein.
  • the protein of interest may complement a function in the host cell, cleave a colorimetric substrate, etc. Recursive sequence recombination is then used to rapidly evolve improved functional expression from such a pool of improved mutants.
  • AMV reverse transcriptase is of particular commercial importance because it is active at a higher temperature (42° C) and is more robust than many other reverse transcriptases.
  • it is difficult to express in prokaryotic hosts such as E. coli, and is consequently expensive because it has to be purified from chicken cells.
  • an evolved AMV reverse transcriptase that can be expressed efficiently in E. coli is highly desirable.
  • the AMV reverse transcriptase gene (Papas et al., J. Cellular Biochem 20:95-103 (1982)) is mutagenized by any method common in the art.
  • the library of mutant genes is cloned into a colE1 plasmid (Amp resistant) under control of the lac promoter in a polA12 (Ts) recA718 (Sweasy et al. Proc. Natl. Acad. Sci. U.S.A. 90:4626- 4630 (1993)) E. coli host.
  • the library is induced with IPTG, and shifted to the nonpermissive temperature.
  • Chaperonins In some embodiments of the invention, overexpression of a protein can lead to the accumulation of folding intermediates which have a tendency to aggregate. Without being limited to any one theory, the role of chaperonins is thought to be to stabilize such folding intermediates against aggregration; thus, overexpression of a protein of interest can lead to overwhelming the capacity of chaperonins. Chaperonin genes can be evolved using the techniques of the invention, either alone or in combination with the genes encoding the protein of interest, to overcome this problem.
  • proteins of interest which are especially suited to this approach include but are not limited to: cytokines; malarial coat proteins; T cell receptors; antibodies; industrial enzymes (e.g., detergent proteases and detergent lipases); viral proteins for use in vaccines; and plant seed storage proteins.
  • Sources of chaperonin genes include but are limited to E. coli chaperonin genes encoding such proteins as thioredoxin, Gro ES/Gro EL, PapD, CIpB, DsbA, DsbB, DnaJ, DnaK, and GrpE; mammalian chaperonins such as Hsp70, Hsp72, Hsp73, Hsp40,Hsp60, Hsp10, Hdj1, TCP-1, Cpn60, 3iP; and the homologues of these chaperonin genes in other species such as yeast (J.G. Wall and A. Pluckthun, Current Biology. 6:507- 516 (1995); Hartl, Nature. 381:571-580 (1996)). Additionally, heterologous genomic or cDNA libraries can be used as libraries to select or screen for novel chaperonins.
  • E. coli chaperonin genes encoding such proteins as thioredoxin, Gro ES/G
  • the chaperonin genes are evolved independently of the gene(s) for the protein of interest.
  • the improvement in the evolved chaperonin can be assayed, for example, by screening for enhancement of the activity of the target protein itself or for the activity of a fusion protein comprising the target protein and a selectable or screenable protein (e.g., GFP, alkaline phosphatase or beta-galactosidase).
  • a selectable or screenable protein e.g., GFP, alkaline phosphatase or beta-galactosidase.
  • the chaperonin genes and the target protein genes are encoded on the same plasmid, but not necessarily evolved together.
  • a lac headpiece dimer can be fused to the protein target to allow for selection of plasmids which encode soluble protein.
  • Chaperonin genes are provided on this same plasmid ("cis") and are shuffled and evolved rather than the target protein.
  • the chaperonin genes can be cloned onto a phagemid plasmid that encodes a gene III or gene VIII fusion with a protein of interest.
  • the cloned chaperonins are mutagenized and, as with the selection described above, phage expressing functionally displayed fusion protein are isolated on an affinity matrix.
  • the chaperonin genes from these phage are shuffled and the cycle of selection, mutation and recombination are applied recursively until fusion proteins are efficiently displayed in functional form.
  • coli for example, is known to be influenced by many proteins including: a secretory ATPase (SecA), a translocase complex (SecB, SecD, SecE, SecF, and SecY), chaperonins (DnaK, DnaJ, GroES, GroEL), signal peptidases (LepB, LspA, Ppp), specific folding catalysts (DsbA) and other proteins of less well defined function (e.g., Ffh, FtsY) (Sandkvist et al., Curr. Op. Biotechnol. 7:505-511 (1996)). Overproduction of wild type or mutant copies of these genes for these proteins can significantly increase the yield of mature secreted protein.
  • RSR provides a route to evolution of one or more of the above named components of the secretory pathway.
  • the following strategy is employed to optimize protein secretion in E coli. Variations on this method, suitable for application to Bacillus subtilis, Pseudomonas, Saccaromyces cerevisiae, Pichia pastoris, mammalian cells and other hosts are also described.
  • the general protocol is as follows.
  • genes named above are obtained by PCR amplification from E. coli genomic DNA using known flanking sequence, and cloned in an ordered array into a plasmid or cos id vector. These genes do not in general occur naturally in clusters, and hence these will comprise artificial gene clusters.
  • the genes may be cloned under the control of their natural promoter or under the control of another promoter such as the lac, tac, arabinose, or tip promoters.
  • rare restriction sites such as Sfi I are placed between the genes to facilitate ordered reassembly of shuffled genes as described in the methods of the invention.
  • the gene cluster is mutagenized and introduced into a host cell in which the gene of interest can be inducibly expressed.
  • Expression of the target gene to be secreted and of the cloned genes is induced by standard methods for the promoter of interest (e.g., addition of 1 mM IPTG for the lac promoter).
  • the efficiency of protein secretion by a library of mutants is measured, for example by the method of colony blotting (Skerra et al., Anal. Biochem. 196:151-155 (1991)). Those colonies expressing the highest levels of secreted protein (the top 0.1 - 10%; preferably the top 1%) are picked. Plasmid DNA is prepared from these colonies and shuffled according to any of the methods of the invention.
  • each individual gene is amplified from the population and subjected to RSR.
  • the fragments are digested with Sfi I (introduced between each gene with nonpalindromic overhangs designed to promote ordered reassembly by DNA ligase) and ligated together, preferably at low dilution to promote formation of covalently closed relaxed circles ( ⁇ 1 ng/microliter).
  • Sfi I introduced between each gene with nonpalindromic overhangs designed to promote ordered reassembly by DNA ligase
  • Each of the PCR amplified gene populations may be shuffled prior to reassembly into the final gene cluster.
  • the ligation products are transformed back into the host of interest and the cycle of selection and RSR is repeated.
  • Analogous strategies can be employed in other hosts such as Pseudomonas, Bacillus subtilis, yeast and mammalian cells.
  • the homologs of the E. coli genes listed above are targets for optimization, and indeed many of these homologs have been identified in other species (Pugsley, Microb. Rev. 57:50-108 (1993)).
  • other components such as the six polypeptides of the signal recognition particle, the translocating chain-associating membrane protein (TRAM), BiP, the Ssa proteins and other hsp70 homologs, and prsA (B. subtilis) (Simonen and Pulva, Microb. Rev. 57:109-137 (1993)) are targets for optimization by RSR.
  • replicating episomal vectors such as SV40-neo (Sambrook et al., Molecular Cloning. CSH Press (1987), Northrup et al., J. Biol. Chem. 268(4):2917-2923 (1993)) for mammalian cells or 2 micron or ars plasmids for yeast
  • Integrative vectors such as pJM 103, pJM 113 or pSGMU2 are preferred for B. subtilis (Perego, Chap. 42, pp. 615-624 in: Bacillus subtilis and Other Gram-Positive Bacteria. A. Sonenshein, J. Hoch, and R. Losick, eds., 1993).
  • an efficiently secreted thermostable DNA polymerase can be evolved, thus allowing the performance of DNA polymerization assays with little or no purification of the expressed DNA polymerase.
  • Initial constructs are made by fusing a signal peptide such as that from STII or OmpA to the amino terminus of the protein to be secreted.
  • a gene cluster of cloned genes believed to act in the secretory pathway of interest are mutagenized and coexpressed with the target construct.
  • Individual clones are screened for expresion of the gene product.
  • the secretory gene clusters from improved clones are recovered and recloned and introduced back into the original host. Preferably, they are first subjected to mutagenesis before the process is repeated. This cycle is repeated until the desired improvement in expression of secreted protein is achieved.
  • enzymes of industrial interest that have substantially suboptimal activity on the substrate of interest.
  • the enzyme obtained from nature is required to work either under conditions that are very different from the conditions under which it evolved or to have activity towards a substrate that is different from the natural substrate.
  • the application of evolutionary technologies to industrial enzymes is often significantly limited by the types of selections that can be applied and the modest numbers of mutants that can be surveyed in screens. Selection of enzymes or catalytic antibodies, expressed in a display format, for binding to transition state analogs (McCafferty et al., Appl. Biochem. Biotechnol.
  • Phage display (O'Neil et al., Current Bioloov 5:443-449 (1995) and the other display formats (Gates et al., J. Mol. Biol. 255:373-386 (1995); Mattheakis et al., Proc. Natl. Acad. Sci. (U.S.A.) 91 :9022-9026 (1994)) described herein represent general methodologies for applying affinity-based selections to proteins of interest. For example, Matthews and Wells (Science 260: 1113-1117 (1993)) have used phage display of a protease substrate to select improved substrates. Display of active enzymes on the surface of phage, on the other hand, allows selection of mutant proteins with improved transition state analog binding.
  • Improvements in affinity for transition state analogs correlate with improvements in catalytic efficiency.
  • Patten et al. Science 271 :1086-1091 (1996) have shown that improvements in affinity of a catalytic antibody for its hapten are well correlated with improvements in catalytic efficiency, with an 80-fold improvement in kcat/Km being achieved for an esterolytic antibody.
  • an enzyme used in antibiotic biosynthesis can be evolved for new substrate specificity and activity under desired conditions using phage display selections.
  • Some antibiotics are currently made by chemical modifications of biologically produced starting compounds. Complete biosynthesis of the desired molecules is currently impractical because of the lack of an enzyme with the required enzymatic activity and substrate specificity (Skatrud, TIBTECH 10:324-329, September 1992).
  • 7- aminodeacetooxycephalosporanic acid (7-ADCA) is a precursor for semi-synthetically produced cephalosporins. 7-ADCA is made by a chemical ring expansion of penicillin G followed by enzymatic deacylation of the phenoxyacetal group.
  • 7-ADCA can be made enzymatically from deacetylcephalosporin C (DAOC V), which could in turn be derived from penicillin V by enzymatic ring expansion if a suitably modified penicillin expandase could be evolved (Cantwell et al., Curr. Genet. 17:213-221 (1990)).
  • DAOC V deacetylcephalosporin C
  • 7-ADCA could in principle be produced enzymatically from penicillin V using a modified penicillin N expandase, such as mutant forms of the S. clavuligerus cefE gene (Skatrud, TIBTECH 10:324-329, September 1992).
  • penicillin V is not accepted as a substrate by any known expandase with sufficient efficiency to be commercially useful.
  • RSR techniques of the invention can be used to evolve the penicillin expandase encoded by cefE or other expandases so that they will use penicillin V as a substrate.
  • Phage display or other display format selections are applied to this problem by expressing libraries of cefE penicillin expandase mutants in a display format, selecting for binding to substrates or transition state analogs, and applying RSR to rapidly evolve high affinity binders. Candidates are further screened to identify mutants with improved enzymatic activity on penicillin V under desired reaction conditions, such as pH, temperature, solvent concentration, etc.
  • RSR is applied to further evolve mutants with the desired expandase activity.
  • a number of transition state analogs (TSA's) are suitable for this reaction. The following structure is the initial TSA that is used for selection of the display library of cefE mutants:
  • the display library is subjected to selection for binding to penicillin V and/or to transition state analog given above for the conversion of penicillin V to DAOC V. These binding selections may be performed under non-physiological reaction conditions, such as elevated temperature, to obtain mutants that are active under the new conditions. RSR is applied to evolve mutants with 2 - 10 5 fold improvement in binding affinity for the selecting ligand. When the desired level of improved binding has been obtained, candidate mutants are expressed in a high throughput format and specific activity for expanding penicillin V to DAOC V is quantitatively measured. Recombinants with improved enzymatic activity are mutagenized and the process repeated to further evolve them.
  • Retention of TSA binding by a displayed enzyme is a good selection for retention of the overall integrity of the active site and hence can be exploited to select for mutants which retain activity under conditions of interest.
  • Such conditions include but are not limited to: different pH optima, broader pH optima, activity in altered solvents such as DMSO (Seto et al., DNA Sequence 5:131-140 (1995)) or formamide (Chen et al., Proc. Natl. Acad. Sci. (U.S.A.) 90:5618-5622, (1993)) altered temperature, improved shelf life, altered or broadened substrate specificity, or protease resistance.
  • DMSO Seto et al., DNA Sequence 5:131-140 (1995)
  • formamide Choen et al., Proc. Natl. Acad. Sci. (U.S.A.) 90:5618-5622, (1993)
  • altered temperature improved shelf life
  • altered or broadened substrate specificity or protease resistance
  • Novel sequencing formats have been described which use matrix assisted laser desorption ionization time of flight (MALDT-TOF) mass spectroscopy to resolve dideoxy ladders (Smith, Nature Biotechnology 14:1084-1085 (1996)). It is noted in Smith's recent review that fragmentation of the DNA is the singular feature limiting the development of this method as a viable alternative to standard gel electrophoresis for DNA sequencing.
  • Base analogs which stabilize the N-glycosidic bond by modifications of the purine bases to 7- deaza analogs (Kirpekar et al., Rapid Comm. in Mass Spec.
  • thermostable DNA polymerase for more efficient mutagenesis or as a useful correlate for acceptance of base analogs for the purposes described above; higher fidelity polymerase for PCR (Lundberg et al., Gene 108:1-6 (1991)); higher fidelity reverse transcriptase for retroviral gene therapy vehicles to reduce mutation of the therapeutic construct and of the retrovirus; improved PCR of GC rich DNA and PCR with modified bases (S. Turner and F. J. Jenkins, BioTechnioues 19(1):48-52 (1995)).
  • libraries of mutant polymerase genes are screened by direct high throughput screening for improved sequencing properties. The best candidates are then subjected to RSR.
  • mutant libraries of candidate polymerases such as Taq polymerase are constructed using standard methods such as PCR mutagenesis (Caldwell et al., PCR Meth. App. 2:28-33 (1992)) and/or cassette mutagenesis (Sambrook et al., Molecular Cloning. CSH Press (1987)).
  • PCR mutagenesis Caldwell et al., PCR Meth. App. 2:28-33 (1992)
  • cassette mutagenesis Sambrook et al., Molecular Cloning. CSH Press (1987)
  • Incorporation of mutations into Taq DNA polymerase such as the active site residue from T7 polymerase that improves acceptance of dideoxy nucleotides (Tabor and Richardson, J. Biol. Chem. 265:8322-8328 (1990)) and mutations that inactivate the 5' - 3' exonuclease activity (R.S.
  • the data is analyzed to identify mutants with improved sequencing properties, according to any of these criteria: higher quality ladders on GC-rich templates, especially greater than 60% GC, including such points as fewer artifactual termination products and stronger signals than given with the wild-type enzyme; less termination of reactions by inosine in primer labelled reactions, e.g., fluorescent labelled primers; less variation in incorporation of signals in reactions with fluorescent dideoxy nucleotides at any given position; longer sequencing ladders than obtained with the wild-type enzyme, such as about 20 to 100 nucleotides; improved acceptance of other known base analogs such as 7-deaza purines; improved acceptance of new base analogs from combinatorial chemistry libraries (See, for example, Hogan, Nature 384(Supp): 17-1996).
  • the best candidates are then subjected to mutagenesis, and then selected or screened for the improved sequencing properties decribed above.
  • a screen or selection is performed as follows.
  • the replication of a plasmid can be placed under obligate control of a polymerase expressed in E. coli or another microorganism.
  • the effectiveness of this system has been demonstrated for making plasmid replication dependent on mammalian polymerase beta (Sweasy et al., Proc. Natl. Acad. Sci. (U.S.A.) 90:4626-4630, (1993)), Taq polymerase (Suzuki et al., Proc. Natl. Acad. Sci. (U.S.A.) 93:9670-9675 (1996)), or HIV reverse transcriptase (Kim et al., Proc. Natl. Acad. Sci.
  • the mutant polymerase gene is placed on a plasmid bearing a colE1 origin and expressed under the control of an arabinose promoter.
  • the library is enriched for active polymerases essentially as described by Suzuki et al., (supra), with polymerase expression being induced by the presence of arabinose in the culture.
  • a further quantitative screen utilizes the presence of GFP (green fluorescence protein) on the same plasmid, replica plating onto arabinose at the nonpermissive temperature in the absence of a selective antibiotic, and using a fluorimeter to quantitatively measure fluorescence of each culture.
  • GFP activity correlates with plasmid stability and copy number which is in turn dependent on expression of active polymerase.
  • a polymerase with a very high error rate would be a superior sequencing enzyme, as it would have a more normalized signal for incorporation of base analogs such as the currently used fluorescently labelled dideoxies because it will have reduced specificity and selectivity.
  • the error rates of currently used polymerases are on the order of 10 "5 to 10 "6 , orders of magnitude lower than what can be detected given the resolving power of the gel systems.
  • An error rate of 1%, and possibly as high as 10%, could not be detected by current gel systems, and thus there is a large window of opportunity to increase the "sloppiness" of the enzyme.
  • An error-prone cycling polymerase would have other uses such as for hypermutagenesis of genes by PCR.
  • the system described by Suzuki is used to make replication of a reporter plasmid dependent on the expressed polymerase.
  • This system puts replication of the first 200 - 300 bases next to the ColE1 origin directly under the control of the expressed polymerase (Sweasy and Loeb, J. Bact. 177:2923-2925 (1995); Sweasy et al., Proc. Natl. Acad. Sci. (U.S.A.) 90:4626-4630 (1993)).
  • a screenable or selectable reporter gene containing stop codons is positioned in this region, such as LacZ alpha containing one, two or three stop codons.
  • the constructs are grown on arabinose at the nonpermissible temperature, allowed to recover, and plated on selective lactose minimal media that demands reversion of the stop codons in the reporter cassette.
  • Mutant polymerases are recovered from the survivors by PCR. The survivors are enriched for mutators because their mutator phenotype increases the rate of reversion of stop codons in the reporter lacZ alpha fragment.
  • the polymerase genes from the survivors are subjected to RSR, then the polymerase mutants are retransformed into the indicator strain.
  • Mutators can be visually screened by plating on arabinose/Xgal plates at the nonpermissive temperature. Mutator polymerases will give rise to colonies with a high frequency of blue papillae due to reversion of the stop codon(s).
  • Candidate papillators can be rescreened by picking a non-papillating region of the most heavily papillated colonies (i.e, "best" colonies) and replating on the arabinose/Xgal indicator medium to further screen for colonies with increased papillation rates. These steps are repeated until a desired reversion rate is achieved (e.g., 10 "2 to 10 3 mutations per base pair per replication).
  • Colonies which exhibit high frequency papillation are candidates for encoding an error prone polymerase. These candidates are screened for improved sequencing properties essentially as for the high throughput screen described above. Briefly, mutant Taq proteins are expressed and purified in a 96-well format. The purified proteins are used in sequencing reactions and the sequence data are analyzed to identify mutants that exhibit the improvements outlined herein. Mutants with improved properties are subjected to RSR and rescreened for further improvements in function. In some embodiments, GFP containing stop codons instead of lacZ alpha with stop codons is used for the construction. Cells with reverted stop codons in GFP are selected by fluorescence activated cell sorter (FACS).
  • FACS fluorescence activated cell sorter
  • FACS selection is performed by gating the brightest about 0.1- 10%, preferably the top 0.1 to 1%, and collected according to a protocol similar to that of Dangl et al., (Cvtometrv 2(6):395-401 (1982)).
  • the polA gene is flanked with lox sites or other targets of a site specific recombinase. The recombinase is induced, thus allowing one to inducibly delete the polA gene (Mulbery et al., Nucleic Acid Res. 23:485-490 (1995)). This would allow one to perform "Loeb-type" selections at any temperature and in any host. For example, one could set up such a selection in a recA deficient mesophile or thermophile by placing the polA homologue in an inducibly deletable format and thus apply the selection for active polymerase under more general conditions.
  • this general system is preferred for directed in vivo mutagenesis of genes.
  • the target gene is cloned into the region near a plasmid origin of replication that puts its replication obligately under control of the error prone polymerase.
  • the construct is passaged through a polA(ts) recA strain and grown at the nonpermissive temperature, thus specifically mutagenizing the target gene while replicating the rest of the plasmid with high fidelity.
  • selection is based on the ability of mutant DNA polymerases to PCR amplify DNA under altered conditions or by utilizing base analogs.
  • the mutant polymerases act on the template that encodes them in a PCR amplification, thus differentially replicating those polymerases.
  • an initial library of mutants is replica plated. Polymerase preparations are done in a 96-well format. Crude plasmid preparations are made of the same set.
  • Each plasmid prep is PCR-amplified using the polymerase prep derived from that plasmid under the conditions for which one wishes to optimize the polymerase (e.g., added DMSO or formamide, altered temperature of denaturation or extension, altered buffer salts, PCR with base analogs such a-thiol dNTP's for use with mass spectroscopy sequencing, PCR of GC rich DNA (>60% GC),PCR with novel base analogs such as 7-deaza purines, 2' fluoro dNTP's, rNTP's, PCR with inosine, etc.).
  • the amplified genes are pooled, cloned, and subjected to mutagenesis, and the process repeated until an improvement is achieved.
  • Alkaline phosphatase is a widely used reporter enzyme for ELISA assays, protein fusion assays, and in a secreted form as a reporter gene for mammalian cells.
  • the chemical lability of p-nitrophenyl phosphate (pNPP) substrates and the existence of cellular phosphatases that cross-react with pNPP is an important limitation on the sensitivity of assays using this reporter gene.
  • a reporter gene with superior signal to noise properties can be developed based on hydrolysis of p-nitrophenyl phosphonates, which are far more stable to base catalyzed hydrolysis than the corresponding phosphates. Additionally, there are far fewer naturally occurring cellular phosphonatases than alkaline phosphatases.
  • Proteases and lipases are added in large quantities to detergents to enzymatically degrade protein and lipid stains on clothes.
  • the incorporation of these enzymes into detergents has significantly reduced the need for surfactants in detergents with a consequent reduction in the cost of formulation of detergents and improvement in stain removal properties.
  • Proteases with improved specific activity, improved range of protein substrate specificity, improved shelf life, improved stability at elevated temperature, and reduced requirements for surfactants would add value to these products.
  • subtilisin can be evolved as follows.
  • the cloned subtilisin gene (von der Osten et al., J. Biotechnol. 28:55-68 (1993)) can be subjected to RSR using growth selections on complex protein media by virtue of secreted subtilisin degrading the complex protein mixture.
  • libraries of subtilisin mutants are constructed in an expression vector which directs the mutant protein to be secreted by Bacillus subtilus.
  • Bacillus hosts transformed with the libraries are grown in minimal media with complex protein formulation as carbon and/or nitrogen source.
  • Subtilisin genes are recovered from fast growers and subjected to RSR, then screened for improvement in a desired property.
  • a library of mutant protease genes is constructed on a display phage and the phage grown in a multiwell format or on plates.
  • the phage are overiayed with a "protein net” which ensnares the phage.
  • the net can consist of a protein or proteins engineered with surface disulphides and then crosslinked with a library of peptide linkers.
  • a further embodiment employs an auxiliary matrix to further trap the phage. The phage are further incubated, then washed to collect liberated phage wherein the displayed protease was able to liberate the phage from the protein net.
  • a further embodiment employs a library of proteases encoded by but not displayed on a phagemid wherein streptavidin is fused to pill by a peptide linker.
  • the library of protease mutants is evolved to cleave the linker by selecting phagemids on a biotin column between rounds of amplification.
  • the protease is not necessarily provided in a display format.
  • the host cells secrete the protease encoded by but not surface diplayed by a phagemid, while constrained to a well, for example, in a microtiter plate.
  • Phage display format is preferred where an entire high titre lysate is encased in a protein net matrix, and the phage expressing active and broad specificity proteases digesting the matrix to be liberated for the next round of amplification, mutagenesis, and selection.
  • the phage are not constrained to a well but, rather, protein binding filters are used to make a colony of plaque lifts and are screened for activity with chromogenic or fluorogenic substrates. Colonies or plaques corresponding to positive spots on the filters are picked and the encoded protease genes are recovered by, for example, PCR. The protease genes are then subjected to RSR for further evolution.
  • Peptide substrates containing fluorophores attached to the carboxy terminus and fluorescence quenching moities on the amino terminus such as those described by Holskin, et al, (Anal. Biochem. 227:148-55 (1995)) (e.g., (4-4'- dimethylaminophenazo)benzoyl-arg-gly-val-val-asn-ala-ser-ser-arg-leu-ala-5-(2'-aminoethyl)- amino-naphthalene-1 -sulfonic acid) are used to screen protease mutants for broadened or altered specificity.
  • fluorophores attached to the carboxy terminus and fluorescence quenching moities on the amino terminus such as those described by Holskin, et al, (Anal. Biochem. 227:148-55 (1995)) (e.g., (4-4'- dimethylaminophenazo)benzoyl-arg-gly-val-
  • a library of peptide substrates is designed with a flourophore on the amino terminus and a potent fluorescence quencher on the carboxy terminus, or vice versa.
  • Supernatants containing secreted proteases are incubated either separately with various members of the library or with a complex cocktail. Those proteases which are highly active and have broad specificity will cleave the majority of the peptides, thus releasing the fluorophore from the quencher and giving a positive signal on a fluorimeter. This technique is amenable to a high density multiwell format.
  • Table I lists proteins that are of particular commercial interest to the pharmaceutical industry. These proteins are all candidates for RSR evolution to improve function, such as specific activity, ligand binding, shelf life, reduction of side effects through enhanced specificity, etc. All are well-suited to manipulation by the techniques of the invention. Additional embodiments especially applicable to this list are described below.
  • mutants of Table I are screened for activity in a functional assay.
  • mutants of IL2 are screened for resistance to degradation by plasma or tissue proteases; or for retention of activity on the low affinity IL2 receptor but with loss of activity on the high affinity IL2 receptor.
  • the genes from mutants with improved activity relative to wild-type are recovered, and subjected to RSR to improve the phenotype further.
  • the libraries are generated in a display format such that the mature folded protein is physically linked to the genetic information that encodes it.
  • Examples include phage display using filamentous phage (O'Neil et al., Current Biology 5:443-449 (1995)) or bacteriophage lambda gene V display (Dunn, J. Mol. Biol. 248:497-506 (1995)), peptides on plasmids (Gates et al., J. Mol. Biol.
  • the following method can be used for selection.
  • a stock of phagemids encoding IFN alpha mutants for example, can be used directly at suitable dilution to stimulate cells.
  • the biological effect on the cells can be read out by standard assays (e.g., proliferation or viral resistance) or indirectly through the activation of a reporter gene such as GFP (Crameri et al., Nat. Med. 14:315-319 (1996)) under the control of an IFN responsive promoter, such as an MHC class I promoter.
  • phagemids remaining attached after stimulation, expression and FACS purification of the responsive cells can be purified by FACS.
  • the brightest cells are collected.
  • the phagemids are collected and their DNA subjected to RSR until the level of desired improvement is achieved.
  • IL-3 is prepared in one of these display formats and subjected to RSR to evolve an agonist with a desired level of activity.
  • a library of IL3 mutants on a filamentous phage vector is created and affinity selected ("panned") against purified IL3 receptor to obtain mutants with improved affinity for receptor or for improved potency of phase displayed IL-3.
  • the mutant IL-3 genes are recovered by PCR, subjected to RSR, and recloned into the display vector. The cycle is repeated until the desired affinity or agonist activity is achieved.
  • the display formats descibed above preferentially are applied to a single chain version of the protein. Mutagenesis, such as RSR, can be used in these display formats to evolve improved single chain derivatives of multimeric factors which initially have low but detectable activity. This strategy is described in more detail below. H. Whole Cell Selections
  • the eukaryotic cell is the unit of biological selection.
  • the following general protocol can be used to apply RSR to the improvement of proteins using eukaryotic cells as the unit of selection: (1) transfection or transduction of libraries of mutants into a suitable host cell, (2) expression of the encoded gene product(s) either transiently or stably, (3) functional selection for ceils with an improved phenotype (expression of a receptor with improved affinity for a target ligand; viral resistance, etc., (4) recovery of the mutant genes by, for example, PCR followed by preparation of HIRT supernatants with subsequent tranformation of E. coli, (5) RSR and (6) repetition of steps (1) - (5) until the desired degree of improvement is achieved.
  • mammalian surface display to functionally select cells expressing cloned genes, such as using an antibody to done the gene for an expressed surface protein
  • cells are transiently transfected with libraries of cloned genes residing on replicating episomal vectors.
  • An antibody directed against the protein of interest (whose gene one wishes to clone) is immobilized on a solid surface such as a plastic dish, and the transfected cells expressing the protein of interest are affinity selected.
  • the affinity of an antibody for a ligand can be improved using mammalian surface display and RSR.
  • Antibodies with higher affinity for their cognate ligands are then screened for improvement of one or more of the following properties: (1) improved therapeutic properties (increased cell killing, neutralization of ligands, activation of signal transduction pathways by crosslinking receptors), (2) improved in vivo imaging applications (detection of the antibody by covalent/noncovalent binding of a radionuclide or any agent delectable outside of the body by noninvasive means, such as NMR), (3) improved analytical applications (ELISA detection of proteins or small molecules), and (4) improved catalysts (catalytic antibodies).
  • improved therapeutic properties increased cell killing, neutralization of ligands, activation of signal transduction pathways by crosslinking receptors
  • improved in vivo imaging applications detection of the antibody by covalent/noncovalent binding of a radionuclide or any agent delectable outside of the body by noninvasive means, such as NMR
  • improved analytical applications ELISA detection of proteins or small molecules
  • catalytic antibodies catalytic antibodies
  • Retroviral vectors provide a second alternative, but they are limited in the size of acceptable insert ( ⁇ 10 kb) and consistent, high expression levels are sometimes difficult to achieve. Random integration results in varying expression levels, thus introducing noise and limiting one's ability to distinguish between improvements in the affinity of the mutant protein vs. increased expression.
  • a related class of strategies that can be used effectively to achieve "one gene- one cell" DNA transfer and consistent expression levels for RSR is to use a viral vector which contains a lox site and to introduce this into a host that expresses ere recombinase, preferably transiently, and contains one or more lox sites integrated into its genome, thus limiting the variability of integration sites (Rohlman et al. Nature Biotech. 14:1562-1565 (1996)).
  • An alternative strategy is to transfect with limiting concentrations of plasmid (i.e., about one copy per cell) using a vector that can replicate in the target cells, such as is the case with plasmids bearing SV40 origins transfected into COS cells.
  • This strategy requires that either the host cell or the vector supply a replication factor such as SV40 large T antigen.
  • Northrup et al. J. Biol. Chem. 268:2917-2923 (1993) describe a strategy wherein a stable transfectant expressing SV40 large T antigen is then transfected with vectors bearing SV40 origins.
  • This format gave consistently higher transient expression and demonstrable plasmid replication, as assayed by sensitivity to digestion by Dpn I.
  • Transient expression i.e, non-integrating plasmids
  • SV40 large T antigen or other replication factors may have deleterious effects on or may work inefficiently in some cells.
  • RSR is applied to the replication factor itself to evolve mutants with improved activity in the cell type of interest.
  • a generic protocol for evolving such a factor is as follows:
  • the target cell is transfected with GFP cloned onto a vector containing SV40 large T antigen, an SV40 origin, and a reporter gene such as GFP; a related format is cotransfection with limiting amounts of the SV40 large T antigen expression vector and an excess of a reporter such as GFP cloned onto an SV40 origin containing plasmid.
  • the brightest cells are purified by FACS.
  • SV40 large T antigen mutants are recovered by PCR, and subjected to mutagenesis. The cycle is repeated until the desired level of improvement is obtained. I.
  • mutant proteins are selected or screened based on their ability to exert a biological effect in an autocrine fashion on the cell expressing the mutant protein.
  • a library of alpha interferon genes can be selected for induction of more potent or more specific antiviral activity as follows.
  • a library of interferon alpha mutants is generated in a vector which allows for induction of expression (i.e. under control of a metallothionein promoter) and efficient secretion in a multiwell format (96-well for example) with one or a few independent clones per well.
  • the promoter is not inducible.and may be constitutive.
  • the cloned interferon genes are induced.
  • the cells are challenged with a cytotoxic virus against which one wishes to evolve an optimized interferon (for example vesicular stomatitus virus or HIV).
  • an optimized interferon for example vesicular stomatitus virus or HIV.
  • Surviving cells are recovered.
  • the cloned interferon genes are recovered by PCR amplification, subjected to RSR, and cloned back into the transfection vector and retransfected into the host cells. These steps are repeated until the desired level of antiviral activity is evolved.
  • the virus of interest is not strongly cytotoxic.
  • a conditionally lethal gene such as herpes simplex virus thymidine kinase
  • thymidine kinase is cloned into the virus and after challenge with virus and recovery, conditionally lethal selective conditions are applied to kill cells that are infected with virus.
  • An example of a conditionally lethal gene is herpes TK, which becomes lethal upon treating cells expressing this gene with the thymidine analog acyclovir.
  • the antiproliferative activity of the cloned interferons is selected by treating the cells with agents that kill dividing cells (for example, DNA alkylating agents).
  • potent cytokines are selected by expressing and secreting a library of cytokines in cells that have GFP or another reporter under control of a promoter that is induced by the cytokine, such as the MHC class I promoter being induced by evolved variants of alpha interferon.
  • the signal transduction pathway is configured such that the wild type cytokine to be evolved gives a weak but detectable signal.
  • proteins are evolved by RSR to have improved circulation half life or stability in serum.
  • a preferred method for improving half-life is evolving the affinity of a protein of interest for a long lived serum protein, such as an antibody or other abundant serum protein. Examples of how affinity for an antibody can enhance serum half life include the co-administration of IL2 and anti-IL2 antibodies which increases serum half-life and anti-tumor activity of human recombinant IL2 (Courtney et al., Immunopharmacoloov 28:223-232 (1994)).
  • the eight most abundant human serum proteins are serum albumin, immunoglobulins, lipoproteins, haptoglobin, fibrinogen, transferrin, alpha-1 antitrypsin, and alpha-2 macroglobulin (Doolittle, chapter 6, The Plasma Proteins F. Putnam, ed.; Academic Press, 1984). These and other abundant serum proteins such as ceruloplasmin and fibronectin are the primary targets against which to evolve binding sites on therapeutic proteins such as in Table I for the purpose of extending half-life. In the case of antibodies, the preferred strategy is to evolve affinity for constant regions rather than variable regions in order to minimize individual variation in the concentration of the relevant target epitope (antibody V region usage between different individuals is significantly variable).
  • Binding sites of the desired affinity are evolved by applying phage display, peptides on plasmid display or polysome display selections to the protein of interest.
  • phage display peptides on plasmid display or polysome display selections to the protein of interest.
  • one could randomly mutagenize an existing binding site or otherwise defined region of the target protein append a peptide library to the N terminus, C terminus, or internally as a functionally nondisruptive loop, or use "family shuffling" of homologous genes.
  • DNA shuffling is particularly advantageous for problems where one wants to simultaneously optimize two or more "uncorrelated" properties such as improved affinity for HSA while retaining biological activity.
  • half life is improved by derivatization with PEG, other polymer conjugates or half-life extending chemical moieties.
  • a preferred strategy is to express a library of mutants of the protein in a display format, derivatize the library with the agent of interest (i.e. PEG) using chemistry that does not biologically inactivate the display system, select based on affinity for the cognate receptor, PCR amplify the genes encoding the selected mutants, shuffle, reassemble, redone into the display format, and iterate until a mutant with the desired activity, post modification, is obtained.
  • An alternative format is to express, purify and derivatize the mutants in a high throughput format, screen for mutants with optimized activity, recover the corresponding genes, subject the genes to RSR and repeat.
  • binding sites for target human proteins that are localized in particular tissues of interest are evolved by RSR.
  • an interferon can be evolved to contain a binding site for a liver surface protein, such as hepatocyte growth factor receptor, such that the interferon partitions selectively onto liver cells and has higher specific antiviral activity on liver cells.
  • a liver surface protein such as hepatocyte growth factor receptor
  • Such an evolved interferon could be useful for treatment of hepatitis.
  • the protein of interest is evolved to have increased stability to proteases.
  • the clinical use of IL2 is limited by serious side effects that are related to the need to administer high doses.
  • High doses are required due to the short half life (3-5 min, Lotze et al., JAMA 256(22):3117-3124 (1986)) and the consequent need for high doses to maintain a therapeutic level of IL2.
  • One of the factors contributing to short half-lives of therapeutic proteins is proteolysis by serum proteases.
  • Cathepsin D a major renal acid protease, is responsible for the degradation of IL2 in Balb/c mice (Ohnishi et al., Cancer Res. 50:1107-1112 (1990)).
  • a preferred protocol is as follows.
  • a library of the mutagenized protein of interest is expressed in a display system with a gene-distal epitope tag (i.e. on the N-terminus of a phage display construct such that if it is cleaved off by proteases, the epitope tag is lost).
  • the expressed proteins are treated with defined proteases or with complex cocktails such as whole human serum.
  • Affinity selection with an antibody to the gene distal tag is performed.
  • a second screen or selection demanding biological function e.g., binding to cognate receptor
  • Phage retaining the epitope tag and hence protease resistant
  • the process is repeated until the desired level of resistance is attained.
  • the procedure is performed in a screening format wherein mutant proteins are expressed and purified in a high throughput format and screened for protease resistance with retention of biological activity.
  • the protein of interest is evolved to have increased shelf life.
  • a library of the mutagenized nucleic acid squence encoding the protein of interest is expressed in a display format or high throughput expression format, and exposed for various lengths of time to conditions for which one wants to evolve stability (heat, metal ions, nonphysiological pH of, for example, ⁇ 6 or >8, lyophilization, freeze- thawing). Genes are recovered from functional survivors, for example, by PCR.
  • the DNA is subjected to mutagenesis, such as RSR, and the process repeated until the desired level of improvement is achieved.
  • mutagenesis such as RSR
  • the case of IFN presents an opportunity to evolve recombinants with improved half-life. There are > 10 26 possible recombinations of the amino acid diversity in this family. Since these recombinants are formed from segments of wild-type IFN genes, relatively few if any novel T ceil epitopes will be created by the process. Molecules that are highly active are like to closely resemble natural interferons structurally, and thus present few if any novel B cell epitopes.
  • the substrate for evolution by RSR is preferably a single chain contruction.
  • the possibility of performing asymetric mutagenesis on constructs of homomultimeric proteins provides important new pathways for further evolution of such constructs that is not open to the proteins in their natural homomultimeric states.
  • a given mutation in a homomultimer will result in that change being present in each identical subunit.
  • the domains can mutate independently of each other.
  • a single chain version of urokinase-type plasminogen activator has been made, and it has been shown that the single chain construct is more resistant to plasminogen activator inhibitor type 1 than the native homodimer (Higazi et al., Blood 87:3545-3549 (1996)).
  • a linker is constructed which joins the amino terminus of one subunit of a protein of interest to the carboxyl terminus of another subunit in the complex.
  • These fusion proteins can consist of linked versions of homodimers, homomultimers, heterodimers or higher order heteromultimers. In the simplest case, one adds polypeptide linkers between the native termini to be joined. Two significant variations can be made. First, one can construct diverse libraries of variations of the wild type sequence in and around the junctions and in the linkers to facilitate the construction of active fusion proteins.
  • a population of selected mutant single chain constructs is PCR amplified in two seprate PCR reactions such that each of the two domains is amplified separately.
  • Oligonucieotides are derived from the 5' and 3' ends of the gene and from both strands of the linker.
  • the separately amplified domains are shuffled in separate reactions, then the two populations are recombined using PCR reassembly to generate intact single chain constructs for further rounds of selection and evolution.
  • the majority of the proteins listed in Table I are either receptors or ligands of pharmaceutical interest. Many agonists such as chemokines or interieukins agonize more than one receptor. Evolved mutants with improved specificity may have reduced side effects due to their loss of activity on receptors which are implicated in a particular side effect profile. For most of these ligand/receptors, mutant forms with improved affinity would have improved pharmaceutical properties. For example, an antagonistic form of RANTES with improved affinity for CCR5 or CXCR4 or both should be an improved inhibitor of HIV infection by virtue of achieving greater receptor occupancy for a given dose of the drug. Using the selections and screens outlined above in combination with RSR, the affinities and specificities of any of the proteins listed in Table I can be improved. For example, the mammalian display format could be used to evolve TNF receptors with improved affinity for TNF.
  • IL2 variants that stimulate the low affinity IL2 receptor complex but not the high affinity receptor (or vice versa)
  • superantigens that stimulate only a subset of the V beta proteins recognized by the wild type protein (preferably a single V beta)
  • antagonistic forms of chemokines that specifically antagonize only a receptor of interest
  • antibodies with reduced cross-reactivity preferably a single V beta
  • chimeric factors that specifically activate a particular receptor complex.
  • a preferred strategy is the selection or screening for mutants with increased agonist activity using the whole cell formats described above, combined with RSR.
  • a library of mutants of IL3 is expressed in active form on phage or phagemids as described by Gram et al. (J. Immun. Meth. 161:169-176
  • Clonal lysates resulting from infection with plaque-purified phage are prepared in a high through-put format such as a 96-well microtiter format.
  • An IL3-dependent cell line expressing a reporter gene such as GFP is stimulated with the phage stocks in a high throughput 96-well. Phage that result in positive signals at the greatest dilution of phage supernatants are recovered; alternatively, DNA encoding the mutant IL3 can be recovered by PCR.
  • single cells expressing GFP under control of an IL3 responsive promoter can be stimulated with the IL3 phagemid library, and the positive cells are FACS sorted. The recovered nucleic acid is then subjected to PCR, and the process repeated until the desired level of improvement is obtained.
  • Alpha-1 antitrypsin Hedgehog proteins e.g., Sonic, Indian,
  • Antihemolytic factor Hemoglobin for blood substitute; for Apolipoprotein radiosensitization
  • Atrial peptides Interferon gamma Bacillus thuringensis toxins (Bt toxins) Interleukin 20 (melanoma differentiation
  • C-X-C chemokines e.g., T39765, NAP-2, Interieukins (1 to 18) ENA-78, Gro-a, Gro-b, Gro-c, IP- Lactoferrin 10, GCP-2, NAP-4, SDF-1 , PF4, Leptin MIG) Leukemia inhibitiry factor (LIF)
  • CC chemokines e.g., Monocyte Neurturin chemoattractant protein-1 , Neutrophil inhibitory factor (NIF) Monocyte chemoattractant protein- Oncostatin-M 2, Monocyte chemoattractant Osteogenic protein protein-3, Monocyte inflammatory Parathyroid hormone protein-1 alpha, Monocyte Protein A inflammatory protein-1 beta, Protein G RANTES, I309, R83915, R91733, RANK (receptor activator of NF- ⁇ ) HCC1 , T58847, D31065, T64262) RANK ligand
  • CNTF Ciliary neurotrophic factor
  • CD4 Colony stimulating factor (CSF, G-CSF, Salmon growth hormone GM-CSF, M-CSF) Soluble CD4
  • EGF Epidermal growth factor
  • Superantigens i.e., Staphylococcal Tumor necrosis factor beta (TNF beta) enterotoxins (SEA, SEB, SEC1 , Tumor necrosis factor receptor (TNFR) SEC2, SEC3, SED, SEE), Toxic Tumor necrosis factor-alpha (TNF alpha) shock syndrome toxin (TSST-1), Urokinase Exfoliating toxins A and B, Viral IL10 homologs Pyrogenic exotoxins A, B, and C, and M. arthritidis mitogen
  • RSR can be used in several ways to modify eukaryotic signal transduction or transcriptional pathways. Any component of a signal transduction pathway of interest, or of the regulatory regions and transcriptional activators that interact with this region and with chemicals that induce transcription can be evolved. This generates regulatory systems in which transcription is activated more potently by the natural inducer or by analogues of the normal inducer. This technology is preferred for the development and optimization of diverse assays of biotechnological interest. For example, dozens of 7 transmembrane receptors (7-TM) are validated targets for drug discovery (see, for example, Siderovski et al., Curr Biol ..
  • biosensors can be developed that will respond to any chemical for which there are receptors, or for which receptors can be evolved by recursive sequence recombination, such as hormones, growth factors, metals and drugs.
  • the receptors may be intracellular and direct activators of transcription, or they may be membrane bound receptors that activate transcription of the signal indirectly, for example by a phosphorylation cascade. They may also not act on transcription at all, but may produce a signal by some post- transcriptional modification of a component of the signal generating pathway. These receptors may also be generated by fusing domains responsible for binding different ligands with different signalling domains. Again, recursive sequence recombination can be used to increase the amplitude of the signal generated to optimize expression and functioning of chimeric receptors, and to alter the specificity of the chemicals detected by the receptor.
  • G proteins can be evolved to efficiently couple mammalian 7-TM receptors to yeast signal transduction pathways.
  • G alpha protein loci in mammals which can be grouped by sequence and functional similarity into four groups, Gs (Gna, Gna1), Gi (Gnai-2, Gnai-3, Gnai-1 , Gnao, Gnat-1 , Gnat-2, Gnaz), Gq (Gnaq, Gna-11 , Gna-14, Gna-15) and G12 (Gna-12, Gna-13) (B. Nurnberg et al., J. Mol. Med., 73:123-132 (1995)).
  • G alpha proteins are complexed noncovalently with G beta and G gamma proteins as well as to their cognate 7-TM receptor(s). Receptor and signal specificity are controlled by the particular combination of G alpha, G beta (of which there are five known loci) and G gamma (seven known loci) subunits. Activation of the heterotrimeric complex by ligand bound receptor results in dissociation of the complex into G alpha monomers and G beta, gamma dinners which then transmit signals by associating with downstream effector proteins.
  • the G alpha subunit is believed to be the subunit that contacts the 7-TM, and thus it is a focal point for the evolution of chimeric or evolved G alpha subunits that can transmit signals from mammalian 7-TM's to yeast downstream genes.
  • Yeast based bioassays for mammalian receptors will greatly facilitate the discovery of novel ligands. Kang et al. (Mol. Cell Biol. 10:2582-2590 (1990)) have described the partial complementation of yeast strains bearing mutations in SCG1 (GPA1), a homologue of the alpha subunits of G proteins involved in signal transduction in mammalian cells, by mammalian and hybrid yeast/mammalian G alpha proteins.
  • Such strains are useful as reporter strains for mammalian receptors, but suffer from important limitations as exemplified by the study of Kang et al., where there appears to be a block in the transmission of signals from the yeast pheromone receptors to the mammalian G proteins.
  • a mammalian 7-TM receptor to yeast signal transduction pathways one couples the mammalian receptor to yeast, mammalian, or chimeric G alpha proteins, and these will in turn productively interact with downstream components in the pathway to induce expression of a pheromone responsive promoter such as FUS-1.
  • Such functional reconstitution is commonly referred to as "coupling”.
  • the methods described herein can be used to evolve the coupling of mammalian 7-TM receptors to yeast signal transduction pathways.
  • a typical approach is as follows: (1) clone a 7-TM of interest into a yeast strain with a modified pheromone response pathway similar to that described by Price (e.g., strains deficient in FAR1, a negative regulator of G, cyclins, and deficient in SST2 which causes the cells to be hypersensitive to the presence of pheromone), (2) construct libraries of chimeras between the mammalian G alpha protein(s) known or thought to interact with the GPA1 or homologous yeast G alpha proteins, (3) place a selectable reporter gene such as HIS3 under control of the pheromone responsive promoter FUS1 (Price et al., Mol.
  • a screenable gene such as luciferase may be placed under the control of the FUS1 promoter; (4) transform library (2) into strain (3) (HIS(-)), (5) screen or select for expression of the reporter in response to the ligand of interest, for example by growing the library of transformants on minimal plates in the presence of ligand to demand HIS3 expression, (6) recover the selected cells, and and apply RSR to evolve improved expression of the reporter under the control of the pheromone responsive promoter FUS1.
  • a second important consideration in evolving strains with optimized reporter constructs for signal transduction pathways of interest is optimizing the signal to noise ratio (the ratio of gene expression under inducing vs noninducing conditions).
  • Many 7-TM pathways are leaky such that the maximal induction of a typical reporter gene is 5 to 10-fold over background. This range of signal to noise may be insufficient to detect small effects in many high through put assays. Therefore, it is of interest to couple the 7-TM pathway to a second nonlinear amplification system that is tuned to be below but near the threshold of activation in the uninduced state.
  • An example of a nonlinear amplification system is expression of genes driven by the lambda P L promoter.
  • GAL4 a limiting component of a transcription factor for such a promoter
  • GAL4 under control of the FUS-1 pheromone responsive promoter and to have the intracellular GAL4 (itself a transcriptional enhancer) level positively feedback on itself by placing a GAL4 binding site upstream of the FUS-1 promoter.
  • a reporter gene is also put under the control of a GAL4 activated promoter. This system is designed so that GAL4 expression will nonlinearly self- amplify and co-amplify expression of a reporter gene such as luciferase upon reaching a certain threshold in the cell.
  • RSR can be used to great advantage to evolve reporter constructs with the desired signaling properties, as follows: (1) A single plasmid construct is made which contains both the GAL4/pheromone pathway regulated GAL4 gene and the GAL4 regulated reporter gene. (2) This construct is mutagenized and transformed into the appropriately engineered yeast strain expressing a 7-TM and chimeric yeast/mammalian protein of interest. (3) Cells are stimulated with agonists and screened (or selected) based on the activity of the reporter gene. In a preferred format, luciferase is the reporter gene and activity is quantitated before and after stimulation with the agonist, thus allowing for a quantitative measurement of signal to noise for each colony. (4) Cells with improved reporter properties are recovered, the constructs are shuffled, and RSR is applied to further evolve the plasmid to give optimal signal to noise characteristics.
  • a preferred strategy to evolve BIAP is as follows.
  • a codon usage libary is constructed from 60-mer oligonucleotides such that the central 20 bases of each oligo specifies the wild type protein, but encodes the wild-type protein sequence with degenerate codons.
  • very rare codons for the prokaryotic host of choice such as E. coli, are not used.
  • the 20 bases at each end of the oligo use non-degenerate, but preferred, codons in E. coli.
  • the oligonucleotides are assembled into full-length genes as described above. The assembled products are cloned into an expression vector by techniques well known in the art.
  • the codon usage library is expressed with a library of secretory leader sequences, each of which directs the encoded BIAP protein to the E. coli periplasm.
  • a library of leader sequences is used to optimize the combination of leader sequence and mutant. Examples of leader sequences are reviewed by Schatz et al. (Ann Rev. Genet. 24:215-248 (1990)).
  • the cloned BIAP genes are expressed under the control of an inducible promoter such as the arabinose promoter. Arabinose- induced colonies are screened by spraying with a substrate for BIAP, bromo-chloro-indolyl phosphate (BCIP). The bluest colonies are picked visually and subjected to the RSR procedures described herein.
  • the oligonucleotides for construction of the codon usage library are listed in
  • TTGAAGAGGA 10. TGCCGCTGCT GTTCACCCCG GTDACYAARG CDGCDCARGT DCTGGTTCCG GTTGAAGAGG A
  • CTGCTCGTTA CAACCAGTGC AARACYACYC GYGGYAAYGA AGTTACCTCT GTTATGAACC
  • GGTAGAAACC ACGCGGGTTA CGRGAHACHA CRCGCAGHGC AACTTCGGTC ATTTCCTGCA
  • H A or C or T
  • D A or G or T.
  • the kappa construct is cloned onto a plasmid encoding puromycin resistance and the heavy chain is cloned onto a neomycin resistance encoding vector.
  • the cDNA derived variable region sequences encoding the mature and germline heavy and light chain V regions are reconfigured by PCR mutagenesis into genomic exons flanked by Sfi I sites with complementary Sfi I sites placed at the appropriate locations in the genomic shuttle vectors.
  • the oligonucleotides used to create the intronic Sfi I sites flanking the VDJ exon are: 5' Sfi I: 5'-TTCCATTTCA TACATGGCCG AAGGGGCCGT GCCATGAGGA TTTT-3'; 3' Sfi I: 5'- TTCTAAATG CATGTTGGCC TCCTTGGCCG GATTCTGAGC CTTCAGGACC A-3'.
  • Standard PCR mutagenesis protocols are applied to produce libraries of mutants wherein the following sets of residues (numbered according to Kabat, Sequences of Proteins of Immunological Interest. U.S. Dept of Health and Human Services, 1991) are randomized to NNK codons (GATC,GATC,GC):
  • Stable transfectant lines are made for each of the two light and heavy chain constructs (mature and germline) using the B cell myeloma AG8-653 (a gift from J. Kearney) as a host using standard electroporation protocols.
  • Libraries of mutant plasmids encoding the indicated libraries of V-L mutants are transfected into the stable transformant expressing the germline V-H; and the V-H mutants are transfected into the germline V-L stable transfectant line. In both cases, the libraries are introduced by protoplast fusion (Sambrook et al., Molecular Cloning.
  • JWJ-1 The p-nitrophenylphosphonate hapten (JWJ-1) recognized by this antibody is synthesized as described by Patten et al. (Science 271:1086-1091 (1996)). JWJ-1 is coupled directly to 5-(((2-aminoethyl)thio)acetyl)fluorescein (Molecular Probes, Inc.) by formation of an amide bond using a standard coupling chemistry such as EDAC (March, Advanced Organic Chemistry. Third edition, John Wiley and Sons, 1985) to give a monomeric JWJ-1-FITC probe.
  • EDAC March, Advanced Organic Chemistry. Third edition, John Wiley and Sons, 1985
  • a "dimeric" conjugate (two molecules of JWJ-1 coupled to a FACS marker) is made in order to get a higher avidity probe, thus making low affinity interactions (such as with the germline antibody) more readily detected by FACS. This is generated by staining with Texas Red conjugated to an anti-fluorescein antibody in the presence of two equivalents of JWJ-1-FITC.
  • the bivalent structure of IgG then provides a homogeneous bivalent reagent.
  • a spin column is used to remove excess JWJ-1 -FITC molecules that are not bound to the anti-FITC reagent.
  • a tetravalent reagent is made as follows.
  • biotin is coupled with EDAC to two equivalents of ethylenediamine, and this is then be coupled to the free carboxylate on JWJ-1.
  • the biotiylated JWJ-1 product is purified by ion exchange chromatography and characterized by mass spectrometry.
  • FITC labelled avidin is incubated with the biotinylated JWJ-1 in order to generate a tetravalent probe.
  • the FACS selection is performed as follows, according to a protocol similar to that of Panka et al. (Proc. Natl. Acad. Sci. (U.S.A.) 85:3080-3084 (1988)).
  • the cells are incubated on ice with fluorescently labelled hapten.
  • the incubation is done on ice to minimize pinocytosis of the FITC conjugate which may contribute to nonspecific background.
  • the cells are then sorted on the FACS either with or without a washing step.
  • FACSing without a washing step is preferable because the off rate for the germline antibody prior to affinity maturation is expected to be very fast (>0.1 sec-1 ; Patten et al., Science 271 :1086-1091 (1996)); a washing step adds a complicating variable. The brightest 0.1 - 10% of the cells are collected.
  • Plasmids are recovered from the FACS selected cells by the transformation of an E. coli host with Hirt supernatants.
  • the mutant V gene exons are PCR- amplified from the FACS selected cells.
  • the recovered V gene exons are subjected to RSR, recloned into the corresponding genomic shuttle vector, and the procedure recursively applied until the mean fluorescence intensity has increased.
  • a relevant positive control for improved binding is transfection with the affinity matured 48G7 exons (Patten et al., op. cit.).
  • equal numbers of germline and each of the two half germline transfectants are mixed. The brightest cells are selected under conditions described above.
  • V genes are recovered by PCR, recloned into expression vectors, and co-transfected, either two plasmids per E. coli followed by protoplast fusion, or by bulk electroporation.
  • the mean fluorescent intensity of the transfectants should increase due to enrichment of mature relative to germline V regions.
  • This methodology can be applied to evolve any receptor-ligand or binding partner interaction.
  • Natural expression formats can be used to express libraries of mutants of any receptor for which one wants to improve the affinity for the natural or novel ligands. Typical examples would be improvement of the affinity of T cell receptors for ligands of interest (i.e. MHC/tumor peptide antigen complexes) or TNF receptor for TNF (soluble forms of TNF receptors are used therapeutically to neutralize TNF activity).
  • This format can also be used to select for mutant forms of ligands by expressing the ligand in a membrane bound form with an engineered membrane anchor by a strategy analogous to that of Wettstein et al. ( J. EXP. Med. 174:219-28 (1991)).
  • FACS selection is then performed with fluorescently labelled receptor.
  • Mutant forms of agonists with improved affinity for their cognate receptors could also be evolved in this format. These mutants would be candidates for improved agonists or potent receptor antagonists, analogous to reported antagonistic mutant forms of IL3.
  • III. Evolution of Alpha Interferon There are at hand 18 known non-allelic human interferon-alpha (INF- ⁇ ) genes, with highly related primary structures (78-95% identical) and with a broad range of biological activities. Many hybrid interferons with interesting biological activities differing from the parental molecules have been described (reviewed by Horisberger and Di Marco, Pharm. Ther.
  • IFN-Con1 A consensus human alpha interferon, IFN-Con1 has been constructed synthetically wherein the most common residue in fourteen known IFN- ⁇ 's has been put at each position, and it compares favorably with the naturally occurring interferons (Ozes et al., J. Interferon Res. 12:55-59 (1992)).
  • This IFN contains 20 amino acid changes relative to IFN- ⁇ 2a, the INF- ⁇ to which it is most closely related.
  • IFN-Con1 has 10-fold higher specific antiviral activity than any known natural IFN subtype.
  • IFN- ⁇ Con1 has in vitro activities 10 to 20 fold higher than that of recombinant IFN ⁇ -2a (the major IFN used clinically) in antiviral, antiproliferative and NK cell activation.
  • IFN ⁇ -2a the major IFN used clinically
  • NK cell activation the major IFN used clinically
  • IFN- ⁇ 's The biological effects of IFN- ⁇ 's are diverse, and include such properties as induction of antiviral state (induction of factors that arrest translation and degrade mRNA); inhibition of cell growth; induction of Class I and Class II MHC; activation of monocytes and macrophages; activation of natural killer cells; activation of cytotoxic T cells; modulation of Ig synthesis in B cells; and pyrogenic activity.
  • the various IFN- ⁇ 's subtypes have unique spectra of activities on different target cells and unique side effect profiles (Ortaldo et al., Proc. Natl. Acad. Sci. (U.S.A.) 81:4926-4929 (1984); Overall et al., J. Interferon Res. 12:281-288 (1992); Fish and Stebbing, Biochem. Bioohvs. Res. Comm. 112:537-546 (1983); Week et al., J. Gen. Virol. 57:233-237 (1981)).
  • human IFN ⁇ has very mild side effects but low antiviral activity.
  • Human IFN ⁇ has very high antiviral activity, but relatively severe side effects.
  • Human IFN ⁇ 7 lacks NK activity and blocks NK stimulation by other INF ⁇ 's.
  • Human IFN- ⁇ J lacks the ability to stimulate NK cells, but it can bind to the IFN- ⁇ receptor on NK cells and block the stimulatory activity of IFN- ⁇ A (Langer et al., J. Interferon Res. 6:97-105 (1986)).
  • the therapeutic applications of interferons are limited by diverse and severe side effect profiles which include flu-like symptoms, fatigue, neurological disorders including hallucination, fever, hepatic enzyme elevation, and leukopenia.
  • the multiplicity of effects of IFN- ⁇ 's has stimulated the hypothesis that there may be more than one receptor or a mutticomponent receptor for the IFN- ⁇ family (R.
  • 171 of the 175 changes can be incorporated into homologue libraries using single degenerate codons at the corresponding positions.
  • Arg, Tip and Gly can all be encoded by the degenerate codon (A,T,G)GG.
  • 1.3 x 10 25 hybrids can be captured with a single set of degenerate oligonucleotides.
  • 27 oligonucleotides is sufficient to shuffle all eleven human alpha interferons. Virtually all of the natural diversity is thereby encoded and fully permuted due to degeneracies in the nine "block" oligonucleotides in Table V.
  • the modelled structure of IFN alpha has been divided into nine segments based on a combination of criteria of maintaining secondary structure elements as single units and placing/choosing placement of the segment boundaries in regions of high identity. Hence, one can capture the whole family with a single set of mildly degenerate oligonucleotides. Table III and Figure 2 give the precise locations of these boundaries at the protein and DNA levels respectively. It should be emphasized that this particular segmentation scheme is arbitrary and that other segmentation schemes could also be pursued. The general strategy does not depend on placement of recombination boundaries at regions of high identity between the family members or on any particular algorithm for breaking the structure into segments.
  • oligo directed shuffling i.e. bridge oligonucleotides
  • oligo directed shuffling i.e. bridge oligonucleotides
  • the general methods described above are employed to screen or select these mutants for improved function.
  • exemplary descriptions of IFN based assays are described below.
  • libraries are constructed wherein the 11 homologous forms of the nine segments are permuted (note that in many cases two homologues are identical over a given segment). All nine segments are PCR- amplified out of all eleven IFN alpha genes with the eighteen oligonucleotides listed in Table IV, and reassembled into full length genes with oligo directed recombination. An arbitrary number, e.g., 1000, clones from the library are prepared in a 96-well expression/purification format. Hybrids with the most potent antiviral activities are screened. Nucleic acid is recovered by PCR amplification, and subjected to recombination using bridge oligonucleotides. These steps are repeated until candidates with desired properties are obtained. E. Strategies for Examining the Space of >10 26 Fine Grain Hybrids
  • each of the nine segments is synthesized with one degenerate oligo per segment.
  • Degeneracies are chosen to capture all of the IFN-alpha diversity that can be captured with a single degenerate codon without adding any non-natural sequence.
  • a second set of degenerate oligonucleotides encoding the nine segments is generated wherein all of the natural diversity is captured, but additional non-natural mutations are included at positions where necessitated by the constraints of the genetic code.
  • One way to make this approach more "gentle” would be to obtain a candidate starting point and to gently search from there.
  • This starting point could be either one of the natural IFN-alpha's (such as IFN alpha-2a which is the one that is being used most widely therapeutically), the characterized IFN-Con1 consensus interferon, or a hit from screening the shuffled IFN-alpha's described above.
  • IFN alpha-2a which is the one that is being used most widely therapeutically
  • the characterized IFN-Con1 consensus interferon or a hit from screening the shuffled IFN-alpha's described above.
  • Given a starting point one would make separate libraries wherein one breeds the degenerate segment libraries one at a time into the founder sequence. Improved hits from each library would then be bred together to gently build up mutations all throughout the molecule.
  • H. Functional Cellular Assays The following assays, well known in the art, are used to screen IFN alpha mutants: inhibition of viral killing; standard error of 30-50%; inhibition of plaque forming units; very low standard error (can measure small effects); reduced viral yield (useful for nonlethal, nonplaque forming viruses); inhibition of cell growth (3H-thymidine uptake assay; activation of NK cells to kill tumor cells; suppression of tumor formation by human INF administered to nude mice engrafted with human tumors (skin tumors for example).
  • IFN alpha mutants are expressed and purified in high throughput formats such as expression, lysis and purification in a 96-well format using anti-IFN antibodies or an epitope tag and affinity resin.
  • the purified IFN preparations are screened in a high throughput format, scored, and the mutants encoding the highest activities of interest are subjected to further mutagenesis, such as RSR, and the process repeated until a desired level of activity is obtained.
  • Standard phage display formats are used to display biologically active IFN. Libraries of chimeric IFN genes are expressed in this format and are selected (positively or negatively) for binding (or reduced binding) to one or more purified IFN receptor preparations or to one or more IFN receptor expressing cell types.
  • Protein expressed by mutants can be screened in high throughput format on a reporter cell line which expresses GFP or luciferase under the control of an IFN alpha responsive promoter, such as an MHC Class I promoter driving GFP expression.
  • an IFN alpha responsive promoter such as an MHC Class I promoter driving GFP expression.
  • the range of concentration used in biological assays is: 1 ng/ml for NK activation, 0.1 - 10 ng/ml for antiproliferative activity on Eskol cells, and 0.1 - 1 ng/ml on Daudi cells (Ozes et al., J. Interferon Res. 12:55-59 (1992)).
  • interferon alpha2a and consensus interferon are expressed in active recombinant form in E coli, so at least these two do not require glycosylation for activity.
  • IFN alpha expressed on filamentous phage is likely to be biologically active as phage stocks without further concentration.
  • IFN chimeras are expressed in phage display formats and scored in the assays described above and below to identify mutants with improved properties to be put into further rounds of RSR.
  • a phage stock can be used directly at suitable dilution to stimulate cells with a GFP reporter construct under the control of an IFN responsive promoter. Assuming that the phage remain attached after stimulation, expression and FACS purification of the responsive cells, one could then directly FACS purify hybrids with improved activity from very large libraries (up to and perhaps larger than 10 7 phage per FACS run).
  • FACS Fluorescence Activated Cell Sorting
  • Cells can be stimulated in a multiwell format with one phage stock per well and a GFP type reporter construct. All stimulated cells are FACS purified to collect the brightest cells, and the IFN genes recovered and subjected to RSR, with iteration of the protocol until the desired level of improvement is obtained. In this protocol the stimulation is performed with individual concentrated lysates and hence the requirement that a single phage be sufficient to stimulate the cell is relaxed. Furthermore, one can gate to collect the brightest cells which, in turn, should have the most potent phage attached to them. L. Cell Surface Display Protocol for IFN Alpha Mutants
  • a sample protocol follows for the cell surface display of IFN alpha mutants.
  • This form of display has at least two advantages over phage display.
  • the protein is displayed by a eukaryotic cell and hence can be expressed in a properly glycosylated form which may be necessary for some IFN alphas (and other growth factors).
  • it is a very high valency display format and is preferred in detecting activity from very weakly active mutants.
  • a library of mutant IFN's is constructed wherein a polypeptide signal for addition of a phosphoinositol tail has been fused to the carboxyl terminus, thus targeting the protein for surface expression (Wettstein et al., J. Exp. Med. 174:219-28 (1991)).
  • the library is used to transfect reporter cells described above (luciferase reporter gene) in a microtiter format. Positives are detected with a charge coupling device(CCD) camera. Nucleic acids are recovered either by HIRT and retransformation of the host or by PCR, and are subjected to RSR for further evolution.
  • a sample protocol follows for the autocrine display of IFN alpha mutants.
  • a library of IFN mutants is generated in a vector which allows for induction of expression (i.e. metallothionein promoter) and efficient secretion.
  • the recipient cell line carrying an IFN responsive reporter cassette (GFP or luciferase) is induced by transfection with the mutant IFN constructs. Mutants which stimulate the IFN responsive promoter are detected by by FACS or CCD camera.
  • a variation on this format is to challenge transfectants with virus and select for survivors.
  • Multiple rounds of killing and outgrowth allow an exponential amplification of a small advantage and hence provide an advantage in detecting small improvements in viral killing.
  • Brackets indicate degeneracy with equal mixture of the specified bases at those positions.
  • the purpose of the degeneracy is to allow this one set of primers to prime all members of the IFN family with similar efficiency.
  • the choice of the oligo driven recombination points is important because they will get "overwritten" in each cycle of breeding and hence cannot coevolve with the rest of the sequence over many cycles of selection. Table V
  • R L P, H, Q, C, W, S, G, K, T, I, M
  • IFN genes were cloned by PCR amplification from genomic DNA with 12 sets of degenerate primers by methods as discussed generally above. The PCR products were cloned into a standard phagemid display vector as fusions to fd bacteriophage gene III. Thirty clones were sequenced and compared to human alpha IFN genes in the literature. Most of the sequence matched known sequences exactly or nearly exactly (>98%DNA identity). Several clones did not match well with any known IFNs (i.e., about 93% identity) and are candidate novel IFN genes. One gene was a clear recombinant which presumably was created during the PCR. Eight of the ten clones were pooled and shuffled. These eight sequences contain about 66% of the known amino acid changes in this gene family. 2. Shuffling
  • phagemid particles Large scale preps of phagemid particles were made by standard methods, using M13 VCS as the helper phage.
  • the IFN-genelll fusion genes were induced at mid log phase by the addition of 0.02% arabinose.
  • the PEG precipitated phagemid particles were CsCI banded and dialyzed.
  • the phagemid particles displayed active IFN as evidenced by the biological activity of phagemid preps expressing IFN-Con1 , IFN2a, or the eight cloned wild type IFN's in a human Daudi cell antiproliferation assay (human cells) (Tymms et al., Genet. Anal. Techn. APPI. 7:53-63 (1990)). 4. Screening for improved activity in the Daudi assay
  • Figure 3 depicts the alignment of the amino acid sequences of four chimeric interferons with IFN-Con1.
  • pooled clones An example of pooled clones follows. Ninety-six clones were combined into eight different pools of twelve and assayed as pools on Daudi cells. CsCI preps were made from the twelve clones in the most active pool (P12.7, or pool "F"). One of these clones, F4, was highly active with activity about 60x greater than Con1 and about 1000x greater than IFN2a. None of the parental IFN's had activity greater than Con1, so this represents an increase of about 60-fold relative to the best parental clone. This clone has been assayed in a human virus protection assay (WISH cells) (Jilbert et al., Microbial. Path. 1 :159-168 (1986) and been found to be more active than Con1 in this assay as well, thus verifying bona fide interferon activity rather than generalized toxicity.
  • WISH cells human virus protection assay
  • mice IFN genes Eight wild-type mouse IFN genes were PCR amplified by standard methods and cloned into the phagemid vector. One of these clones was highly active in a mouse antiviral assay (mouse cells) (Beilharz et al., J. Interferon Res. 9:305-314 (1988) when displayed in this vector. The eight human parental IFN clones and IFN2a were all inactive; and Con1 was weakly active in the mouse antiviral assay. One of eight randomly screened human chimeras was more active than Con1. One of eight pools of 12 clones (Pool "G") was active in the mouse assay. Pool "G" yielded one highly active clone, G8. One of sixteen pools of ninety-six was active. This pool of ninety-six was broken into eight pools of twelve, and two of these pools were highly active.
  • the luciferase of Luciola mingrelica was PCR amplified from pJGR (Devine et al., Biochim. Biophvs. Acta 1173:121-132 (1993)). Both were cloned by their start codon, encoded by Ncol, into pBAD24 (Guzman et al., J. Bacter. 177:4121-4130 (1995)).
  • the luciferase genes including some flanking regions, were PCR amplified by the primers BADup (TGCACGGCGTCACACTTTGCTA) and BADdown (TACTGCCGCCAGGCAAATTCT).
  • the PCR products were mixed in equimolar amounts and partially digested with DNAsel. Fragments from 70 to 280 bp were gel purified. Five ⁇ g fragments were assembled in a volume of 10 ⁇ l using Taq-polymerase and the following 15 cycles in a robocycler: 94°C, 30 seconds; 6°C, 60 seconds; 25°C, 180 seconds. The sample was diluted 1 :6 and cycled for another 20 cycles using a 1 : 1 mix of Taq- and Pwo-polymerase in the DNA engine (94°C, 30 seconds; 40°C, 30 seconds, 72 °C, 30 seconds).
  • the sample was diluted 1 :4 and cycled for another 20 cycles using a 1 : 1 mix of Taq- and Pwo-polymerase in the DNA engine (94°C, 30 seconds; 40°C, 30 seconds; 72°, 30 seconds).
  • the assembly reaction was diluted 1 : 10 to 1 : 100 and the primers #773 (TAGCGGATCCTACCTGACGC) and #297
  • TGAAAATCTTCTCTCATCCG were included with the next 25 cycles using a 1 :1 mix of Taq- and Pwo-polymerase in the DNA engine (94°C, 30 seconds; 45°C, 30 seconds; 72°C, 110 seconds).
  • the PCR products were Ncol/Hindlll digested and ligated into pCKX-GFP.
  • pCKX-GFP is pBAD24, wherein the Gal, Ncol Arabinose regulatory unit cassette was replaced by a variant of the lux autoinducer system of Vibrio fischeri from pJGR (Devine et al., Biochim. Biophvs. Acta 1173:121-132 (1993)).
  • the ligation was transformed into XL1- Blue.
  • the libraries were plated on LB-Amp200 and grown ON at 37°C. The colonies were picked into six 384 well plates and grown overnight. The cultures were gridded onto nitrocellulose and the colonies were grown overnight (ON) at 30 °C. The plate was incubated for 45 min. at 60 °C. Then the nitrocellulose filter was placed onto a blotting paper containing 100 mM Na-citrate pH 5 containing 0.2% Triton X-100 and 1 mM D-Luciferin. This was placed onto plastic wrap with the nitrocellulose and colonies facing down. This assembly was placed on a BIOMAX MR in a film cassette for 30 min.
  • the film was scored by eye, the brightest clones were inoculated from the 384 well plates, and these clones were grown ON at 30°C in 75 ⁇ l LB-Amp in 96 well format.
  • the luciferase was extracted from these cultures as follows. A culture volume of 20 ⁇ l was mixed with 20 ⁇ l lysis buffer I (100 mM Tris-CL pH 7.8, 5% Triton X-100, 10 mM DTT, 10 mM EDTA, 2 mg/ml Polymyxin B sulfate). After shaking, the reaction mixture was frozen for 1 hr. at -70°C and thawed after that at room temperature.
  • lysis buffer II 100 mM Tris-G pH 7.8, 0.25U/ ⁇ l DNAsel, 1.5 mg/ml hen egg lysozyme, 40 mM MgS04
  • lysis buffer II 100 mM Tris-G pH 7.8, 0.25U/ ⁇ l DNAsel, 1.5 mg/ml hen egg lysozyme, 40 mM MgS04
  • the luciferase activity of 5 ⁇ l of the standard lysate and the heat treated lysates were measured using 50 ⁇ l complete assay buffer (20 mM Tris-G pH 7.8 5 mM MgS04, 0.5 mM ATP, 0.5 mM Coenzyme A, 0.5 mM D-Luciferin, 5 mM DTT) in a Topcount luminometer.
  • 50 ⁇ l complete assay buffer (20 mM Tris-G pH 7.8 5 mM MgS04, 0.5 mM ATP, 0.5 mM Coenzyme A, 0.5 mM D-Luciferin, 5 mM DTT) in a Topcount luminometer.
  • Several clones showed an increase in residual activity after heat treatment and when left at RT for several days.
  • One clone showed an increase in luciferase activity of 5-fold over Luciola mingrelica wildtype clone in E. coli extracts when treated for 30 minutes

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Genetics & Genomics (AREA)
  • Organic Chemistry (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Molecular Biology (AREA)
  • Biotechnology (AREA)
  • Biomedical Technology (AREA)
  • General Health & Medical Sciences (AREA)
  • General Engineering & Computer Science (AREA)
  • Biochemistry (AREA)
  • Microbiology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Medicinal Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Immunology (AREA)
  • Plant Pathology (AREA)
  • Crystallography & Structural Chemistry (AREA)
  • Analytical Chemistry (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Urology & Nephrology (AREA)
  • Hematology (AREA)
  • Cell Biology (AREA)
  • Toxicology (AREA)
  • Pathology (AREA)
  • Animal Behavior & Ethology (AREA)
  • Veterinary Medicine (AREA)
  • Food Science & Technology (AREA)
  • General Physics & Mathematics (AREA)
  • Virology (AREA)
  • General Chemical & Material Sciences (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Epidemiology (AREA)
  • Bioinformatics & Computational Biology (AREA)
PCT/US1997/024239 1996-12-18 1997-12-17 Methods and compositions for polypeptide engineering Ceased WO1998027230A1 (en)

Priority Applications (5)

Application Number Priority Date Filing Date Title
CA2274319A CA2274319C (en) 1996-12-18 1997-12-17 Methods and compositions for polypeptide engineering
EP97953571A EP0946755A4 (en) 1996-12-18 1997-12-17 METHOD AND COMPOSITION FOR MANIPULATING POLYPEPTIDES
IL13019097A IL130190A0 (en) 1996-12-18 1997-12-17 Methods and compositions for polypeptide engineering
AU57292/98A AU732146B2 (en) 1996-12-18 1997-12-17 Methods and compositions for polypeptide engineering
JP52805498A JP5008784B2 (ja) 1996-12-18 1997-12-17 ポリペプチド操作のための方法および組成物

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US08/769,062 US6335160B1 (en) 1995-02-17 1996-12-18 Methods and compositions for polypeptide engineering
US08/769,062 1996-12-18

Publications (1)

Publication Number Publication Date
WO1998027230A1 true WO1998027230A1 (en) 1998-06-25

Family

ID=25084330

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US1997/024239 Ceased WO1998027230A1 (en) 1996-12-18 1997-12-17 Methods and compositions for polypeptide engineering

Country Status (12)

Country Link
US (20) US6335160B1 (https=)
EP (5) EP2202308B1 (https=)
JP (2) JP5008784B2 (https=)
KR (1) KR20000069591A (https=)
AT (1) ATE481480T1 (https=)
AU (1) AU732146B2 (https=)
CA (2) CA2274319C (https=)
DE (1) DE69739996D1 (https=)
DK (2) DK2202308T3 (https=)
ES (1) ES2351673T3 (https=)
IL (1) IL130190A0 (https=)
WO (1) WO1998027230A1 (https=)

Cited By (303)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
FR2782323A1 (fr) * 1998-08-12 2000-02-18 Proteus Procede de production in vitro de sequences polynucleotidiques recombinees, banques de sequences et sequences ainsi obtenues
WO2000009727A3 (en) * 1998-08-12 2000-05-18 Maxygen Inc Dna shuffling to produce herbicide selective crops
WO2000020573A3 (en) * 1998-10-07 2000-07-20 Maxygen Inc Dna shuffling to produce nucleic acids for mycotoxin detoxification
WO2000061740A1 (en) * 1999-04-10 2000-10-19 Maxygen, Inc. Modified lipid production
WO2000042561A3 (en) * 1999-01-19 2000-12-07 Maxygen Inc Oligonucleotide mediated nucleic acid recombination
US6159687A (en) * 1997-03-18 2000-12-12 Novo Nordisk A/S Methods for generating recombined polynucleotides
WO2001004287A1 (en) * 1999-07-07 2001-01-18 Maxygen Aps A method for preparing modified polypeptides
WO2000053744A3 (en) * 1999-03-09 2001-01-18 Diversa Corp End selection in directed evolution
US6177263B1 (en) * 1997-03-25 2001-01-23 California Institute Of Technology Recombination of polynucleotide sequences using random or defined primers
WO2001012791A1 (en) * 1999-08-12 2001-02-22 Maxygen, Inc. Dna shuffling of dioxygenase genes for production of industrial chemicals
WO2001029212A1 (en) * 1999-10-19 2001-04-26 Enchira Biotechnology Corporation Methods for chimeragenesis of whole genomes or large polynucleotides
US6238884B1 (en) 1995-12-07 2001-05-29 Diversa Corporation End selection in directed evolution
US6242211B1 (en) 1996-04-24 2001-06-05 Terragen Discovery, Inc. Methods for generating and screening novel metabolic pathways
US6287862B1 (en) 1997-01-17 2001-09-11 Maxygen, Inc. Evolution of whole cells and organisms by recursive sequence recombination
US6303848B1 (en) 1998-01-16 2001-10-16 Large Scale Biology Corporation Method for conferring herbicide, pest, or disease resistance in plant hosts
US6319714B1 (en) 1999-01-19 2001-11-20 Maxygen, Inc. Oligonucleotide mediated nucleic acid recombination
US6337186B1 (en) 1998-06-17 2002-01-08 Maxygen, Inc. Method for producing polynucleotides with desired properties
WO2001029211A3 (en) * 1999-10-19 2002-01-24 Enchira Biotechnology Corp Method for directed evolution by random chimeragenesis on transient templates
US6352859B1 (en) 1997-01-17 2002-03-05 Maxygen, Inc. Evolution of whole cells and organisms by recursive sequence recombination
US6358712B1 (en) 1999-01-05 2002-03-19 Trustee Of Boston University Ordered gene assembly
US6358709B1 (en) 1995-12-07 2002-03-19 Diversa Corporation End selection in directed evolution
WO2001032712A3 (en) * 1999-11-03 2002-03-21 Maxygen Inc Antibody diversity generation
WO2001064864A3 (en) * 2000-02-28 2002-03-28 Maxygen Inc Single-stranded nucleic acid template-mediated recombination and nucleic acid fragment isolation
US6391640B1 (en) 1994-02-17 2002-05-21 Maxygen, Inc. Methods and compositions for cellular and metabolic engineering
US6399383B1 (en) 1997-10-28 2002-06-04 Maxygen, Inc. Human papilloma virus vectors
WO2001088173A3 (en) * 2000-05-16 2002-06-06 Hercules Inc Methods for the enzymatic assembly of polynucleotides and identification of polynucleotides having desired characteristics
US6420175B1 (en) 1994-02-17 2002-07-16 Maxygen, Inc. Methods for generating polynucleotides having desired characteristics by iterative selection and recombination
US6426185B1 (en) 1998-01-16 2002-07-30 Large Scale Biology Corporation Method of compiling a functional gene profile in a plant by transfecting a nucleic acid sequence of a donor plant into a different host plant in an anti-sense orientation
WO2002006469A3 (en) * 2000-07-18 2002-08-15 Enchira Biotechnology Corp Methods of ligation mediated chimeragenesis utilizing populations of scaffold and donor nucleic acids
US6436675B1 (en) 1999-09-28 2002-08-20 Maxygen, Inc. Use of codon-varied oligonucleotide synthesis for synthetic shuffling
WO2002004630A3 (en) * 2000-07-10 2002-08-29 Ambion Inc Methods for recombinatorial nucleic acid synthesis
US6468745B1 (en) 1998-01-16 2002-10-22 Large Scale Biology Corporation Method for expressing a library of nucleic acid sequence variants and selecting desired traits
US6483011B1 (en) 1998-11-10 2002-11-19 Maxygen, Inc. Modified ADP-glucose pyrophosphorylase for improvement and optimization of plant phenotypes
US6500617B1 (en) 1998-05-01 2002-12-31 Maxygen, Inc. Optimization of pest resistance genes using DNA shuffling
WO2002099080A3 (en) * 2001-06-05 2003-02-20 Gorilla Genomics Inc Methods for low background cloning of dna using long oligonucleotides
US6531316B1 (en) 1999-03-05 2003-03-11 Maxyag, Inc. Encryption of traits using split gene sequences and engineered genetic elements
US6596539B1 (en) 1997-10-31 2003-07-22 Maxygen, Inc. Modification of virus tropism and host range by viral genome shuffling
US6605449B1 (en) 1999-06-14 2003-08-12 Diversa Corporation Synthetic ligation reassembly in directed evolution
US6605430B1 (en) 1998-08-12 2003-08-12 Maxygen, Inc. DNA shuffling of monooxygenase genes for production of industrial chemicals
WO2003075129A2 (en) 2002-03-01 2003-09-12 Maxygen, Inc. Methods, systems, and software for identifying functional bio-molecules
WO2003078583A2 (en) 2002-03-09 2003-09-25 Maxygen, Inc. Optimization of crossover points for directed evolution
US6632673B1 (en) 1999-08-12 2003-10-14 Pfizer, Inc. Directing the ratio of B2:B1 avermectins in Streptomyces avermitilis host cells
EP1352959A1 (en) * 1997-01-24 2003-10-15 Bioinvent International AB A method for in vitro molecular evolution of protein function
WO2003010311A3 (en) * 2001-07-23 2003-12-11 Dsm Ip Assets Bv Process for preparing variant polynucleotides
US6686515B1 (en) 1999-11-23 2004-02-03 Maxygen, Inc. Homologous recombination in plants
WO2002090536A3 (en) * 2001-05-10 2004-03-04 Novozymes As A method for producing recombined polynucleotides
US6713279B1 (en) 1995-12-07 2004-03-30 Diversa Corporation Non-stochastic generation of genetic vaccines and enzymes
US6713281B2 (en) 1995-12-07 2004-03-30 Diversa Corporation Directed evolution of thermophilic enzymes
US6740506B2 (en) 1995-12-07 2004-05-25 Diversa Corporation End selection in directed evolution
US6759226B1 (en) 2000-05-24 2004-07-06 Third Wave Technologies, Inc. Enzymes for the detection of specific nucleic acid sequences
US6764835B2 (en) 1995-12-07 2004-07-20 Diversa Corporation Saturation mutageneis in directed evolution
WO2004090099A2 (en) 2003-04-04 2004-10-21 Diversa Corporation Pectate lyases, nucleic acids encoding them and methods for making and using them
US6858422B2 (en) 2000-07-13 2005-02-22 Codexis, Inc. Lipase genes
WO2005021714A2 (en) 2003-08-11 2005-03-10 Diversa Corporation Laccases, nucleic acids encoding them and methods for making and using them
EP1421203A4 (en) * 2001-05-17 2005-06-01 Diversa Corp NEW ANTIGEN-BINDING MOLECULES FOR THERAPEUTIC, DIAGNOSTIC, PROPHYLACTIC, ENZYMATIC, INDUSTRIAL AND AGRICULTURAL APPLICATIONS AND METHOD FOR THE PRODUCTION AND SCREENING THEREOF
US6902918B1 (en) 1998-05-21 2005-06-07 California Institute Of Technology Oxygenase enzymes and screening method
US6917882B2 (en) 1999-01-19 2005-07-12 Maxygen, Inc. Methods for making character strings, polynucleotides and polypeptides having desired characteristics
US6939689B2 (en) 1995-12-07 2005-09-06 Diversa Corporation Exonuclease-mediated nucleic acid reassembly in directed evolution
WO2005082077A2 (en) 2004-02-25 2005-09-09 Pioneer Hi-Bred International, Inc. Novel bacillus thuringiensis crystal polypeptides, polynucleotides, and compositions thereof
US6946296B2 (en) 1995-11-30 2005-09-20 Maxygen, Inc. Methods and compositions for polypeptide engineering
US6951719B1 (en) 1999-08-11 2005-10-04 Proteus S.A. Process for obtaining recombined nucleotide sequences in vitro, libraries of sequences and sequences thus obtained
US6958213B2 (en) 2000-12-12 2005-10-25 Alligator Bioscience Ab Method for in vitro molecular evolution of protein function
US6961664B2 (en) 1999-01-19 2005-11-01 Maxygen Methods of populating data structures for use in evolutionary simulations
AU2002254773B2 (en) * 2001-05-03 2005-12-08 Rensselaer Polytechnic Institute Novel methods of directed evolution
WO2005123929A2 (en) 2004-06-09 2005-12-29 Pioneer Hi-Bred International, Inc. Plastid transit peptides
WO2006009676A2 (en) 2004-06-16 2006-01-26 Diversa Corporation Compositions and methods for enzymatic decolorization of chlorophyll
US6991922B2 (en) 1998-08-12 2006-01-31 Proteus S.A. Process for in vitro creation of recombinant polynucleotide sequences by oriented ligation
US7024312B1 (en) 1999-01-19 2006-04-04 Maxygen, Inc. Methods for making character strings, polynucleotides and polypeptides having desired characteristics
US7045289B2 (en) 1991-09-09 2006-05-16 Third Wave Technologies, Inc. Detection of RNA Sequences
US7074590B2 (en) 2000-06-23 2006-07-11 Maxygen, Inc. Chimeric promoters
US7087415B2 (en) 2000-07-31 2006-08-08 Athena Biotechnologies, Inc. Methods and compositions for directed gene assembly
US7094875B2 (en) 2000-06-23 2006-08-22 Maxygen, Inc. Co-stimulatory polypeptides
US7105297B2 (en) 1994-02-17 2006-09-12 Maxygen, Inc. Methods and compositions for cellular and metabolic engineering
WO2006101584A2 (en) 2005-03-15 2006-09-28 Diversa Corporation Cellulases, nucleic acids encoding them and methods for making and using them
US7115712B1 (en) 1999-12-02 2006-10-03 Maxygen, Inc. Cytokine polypeptides
US7148054B2 (en) 1997-01-17 2006-12-12 Maxygen, Inc. Evolution of whole cells and organisms by recursive sequence recombination
US7150982B2 (en) 1991-09-09 2006-12-19 Third Wave Technologies, Inc. RNA detection assays
US7153655B2 (en) 1998-06-16 2006-12-26 Alligator Bioscience Ab Method for in vitro molecular evolution of protein function involving the use of exonuclease enzyme and two populations of parent polynucleotide sequence
US7166466B2 (en) 1997-12-08 2007-01-23 California Institute Of Technology Method for creating polynucleotide and polypeptide sequences
US20070037254A1 (en) * 1999-07-12 2007-02-15 Genentech, Inc. Expression Vectors and Methods
US7226768B2 (en) 2001-07-20 2007-06-05 The California Institute Of Technology Cytochrome P450 oxygenases
WO2007095398A2 (en) 2006-02-14 2007-08-23 Verenium Corporation Xylanases, nucleic acids encoding them and methods for making and using them
US7262042B2 (en) 2001-12-20 2007-08-28 Henkel Kommanditgesellschaft Auf Aktien (Henkel Kgaa) Alkaline protease from Bacillus gibsonii (DSM 14393) and washing and cleaning products comprising said alkaline protease
US7262012B2 (en) 2002-05-17 2007-08-28 Alligator Bioscience Ab Method for in vitro molecular evolution of protein function using varied exonuclease digestion in two polynucleotide populations
EP1073710A4 (en) * 1999-02-04 2007-12-19 Verenium Corp NON-STOCHASTIC DEVELOPMENT OF GENETIC VACCINES AND ENZYMES
WO2008036863A2 (en) 2006-09-21 2008-03-27 Verenium Corporation Phospholipases, nucleic acids encoding them and methods for making and using them
US7354734B2 (en) 2003-08-25 2008-04-08 Funzyme Biotechnologies Sa Fungal proteins and nucleic acids encoding same
US7384387B1 (en) 1999-02-11 2008-06-10 Maxygen, Inc. High throughput mass spectrometry
US7390619B1 (en) 1998-02-11 2008-06-24 Maxygen, Inc. Optimization of immunomodulatory properties of genetic vaccines
WO2008080093A2 (en) 2006-12-21 2008-07-03 Verenium Corporation Amylases and glucoamylases, nucleic acids encoding them and methods for making and using them
DE102007003143A1 (de) 2007-01-16 2008-07-17 Henkel Kgaa Neue Alkalische Protease aus Bacillus gibsonii und Wasch- und Reinigungsmittel enthaltend diese neue Alkalische Protease
WO2008095033A2 (en) 2007-01-30 2008-08-07 Verenium Corporation Enzymes for the treatment of lignocellulosics, nucleic acids encoding them and methods for making and using them
WO2008098198A2 (en) 2007-02-08 2008-08-14 The California Institute Of Technology Alkane oxidation by modified hydroxylases
WO2008103248A1 (en) 2007-02-08 2008-08-28 Codexis, Inc. Ketoreductases and uses thereof
WO2008105797A2 (en) 2006-06-30 2008-09-04 Bristol-Myers Squibb Company Polynucleotides encoding novel pcsk9 variants
US7430477B2 (en) 1999-10-12 2008-09-30 Maxygen, Inc. Methods of populating data structures for use in evolutionary simulations
US7435570B2 (en) 2003-08-11 2008-10-14 California Institute Of Technology Thermostable peroxide-driven cytochrome P450 oxygenase variants and methods of use
US7439021B2 (en) 1999-01-05 2008-10-21 Trustees Of Boston University Nucleic acid cloning
EP1558748A4 (en) * 2002-11-01 2008-10-22 Promega Corp CELL SYSE COMPOSITIONS, USE METHOD, DEVICE AND KIT
US7449187B2 (en) 2001-12-20 2008-11-11 Henkel Kommanditgesellschaft Auf Aktien (Henkel Kgaa) Alkaline protease from Bacillus gibsonii (DSM 14391) and washing and cleaning products comprising said alkaline protease
US7462469B2 (en) 2000-01-11 2008-12-09 Maxygen, Inc. Integrated system for diversity generation and screening
US7465567B2 (en) 2001-04-16 2008-12-16 California Institute Of Technology Peroxide-driven cytochrome P450 oxygenase variants
WO2009029554A2 (en) 2007-08-24 2009-03-05 Codexis, Inc. Improved ketoreductase polypeptides for the stereoselective production of (r)-3-hydroxythiolane
WO2009045627A2 (en) 2007-10-03 2009-04-09 Verenium Corporation Xylanases, nucleic acids encoding them and methods for making and using them
US7524664B2 (en) 2003-06-17 2009-04-28 California Institute Of Technology Regio- and enantioselective alkane hydroxylation with modified cytochrome P450
DE102007051092A1 (de) 2007-10-24 2009-04-30 Henkel Ag & Co. Kgaa Subtilisin aus Becillus pumilus und Wasch- und Reinigungsmittel enthaltend dieses neue Subtilisin
WO2009058564A2 (en) 2007-11-01 2009-05-07 Maxygen, Inc. Immunosuppressive polypeptides and nucleic acids
WO2009088949A1 (en) 2008-01-03 2009-07-16 Verenium Corporation Transferases and oxidoreductases, nucleic acids encoding them and methods for making and using them
US7569226B2 (en) 2001-12-22 2009-08-04 Henkel Kommanditgesellschaft Auf Aktien (Henkel Kgaa) Alkaline protease from Bacillus sp. (DSM 14392) and washing and cleaning products comprising said alkaline protease
EP2112227A1 (en) 2006-03-07 2009-10-28 Cargill, Incorporated Aldolases, nucleic acids encoding them and methods for making and using them
WO2009152336A1 (en) 2008-06-13 2009-12-17 Codexis, Inc. Method of synthesizing polynucleotide variants
WO2010025238A2 (en) 2008-08-27 2010-03-04 Codexis, Inc. Ketoreductase polypeptides for the production of a 3-aryl-3-hydroxypropanamine from a 3-aryl-3-ketopropanamine
WO2010025395A2 (en) 2008-08-29 2010-03-04 Verenium Corporation Hydrolases, nucleic acids encoding them and methods for making and using them
EP2194133A2 (en) 2003-03-06 2010-06-09 Verenium Corporation Amylases, nucleic acids encoding them and methods for making and using them
WO2010081053A2 (en) 2009-01-08 2010-07-15 Codexis, Inc. Transaminase polypeptides
EP2216403A2 (en) 2006-02-02 2010-08-11 Verenium Corporation Esterases and related nucleic acids and methods
US7795030B2 (en) 1994-02-17 2010-09-14 Maxygen, Inc. Methods and compositions for cellular and metabolic engineering
WO2010107644A2 (en) 2009-03-17 2010-09-23 Codexis, Inc. Variant endoglucanases and related polynucleotides
WO2010120557A1 (en) 2009-03-31 2010-10-21 Codexis, Inc. Improved endoglucanases
WO2010135588A2 (en) 2009-05-21 2010-11-25 Verenium Corporation Phytases, nucleic acids encoding them and methods for making and using them
WO2010144103A1 (en) 2009-06-11 2010-12-16 Codexis, Inc. Combined automated parallel synthesis of polynucleotide variants
WO2010148128A1 (en) 2009-06-16 2010-12-23 Codexis, Inc. Beta-glucosidase variant enzymes and related polynucleotides
WO2011005527A2 (en) 2009-06-22 2011-01-13 Codexis, Inc. Ketoreductase-mediated stereoselective route to alpha chloroalcohols
EP2275536A1 (en) 2002-08-06 2011-01-19 Verdia, Inc. AP1 amine oxidase variants
WO2011022597A1 (en) 2009-08-20 2011-02-24 Pioneer Hi-Bred International, Inc. Functional expression of shuffled yeast nitrate transporter (ynti) in maize to improve nitrate uptake under low nitrate environment
WO2011022548A2 (en) 2009-08-19 2011-02-24 Codexis, Inc. Ketoreductase polypeptides for the preparation of phenylephrine
WO2011028708A1 (en) 2009-09-04 2011-03-10 Codexis, Inc. Variant cbh2 cellulases and related polynucleotides
EP2298871A1 (en) 2002-04-19 2011-03-23 Verenium Corporation Phospholipases, nucleic acids encoding them and methods for making and using them
WO2011046815A1 (en) 2009-10-16 2011-04-21 Bunge Oils, Inc. Oil degumming methods
WO2011046812A1 (en) 2009-10-16 2011-04-21 Verenium Corporation Phospholipases, nucleic acids encoding them and methods for making and using them
EP2322629A2 (en) 2003-04-29 2011-05-18 Pioneer Hi-Bred International Inc. Novel glyphosate-n-acetyltransferase (GAT) genes
WO2011066187A1 (en) 2009-11-25 2011-06-03 Codexis, Inc. Recombinant thermoascus aurantiacus beta-glucosidase variants for production of fermentable sugars from cellulosic biomass
WO2011071982A2 (en) 2009-12-08 2011-06-16 Codexis, Inc. Synthesis of prazole compounds
WO2011082304A1 (en) 2009-12-31 2011-07-07 Pioneer Hi-Bred International, Inc. Engineering plant resistance to diseases caused by pathogens
US8026085B2 (en) 2006-08-04 2011-09-27 California Institute Of Technology Methods and systems for selective fluorination of organic molecules
EP2385108A1 (en) 2006-03-07 2011-11-09 Verenium Corporation Aldolases, nucleic acids encoding them and methods for making and using them
WO2011140219A1 (en) 2010-05-04 2011-11-10 Codexis, Inc. Biocatalysts for ezetimibe synthesis
WO2011143274A1 (en) 2010-05-10 2011-11-17 Perseid Therapeutics Polypeptide inhibitors of vla4
EP2397486A1 (en) 2006-09-21 2011-12-21 Verenium Corporation Phytases, nucleic acids encoding them and methods for making and using them
WO2011159910A2 (en) 2010-06-17 2011-12-22 Codexis, Inc. Biocatalysts and methods for the synthesis of (s)-3-(1-aminoethyl)-phenol
WO2012003299A2 (en) 2010-06-30 2012-01-05 Codexis, Inc. Highly stable beta-class carbonic anhydrases useful in carbon capture systems
EP2404930A1 (en) 2003-07-02 2012-01-11 Verenium Corporation Glucanases, nucleic acids encoding them and methods for making and using them
WO2012006114A2 (en) 2010-06-28 2012-01-12 Codexis, Inc. Fatty alcohol forming acyl reductases (fars) and methods of use thereof
EP2415864A1 (en) 2006-02-10 2012-02-08 Verenium Corporation Oligomerase-2 (or beta-xylosidase) enzymes, nucleic acids encoding them and methods for making and using them
WO2012021785A1 (en) 2010-08-13 2012-02-16 Pioneer Hi-Bred International, Inc. Compositions and methods comprising sequences having hydroxyphenylpyruvate dioxygenase (hppd) activity
WO2012024698A1 (en) 2010-08-20 2012-02-23 Codexis, Inc. Use of glycoside hydrolase 61 family proteins in processing of cellulose
EP2444413A1 (en) 2006-08-04 2012-04-25 Verenium Corporation Methods for oil or gas well drilling, washing and/or fracturing
US8178333B2 (en) 2008-06-24 2012-05-15 Codexis, Inc. Biocatalytic processes for the preparation of substantially stereomerically pure fused bicyclic proline compounds
WO2012078800A2 (en) 2010-12-08 2012-06-14 Codexis, Inc. Biocatalysts and methods for the synthesis of armodafinil
US8252559B2 (en) 2006-08-04 2012-08-28 The California Institute Of Technology Methods and systems for selective fluorination of organic molecules
US8273554B2 (en) 2008-08-29 2012-09-25 Codexis, Inc. Ketoreductase polypeptides for the stereoselective production of (4S)-3-[(5S)-5-(4-fluorophenyl)-5-hydroxypentanoyl]-4-phenyl-1,3-oxazolidin-2-one
US8288131B2 (en) 2008-08-27 2012-10-16 Codexis, Inc. Ketoreductase polypeptides and uses thereof
US8288141B2 (en) 2008-08-27 2012-10-16 Codexis, Inc. Ketoreductase polypeptides for the production of 3-aryl-3-hydroxypropanamine from a 3-aryl-3-ketopropanamine
WO2012142302A2 (en) 2011-04-13 2012-10-18 Codexis, Inc. Biocatalytic process for preparing eslicarbazepine and analogs thereof
EP2559702A1 (en) 2007-02-08 2013-02-20 Domantis Limited Antibody single variable domains against serum albumin
US8383346B2 (en) 2008-06-13 2013-02-26 Codexis, Inc. Combined automated parallel synthesis of polynucleotide variants
WO2013028701A1 (en) 2011-08-22 2013-02-28 Codexis, Inc. Gh61 glycoside hydrolase protein variants and cofactors that enhance gh61 activity
WO2013036861A1 (en) 2011-09-08 2013-03-14 Codexis, Inc Biocatalysts and methods for the synthesis of substituted lactams
WO2013074650A1 (en) 2011-11-18 2013-05-23 Codexis, Inc. Biocatalysts for the preparation of hydroxy substituted carbamates
US8504498B2 (en) 2008-02-12 2013-08-06 Codexis, Inc. Method of generating an optimized, diverse population of variants
AU2009212959B2 (en) * 1999-06-14 2013-08-15 Bp Corporation North America Inc. Synthetic ligation reassembly in directed evolution
WO2013142770A1 (en) 2012-03-23 2013-09-26 Codexis, Inc. Biocatalysts and methods for synthesizing derivatives of tryptamine and tryptamine analogs
WO2013166113A1 (en) 2012-05-04 2013-11-07 E. I. Du Pont De Nemours And Company Compositions and methods comprising sequences having meganuclease activity
WO2013169725A2 (en) 2012-05-08 2013-11-14 Codexis, Inc. Biocatalysts and methods for hydroxylation of chemical compounds
WO2013170050A1 (en) 2012-05-11 2013-11-14 Codexis, Inc. Engineered imine reductases and methods for the reductive amination of ketone and amine compounds
US8603949B2 (en) 2003-06-17 2013-12-10 California Institute Of Technology Libraries of optimized cytochrome P450 enzymes and the optimized P450 enzymes
WO2013188305A2 (en) 2012-06-11 2013-12-19 Codexis, Inc. Fungal beta-xylosidase variants
US8614081B2 (en) 2009-07-23 2013-12-24 Codexis, Inc. Nitrilase biocatalysts
EP2706119A1 (en) 2009-11-25 2014-03-12 Codexis, Inc. Recombinant beta-glucosidase variants for production of soluble sugars from cellulosic biomass
EP2706122A2 (en) 2008-01-03 2014-03-12 Verenium Corporation Isomerases, nucleic acids encoding them and methods for making and using them
US8709415B2 (en) 2006-01-12 2014-04-29 Alexion Pharmaceuticals, Inc. Antibodies to OX-2/CD200 and uses thereof
US8715962B2 (en) 2010-03-31 2014-05-06 Codexis, Inc. Production of geranyl diphosphate
US8715996B2 (en) 2009-02-26 2014-05-06 Codexis, Inc. Beta-glucosidase variant enzymes and related polynucleotides
WO2014099730A1 (en) 2012-12-21 2014-06-26 Codexis, Inc. Engineered biocatalysts and methods for synthesizing chiral amines
US8768871B2 (en) 2008-02-12 2014-07-01 Codexis, Inc. Method of generating an optimized, diverse population of variants
US8778652B2 (en) 2011-06-30 2014-07-15 Codexis, Inc. Pentose fermentation by a recombinant microorganism
WO2014113521A1 (en) 2013-01-18 2014-07-24 Codexis, Inc. Engineered biocatalysts useful for carbapenem synthesis
WO2014120821A1 (en) 2013-01-31 2014-08-07 Codexis, Inc. Methods, systems, and software for identifying bio-molecules using models of multiplicative form
WO2014133960A1 (en) 2013-02-28 2014-09-04 Codexis, Inc. Engineered transaminase polypeptides for industrial biocatalysis
US8840885B2 (en) 2000-12-08 2014-09-23 Alexion Pharmaceuticals, Inc. Methods for treating chronic lymphocytic leukemia
WO2014153234A1 (en) 2013-03-14 2014-09-25 Pioneer Hi-Bred International, Inc. Compositions having dicamba decarboxylase activity and methods of use
WO2014150914A2 (en) 2013-03-15 2014-09-25 Pioneer Hi-Bred International, Inc. Phi-4 polypeptides and methods for their use
WO2014153242A1 (en) 2013-03-14 2014-09-25 Pioneer Hi-Bred International, Inc. Compositions having dicamba decarboxylase activity and methods of use
WO2014172541A2 (en) 2013-04-18 2014-10-23 Codexis, Inc. Engineered phenylalanine ammonia lyase polypeptides
WO2015023846A2 (en) 2013-08-16 2015-02-19 Pioneer Hi-Bred International, Inc. Insecticidal proteins and methods for their use
WO2015038734A2 (en) 2013-09-13 2015-03-19 Pioneer Hi-Bred International, Inc. Insecticidal proteins and methods for their use
US8986684B2 (en) 2007-07-25 2015-03-24 Alexion Pharmaceuticals, Inc. Methods and compositions for treating autoimmune disease
EP2853593A1 (en) 2003-03-07 2015-04-01 DSM IP Assets B.V. Hydrolases, nucleic acids encoding them and mehods for making and using them
US8999328B2 (en) 2000-12-08 2015-04-07 Alexion Pharmaceuticals, Inc. Polypeptides and antibodies derived from chronic lymphocytic Leukemia cells and uses thereof
US9006460B2 (en) 2010-08-16 2015-04-14 Cardiome International Ag Process for preparing aminocyclohexyl ether compounds
WO2015073555A1 (en) 2013-11-13 2015-05-21 Codexis, Inc. Engineered imine reductases and methods for the reductive amination of ketone and amine compounds
EP2886658A1 (en) 2005-03-10 2015-06-24 BASF Enzymes LLC Lyase enzymes, nucleic acids encoding them and methods for making and using them
US9080192B2 (en) 2010-02-10 2015-07-14 Codexis, Inc. Processes using amino acid dehydrogenases and ketoreductase-based cofactor regenerating system
WO2015120276A1 (en) 2014-02-07 2015-08-13 Pioneer Hi Bred International Inc Insecticidal proteins and methods for their use
WO2015120270A1 (en) 2014-02-07 2015-08-13 Pioneer Hi Bred International, Inc. Insecticidal proteins and methods for their use
CN104955961A (zh) * 2012-12-11 2015-09-30 塞勒密斯株式会社 利用密码子随机化和诱变来合成基因文库的方法
US9150661B2 (en) 2000-12-08 2015-10-06 Alexion Pharmaceuticals, Inc. Polypeptides and antibodies derived from chronic lymphocytic leukemia cells and uses thereof
WO2015161019A1 (en) 2014-04-16 2015-10-22 Codexis, Inc. Engineered tyrosine ammonia lyase
US9169468B2 (en) 2011-03-30 2015-10-27 Codexis, Inc. Pentose fermentation by a recombinant microorganism
WO2016061206A1 (en) 2014-10-16 2016-04-21 Pioneer Hi-Bred International, Inc. Insecticidal proteins and methods for their use
US9322007B2 (en) 2011-07-22 2016-04-26 The California Institute Of Technology Stable fungal Cel6 enzyme variants
US9322027B2 (en) 2010-08-20 2016-04-26 Shell Oil Company Expression constructs comprising fungal promoters
WO2016085916A1 (en) 2014-11-25 2016-06-02 Codexis, Inc. Engineered imine reductases and methods for the reductive amination of ketone and amine compounds
WO2016105889A1 (en) 2014-12-22 2016-06-30 Codexis, Inc. Human alpha-galactosidase variants
WO2016114973A1 (en) 2015-01-15 2016-07-21 Pioneer Hi Bred International, Inc Insecticidal proteins and methods for their use
WO2016130412A1 (en) 2015-02-10 2016-08-18 Codexis, Inc. Ketoreductase polypeptides for the synthesis of chiral compounds
US9434919B2 (en) 2011-09-30 2016-09-06 Codexis, Inc. Fungal proteases
WO2016144688A1 (en) 2015-03-11 2016-09-15 Pioneer Hi Bred International Inc Insecticidal combinations of pip-72 and methods of use
WO2016179464A1 (en) 2015-05-07 2016-11-10 Codexis, Inc. Penicillin-g acylases
WO2016186986A1 (en) 2015-05-19 2016-11-24 Pioneer Hi Bred International Inc Insecticidal proteins and methods for their use
EP3115459A2 (en) 2008-05-23 2017-01-11 E. I. du Pont de Nemours and Company Novel dgat genes for increased seed storage lipid production and altered fatty acid profiles in oilseed plants
WO2017007547A1 (en) 2015-07-07 2017-01-12 Codexis, Inc. Novel p450-bm3 variants with improved activity
WO2017023486A1 (en) 2015-08-06 2017-02-09 Pioneer Hi-Bred International, Inc. Plant derived insecticidal proteins and methods for their use
US9611515B2 (en) 2012-11-20 2017-04-04 Codexis, Inc. Pentose fermentation by a recombinant microorganism
US9611462B2 (en) 2011-12-20 2017-04-04 Codexis, Inc. Endoglucanase 1B (EG1B) variants
WO2017105987A1 (en) 2015-12-18 2017-06-22 Pioneer Hi-Bred International, Inc. Insecticidal proteins and methods for their use
EP3190182A1 (en) 2004-03-08 2017-07-12 DSM IP Assets B.V. Phospholipases, nucleic acids encoding them and methods for making and using them
US9708587B2 (en) 2014-07-09 2017-07-18 Codexis, Inc. P450-BM3 variants with improved activity
US9752171B2 (en) 2010-05-28 2017-09-05 Codexis, Inc. Pentose fermentation by a recombinant microorganism
WO2017193022A1 (en) 2016-05-05 2017-11-09 Codexis, Inc. Penicillin-g acylases
WO2017192560A1 (en) 2016-05-04 2017-11-09 Pioneer Hi-Bred International, Inc. Insecticidal proteins and methods for their use
WO2017213758A1 (en) 2016-06-09 2017-12-14 Codexis, Inc. Biocatalysts and methods for hydroxylation of chemical compounds
WO2018005411A1 (en) 2016-07-01 2018-01-04 Pioneer Hi-Bred International, Inc. Insecticidal proteins from plants and methods for their use
WO2018038906A1 (en) 2016-08-26 2018-03-01 Codexis, Inc. Engineered imine reductases and methods for the reductive amination of ketone and amine compounds
EP3301208A1 (en) 2009-09-18 2018-04-04 Codexis, Inc. Reduced codon mutagenesis
WO2018084936A1 (en) 2016-11-01 2018-05-11 Pioneer Hi-Bred International, Inc. Insecticidal proteins and methods for their use
WO2018111551A1 (en) 2016-12-14 2018-06-21 Pioneer Hi-Bred International, Inc. Insecticidal proteins and methods for their use
WO2018118811A1 (en) 2016-12-22 2018-06-28 Pioneer Hi-Bred International, Inc. Insecticidal proteins and methods for their use
WO2018144679A2 (en) 2017-02-03 2018-08-09 Codexis, Inc. Engineered glycosyltransferases and steviol glycoside glucosylation methods
WO2018148001A1 (en) 2017-02-08 2018-08-16 Pioneer Hi-Bred International Inc Insecticidal combinations of plant derived insecticidal proteins and methods for their use
WO2018200214A2 (en) 2017-04-27 2018-11-01 Codexis, Inc. Ketoreductase polypeptides and polynucleotides
WO2018208882A1 (en) 2017-05-11 2018-11-15 Pioneer Hi-Bred International, Inc. Insecticidal proteins and methods for their use
WO2018208665A1 (en) 2017-05-08 2018-11-15 Codexis, Inc. Engineered ligase variants
EP3406594A1 (en) 2012-12-07 2018-11-28 Merck Sharp & Dohme Corp. Biocatalytic transamination process
EP3418929A1 (en) 2013-09-27 2018-12-26 Codexis, Inc. Automated screening of enzyme variants
WO2019005337A1 (en) 2017-06-27 2019-01-03 Codexis, Inc. PENICILLIN G ACYLASES
WO2019040335A1 (en) 2017-08-19 2019-02-28 University Of Rochester MICHELOLID DERIVATIVES, PREPARATION METHODS AND THEIR USE AS ANTICANCER AND ANTI-INFLAMMATORY AGENTS
EP3450549A1 (en) 2012-10-29 2019-03-06 University Of Rochester Artemisinin derivatives, methods for their preparation and their use as antimalarial agents
EP3460061A1 (en) 2008-09-26 2019-03-27 Tocagen Inc. Recombinant replication competent murine leukemia gamma-retrovirus (mlv) for the expression of heat-stabilized cytosine deaminase
WO2019116311A1 (en) 2017-12-13 2019-06-20 Glaxosmithkline Intellectual Property Development Limited Carboxyesterase biocatalysts
WO2019178038A1 (en) 2018-03-14 2019-09-19 Pioneer Hi-Bred International, Inc. Insecticidal proteins from plants and methods for their use
WO2019178042A1 (en) 2018-03-14 2019-09-19 Pioneer Hi-Bred International, Inc. Insecticidal proteins from plants and methods for their use
EP3565893A1 (en) 2017-01-05 2019-11-13 Codexis, Inc. Penicillin-g acylases
WO2020014047A1 (en) 2018-07-09 2020-01-16 Codexis, Inc. Engineered purine nucleoside phosphorylase variant enzymes
WO2020014050A1 (en) 2018-07-09 2020-01-16 Codexis, Inc. Engineered pantothenate kinase variant enzymes
WO2020028039A1 (en) 2018-07-30 2020-02-06 Codexis, Inc. Engineered glycosyltransferases and steviol glycoside glucosylation methods
EP3638688A1 (en) 2017-06-14 2020-04-22 Codexis, Inc. Engineered transaminase polypeptides for industrial biocatalysis
EP3645711A1 (en) 2017-06-30 2020-05-06 Codexis, Inc. T7 rna polymerase variants
WO2020132252A2 (en) 2018-12-20 2020-06-25 Codexis, Inc. Human alpha-galactosidase variants
US10738286B2 (en) 2017-06-30 2020-08-11 Codexis, Inc. T7 RNA polymerase variants
EP3724325A1 (en) 2017-12-13 2020-10-21 Codexis, Inc. Carboxyesterase polypeptides for amide coupling
US10900055B2 (en) 2018-06-12 2021-01-26 Codexis, Inc. Engineered tyrosine ammonia lyase
WO2021067608A1 (en) 2019-10-02 2021-04-08 Abbott Laboratories Detection of analytes by protein switches
US10995329B2 (en) 2017-02-13 2021-05-04 Codexis, Inc. Engineered phenylalanine ammonia lyase polypeptides
US11034948B2 (en) 2018-07-09 2021-06-15 Codexis, Inc. Engineered phosphopentomutase variant enzymes
US11060075B2 (en) 2018-10-29 2021-07-13 Codexis, Inc. Engineered DNA polymerase variants
WO2021142393A1 (en) 2020-01-10 2021-07-15 The Regents Of The University Of California Biosynthetic platform for the production of olivetolic avid and analogues of olivetolic acid
US11161834B2 (en) 2017-04-24 2021-11-02 Tesaro, Inc. Methods of manufacturing of niraparib
US11198861B2 (en) 2018-07-12 2021-12-14 Codexis, Inc. Engineered phenylalanine ammonia lyase polypeptides
US11214817B2 (en) 2005-03-28 2022-01-04 California Institute Of Technology Alkane oxidation by modified hydroxylases
WO2022015619A2 (en) 2020-07-14 2022-01-20 Pioneer Hi-Bred International, Inc. Insecticidal proteins and methods for their use
US11274286B2 (en) 2018-07-09 2022-03-15 Codexis, Inc. Engineered deoxyribose-phosphate aldolases
US11299723B2 (en) 2016-06-15 2022-04-12 Codexis, Inc. Engineered beta-glucosidases and glucosylation methods
US11319531B2 (en) 2017-11-07 2022-05-03 Codexis, Inc. Transglutaminase variants
WO2022125960A1 (en) 2020-12-11 2022-06-16 Willow Biosciences, Inc. Recombinant acyl activating enzyme (aae) genes for enhanced biosynthesis of cannabinoids and cannabinoid precursors
WO2022212832A1 (en) 2021-04-02 2022-10-06 Codexis, Inc. Engineered cyclic gmp-amp synthase (cgas) variant enzymes
WO2022212835A1 (en) 2021-04-02 2022-10-06 Codexis, Inc. Engineered acetate kinase variant enzymes
WO2022212828A1 (en) 2021-04-02 2022-10-06 Codexis, Inc. Engineered guanylate kinase variant enzymes
WO2022212824A1 (en) 2021-04-02 2022-10-06 Codexis, Inc. Engineered adenylate kinase variant enzymes
US11466259B2 (en) 2018-07-09 2022-10-11 Codexis, Inc. Engineered galactose oxidase variant enzymes
US11473077B2 (en) 2018-12-14 2022-10-18 Codexis, Inc. Engineered tyrosine ammonia lyase
EP4122945A1 (en) 2013-12-23 2023-01-25 University of Rochester Methods and compositions for ribosomal synthesis of macrocyclic peptides
WO2023010083A2 (en) 2021-07-30 2023-02-02 Willow Biosciences, Inc. Recombinant prenyltransferase polypeptides engineered for enhanced biosynthesis of cannabinoids
WO2023023621A1 (en) 2021-08-19 2023-02-23 Willow Biosciences, Inc. Recombinant olivetolic acid cyclase polypeptides engineered for enhanced biosynthesis of cannabinoids
WO2023069921A1 (en) 2021-10-19 2023-04-27 Epimeron Usa, Inc. Recombinant thca synthase polypeptides engineered for enhanced biosynthesis of cannabinoids
WO2023173084A1 (en) 2022-03-11 2023-09-14 University Of Rochester Cyclopeptibodies and uses thereof
US11761963B2 (en) 2017-09-27 2023-09-19 Alexion Pharmaceuticals, Inc. Biomarker signature for predicting tumor response to anti-CD200 therapy
US11767519B2 (en) 2020-08-28 2023-09-26 Codexis, Inc. Engineered amylase variants
US11788071B2 (en) 2020-04-10 2023-10-17 Codexis, Inc. Engineered transaminase polypeptides
US11898174B2 (en) 2020-12-18 2024-02-13 Codexis, Inc. Engineered uridine phosphorylase variant enzymes
WO2024040020A1 (en) 2022-08-15 2024-02-22 Absci Corporation Quantitative affinity activity specific cell enrichment
US11959108B2 (en) 2020-08-28 2024-04-16 Codexis, Inc. Engineered protease variants
US11970722B2 (en) 2019-12-20 2024-04-30 Codexis, Inc. Engineered acid alpha-glucosidase variants
US11987823B2 (en) 2019-08-30 2024-05-21 Societe Des Produits Nestle S.A. Engineered lipase variants
US12012620B2 (en) 2019-09-12 2024-06-18 Codexis, Inc. Peroxidase activity towards 10-acetyl-3,7-dihydroxyphenoxazine
WO2024150146A1 (en) 2023-01-12 2024-07-18 Novartis Ag Engineered ketoreductase polypeptides
US12110521B2 (en) 2021-05-21 2024-10-08 Syntis Bio, Inc. Engineered methionine gamma lyase variants
US12129495B2 (en) 2021-10-15 2024-10-29 Codexis, Inc. Engineered DNA polymerase variants
DE112023000593T5 (de) 2022-03-31 2024-11-14 Qingdao Kingagroot Chemical Compound Co., Ltd. Monoaminoxidase und deren anwendung
US12215368B2 (en) 2019-05-01 2025-02-04 Codexis, Inc. Engineered imine reductases and methods for the reductive amination of ketone and amine compounds
US12215359B2 (en) 2019-05-01 2025-02-04 Codexis, Inc. Engineered glucose dehydrogenases and methods for the reductive amination of ketone and amine compounds
US12241100B2 (en) 2020-02-04 2025-03-04 Syntis Bio, Inc. Engineered leucine decarboxylases
WO2025061911A1 (en) 2023-09-22 2025-03-27 Glaxosmithkline Intellectual Property Development Limited Methods of producing nucleotide triphosphates (ntps)
US12275962B2 (en) 2019-07-02 2025-04-15 Codexis, Inc. Engineered acetate kinase variant enzymes
US12344865B2 (en) 2019-11-26 2025-07-01 Codexis, Inc. Biocatalysts and methods for hydroxylation of chemical compounds
WO2025144700A1 (en) 2023-12-27 2025-07-03 Absci Corporation Nanobody library screening using bacterial surface display
WO2025235589A1 (en) 2024-05-08 2025-11-13 Codexis, Inc. Dna polymerase variants
US12480104B2 (en) 2019-07-02 2025-11-25 Codexis, Inc. Engineered sucrose phosphorylase variant enzymes
WO2025242702A1 (en) 2024-05-23 2025-11-27 Glaxosmithkline Intellectual Property Development Limited Enzymatic process for producing n-acetyl galactosamine clusters
US12503688B2 (en) 2019-01-15 2025-12-23 Codexis, Inc. Engineered transaminase polypeptides
US12502421B2 (en) 2021-11-01 2025-12-23 Syntis Bio, Inc. Engineered leucine decarboxylases
US12565641B2 (en) 2021-10-15 2026-03-03 Codexis, Inc. Engineered terminal deoxynucleotidyl transferase variants
US12612605B2 (en) 2021-04-06 2026-04-28 Codexis, Inc. Carboxyesterase polypeptides for kinetic resolution

Families Citing this family (161)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6406855B1 (en) 1994-02-17 2002-06-18 Maxygen, Inc. Methods and compositions for polypeptide engineering
GB9722131D0 (en) * 1997-10-20 1997-12-17 Medical Res Council Method
US6759243B2 (en) * 1998-01-20 2004-07-06 Board Of Trustees Of The University Of Illinois High affinity TCR proteins and methods
EP1965213A3 (en) 1998-02-04 2009-07-15 Invitrogen Corporation Microarrays and uses therefor
ATE282717T1 (de) * 1998-04-30 2004-12-15 Max Planck Gesellschaft Neuartiges verfahren zur identifizierung von klonen mit einer gewünschten biologischen eigenschaft, ausgehend von einer expressionsgenbank
US6846655B1 (en) 1998-06-29 2005-01-25 Phylos, Inc. Methods for generating highly diverse libraries
US20030104417A1 (en) * 1998-08-12 2003-06-05 Proteus S.A. Template-mediated, ligation-oriented method of nonrandomly shuffling polynucleotides
US20030092023A1 (en) * 1998-08-12 2003-05-15 Daniel Dupret Method of shuffling polynucleotides using templates
US20040191772A1 (en) * 1998-08-12 2004-09-30 Dupret Daniel Marc Method of shuffling polynucleotides using templates
US20040005673A1 (en) * 2001-06-29 2004-01-08 Kevin Jarrell System for manipulating nucleic acids
WO2000042559A1 (en) * 1999-01-18 2000-07-20 Maxygen, Inc. Methods of populating data structures for use in evolutionary simulations
US20030054390A1 (en) * 1999-01-19 2003-03-20 Maxygen, Inc. Oligonucleotide mediated nucleic acid recombination
US20070065838A1 (en) * 1999-01-19 2007-03-22 Maxygen, Inc. Oligonucleotide mediated nucleic acid recombination
US20090130718A1 (en) * 1999-02-04 2009-05-21 Diversa Corporation Gene site saturation mutagenesis
ATE423845T1 (de) * 1999-03-18 2009-03-15 Complete Genomics As Methoden zur klonierung und herstelung von kettenfragmenten mit lesbarem inhalt an information
US20040002474A1 (en) * 1999-10-07 2004-01-01 Maxygen Inc. IFN-alpha homologues
CA2395715A1 (en) * 1999-12-27 2001-07-05 Atsushi Sato Cytokine-like peptide
CA2408291C (en) 2000-05-04 2014-07-15 Yale University High density protein arrays for screening of protein activity
US7846733B2 (en) * 2000-06-26 2010-12-07 Nugen Technologies, Inc. Methods and compositions for transcription-based nucleic acid amplification
US7435562B2 (en) * 2000-07-21 2008-10-14 Modular Genetics, Inc. Modular vector systems
US20030017552A1 (en) * 2000-07-21 2003-01-23 Jarrell Kevin A. Modular vector systems
AUPQ974900A0 (en) * 2000-08-29 2000-09-21 Macquarie Research Limited Degenerate oligonucleotide gene-shuffling
WO2002048402A2 (en) 2000-12-13 2002-06-20 Nugen Technologies, Inc. Methods and compositions for generation of multiple copies of nucleic acid sequences and methods of detection thereof
US20020086292A1 (en) * 2000-12-22 2002-07-04 Shigeaki Harayama Synthesis of hybrid polynucleotide molecules using single-stranded polynucleotide molecules
US20030036641A1 (en) * 2001-01-31 2003-02-20 Padgett Hal S. Methods for homology-driven reassembly of nucleic acid sequences
US20110111413A1 (en) * 2001-02-02 2011-05-12 Padgett Hal S Method of optimizing codon usage through dna shuffling
AU2002258480B2 (en) * 2001-03-07 2007-03-15 Xenogen Corporation Methods of screening for introduction of DNA into a target cell
JP4542312B2 (ja) 2001-03-09 2010-09-15 ニューゲン テクノロジーズ, インコーポレイテッド Rna配列の増幅のための方法および組成物
US7807408B2 (en) * 2001-03-19 2010-10-05 President & Fellows Of Harvard College Directed evolution of proteins
AU2002257076A1 (en) 2001-03-19 2002-10-03 President And Fellows Of Harvard College Nucleic acid shuffling
ATE365211T1 (de) * 2001-08-20 2007-07-15 Regenesis Bioremediation Produ Biosensor für kleinmolekulare analyten
US20040005709A1 (en) * 2001-10-24 2004-01-08 Hoogenboom Henricus Renerus Jacobus Mattheus Hybridization control of sequence variation
US20040009498A1 (en) * 2002-01-14 2004-01-15 Diversa Corporation Chimeric antigen binding molecules and methods for making and using them
US20050075298A1 (en) * 2002-01-31 2005-04-07 Wei Chen Methods and composition for delivering nucleic acids and/or proteins to the intestinal mucosa
US20040009937A1 (en) * 2002-01-31 2004-01-15 Wei Chen Methods and composition for delivering nucleic acids and/or proteins to the respiratory system
US20040043003A1 (en) * 2002-01-31 2004-03-04 Wei Chen Clinical grade vectors based on natural microflora for use in delivering therapeutic compositions
WO2003072054A2 (en) * 2002-02-25 2003-09-04 Cabot Corporation Custom ligand design for biomolecular filtration and purification for bioseperation
US20050084907A1 (en) 2002-03-01 2005-04-21 Maxygen, Inc. Methods, systems, and software for identifying functional biomolecules
US7747391B2 (en) * 2002-03-01 2010-06-29 Maxygen, Inc. Methods, systems, and software for identifying functional biomolecules
WO2003078645A2 (en) * 2002-03-11 2003-09-25 Nugen Technologies, Inc. Methods for generating double stranded dna comprising a 3’ single stranded portion and uses of these complexes for recombination
DE60332358D1 (de) * 2002-09-09 2010-06-10 Hanall Pharmaceutical Co Ltd Protease-resistente modifizierte interferon alpha polypeptide
US7563600B2 (en) 2002-09-12 2009-07-21 Combimatrix Corporation Microarray synthesis and assembly of gene-length polynucleotides
CA2501295A1 (en) * 2002-10-02 2004-04-15 Jack Nguyen Methods of generating and screening for proteases with altered specificity
US20060024289A1 (en) * 2002-10-02 2006-02-02 Ruggles Sandra W Cleavage of VEGF and VEGF receptor by wild-type and mutant proteases
SI2301965T1 (sl) 2002-10-16 2015-07-31 Purdue Pharma L.P. Protitelesa, ki vežejo celično- povezan CA 125 / O722P in metode uporabe le-teh
US7314613B2 (en) * 2002-11-18 2008-01-01 Maxygen, Inc. Interferon-alpha polypeptides and conjugates
EP1565205A4 (en) * 2002-11-18 2006-07-05 Maxygen Inc Interferon-alpha polypeptides and conjugates
US20040121305A1 (en) * 2002-12-18 2004-06-24 Wiegand Roger Charles Generation of efficacy, toxicity and disease signatures and methods of use thereof
JP2006523465A (ja) 2003-04-14 2006-10-19 ニューゲン テクノロジーズ, インコーポレイテッド ランダムにプライミングされる複合プライマーを用いる大規模増幅
US20040248323A1 (en) 2003-06-09 2004-12-09 Protometrix, Inc. Methods for conducting assays for enzyme activity on protein microarrays
DE602004023956D1 (de) * 2003-08-18 2009-12-17 Univ California Polypeptid-display-bibliotheken und verfahren zur herstellung und verwendung davon
US20050053989A1 (en) * 2003-08-27 2005-03-10 Gil Sharon Libraries of recombinant chimeric proteins
WO2005042709A2 (en) * 2003-10-29 2005-05-12 Ribomed Biotechnologies, Inc. Compositions, methods and detection technologies for reiterative oligonucleotide synthesis
DK1735439T3 (da) * 2004-04-12 2012-02-06 Catalyst Biosciences Inc Spaltning af VEGF og VEGF receptor ved hjælp af vild-type og mutant MT-SP1
AU2005245918A1 (en) 2004-05-19 2005-12-01 F. Hoffmann-La Roche Ag Interferon-alpha polypeptides and conjugates
WO2006004959A2 (en) * 2004-06-30 2006-01-12 Egen Corporation Pegylated interferon alpha-1b
GB0422052D0 (en) 2004-10-04 2004-11-03 Dansico As Enzymes
EP1812598A1 (en) * 2004-10-18 2007-08-01 Codon Devices, Inc. Methods for assembly of high fidelity synthetic polynucleotides
US20070122817A1 (en) * 2005-02-28 2007-05-31 George Church Methods for assembly of high fidelity synthetic polynucleotides
GB0423139D0 (en) 2004-10-18 2004-11-17 Danisco Enzymes
DK1737889T3 (da) 2004-10-19 2011-01-03 Lonza Ag Fremgangsmåde til fastfase-peptidsyntese
EP1817413B1 (en) 2004-11-11 2012-01-04 Modular Genetics, Inc. Oligonucleotide ladder assembly and system for generating molecular diversity
US7329797B2 (en) * 2004-12-08 2008-02-12 Ceres, Inc. Modulating plant carbon levels
WO2007087601A2 (en) * 2006-01-25 2007-08-02 Ceres, Inc. Modulating plant protein levels
BRPI0519657A2 (pt) * 2004-12-16 2009-03-03 Ceres Inc modulaÇço dos nÍveis de nitrogÊnio em plantas
JP2008526259A (ja) * 2005-01-13 2008-07-24 コドン デバイシズ インコーポレイテッド 蛋白質デザインのための組成物及び方法
MX2007014524A (es) * 2005-05-18 2008-02-07 Maxygen Inc Polipeptidos desarrollados de interferon-alfa.
WO2006127423A2 (en) * 2005-05-18 2006-11-30 Codon Devices, Inc. Methods of producing polynucleotide libraries using scarless ligation
DK1899378T3 (da) 2005-06-21 2010-02-01 Xoma Technology Ltd IL-1 beta-bindende antistoffer og fragmenter deraf
JP2009501522A (ja) * 2005-07-12 2009-01-22 コドン デバイシズ インコーポレイテッド 生体触媒工学のための組成物及び方法
WO2007008951A1 (en) * 2005-07-12 2007-01-18 Codon Devices, Inc. Compositions and methods for design of non-immunogenic proteins
EP2535346B1 (en) 2005-08-31 2017-08-02 The Regents of The University of California Cellular libraries of peptide sequences (CLiPS) and methods of using the same
WO2007030759A2 (en) * 2005-09-07 2007-03-15 Nugen Technologies, Inc. Improved nucleic acid amplification procedure
GB2432366B (en) * 2005-11-19 2007-11-21 Alligator Bioscience Ab A method for in vitro molecular evolution of protein function
KR100759817B1 (ko) * 2005-12-08 2007-09-20 한국전자통신연구원 다중 전사 인자 조절 관계 예측 방법 및 장치
US8222482B2 (en) * 2006-01-26 2012-07-17 Ceres, Inc. Modulating plant oil levels
EP1988920A1 (en) 2006-02-02 2008-11-12 Rinat Neuroscience Corp. Methods for treating obesity by administering a trkb antagonist
US20070231805A1 (en) * 2006-03-31 2007-10-04 Baynes Brian M Nucleic acid assembly optimization using clamped mismatch binding proteins
WO2007133804A2 (en) * 2006-05-15 2007-11-22 Ceres, Inc. Modulation of oil levels in plants
WO2007136834A2 (en) * 2006-05-19 2007-11-29 Codon Devices, Inc. Combined extension and ligation for nucleic acid assembly
WO2007146975A2 (en) * 2006-06-13 2007-12-21 Athenix Corporation Methods for generating genetic diversity by permutational mutagenesis
US20090320165A1 (en) * 2006-06-21 2009-12-24 Steven Craig Bobzin Modulation of protein levels in plants
US7727745B2 (en) * 2006-08-14 2010-06-01 Bio-Id Diagnostic Inc. Synthesis of single-stranded DNA
EP2061908A4 (en) * 2006-08-15 2010-01-13 Commw Scient Ind Res Org NEUMISCHING BY FRAGMENT LIGATION
US8158411B2 (en) 2006-08-21 2012-04-17 Samsung Electronics Co., Ltd. Method of separating microorganism using nonplanar solid substrate and device for separating microorganism using the same
WO2008027558A2 (en) 2006-08-31 2008-03-06 Codon Devices, Inc. Iterative nucleic acid assembly using activation of vector-encoded traits
US20100151109A1 (en) * 2006-12-15 2010-06-17 Amr Saad Ragab Modulation of plant protein levels
US20080175668A1 (en) * 2007-01-18 2008-07-24 Larry Wayne Haese Graywater recycling system including rainwater recovery
US8143046B2 (en) 2007-02-07 2012-03-27 Danisco Us Inc., Genencor Division Variant Buttiauxella sp. phytases having altered properties
US20090118130A1 (en) * 2007-02-12 2009-05-07 Codexis, Inc. Structure-activity relationships
BRPI0807952A2 (pt) 2007-02-20 2014-06-10 Anaptysbio Inc Sistemas de hipermutação somática
US7625555B2 (en) * 2007-06-18 2009-12-01 Novagen Holding Corporation Recombinant human interferon-like proteins
US8293685B2 (en) 2007-07-26 2012-10-23 The Regents Of The University Of California Methods for enhancing bacterial cell display of proteins and peptides
NZ582876A (en) * 2007-07-31 2012-07-27 Bp Corp North America Inc Tailored multi-site combinatorial assembly of polynucleotides
AU2008288849A1 (en) * 2007-08-21 2009-02-26 Affomix Corporation Interaction screening methods, systems and devices
WO2009046153A1 (en) 2007-10-01 2009-04-09 Codexis, Inc. Ketoreductase polypeptides for the production of azetidinone
WO2009097673A1 (en) * 2008-02-07 2009-08-13 Bio-Id Diagnostic Inc. Synthesis of single-stranded dna
US20090203531A1 (en) * 2008-02-12 2009-08-13 Nurith Kurn Method for Archiving and Clonal Expansion
CA3100435C (en) 2008-02-15 2024-01-30 Ceres, Inc. Drought and heat tolerance in plants
GB2470672B (en) 2008-03-21 2012-09-12 Nugen Technologies Inc Methods of RNA amplification in the presence of DNA
WO2010054319A2 (en) 2008-11-10 2010-05-14 Codexis, Inc. Penicillin-g acylases
WO2010075574A2 (en) 2008-12-25 2010-07-01 Codexis, Inc. Enone reductases
WO2010091021A2 (en) * 2009-02-03 2010-08-12 Complete Genomics, Inc. Oligomer sequences mapping
WO2010091024A1 (en) * 2009-02-03 2010-08-12 Complete Genomics, Inc. Oligomer sequences mapping
WO2010091023A2 (en) * 2009-02-03 2010-08-12 Complete Genomics, Inc. Indexing a reference sequence for oligomer sequence mapping
EP2401366B1 (en) 2009-02-26 2013-12-18 Codexis, Inc. Transaminase biocatalysts
US9464284B2 (en) * 2009-03-09 2016-10-11 Bioatla, Llc Mirac proteins
WO2010123625A1 (en) 2009-04-24 2010-10-28 University Of Southern California Cd133 polymorphisms predict clinical outcome in patients with cancer
WO2010127045A2 (en) * 2009-04-29 2010-11-04 Complete Genomics, Inc. Method and system for calling variations in a sample polynucleotide sequence with respect to a reference polynucleotide sequence
US8772010B2 (en) 2009-06-16 2014-07-08 Codexis, Inc. β-Glucosidase variants
ES2644992T3 (es) 2009-06-22 2017-12-01 Codexis, Inc. Reacciones de transaminasa
DK2483415T3 (en) 2009-09-30 2015-02-09 Codexis Inc RECOMBINANT C1 B-glucosidase FOR MANUFACTURE OF sugars from cellulosic BIOMASS
US8916366B2 (en) 2009-11-20 2014-12-23 Codexis, Inc. Multi-cellulase enzyme compositions for hydrolysis of cellulosic biomass
US20120288861A1 (en) 2009-12-21 2012-11-15 Heinz-Josef Lenz Germline polymorphisms in the sparc gene associated with clinical outcome in gastric cancer
WO2011085334A1 (en) 2010-01-11 2011-07-14 University Of Southern California Cd44 polymorphisms predict clinical outcome in patients with gastric cancer
EP2569426A4 (en) 2010-05-14 2013-10-09 Codexis Inc ZELLBIOHYDROLASE VARIANTS
US8932836B2 (en) 2010-08-16 2015-01-13 Codexis, Inc. Biocatalysts and methods for the synthesis of (1R,2R)-2-(3,4-dimethoxyphenethoxy)cyclohexanamine
ES2570382T3 (es) 2010-11-02 2016-05-18 Codexis Inc Composiciones y métodos para la producción de azúcares fermentables
WO2012061382A1 (en) 2010-11-02 2012-05-10 Codexis, Inc. Improved fungal strains
EP2637780B1 (en) 2010-11-12 2022-02-09 Gen9, Inc. Protein arrays and methods of using and making the same
CN103502448B (zh) 2010-11-12 2017-03-29 Gen9股份有限公司 核酸合成的方法和设备
EP2655609A4 (en) 2010-12-21 2015-06-03 Codexis Inc ENDOGLUCANASE VARIANTS
US20120258866A1 (en) * 2011-04-05 2012-10-11 Full Spectrum Genetics, Inc. Multi-dimensional selection of protein mutants using high throughput sequence analysis
JP6243325B2 (ja) 2011-04-12 2017-12-06 ガンガゲン インコーポレーティッド キメラ抗菌ポリペプチド
EP2726651B1 (en) 2011-06-28 2018-11-07 Codexis, Inc. Protein variant generation by region shuffling
BR112014003740A2 (pt) 2011-08-23 2018-08-14 Codexis Inc variantes da celobiohidrolase
LT2944693T (lt) 2011-08-26 2019-08-26 Gen9, Inc. Kompozicijos ir būdai, skirti nukleorūgščių didelio tikslumo sąrankai
US20140357727A1 (en) 2011-12-20 2014-12-04 Codexis, Inc. Fatty alcohol forming acyl reductase (far) variants and methods of use
US9150853B2 (en) 2012-03-21 2015-10-06 Gen9, Inc. Methods for screening proteins using DNA encoded chemical libraries as templates for enzyme catalysis
WO2013159055A1 (en) 2012-04-20 2013-10-24 Codexis, Inc. Production of fatty alcohols from engineered microorganisms
CN111876409A (zh) 2012-04-24 2020-11-03 Gen9股份有限公司 在体外克隆中分选核酸和多重制备物的方法
EP2850095B1 (en) 2012-05-17 2019-10-09 RA Pharmaceuticals, Inc. Peptide and peptidomimetic inhibitors
AU2013280661A1 (en) 2012-06-25 2015-01-22 Gen9, Inc. Methods for nucleic acid assembly and high throughput sequencing
US9650655B2 (en) 2012-07-20 2017-05-16 Codexis, Inc. Production of fatty alcohols from engineered microorganisms
WO2014025747A1 (en) 2012-08-07 2014-02-13 Codexis, Inc. Glucose and xylose co-utilization in e. coli
WO2014093070A1 (en) 2012-12-14 2014-06-19 Codexis, Inc. Modified native beta-ketoacyl-acp synthases and engineered microorganisms
EP2970869A4 (en) 2013-03-14 2016-08-03 Codexis Inc REPRESSIBLE PROMOTER WITH LOW PHOSPHATE CONTENT
US10726942B2 (en) 2013-08-23 2020-07-28 Complete Genomics, Inc. Long fragment de novo assembly using short reads
WO2015145463A1 (en) 2014-03-27 2015-10-01 Gangagen, Inc. Phage-derived compositions for improved mycobacterial therapy
WO2016014725A1 (en) 2014-07-22 2016-01-28 The University Of Notre Dame Du Lac Molecular constructs and uses thereof
WO2016033304A1 (en) 2014-08-28 2016-03-03 Codexis, Inc. Imidazoyl anilide derivatives and methods of use
WO2016033296A1 (en) 2014-08-28 2016-03-03 Codexis, Inc. N-substituted 4-aminoquinazoline derivatives and methods of use
EP3294757B1 (en) 2015-05-13 2023-12-27 Synlogic Operating Company, Inc. Bacteria engineered to treat a disease or disorder
WO2016210384A2 (en) 2015-06-25 2016-12-29 Synlogic, Inc. Bacteria engineered to treat metabolic diseases
US9988624B2 (en) 2015-12-07 2018-06-05 Zymergen Inc. Microbial strain improvement by a HTP genomic engineering platform
JP6821598B2 (ja) 2015-12-07 2021-01-27 ザイマージェン インコーポレイテッド Corynebacterium glutamicum由来のプロモーター
US11208649B2 (en) 2015-12-07 2021-12-28 Zymergen Inc. HTP genomic engineering platform
WO2017123592A1 (en) 2016-01-11 2017-07-20 Synlogic, Inc. Bacteria engineered to treat disorders associated with bile salts
WO2017123418A1 (en) 2016-01-11 2017-07-20 Synlogic, Inc. Bacteria engineered to treat metabolic diseases
WO2017123676A1 (en) 2016-01-11 2017-07-20 Synlogic, Inc. Recombinant bacteria engineered to treat diseases and disorders associated with amino acid metabolism and methods of use thereof
WO2017139708A1 (en) 2016-02-10 2017-08-17 Synlogic, Inc. Bacteria engineered to treat nonalcoholic steatohepatitis (nash)
EP3478833A4 (en) 2016-06-30 2019-10-02 Zymergen, Inc. METHOD FOR PRODUCING A BACTERIAL HEMOGLOBIN LIBRARY AND ITS USE
JP2019519241A (ja) 2016-06-30 2019-07-11 ザイマージェン インコーポレイテッド グルコース透過酵素ライブラリーを生成するための方法およびその使用
US11857606B2 (en) 2017-12-14 2024-01-02 Bactoclear Holdings Pte. Ltd. Therapeutic bacteriocins
MX2022013462A (es) 2020-04-27 2022-11-16 4D Molecular Therapeutics Inc Variantes, formulaciones y metodos adeno-asociados para suministro pulmonar.
WO2023245168A1 (en) 2022-06-17 2023-12-21 Synlogic Operating Company, Inc. Bacteria engineered to treat diseases associated with bile acid metabolism and methods of use thereof
WO2023245171A1 (en) 2022-06-17 2023-12-21 Synlogic Operating Company, Inc. Bacteria engineered to treat diseases associated with bile acid metabolism and methods of use thereof
CA3260276A1 (en) 2022-06-23 2023-12-28 Michael James Genetically modified recombinant bacteria for treating diseases associated with methionine metabolism and associated methods of use
WO2025199112A2 (en) 2024-03-19 2025-09-25 General Biological Corporation Bio-based production of succinic acid using vibrio natriegens
WO2025240660A1 (en) 2024-05-15 2025-11-20 Foresite Labs, Llc Drug development and drug activity determination for coronary artery disease (cad)
WO2026053219A1 (en) 2024-09-08 2026-03-12 Yeda Research And Development Co. Ltd. Polyphenol oxidase, an amino acid transporter, and a transgenic cell, tissue, and organism comprising same

Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
GB2183661A (en) * 1985-03-30 1987-06-10 Marc Ballivet Method for obtaining dna, rna, peptides, polypeptides or proteins by means of a dna recombinant technique
WO1989006694A1 (en) * 1988-01-15 1989-07-27 Trustees Of The University Of Pennsylvania Process for selection of proteinaceous substances which mimic growth-inducing molecules
WO1991000925A1 (en) * 1989-07-13 1991-01-24 Massachusetts Institute Of Technology Determination of a mutational spectrum
US5525486A (en) * 1993-01-14 1996-06-11 Tasuku Honjo Process for constructing cDNA library, and novel polypeptide and DNA coding for the same
US5565332A (en) * 1991-09-23 1996-10-15 Medical Research Council Production of chimeric antibodies - a combinatorial approach

Family Cites Families (195)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
NL154598B (nl) 1970-11-10 1977-09-15 Organon Nv Werkwijze voor het aantonen en bepalen van laagmoleculire verbindingen en van eiwitten die deze verbindingen specifiek kunnen binden, alsmede testverpakking.
US3817837A (en) 1971-05-14 1974-06-18 Syva Corp Enzyme amplification assay
US3939350A (en) 1974-04-29 1976-02-17 Board Of Trustees Of The Leland Stanford Junior University Fluorescent immunoassay employing total reflection for activation
US3996345A (en) 1974-08-12 1976-12-07 Syva Company Fluorescence quenching with immunological pairs in immunoassays
US3996945A (en) * 1975-04-07 1976-12-14 Mcdowell James A Extinguisher for cigarettes or cigars
US4275149A (en) 1978-11-24 1981-06-23 Syva Company Macromolecular environment control in specific receptor assays
US4277437A (en) 1978-04-05 1981-07-07 Syva Company Kit for carrying out chemically induced fluorescence immunoassay
US4351901A (en) * 1980-03-24 1982-09-28 Cetus Corporation Method for single nucleotide alteration
US4366241A (en) 1980-08-07 1982-12-28 Syva Company Concentrating zone method in heterogeneous immunoassays
US4695543A (en) * 1982-03-23 1987-09-22 Bristol-Myers Company Alpha Interferon GX-1
US5618697A (en) 1982-12-10 1997-04-08 Novo Nordisk A/S Process for preparing a desired protein
US4994379A (en) 1983-03-09 1991-02-19 Cetus Corporation Modified signal peptides
US4816567A (en) 1983-04-08 1989-03-28 Genentech, Inc. Recombinant immunoglobin preparations
US5538868A (en) 1984-02-08 1996-07-23 Cetus Oncology Corporation Recombinant ricin toxin fragments
US5422266A (en) * 1984-12-31 1995-06-06 University Of Georgia Research Foundation, Inc. Recombinant DNA vectors capable of expressing apoaequorin
US5176995A (en) 1985-03-28 1993-01-05 Hoffmann-La Roche Inc. Detection of viruses by amplification and hybridization
US4683202A (en) 1985-03-28 1987-07-28 Cetus Corporation Process for amplifying nucleic acid sequences
US4965188A (en) 1986-08-22 1990-10-23 Cetus Corporation Process for amplifying, detecting, and/or cloning nucleic acid sequences using a thermostable enzyme
EP0316018A3 (en) * 1985-03-29 1989-07-26 Cetus Oncology Corporation Modification of dna sequences
US6492107B1 (en) 1986-11-20 2002-12-10 Stuart Kauffman Process for obtaining DNA, RNA, peptides, polypeptides, or protein, by recombinant DNA technique
US4959312A (en) 1985-05-31 1990-09-25 The University Of Tennessee Research Corporation Full spectrum mutagenesis
US4766106A (en) 1985-06-26 1988-08-23 Cetus Corporation Solubilization of proteins for pharmaceutical compositions using polymer conjugation
EP0208491B1 (en) 1985-07-03 1993-08-25 Genencor International, Inc. Hybrid polypeptides and process for their preparation
US5866363A (en) 1985-08-28 1999-02-02 Pieczenik; George Method and means for sorting and identifying biological information
US4800159A (en) 1986-02-07 1989-01-24 Cetus Corporation Process for amplifying, detecting, and/or cloning nucleic acid sequences
FI72765C (fi) 1986-02-13 1987-07-10 Valmet Oy Utbredningsvals eller motsvarande foer vaevnaden i en pappersmaskin samt foerfarande foer framstaellning av denna.
DK311186D0 (da) 1986-06-30 1986-06-30 Novo Industri As Enzymer
US5824469A (en) 1986-07-17 1998-10-20 University Of Washington Method for producing novel DNA sequences with biological activity
US4795699A (en) 1987-01-14 1989-01-03 President And Fellows Of Harvard College T7 DNA polymerase
US4994368A (en) 1987-07-23 1991-02-19 Syntex (U.S.A.) Inc. Amplification method for polynucleotide assays
DK6488D0 (da) 1988-01-07 1988-01-07 Novo Industri As Enzymer
US5206152A (en) * 1988-04-08 1993-04-27 Arch Development Corporation Cloning and expression of early growth regulatory protein genes
US4994366A (en) * 1988-04-28 1991-02-19 Jac Creative Foods, Inc. Shrimp analog forming process
JPH03505966A (ja) * 1988-07-14 1991-12-26 ベイラー カレッジ オブ メディシン 生物高分子の固相組立及び再構築方法
US5223409A (en) 1988-09-02 1993-06-29 Protein Engineering Corp. Directed evolution of novel binding proteins
FR2641793B1 (fr) 1988-12-26 1993-10-01 Setratech Procede de recombinaison in vivo de sequences d'adn presentant des mesappariements de bases
US4902502A (en) 1989-01-23 1990-02-20 Cetus Corporation Preparation of a polymer/interleukin-2 conjugate
DD282028A5 (de) 1989-02-16 1990-08-29 Akad Wissenschaften Ddr Verfahren zur herstellung einer thermostabilen, hybriden bacillus-beta-1,3-1,4-glukanase
DE69028725T2 (de) * 1989-02-28 1997-03-13 Canon Kk Partiell doppelsträngiges Oligonukleotid und Verfahren zu seiner Bildung
DE3909710A1 (de) * 1989-03-23 1990-09-27 Boehringer Mannheim Gmbh Verfahren zur expression eines rekombinanten gens
US5043272A (en) 1989-04-27 1991-08-27 Life Technologies, Incorporated Amplification of nucleic acid sequences using oligonucleotides of random sequence as primers
US5106727A (en) 1989-04-27 1992-04-21 Life Technologies, Inc. Amplification of nucleic acid sequences using oligonucleotides of random sequences as primers
EP0397463A3 (en) 1989-05-10 1991-03-06 Eastman Kodak Company Construction of synthetic double-stranded dna sequences
US5556750A (en) 1989-05-12 1996-09-17 Duke University Methods and kits for fractionating a population of DNA molecules based on the presence or absence of a base-pair mismatch utilizing mismatch repair systems
CA2016842A1 (en) 1989-05-16 1990-11-16 Richard A. Lerner Method for tapping the immunological repertoire
US6291158B1 (en) 1989-05-16 2001-09-18 Scripps Research Institute Method for tapping the immunological repertoire
CA2016841C (en) 1989-05-16 1999-09-21 William D. Huse A method for producing polymers having a preselected activity
US6291161B1 (en) 1989-05-16 2001-09-18 Scripps Research Institute Method for tapping the immunological repertiore
DK169306B1 (da) 1989-06-14 1994-10-10 Af 18 Juni 1990 As Middel til fjernelse eller inaktivering af uønskede komponenter i blod eller andre ekstracellulære legemsvæsker samt fremgangsmåde til fremstilling af dextran-O-carbonyl-benzo-18-crown-6 og af dextran-hydroxyethylbenzo-18-crown-6
IL94847A0 (en) 1989-06-26 1991-04-15 Lilly Co Eli Control of aberrant expression vector accumulation during fermentation procedures
US5240845A (en) * 1989-07-11 1993-08-31 Otsuka Pharmaceutical Factory, Ltd. Mutated streptokinase proteins
IT1231157B (it) 1989-07-20 1991-11-19 Crc Ricerca Chim Nuovi geni ibridi funzionali di bacillus thuringiensis ottenuti mediante ricombinazione in vivo.
US5514787A (en) * 1989-07-21 1996-05-07 Washington University DNA sequences encoding human membrane cofactor protein (MCP)
US5574205A (en) 1989-07-25 1996-11-12 Cell Genesys Homologous recombination for universal donor cells and chimeric mammalian hosts
US5023171A (en) 1989-08-10 1991-06-11 Mayo Foundation For Medical Education And Research Method for gene splicing by overlap extension using the polymerase chain reaction
US5360726A (en) 1989-09-12 1994-11-01 Board Of Trustees Operating Michigan State University Polypeptides enabling sorting of proteins to vacuoles in plants
US5030568A (en) * 1989-09-29 1991-07-09 Minnesota Mining And Manufacturing Company Bioconversion of naphthalene monomers
WO1991006570A1 (en) 1989-10-25 1991-05-16 The University Of Melbourne HYBRID Fc RECEPTOR MOLECULES
AU6886991A (en) 1989-11-08 1991-06-13 United States of America, as represented by the Secretary, U.S. Department of Commerce, The A method of synthesizing double-stranded dna molecules
DE4000939A1 (de) * 1990-01-15 1991-07-18 Brem Gottfried Prof Dr Dr Verfahren zur antikoerpergewinnung
DE69118930T2 (de) 1990-01-26 1997-01-09 Abbott Lab Verbessertes Verfahren zur Amplifikation von Nuklein säurezielsequenz, einsetzbar für die Polymerase und Ligasekettenreaktion
US5427930A (en) 1990-01-26 1995-06-27 Abbott Laboratories Amplification of target nucleic acids using gap filling ligase chain reaction
ES2078518T3 (es) 1990-04-05 1995-12-16 Roberto Crea Mutagenesis por desplazamiento completo.
WO1991016427A1 (en) 1990-04-24 1991-10-31 Stratagene Methods for phenotype creation from multiple gene populations
US5427908A (en) * 1990-05-01 1995-06-27 Affymax Technologies N.V. Recombinant library screening methods
US5877402A (en) 1990-05-01 1999-03-02 Rutgers, The State University Of New Jersey DNA constructs and methods for stably transforming plastids of multicellular plants and expressing recombinant proteins therein
US5851813A (en) 1990-07-12 1998-12-22 President And Fellows Of Harvard College Primate lentivirus antigenic compositions
WO1992001814A2 (en) * 1990-07-24 1992-02-06 F. Hoffmann-La-Roche Ag The reduction of non-specific amplification during in vitro nucleic acid amplification using modified nucleic acid bases
US5169764A (en) 1990-08-08 1992-12-08 Regeneron Pharmaceuticals, Inc. Multitrophic and multifunctional chimeric neurotrophic factors, and nucleic acids and plasmids encoding the chimeras
DE69128898T2 (de) * 1990-08-15 1998-05-28 Therion Biolog Corp Selbstständig zusammenfügende replikationsdefekte hybride viruspartikel
US5264563A (en) 1990-08-24 1993-11-23 Ixsys Inc. Process for synthesizing oligonucleotides with random codons
JP3306063B2 (ja) 1990-08-24 2002-07-24 イグジス, インコーポレイテッド ランダムコドンを有するオリゴヌクレオチドを合成する方法
CA2049879A1 (en) 1990-08-30 1992-03-01 Keith C. Backman Controlled initial target-dependent production of templates for ligase chain reaction
US5770434A (en) 1990-09-28 1998-06-23 Ixsys Incorporated Soluble peptides having constrained, secondary conformation in solution and method of making same
US5698426A (en) 1990-09-28 1997-12-16 Ixsys, Incorporated Surface expression libraries of heteromeric receptors
US5871974A (en) 1990-09-28 1999-02-16 Ixsys Inc. Surface expression libraries of heteromeric receptors
IL99553A0 (en) 1990-09-28 1992-08-18 Ixsys Inc Compositions containing oligonucleotides linked to expression elements,a kit for the preparation of vectors useful for the expression of a diverse population of random peptides and methods utilizing the same
US5858725A (en) 1990-10-10 1999-01-12 Glaxo Wellcome Inc. Preparation of chimaeric antibodies using the recombinant PCR strategy
US5187083A (en) 1990-11-13 1993-02-16 Specialty Laboratories, Inc. Rapid purification of DNA
US5234824A (en) 1990-11-13 1993-08-10 Specialty Laboratories, Inc. Rapid purification of DNA
CA2405246A1 (en) 1990-12-03 1992-06-11 Genentech, Inc. Enrichment method for variant proteins with alterred binding properties
US5489523A (en) 1990-12-03 1996-02-06 Stratagene Exonuclease-deficient thermostable Pyrococcus furiosus DNA polymerase I
EP0563296B1 (en) 1990-12-20 1999-03-17 Ixsys, Inc. Optimization of binding proteins
US5795747A (en) 1991-04-16 1998-08-18 Evotec Biosystems Gmbh Process for manufacturing new biopolymers
DE4112440C1 (https=) 1991-04-16 1992-10-22 Diagen Institut Fuer Molekularbiologische Diagnostik Gmbh, 4000 Duesseldorf, De
US5514568A (en) 1991-04-26 1996-05-07 Eli Lilly And Company Enzymatic inverse polymerase chain reaction
US5512463A (en) 1991-04-26 1996-04-30 Eli Lilly And Company Enzymatic inverse polymerase chain reaction library mutagenesis
ES2091976T3 (es) 1991-06-20 1996-11-16 Hoffmann La Roche Metodos perfeccionados para la amplificacion del acido nucleico.
WO1993000103A1 (en) 1991-06-21 1993-01-07 The Wistar Institute Of Anatomy And Biology Chimeric envelope proteins for viral targeting
JP3442774B2 (ja) * 1991-07-01 2003-09-02 バーレックス ラボラトリーズ,インコーポレイティド 新規な突然変異誘発法および組成物
US6071889A (en) 1991-07-08 2000-06-06 Neurospheres Holdings Ltd. In vivo genetic modification of growth factor-responsive neural precursor cells
US5223408A (en) 1991-07-11 1993-06-29 Genentech, Inc. Method for making variant secreted proteins with altered properties
GB9115364D0 (en) 1991-07-16 1991-08-28 Wellcome Found Antibody
US5279952A (en) 1991-08-09 1994-01-18 Board Of Regents, The University Of Texas System PCR-based strategy of constructing chimeric DNA molecules
JP2001524926A (ja) 1991-09-18 2001-12-04 アフィマックス テクノロジーズ ナームロゼ フェンノートシャップ オリゴマーの雑多ライブラリーの集合体を合成する方法
AU665025B2 (en) 1991-09-23 1995-12-14 Cambridge Antibody Technology Limited Production of chimeric antibodies - a combinatorial approach
US5872215A (en) * 1991-12-02 1999-02-16 Medical Research Council Specific binding members, materials and methods
GB9125979D0 (en) 1991-12-06 1992-02-05 Wellcome Found Antibody
AU674137B2 (en) 1992-01-30 1996-12-12 Genzyme Limited Chiral synthesis with modified enzymes
US5773267A (en) * 1992-02-07 1998-06-30 Albert Einstein College Of Medicine Of Yeshiva University, A Division Of Yeshiva University D29 shuttle phasmids and uses thereof
GB9202796D0 (en) 1992-02-11 1992-03-25 Wellcome Found Antiviral antibody
US5843643A (en) 1992-02-21 1998-12-01 Ratner; Paul L. Site-specific transfection of eukaryotic cells using polypeptide-linked recombinant nucleic acid
CA2131389A1 (en) 1992-03-02 1993-09-16 John M. Maraganore Thrombin receptor antagonists
WO1993018175A1 (en) * 1992-03-10 1993-09-16 Life Technologies, Inc. Udg-facilitated mutagenesis
CA2132306C (en) 1992-03-16 2012-07-10 Jacob N. Wohlstadter Selection methods
DE69333823T2 (de) 1992-03-24 2006-05-04 Cambridge Antibody Technology Ltd., Melbourn Verfahren zur herstellung von gliedern von spezifischen bindungspaaren
WO1993020227A1 (en) 1992-03-31 1993-10-14 Abbott Laboratories Method of multiplex ligase chain reaction
US5316935A (en) 1992-04-06 1994-05-31 California Institute Of Technology Subtilisin variants suitable for hydrolysis and synthesis in organic media
US5474896A (en) * 1992-05-05 1995-12-12 Institut Pasteur Nucleotide sequence encoding the enzyme I-SceI and the uses thereof
CA2136764A1 (en) 1992-05-29 1993-12-09 Ronald L. Marshall Ligase chain reaction starting with rna sequences
WO1993025237A1 (en) 1992-06-15 1993-12-23 City Of Hope Chimeric anti-cea antibody
MX9304135A (es) 1992-07-10 1995-01-31 Energy Biosystems Corp Adn recombinante que codifica un biocatalizador de desulfuracion.
US6107062A (en) 1992-07-30 2000-08-22 Inpax, Inc. Antisense viruses and antisense-ribozyme viruses
WO1994008047A1 (en) 1992-09-25 1994-04-14 Abbott Laboratories Ligase chain reaction method for detecting small mutations
US5837821A (en) 1992-11-04 1998-11-17 City Of Hope Antibody construct
EP0675953B1 (en) 1992-11-10 2009-01-28 Applied Molecular Evolution, Inc. Soluble peptides having constrained, secondary conformation in solution and method of making same
DE4239311C2 (de) 1992-11-23 1996-04-18 Guehring Joerg Dr Bohrer, insbesondere Spitzbohrwerkzeug mit austauschbarem Schneideinsatz
WO1994012632A1 (en) * 1992-11-27 1994-06-09 University College London Improvements in nucleic acid synthesis by pcr
US5360728A (en) 1992-12-01 1994-11-01 Woods Hole Oceanographic Institution (W.H.O.I.) Modified apoaequorin having increased bioluminescent activity
ATE199392T1 (de) 1992-12-04 2001-03-15 Medical Res Council Multivalente und multispezifische bindungsproteine, deren herstellung und verwendung
US5541311A (en) 1992-12-07 1996-07-30 Third Wave Technologies, Inc. Nucleic acid encoding synthesis-deficient thermostable DNA polymerase
US5571708A (en) 1993-04-19 1996-11-05 Bristol-Myers Squibb Company Thrombin-activatable plasminogen activator
US5501962A (en) 1993-06-21 1996-03-26 G. D. Searle & Co. Interleuken-3 (IL-3) human/murine hybrid polypeptides and recombinant production of the same
IT1264712B1 (it) 1993-07-13 1996-10-04 Eniricerche Spa Metodo di sintesi biologica di peptidi
US5547859A (en) 1993-08-02 1996-08-20 Goodman; Myron F. Chain-terminating nucleotides for DNA sequencing methods
US5498531A (en) 1993-09-10 1996-03-12 President And Fellows Of Harvard College Intron-mediated recombinant techniques and reagents
US6015686A (en) 1993-09-15 2000-01-18 Chiron Viagene, Inc. Eukaryotic layered vector initiation systems
IL107268A0 (en) 1993-10-12 1994-01-25 Yeda Res & Dev Molecules influencing the shedding of the tnf receptor, their preparation and their use
JPH09507121A (ja) 1993-10-26 1997-07-22 アフィマックス テクノロジーズ ナームロゼ ベノートスハップ 生物学的チップ上の核酸プローブアレー
US6027877A (en) 1993-11-04 2000-02-22 Gene Check, Inc. Use of immobilized mismatch binding protein for detection of mutations and polymorphisms, purification of amplified DNA samples and allele identification
US5556772A (en) 1993-12-08 1996-09-17 Stratagene Polymerase compositions and uses thereof
DE4343591A1 (de) 1993-12-21 1995-06-22 Evotec Biosystems Gmbh Verfahren zum evolutiven Design und Synthese funktionaler Polymere auf der Basis von Formenelementen und Formencodes
US6165793A (en) 1996-03-25 2000-12-26 Maxygen, Inc. Methods for generating polynucleotides having desired characteristics by iterative selection and recombination
US5605793A (en) 1994-02-17 1997-02-25 Affymax Technologies N.V. Methods for in vitro recombination
US5928905A (en) 1995-04-18 1999-07-27 Glaxo Group Limited End-complementary polymerase reaction
US5834252A (en) 1995-04-18 1998-11-10 Glaxo Group Limited End-complementary polymerase reaction
US6117679A (en) 1994-02-17 2000-09-12 Maxygen, Inc. Methods for generating polynucleotides having desired characteristics by iterative selection and recombination
US6309883B1 (en) 1994-02-17 2001-10-30 Maxygen, Inc. Methods and compositions for cellular and metabolic engineering
US5837458A (en) * 1994-02-17 1998-11-17 Maxygen, Inc. Methods and compositions for cellular and metabolic engineering
US6406855B1 (en) * 1994-02-17 2002-06-18 Maxygen, Inc. Methods and compositions for polypeptide engineering
US6395547B1 (en) * 1994-02-17 2002-05-28 Maxygen, Inc. Methods for generating polynucleotides having desired characteristics by iterative selection and recombination
US6335160B1 (en) * 1995-02-17 2002-01-01 Maxygen, Inc. Methods and compositions for polypeptide engineering
US5521077A (en) 1994-04-28 1996-05-28 The Leland Stanford Junior University Method of generating multiple protein variants and populations of protein variants prepared thereby
US5728821A (en) * 1994-08-04 1998-03-17 Bristol-Myers Squibb Company Mutant BR96 antibodies reactive with human carcinomas
WO1996017056A1 (en) * 1994-12-02 1996-06-06 Institut Pasteur Hypermutagenesis
US5514588A (en) 1994-12-13 1996-05-07 Exxon Research And Engineering Company Surfactant-nutrients for bioremediation of hydrocarbon contaminated soils and water
US5629179A (en) 1995-03-17 1997-05-13 Novagen, Inc. Method and kit for making CDNA library
KR100501838B1 (ko) 1995-04-24 2005-07-21 큐비스트 파마슈티컬즈 인코포레이티드 새로운 대사 경로를 만들고 이를 스크리닝하는 방법
US5885813A (en) 1995-05-31 1999-03-23 Amersham Life Science, Inc. Thermostable DNA polymerases
US5667974A (en) 1995-06-07 1997-09-16 Abbott Laboratories Method for detecting nucleic acid sequences using competitive amplification
CA2151183C (en) * 1995-06-07 2005-05-17 Slawomir Jonasz Composite compression molded article, composition therefor and process for manufacture thereof, and use
US6004788A (en) 1995-07-18 1999-12-21 Diversa Corporation Enzyme kits and libraries
US6030779A (en) 1995-07-18 2000-02-29 Diversa Corporation Screening for novel bioactivities
US6168919B1 (en) 1996-07-17 2001-01-02 Diversa Corporation Screening methods for enzymes and enzyme kits
US6057103A (en) 1995-07-18 2000-05-02 Diversa Corporation Screening for novel bioactivities
US5958672A (en) 1995-07-18 1999-09-28 Diversa Corporation Protein activity screening of clones having DNA from uncultivated microorganisms
WO1997007206A1 (en) 1995-08-11 1997-02-27 Okkels, Jens, Sigurd Method for preparing polypeptide variants
US5962258A (en) 1995-08-23 1999-10-05 Diversa Corporation Carboxymethyl cellulase fromthermotoga maritima
US6051409A (en) 1995-09-25 2000-04-18 Novartis Finance Corporation Method for achieving integration of exogenous DNA delivered by non-biological means to plant cells
US5756316A (en) 1995-11-02 1998-05-26 Genencor International, Inc. Molecular cloning by multimerization of plasmids
US20030215798A1 (en) 1997-06-16 2003-11-20 Diversa Corporation High throughput fluorescence-based screening for novel enzymes
US6171820B1 (en) 1995-12-07 2001-01-09 Diversa Corporation Saturation mutagenesis in directed evolution
ATE260987T1 (de) 1995-12-07 2004-03-15 Diversa Corp Verfahren zum screening enzymatischer aktivität
US5965408A (en) 1996-07-09 1999-10-12 Diversa Corporation Method of DNA reassembly by interrupting synthesis
US5830696A (en) 1996-12-05 1998-11-03 Diversa Corporation Directed evolution of thermophilic enzymes
US6361974B1 (en) 1995-12-07 2002-03-26 Diversa Corporation Exonuclease-mediated nucleic acid reassembly in directed evolution
US6238884B1 (en) 1995-12-07 2001-05-29 Diversa Corporation End selection in directed evolution
US5939250A (en) 1995-12-07 1999-08-17 Diversa Corporation Production of enzymes having desired activities by mutagenesis
US6358709B1 (en) 1995-12-07 2002-03-19 Diversa Corporation End selection in directed evolution
US6352842B1 (en) 1995-12-07 2002-03-05 Diversa Corporation Exonucease-mediated gene assembly in directed evolution
JP2000502568A (ja) 1996-01-10 2000-03-07 ノボ ノルディスク アクティーゼルスカブ 細胞内での突然変異ライブラリーの in vivo製造のための方法
US5871969A (en) * 1996-02-12 1999-02-16 Human Genome Sciences, Inc. Nucleic acids encoding human neuronal attachment factor-1
US6096548A (en) 1996-03-25 2000-08-01 Maxygen, Inc. Method for directing evolution of a virus
US5783431A (en) 1996-04-24 1998-07-21 Chromaxome Corporation Methods for generating and screening novel metabolic pathways
EP0906420A1 (en) * 1996-06-07 1999-04-07 Massachusetts Institute Of Technology Programmed sequential mutagenesis
US5763239A (en) 1996-06-18 1998-06-09 Diversa Corporation Production and use of normalized DNA libraries
US6093873A (en) 1996-08-19 2000-07-25 Institut National De La Sante Et De La Recherche Medicale Genetically engineered mice containing alterations in the gene encoding RXR
JP2001504325A (ja) 1996-09-27 2001-04-03 マキシジェン,インコーポレイテッド 回帰的配列シャフリングおよび選択による遺伝子治療の最適化のための方法
AU4597197A (en) 1996-09-27 1998-04-17 Introgene B.V. Methods for optimization of gene therapy by recursive sequence shuffling and selection
WO1998028416A1 (en) 1996-12-20 1998-07-02 Novo Nordisk A/S In vivo recombination
US6326204B1 (en) * 1997-01-17 2001-12-04 Maxygen, Inc. Evolution of whole cells and organisms by recursive sequence recombination
CA2284097A1 (en) 1997-03-18 1998-09-24 Novo Nordisk A/S Shuffling of heterologous dna sequences
US6159687A (en) 1997-03-18 2000-12-12 Novo Nordisk A/S Methods for generating recombined polynucleotides
EP0973940B1 (en) 1997-03-18 2008-07-02 Novozymes A/S An in vitro method for the construction of a dna library
JP4263248B2 (ja) 1997-03-18 2009-05-13 ノボザイムス アクティーゼルスカブ Dnaのシャッフリングによるライブラリーの作成方法
US5948653A (en) 1997-03-21 1999-09-07 Pati; Sushma Sequence alterations using homologous recombination
US6153410A (en) 1997-03-25 2000-11-28 California Institute Of Technology Recombination of polynucleotide sequences using random or defined primers
US6051049A (en) 1997-05-29 2000-04-18 Exothermic Distribution Corporation Utilization of strontium aluminate in steelmaking
DK1036198T3 (da) 1997-12-08 2013-01-02 California Inst Of Techn Fremgangsmåde til fremstilling af polynukleotid- og polypeptidsekvenser
US6087341A (en) 1998-02-12 2000-07-11 The Board Of Trustees Of The Leland Standford Junior University Introduction of nucleic acid into skin cells by topical application
US6365408B1 (en) 1998-06-19 2002-04-02 Maxygen, Inc. Methods of evolving a polynucleotides by mutagenesis and recombination
US6436675B1 (en) * 1999-09-28 2002-08-20 Maxygen, Inc. Use of codon-varied oligonucleotide synthesis for synthetic shuffling
US6376246B1 (en) * 1999-02-05 2002-04-23 Maxygen, Inc. Oligonucleotide mediated nucleic acid recombination
EP1152058A1 (en) * 2000-05-03 2001-11-07 Institut Curie Methods and compositions for effecting homologous recombination
US6355160B1 (en) 2000-07-21 2002-03-12 Cecil A. Wiseman Gray-water recycling system

Patent Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
GB2183661A (en) * 1985-03-30 1987-06-10 Marc Ballivet Method for obtaining dna, rna, peptides, polypeptides or proteins by means of a dna recombinant technique
WO1989006694A1 (en) * 1988-01-15 1989-07-27 Trustees Of The University Of Pennsylvania Process for selection of proteinaceous substances which mimic growth-inducing molecules
WO1991000925A1 (en) * 1989-07-13 1991-01-24 Massachusetts Institute Of Technology Determination of a mutational spectrum
US5565332A (en) * 1991-09-23 1996-10-15 Medical Research Council Production of chimeric antibodies - a combinatorial approach
US5525486A (en) * 1993-01-14 1996-06-11 Tasuku Honjo Process for constructing cDNA library, and novel polypeptide and DNA coding for the same

Non-Patent Citations (15)

* Cited by examiner, † Cited by third party
Title
BIOTECH. ADV., 1992, Vol. 10, REIKOFSKI et al., "Polymerase Chain Reaction (PCR) Techniques for Site-Directed Mutagenesis", pages 535-547. *
CURR. OPIN. STRUCT. BIOL., 1995, Vol. 5, O'NEIL et al., "Phage Display: Protein Engineering by Directed Evolution", pages 443-449. *
GENE, 1988, Vol. 68, MANDECKI et al., "FokI Method of Gene Synthesis (Recombinant DNA; Oligodeoxyribonucleotide; Bridge Mutagenesis; Cloning; Gene Assembly; HIV)", pages 101-107. *
J. BIOL. CHEM., 06 September 1996, Vol. 271, No. 36, CHONG et al., "Protein Splicing Involving the Saccharomyces Cerevisiae VMA Intein", pages 22159-22168. *
J. MOL. BIOL., 1996, Vol. 255, GATES et al., "Affinity Selective Isolation of Ligands from Peptide Libraries Through Display on a Lac Repressor 'Headpiece Dimer'", pages 373-386. *
MOL. BIOL., July-August 1995, Vol. 29, No. 5, Part 1, LEVICHKIN et al., "A New Approach to Construction of Hybrid Genes: Homolog Recombination Method", pages 572-577. *
NATURE MED., January 1996, Vol. 2, No. 1, CRAMERI et al., "Construction and Evolution of Antibody-Phage Libraries by DNA Shuffling", pages 100-102. *
NATURE, 19 April 1990, Vol. 344, JONES et al., "DNA Mutagenesis and Recombination", pages 793-794. *
NUC. ACIDS RES., 1994, Vol. 22, No. 9, BENDIXEN et al., "A Yeast Mating-Selection Scheme for Detection of Protein-Protein Interactions", pages 1778-1779. *
PCR METH. APPL., 1992, Vol. 2, CADWELL et al., "Randomization of Genes by PCR Mutagenesis", pages 28-33. *
PROC. NATL. ACAD. SCI. U.S.A., May 1987, Vol. 84, SEED et al., "Molecular Cloning of the CD2 Antigen, the T-Cell Erythrocyte Receptor, by a Rapid Immunoselection Procedure", pages 3365-3369. *
PROC. NATL. ACAD. SCI. U.S.A., May 1993, Vol. 90, SWEASY et al., "Detection and Characterization of Mammalian DNA Polymerase beta Mutants by Functional Complementation in Escherichia Coli", pages 4626-4630. *
PROC. NATL. ACAD. SCI. U.S.A., October 1994, Vol. 91, STEMMER W.P.C., "DNA Shuffling by Random Fragmentation and Reassembly: In Vitro Recombination for Molecular Evolution", pages 10747-10751. *
PROTEIN ENG., 1992, Vol. 5, No. 8, PRODROMOU et al., "PROTOCOL: Recursive PCR: A Novel Technique for Total Gene Synthesis", pages 827-829. *
SCIENCE, 21 May 1993, Vol. 260, MATTHEWS et al., "Substrate Phage: Selection of Protease Substrates by Monovalent Phage Display", pages 1113-1117. *

Cited By (652)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7045289B2 (en) 1991-09-09 2006-05-16 Third Wave Technologies, Inc. Detection of RNA Sequences
US7150982B2 (en) 1991-09-09 2006-12-19 Third Wave Technologies, Inc. RNA detection assays
US7105297B2 (en) 1994-02-17 2006-09-12 Maxygen, Inc. Methods and compositions for cellular and metabolic engineering
US6391640B1 (en) 1994-02-17 2002-05-21 Maxygen, Inc. Methods and compositions for cellular and metabolic engineering
US6420175B1 (en) 1994-02-17 2002-07-16 Maxygen, Inc. Methods for generating polynucleotides having desired characteristics by iterative selection and recombination
US7288375B2 (en) 1994-02-17 2007-10-30 Maxygen, Inc. Methods for generating polynucleotides having desired characteristics by iterative selection and recombination
US7795030B2 (en) 1994-02-17 2010-09-14 Maxygen, Inc. Methods and compositions for cellular and metabolic engineering
US8048674B2 (en) 1994-02-17 2011-11-01 Codexis Mayflower Holdings, Llc Methods and compositions for cellular and metabolic engineering
US6946296B2 (en) 1995-11-30 2005-09-20 Maxygen, Inc. Methods and compositions for polypeptide engineering
US6713282B2 (en) 1995-12-07 2004-03-30 Diversa Corporation End selection in directed evolution
US6764835B2 (en) 1995-12-07 2004-07-20 Diversa Corporation Saturation mutageneis in directed evolution
US6696275B2 (en) 1995-12-07 2004-02-24 Diversa Corporation End selection in directed evolution
US6713281B2 (en) 1995-12-07 2004-03-30 Diversa Corporation Directed evolution of thermophilic enzymes
US6713279B1 (en) 1995-12-07 2004-03-30 Diversa Corporation Non-stochastic generation of genetic vaccines and enzymes
US6238884B1 (en) 1995-12-07 2001-05-29 Diversa Corporation End selection in directed evolution
US6740506B2 (en) 1995-12-07 2004-05-25 Diversa Corporation End selection in directed evolution
US6939689B2 (en) 1995-12-07 2005-09-06 Diversa Corporation Exonuclease-mediated nucleic acid reassembly in directed evolution
US6358709B1 (en) 1995-12-07 2002-03-19 Diversa Corporation End selection in directed evolution
US7935800B2 (en) 1996-01-24 2011-05-03 Third Wave Technologies, Inc. RNA detection assays
US7807806B2 (en) 1996-01-24 2010-10-05 Third Wave Technologies, Inc. RNA detection assays
US6242211B1 (en) 1996-04-24 2001-06-05 Terragen Discovery, Inc. Methods for generating and screening novel metabolic pathways
US8063184B2 (en) 1996-11-29 2011-11-22 Third Wave Technologies, Inc. RNA detection assays
US6528311B1 (en) 1997-01-17 2003-03-04 Maxygen, Inc. Evolution of whole cells and organisms by recursive sequence recombination
US7148054B2 (en) 1997-01-17 2006-12-12 Maxygen, Inc. Evolution of whole cells and organisms by recursive sequence recombination
US6352859B1 (en) 1997-01-17 2002-03-05 Maxygen, Inc. Evolution of whole cells and organisms by recursive sequence recombination
US7629170B2 (en) 1997-01-17 2009-12-08 Maxygen, Inc. Evolution of whole cells and organisms by recursive sequence recombination
US6287862B1 (en) 1997-01-17 2001-09-11 Maxygen, Inc. Evolution of whole cells and organisms by recursive sequence recombination
US6326204B1 (en) 1997-01-17 2001-12-04 Maxygen, Inc. Evolution of whole cells and organisms by recursive sequence recombination
US6379964B1 (en) 1997-01-17 2002-04-30 Maxygen, Inc. Evolution of whole cells and organisms by recursive sequence recombination
US6335198B1 (en) 1997-01-17 2002-01-01 Maxygen, Inc. Evolution of whole cells and organisms by recursive sequence recombination
US6989250B2 (en) 1997-01-24 2006-01-24 Bioinvent International Ab Method for in vitro molecular evolution of protein function
EP1352959A1 (en) * 1997-01-24 2003-10-15 Bioinvent International AB A method for in vitro molecular evolution of protein function
US7432083B2 (en) 1997-01-24 2008-10-07 Bioinvent International Ab Method for in vitro molecular evolution of protein function
US6159687A (en) * 1997-03-18 2000-12-12 Novo Nordisk A/S Methods for generating recombined polynucleotides
US6541207B1 (en) 1997-03-18 2003-04-01 Novozymes A/S Methods for generating recombined polynucleotides
EP0920496A4 (en) * 1997-03-25 2001-05-02 California Inst Of Techn RECOMBINATION OF POLYNUCLEOTIDE SEQUENCES USING RANDOM OR DEFINED PRIMERS
US6177263B1 (en) * 1997-03-25 2001-01-23 California Institute Of Technology Recombination of polynucleotide sequences using random or defined primers
US6399383B1 (en) 1997-10-28 2002-06-04 Maxygen, Inc. Human papilloma virus vectors
US6596539B1 (en) 1997-10-31 2003-07-22 Maxygen, Inc. Modification of virus tropism and host range by viral genome shuffling
US7166466B2 (en) 1997-12-08 2007-01-23 California Institute Of Technology Method for creating polynucleotide and polypeptide sequences
EP2270234A1 (en) 1997-12-08 2011-01-05 California Institute of Technology Method for creating polynucleotide and polypeptide sequences
US8377681B2 (en) 1998-01-16 2013-02-19 Codexis Mayflower Holdings, Llc Evolution of whole cells and organisms by recursive sequence recombination
US6426185B1 (en) 1998-01-16 2002-07-30 Large Scale Biology Corporation Method of compiling a functional gene profile in a plant by transfecting a nucleic acid sequence of a donor plant into a different host plant in an anti-sense orientation
US6468745B1 (en) 1998-01-16 2002-10-22 Large Scale Biology Corporation Method for expressing a library of nucleic acid sequence variants and selecting desired traits
US6303848B1 (en) 1998-01-16 2001-10-16 Large Scale Biology Corporation Method for conferring herbicide, pest, or disease resistance in plant hosts
US7390619B1 (en) 1998-02-11 2008-06-24 Maxygen, Inc. Optimization of immunomodulatory properties of genetic vaccines
US6500617B1 (en) 1998-05-01 2002-12-31 Maxygen, Inc. Optimization of pest resistance genes using DNA shuffling
US6902918B1 (en) 1998-05-21 2005-06-07 California Institute Of Technology Oxygenase enzymes and screening method
US7153655B2 (en) 1998-06-16 2006-12-26 Alligator Bioscience Ab Method for in vitro molecular evolution of protein function involving the use of exonuclease enzyme and two populations of parent polynucleotide sequence
US6337186B1 (en) 1998-06-17 2002-01-08 Maxygen, Inc. Method for producing polynucleotides with desired properties
FR2782323A1 (fr) * 1998-08-12 2000-02-18 Proteus Procede de production in vitro de sequences polynucleotidiques recombinees, banques de sequences et sequences ainsi obtenues
US6605430B1 (en) 1998-08-12 2003-08-12 Maxygen, Inc. DNA shuffling of monooxygenase genes for production of industrial chemicals
EP1683861A1 (fr) * 1998-08-12 2006-07-26 Proteus Procédé d'obtention in vitro de séquences polynucléotidiques recombinées, banques de séquences et séquences ainsi obtenues
US7718786B2 (en) 1998-08-12 2010-05-18 Proteus Sa Process for obtaining recombined nucleotide sequences in vitro, libraries of sequences and sequences thus obtained
WO2000009727A3 (en) * 1998-08-12 2000-05-18 Maxygen Inc Dna shuffling to produce herbicide selective crops
US6991922B2 (en) 1998-08-12 2006-01-31 Proteus S.A. Process for in vitro creation of recombinant polynucleotide sequences by oriented ligation
WO2000009679A1 (fr) * 1998-08-12 2000-02-24 Proteus (S.A.) Procede d'obtention in vitro de sequences polynucleotidiques recombinees, banques de sequences et sequences ainsi obtenues
US6500639B2 (en) 1998-10-07 2002-12-31 Maxygen, Inc. DNA shuffling to produce nucleic acids for mycotoxin detoxification
WO2000020573A3 (en) * 1998-10-07 2000-07-20 Maxygen Inc Dna shuffling to produce nucleic acids for mycotoxin detoxification
US6483011B1 (en) 1998-11-10 2002-11-19 Maxygen, Inc. Modified ADP-glucose pyrophosphorylase for improvement and optimization of plant phenotypes
US7579146B2 (en) 1999-01-05 2009-08-25 Trustees Of Boston University Nucleic acid cloning
US6358712B1 (en) 1999-01-05 2002-03-19 Trustee Of Boston University Ordered gene assembly
US7439021B2 (en) 1999-01-05 2008-10-21 Trustees Of Boston University Nucleic acid cloning
US6423542B1 (en) 1999-01-19 2002-07-23 Maxygen, Inc. Oligonucleotide mediated nucleic acid recombination
US7058515B1 (en) 1999-01-19 2006-06-06 Maxygen, Inc. Methods for making character strings, polynucleotides and polypeptides having desired characteristics
US6961664B2 (en) 1999-01-19 2005-11-01 Maxygen Methods of populating data structures for use in evolutionary simulations
US7024312B1 (en) 1999-01-19 2006-04-04 Maxygen, Inc. Methods for making character strings, polynucleotides and polypeptides having desired characteristics
WO2000042561A3 (en) * 1999-01-19 2000-12-07 Maxygen Inc Oligonucleotide mediated nucleic acid recombination
US6319714B1 (en) 1999-01-19 2001-11-20 Maxygen, Inc. Oligonucleotide mediated nucleic acid recombination
US6521453B1 (en) 1999-01-19 2003-02-18 Maxygen, Inc. Oligonucloetide mediated nucleic acid recombination
US7421347B2 (en) 1999-01-19 2008-09-02 Maxygen, Inc. Identifying oligonucleotides for in vitro recombination
US7620502B2 (en) 1999-01-19 2009-11-17 Maxygen, Inc. Methods for identifying sets of oligonucleotides for use in an in vitro recombination procedure
US6917882B2 (en) 1999-01-19 2005-07-12 Maxygen, Inc. Methods for making character strings, polynucleotides and polypeptides having desired characteristics
EP2253704A1 (en) 1999-01-19 2010-11-24 Maxygen, Inc. Oligonucleotide mediated nucleic acid recombination
US6426224B1 (en) 1999-01-19 2002-07-30 Maxygen, Inc. Oligonucleotide mediated nucleic acid recombination
EP1073710A4 (en) * 1999-02-04 2007-12-19 Verenium Corp NON-STOCHASTIC DEVELOPMENT OF GENETIC VACCINES AND ENZYMES
EP2397549A2 (en) * 1999-02-04 2011-12-21 BP Corporation North America Inc. Non-stochastic generation of genetic vaccines and enzymes
US6376246B1 (en) 1999-02-05 2002-04-23 Maxygen, Inc. Oligonucleotide mediated nucleic acid recombination
US7384387B1 (en) 1999-02-11 2008-06-10 Maxygen, Inc. High throughput mass spectrometry
US6531316B1 (en) 1999-03-05 2003-03-11 Maxyag, Inc. Encryption of traits using split gene sequences and engineered genetic elements
WO2000053744A3 (en) * 1999-03-09 2001-01-18 Diversa Corp End selection in directed evolution
WO2000061740A1 (en) * 1999-04-10 2000-10-19 Maxygen, Inc. Modified lipid production
EP2865754A1 (en) * 1999-06-14 2015-04-29 BP Corporation North America Inc. Synthetic ligation reassembly in directed evolution
EP1192280A4 (en) * 1999-06-14 2006-04-05 Diversa Corp SYNTHETIC COMBINATION THROUGH LIGATION IN THE TARGETED EVOLUTION
USRE45349E1 (en) 1999-06-14 2015-01-20 Bp Corporation North America Inc. Synthetic ligation reassembly in directed evolution
AU2009212959B2 (en) * 1999-06-14 2013-08-15 Bp Corporation North America Inc. Synthetic ligation reassembly in directed evolution
US6605449B1 (en) 1999-06-14 2003-08-12 Diversa Corporation Synthetic ligation reassembly in directed evolution
WO2001004287A1 (en) * 1999-07-07 2001-01-18 Maxygen Aps A method for preparing modified polypeptides
US20070037254A1 (en) * 1999-07-12 2007-02-15 Genentech, Inc. Expression Vectors and Methods
US6951719B1 (en) 1999-08-11 2005-10-04 Proteus S.A. Process for obtaining recombined nucleotide sequences in vitro, libraries of sequences and sequences thus obtained
US7858340B2 (en) 1999-08-12 2010-12-28 Pfizer Inc. Polynucleotides and methods of directing the ratio of B2:B1 avermectins in Streptomyces avermitilis host cells
US6632673B1 (en) 1999-08-12 2003-10-14 Pfizer, Inc. Directing the ratio of B2:B1 avermectins in Streptomyces avermitilis host cells
WO2001012791A1 (en) * 1999-08-12 2001-02-22 Maxygen, Inc. Dna shuffling of dioxygenase genes for production of industrial chemicals
US6436675B1 (en) 1999-09-28 2002-08-20 Maxygen, Inc. Use of codon-varied oligonucleotide synthesis for synthetic shuffling
US7430477B2 (en) 1999-10-12 2008-09-30 Maxygen, Inc. Methods of populating data structures for use in evolutionary simulations
WO2001029211A3 (en) * 1999-10-19 2002-01-24 Enchira Biotechnology Corp Method for directed evolution by random chimeragenesis on transient templates
WO2001029212A1 (en) * 1999-10-19 2001-04-26 Enchira Biotechnology Corporation Methods for chimeragenesis of whole genomes or large polynucleotides
WO2001032712A3 (en) * 1999-11-03 2002-03-21 Maxygen Inc Antibody diversity generation
US6686515B1 (en) 1999-11-23 2004-02-03 Maxygen, Inc. Homologous recombination in plants
US7115712B1 (en) 1999-12-02 2006-10-03 Maxygen, Inc. Cytokine polypeptides
US7462469B2 (en) 2000-01-11 2008-12-09 Maxygen, Inc. Integrated system for diversity generation and screening
WO2001064864A3 (en) * 2000-02-28 2002-03-28 Maxygen Inc Single-stranded nucleic acid template-mediated recombination and nucleic acid fragment isolation
US6479262B1 (en) 2000-05-16 2002-11-12 Hercules, Incorporated Solid phase enzymatic assembly of polynucleotides
US6635453B2 (en) 2000-05-16 2003-10-21 Hercules Incorporated Methods for the enzymatic assembly of polynucleotides and identification of polynucleotides having desired characteristics
WO2001088173A3 (en) * 2000-05-16 2002-06-06 Hercules Inc Methods for the enzymatic assembly of polynucleotides and identification of polynucleotides having desired characteristics
US6759226B1 (en) 2000-05-24 2004-07-06 Third Wave Technologies, Inc. Enzymes for the detection of specific nucleic acid sequences
US7094875B2 (en) 2000-06-23 2006-08-22 Maxygen, Inc. Co-stimulatory polypeptides
US7612170B2 (en) 2000-06-23 2009-11-03 Maxygen, Inc. Co-stimulatory polypeptides
US7074590B2 (en) 2000-06-23 2006-07-11 Maxygen, Inc. Chimeric promoters
WO2002004630A3 (en) * 2000-07-10 2002-08-29 Ambion Inc Methods for recombinatorial nucleic acid synthesis
US6994963B1 (en) 2000-07-10 2006-02-07 Ambion, Inc. Methods for recombinatorial nucleic acid synthesis
US6858422B2 (en) 2000-07-13 2005-02-22 Codexis, Inc. Lipase genes
US7407786B2 (en) 2000-07-13 2008-08-05 Codexis, Inc. Lipase genes
WO2002006469A3 (en) * 2000-07-18 2002-08-15 Enchira Biotechnology Corp Methods of ligation mediated chimeragenesis utilizing populations of scaffold and donor nucleic acids
US7087415B2 (en) 2000-07-31 2006-08-08 Athena Biotechnologies, Inc. Methods and compositions for directed gene assembly
US9150661B2 (en) 2000-12-08 2015-10-06 Alexion Pharmaceuticals, Inc. Polypeptides and antibodies derived from chronic lymphocytic leukemia cells and uses thereof
US8840885B2 (en) 2000-12-08 2014-09-23 Alexion Pharmaceuticals, Inc. Methods for treating chronic lymphocytic leukemia
US8999328B2 (en) 2000-12-08 2015-04-07 Alexion Pharmaceuticals, Inc. Polypeptides and antibodies derived from chronic lymphocytic Leukemia cells and uses thereof
US6958213B2 (en) 2000-12-12 2005-10-25 Alligator Bioscience Ab Method for in vitro molecular evolution of protein function
US7282334B2 (en) 2000-12-12 2007-10-16 Alligator Bioscience, Ab Method for in vitro molecular evolution of protein function
US7563578B2 (en) 2000-12-12 2009-07-21 Alligator Bioscience Ab Method for in vitro molecular evolution of protein function
US7704715B2 (en) 2001-04-16 2010-04-27 California Institute Of Technology Peroxide-driven cytochrome P450 oxygenase variants
US7465567B2 (en) 2001-04-16 2008-12-16 California Institute Of Technology Peroxide-driven cytochrome P450 oxygenase variants
AU2002254773B2 (en) * 2001-05-03 2005-12-08 Rensselaer Polytechnic Institute Novel methods of directed evolution
WO2002090536A3 (en) * 2001-05-10 2004-03-04 Novozymes As A method for producing recombined polynucleotides
EP1421203A4 (en) * 2001-05-17 2005-06-01 Diversa Corp NEW ANTIGEN-BINDING MOLECULES FOR THERAPEUTIC, DIAGNOSTIC, PROPHYLACTIC, ENZYMATIC, INDUSTRIAL AND AGRICULTURAL APPLICATIONS AND METHOD FOR THE PRODUCTION AND SCREENING THEREOF
WO2002099080A3 (en) * 2001-06-05 2003-02-20 Gorilla Genomics Inc Methods for low background cloning of dna using long oligonucleotides
US8367386B2 (en) 2001-07-20 2013-02-05 California Institute Of Technology Cytochrome P450 oxygenases
US7226768B2 (en) 2001-07-20 2007-06-05 The California Institute Of Technology Cytochrome P450 oxygenases
US8076114B2 (en) 2001-07-20 2011-12-13 California Institute Of Technology Cytochrome P450 oxygenases
US9322001B2 (en) 2001-07-20 2016-04-26 California Institute Of Technology Cytochrome P450 oxygenases
US7691616B2 (en) 2001-07-20 2010-04-06 California Institute Of Technology Cytochrome P450 oxygenases
US8722371B2 (en) 2001-07-20 2014-05-13 California Institute Of Technology Cytochrome P450 oxygenases
WO2003010311A3 (en) * 2001-07-23 2003-12-11 Dsm Ip Assets Bv Process for preparing variant polynucleotides
US7262042B2 (en) 2001-12-20 2007-08-28 Henkel Kommanditgesellschaft Auf Aktien (Henkel Kgaa) Alkaline protease from Bacillus gibsonii (DSM 14393) and washing and cleaning products comprising said alkaline protease
US7449187B2 (en) 2001-12-20 2008-11-11 Henkel Kommanditgesellschaft Auf Aktien (Henkel Kgaa) Alkaline protease from Bacillus gibsonii (DSM 14391) and washing and cleaning products comprising said alkaline protease
US7569226B2 (en) 2001-12-22 2009-08-04 Henkel Kommanditgesellschaft Auf Aktien (Henkel Kgaa) Alkaline protease from Bacillus sp. (DSM 14392) and washing and cleaning products comprising said alkaline protease
EP2410049A1 (en) 2002-02-26 2012-01-25 Third Wave Technologies, Inc. RNA detection enzymes
EP2278509A1 (en) 2002-03-01 2011-01-26 Maxygen Inc. Methods, systems, and software for identifying functional biomolecules
WO2003075129A2 (en) 2002-03-01 2003-09-12 Maxygen, Inc. Methods, systems, and software for identifying functional bio-molecules
EP2390803A1 (en) 2002-03-01 2011-11-30 Codexis Mayflower Holdings, LLC Methods, systems, and software for identifying functional biomolecules
EP2315145A1 (en) 2002-03-01 2011-04-27 Codexis Mayflower Holdings, LLC Methods, systems, and software for identifying functional biomolecules
WO2003078583A2 (en) 2002-03-09 2003-09-25 Maxygen, Inc. Optimization of crossover points for directed evolution
EP2298871A1 (en) 2002-04-19 2011-03-23 Verenium Corporation Phospholipases, nucleic acids encoding them and methods for making and using them
US7262012B2 (en) 2002-05-17 2007-08-28 Alligator Bioscience Ab Method for in vitro molecular evolution of protein function using varied exonuclease digestion in two polynucleotide populations
EP2275536A1 (en) 2002-08-06 2011-01-19 Verdia, Inc. AP1 amine oxidase variants
EP1558748A4 (en) * 2002-11-01 2008-10-22 Promega Corp CELL SYSE COMPOSITIONS, USE METHOD, DEVICE AND KIT
EP3508578A1 (en) 2003-03-06 2019-07-10 BASF Enzymes, LLC Amylases, nucleic acids encoding them and methods for making and using them
EP3023498A1 (en) 2003-03-06 2016-05-25 BASF Enzymes LLC Amylases, nucleic acids encoding them and methods for making and using them
EP2194133A2 (en) 2003-03-06 2010-06-09 Verenium Corporation Amylases, nucleic acids encoding them and methods for making and using them
EP2853593A1 (en) 2003-03-07 2015-04-01 DSM IP Assets B.V. Hydrolases, nucleic acids encoding them and mehods for making and using them
EP2341136A1 (en) 2003-04-04 2011-07-06 Verenium Corporation Pectate lyases, Nucleic Acids encoding them and methods for making and using them
WO2004090099A2 (en) 2003-04-04 2004-10-21 Diversa Corporation Pectate lyases, nucleic acids encoding them and methods for making and using them
EP2322629A2 (en) 2003-04-29 2011-05-18 Pioneer Hi-Bred International Inc. Novel glyphosate-n-acetyltransferase (GAT) genes
EP2535414A1 (en) 2003-04-29 2012-12-19 Pioneer Hi-Bred International Inc. Novel glyphosate-n-acetyltransferase (gat) genes
US8741616B2 (en) 2003-06-17 2014-06-03 California Institute Of Technology Regio- and enantioselective alkane hydroxylation with modified cytochrome P450
US7863030B2 (en) 2003-06-17 2011-01-04 The California Institute Of Technology Regio- and enantioselective alkane hydroxylation with modified cytochrome P450
US8603949B2 (en) 2003-06-17 2013-12-10 California Institute Of Technology Libraries of optimized cytochrome P450 enzymes and the optimized P450 enzymes
US7524664B2 (en) 2003-06-17 2009-04-28 California Institute Of Technology Regio- and enantioselective alkane hydroxylation with modified cytochrome P450
US8343744B2 (en) 2003-06-17 2013-01-01 The California Institute Of Technology Regio- and enantioselective alkane hydroxylation with modified cytochrome P450
US9145549B2 (en) 2003-06-17 2015-09-29 The California Institute Of Technology Regio- and enantioselective alkane hydroxylation with modified cytochrome P450
EP2404931A1 (en) 2003-07-02 2012-01-11 Verenium Corporation Glucanases, nucleic acids encoding them and methods for making and using them
EP2404930A1 (en) 2003-07-02 2012-01-11 Verenium Corporation Glucanases, nucleic acids encoding them and methods for making and using them
EP2409981A1 (en) 2003-07-02 2012-01-25 Verenium Corporation Glucanases, nucleic acids encoding them and methods for making and using them
EP2404928A1 (en) 2003-07-02 2012-01-11 Verenium Corporation Glucanases, nucleic acids encoding them and methods for making and using them
EP2404929A1 (en) 2003-07-02 2012-01-11 Verenium Corporation Glucanases, nucleic acids encoding them and methods for making and using them
US7435570B2 (en) 2003-08-11 2008-10-14 California Institute Of Technology Thermostable peroxide-driven cytochrome P450 oxygenase variants and methods of use
WO2005021714A2 (en) 2003-08-11 2005-03-10 Diversa Corporation Laccases, nucleic acids encoding them and methods for making and using them
US7468267B2 (en) 2003-08-25 2008-12-23 Funzyme Biotechnologies Sa Fungal proteins and nucleic acids encoding same
US7943340B2 (en) 2003-08-25 2011-05-17 Funzyme Biotechnologies Sa Fungal dipeptidyl peptidase IV (DPPIV) enzyme for reagent use
US7354734B2 (en) 2003-08-25 2008-04-08 Funzyme Biotechnologies Sa Fungal proteins and nucleic acids encoding same
EP2184360A2 (en) 2004-02-25 2010-05-12 Pioneer Hi-Bred International Inc. Novel bacillus thuringiensis crystal polypeptides, polynucleotides, and compositions thereof
WO2005082077A2 (en) 2004-02-25 2005-09-09 Pioneer Hi-Bred International, Inc. Novel bacillus thuringiensis crystal polypeptides, polynucleotides, and compositions thereof
EP3190182A1 (en) 2004-03-08 2017-07-12 DSM IP Assets B.V. Phospholipases, nucleic acids encoding them and methods for making and using them
WO2005123929A2 (en) 2004-06-09 2005-12-29 Pioneer Hi-Bred International, Inc. Plastid transit peptides
WO2006009676A2 (en) 2004-06-16 2006-01-26 Diversa Corporation Compositions and methods for enzymatic decolorization of chlorophyll
EP2468853A1 (en) 2004-06-16 2012-06-27 Verenium Corporation Composition and methods for enzymatic decolorization of chlorophyll
EP2886658A1 (en) 2005-03-10 2015-06-24 BASF Enzymes LLC Lyase enzymes, nucleic acids encoding them and methods for making and using them
EP2949756A2 (en) 2005-03-15 2015-12-02 BP Corporation North America Inc. Cellulases, nucleic acids encoding them and methods for making and using them
WO2006101584A2 (en) 2005-03-15 2006-09-28 Diversa Corporation Cellulases, nucleic acids encoding them and methods for making and using them
US12258605B2 (en) 2005-03-28 2025-03-25 California Institute Of Technology Alkane oxidation by modified hydroxylases
US8715988B2 (en) 2005-03-28 2014-05-06 California Institute Of Technology Alkane oxidation by modified hydroxylases
US9404096B2 (en) 2005-03-28 2016-08-02 California Institute Of Technology Alkane oxidation by modified hydroxylases
US11214817B2 (en) 2005-03-28 2022-01-04 California Institute Of Technology Alkane oxidation by modified hydroxylases
US10648006B2 (en) 2005-03-28 2020-05-12 California Institute Of Technology Alkane oxidation by modified hydroxylases
US9963720B2 (en) 2005-03-28 2018-05-08 California Institute Of Technology Alkane oxidation by modified hydroxylases
US8709415B2 (en) 2006-01-12 2014-04-29 Alexion Pharmaceuticals, Inc. Antibodies to OX-2/CD200 and uses thereof
US9000133B2 (en) 2006-01-12 2015-04-07 Alexion Pharmaceuticals, Inc. Antibodies to OX-2/CD200 and uses thereof
EP2216403A2 (en) 2006-02-02 2010-08-11 Verenium Corporation Esterases and related nucleic acids and methods
EP2444490A1 (en) 2006-02-10 2012-04-25 Verenium Corporation Cellulolytic enzymes, nucleic acids encoding them and methods for making and using them
EP2415864A1 (en) 2006-02-10 2012-02-08 Verenium Corporation Oligomerase-2 (or beta-xylosidase) enzymes, nucleic acids encoding them and methods for making and using them
EP2450439A1 (en) 2006-02-10 2012-05-09 Verenium Corporation Cellulolytic enzymes, nucleic acids encoding them and methods for making and using them
EP2447363A1 (en) 2006-02-10 2012-05-02 Verenium Corporation Cellucloytic enzymes, nucleic acids encoding them and methods for making and using them
EP2444487A1 (en) 2006-02-10 2012-04-25 Verenium Corporation Cellulolytic enzymes, nucleic acids encoding them and methods for making and using them
EP2420570A1 (en) 2006-02-10 2012-02-22 Verenium Corporation Arabinofuranosidase enzymes, nucleic acids encoding them and methods for making and using them
EP2444489A1 (en) 2006-02-10 2012-04-25 Verenium Corporation Cellucloytic enzymes, nucleic acids encoding them and methods for making and using them
EP2444488A1 (en) 2006-02-10 2012-04-25 Verenium Corporation Cellucloytic enzymes, nucleic acids encoding them and methods for making and using them
WO2007095398A2 (en) 2006-02-14 2007-08-23 Verenium Corporation Xylanases, nucleic acids encoding them and methods for making and using them
EP2548954A1 (en) 2006-02-14 2013-01-23 Verenium Corporation Xylanases, nucleic acids encoding them and methods for making and using them
EP2548955A1 (en) 2006-02-14 2013-01-23 Verenium Corporation Xylanases, nucleic acids encoding them and methods for making and using them
EP2548956A1 (en) 2006-02-14 2013-01-23 Verenium Corporation Xylanases, nucleic acids encoding them and methods for making and using them
EP2385108A1 (en) 2006-03-07 2011-11-09 Verenium Corporation Aldolases, nucleic acids encoding them and methods for making and using them
EP2112227A1 (en) 2006-03-07 2009-10-28 Cargill, Incorporated Aldolases, nucleic acids encoding them and methods for making and using them
EP3153580A2 (en) 2006-03-07 2017-04-12 BASF Enzymes LLC Aldolases, nucleic acids encoding them and methods for making and using them
EP2316962A1 (en) 2006-03-07 2011-05-04 Cargill, Incorporated Aldolases, nucleic acids encoding them and methods for making and using them
EP2388316A2 (en) 2006-03-07 2011-11-23 Verenium Corporation Aldolases, nucleic acids encoding them and methods for making and using them
EP2322643A1 (en) 2006-03-07 2011-05-18 Cargill, Incorporated Aldolases, nucleic acids encoding them and methods for making and using them
EP2671946A1 (en) 2006-06-30 2013-12-11 Bristol-Myers Squibb Company Polynucleotides encoding novel PCSK9 variants
EP2639301A2 (en) 2006-06-30 2013-09-18 Bristol-Myers Squibb Company Polynucleotides encoding novel PCSK9 variants
WO2008105797A2 (en) 2006-06-30 2008-09-04 Bristol-Myers Squibb Company Polynucleotides encoding novel pcsk9 variants
EP2444413A1 (en) 2006-08-04 2012-04-25 Verenium Corporation Methods for oil or gas well drilling, washing and/or fracturing
US8026085B2 (en) 2006-08-04 2011-09-27 California Institute Of Technology Methods and systems for selective fluorination of organic molecules
US8252559B2 (en) 2006-08-04 2012-08-28 The California Institute Of Technology Methods and systems for selective fluorination of organic molecules
EP2617819A2 (en) 2006-09-21 2013-07-24 Verenium Corporation Phytases, nucleic acids encoding them and methods for making and using them
EP2617816A2 (en) 2006-09-21 2013-07-24 Verenium Corporation Phytases, nucleic acids encoding them and methods for making and using them
EP2617729A2 (en) 2006-09-21 2013-07-24 Verenium Corporation Phytases, nucleic acids encoding them and methods for making and using them
EP2397486A1 (en) 2006-09-21 2011-12-21 Verenium Corporation Phytases, nucleic acids encoding them and methods for making and using them
WO2008036863A2 (en) 2006-09-21 2008-03-27 Verenium Corporation Phospholipases, nucleic acids encoding them and methods for making and using them
EP2617823A2 (en) 2006-09-21 2013-07-24 Verenium Corporation Phytases, nucleic acids encoding them and methods for making and using them
EP2620495A2 (en) 2006-09-21 2013-07-31 Verenium Corporation Phytases, nucleic acids encoding them and methods for making and using them
EP2617817A2 (en) 2006-09-21 2013-07-24 Verenium Corporation Phytases, nucleic acids encoding them and methods for making and using them
EP2617815A2 (en) 2006-09-21 2013-07-24 Verenium Corporation Phytases, nucleic acids encoding them and methods for making and using them
EP2617728A2 (en) 2006-09-21 2013-07-24 Verenium Corporation Phytases, nucleic acids encoding them and methods for making and using them
EP2617820A2 (en) 2006-09-21 2013-07-24 Verenium Corporation Phytases, nucleic acids encoding them and methods for making and using them
EP2617821A2 (en) 2006-09-21 2013-07-24 Verenium Corporation Phytases, nucleic acids encoding them and methods for making and using them
EP2479266A1 (en) 2006-12-21 2012-07-25 Verenium Corporation Amylases and glucoamylases, nucleic acids encoding them and methods for making and using them
EP2479267A1 (en) 2006-12-21 2012-07-25 Verenium Corporation Amylases and glucoamylases, nucleic acids encoding them and methods for making and using them
WO2008080093A2 (en) 2006-12-21 2008-07-03 Verenium Corporation Amylases and glucoamylases, nucleic acids encoding them and methods for making and using them
EP3101128A1 (en) 2006-12-21 2016-12-07 BASF Enzymes LLC Amylases and glucoamylases, nucleic acids encoding them and methods for making and using them
EP3540053A1 (en) 2006-12-21 2019-09-18 BASF Enzymes, LLC Amylases and glucoamylases, nucleic acids encoding them and methods for making and using them
DE102007003143A1 (de) 2007-01-16 2008-07-17 Henkel Kgaa Neue Alkalische Protease aus Bacillus gibsonii und Wasch- und Reinigungsmittel enthaltend diese neue Alkalische Protease
WO2008095033A2 (en) 2007-01-30 2008-08-07 Verenium Corporation Enzymes for the treatment of lignocellulosics, nucleic acids encoding them and methods for making and using them
WO2008098198A2 (en) 2007-02-08 2008-08-14 The California Institute Of Technology Alkane oxidation by modified hydroxylases
WO2008103248A1 (en) 2007-02-08 2008-08-28 Codexis, Inc. Ketoreductases and uses thereof
EP2559702A1 (en) 2007-02-08 2013-02-20 Domantis Limited Antibody single variable domains against serum albumin
EP2559703A1 (en) 2007-02-08 2013-02-20 Domantis Limited Antibody single variable domains against serum albumin
EP2559704A1 (en) 2007-02-08 2013-02-20 Domantis Limited Antibody single variable domains against serum albumin
US8986684B2 (en) 2007-07-25 2015-03-24 Alexion Pharmaceuticals, Inc. Methods and compositions for treating autoimmune disease
WO2009029554A2 (en) 2007-08-24 2009-03-05 Codexis, Inc. Improved ketoreductase polypeptides for the stereoselective production of (r)-3-hydroxythiolane
EP2708602A2 (en) 2007-10-03 2014-03-19 Verenium Corporation Xylanases, nucleic acids encoding them and methods for making and using them
WO2009045627A2 (en) 2007-10-03 2009-04-09 Verenium Corporation Xylanases, nucleic acids encoding them and methods for making and using them
DE102007051092A1 (de) 2007-10-24 2009-04-30 Henkel Ag & Co. Kgaa Subtilisin aus Becillus pumilus und Wasch- und Reinigungsmittel enthaltend dieses neue Subtilisin
WO2009058564A2 (en) 2007-11-01 2009-05-07 Maxygen, Inc. Immunosuppressive polypeptides and nucleic acids
EP2385065A1 (en) 2007-11-01 2011-11-09 Perseid Therapeutics LLC Immunosuppressive polypeptides and nucleic acids
EP2612867A1 (en) 2007-11-01 2013-07-10 Perseid Therapeutics LLC Immunosuppressive polypeptides and nucleic acids
EP2612868A1 (en) 2007-11-01 2013-07-10 Perseid Therapeutics LLC Immunosuppressive polypeptides and nucleic acids
EP2865750A2 (en) 2008-01-03 2015-04-29 BASF Enzymes LLC Transferases and oxidoreductases, nucleic acids encoding them and methods for making and using them
EP2706122A2 (en) 2008-01-03 2014-03-12 Verenium Corporation Isomerases, nucleic acids encoding them and methods for making and using them
WO2009088949A1 (en) 2008-01-03 2009-07-16 Verenium Corporation Transferases and oxidoreductases, nucleic acids encoding them and methods for making and using them
US10155943B2 (en) 2008-02-12 2018-12-18 Codexis, Inc. Method of generating an optimized, diverse population of variants
US8504498B2 (en) 2008-02-12 2013-08-06 Codexis, Inc. Method of generating an optimized, diverse population of variants
US8768871B2 (en) 2008-02-12 2014-07-01 Codexis, Inc. Method of generating an optimized, diverse population of variants
EP3115459A2 (en) 2008-05-23 2017-01-11 E. I. du Pont de Nemours and Company Novel dgat genes for increased seed storage lipid production and altered fatty acid profiles in oilseed plants
WO2009152336A1 (en) 2008-06-13 2009-12-17 Codexis, Inc. Method of synthesizing polynucleotide variants
US8383346B2 (en) 2008-06-13 2013-02-26 Codexis, Inc. Combined automated parallel synthesis of polynucleotide variants
EP3023494A1 (en) 2008-06-13 2016-05-25 Codexis, Inc. Method of synthesizing polynucleotide variants
US8859784B2 (en) 2008-06-24 2014-10-14 Codexis, Inc. Stereomerically pure fused bicyclic proline compounds useful for preparing hepatitis C protease inhibitors
EP2481737A1 (en) 2008-06-24 2012-08-01 Merck Sharp & Dohme Corp. Biocatalytic processes for the preparation of substantially stereomerically pure fused bicyclic proline compounds
US8178333B2 (en) 2008-06-24 2012-05-15 Codexis, Inc. Biocatalytic processes for the preparation of substantially stereomerically pure fused bicyclic proline compounds
US8574876B2 (en) 2008-06-24 2013-11-05 Codexis, Inc. Biocatalytic processes for the preparation of stereomerically pure fused bicyclic proline compounds
US8288131B2 (en) 2008-08-27 2012-10-16 Codexis, Inc. Ketoreductase polypeptides and uses thereof
US8455230B2 (en) 2008-08-27 2013-06-04 Codexis, Inc. Polynucleotides encoding engineered ketoreductase polypeptides
US8288141B2 (en) 2008-08-27 2012-10-16 Codexis, Inc. Ketoreductase polypeptides for the production of 3-aryl-3-hydroxypropanamine from a 3-aryl-3-ketopropanamine
WO2010025238A2 (en) 2008-08-27 2010-03-04 Codexis, Inc. Ketoreductase polypeptides for the production of a 3-aryl-3-hydroxypropanamine from a 3-aryl-3-ketopropanamine
US8426178B2 (en) 2008-08-27 2013-04-23 Codexis, Inc. Ketoreductase polypeptides for the production of a 3-aryl-3-hydroxypropanamine from a 3-aryl-3-ketopropanamine
US8673607B2 (en) 2008-08-27 2014-03-18 Codexis, Inc. Ketoreductase polypeptides for the production of a 3-aryl-3-hydroxypropanamine from a 3-aryl-3-ketopropanamine
US10988739B2 (en) 2008-08-29 2021-04-27 Codexis, Inc. Ketoreductase polypeptides
US8956840B2 (en) 2008-08-29 2015-02-17 Codexis, Inc. Engineered ketoreductase polypeptides
US9139820B2 (en) 2008-08-29 2015-09-22 Codexis, Inc. Ketoreductase polypeptides
US10246687B2 (en) 2008-08-29 2019-04-02 Codexis, Inc. Ketoreductase polypeptides
US10544401B2 (en) 2008-08-29 2020-01-28 Codexis, Inc. Ketoreductase polypeptides
US8273554B2 (en) 2008-08-29 2012-09-25 Codexis, Inc. Ketoreductase polypeptides for the stereoselective production of (4S)-3-[(5S)-5-(4-fluorophenyl)-5-hydroxypentanoyl]-4-phenyl-1,3-oxazolidin-2-one
WO2010025395A2 (en) 2008-08-29 2010-03-04 Verenium Corporation Hydrolases, nucleic acids encoding them and methods for making and using them
US8415126B2 (en) 2008-08-29 2013-04-09 Codexis, Inc. Polynucleotides encoding recombinant ketoreductase polypeptides
US12365881B2 (en) 2008-08-29 2025-07-22 Codexis, Inc. Ketoreductase polypeptides
US10047348B2 (en) 2008-08-29 2018-08-14 Codexis, Inc. Ketoreductase polypeptides
US9422530B2 (en) 2008-08-29 2016-08-23 Codexis, Inc. Ketoreductase polypeptides
US9796964B2 (en) 2008-08-29 2017-10-24 Codexis, Inc. Ketoreductase polypeptides
EP3460061A1 (en) 2008-09-26 2019-03-27 Tocagen Inc. Recombinant replication competent murine leukemia gamma-retrovirus (mlv) for the expression of heat-stabilized cytosine deaminase
WO2010081053A2 (en) 2009-01-08 2010-07-15 Codexis, Inc. Transaminase polypeptides
EP3354727A1 (en) 2009-01-08 2018-08-01 Codexis, Inc. Transaminase polypeptides
US8715996B2 (en) 2009-02-26 2014-05-06 Codexis, Inc. Beta-glucosidase variant enzymes and related polynucleotides
US9005946B2 (en) 2009-03-17 2015-04-14 Codexis, Inc. Variant endoglucanases and related polynucleotides
US9464278B2 (en) 2009-03-17 2016-10-11 Codexis, Inc. Variant endoglucanases and related polynucleotides
WO2010107644A2 (en) 2009-03-17 2010-09-23 Codexis, Inc. Variant endoglucanases and related polynucleotides
WO2010120557A1 (en) 2009-03-31 2010-10-21 Codexis, Inc. Improved endoglucanases
EP2698374A1 (en) 2009-05-21 2014-02-19 Verenium Corporation Phytases, nucleic acids encoding them and methods for making and using them
WO2010135588A2 (en) 2009-05-21 2010-11-25 Verenium Corporation Phytases, nucleic acids encoding them and methods for making and using them
WO2010144103A1 (en) 2009-06-11 2010-12-16 Codexis, Inc. Combined automated parallel synthesis of polynucleotide variants
EP3026113A2 (en) 2009-06-11 2016-06-01 Codexis, Inc. Combined automated parallel synthesis of polynucleotide variants
WO2010148128A1 (en) 2009-06-16 2010-12-23 Codexis, Inc. Beta-glucosidase variant enzymes and related polynucleotides
US9029112B2 (en) 2009-06-22 2015-05-12 Codexis, Inc. Ketoreductase-mediated stereoselective route to alpha chloroalcohols
WO2011005527A2 (en) 2009-06-22 2011-01-13 Codexis, Inc. Ketoreductase-mediated stereoselective route to alpha chloroalcohols
US9404092B2 (en) 2009-06-22 2016-08-02 Codexis, Inc. Ketoreductase-mediated stereoselective route to alpha chloroalcohols
US8796002B2 (en) 2009-06-22 2014-08-05 Codexis, Inc. Polypeptides for a ketoreductase-mediated stereoselective route to alpha chloroalcohols
US9296992B2 (en) 2009-06-22 2016-03-29 Codexis, Inc. Ketoreductase-mediated stereoselective route to alpha chloroalcohols
EP3409765A2 (en) 2009-06-22 2018-12-05 Codexis, Inc. Ketoreductase-mediated stereoselective route to alpha chloroalcohols
US8614081B2 (en) 2009-07-23 2013-12-24 Codexis, Inc. Nitrilase biocatalysts
WO2011022548A2 (en) 2009-08-19 2011-02-24 Codexis, Inc. Ketoreductase polypeptides for the preparation of phenylephrine
US11345898B2 (en) 2009-08-19 2022-05-31 Codexis, Inc. Ketoreductase polypeptides for the preparation of phenylephrine
US12480100B2 (en) 2009-08-19 2025-11-25 Codexis, Inc. Ketoreductase polypeptides for the preparation of phenylephrine
US10870835B2 (en) 2009-08-19 2020-12-22 Codexis, Inc. Ketoreductase polypeptides for the preparation of phenylephrine
US10358631B2 (en) 2009-08-19 2019-07-23 Codexis, Inc. Ketoreductase polypeptides for the preparation of phenylephrine
US9834758B2 (en) 2009-08-19 2017-12-05 Codexis, Inc. Ketoreductase polypeptides for the preparation of phenylephrine
US9102959B2 (en) 2009-08-19 2015-08-11 Codexis, Inc. Ketoreductase polypeptides for the preparation of phenylephrine
US10590396B2 (en) 2009-08-19 2020-03-17 Codexis, Inc. Ketoreductase polypeptides for the preparation of phenylephrine
US12031159B2 (en) 2009-08-19 2024-07-09 Codexis, Inc. Ketoreductase polypeptides for the preparation of phenylephrine
WO2011022597A1 (en) 2009-08-20 2011-02-24 Pioneer Hi-Bred International, Inc. Functional expression of shuffled yeast nitrate transporter (ynti) in maize to improve nitrate uptake under low nitrate environment
WO2011028708A1 (en) 2009-09-04 2011-03-10 Codexis, Inc. Variant cbh2 cellulases and related polynucleotides
US9102927B2 (en) 2009-09-04 2015-08-11 Codexis, Inc. Variant CBH2 cellulases and related polynucleotides
US8785170B2 (en) 2009-09-04 2014-07-22 Codexis, Inc. Variant CBH2 cellulases and related polynucleotides
EP3301208A1 (en) 2009-09-18 2018-04-04 Codexis, Inc. Reduced codon mutagenesis
US9045712B2 (en) 2009-10-16 2015-06-02 Bunge Global Innovation, Llc Oil degumming methods
WO2011046815A1 (en) 2009-10-16 2011-04-21 Bunge Oils, Inc. Oil degumming methods
WO2011046812A1 (en) 2009-10-16 2011-04-21 Verenium Corporation Phospholipases, nucleic acids encoding them and methods for making and using them
US9512382B2 (en) 2009-10-16 2016-12-06 Bunge Global Innovation, Llc Oil degumming methods
WO2011066187A1 (en) 2009-11-25 2011-06-03 Codexis, Inc. Recombinant thermoascus aurantiacus beta-glucosidase variants for production of fermentable sugars from cellulosic biomass
US8652813B2 (en) 2009-11-25 2014-02-18 Codexis, Inc. Recombinant Thermoascus aurantiacus β-glucosidase variants
EP2706119A1 (en) 2009-11-25 2014-03-12 Codexis, Inc. Recombinant beta-glucosidase variants for production of soluble sugars from cellulosic biomass
US8993277B2 (en) 2009-11-25 2015-03-31 Codexis, Inc. Polynucleotides encoding beta-glucosidase variants
WO2011071982A2 (en) 2009-12-08 2011-06-16 Codexis, Inc. Synthesis of prazole compounds
WO2011082304A1 (en) 2009-12-31 2011-07-07 Pioneer Hi-Bred International, Inc. Engineering plant resistance to diseases caused by pathogens
US9080192B2 (en) 2010-02-10 2015-07-14 Codexis, Inc. Processes using amino acid dehydrogenases and ketoreductase-based cofactor regenerating system
US10196667B2 (en) 2010-02-10 2019-02-05 Codexis, Inc. Processes using amino acid dehydrogenases and ketoreductase-based cofactor regenerating system
US11193157B2 (en) 2010-02-10 2021-12-07 Codexis, Inc. Processes using amino acid dehydrogenases and ketoreductase-based cofactor regenerating system
US9714439B2 (en) 2010-02-10 2017-07-25 Codexis, Inc. Processes using amino acid dehydrogenases and ketoreductase-based cofactor regenerating system
US9394551B2 (en) 2010-02-10 2016-07-19 Codexis, Inc. Processes using amino acid dehydrogenases and ketoreductase-based cofactor regenerating system
US10604781B2 (en) 2010-02-10 2020-03-31 Codexis, Inc. Processes using amino acid dehydrogenases and ketoreductase-based cofactor regenerating system
US8715962B2 (en) 2010-03-31 2014-05-06 Codexis, Inc. Production of geranyl diphosphate
US10544400B2 (en) 2010-05-04 2020-01-28 Codexis, Inc. Biocatalysts for ezetimibe synthesis
US9040262B2 (en) 2010-05-04 2015-05-26 Codexis, Inc. Biocatalysts for ezetimibe synthesis
WO2011140219A1 (en) 2010-05-04 2011-11-10 Codexis, Inc. Biocatalysts for ezetimibe synthesis
US10053673B2 (en) 2010-05-04 2018-08-21 Codexis, Inc. Biocatalysts for Ezetimibe synthesis
US12110512B2 (en) 2010-05-04 2024-10-08 Codexis, Inc. Biocatalysts for ezetimibe synthesis
US10995320B2 (en) 2010-05-04 2021-05-04 Codexis, Inc. Biocatalysts for Ezetimibe synthesis
US9644189B2 (en) 2010-05-04 2017-05-09 Codexis, Inc. Biocatalysts for ezetimibe synthesis
US9388391B2 (en) 2010-05-04 2016-07-12 Codexis, Inc. Biocatalysts for Ezetimibe synthesis
WO2011143274A1 (en) 2010-05-10 2011-11-17 Perseid Therapeutics Polypeptide inhibitors of vla4
US9752171B2 (en) 2010-05-28 2017-09-05 Codexis, Inc. Pentose fermentation by a recombinant microorganism
WO2011159910A2 (en) 2010-06-17 2011-12-22 Codexis, Inc. Biocatalysts and methods for the synthesis of (s)-3-(1-aminoethyl)-phenol
WO2012006114A2 (en) 2010-06-28 2012-01-12 Codexis, Inc. Fatty alcohol forming acyl reductases (fars) and methods of use thereof
WO2012003299A2 (en) 2010-06-30 2012-01-05 Codexis, Inc. Highly stable beta-class carbonic anhydrases useful in carbon capture systems
WO2012021785A1 (en) 2010-08-13 2012-02-16 Pioneer Hi-Bred International, Inc. Compositions and methods comprising sequences having hydroxyphenylpyruvate dioxygenase (hppd) activity
US9006460B2 (en) 2010-08-16 2015-04-14 Cardiome International Ag Process for preparing aminocyclohexyl ether compounds
US8877474B2 (en) 2010-08-20 2014-11-04 Codexis, Inc. GH61 glycoside hydrolase protein variants and cofactors that enhance GH61 activity
US9493802B2 (en) 2010-08-20 2016-11-15 Codexis, Inc. Use of glycohydrolase 61 protein variants with improved thermostability for processing cellulose
WO2012024698A1 (en) 2010-08-20 2012-02-23 Codexis, Inc. Use of glycoside hydrolase 61 family proteins in processing of cellulose
US9322027B2 (en) 2010-08-20 2016-04-26 Shell Oil Company Expression constructs comprising fungal promoters
WO2012078800A2 (en) 2010-12-08 2012-06-14 Codexis, Inc. Biocatalysts and methods for the synthesis of armodafinil
US9169468B2 (en) 2011-03-30 2015-10-27 Codexis, Inc. Pentose fermentation by a recombinant microorganism
US9365878B2 (en) 2011-04-13 2016-06-14 Codexis, Inc. Biocatalytic process for preparing eslicarbazepine and analogs thereof
US9102963B2 (en) 2011-04-13 2015-08-11 Codexis, Inc. Biocatalytic process for preparing eslicarbazepine and analogs thereof
US9963683B2 (en) 2011-04-13 2018-05-08 Codexis, Inc. Biocatalytic process for preparing eslicarbazepine and analogs thereof
US9605290B2 (en) 2011-04-13 2017-03-28 Codexis, Inc. Biocatalytic process for preparing eslicarbazepine and analogs thereof
WO2012142302A2 (en) 2011-04-13 2012-10-18 Codexis, Inc. Biocatalytic process for preparing eslicarbazepine and analogs thereof
US9045745B2 (en) 2011-06-30 2015-06-02 Codexis, Inc. Pentose fermentation by a recombinant microorganism
US8778652B2 (en) 2011-06-30 2014-07-15 Codexis, Inc. Pentose fermentation by a recombinant microorganism
US9322007B2 (en) 2011-07-22 2016-04-26 The California Institute Of Technology Stable fungal Cel6 enzyme variants
US8951758B2 (en) 2011-08-22 2015-02-10 Codexis, Inc. GH61 glycoside hydrolase protein variants and cofactors that enhance GH61 activity
WO2013028701A1 (en) 2011-08-22 2013-02-28 Codexis, Inc. Gh61 glycoside hydrolase protein variants and cofactors that enhance gh61 activity
US12163162B2 (en) 2011-09-08 2024-12-10 Codexis, Inc. Biocatalysts and methods for the synthesis of substituted lactams
US11597918B2 (en) 2011-09-08 2023-03-07 Codexis, Inc. Biocatalysts and methods for the synthesis of substituted lactams
US10858635B2 (en) 2011-09-08 2020-12-08 Codexis, Inc. Biocatalysts and methods for the synthesis of substituted lactams
WO2013036861A1 (en) 2011-09-08 2013-03-14 Codexis, Inc Biocatalysts and methods for the synthesis of substituted lactams
US10633640B2 (en) 2011-09-08 2020-04-28 Codexis, Inc. Biocatalysts and methods for the synthesis of substituted lactams
US9624478B2 (en) 2011-09-08 2017-04-18 Codexis, Inc. Biocatalysts and methods for the synthesis of substituted lactams
US9109209B2 (en) 2011-09-08 2015-08-18 Codexis, Inc. Biocatalysts and methods for the synthesis of substituted lactams
US9434919B2 (en) 2011-09-30 2016-09-06 Codexis, Inc. Fungal proteases
US9139819B2 (en) 2011-11-18 2015-09-22 Codexis, Inc. Biocatalysts for the preparation of hydroxy substituted carbamates
US10253303B2 (en) 2011-11-18 2019-04-09 Codexis, Inc. Biocatalysts for the preparation of hydroxy substituted carbamates
US11713451B2 (en) 2011-11-18 2023-08-01 Codexis, Inc. Biocatalysts for the preparation of hydroxy substituted carbamates
US10100287B2 (en) 2011-11-18 2018-10-16 Codexis, Inc. Biocatalysts for the preparation of hydroxy substituted carbamates
US9422531B2 (en) 2011-11-18 2016-08-23 Codexis, Inc. Biocatalysts for the preparation of hydroxy substituted carbamates
US10851351B2 (en) 2011-11-18 2020-12-01 Codexis, Inc. Biocatalysts for the preparation of hydroxy substituted carbamates
US9803178B2 (en) 2011-11-18 2017-10-31 Codexis, Inc. Biocatalysts for the preparation of hydroxy substituted carbamates
US12241093B2 (en) 2011-11-18 2025-03-04 Codexis, Inc. Biocatalysts for the preparation of hydroxy substituted carbamates
WO2013074650A1 (en) 2011-11-18 2013-05-23 Codexis, Inc. Biocatalysts for the preparation of hydroxy substituted carbamates
US9611462B2 (en) 2011-12-20 2017-04-04 Codexis, Inc. Endoglucanase 1B (EG1B) variants
US9388395B2 (en) 2012-03-23 2016-07-12 Codexis, Inc. Biocatalysts and methods for synthesizing derivatives of tryptamine and tryptamine analogs
US12378537B2 (en) 2012-03-23 2025-08-05 Codexis, Inc. Biocatalysts and methods for synthesizing derivatives of tryptamine and tryptamine analogs
US9708588B2 (en) 2012-03-23 2017-07-18 Codexis, Inc. Biocatalysts and methods for synthesizing derivatives of tryptamine and tryptamine analogs
US11098291B2 (en) 2012-03-23 2021-08-24 Codexis, Inc. Biocatalysts and methods for synthesizing derivatives of tryptamine and tryptamine analogs
US9139821B2 (en) 2012-03-23 2015-09-22 Codexis, Inc. Biocatalysts and methods for synthesizing derivatives of tryptamine and tryptamine analogs
US10544402B2 (en) 2012-03-23 2020-01-28 Codexis Inc. Biocatalysts and methods for synthesizing derivatives of tryptamine and tryptamine analogs
WO2013142770A1 (en) 2012-03-23 2013-09-26 Codexis, Inc. Biocatalysts and methods for synthesizing derivatives of tryptamine and tryptamine analogs
WO2013166113A1 (en) 2012-05-04 2013-11-07 E. I. Du Pont De Nemours And Company Compositions and methods comprising sequences having meganuclease activity
US10370688B2 (en) 2012-05-08 2019-08-06 Codexis, Inc. Methods for hydroxylyation of chemical compounds
WO2013169725A2 (en) 2012-05-08 2013-11-14 Codexis, Inc. Biocatalysts and methods for hydroxylation of chemical compounds
US10731189B2 (en) 2012-05-08 2020-08-04 Codexis, Inc. Engineered proline hydroxylase polynucleotides and methods
US12247234B2 (en) 2012-05-08 2025-03-11 Codexis, Inc. Biocatalysts and methods for hydroxylation of chemical compounds
US11549132B2 (en) 2012-05-08 2023-01-10 Codexis, Inc. Biocatalysts and methods for hydroxylation of chemical compounds
US10995349B2 (en) 2012-05-08 2021-05-04 Codexis, Inc. Engineered proline hydroxylase polypeptides and methods
US9790527B2 (en) 2012-05-08 2017-10-17 Codexis, Inc. Engineered proline hydroxylase polypeptides
WO2013170050A1 (en) 2012-05-11 2013-11-14 Codexis, Inc. Engineered imine reductases and methods for the reductive amination of ketone and amine compounds
US8956844B2 (en) 2012-06-11 2015-02-17 Codexis, Inc. Fungal xylanases and xylosidases
WO2013188305A2 (en) 2012-06-11 2013-12-19 Codexis, Inc. Fungal beta-xylosidase variants
US8980578B2 (en) 2012-06-11 2015-03-17 Codexis, Inc. Fungal beta-xylosidase variants
US9476077B2 (en) 2012-06-11 2016-10-25 Codexis, Inc. Fungal beta-xylosidase variants
EP3450549A1 (en) 2012-10-29 2019-03-06 University Of Rochester Artemisinin derivatives, methods for their preparation and their use as antimalarial agents
US9611515B2 (en) 2012-11-20 2017-04-04 Codexis, Inc. Pentose fermentation by a recombinant microorganism
EP3406594A1 (en) 2012-12-07 2018-11-28 Merck Sharp & Dohme Corp. Biocatalytic transamination process
US10036007B2 (en) 2012-12-11 2018-07-31 Celemics, Inc. Method of synthesis of gene library using codon randomization and mutagenesis
CN104955961A (zh) * 2012-12-11 2015-09-30 塞勒密斯株式会社 利用密码子随机化和诱变来合成基因文库的方法
EP2921560A4 (en) * 2012-12-11 2016-05-04 Celemics Inc METHOD FOR SYNTHESIZING A LIBRARY OF GENES USING A COMBINATION OF CODONS AND MUTAGENESIS
US12305201B2 (en) 2012-12-21 2025-05-20 Codexis, Inc. Engineered biocatalysts and methods for synthesizing chiral amines
WO2014099730A1 (en) 2012-12-21 2014-06-26 Codexis, Inc. Engineered biocatalysts and methods for synthesizing chiral amines
US11732248B2 (en) 2012-12-21 2023-08-22 Codexis, Inc. Engineered biocatalysts and methods for synthesizing chiral amines
US10435674B2 (en) 2012-12-21 2019-10-08 Codexis, Inc. Engineered biocatalysts and methods for synthesizing chiral amines
US10526587B2 (en) 2012-12-21 2020-01-07 Codexis, Inc. Engineered biocatalysts and methods for synthesizing chiral amines
US9902943B2 (en) 2012-12-21 2018-02-27 Codexis, Inc. Engineered biocatalysts and methods for synthesizing chiral amines
US11034939B2 (en) 2012-12-21 2021-06-15 Codexis, Inc. Engineered biocatalysts and methods for synthesizing chiral amines
WO2014113521A1 (en) 2013-01-18 2014-07-24 Codexis, Inc. Engineered biocatalysts useful for carbapenem synthesis
US9540622B2 (en) 2013-01-18 2017-01-10 Codexis, Inc. Engineered biocatalysts useful for carbapenem synthesis
US9663771B2 (en) 2013-01-18 2017-05-30 Codexis, Inc. Engineered biocatalysts useful for carbapenem synthesis
EP4398255A2 (en) 2013-01-31 2024-07-10 Codexis, Inc. Methods, systems, and software for identifying bio-molecules with interacting components
EP4414988A2 (en) 2013-01-31 2024-08-14 Codexis, Inc. Methods, systems, and software for identifying bio-molecules using models of multiplicative form
WO2014120821A1 (en) 2013-01-31 2014-08-07 Codexis, Inc. Methods, systems, and software for identifying bio-molecules using models of multiplicative form
WO2014120819A1 (en) 2013-01-31 2014-08-07 Codexis, Inc. Methods, systems, and software for identifying bio-molecules with interacting components
WO2014133960A1 (en) 2013-02-28 2014-09-04 Codexis, Inc. Engineered transaminase polypeptides for industrial biocatalysis
US9963685B2 (en) 2013-02-28 2018-05-08 Codexis, Inc. Engineered transaminase polypeptides for industrial biocatalysis
US12371678B2 (en) 2013-02-28 2025-07-29 Codexis, Inc. Engineered transaminase polypeptides for industrial biocatalysis
US10604744B2 (en) 2013-02-28 2020-03-31 Codexis, Inc. Engineered transaminase polypeptides for industrial biocatalysis
US11098292B2 (en) 2013-02-28 2021-08-24 Codexis, Inc. Engineered transaminase polypeptides for industrial biocatalysis
US9617573B2 (en) 2013-02-28 2017-04-11 Codexis, Inc. Engineered transaminase polypeptides for industrial biocatalysis
WO2014153234A1 (en) 2013-03-14 2014-09-25 Pioneer Hi-Bred International, Inc. Compositions having dicamba decarboxylase activity and methods of use
WO2014153242A1 (en) 2013-03-14 2014-09-25 Pioneer Hi-Bred International, Inc. Compositions having dicamba decarboxylase activity and methods of use
WO2014150914A2 (en) 2013-03-15 2014-09-25 Pioneer Hi-Bred International, Inc. Phi-4 polypeptides and methods for their use
WO2014172541A2 (en) 2013-04-18 2014-10-23 Codexis, Inc. Engineered phenylalanine ammonia lyase polypeptides
EP3521423A1 (en) 2013-04-18 2019-08-07 Codexis, Inc. Engineered phenylalanine ammonia lyase polypeptides
US10294468B2 (en) 2013-04-18 2019-05-21 Codexis, Inc. Engineered phenylalanine ammonia lyase polypeptides
US10941391B2 (en) 2013-04-18 2021-03-09 Codexis, Inc. Engineered phenylalanine ammonia lyase polypeptides
EP3971288A1 (en) 2013-04-18 2022-03-23 Codexis, Inc. Engineered phenylalanine ammonia lyase polypeptides
US10358639B2 (en) 2013-04-18 2019-07-23 Codexis, Inc. Engineered phenylalanine ammonia lyase polypeptides
US10640759B2 (en) 2013-04-18 2020-05-05 Codexis, Inc. Engineered phenylalanine ammonia lyase polypeptides
US10870843B2 (en) 2013-04-18 2020-12-22 Codexis, Inc. Engineered phenylalanine ammonia lyase polypeptides
US11130947B2 (en) 2013-04-18 2021-09-28 Codexis, Inc. Engineered phenylalanine ammonia lyase polypeptides
US10494623B2 (en) 2013-04-18 2019-12-03 Codexis, Inc. Engineered phenylalanine ammonia lyase polypeptides
US9611468B2 (en) 2013-04-18 2017-04-04 Codexis, Inc. Engineered phenylalanine ammonia lyase polypeptides
US11136571B2 (en) 2013-04-18 2021-10-05 Codexis, Inc. Engineered phenylalanine ammonia lyase polypeptides
US10975367B2 (en) 2013-04-18 2021-04-13 Codexis, Inc. Engineered phenylalanine ammonia lyase polypeptides
US10717974B2 (en) 2013-04-18 2020-07-21 Codexis, Inc. Engineered phenylalanine ammonia lyase polypeptides
US10160963B2 (en) 2013-04-18 2018-12-25 Codexis, Inc. Engineered phenylalanine ammonia lyase polypeptides
US11401515B2 (en) 2013-04-18 2022-08-02 Codexis, Inc. Engineered phenylalanine ammonia lyase polypeptides
US10144924B2 (en) 2013-04-18 2018-12-04 Codexis, Inc. Engineered phenylalanine ammonia lyase polypeptides
US11913045B2 (en) 2013-04-18 2024-02-27 Codexis, Inc. Engineered phenylalanine ammonia lyase polypeptides
US10487319B2 (en) 2013-04-18 2019-11-26 Codexis, Inc. Engineered phenylalanine ammonia lyase polypeptides
WO2015023846A2 (en) 2013-08-16 2015-02-19 Pioneer Hi-Bred International, Inc. Insecticidal proteins and methods for their use
WO2015038734A2 (en) 2013-09-13 2015-03-19 Pioneer Hi-Bred International, Inc. Insecticidal proteins and methods for their use
EP3692786A1 (en) 2013-09-13 2020-08-12 Pioneer Hi-Bred International, Inc. Insecticidal proteins and methods for their use
EP4159028A1 (en) 2013-09-13 2023-04-05 Pioneer Hi-Bred International, Inc. Insecticidal proteins and methods for their use
EP3418929A1 (en) 2013-09-27 2018-12-26 Codexis, Inc. Automated screening of enzyme variants
US10407668B2 (en) 2013-11-13 2019-09-10 Codexis, Inc. Engineered imine reductases and methods for the reductive amination of ketone and amine compounds
US12312609B2 (en) 2013-11-13 2025-05-27 Codexis, Inc. Engineered imine reductases and methods for the reductive amination of ketone and amine compounds
US9822346B2 (en) 2013-11-13 2017-11-21 Codexis, Inc. Engineered imine reductases and methods for the reductive amination of ketone and amine compounds
WO2015073555A1 (en) 2013-11-13 2015-05-21 Codexis, Inc. Engineered imine reductases and methods for the reductive amination of ketone and amine compounds
US11060072B2 (en) 2013-11-13 2021-07-13 Codexis, Inc. Engineered imine reductases and methods for the reductive amination of ketone and amine compounds
EP4122945A1 (en) 2013-12-23 2023-01-25 University of Rochester Methods and compositions for ribosomal synthesis of macrocyclic peptides
WO2015120270A1 (en) 2014-02-07 2015-08-13 Pioneer Hi Bred International, Inc. Insecticidal proteins and methods for their use
EP3705489A1 (en) 2014-02-07 2020-09-09 Pioneer Hi-Bred International, Inc. Insecticidal proteins and methods for their use
WO2015120276A1 (en) 2014-02-07 2015-08-13 Pioneer Hi Bred International Inc Insecticidal proteins and methods for their use
US10287567B2 (en) 2014-04-16 2019-05-14 Codexis, Inc. Polynucleotides encoding engineered tyrosine ammonia lyase variants
WO2015161019A1 (en) 2014-04-16 2015-10-22 Codexis, Inc. Engineered tyrosine ammonia lyase
US11015184B2 (en) 2014-04-16 2021-05-25 Codexis, Inc. Polynucleotides encoding engineered tyrosine ammonia lyase variants
US9605252B2 (en) 2014-04-16 2017-03-28 Codexis, Inc. Engineered tyrosine ammonia lyase
EP3928787A1 (en) 2014-04-16 2021-12-29 Codexis, Inc. Engineered tyrosine ammonia lyase
US10533168B2 (en) 2014-04-16 2020-01-14 Codexis, Inc. Engineered tyrosine ammonia lyase
US12365882B2 (en) 2014-07-09 2025-07-22 Codexis, Inc. P450-BM3 variants with improved activity
US9708587B2 (en) 2014-07-09 2017-07-18 Codexis, Inc. P450-BM3 variants with improved activity
US10689627B2 (en) 2014-07-09 2020-06-23 Codexis, Inc. P450-BM3 variants with improved activity
US11279917B2 (en) 2014-07-09 2022-03-22 Codexis, Inc. P450-BM3 variants with improved activity
US11807874B2 (en) 2014-07-09 2023-11-07 Codexis, Inc. P450-BM3 variants with improved activity
US10100289B2 (en) 2014-07-09 2018-10-16 Codexis, Inc. P450-BM3 variants with improved activity
WO2016061206A1 (en) 2014-10-16 2016-04-21 Pioneer Hi-Bred International, Inc. Insecticidal proteins and methods for their use
US12378533B2 (en) 2014-11-25 2025-08-05 Codexis, Inc. Engineered imine reductases and methods for the reductive amination of ketone and amine compounds
US10793836B2 (en) 2014-11-25 2020-10-06 Codexis, Inc. Engineered imine reductases and methods for the reductive amination of ketone and amine compounds
WO2016085916A1 (en) 2014-11-25 2016-06-02 Codexis, Inc. Engineered imine reductases and methods for the reductive amination of ketone and amine compounds
US11802274B2 (en) 2014-11-25 2023-10-31 Codexis, Inc. Engineered imine reductases and methods for the reductive amination of ketone and amine compounds
US11352609B2 (en) 2014-11-25 2022-06-07 Codexis, Inc. Engineered imine reductases and methods for the reductive amination of ketone and amine compounds
US10370648B2 (en) 2014-11-25 2019-08-06 Codexis, Inc. Engineered imine reductases and methods for the reductive amination of ketone and amine compounds
US12257291B2 (en) 2014-12-22 2025-03-25 Crosswalk Therapeutics, Inc. Human alpha-galactosidase variants
EP4234699A1 (en) 2014-12-22 2023-08-30 Codexis, Inc. Human alpha-galactosidase variants
US11497798B2 (en) 2014-12-22 2022-11-15 Codexis, Inc. Human alpha-galactosidase variants
US12263207B2 (en) 2014-12-22 2025-04-01 Crosswalk Therapeutics, Inc. Human alpha-galactosidase variants
WO2016105889A1 (en) 2014-12-22 2016-06-30 Codexis, Inc. Human alpha-galactosidase variants
WO2016114973A1 (en) 2015-01-15 2016-07-21 Pioneer Hi Bred International, Inc Insecticidal proteins and methods for their use
EP4663761A2 (en) 2015-01-15 2025-12-17 Pioneer Hi-Bred International, Inc. Insecticidal proteins and methods for their use
WO2016130412A1 (en) 2015-02-10 2016-08-18 Codexis, Inc. Ketoreductase polypeptides for the synthesis of chiral compounds
US12410410B2 (en) 2015-02-10 2025-09-09 Codexis, Inc. Ketoreductase polypeptides for the synthesis of chiral compounds
US10696953B2 (en) 2015-02-10 2020-06-30 Codexis, Inc. Ketoreductase polypeptides for the synthesis of chiral compounds
US11236308B2 (en) 2015-02-10 2022-02-01 Codexis, Inc. Ketoreductase polypeptides for the synthesis of chiral compounds
WO2016144688A1 (en) 2015-03-11 2016-09-15 Pioneer Hi Bred International Inc Insecticidal combinations of pip-72 and methods of use
US11180747B2 (en) 2015-05-07 2021-11-23 Codexis, Inc. Variant penicillin-G acylases
US10400231B2 (en) 2015-05-07 2019-09-03 Codexis, Inc. Penicillin-G acylases
US9944916B2 (en) 2015-05-07 2018-04-17 Codexis, Inc. Penicillin-G acylases
WO2016179464A1 (en) 2015-05-07 2016-11-10 Codexis, Inc. Penicillin-g acylases
US12378541B2 (en) 2015-05-07 2025-08-05 Codexis, Inc. Penicillin-G acylases
US10781436B2 (en) 2015-05-07 2020-09-22 Codexis, Inc. Penicillin-G acylases
WO2016186986A1 (en) 2015-05-19 2016-11-24 Pioneer Hi Bred International Inc Insecticidal proteins and methods for their use
US10704030B2 (en) 2015-07-07 2020-07-07 Codexis, Inc. P450-BM3 variants with improved activity
WO2017007547A1 (en) 2015-07-07 2017-01-12 Codexis, Inc. Novel p450-bm3 variants with improved activity
US9683220B2 (en) 2015-07-07 2017-06-20 Codexis, Inc. P450-BM3 variants with improved activity
US11591578B2 (en) 2015-07-07 2023-02-28 Codexis, Inc. P450-BM3 variants with improved activity
US10450550B2 (en) 2015-07-07 2019-10-22 Codexis, Inc. P450-BM3 variants with improved activity
US10113153B2 (en) 2015-07-07 2018-10-30 Codexis, Inc. P450-BM3 variants with improved activity
US10982197B2 (en) 2015-07-07 2021-04-20 Codexis, Inc. P450-BM3 variants with improved activity
EP3943602A1 (en) 2015-08-06 2022-01-26 Pioneer Hi-Bred International, Inc. Plant derived insecticidal proteins and methods for their use
WO2017023486A1 (en) 2015-08-06 2017-02-09 Pioneer Hi-Bred International, Inc. Plant derived insecticidal proteins and methods for their use
WO2017105987A1 (en) 2015-12-18 2017-06-22 Pioneer Hi-Bred International, Inc. Insecticidal proteins and methods for their use
EP3960863A1 (en) 2016-05-04 2022-03-02 Pioneer Hi-Bred International, Inc. Insecticidal proteins and methods for their use
WO2017192560A1 (en) 2016-05-04 2017-11-09 Pioneer Hi-Bred International, Inc. Insecticidal proteins and methods for their use
WO2017193022A1 (en) 2016-05-05 2017-11-09 Codexis, Inc. Penicillin-g acylases
US11965192B2 (en) 2016-05-05 2024-04-23 Codexis, Inc. Penicillin-G acylases
US10724025B2 (en) 2016-05-05 2020-07-28 Codexis, Inc. Penicillin-G acylases
US11214786B2 (en) 2016-05-05 2022-01-04 Codexis, Inc. Penicillin-G acylases
US10844358B2 (en) 2016-06-09 2020-11-24 Codexis, Inc. Polynucleotides encoding biocatalysts and methods for hydroxylation of chemical compounds
US12286648B2 (en) 2016-06-09 2025-04-29 Codexis, Inc. Engineered proline hydroxylase biocatalysts for hydroxylation of chemical compounds
WO2017213758A1 (en) 2016-06-09 2017-12-14 Codexis, Inc. Biocatalysts and methods for hydroxylation of chemical compounds
US11634695B2 (en) 2016-06-09 2023-04-25 Codexis, Inc. Vectors for expression of biocatalysts
US10184117B2 (en) 2016-06-09 2019-01-22 Codexis, Inc. Biocatalysts and methods for hydroxylation of chemical compounds
US11299723B2 (en) 2016-06-15 2022-04-12 Codexis, Inc. Engineered beta-glucosidases and glucosylation methods
EP3954202A1 (en) 2016-07-01 2022-02-16 Pioneer Hi-Bred International, Inc. Insecticidal proteins from plants and methods for their use
WO2018005411A1 (en) 2016-07-01 2018-01-04 Pioneer Hi-Bred International, Inc. Insecticidal proteins from plants and methods for their use
EP4223766A2 (en) 2016-08-26 2023-08-09 Codexis, Inc. Engineered imine reductases and methods for the reductive amination of ketone and amine compounds
US11046936B2 (en) 2016-08-26 2021-06-29 Codexis, Inc. Engineered imine reductases and methods for the reductive amination of ketone and amine compounds
US11987818B2 (en) 2016-08-26 2024-05-21 Codexis, Inc. Engineered imine reductases and methods for the reductive amination of ketone and amine compounds
WO2018038906A1 (en) 2016-08-26 2018-03-01 Codexis, Inc. Engineered imine reductases and methods for the reductive amination of ketone and amine compounds
WO2018084936A1 (en) 2016-11-01 2018-05-11 Pioneer Hi-Bred International, Inc. Insecticidal proteins and methods for their use
EP4050021A1 (en) 2016-11-01 2022-08-31 Pioneer Hi-Bred International, Inc. Insecticidal proteins and methods for their use
WO2018111551A1 (en) 2016-12-14 2018-06-21 Pioneer Hi-Bred International, Inc. Insecticidal proteins and methods for their use
WO2018118811A1 (en) 2016-12-22 2018-06-28 Pioneer Hi-Bred International, Inc. Insecticidal proteins and methods for their use
US10865402B2 (en) 2017-01-05 2020-12-15 Codexis, Inc. Penicillin-G acylases
US11591588B2 (en) 2017-01-05 2023-02-28 Codexis, Inc. Penicillin-G acylases
US10745681B2 (en) 2017-01-05 2020-08-18 Codexis, Inc. Penicillin-G acylases
EP3565893A1 (en) 2017-01-05 2019-11-13 Codexis, Inc. Penicillin-g acylases
US12084697B2 (en) 2017-01-05 2024-09-10 Codexis, Inc. Penicillin-G acylases
WO2018144679A2 (en) 2017-02-03 2018-08-09 Codexis, Inc. Engineered glycosyltransferases and steviol glycoside glucosylation methods
US11920167B2 (en) 2017-02-03 2024-03-05 Tate & Lyle Solutions Usa Llc Engineered glycosyltransferases and steviol glycoside glucosylation methods
US12404499B2 (en) 2017-02-03 2025-09-02 Tate & Lyle Solutions Usa Llc Engineered glycosyltransferases and steviol glycoside glucosylation methods
US12291728B2 (en) 2017-02-03 2025-05-06 Tate & Lyle Solutions Usa Llc Engineered glycosyltransferases and steviol glycoside glucosylation methods
WO2018148001A1 (en) 2017-02-08 2018-08-16 Pioneer Hi-Bred International Inc Insecticidal combinations of plant derived insecticidal proteins and methods for their use
US10995329B2 (en) 2017-02-13 2021-05-04 Codexis, Inc. Engineered phenylalanine ammonia lyase polypeptides
US11629137B2 (en) 2017-04-24 2023-04-18 Tesaro, Inc. Methods of manufacturing of niraparib
US11161834B2 (en) 2017-04-24 2021-11-02 Tesaro, Inc. Methods of manufacturing of niraparib
WO2018200214A2 (en) 2017-04-27 2018-11-01 Codexis, Inc. Ketoreductase polypeptides and polynucleotides
US12252723B2 (en) 2017-04-27 2025-03-18 Codexis, Inc. Ketoreductase polypeptides and polynucleotides
US11021729B2 (en) 2017-04-27 2021-06-01 Codexis, Inc. Ketoreductase polypeptides and polynucleotides
US11746369B2 (en) 2017-04-27 2023-09-05 Codexis, Inc. Ketoreductase polypeptides and polynucleotides
EP3957723A2 (en) 2017-05-08 2022-02-23 Codexis, Inc. Engineered ligase variants
WO2018208665A1 (en) 2017-05-08 2018-11-15 Codexis, Inc. Engineered ligase variants
US12344872B2 (en) 2017-05-08 2025-07-01 Codexis, Inc. Engineered ligase variants
WO2018208882A1 (en) 2017-05-11 2018-11-15 Pioneer Hi-Bred International, Inc. Insecticidal proteins and methods for their use
US12297462B2 (en) 2017-06-14 2025-05-13 Codexis, Inc. Engineered transaminase polypeptides for industrial biocatalysis
EP3638688A1 (en) 2017-06-14 2020-04-22 Codexis, Inc. Engineered transaminase polypeptides for industrial biocatalysis
US11359183B2 (en) 2017-06-14 2022-06-14 Codexis, Inc. Engineered transaminase polypeptides for industrial biocatalysis
WO2019005337A1 (en) 2017-06-27 2019-01-03 Codexis, Inc. PENICILLIN G ACYLASES
US11643642B2 (en) 2017-06-27 2023-05-09 Codexis, Inc. Penicillin-g acylases
US12480111B2 (en) 2017-06-27 2025-11-25 Codexis, Inc. Penicillin-G acylases
US11236312B2 (en) 2017-06-30 2022-02-01 Codexis, Inc. T7 RNA polymerase variants
US12129494B2 (en) 2017-06-30 2024-10-29 Codexis, Inc. T7 RNA polymerase variants
US10793841B2 (en) 2017-06-30 2020-10-06 Codexis, Inc. T7 RNA polymerase variants
EP3645711A1 (en) 2017-06-30 2020-05-06 Codexis, Inc. T7 rna polymerase variants
US11236311B2 (en) 2017-06-30 2022-02-01 Codexis, Inc. T7 RNA polymerase variants
US10738286B2 (en) 2017-06-30 2020-08-11 Codexis, Inc. T7 RNA polymerase variants
WO2019040335A1 (en) 2017-08-19 2019-02-28 University Of Rochester MICHELOLID DERIVATIVES, PREPARATION METHODS AND THEIR USE AS ANTICANCER AND ANTI-INFLAMMATORY AGENTS
US11761963B2 (en) 2017-09-27 2023-09-19 Alexion Pharmaceuticals, Inc. Biomarker signature for predicting tumor response to anti-CD200 therapy
US11319531B2 (en) 2017-11-07 2022-05-03 Codexis, Inc. Transglutaminase variants
EP4471137A2 (en) 2017-12-13 2024-12-04 GlaxoSmithKline Intellectual Property Development Ltd Carboxyesterase biocatalysts
WO2019116311A1 (en) 2017-12-13 2019-06-20 Glaxosmithkline Intellectual Property Development Limited Carboxyesterase biocatalysts
EP3724325A1 (en) 2017-12-13 2020-10-21 Codexis, Inc. Carboxyesterase polypeptides for amide coupling
US12286653B2 (en) 2017-12-13 2025-04-29 Codexis, Inc. Carboxyesterase polypeptides for amide coupling
US12331327B2 (en) 2017-12-13 2025-06-17 Glaxosmithkline Intellectual Property Development Limited Carboxyesterase biocatalysts
US11015180B2 (en) 2017-12-13 2021-05-25 Codexis, Inc. Carboxyesterase polypeptides for amide coupling
US11535833B2 (en) 2017-12-13 2022-12-27 Glaxosmithkline Intellectual Property Development Limited Carboxyesterase biocatalysts
EP4659582A2 (en) 2018-03-14 2025-12-10 Pioneer Hi-Bred International, Inc. Insecticidal proteins from plants and methods for their use
WO2019178038A1 (en) 2018-03-14 2019-09-19 Pioneer Hi-Bred International, Inc. Insecticidal proteins from plants and methods for their use
WO2019178042A1 (en) 2018-03-14 2019-09-19 Pioneer Hi-Bred International, Inc. Insecticidal proteins from plants and methods for their use
US10900055B2 (en) 2018-06-12 2021-01-26 Codexis, Inc. Engineered tyrosine ammonia lyase
US11421253B2 (en) 2018-06-12 2022-08-23 Codexis, Inc. Engineered tyrosine ammonia lyase
WO2020014050A1 (en) 2018-07-09 2020-01-16 Codexis, Inc. Engineered pantothenate kinase variant enzymes
US11795445B2 (en) 2018-07-09 2023-10-24 Codexis, Inc. Engineered phosphopentomutase variant enzymes
US11466259B2 (en) 2018-07-09 2022-10-11 Codexis, Inc. Engineered galactose oxidase variant enzymes
WO2020014047A1 (en) 2018-07-09 2020-01-16 Codexis, Inc. Engineered purine nucleoside phosphorylase variant enzymes
US12012618B2 (en) 2018-07-09 2024-06-18 Codexis, Inc. Engineered galactose oxidase variant enzymes
US11274286B2 (en) 2018-07-09 2022-03-15 Codexis, Inc. Engineered deoxyribose-phosphate aldolases
US11162105B2 (en) 2018-07-09 2021-11-02 Codexis, Inc. Engineered purine nucleoside phosphorylase variant enzymes
US12421509B2 (en) 2018-07-09 2025-09-23 Codexis, Inc. Engineered phosphopentomutase variant enzymes
US12460195B2 (en) 2018-07-09 2025-11-04 Codexis, Inc. Engineered deoxyribose-phosphate aldolases
US11845968B2 (en) 2018-07-09 2023-12-19 Codexis, Inc. Engineered deoxyribose-phosphate aldolases
US11034948B2 (en) 2018-07-09 2021-06-15 Codexis, Inc. Engineered phosphopentomutase variant enzymes
US10889806B2 (en) 2018-07-09 2021-01-12 Codexis, Inc. Engineered pantothenate kinase variant enzymes
US12110513B2 (en) 2018-07-09 2024-10-08 Codexis, Inc. Engineered pantothenate kinase variant enzymes
US12480099B2 (en) 2018-07-09 2025-11-25 Codexis, Inc. Engineered galactose oxidase variant enzymes
US12110493B2 (en) 2018-07-09 2024-10-08 Codexis, Inc. Engineered purine nucleoside phosphorylase variant enzymes
US11198861B2 (en) 2018-07-12 2021-12-14 Codexis, Inc. Engineered phenylalanine ammonia lyase polypeptides
US11760981B2 (en) 2018-07-30 2023-09-19 Codexis, Inc. Engineered glycosyltransferases and steviol glycoside glucosylation methods
WO2020028039A1 (en) 2018-07-30 2020-02-06 Codexis, Inc. Engineered glycosyltransferases and steviol glycoside glucosylation methods
US12454682B2 (en) 2018-07-30 2025-10-28 Tate & Lyle Solutions Usa Llc Engineered glycosyltransferases and steviol glycoside glucosylation methods
US12018295B2 (en) 2018-10-29 2024-06-25 Codexis, Inc. Engineered DNA polymerase variants
US11060075B2 (en) 2018-10-29 2021-07-13 Codexis, Inc. Engineered DNA polymerase variants
US11473077B2 (en) 2018-12-14 2022-10-18 Codexis, Inc. Engineered tyrosine ammonia lyase
WO2020132252A2 (en) 2018-12-20 2020-06-25 Codexis, Inc. Human alpha-galactosidase variants
US11427813B2 (en) 2018-12-20 2022-08-30 Codexis, Inc. Human alpha-galactosidase variants
US12286655B2 (en) 2018-12-20 2025-04-29 Crosswalk Therapeutics, Inc. Human alpha-galactosidase variants
US12503688B2 (en) 2019-01-15 2025-12-23 Codexis, Inc. Engineered transaminase polypeptides
US12215359B2 (en) 2019-05-01 2025-02-04 Codexis, Inc. Engineered glucose dehydrogenases and methods for the reductive amination of ketone and amine compounds
US12215368B2 (en) 2019-05-01 2025-02-04 Codexis, Inc. Engineered imine reductases and methods for the reductive amination of ketone and amine compounds
US12480104B2 (en) 2019-07-02 2025-11-25 Codexis, Inc. Engineered sucrose phosphorylase variant enzymes
US12275962B2 (en) 2019-07-02 2025-04-15 Codexis, Inc. Engineered acetate kinase variant enzymes
EP4501403A2 (en) 2019-08-30 2025-02-05 Société des Produits Nestlé S.A. Engineered lipase variants
US11987823B2 (en) 2019-08-30 2024-05-21 Societe Des Produits Nestle S.A. Engineered lipase variants
US12540314B2 (en) 2019-09-12 2026-02-03 Codexis, Inc. Peroxidase activity towards 10-acetyl-3,7-dihydroxyphenoxazine
US12012620B2 (en) 2019-09-12 2024-06-18 Codexis, Inc. Peroxidase activity towards 10-acetyl-3,7-dihydroxyphenoxazine
WO2021067608A1 (en) 2019-10-02 2021-04-08 Abbott Laboratories Detection of analytes by protein switches
US12344865B2 (en) 2019-11-26 2025-07-01 Codexis, Inc. Biocatalysts and methods for hydroxylation of chemical compounds
US12497605B2 (en) 2019-12-20 2025-12-16 Crosswalk Therapeutics, Inc. Engineered acid alpha-glucosidase variants
US11970722B2 (en) 2019-12-20 2024-04-30 Codexis, Inc. Engineered acid alpha-glucosidase variants
WO2021142393A1 (en) 2020-01-10 2021-07-15 The Regents Of The University Of California Biosynthetic platform for the production of olivetolic avid and analogues of olivetolic acid
US12241100B2 (en) 2020-02-04 2025-03-04 Syntis Bio, Inc. Engineered leucine decarboxylases
US11788071B2 (en) 2020-04-10 2023-10-17 Codexis, Inc. Engineered transaminase polypeptides
US12331325B2 (en) 2020-04-10 2025-06-17 Codexis, Inc. Engineered transaminase polypeptides
WO2022015619A2 (en) 2020-07-14 2022-01-20 Pioneer Hi-Bred International, Inc. Insecticidal proteins and methods for their use
US11767519B2 (en) 2020-08-28 2023-09-26 Codexis, Inc. Engineered amylase variants
US11959108B2 (en) 2020-08-28 2024-04-16 Codexis, Inc. Engineered protease variants
US12071642B2 (en) 2020-08-28 2024-08-27 Codexis, Inc. Engineered amylase variants
WO2022125960A1 (en) 2020-12-11 2022-06-16 Willow Biosciences, Inc. Recombinant acyl activating enzyme (aae) genes for enhanced biosynthesis of cannabinoids and cannabinoid precursors
US11898174B2 (en) 2020-12-18 2024-02-13 Codexis, Inc. Engineered uridine phosphorylase variant enzymes
US12428629B2 (en) 2020-12-18 2025-09-30 Codexis, Inc. Engineered uridine phosphorylase variant enzymes
WO2022212832A1 (en) 2021-04-02 2022-10-06 Codexis, Inc. Engineered cyclic gmp-amp synthase (cgas) variant enzymes
US12473557B2 (en) 2021-04-02 2025-11-18 Codexis, Inc. Engineered guanylate kinase variant enzymes
US11913037B2 (en) 2021-04-02 2024-02-27 Codexis, Inc. Engineered adenylate kinase variant enzymes
US11913036B2 (en) 2021-04-02 2024-02-27 Codexis, Inc. Engineered acetate kinase variant enzymes
WO2022212824A1 (en) 2021-04-02 2022-10-06 Codexis, Inc. Engineered adenylate kinase variant enzymes
US12421505B2 (en) 2021-04-02 2025-09-23 Codexis, Inc. Polynucleotides encoding engineered acetate kinase variant enzymes
WO2022212828A1 (en) 2021-04-02 2022-10-06 Codexis, Inc. Engineered guanylate kinase variant enzymes
US12180483B2 (en) 2021-04-02 2024-12-31 Codexis, Inc. Engineered cyclic GMP-AMP synthase (cGAS) variant enzymes
WO2022212835A1 (en) 2021-04-02 2022-10-06 Codexis, Inc. Engineered acetate kinase variant enzymes
US12612605B2 (en) 2021-04-06 2026-04-28 Codexis, Inc. Carboxyesterase polypeptides for kinetic resolution
US12110521B2 (en) 2021-05-21 2024-10-08 Syntis Bio, Inc. Engineered methionine gamma lyase variants
WO2023010083A2 (en) 2021-07-30 2023-02-02 Willow Biosciences, Inc. Recombinant prenyltransferase polypeptides engineered for enhanced biosynthesis of cannabinoids
WO2023023621A1 (en) 2021-08-19 2023-02-23 Willow Biosciences, Inc. Recombinant olivetolic acid cyclase polypeptides engineered for enhanced biosynthesis of cannabinoids
US12565641B2 (en) 2021-10-15 2026-03-03 Codexis, Inc. Engineered terminal deoxynucleotidyl transferase variants
US12129495B2 (en) 2021-10-15 2024-10-29 Codexis, Inc. Engineered DNA polymerase variants
WO2023069921A1 (en) 2021-10-19 2023-04-27 Epimeron Usa, Inc. Recombinant thca synthase polypeptides engineered for enhanced biosynthesis of cannabinoids
US12502421B2 (en) 2021-11-01 2025-12-23 Syntis Bio, Inc. Engineered leucine decarboxylases
WO2023173084A1 (en) 2022-03-11 2023-09-14 University Of Rochester Cyclopeptibodies and uses thereof
DE112023000593T5 (de) 2022-03-31 2024-11-14 Qingdao Kingagroot Chemical Compound Co., Ltd. Monoaminoxidase und deren anwendung
WO2024040020A1 (en) 2022-08-15 2024-02-22 Absci Corporation Quantitative affinity activity specific cell enrichment
WO2024150146A1 (en) 2023-01-12 2024-07-18 Novartis Ag Engineered ketoreductase polypeptides
WO2025061911A1 (en) 2023-09-22 2025-03-27 Glaxosmithkline Intellectual Property Development Limited Methods of producing nucleotide triphosphates (ntps)
WO2025144700A1 (en) 2023-12-27 2025-07-03 Absci Corporation Nanobody library screening using bacterial surface display
WO2025235589A1 (en) 2024-05-08 2025-11-13 Codexis, Inc. Dna polymerase variants
WO2025242702A1 (en) 2024-05-23 2025-11-27 Glaxosmithkline Intellectual Property Development Limited Enzymatic process for producing n-acetyl galactosamine clusters

Also Published As

Publication number Publication date
ES2351673T3 (es) 2011-02-09
AU732146B2 (en) 2001-04-12
US20120015820A1 (en) 2012-01-19
JP2009089710A (ja) 2009-04-30
CA2274319C (en) 2013-04-09
US20040214277A1 (en) 2004-10-28
CA2589337A1 (en) 1998-06-25
US20110053781A1 (en) 2011-03-03
US6355484B1 (en) 2002-03-12
DE69739996D1 (de) 2010-10-28
US6455253B1 (en) 2002-09-24
EP1149904A1 (en) 2001-10-31
JP2001506855A (ja) 2001-05-29
EP1149905B1 (en) 2010-09-15
US6613514B2 (en) 2003-09-02
EP0946755A4 (en) 2001-03-07
US6579678B1 (en) 2003-06-17
US20060166225A1 (en) 2006-07-27
JP5008784B2 (ja) 2012-08-22
EP2202308A3 (en) 2011-11-30
US20090149331A1 (en) 2009-06-11
EP2202308A2 (en) 2010-06-30
US6319713B1 (en) 2001-11-20
US6586182B1 (en) 2003-07-01
US20050059109A1 (en) 2005-03-17
AU5729298A (en) 1998-07-15
EP0946755A1 (en) 1999-10-06
EP2202308B1 (en) 2013-02-13
US6653072B1 (en) 2003-11-25
US20060084091A1 (en) 2006-04-20
ATE481480T1 (de) 2010-10-15
US6335160B1 (en) 2002-01-01
KR20000069591A (ko) 2000-11-25
EP1231269A1 (en) 2002-08-14
US6946296B2 (en) 2005-09-20
IL130190A0 (en) 2000-06-01
US7534564B2 (en) 2009-05-19
US6303344B1 (en) 2001-10-16
US20060223143A1 (en) 2006-10-05
US20040248253A1 (en) 2004-12-09
US20070031878A1 (en) 2007-02-08
EP1149905A1 (en) 2001-10-31
US20020051976A1 (en) 2002-05-02
DK2202308T3 (da) 2013-03-25
US7776598B2 (en) 2010-08-17
US20030027156A1 (en) 2003-02-06
DK1149905T3 (da) 2010-11-01
CA2274319A1 (en) 1998-06-25

Similar Documents

Publication Publication Date Title
CA2274319C (en) Methods and compositions for polypeptide engineering
US6406855B1 (en) Methods and compositions for polypeptide engineering
US20070009930A1 (en) Methods and compositions for polypeptide engineering
AU2011202018B2 (en) Methods and compositions for polypeptide engineering
AU2004210610A1 (en) Methods and compositions for polypeptide engineering
AU2761602A (en) Methods and compositions for polypeptide engineering
MXPA99005653A (en) Methods and compositions for polypeptide engineering

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AL AM AT AU AZ BA BB BG BR BY CA CH CN CU CZ DE DK EE ES FI GB GE GH GM GW HU ID IL IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MD MG MK MN MW MX NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT UA UG US UZ VN YU ZW AM AZ BY KG KZ MD RU TJ TM

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): GH GM KE LS MW SD SZ UG ZW AT BE CH DE DK ES FI FR GB GR IE

DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
CFP Corrected version of a pamphlet front page

Free format text: ADD INID NUMBER (63) "RELATED BY CONTINUATION (CON) OR CONTINUATION-IN-PART (CIP) TO EARLIER APPLICATION" WHICH WAS INADVERTENTLY OMITTED FROM THE FRONT PAGE

121 Ep: the epo has been informed by wipo that ep was designated in this application
ENP Entry into the national phase

Ref document number: 2274319

Country of ref document: CA

Ref country code: CA

Ref document number: 2274319

Kind code of ref document: A

Format of ref document f/p: F

ENP Entry into the national phase

Ref country code: JP

Ref document number: 1998 528054

Kind code of ref document: A

Format of ref document f/p: F

WWE Wipo information: entry into national phase

Ref document number: PA/a/1999/005653

Country of ref document: MX

WWE Wipo information: entry into national phase

Ref document number: 1019997005569

Country of ref document: KR

WWE Wipo information: entry into national phase

Ref document number: 1997953571

Country of ref document: EP

WWE Wipo information: entry into national phase

Ref document number: 57292/98

Country of ref document: AU

WWP Wipo information: published in national office

Ref document number: 1997953571

Country of ref document: EP

REG Reference to national code

Ref country code: DE

Ref legal event code: 8642

WWP Wipo information: published in national office

Ref document number: 1019997005569

Country of ref document: KR

WWW Wipo information: withdrawn in national office

Ref document number: 1019997005569

Country of ref document: KR

WWW Wipo information: withdrawn in national office

Ref document number: 1997953571

Country of ref document: EP

WWW Wipo information: withdrawn in national office

Ref document number: 57292/98

Country of ref document: AU