US20170175142A1 - Crispr-cas systems and methods for altering expression of gene products - Google Patents

Crispr-cas systems and methods for altering expression of gene products Download PDF

Info

Publication number
US20170175142A1
US20170175142A1 US15/217,489 US201615217489A US2017175142A1 US 20170175142 A1 US20170175142 A1 US 20170175142A1 US 201615217489 A US201615217489 A US 201615217489A US 2017175142 A1 US2017175142 A1 US 2017175142A1
Authority
US
United States
Prior art keywords
sequence
crispr
target
expression
cell
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Abandoned
Application number
US15/217,489
Inventor
Feng Zhang
Luciano MARRAFFINI
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Rockefeller University
Massachusetts Institute of Technology
Broad Institute Inc
Original Assignee
Rockefeller University
Massachusetts Institute of Technology
Broad Institute Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Family has litigation
First worldwide family litigation filed litigation Critical https://patents.darts-ip.com/?family=50441380&utm_source=google_patent&utm_medium=platform_link&utm_campaign=public_patent_search&patent=US20170175142(A1) "Global patent litigation dataset” by Darts-ip is licensed under a Creative Commons Attribution 4.0 International License.
Application filed by Rockefeller University, Massachusetts Institute of Technology, Broad Institute Inc filed Critical Rockefeller University
Priority to US15/217,489 priority Critical patent/US20170175142A1/en
Assigned to THE ROCKEFELLER UNIVERSITY reassignment THE ROCKEFELLER UNIVERSITY ASSIGNMENT OF ASSIGNORS INTEREST (SEE DOCUMENT FOR DETAILS). Assignors: MARRAFFINI, Luciano
Publication of US20170175142A1 publication Critical patent/US20170175142A1/en
Assigned to MASSACHUSETTS INSTITUTE OF TECHNOLOGY, THE BROAD INSTITUTE, INC. reassignment MASSACHUSETTS INSTITUTE OF TECHNOLOGY ASSIGNMENT OF ASSIGNORS INTEREST (SEE DOCUMENT FOR DETAILS). Assignors: ZHANG, FENG
Priority to US16/177,403 priority patent/US20190153476A1/en
Abandoned legal-status Critical Current

Links

Images

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/87Introduction of foreign genetic material using processes not otherwise provided for, e.g. co-transformation
    • C12N15/90Stable introduction of foreign DNA into chromosome
    • C12N15/902Stable introduction of foreign DNA into chromosome using homologous recombination
    • C12N15/907Stable introduction of foreign DNA into chromosome using homologous recombination in mammalian cells
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/10Processes for the isolation, preparation or purification of DNA or RNA
    • C12N15/102Mutagenizing nucleic acids
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/111General methods applicable to biologically active non-coding nucleic acids
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/87Introduction of foreign genetic material using processes not otherwise provided for, e.g. co-transformation
    • C12N15/90Stable introduction of foreign DNA into chromosome
    • C12N15/902Stable introduction of foreign DNA into chromosome using homologous recombination
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14Hydrolases (3)
    • C12N9/16Hydrolases (3) acting on ester bonds (3.1)
    • C12N9/22Ribonucleases RNAses, DNAses
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/96Stabilising an enzyme by forming an adduct or a composition; Forming enzyme conjugates
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00Medicinal preparations containing peptides
    • A61K38/16Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • A61K38/43Enzymes; Proenzymes; Derivatives thereof
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00Medicinal preparations containing peptides
    • A61K38/16Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • A61K38/43Enzymes; Proenzymes; Derivatives thereof
    • A61K38/46Hydrolases (3)
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00Medicinal preparations containing peptides
    • A61K38/16Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • A61K38/43Enzymes; Proenzymes; Derivatives thereof
    • A61K38/46Hydrolases (3)
    • A61K38/47Hydrolases (3) acting on glycosyl compounds (3.2), e.g. cellulases, lactases
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/10Processes for the isolation, preparation or purification of DNA or RNA
    • C12N15/1034Isolating an individual clone by screening libraries
    • C12N15/1082Preparation or screening gene libraries by chromosomal integration of polynucleotide sequences, HR-, site-specific-recombination, transposons, viral vectors
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/10Type of nucleic acid
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/10Type of nucleic acid
    • C12N2310/20Type of nucleic acid involving clustered regularly interspaced short palindromic repeats [CRISPRs]
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2800/00Nucleic acids vectors
    • C12N2800/30Vector systems comprising sequences for excision in presence of a recombinase, e.g. loxP or FRT
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2800/00Nucleic acids vectors
    • C12N2800/80Vectors containing sites for inducing double-stranded breaks, e.g. meganuclease restriction sites
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2800/00Nucleic acids vectors
    • C12N2800/90Vectors containing a transposable element
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14Hydrolases (3)
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14Hydrolases (3)
    • C12N9/48Hydrolases (3) acting on peptide bonds (3.4)
    • C12N9/50Proteinases, e.g. Endopeptidases (3.4.21-3.4.25)
    • C12N9/52Proteinases, e.g. Endopeptidases (3.4.21-3.4.25) derived from bacteria or Archaea

Definitions

  • the present invention generally relates to systems, methods and compositions used for the control of gene expression involving sequence targeting, such as genome perturbation or gene-editing, that may use vector systems related to Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR) and components thereof.
  • sequence targeting such as genome perturbation or gene-editing
  • CRISPR Clustered Regularly Interspaced Short Palindromic Repeats
  • the CRISPR/Cas or the CRISPR-Cas system does not require the generation of customized proteins to target specific sequences but rather a single Cas enzyme can be programmed by a short RNA molecule to recognize a specific DNA target, in other words the Cas enzyme can be recruited to a specific DNA target using said short RNA molecule.
  • Adding the CRISPR-Cas system to the repertoire of genome sequencing techniques and analysis methods may significantly simplify the methodology and accelerate the ability to catalog and map genetic factors associated with a diverse range of biological functions and diseases.
  • the invention provides a method for altering or modifying expression of one or more gene products.
  • the said method may comprise introducing into a eukaryotic cell containing and expressing DNA molecules encoding the one or more gene products an engineered, non-naturally occurring vector system comprising one or more vectors comprising: a) a first regulatory element operably linked to one or more Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR)-CRISPR associated (Cas) system guide RNAs that hybridize with target sequences in genomic loci of the DNA molecules encoding the one or more gene products, b) a second regulatory element operably linked to a Type-II Cas9 protein, wherein components (a) and (b) are located on same or different vectors of the system, whereby the guide RNAs target the genomic loci of the DNA molecules encoding the one or more gene products and the Cas9 protein cleaves the genomic loci of the DNA molecules encoding the one or more gene products, whereby expression of the one
  • the invention comprehends the expression of two or more gene products being altered and the vectors of the system further comprising one or more nuclear localization signal(s) (NLS(s)).
  • the invention comprehends the guide RNAs comprising a guide sequence fused to a tracr sequence.
  • the invention further comprehends the Cas9 protein being codon optimized for expression in the eukaryotic cell.
  • the eukaryotic cell is a mammalian cell or a human cell.
  • the expression of one or more of the gene products is decreased.
  • cleaving the genomic loci of the DNA molecule encoding the gene product encompasses cleaving either one or both strands of the DNA duplex.
  • the invention provides an engineered, programmable, non-naturally occurring CRISPR-Cas system comprising a Cas9 protein and one or more guide RNAs that target the genomic loci of DNA molecules encoding one or more gene products in a eukaryotic cell and the Cas9 protein cleaves the genomic loci of the DNA molecules encoding the one or more gene products, whereby expression of the one or more gene products is altered; and, wherein the Cas9 protein and the guide RNAs do not naturally occur together.
  • the invention comprehends the expression of two or more gene products being altered and the CRISPR-Cas system further comprising one or more NLS(s).
  • the invention comprehends the guide RNAs comprising a guide sequence fused to a tracr sequence.
  • the invention further comprehends the Cas9 protein being codon optimized for expression in the eukaryotic cell.
  • the eukaryotic cell is a mammalian cell or a human cell.
  • cleaving the genomic loci of the DNA molecule encoding the gene product encompasses cleaving either one or both strands of the DNA duplex.
  • the invention provides an engineered, non-naturally occurring vector system comprising one or more vectors comprising a) a first regulatory element operably linked to one or more CRISPR-Cas system guide RNAs that hybridize with target sequences in genomic loci of DNA molecules encoding one or more gene products, b) a second regulatory element operably linked to a Type-II Cas9 protein, wherein components (a) and (b) are located on same or different vectors of the system, whereby the guide RNAs target the genomic loci of the DNA molecules encoding the one or more gene products in a eukaryotic cell and the Cas9 protein cleaves the genomic loci of the DNA molecules encoding the one or more gene products, whereby expression of the one or more gene products is altered; and, wherein the Cas9 protein and the guide RNAs do not naturally occur together.
  • the invention comprehends the expression of two or more gene products being altered and the vectors of the system further comprising one or more nuclear localization signal(s) (NLS(s)).
  • the invention comprehends the guide RNAs comprising a guide sequence fused to a tracr sequence.
  • the invention further comprehends the Cas9 protein being codon optimized for expression in the eukaryotic cell.
  • the eukaryotic cell is a mammalian cell or a human cell.
  • the expression of one or more of the gene products is decreased.
  • cleaving the genomic loci of the DNA molecule encoding the gene product encompasses cleaving either one or both strands of the DNA duplex.
  • the invention provides a vector system comprising one or more vectors.
  • the system comprises: (a) a first regulatory element operably linked to a tracr mate sequence and one or more insertion sites for inserting one or more guide sequences upstream of the tracr mate sequence, wherein when expressed, the guide sequence directs sequence-specific binding of a CRISPR complex to a target sequence in a eukaryotic cell, wherein the CRISPR complex comprises a CRISPR enzyme complexed with (1) the guide sequence that is hybridized to the target sequence, and (2) the tracr mate sequence that is hybridized to the tracr sequence; and (b) a second regulatory element operably linked to an enzyme-coding sequence encoding said CRISPR enzyme comprising a nuclear localization sequence; wherein components (a) and (b) are located on the same or different vectors of the system.
  • component (a) further comprises the tracr sequence downstream of the tracr mate sequence under the control of the first regulatory element.
  • component (a) further comprises two or more guide sequences operably linked to the first regulatory element, wherein when expressed, each of the two or more guide sequences direct sequence specific binding of a CRISPR complex to a different target sequence in a eukaryotic cell.
  • the system comprises the tracr sequence under the control of a third regulatory element, such as a polymerase III promoter.
  • the tracr sequence exhibits at least 50%, 60%, 70%, 80%, 90%, 95%, or 99% of sequence complementarity along the length of the tracr mate sequence when optimally aligned.
  • the CRISPR complex comprises one or more nuclear localization sequences of sufficient strength to drive accumulation of said CRISPR complex in a detectable amount in the nucleus of a eukaryotic cell.
  • a nuclear localization sequence is not necessary for CRISPR complex activity in eukaryotes, but that including such sequences enhances activity of the system, especially as to targeting nucleic acid molecules in the nucleus.
  • the CRISPR enzyme is a type II CRISPR system enzyme.
  • the CRISPR enzyme is a Cas9 enzyme.
  • the Cas9 enzyme is S. pneumoniae, S. pyogenes , or S. thermophilus Cas9, and may include mutated Cas9 derived from these organisms.
  • the enzyme may be a Cas9 homolog or ortholog.
  • the CRISPR enzyme is codon-optimized for expression in a eukaryotic cell.
  • the CRISPR enzyme directs cleavage of one or two strands at the location of the target sequence.
  • the first regulatory element is a polymerase II promoter.
  • the second regulatory element is a polymerase II promoter.
  • the guide sequence is at least 15, 16, 17, 18, 19, 20, 25 nucleotides, or between 10-30, or between 15-25, or between 15-20 nucleotides in length.
  • vector refers to a nucleic acid molecule capable of transporting another nucleic acid to which it has been linked. Vectors include, but are not limited to, nucleic acid molecules that are single-stranded, double-stranded, or partially double-stranded; nucleic acid molecules that comprise one or more free ends, no free ends (e.g.
  • vectors refers to a circular double stranded DNA loop into which additional DNA segments can be inserted, such as by standard molecular cloning techniques.
  • viral vector wherein virally-derived DNA or RNA sequences are present in the vector for packaging into a virus (e.g. retroviruses, replication defective retroviruses, adenoviruses, replication defective adenoviruses, and adeno-associated viruses).
  • Viral vectors also include polynucleotides carried by a virus for transfection into a host cell.
  • vectors are capable of autonomous replication in a host cell into which they are introduced (e.g. bacterial vectors having a bacterial origin of replication and episomal mammalian vectors). Other vectors (e.g., non-episomal mammalian vectors) are integrated into the genome of a host cell upon introduction into the host cell, and thereby are replicated along with the host genome. Moreover, certain vectors are capable of directing the expression of genes to which they are operatively-linked. Such vectors are referred to herein as “expression vectors.” Common expression vectors of utility in recombinant DNA techniques are often in the form of plasmids.
  • Recombinant expression vectors can comprise a nucleic acid of the invention in a form suitable for expression of the nucleic acid in a host cell, which means that the recombinant expression vectors include one or more regulatory elements, which may be selected on the basis of the host cells to be used for expression, that is operatively-linked to the nucleic acid sequence to be expressed.
  • “operably linked” is intended to mean that the nucleotide sequence of interest is linked to the regulatory element(s) in a manner that allows for expression of the nucleotide sequence (e.g. in an in vitro transcription/translation system or in a host cell when the vector is introduced into the host cell).
  • regulatory element is intended to include promoters, enhancers, internal ribosomal entry sites (IRES), and other expression control elements (e.g. transcription termination signals, such as polyadenylation signals and poly-U sequences).
  • promoters e.g. promoters, enhancers, internal ribosomal entry sites (IRES), and other expression control elements (e.g. transcription termination signals, such as polyadenylation signals and poly-U sequences).
  • IRES internal ribosomal entry sites
  • regulatory elements e.g. transcription termination signals, such as polyadenylation signals and poly-U sequences.
  • Regulatory elements include those that direct constitutive expression of a nucleotide sequence in many types of host cell and those that direct expression of the nucleotide sequence only in certain host cells (e.g., tissue-specific regulatory sequences).
  • a tissue-specific promoter may direct expression primarily in a desired tissue of interest, such as muscle, neuron, bone, skin, blood, specific organs (e.g. liver, pancreas), or particular cell types (e.g. lymphocytes). Regulatory elements may also direct expression in a temporal-dependent manner, such as in a cell-cycle dependent or developmental stage-dependent manner, which may or may not also be tissue or cell-type specific.
  • a vector comprises one or more pol III promoter (e.g. 1, 2, 3, 4, 5, or more pol I promoters), one or more pol II promoters (e.g. 1, 2, 3, 4, 5, or more pol II promoters), one or more pol I promoters (e.g.
  • pol III promoters include, but are not limited to, U6 and H1 promoters.
  • pol II promoters include, but are not limited to, the retroviral Rous sarcoma virus (RSV) LTR promoter (optionally with the RSV enhancer), the cytomegalovirus (CMV) promoter (optionally with the CMV enhancer) [see, e.g., Boshart et al, Cell, 41:521-530 (1985)], the SV40 promoter, the dihydrofolate reductase promoter, the ⁇ -actin promoter, the phosphoglycerol kinase (PGK) promoter, and the EF1 ⁇ promoter.
  • RSV Rous sarcoma virus
  • CMV cytomegalovirus
  • PGK phosphoglycerol kinase
  • enhancer elements such as WPRE; CMV enhancers; the R-U5′ segment in LTR of HTLV-I (Mol. Cell. Biol., Vol. 8(1), p. 466-472, 1988); SV40 enhancer; and the intron sequence between exons 2 and 3 of rabbit ⁇ -globin (Proc. Natl. Acad. Sci. USA., Vol. 78(3), p. 1527-31, 1981).
  • WPRE WPRE
  • CMV enhancers the R-U5′ segment in LTR of HTLV-I
  • SV40 enhancer SV40 enhancer
  • the intron sequence between exons 2 and 3 of rabbit ⁇ -globin Proc. Natl. Acad. Sci. USA., Vol. 78(3), p. 1527-31, 1981.
  • a vector can be introduced into host cells to thereby produce transcripts, proteins, or peptides, including fusion proteins or peptides, encoded by nucleic acids as described herein (e.g., clustered regularly interspersed short palindromic repeats (CRISPR) transcripts, proteins, enzymes, mutant forms thereof, fusion proteins thereof, etc.).
  • CRISPR clustered regularly interspersed short palindromic repeats
  • Advantageous vectors include lentiviruses and adeno-associated viruses, and types of such vectors can also be selected for targeting particular types of cells.
  • the invention provides a eukaryotic host cell comprising (a) a first regulatory element operably linked to a tracr mate sequence and one or more insertion sites for inserting one or more guide sequences upstream of the tracr mate sequence, wherein when expressed, the guide sequence directs sequence-specific binding of a CRISPR complex to a target sequence in a eukaryotic cell, wherein the CRISPR complex comprises a CRISPR enzyme complexed with (1) the guide sequence that is hybridized to the target sequence, and (2) the tracr mate sequence that is hybridized to the tracr sequence; and/or (b) a second regulatory element operably linked to an enzyme-coding sequence encoding said CRISPR enzyme comprising a nuclear localization sequence.
  • the host cell comprises components (a) and (b).
  • component (a), component (b), or components (a) and (b) are stably integrated into a genome of the host eukaryotic cell.
  • component (a) further comprises the tracr sequence downstream of the tracr mate sequence under the control of the first regulatory element.
  • component (a) further comprises two or more guide sequences operably linked to the first regulatory element, wherein when expressed, each of the two or more guide sequences direct sequence specific binding of a CRISPR complex to a different target sequence in a eukaryotic cell.
  • the eukaryotic host cell further comprises a third regulatory element, such as a polymerase III promoter, operably linked to said tracr sequence.
  • the tracr sequence exhibits at least 50%, 60%, 70%, 80%, 90%, 95%, or 99% of sequence complementarity along the length of the tracr mate sequence when optimally aligned.
  • the enzyme may be a Cas9 homolog or ortholog.
  • the CRISPR enzyme is codon-optimized for expression in a eukaryotic cell.
  • the CRISPR enzyme directs cleavage of one or two strands at the location of the target sequence.
  • the CRISPR enzyme lacks DNA strand cleavage activity.
  • the first regulatory element is a polymerase III promoter.
  • the second regulatory element is a polymerase II promoter.
  • the guide sequence is at least 15, 16, 17, 18, 19, 20, 25 nucleotides, or between 10-30, or between 15-25, or between 15-20 nucleotides in length.
  • the invention provides a non-human eukaryotic organism; preferably a multicellular eukaryotic organism, comprising a eukaryotic host cell according to any of the described embodiments.
  • the invention provides a eukaryotic organism; preferably a multicellular eukaryotic organism, comprising a eukaryotic host cell according to any of the described embodiments.
  • the organism in some embodiments of these aspects may be an animal; for example a mammal. Also, the organism may be an arthropod such as an insect. The organism also may be a plant. Further, the organism may be a fungus.
  • the invention provides a kit comprising one or more of the components described herein.
  • the kit comprises a vector system and instructions for using the kit.
  • the vector system comprises (a) a first regulatory element operably linked to a tracr mate sequence and one or more insertion sites for inserting one or more guide sequences upstream of the tracr mate sequence, wherein when expressed, the guide sequence directs sequence-specific binding of a CRISPR complex to a target sequence in a eukaryotic cell, wherein the CRISPR complex comprises a CRISPR enzyme complexed with (1) the guide sequence that is hybridized to the target sequence, and (2) the tracr mate sequence that is hybridized to the tracr sequence; and/or (b) a second regulatory element operably linked to an enzyme-coding sequence encoding said CRISPR enzyme comprising a nuclear localization sequence.
  • the kit comprises components (a) and (b) located on the same or different vectors of the system.
  • component (a) further comprises the tracr sequence downstream of the tracr mate sequence under the control of the first regulatory element.
  • component (a) further comprises two or more guide sequences operably linked to the first regulatory element, wherein when expressed, each of the two or more guide sequences direct sequence specific binding of a CRISPR complex to a different target sequence in a eukaryotic cell.
  • the system further comprises a third regulatory element, such as a polymerase III promoter, operably linked to said tracr sequence.
  • the tracr sequence exhibits at least 50%, 60%, 70%, 80%, 90%, 95%, or 99% of sequence complementarity along the length of the tracr mate sequence when optimally aligned.
  • the CRISPR enzyme comprises one or more nuclear localization sequences of sufficient strength to drive accumulation of said CRISPR enzyme in a detectable amount in the nucleus of a eukaryotic cell.
  • the CRISPR enzyme is a type II CRISPR system enzyme.
  • the CRISPR enzyme is a Cas9 enzyme.
  • the Cas9 enzyme is S. pneumoniae, S. pyogenes or S.
  • thermophilus Cas9 and may include mutated Cas9 derived from these organisms.
  • the enzyme may be a Cas9 homolog or ortholog.
  • the CRISPR enzyme is codon-optimized for expression in a eukaryotic cell.
  • the CRISPR enzyme directs cleavage of one or two strands at the location of the target sequence.
  • the CRISPR enzyme lacks DNA strand cleavage activity.
  • the first regulatory element is a polymerase III promoter.
  • the second regulatory element is a polymerase II promoter.
  • the guide sequence is at least 15, 16, 17, 18, 19, 20, 25 nucleotides, or between 10-30, or between 15-25, or between 15-20 nucleotides in length.
  • the invention provides a method of modifying a target polynucleotide in a eukaryotic cell.
  • the method comprises allowing a CRISPR complex to bind to the target polynucleotide to effect cleavage of said target polynucleotide thereby modifying the target polynucleotide, wherein the CRISPR complex comprises a CRISPR enzyme complexed with a guide sequence hybridized to a target sequence within said target polynucleotide, wherein said guide sequence is linked to a tracr mate sequence which in turn hybridizes to a tracr sequence.
  • said cleavage comprises cleaving one or two strands at the location of the target sequence by said CRISPR enzyme. In some embodiments, said cleavage results in decreased transcription of a target gene. In some embodiments, the method further comprises repairing said cleaved target polynucleotide by homologous recombination with an exogenous template polynucleotide, wherein said repair results in a mutation comprising an insertion, deletion, or substitution of one or more nucleotides of said target polynucleotide. In some embodiments, said mutation results in one or more amino acid changes in a protein expressed from a gene comprising the target sequence.
  • the method further comprises delivering one or more vectors to said eukaryotic cell, wherein the one or more vectors drive expression of one or more of: the CRISPR enzyme, the guide sequence linked to the tracr mate sequence, and the tracr sequence.
  • said vectors are delivered to the eukaryotic cell in a subject.
  • said modifying takes place in said eukaryotic cell in a cell culture.
  • the method further comprises isolating said eukaryotic cell from a subject prior to said modifying.
  • the method further comprises returning said eukaryotic cell and/or cells derived therefrom to said subject.
  • the invention provides a method of modifying expression of a polynucleotide in a eukaryotic cell.
  • the method comprises allowing a CRISPR complex to bind to the polynucleotide such that said binding results in increased or decreased expression of said polynucleotide; wherein the CRISPR complex comprises a CRISPR enzyme complexed with a guide sequence hybridized to a target sequence within said polynucleotide, wherein said guide sequence is linked to a tracr mate sequence which in turn hybridizes to a tracr sequence.
  • the method further comprises delivering one or more vectors to said eukaryotic cells, wherein the one or more vectors drive expression of one or more of: the CRISPR enzyme, the guide sequence linked to the tracr mate sequence, and the tracr sequence.
  • the invention provides a method of generating a model eukaryotic cell comprising a mutated disease gene.
  • a disease gene is any gene associated an increase in the risk of having or developing a disease.
  • the method comprises (a) introducing one or more vectors into a eukaryotic cell, wherein the one or more vectors drive expression of one or more of: a CRISPR enzyme, a guide sequence linked to a tracr mate sequence, and a tracr sequence; and (b) allowing a CRISPR complex to bind to a target polynucleotide to effect cleavage of the target polynucleotide within said disease gene, wherein the CRISPR complex comprises the CRISPR enzyme complexed with (1) the guide sequence that is hybridized to the target sequence within the target polynucleotide, and (2) the tracr mate sequence that is hybridized to the tracr sequence, thereby generating a model eukaryotic cell comprising
  • said cleavage comprises cleaving one or two strands at the location of the target sequence by said CRISPR enzyme. In some embodiments, said cleavage results in decreased transcription of a target gene. In some embodiments, the method further comprises repairing said cleaved target polynucleotide by homologous recombination with an exogenous template polynucleotide, wherein said repair results in a mutation comprising an insertion, deletion, or substitution of one or more nucleotides of said target polynucleotide. In some embodiments, said mutation results in one or more amino acid changes in a protein expression from a gene comprising the target sequence.
  • the invention provides a method for developing a biologically active agent that modulates a cell signaling event associated with a disease gene.
  • a disease gene is any gene associated an increase in the risk of having or developing a disease.
  • the method comprises (a) contacting a test compound with a model cell of any one of the described embodiments; and (b) detecting a change in a readout that is indicative of a reduction or an augmentation of a cell signaling event associated with said mutation in said disease gene, thereby developing said biologically active agent that modulates said cell signaling event associated with said disease gene.
  • the invention provides a recombinant polynucleotide comprising a guide sequence upstream of a tracr mate sequence, wherein the guide sequence when expressed directs sequence-specific binding of a CRISPR complex to a corresponding target sequence present in a eukaryotic cell.
  • the target sequence is a viral sequence present in a eukaryotic cell.
  • the target sequence is a proto-oncogene or an oncogene.
  • the invention provides for a method of selecting one or more cell(s) by introducing one or more mutations in a gene in the one or more cell (s), the method comprising: introducing one or more vectors into the cell (s), wherein the one or more vectors drive expression of one or more of: a CRISPR enzyme, a guide sequence linked to a tracr mate sequence, a tracr sequence, and an editing template; wherein the editing template comprises the one or more mutations that abolish CRISPR enzyme cleavage; allowing homologous recombination of the editing template with the target polynucleotide in the cell(s) to be selected; allowing a CRISPR complex to bind to a target polynucleotide to effect cleavage of the target polynucleotide within said gene, wherein the CRISPR complex comprises the CRISPR enzyme complexed with (1) the guide sequence that is hybridized to the target sequence within the target polynucleotide, and (2) the tracr mate
  • the CRISPR enzyme is Cas9.
  • the cell to be selected may be a eukaryotic cell. Aspects of the invention allow for selection of specific cells without requiring a selection marker or a two-step process that may include a counter-selection system Accordingly, it is an object of the invention not to encompass within the invention any previously known product, process of making the product, or method of using the product such that Applicants reserve the right and hereby disclose a disclaimer of any previously known product, process, or method.
  • the invention does not intend to encompass within the scope of the invention any product, process, or making of the product or method of using the product, which does not meet the written description and enablement requirements of the USPTO (35 U.S.C. ⁇ 112, first paragraph) or the EPO (Article 83 of the EPC), such that Applicants reserve the right and hereby disclose a disclaimer of any previously described product, process of making the product, or method of using the product.
  • FIG. 1 shows a schematic model of the CRISPR system.
  • the Cas9 nuclease from Streptococcus pyogenes (yellow) is targeted to genomic DNA by a synthetic guide RNA (sgRNA) consisting of a 20-nt guide sequence (blue) and a scaffold (red).
  • the guide sequence base-pairs with the DNA target (blue), directly upstream of a requisite 5′-NGG protospacer adjacent motif (PAM; magenta), and Cas9 mediates a double-stranded break (DSB) ⁇ 3 bp upstream of the PAM (red triangle).
  • PAM magenta
  • FIG. 2A-F shows an exemplary CRISPR system, a possible mechanism of action, an example adaptation for expression in eukaryotic cells, and results of tests assessing nuclear localization and CRISPR activity.
  • FIG. 2C discloses SEQ ID NOS 23-24, respectively, in order of appearance.
  • FIG. 2E discloses SEQ ID NOS 25-27, respectively, in order of appearance.
  • FIG. 2F discloses SEQ ID NOS 28-32, respectively, in order of appearance.
  • FIG. 3A-D shows results of an evaluation of SpCas9 specificity for an example target.
  • FIG. 3A discloses SEQ ID NOS 33, 26 and 34-44, respectively, in order of appearance.
  • FIG. 3C discloses SEQ ID NO: 33.
  • FIG. 4A-G shows an exemplary vector system and results for its use in directing homologous recombination in eukaryotic cells.
  • FIG. 4E discloses SEQ ID NO: 45.
  • FIG. 4F discloses SEQ ID NOS 46-47, respectively, in order of appearance.
  • FIG. 4G discloses SEQ ID NOS 48-52, respectively, in order of appearance.
  • FIG. 5 provides a table of protospacer sequences (SEQ ID NOS 16, 15, 14, 53-58, 18, 17 and 59-63, respectively, in order of appearance) and summarizes modification efficiency results for protospacer targets designed based on exemplary S. pyogenes and S. thermophilus CRISPR systems with corresponding PAMs against loci in human and mouse genomes.
  • FIG. 6A-C shows a comparison of different tracrRNA transcripts for Cas9-mediated gene targeting.
  • FIG. 6A discloses SEQ ID NOS 64-65, respectively, in order of appearance.
  • FIG. 7 shows a schematic of a surveyor nuclease assay for detection of double strand break-induced micro-insertions and -deletions.
  • FIG. 8A-B shows exemplary bicistronic expression vectors for expression of CRISPR system elements in eukaryotic cells.
  • FIG. 8A discloses SEQ ID NOS 66-68, respectively, in order of appearance.
  • FIG. 8B discloses SEQ ID NOS 69-71, respectively, in order of appearance.
  • FIG. 9A-C shows histograms of distances between adjacent S. pyogenes SF370 locus 1 PAM (NGG) ( FIG. 9A ) and S. thermophilus LMD9 locus 2 PAM (NNAGAAW) ( FIG. 9B ) in the human genome; and distances for each PAM by chromosome (Chr) ( FIG. 9C ).
  • FIG. 10A-D shows an exemplary CRISPR system, an example adaptation for expression in eukaryotic cells, and results of tests assessing CRISPR activity.
  • FIG. 10B discloses SEQ ID NOS 72-73, respectively, in order of appearance.
  • FIG. 10C discloses SEQ ID NO: 74.
  • FIG. 11A-C shows exemplary manipulations of a CRISPR system for targeting of genomic loci in mammalian cells.
  • FIG. 11A discloses SEQ ID NO: 75.
  • FIG. 11B discloses SEQ ID NOS 76-78, respectively, in order of appearance.
  • FIG. 12A-B shows the results of a Northern blot analysis of crRNA processing in mammalian cells.
  • FIG. 12A discloses SEQ ID NO: 79.
  • FIG. 13A-B shows an exemplary selection of protospacers in the human PVALB and mouse Th loci.
  • FIG. 13A discloses SEQ ID NO: 80.
  • FIG. 13B discloses SEQ ID NO: 81.
  • FIG. 14 shows example protospacer and corresponding PAM sequence targets of the S. thermophilus CRISPR system in the human EMX1 locus.
  • FIG. 14 discloses SEQ ID NO: 74.
  • FIG. 15 provides a table of sequences (SEQ ID NOS 82-93, respectively, in order of appearance) for primers and probes used for Surveyor, RFLP, genomic sequencing, and Northern blot assays.
  • FIG. 16A-C shows exemplary manipulation of a CRISPR system with chimeric RNAs and results of SURVEYOR assays for system activity in eukaryotic cells.
  • FIG. 16A discloses SEQ ID NO: 94.
  • FIG. 17A-B shows a graphical representation of the results of SURVEYOR assays for CRISPR system activity in eukaryotic cells.
  • FIG. 18 shows an exemplary visualization of some S. pyogenes Cas9 target sites in the human genome using the UCSC genome browser.
  • FIG. 18 discloses SEQ ID NOS 95-173, respectively, in order of appearance.
  • FIG. 19A-D shows a circular depiction of the phylogenetic analysis revealing five families of Cas9s, including three groups of large Cas9s ( ⁇ 1400 amino acids) and two of small Cas9s ( ⁇ 1100 amino acids).
  • FIG. 20A-F shows the linear depiction of the phylogenetic analysis revealing five families of Cas9s, including three groups of large Cas9s ( ⁇ 1400 amino acids) and two of small Cas9s ( ⁇ 1100 amino acids).
  • FIG. 21A-D shows genome editing via homologous recombination.
  • FIG. 21C discloses SEQ ID NOS 174-176, 174, 177 and 176, respectively, in order of appearance.
  • FIG. 22A-B shows single vector designs for SpCas9.
  • FIG. 22A discloses SEQ ID NOS 178-180, respectively, in order of appearance.
  • FIG. 22B discloses SEQ ID NO: 181.
  • polynucleotide refers to a polymeric form of nucleotides of any length, either deoxyribonucleotides or ribonucleotides, or analogs thereof.
  • Polynucleotides may have any three dimensional structure, and may perform any function, known or unknown.
  • polynucleotides coding or non-coding regions of a gene or gene fragment, loci (locus) defined from linkage analysis, exons, introns, messenger RNA (mRNA), transfer RNA, ribosomal RNA, short interfering RNA (siRNA), short-hairpin RNA (shRNA), micro-RNA (miRNA), ribozymes, cDNA, recombinant polynucleotides, branched polynucleotides, plasmids, vectors, isolated DNA of any sequence, isolated RNA of any sequence, nucleic acid probes, and primers.
  • loci locus defined from linkage analysis, exons, introns, messenger RNA (mRNA), transfer RNA, ribosomal RNA, short interfering RNA (siRNA), short-hairpin RNA (shRNA), micro-RNA (miRNA), ribozymes, cDNA, recombinant polynucleotides, branched poly
  • a polynucleotide may comprise one or more modified nucleotides, such as methylated nucleotides and nucleotide analogs. If present, modifications to the nucleotide structure may be imparted before or after assembly of the polymer. The sequence of nucleotides may be interrupted by non nucleotide components. A polynucleotide may be further modified after polymerization, such as by conjugation with a labeling component.
  • chimeric RNA refers to the polynucleotide sequence comprising the guide sequence, the tracr sequence and the tracr mate sequence.
  • guide sequence refers to the about 20 bp sequence within the guide RNA that specifies the target site and may be used interchangeably with the terms “guide” or “spacer”.
  • tracr mate sequence may also be used interchangeably with the term “direct repeat(s)”.
  • FIG. 1 An exemplary CRISPR-Cas system is illustrated in FIG. 1 .
  • wild type is a term of the art understood by skilled persons and means the typical form of an organism, strain, gene or characteristic as it occurs in nature as distinguished from mutant or variant forms.
  • variable should be taken to mean the exhibition of qualities that have a pattern that deviates from what occurs in nature.
  • nucleic acid molecules or polypeptides mean that the nucleic acid molecule or the polypeptide is at least substantially free from at least one other component with which they are naturally associated in nature and as found in nature.
  • “Complementarity” refers to the ability of a nucleic acid to form hydrogen bond(s) with another nucleic acid sequence by either traditional Watson-Crick or other non-traditional types.
  • a percent complementarity indicates the percentage of residues in a nucleic acid molecule which can form hydrogen bonds (e.g., Watson-Crick base pairing) with a second nucleic acid sequence (e.g., 5, 6, 7, 8, 9, 10 out of 10 being 50%, 60%, 70%, 80%, 90%, and 100% complementary).
  • Perfectly complementary means that all the contiguous residues of a nucleic acid sequence will hydrogen bond with the same number of contiguous residues in a second nucleic acid sequence.
  • “Substantially complementary” as used herein refers to a degree of complementarity that is at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%. 97%, 98%, 99%, or 100% over a region of 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 30, 35, 40, 45, 50, or more nucleotides, or refers to two nucleic acids that hybridize under stringent conditions.
  • stringent conditions for hybridization refer to conditions under which a nucleic acid having complementarity to a target sequence predominantly hybridizes with the target sequence, and substantially does not hybridize to non-target sequences. Stringent conditions are generally sequence-dependent, and vary depending on a number of factors. In general, the longer the sequence, the higher the temperature at which the sequence specifically hybridizes to its target sequence. Non-limiting examples of stringent conditions are described in detail in Tijssen (1993), Laboratory Techniques In Biochemistry And Molecular Biology—Hybridization With Nucleic Acid Probes Part 1, Second Chapter “Overview of principles of hybridization and the strategy of nucleic acid probe assay”, Elsevier, N.Y.
  • Hybridization refers to a reaction in which one or more polynucleotides react to form a complex that is stabilized via hydrogen bonding between the bases of the nucleotide residues.
  • the hydrogen bonding may occur by Watson Crick base pairing, Hoogstein binding, or in any other sequence specific manner.
  • the complex may comprise two strands forming a duplex structure, three or more strands forming a multi stranded complex, a single self hybridizing strand, or any combination of these.
  • a hybridization reaction may constitute a step in a more extensive process, such as the initiation of PCR, or the cleavage of a polynucleotide by an enzyme.
  • a sequence capable of hybridizing with a given sequence is referred to as the “complement” of the given sequence.
  • expression refers to the process by which a polynucleotide is transcribed from a DNA template (such as into and mRNA or other RNA transcript) and/or the process by which a transcribed mRNA is subsequently translated into peptides, polypeptides, or proteins.
  • Transcripts and encoded polypeptides may be collectively referred to as “gene product.” If the polynucleotide is derived from genomic DNA, expression may include splicing of the mRNA in a eukaryotic cell.
  • polypeptide refers to polymers of amino acids of any length.
  • the polymer may be linear or branched, it may comprise modified amino acids, and it may be interrupted by non amino acids.
  • the terms also encompass an amino acid polymer that has been modified; for example, disulfide bond formation, glycosylation, lipidation, acetylation, phosphorylation, or any other manipulation, such as conjugation with a labeling component.
  • amino acid includes natural and/or unnatural or synthetic amino acids, including glycine and both the D or L optical isomers, and amino acid analogs and peptidomimetics.
  • subject refers to a vertebrate, preferably a mammal, more preferably a human.
  • Mammals include, but are not limited to, murines, simians, humans, farm animals, sport animals, and pets. Tissues, cells and their progeny of a biological entity obtained in vivo or cultured in vitro are also encompassed.
  • therapeutic agent refers to a molecule or compound that confers some beneficial effect upon administration to a subject.
  • the beneficial effect includes enablement of diagnostic determinations; amelioration of a disease, symptom, disorder, or pathological condition; reducing or preventing the onset of a disease, symptom, disorder or condition; and generally counteracting a disease, symptom, disorder or pathological condition.
  • treatment or “treating,” or “palliating” or “ameliorating” are used interchangeably. These terms refer to an approach for obtaining beneficial or desired results including but not limited to a therapeutic benefit and/or a prophylactic benefit.
  • therapeutic benefit is meant any therapeutically relevant improvement in or effect on one or more diseases, conditions, or symptoms under treatment.
  • the compositions may be administered to a subject at risk of developing a particular disease, condition, or symptom, or to a subject reporting one or more of the physiological symptoms of a disease, even though the disease, condition, or symptom may not have yet been manifested.
  • an effective amount refers to the amount of an agent that is sufficient to effect beneficial or desired results.
  • the therapeutically effective amount may vary depending upon one or more of: the subject and disease condition being treated, the weight and age of the subject, the severity of the disease condition, the manner of administration and the like, which can readily be determined by one of ordinary skill in the art.
  • the term also applies to a dose that will provide an image for detection by any one of the imaging methods described herein.
  • the specific dose may vary depending on one or more of: the particular agent chosen, the dosing regimen to be followed, whether it is administered in combination with other compounds, timing of administration, the tissue to be imaged, and the physical delivery system in which it is carried.
  • Vectors can be designed for expression of CRISPR transcripts (e.g. nucleic acid transcripts, proteins, or enzymes) in prokaryotic or eukaryotic cells.
  • CRISPR transcripts e.g. nucleic acid transcripts, proteins, or enzymes
  • CRISPR transcripts can be expressed in bacterial cells such as Escherichia coli , insect cells (using baculovirus expression vectors), yeast cells, or mammalian cells. Suitable host cells are discussed further in Goeddel, GENE EXPRESSION TECHNOLOGY: METHODS IN ENZYMOLOGY 185, Academic Press, San Diego, Calif. (1990).
  • the recombinant expression vector can be transcribed and translated in vitro, for example using T7 promoter regulatory sequences and T7 polymerase.
  • Vectors may be introduced and propagated in a prokaryote.
  • a prokaryote is used to amplify copies of a vector to be introduced into a eukaryotic cell or as an intermediate vector in the production of a vector to be introduced into a eukaryotic cell (e.g. amplifying a plasmid as part of a viral vector packaging system).
  • a prokaryote is used to amplify copies of a vector and express one or more nucleic acids, such as to provide a source of one or more proteins for delivery to a host cell or host organism.
  • Fusion vectors add a number of amino acids to a protein encoded therein, such as to the amino terminus of the recombinant protein.
  • Such fusion vectors may serve one or more purposes, such as: (i) to increase expression of recombinant protein; (ii) to increase the solubility of the recombinant protein; and (iii) to aid in the purification of the recombinant protein by acting as a ligand in affinity purification.
  • a proteolytic cleavage site is introduced at the junction of the fusion moiety and the recombinant protein to enable separation of the recombinant protein from the fusion moiety subsequent to purification of the fusion protein.
  • enzymes, and their cognate recognition sequences include Factor Xa, thrombin and enterokinase.
  • Example fusion expression vectors include pGEX (Pharmacia Biotech Inc; Smith and Johnson, 1988 .
  • GST glutathione S-transferase
  • E. coli expression vectors examples include pTrc (Amrann et al., (1988) Gene 69:301-315) and pET 11d (Studier et al., GENE EXPRESSION TECHNOLOGY: METHODS IN ENZYMOLOGY 185, Academic Press, San Diego, Calif. (1990) 60-89).
  • a vector is a yeast expression vector.
  • yeast Saccharomyces cerivisae examples include pYepSec1 (Baldari, et al., 1987 . EMBO J. 6: 229-234), pMFa (Kuijan and Herskowitz, 1982 . Cell 30: 933-943), pJRY88 (Schultz et al., 1987 . Gene 54: 113-123), pYES2 (Invitrogen Corporation, San Diego, Calif.), and picZ (InVitrogen Corp, San Diego, Calif.).
  • a vector drives protein expression in insect cells using baculovirus expression vectors.
  • Baculovirus vectors available for expression of proteins in cultured insect cells include the pAc series (Smith, et al., 1983 . Mol. Cell. Biol. 3: 2156-2165) and the pVL series (Lucklow and Summers, 1989 . Virology 170: 31-39).
  • a vector is capable of driving expression of one or more sequences in mammalian cells using a mammalian expression vector.
  • mammalian expression vectors include pCDM8 (Seed, 1987 . Nature 329: 840) and pMT2PC (Kaufman, et al., 1987 . EMBO J. 6: 187-195).
  • the expression vector's control functions are typically provided by one or more regulatory elements.
  • commonly used promoters are derived from polyoma, adenovirus 2, cytomegalovirus, simian virus 40, and others disclosed herein and known in the art.
  • the recombinant mammalian expression vector is capable of directing expression of the nucleic acid preferentially in a particular cell type (e.g., tissue-specific regulatory elements are used to express the nucleic acid).
  • tissue-specific regulatory elements are known in the art.
  • suitable tissue-specific promoters include the albumin promoter (liver-specific; Pinkert, et al., 1987 . Genes Dev. 1: 268-277), lymphoid-specific promoters (Calame and Eaton, 1988 . Adv. Inmmunol. 43: 235-275), in particular promoters of T cell receptors (Winoto and Baltimore, 1989 . EMBO J.
  • promoters are also encompassed, e.g., the murine hox promoters (Kessel and Gruss, 1990 . Science 249: 374-379) and the ⁇ -fetoprotein promoter (Campes and Tilghman, 1989 . Genes Dev. 3: 537-546).
  • a regulatory element is operably linked to one or more elements of a CRISPR system so as to drive expression of the one or more elements of the CRISPR system.
  • CRISPRs Clustered Regularly Interspaced Short Palindromic Repeats
  • SPIDRs Sacer Interspersed Direct Repeats
  • the CRISPR locus comprises a distinct class of interspersed short sequence repeats (SSRs) that were recognized in E. coli (Ishino et al., J. Bacteriol., 169:5429-5433 [1987]; and Nakata et al., J.
  • the CRISPR loci typically differ from other SSRs by the structure of the repeats, which have been termed short regularly spaced repeats (SRSRs) (Janssen et al., OMICS J. Integ. Biol., 6:23-33 [2002]; and Mojica et al., Mol. Microbiol., 36:244-246 [2000]).
  • SRSRs short regularly spaced repeats
  • the repeats are short elements that occur in clusters that are regularly spaced by unique intervening sequences with a substantially constant length (Mojica et al., [2000], supra).
  • the repeat sequences are highly conserved between strains, the number of interspersed repeats and the sequences of the spacer regions typically differ from strain to strain (van Embden et al., J.
  • CRISPR loci have been identified in more than 40 prokaryotes (See e.g., Jansen et al., Mol. Microbiol., 43:1565-1575 [2002]; and Mojica et al., [2005]) including, but not limited to Aeropyrum, Pyrobaculum, Sulfolobus, Archaeoglobus, Halocarcula, Methanobacterium, Methanococcus, Methanosarcina, Methanopyrus, Pyrococcus, Picrophilus, Thermoplasnia, Corynebacterium, Mycobacterium, Streptomyces, Aquifex, Porphyromonas, Chlorobium, Thermus, Bacillus, Listeria, Staphylococcus, Clostridium, Thermoanaerobacter, Mycoplasma, Fusobacterium, Azarcus, Chromobacterium, Neisseria,
  • CRISPR system refers collectively to transcripts and other elements involved in the expression of or directing the activity of CRISPR-associated (“Cas”) genes, including sequences encoding a Cas gene, a tracr (trans-activating CRISPR) sequence (e.g. tracrRNA or an active partial tracrRNA), a tracr-mate sequence (encompassing a “direct repeat” and a tracrRNA-processed partial direct repeat in the context of an endogenous CRISPR system), a guide sequence (also referred to as a “spacer” in the context of an endogenous CRISPR system), or other sequences and transcripts from a CRISPR locus.
  • a tracr trans-activating CRISPR
  • tracr-mate sequence encompassing a “direct repeat” and a tracrRNA-processed partial direct repeat in the context of an endogenous CRISPR system
  • guide sequence also referred to as a “spacer” in the context of an endogenous CRISPR system
  • one or more elements of a CRISPR system is derived from a type 1, type II, or type III CRISPR system. In some embodiments, one or more elements of a CRISPR system is derived from a particular organism comprising an endogenous CRISPR system, such as Streptococcus pyogenes . In general, a CRISPR system is characterized by elements that promote the formation of a CRISPR complex at the site of a target sequence (also referred to as a protospacer in the context of an endogenous CRISPR system).
  • target sequence refers to a sequence to which a guide sequence is designed to have complementarity, where hybridization between a target sequence and a guide sequence promotes the formation of a CRISPR complex. Full complementarity is not necessarily required, provided there is sufficient complementarity to cause hybridization and promote formation of a CRISPR complex.
  • a target sequence may comprise any polynucleotide, such as DNA or RNA polynucleotides.
  • a target sequence is located in the nucleus or cytoplasm of a cell.
  • the target sequence may be within an organelle of a eukaryotic cell, for example, mitochondrion or chloroplast.
  • a sequence or template that may be used for recombination into the targeted locus comprising the target sequences is referred to as an “editing template” or “editing polynucleotide” or “editing sequence”.
  • an exogenous template polynucleotide may be referred to as an editing template.
  • the recombination is homologous recombination.
  • a CRISPR complex comprising a guide sequence hybridized to a target sequence and complexed with one or more Cas proteins
  • formation of a CRISPR complex results in cleavage of one or both strands in or near (e.g. within 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 50, or more base pairs from) the target sequence.
  • the tracr sequence which may comprise or consist of all or a portion of a wild-type tracr sequence (e.g.
  • a wild-type tracr sequence may also form part of a CRISPR complex, such as by hybridization along at least a portion of the tracr sequence to all or a portion of a tracr mate sequence that is operably linked to the guide sequence.
  • the tracr sequence has sufficient complementarity to a tracr mate sequence to hybridize and participate in formation of a CRISPR complex. As with the target sequence, it is believed that complete complementarity is not needed, provided there is sufficient to be functional.
  • the tracr sequence has at least 50%, 60%, 70%, 80%, 90%, 95% or 99% of sequence complementarity along the length of the tracr mate sequence when optimally aligned.
  • one or more vectors driving expression of one or more elements of a CRISPR system are introduced into a host cell such that expression of the elements of the CRISPR system direct formation of a CRISPR complex at one or more target sites.
  • a Cas enzyme, a guide sequence linked to a tracr-mate sequence, and a tracr sequence could each be operably linked to separate regulatory elements on separate vectors.
  • two or more of the elements expressed from the same or different regulatory elements may be combined in a single vector, with one or more additional vectors providing any components of the CRISPR system not included in the first vector.
  • CRISPR system elements that are combined in a single vector may be arranged in any suitable orientation, such as one element located 5′ with respect to (“upstream” of) or 3′ with respect to (“downstream” of) a second element.
  • the coding sequence of one element may be located on the same or opposite strand of the coding sequence of a second element, and oriented in the same or opposite direction.
  • a single promoter drives expression of a transcript encoding a CRISPR enzyme and one or more of the guide sequence, tracr mate sequence (optionally operably linked to the guide sequence), and a tracr sequence embedded within one or more intron sequences (e.g. each in a different intron, two or more in at least one intron, or all in a single intron).
  • the CRISPR enzyme, guide sequence, tracr mate sequence, and tracr sequence are operably linked to and expressed from the same promoter.
  • Single vector constructs for SpCas9 are illustrated in FIG. 22 .
  • a vector comprises one or more insertion sites, such as a restriction endonuclease recognition sequence (also referred to as a “cloning site”).
  • one or more insertion sites e.g. about or more than about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more insertion sites are located upstream and/or downstream of one or more sequence elements of one or more vectors.
  • a vector comprises an insertion site upstream of a tracr mate sequence, and optionally downstream of a regulatory element operably linked to the tracr mate sequence, such that following insertion of a guide sequence into the insertion site and upon expression the guide sequence directs sequence-specific binding of a CRISPR complex to a target sequence in a eukaryotic cell.
  • a vector comprises two or more insertion sites, each insertion site being located between two tracr mate sequences so as to allow insertion of a guide sequence at each site.
  • the two or more guide sequences may comprise two or more copies of a single guide sequence, two or more different guide sequences, or combinations of these.
  • a single expression construct may be used to target CRISPR activity to multiple different, corresponding target sequences within a cell.
  • a single vector may comprise about or more than about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, or more guide sequences. In some embodiments, about or more than about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more such guide-sequence-containing vectors may be provided, and optionally delivered to a cell.
  • a vector comprises a regulatory element operably linked to an enzyme-coding sequence encoding a CRISPR enzyme, such as a Cas protein.
  • Cas proteins include Cas1, Cas1B, Cas2, Cas3, Cas4, Cas5, Cas6, Cas7, Cas8, Cas9 (also known as Csn1 and Csx12), Cas10, Csy1, Csy2, Csy3, Cse1, Cse2, Csc1, Csc2, Csa5, Csn2, Csm2, Csm3, Csm4, Csm5, Csm6, Cmr1, Cmr3, Cmr4, Cmr5, Cmr6, Csb1, Csb2, Csb3, Csx17, Csx14, Csx10, Csx16, CsaX, Csx3, Csx1, Csx15, Csf1, Csf2, Csf3, Csf4, homologs thereof, or modified versions thereof.
  • the amino acid sequence of S. pyogenes Cas9 protein may be found in the SwissProt database under accession number Q99ZW2.
  • the unmodified CRISPR enzyme has DNA cleavage activity, such as Cas9.
  • the CRISPR enzyme is Cas9, and may be Cas9 from S. pyogenes or S. pneumoniae .
  • the CRISPR enzyme directs cleavage of one or both strands at the location of a target sequence, such as within the target sequence and/or within the complement of the target sequence.
  • the CRISPR enzyme directs cleavage of one or both strands within about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 50, 100, 200, 500, or more base pairs from the first or last nucleotide of a target sequence.
  • a vector encodes a CRISPR enzyme that is mutated to with respect to a corresponding wild-type enzyme such that the mutated CRISPR enzyme lacks the ability to cleave one or both strands of a target polynucleotide containing a target sequence.
  • D10A aspartate-to-alanine substitution
  • nickases may be used for genome editing via homologous recombination,
  • FIG. 21 shows genome editing via homologous recombination.
  • FIG. 21 (a) shows the schematic of SpCas9 nickase, with D10A mutation in the RuvC I catalytic domain.
  • a Cas9 nickase may be used in combination with guide sequence(s), e.g., two guide sequences, which target respectively sense and antisense strands of the DNA target. This combination allows both strands to be nicked and used to induce NHEJ.
  • guide sequence(s) e.g., two guide sequences, which target respectively sense and antisense strands of the DNA target.
  • This combination allows both strands to be nicked and used to induce NHEJ.
  • Applicants have demonstrated (data not shown) the efficacy of two nickase targets (i.e., sgRNAs targeted at the same location but to different strands of DNA) in inducing mutagenic NHEJ.
  • a single nickase (Cas9-D10A with a single sgRNA) is unable to induce NHEJ and create indels but Applicants have shown that double nickase (Cas9-D10A and two sgRNAs targeted to different strands at the same location) can do so in human embryonic stem cells (hESCs).
  • the efficiency is about 50% of nuclease (i.e., regular Cas9 without D10 mutation) in hESCs.
  • two or more catalytic domains of Cas9 may be mutated to produce a mutated Cas9 substantially lacking all DNA cleavage activity.
  • a D10A mutation is combined with one or more of H840A, N854A, or N863A mutations to produce a Cas9 enzyme substantially lacking all DNA cleavage activity.
  • a CRISPR enzyme is considered to substantially lack all DNA cleavage activity when the DNA cleavage activity of the mutated enzyme is less than about 25%, 10%, 5%, 1%, 0.1%, 0.01%, or lower with respect to its non-mutated form.
  • Other mutations may be useful; where the Cas9 or other CRISPR enzyme is from a species other than S. pyogenes , mutations in corresponding amino acids may be made to achieve similar effects.
  • an enzyme coding sequence encoding a CRISPR enzyme is codon optimized for expression in particular cells, such as eukaryotic cells.
  • the eukaryotic cells may be those of or derived from a particular organism, such as a mammal, including but not limited to human, mouse, rat, rabbit, dog, or non-human primate.
  • codon optimization refers to a process of modifying a nucleic acid sequence for enhanced expression in the host cells of interest by replacing at least one codon (e.g. about or more than about 1, 2, 3, 4, 5, 10, 15, 20, 25, 50, or more codons) of the native sequence with codons that are more frequently or most frequently used in the genes of that host cell while maintaining the native amino acid sequence.
  • Codon bias differs in codon usage between organisms
  • mRNA messenger RNA
  • tRNA transfer RNA
  • the predominance of selected tRNAs in a cell is generally a reflection of the codons used most frequently in peptide synthesis. Accordingly, genes can be tailored for optimal gene expression in a given organism based on codon optimization. Codon usage tables are readily available, for example, at the “Codon Usage Database”, and these tables can be adapted in a number of ways.
  • codon optimizing a particular sequence for expression in a particular host cell are also available, such as Gene Forge (Aptagen; Jacobus, Pa.), are also available.
  • one or more codons e.g. 1, 2, 3, 4, 5, 10, 15, 20, 25, 50, or more, or all codons
  • one or more codons in a sequence encoding a CRISPR enzyme correspond to the most frequently used codon for a particular amino acid.
  • a guide sequence is any polynucleotide sequence having sufficient complementarity with a target polynucleotide sequence to hybridize with the target sequence and direct sequence-specific binding of a CRISPR complex to the target sequence.
  • the degree of complementarity between a guide sequence and its corresponding target sequence, when optimally aligned using a suitable alignment algorithm is about or more than about 50%, 60%, 75%, 80%, 85%, 90%, 95%, 97.5%, 99%, or more.
  • Optimal alignment may be determined with the use of any suitable algorithm for aligning sequences, non-limiting example of which include the Smith-Waterman algorithm, the Needleman-Wunsch algorithm, algorithms based on the Burrows-Wheeler Transform (e.g. the Burrows Wheeler Aligner), ClustalW, Clustal X, BLAT, Novoalign (Novocraft Technologies, ELAND (Illumina, San Diego, Calif.), SOAP (available at soap.genomics.org.cn), and Maq (available at maq.sourceforge.net).
  • any suitable algorithm for aligning sequences include the Smith-Waterman algorithm, the Needleman-Wunsch algorithm, algorithms based on the Burrows-Wheeler Transform (e.g. the Burrows Wheeler Aligner), ClustalW, Clustal X, BLAT, Novoalign (Novocraft Technologies, ELAND (Illumina, San Diego, Calif.), SOAP (available at soap.genomics.org.cn), and
  • a guide sequence is about or more than about 5, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 35, 40, 45, 50, 75, or more nucleotides in length. In some embodiments, a guide sequence is less than about 75, 50, 45, 40, 35, 30, 25, 20, 15, 12, or fewer nucleotides in length. The ability of a guide sequence to direct sequence-specific binding of a CRISPR complex to a target sequence may be assessed by any suitable assay.
  • the components of a CRISPR system sufficient to form a CRISPR complex may be provided to a host cell having the corresponding target sequence, such as by transfection with vectors encoding the components of the CRISPR sequence, followed by an assessment of preferential cleavage within the target sequence, such as by Surveyor assay as described herein.
  • cleavage of a target polynucleotide sequence may be evaluated in a test tube by providing the target sequence, components of a CRISPR complex, including the guide sequence to be tested and a control guide sequence different from the test guide sequence, and comparing binding or rate of cleavage at the target sequence between the test and control guide sequence reactions.
  • Other assays are possible, and will occur to those skilled in the art.
  • a guide sequence may be selected to target any target sequence.
  • the target sequence is a sequence within a genome of a cell.
  • Exemplary target sequences include those that are unique in the target genome.
  • a unique target sequence in a genome may include a Cas9 target site of the form MMMMMMMMNNNNNNNNNNNNXGG where NNNNNNNNNNXGG (N is A, G, T, or C; and X can be anything) has a single occurrence in the genome.
  • a unique target sequence in a genome may include an S.
  • a unique target sequence in a genome may include a Cas9 target site of the form MMMMMMMMNNNNNNNNNNNNXAGAAW (SEQ ID NO: 1) where NNNNNNNNNNXXAGAAW (SEQ ID NO: 2) (N is A, G, T, or C; X can be anything; and W is A or T) has a single occurrence in the genome.
  • a unique target sequence in a genome may include an S.
  • a unique target sequence in a genome may include a Cas9 target site of the form MMMMMMMMNNNNNNNNNNNNNNNNNNNNNNNNNNNNXGGXG where NNNNNNNNNNNNXGGXG (N is A, G, T, or C; and X can be anything) has a single occurrence in the genome.
  • a unique target sequence in a genome may include an S. pyogenes Cas9 target site of the form MMMMMMMMMNNNNNNNNNNNNNXGGXG where NNNNNNNNNXGGXG (N is A, G, T, or C; and X can be anything) has a single occurrence in the genome.
  • N is A, G, T, or C; and X can be anything
  • M may be A, G, T, or C, and need not be considered in identifying a sequence as unique.
  • a guide sequence is selected to reduce the degree of secondary structure within the guide sequence.
  • Secondary structure may be determined by any suitable polynucleotide folding algorithm. Some programs are based on calculating the minimal Gibbs free energy. An example of one such algorithm is mFold, as described by Zuker and Stiegler (Nucleic Acids Res. 9 (1981), 133-148). Another example folding algorithm is the online webserver RNAfold, developed at Institute for Theoretical Chemistry at the University of Vienna, using the centroid structure prediction algorithm (see e.g. A. R. Gruber et al., 2008 , Cell 106(1): 23-24; and P A Carr and G M Church, 2009 , Nature Biotechnology 27(12): 1151-62). Further algorithms may be found in U.S. application Ser. No. 61/836,080 (attorney docket 44790.11.2022; Broad Reference BI-2013/004A); incorporated herein by reference.
  • a tracr mate sequence includes any sequence that has sufficient complementarity with a tracr sequence to promote one or more of: (1) excision of a guide sequence flanked by tracr mate sequences in a cell containing the corresponding tracr sequence; and (2) formation of a CRISPR complex at a target sequence, wherein the CRISPR complex comprises the tracr mate sequence hybridized to the tracr sequence.
  • degree of complementarity is with reference to the optimal alignment of the tracr mate sequence and tracr sequence, along the length of the shorter of the two sequences.
  • Optimal alignment may be determined by any suitable alignment algorithm, and may further account for secondary structures, such as self-complementarity within either the tracr sequence or tracr mate sequence.
  • the degree of complementarity between the tracr sequence and tracr mate sequence along the length of the shorter of the two when optimally aligned is about or more than about 25%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 97.5%, 99%, or higher.
  • Example illustrations of optimal alignment between a tracr sequence and a tracr mate sequence are provided in FIGS. 10B and 11B .
  • the tracr sequence is about or more than about 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 40, 50, or more nucleotides in length.
  • the tracr sequence and tracr mate sequence are contained within a single transcript, such that hybridization between the two produces a transcript having a secondary structure, such as a hairpin.
  • Preferred loop forming sequences for use in hairpin structures are four nucleotides in length, and most preferably have the sequence GAAA. However, longer or shorter loop sequences may be used, as may alternative sequences.
  • the sequences preferably include a nucleotide triplet (for example, AAA), and an additional nucleotide (for example C or G). Examples of loop forming sequences include CAAA and AAAG.
  • the transcript or transcribed polynucleotide sequence has at least two or more hairpins.
  • the transcript has two, three, four or five hairpins. In a further embodiment of the invention, the transcript has at most five hairpins.
  • the single transcript further includes a transcription termination sequence; preferably this is a polyT sequence, for example six T nucleotides. An example illustration of such a hairpin structure is provided in the lower portion of FIG. 11B , where the portion of the sequence 5′ of the final “N” and upstream of the loop corresponds to the tracr mate sequence, and the portion of the sequence 3′ of the loop corresponds to the tracr sequence.
  • single polynucleotides comprising a guide sequence, a tracr mate sequence, and a tracr sequence are as follows (listed 5′ to 3′), where “N” represents a base of a guide sequence, the first block of lower case letters represent the tracr mate sequence, and the second block of lower case letters represent the tracr sequence, and the final poly-T sequence represents the transcription terminator: (1) NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNgttttgtactctcaagatttaGAAAtaaatcttgcagaagctacaaagataggctt catgccgaaatcaacaccctgtcattttatggcagggtgttttcgttatttaaTTTTTTTTTTTT (SEQ ID NO: 5); (2) NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  • sequences (1) to (3) are used in combination with Cas9 from S. thermophilus CRISPR1.
  • sequences (4) to (6) are used in combination with Cas9 from S. pyogenes .
  • the tracr sequence is a separate transcript from a transcript comprising the tracr mate sequence (such as illustrated in the top portion of FIG. 11B ).
  • the CRISPR enzyme is part of a fusion protein comprising one or more heterologous protein domains (e.g. about or more than about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more domains in addition to the CRISPR enzyme).
  • a CRISPR enzyme fusion protein may comprise any additional protein sequence, and optionally a linker sequence between any two domains.
  • protein domains that may be fused to a CRISPR enzyme include, without limitation, epitope tags, reporter gene sequences, and protein domains having one or more of the following activities: methylase activity, demethylase activity, transcription activation activity, transcription repression activity, transcription release factor activity, histone modification activity, RNA cleavage activity and nucleic acid binding activity.
  • epitope tags include histidine (His) tags, V5 tags, FLAG tags, influenza hemagglutinin (HA) tags, Myc tags, VSV-G tags, and thioredoxin (Trx) tags.
  • reporter genes include, but are not limited to, glutathione-S-transferase (GST), horseradish peroxidase (HRP), chloramphenicol acetyltransferase (CAT) beta-galactosidase, beta-glucuronidase, luciferase, green fluorescent protein (GFP), HcRed, DsRed, cyan fluorescent protein (CFP), yellow fluorescent protein (YFP), and autofluorescent proteins including blue fluorescent protein (BFP).
  • GST glutathione-S-transferase
  • HRP horseradish peroxidase
  • CAT chloramphenicol acetyltransferase
  • beta-galactosidase beta-galactosidase
  • beta-glucuronidase beta-galactosidase
  • luciferase green fluorescent protein
  • GFP green fluorescent protein
  • HcRed HcRed
  • DsRed cyan fluorescent protein
  • a CRISPR enzyme may be fused to a gene sequence encoding a protein or a fragment of a protein that bind DNA molecules or bind other cellular molecules, including but not limited to maltose binding protein (MBP), S-tag, Lex A DNA binding domain (DBD) fusions, GAL4A DNA binding domain fusions, and herpes simplex virus (HSV) BP16 protein fusions. Additional domains that may form part of a fusion protein comprising a CRISPR enzyme are described in US20110059502, incorporated herein by reference. In some embodiments, a tagged CRISPR enzyme is used to identify the location of a target sequence.
  • MBP maltose binding protein
  • DBD Lex A DNA binding domain
  • HSV herpes simplex virus
  • a reporter gene which includes but is not limited to glutathione-S-transferase (GST), horseradish peroxidase (HRP), chloramphenicol acetyltransferase (CAT) beta-galactosidase, beta-glucuronidase, luciferase, green fluorescent protein (GFP), HcRed, DsRed, cyan fluorescent protein (CFP), yellow fluorescent protein (YFP), and autofluorescent proteins including blue fluorescent protein (BFP), may be introduced into a cell to encode a gene product which serves as a marker by which to measure the alteration or modification of expression of the gene product.
  • GST glutathione-S-transferase
  • HRP horseradish peroxidase
  • CAT chloramphenicol acetyltransferase
  • beta-galactosidase beta-galactosidase
  • beta-glucuronidase beta-galactosidase
  • the DNA molecule encoding the gene product may be introduced into the cell via a vector.
  • the gene product is luciferase.
  • the expression of the gene product is decreased.
  • the invention provides methods comprising delivering one or more polynucleotides, such as or one or more vectors as described herein, one or more transcripts thereof, and/or one or proteins transcribed therefrom, to a host cell.
  • the invention further provides cells produced by such methods, and organisms (such as animals, plants, or fungi) comprising or produced from such cells.
  • a CRISPR enzyme in combination with (and optionally complexed with) a guide sequence is delivered to a cell.
  • Conventional viral and non-viral based gene transfer methods can be used to introduce nucleic acids in mammalian cells or target tissues.
  • Non-viral vector delivery systems include DNA plasmids, RNA (e.g. a transcript of a vector described herein), naked nucleic acid, and nucleic acid complexed with a delivery vehicle, such as a liposome.
  • Viral vector delivery systems include DNA and RNA viruses, which have either episomal or integrated genomes after delivery to the cell.
  • Methods of non-viral delivery of nucleic acids include lipofection, nucleofection, microinjection, biolistics, virosomes, liposomes, immunoliposomes, polycation or lipid:nucleic acid conjugates, naked DNA, artificial virions, and agent-enhanced uptake of DNA.
  • Lipofection is described in e.g., U.S. Pat. Nos. 5,049,386, 4,946,787; and 4,897,355) and lipofection reagents are sold commercially (e.g., TransfectamTM and LipofectinTM).
  • Cationic and neutral lipids that are suitable for efficient receptor-recognition lipofection of polynucleotides include those of Felgner, WO 91/17424; WO 91/16024. Delivery can be to cells (e.g. in vitro or ex vivo administration) or target tissues (e.g. in vivo administration).
  • lipid:nucleic acid complexes including targeted liposomes such as immunolipid complexes
  • the preparation of lipid:nucleic acid complexes, including targeted liposomes such as immunolipid complexes is well known to one of skill in the art (see, e.g., Crystal, Science 270:404-410 (1995); Blaese et al., Cancer Gene Ther. 2:291-297 (1995); Behr et al., Bioconjugate Chem. 5:382-389 (1994); Remy et al., Bioconjugate Chem. 5:647-654 (1994); Gao et al., Gene Therapy 2:710-722 (1995); Ahmad et al., Cancer Res. 52:4817-4820 (1992); U.S. Pat. Nos. 4,186,183, 4,217,344, 4,235,871, 4,261,975, 4,485,054, 4,501,728, 4,774,085, 4,837,028, and 4,946,787).
  • RNA or DNA viral based systems for the delivery of nucleic acids take advantage of highly evolved processes for targeting a virus to specific cells in the body and trafficking the viral payload to the nucleus.
  • Viral vectors can be administered directly to patients (in vivo) or they can be used to treat cells in vitro, and the modified cells may optionally be administered to patients (ex vivo).
  • Conventional viral based systems could include retroviral, lentivirus, adenoviral, adeno-associated and herpes simplex virus vectors for gene transfer. Integration in the host genome is possible with the retrovirus, lentivirus, and adeno-associated virus gene transfer methods, often resulting in long term expression of the inserted transgene. Additionally, high transduction efficiencies have been observed in many different cell types and target tissues.
  • Lentiviral vectors are retroviral vectors that are able to transduce or infect non-dividing cells and typically produce high viral titers. Selection of a retroviral gene transfer system would therefore depend on the target tissue. Retroviral vectors are comprised of cis-acting long terminal repeats with packaging capacity for up to 6-10 kb of foreign sequence. The minimum cis-acting LTRs are sufficient for replication and packaging of the vectors, which are then used to integrate the therapeutic gene into the target cell to provide permanent transgene expression.
  • Widely used retroviral vectors include those based upon murine leukemia virus (MuLV), gibbon ape leukemia virus (GaLV), Simian Immuno deficiency virus (SIV), human immuno deficiency virus (HIV), and combinations thereof (see, e.g., Buchscher et al., J. Virol. 66:2731-2739 (1992); Johann et al., J. Virol. 66:1635-1640 (1992); Sommnerfelt et al., Virol. 176:58-59 (1990); Wilson et al., J. Virol. 63:2374-2378 (1989); Miller et al., J. Virol.
  • MiLV murine leukemia virus
  • GaLV gibbon ape leukemia virus
  • SIV Simian Immuno deficiency virus
  • HAV human immuno deficiency virus
  • adenoviral based systems may be used.
  • Adenoviral based vectors are capable of very high transduction efficiency in many cell types and do not require cell division. With such vectors, high titer and levels of expression have been obtained. This vector can be produced in large quantities in a relatively simple system.
  • Adeno-associated virus (“AAV”) vectors may also be used to transduce cells with target nucleic acids, e.g., in the in vitro production of nucleic acids and peptides, and for in vivo and ex vivo gene therapy procedures (see, e.g., West et al., Virology 160:38-47 (1987); U.S. Pat. No. 4,797,368; WO 93/24641; Kotin, Human Gene Therapy 5:793-801 (1994); Muzyczka, J. Clin. Invest. 94:1351 (1994). Construction of recombinant AAV vectors are described in a number of publications, including U.S. Pat. No.
  • Packaging cells are typically used to form virus particles that are capable of infecting a host cell. Such cells include 293 cells, which package adenovirus, and ⁇ 2 cells or PA317 cells, which package retrovirus.
  • Viral vectors used in gene therapy are usually generated by producing a cell line that packages a nucleic acid vector into a viral particle. The vectors typically contain the minimal viral sequences required for packaging and subsequent integration into a host, other viral sequences being replaced by an expression cassette for the polynucleotide(s) to be expressed. The missing viral functions are typically supplied in trans by the packaging cell line. For example, AAV vectors used in gene therapy typically only possess ITR sequences from the AAV genome which are required for packaging and integration into the host genome.
  • Viral DNA is packaged in a cell line, which contains a helper plasmid encoding the other AAV genes, namely rep and cap, but lacking ITR sequences.
  • the cell line may also be infected with adenovirus as a helper.
  • the helper virus promotes replication of the AAV vector and expression of AAV genes from the helper plasmid.
  • the helper plasmid is not packaged in significant amounts due to a lack of ITR sequences. Contamination with adenovirus can be reduced by, e.g., heat treatment to which adenovirus is more sensitive than AAV. Additional methods for the delivery of nucleic acids to cells are known to those skilled in the art. See, for example, US20030087817, incorporated herein by reference.
  • a host cell is transiently or non-transiently transfected with one or more vectors described herein.
  • a cell is transfected as it naturally occurs in a subject.
  • a cell that is transfected is taken from a subject.
  • the cell is derived from cells taken from a subject, such as a cell line. A wide variety of cell lines for tissue culture are known in the art.
  • cell lines include, but are not limited to, C8161, CCRF-CEM, MOLT, mIMCD-3, NHDF, HeLa-S3, Huh1, Huh4, Huh7, HUVEC, HASMC, HEKn, HEKa, MiaPaCell, Panc1, PC-3, TF1, CTLL-2, C1R, Rat6, CV1, RPTE, A10, T24, J82, A375, ARH-77, Calu1, SW480, SW620, SKOV3, SK-UT, CaCo2, P388D1, SEM-K2, WEHI-231, HB56, TIB55, Jurkat, J45.01, LRMB, Bcl-1, BC-3, IC21, DLD2, Raw264.7, NRK, NRK-52E, MRC5, MEF, Hep G2, HeLa B, HeLa T4, COS, COS-1, COS-6, COS-M6A, BS-C-1 monkey kidney epithelial, BALB
  • a cell transfected with one or more vectors described herein is used to establish a new cell line comprising one or more vector-derived sequences.
  • a cell transiently transfected with the components of a CRISPR system as described herein (such as by transient transfection of one or more vectors, or transfection with RNA), and modified through the activity of a CRISPR complex, is used to establish a new cell line comprising cells containing the modification but lacking any other exogenous sequence.
  • cells transiently or non-transiently transfected with one or more vectors described herein, or cell lines derived from such cells are used in assessing one or more test compounds.
  • one or more vectors described herein are used to produce a non-human transgenic animal or transgenic plant.
  • the transgenic animal is a mammal, such as a mouse, rat, or rabbit.
  • the organism or subject is a plant.
  • the organism or subject or plant is algae.
  • Methods for producing transgenic plants and animals are known in the art, and generally begin with a method of cell transfection, such as described herein.
  • Transgenic animals are also provided, as are transgenic plants, especially crops and algae. The transgenic animal or plant may be useful in applications outside of providing a disease model.
  • transgenic plants especially pulses and tubers, and animals, especially mammals such as livestock (cows, sheep, goats and pigs), but also poultry and edible insects, are preferred.
  • Transgenic algae or other plants such as rape may be particularly useful in the production of vegetable oils or biofuels such as alcohols (especially methanol and ethanol), for instance. These may be engineered to express or overexpress high levels of oil or alcohols for use in the oil or biofuel industries.
  • alcohols especially methanol and ethanol
  • the invention provides for methods of modifying a target polynucleotide in a eukaryotic cell, which may be in vivo, ex vivo or in vitro.
  • the method comprises sampling a cell or population of cells from a human or non-human animal or plant (including micro-algae), and modifying the cell or cells. Culturing may occur at any stage ex vivo. The cell or cells may even be re-introduced into the non-human animal or plant (including micro-algae).
  • the invention provides for methods of modifying a target polynucleotide in a eukaryotic cell.
  • the method comprises allowing a CRISPR complex to bind to the target polynucleotide to effect cleavage of said target polynucleotide thereby modifying the target polynucleotide, wherein the CRISPR complex comprises a CRISPR enzyme complexed with a guide sequence hybridized to a target sequence within said target polynucleotide, wherein said guide sequence is linked to a tracr mate sequence which in turn hybridizes to a tracr sequence.
  • the invention provides a method of modifying expression of a polynucleotide in a eukaryotic cell.
  • the method comprises allowing a CRISPR complex to bind to the polynucleotide such that said binding results in increased or decreased expression of said polynucleotide; wherein the CRISPR complex comprises a CRISPR enzyme complexed with a guide sequence hybridized to a target sequence within said polynucleotide, wherein said guide sequence is linked to a tracr mate sequence which in turn hybridizes to a tracr sequence.
  • pathogens are often host-specific.
  • Fusarium oxysporum f. sp. lycopersici causes tomato wilt but attacks only tomato
  • Plants have existing and induced defenses to resist most pathogens. Mutations and recombination events across plant generations lead to genetic variability that gives rise to susceptibility, especially as pathogens reproduce with more frequency than plants. In plants there can be non-host resistance, e.g., the host and pathogen are incompatible.
  • Horizontal Resistance e.g., partial resistance against all races of a pathogen, typically controlled by many genes
  • Vertical Resistance e.g., complete resistance to some races of a pathogen but not to other races, typically controlled by a few genes.
  • Plant and pathogens evolve together, and the genetic changes in one balance changes in other. Accordingly, using Natural Variability, breeders combine most useful genes for Yield, Quality, Uniformity, Hardiness, Resistance.
  • the sources of resistance genes include native or foreign Varieties, Heirloom Varieties, Wild Plant Relatives, and Induced Mutations, e.g., treating plant material with mutagenic agents.
  • plant breeders are provided with a new tool to induce mutations. Accordingly, one skilled in the art can analyze the genome of sources of resistance genes, and in Varieties having desired characteristics or traits employ the present invention to induce the rise of resistance genes, with more precision than previous mutagenic agents and hence accelerate and improve plant breeding programs.
  • the invention provides kits containing any one or more of the elements disclosed in the above methods and compositions.
  • the kit comprises a vector system and instructions for using the kit.
  • the vector system comprises (a) a first regulatory element operably linked to a tracr mate sequence and one or more insertion sites for inserting a guide sequence upstream of the tracr mate sequence, wherein when expressed, the guide sequence directs sequence-specific binding of a CRISPR complex to a target sequence in a eukaryotic cell, wherein the CRISPR complex comprises a CRISPR enzyme complexed with (1) the guide sequence that is hybridized to the target sequence, and (2) the tracr mate sequence that is hybridized to the tracr sequence; and/or (b) a second regulatory element operably linked to an enzyme-coding sequence encoding said CRISPR enzyme comprising a nuclear localization sequence.
  • Elements may be provided individually or in combinations, and may be provided in any suitable container, such as a vial, a bottle, or
  • a kit comprises one or more reagents for use in a process utilizing one or more of the elements described herein.
  • Reagents may be provided in any suitable container.
  • a kit may provide one or more reaction or storage buffers.
  • Reagents may be provided in a form that is usable in a particular assay, or in a form that requires addition of one or more other components before use (e.g. in concentrate or lyophilized form).
  • a buffer can be any buffer, including but not limited to a sodium carbonate buffer, a sodium bicarbonate buffer, a borate buffer, a Tris buffer, a MOPS buffer, a HEPES buffer, and combinations thereof.
  • the buffer is alkaline.
  • the buffer has a pH from about 7 to about 10.
  • the kit comprises one or more oligonucleotides corresponding to a guide sequence for insertion into a vector so as to operably link the guide sequence and a regulatory element.
  • the kit comprises a homologous recombination template polynucleotide.
  • the invention provides methods for using one or more elements of a CRISPR system.
  • the CRISPR complex of the invention provides an effective means for modifying a target polynucleotide.
  • the CRISPR complex of the invention has a wide variety of utility including modifying (e.g., deleting, inserting, translocating, inactivating, activating) a target polynucleotide in a multiplicity of cell types.
  • the CRISPR complex of the invention has a broad spectrum of applications in, e.g., gene therapy, drug screening, disease diagnosis, and prognosis.
  • An exemplary CRISPR complex comprises a CRISPR enzyme complexed with a guide sequence hybridized to a target sequence within the target polynucleotide.
  • the guide sequence is linked to a tracr mate sequence, which in turn hybridizes to a tracr sequence.
  • the target polynucleotide of a CRISPR complex can be any polynucleotide endogenous or exogenous to the eukaryotic cell.
  • the target polynucleotide can be a polynucleotide residing in the nucleus of the eukaryotic cell.
  • the target polynucleotide can be a sequence coding a gene product (e.g., a protein) or a non-coding sequence (e.g., a regulatory polynucleotide or a junk DNA).
  • a gene product e.g., a protein
  • a non-coding sequence e.g., a regulatory polynucleotide or a junk DNA.
  • PAM protospacer adjacent motif
  • PAMs are typically 2-5 base pair sequences adjacent the protospacer (that is, the target sequence) Examples of PAM sequences are given in the examples section below, and the skilled person will be able to identify further PAM sequences for use with a given CRISPR enzyme.
  • the target polynucleotide of a CRISPR complex may include a number of disease-associated genes and polynucleotides as well as signaling biochemical pathway-associated genes and polynucleotides as listed in U.S. provisional patent applications 61/736,527 and 61/748,427 having Broad reference BI-2011/008/WSGR Docket No. 44063-701.101 and BI-2011/008/WSGR Docket No. 44063-701.102 respectively, both entitled SYSTEMS METHODS AND COMPOSITIONS FOR SEQUENCE MANIPULATION filed on Dec. 12, 2012 and Jan. 2, 2013, respectively, the contents of all of which are herein incorporated by reference in their entirety.
  • target polynucleotides include a sequence associated with a signaling biochemical pathway, e.g., a signaling biochemical pathway-associated gene or polynucleotide.
  • target polynucleotides include a disease associated gene or polynucleotide.
  • a “disease-associated” gene or polynucleotide refers to any gene or polynucleotide which is yielding transcription or translation products at an abnormal level or in an abnormal form in cells derived from a disease-affected tissues compared with tissues or cells of a non disease control.
  • a disease-associated gene also refers to a gene possessing mutation(s) or genetic variation that is directly responsible or is in linkage disequilibrium with a gene(s) that is responsible for the etiology of a disease.
  • the transcribed or translated products may be known or unknown, and may be at a normal or abnormal level.
  • disease-associated genes and polynucleotides are available from McKusick-Nathans Institute of Genetic Medicine, Johns Hopkins University (Baltimore, Md.) and National Center for Biotechnology Information, National Library of Medicine (Bethesda, Md.), available on the World Wide Web.
  • Examples of disease-associated genes and polynucleotides are listed in Tables A and B. Disease specific information is available from McKusick-Nathans Institute of Genetic Medicine, Johns Hopkins University (Baltimore, Md.) and National Center for Biotechnology Information, National Library of Medicine (Bethesda, Md.), available on the World Wide Web. Examples of signaling biochemical pathway-associated genes and polynucleotides are listed in Table C.
  • genes and pathways can result in production of improper proteins or proteins in improper amounts which affect function. Further examples of genes, diseases and proteins are hereby incorporated by reference from US Provisional application. Such genes, proteins and pathways may be the target polynucleotide of a CRISPR complex.
  • Neoplasia PTEN ATM; ATR; EGFR; ERBB2; ERBB3; ERBB4; Notch1; Notch2; Notch3; Notch4; AKT; AKT2; AKT3; HIF; HIF1a; HIF3a; Met; HRG; Bcl2; PPAR alpha; PPAR gamma; WTI (Wilms Tumor); FGF Receptor Family members (5 members: 1, 2, 3, 4, 5); CDKN2a; APC; RB (retinoblastoma); MEN1; VHL; BRCA1; BRCA2; AR (Androgen Receptor); TSG101; IGF; IGF Receptor; Igf1 (4 variants); Igf2 (3 variants); Igf 1 Receptor; Igf 2 Receptor; Bax; Bcl2; caspases family (9 members: 1, 2, 3, 4, 6, 7, 8, 9, 12); Kras; Ap
  • APH-1 alpha and beta
  • Presenilin Psen1
  • nicastrin Disorders Ncstn PEN-2 Others Nos1; Parp1; Nat1; Nat2 Prion-related disorders Prp ALS SOD1; ALS2; STEX; FUS; TARDBP; VEGF (VEGF-a; VEGF-b; VEGF-c) Drug addiction Prkce (alcohol); Drd2; Drd4; ABAT (alcohol); GRIA2; Grm5; Grin1; Htr1b; Grin2a; Drd3; Pdyn; Gria1 (alcohol) Autism Mecp2; BZRAP1; MDGA2; Sema5A; Neurexin 1; Fragile X (FMR2 (AFF2); FXR1; FXR2; Mglur5) Alzheimer's Disease E1; CHIP; UCH; UBB; Tau; LRP; PICALM; Clusterin; PS1; SORL1;
  • BCL7A BCL7
  • Leukemia TAL1, and oncology TCL5, SCL, TAL2, FLT3, NBS1, NBS, ZNFN1A1, IK1, LYF1, diseases and disorders HOXD4, HOX4B, BCR, CML, PHL, ALL, ARNT, KRAS2, RASK2, GMPS, AF10, ARHGEF12, LARG, KIAA0382, CALM, CLTH, CEBPA, CEBP, CHIC2, BTL, FLT3, KIT, PBT, LPP, NPM1, NUP214, D9S46E, CAN, CAIN, RUNX1, CBFA2, AML1, WHSC1L1, NSD3, FLT3; AF1Q, NPM1, NUMA1, ZNF145, PLZF, PML, MYL, STAT5B, AF10, CALM, CLTH, ARL11, ARLTS1, P2RX7
  • Inflammation and AIDS KIR3DL1, NKAT3, NKB1, AMB11, KIR3DS1, IFNG, CXCL12, immune related SDF1; Autoimmune lymphoproliferative syndrome (TNFRSF6, APT1, diseases and disorders FAS, CD95, ALPS1A); Combined immunodeficiency, (IL2RG, SCIDX1, SCIDX, IMD4); HIV-1 (CCL5, SCYA5, D17S136E, TCP228), HIV susceptibility or infection (IL10, CSIF, CMKBR2, CCR2, CMKBR5, CCCKR5 (CCU)); Immunodeficiencies (CD3E, CD3G, AICDA, AID, HIGM2, TNFRSF5, CD40, UNG, DGU, HIGM4, TNFSF5, CD40LG, HIGM1, IGM, FOXP3, IPEX, AIID, XPID, PIDX, TNFRSF14B, TACI); Inflammation (IL-10,
  • CTNNB1 TP53, P53, LFS1, IGF2R, MPR1, MET, CASP8, MCH5
  • Medullary cystic kidney disease UMOD, HNFJ, FJHN, MCKD2, ADMCKD2
  • Phenylketonuria PAH, PKU1, QDPR, DHPR, PTS
  • FCYT Polycystic kidney and hepatic disease
  • Muscular/Skeletal Becker muscular dystrophy (DMD, BMD, MYF6), Duchenne Muscular diseases and disorders Dystrophy (DMD, BMD); Emery-Dreifuss muscular dystrophy (LMNA, LMN1, EMD2, FPLD, CMD1A, HGPS, LGMD1B, LMNA, LMN1, EMD2, FPLD, CMD1A); Facioscapulohumeral muscular dystrophy (FSHMa1A, FSHD1A); Muscular dystrophy (FKRP, MDC1C, LGMD2I, LAMA2, LAMM, LARGE, KIAA0609, MDC1D, FCMD, TTID, MYOT, CAPN3, CANP3, DYSF, LGMD2B, SGCG, LGMD2C, DMDA1, SCG3, SGCA, ADL, DAG2, LGMD2D, DMDA2, SGCB, LGMD2E, SGCD, SGD, LGMD2F, C
  • Occular diseases and Age-related macular degeneration (Abcr, Ccl2, Cc2, cp (ceruloplasmin), disorders Timp3, cathepsinD, VIdlr, Ccr2); Cataract (CRYAA, CRYA1, CRYBB2, CRYB2, PITX3, BFSP2, CP49, CP47, CRYAA, CRYA1, PAX6, AN2, MGDA, CRYBA1, CRYB1, CRYGC, CRYG3, CCL, LIM2, MP19, CRYGD, CRYG4, BFSP2, CP49, CP47, HSF4, CTM, HST4, CTM, MIP, AQP0, CRYAB, CRYA2, CTPP2, CRYBB1, CRYGD, CRYG4, CRYBB2, CRYB2, CRYGC, CRYG3, CCL, CRYAA, CRYA1, GJA8, CX50, CAE1, GJA3, CX46, CZP3, CAE3, CCM1, CAM,
  • Embodiments of the invention also relate to methods and compositions related to knocking out genes, amplifying genes and repairing particular mutations associated with DNA repeat instability and neurological disorders (Robert D. Wells, Tetsuo Ashizawa, Genetic Instabilities and Neurological Diseases, Second Edition, Academic Press, Oct. 13, 2011—Medical). Specific aspects of tandem repeat sequences have been found to be responsible for more than twenty human diseases (New insights into repeat instability: role of RNA.DNA hybrids. McIvor E I, Polak U, Napierala M. RNA Biol. 2010 September-October; 7(5):551-8). The CRISPR-Cas system may be harnessed to correct these defects of genomic instability.
  • a further aspect of the invention relates to utilizing the CRISPR-Cas system for correcting defects in the EMP2A and EMP2B genes that have been identified to be associated with Lafora disease.
  • Lafora disease is an autosomal recessive condition which is characterized by progressive myoclonus epilepsy which may start as epileptic seizures in adolescence.
  • a few cases of the disease may be caused by mutations in genes yet to be identified.
  • the disease causes seizures, muscle spasms, difficulty walking, dementia, and eventually death. There is currently no therapy that has proven effective against disease progression.
  • the CRISPR-Cas system may be used to correct ocular defects that arise from several genetic mutations further described in Genetic Diseases of the Eye, Second Edition, edited by Elias I. Traboulsi, Oxford University Press, 2012.
  • the genetic brain diseases may include but are not limited to Adrenoleukodystrophy, Agenesis of the Corpus Callosum, Aicardi Syndrome, Alpers' Disease.
  • the condition may be neoplasia. In some embodiments, where the condition is neoplasia, the genes to be targeted are any of those listed in Table A (in this case PTEN asn so forth). In some embodiments, the condition may be Age-related Macular Degeneration. In some embodiments, the condition may be a Schizophrenic Disorder. In some embodiments, the condition may be a Trinucleotide Repeat Disorder. In some embodiments, the condition may be Fragile X Syndrome. In some embodiments, the condition may be a Secretase Related Disorder. In some embodiments, the condition may be a Prion—related disorder. In some embodiments, the condition may be ALS. In some embodiments, the condition may be a drug addiction. In some embodiments, the condition may be Autism. In some embodiments, the condition may be Alzheimer's Disease. In some embodiments, the condition may be inflammation. In some embodiments, the condition may be Parkinson's Disease.
  • proteins associated with Parkinson's disease include but are not limited to ⁇ -synuclein, DJ-1, LRRK2, PINK1, Parkin, UCHL1, Synphilin-1, and NURR1.
  • addiction-related proteins may include ABAT for example.
  • inflammation-related proteins may include the monocyte chemoattractant protein-1 (MCP1) encoded by the Ccr2 gene, the C—C chemokine receptor type 5 (CCR5) encoded by the Ccr5 gene, the IgG receptor IIB (FCGR2b, also termed CD32) encoded by the Fcgr2b gene, or the Fe epsilon R1g (FCER1g) protein encoded by the Fcer1g gene, for example.
  • MCP1 monocyte chemoattractant protein-1
  • CCR5 C—C chemokine receptor type 5
  • FCGR2b also termed CD32
  • FCER1g Fe epsilon R1g
  • cardiovascular diseases associated proteins may include IL1B (interleukin 1, beta), XDH (xanthine dehydrogenase), TP53 (tumor protein p53), PTGIS (prostaglandin 12 (prostacyclin) synthase), MB (myoglobin), IL4 (interleukin 4), ANGPT1 (angiopoietin 1), ABCG8 (ATP-binding cassette, sub-family G (WHITE), member 8), or CTSK (cathepsin K), for example.
  • IL1B interleukin 1, beta
  • XDH xanthine dehydrogenase
  • TP53 tumor protein p53
  • PTGIS prostaglandin 12 (prostacyclin) synthase)
  • MB myoglobin
  • IL4 interleukin 4
  • ANGPT1 angiopoietin 1
  • ABCG8 ATP-binding cassette, sub-family G (WHITE), member 8
  • CTSK
  • Examples of Alzheimer's disease associated proteins may include the very low density lipoprotein receptor protein (VLDLR) encoded by the VLDLR gene, the ubiquitin-like modifier activating enzyme 1 (UBA1) encoded by the UBA1 gene, or the NEDD8-activating enzyme E1 catalytic subunit protein (UBE1C) encoded by the UBA3 gene, for example.
  • VLDLR very low density lipoprotein receptor protein
  • UBA1 ubiquitin-like modifier activating enzyme 1
  • UBE1C NEDD8-activating enzyme E1 catalytic subunit protein
  • proteins associated Autism Spectrum Disorder may include the benzodiazapine receptor (peripheral) associated protein 1 (BZRAP1) encoded by the BZRAP1 gene, the AF4/FMR2 family member 2 protein (AFF2) encoded by the AFF2 gene (also termed MFR2), the fragile X mental retardation autosomal homolog 1 protein (FXR1) encoded by the FXR1 gene, or the fragile X mental retardation autosomal homolog 2 protein (FXR2) encoded by the FXR2 gene, for example.
  • BZRAP1 benzodiazapine receptor (peripheral) associated protein 1
  • AFF2 AF4/FMR2 family member 2 protein
  • FXR1 fragile X mental retardation autosomal homolog 1 protein
  • FXR2 fragile X mental retardation autosomal homolog 2 protein
  • proteins associated Macular Degeneration may include the ATP-binding cassette, sub-family A (ABC1) member 4 protein (ABCA4) encoded by the ABCR gene, the apolipoprotein E protein (APOE) encoded by the APOE gene, or the chemokine (C—C motif) Ligand 2 protein (CCL2) encoded by the CCL2 gene, for example.
  • ABC1 sub-family A
  • APOE apolipoprotein E protein
  • CCL2 Ligand 2 protein
  • proteins associated Schizophrenia may include NRG1, ErbB4, CPLX1, TPH1, TPH2, NRXN1, GSK3A, BDNF, DISC1, GSK3B, and combinations thereof.
  • proteins involved in tumor suppression may include ATM (ataxia telangiectasia mutated), ATR (ataxia telangiectasia and Rad3 related), EGFR (epidermal growth factor receptor), ERBB2 (v-erb-b2 erythroblastic leukemia viral oncogene homolog 2), ERBB3 (v-erb-b2 erythroblastic leukemia viral oncogene homolog 3), ERBB4 (v-erb-b2 erythroblastic leukemia viral oncogene homolog 4), Notch 1, Notch 2, Notch 3, or Notch 4, for example.
  • ATM ataxia telangiectasia mutated
  • ATR ataxia telangiectasia and Rad3 related
  • EGFR epidermatitise
  • ERBB2 v-erb-b2 erythroblastic leukemia viral oncogene homolog 2
  • ERBB3 v-erb-b2 erythroblastic leukemia viral on
  • proteins associated with a secretase disorder may include PSENEN (presenilin enhancer 2 homolog ( C. elegans )), CTSB (cathepsin B), PSEN1 (presenilin 1), APP (amyloid beta (A4) precursor protein), APH1B (anterior pharynx defective 1 homolog B ( C. elegans )), PSEN2 (presenilin 2 (Alzheimer disease 4)), or BACE1 (beta-site APP-cleaving enzyme 1), for example.
  • proteins associated with Amyotrophic Lateral Sclerosis may include SOD1 (superoxide dismutase 1), ALS2 (amyotrophic lateral sclerosis 2), FUS (fused in sarcoma), TARDBP (TAR DNA binding protein), VAGFA (vascular endothelial growth factor A), VAGFB (vascular endothelial growth factor B), and VAGFC (vascular endothelial growth factor C), and any combination thereof.
  • SOD1 superoxide dismutase 1
  • ALS2 amotrophic lateral sclerosis 2
  • FUS fused in sarcoma
  • TARDBP TAR DNA binding protein
  • VAGFA vascular endothelial growth factor A
  • VAGFB vascular endothelial growth factor B
  • VAGFC vascular endothelial growth factor C
  • proteins associated with prion diseases may include SOD1 (superoxide dismutase 1), ALS2 (amyotrophic lateral sclerosis 2), FUS (fused in sarcoma), TARDBP (TAR DNA binding protein), VAGFA (vascular endothelial growth factor A), VAGFB (vascular endothelial growth factor B), and VAGFC (vascular endothelial growth factor C), and any combination thereof.
  • proteins related to neurodegenerative conditions in prion disorders may include A2M (Alpha-2-Macroglobulin), AATF (Apoptosis antagonizing transcription factor), ACPP (Acid phosphatase prostate), ACTA2 (Actin alpha 2 smooth muscle aorta), ADAM22 (ADAM metallopeptidase domain), ADORA3 (Adenosine A3 receptor), or ADRA1D (Alpha-1D adrenergic receptor for Alpha-1D adrenoreceptor), for example.
  • A2M Alpha-2-Macroglobulin
  • AATF Apoptosis antagonizing transcription factor
  • ACPP Acid phosphatase prostate
  • ACTA2 Actin alpha 2 smooth muscle aorta
  • ADAM22 ADAM metallopeptidase domain
  • ADORA3 Adosine A3 receptor
  • ADRA1D Alpha-1D adrenergic receptor for Alpha-1D adrenoreceptor
  • proteins associated with Immunodeficiency may include A2M [alpha-2-macroglobulin]; AANAT [arylalkylamine N-acetyltransferase]; ABCA1 [ATP-binding cassette, sub-family A (ABC1), member 1]; ABCA2 [ATP-binding cassette, sub-family A (ABC1), member 2]; or ABCA3 [ATP-binding cassette, sub-family A (ABC1), member 3]; for example.
  • A2M alpha-2-macroglobulin
  • AANAT arylalkylamine N-acetyltransferase
  • ABCA1 ATP-binding cassette, sub-family A (ABC1), member 1]
  • ABCA2 ATP-binding cassette, sub-family A (ABC1), member 2]
  • ABCA3 ATP-binding cassette, sub-family A (ABC1), member 3]
  • proteins associated with Trinucleotide Repeat Disorders include AR (androgen receptor), FMR1 (fragile X mental retardation 1), HTT (huntingtin), or DMPK (dystrophia myotonica-protein kinase), FXN (frataxin), ATXN2 (ataxin 2). for example.
  • proteins associated with Neurotransmission Disorders include SST (somatostatin), NOS1 (nitric oxide synthase 1 (neuronal)), ADRA2A (adrenergic, alpha-2A-, receptor), ADRA2C (adrenergic, alpha-2C-, receptor), TACR1 (tachykinin receptor 1), or HTR2c (5-hydroxytryptamine (serotonin) receptor 2C), for example.
  • neurodevelopmental-associated sequences include A2BP1 [ataxin 2-binding protein 1], AADAT [aminoadipate aminotransferase], AANAT [arylalkylamine N-acetyltransferase], ABAT [4-aminobutyrate aminotransferase], ABCA1 [ATP-binding cassette, sub-family A (ABC1), member 1], or ABCA13 [ATP-binding cassette, sub-family A (ABC1), member 13], for example.
  • A2BP1 ataxin 2-binding protein 1
  • AADAT aminoadipate aminotransferase
  • AANAT arylalkylamine N-acetyltransferase
  • ABAT 4-aminobutyrate aminotransferase
  • ABCA1 ATP-binding cassette, sub-family A (ABC1), member 1
  • ABCA13 ATP-binding cassette, sub-family A (ABC1), member 13
  • preferred conditions treatable with the present system include may be selected from: Aicardi-Goutines Syndrome; Alexander Disease; Allan-Herndon-Dudley Syndrome; POLG-Related Disorders; Alpha-Mannosidosis (Type II and III); Alström Syndrome; Angelman; Syndrome; Ataxia-Telangiectasia; Neuronal Ceroid-Lipofuscinoses; Beta-Thalassemia; Bilateral Optic Atrophy and (Infantile) Optic Atrophy Type 1; Retinoblastoma (bilateral); Canavan Disease; Cerebrooculofacioskeletal Syndrome 1 [COFS1]; Cerebrotendinous Xanthomatosis; Cornelia de Lange Syndrome; MAPT-Related Disorders; Genetic Prion Diseases; Dravet Syndrome; Early-Onset Familial Alzheimer Disease; Friedreich Ataxia [FRDA]; Fryns Syndrome; Fucosidosis; Fukuyama Congenital Muscular Dystrophy; Galactosialidosis; Gau
  • the present system can be used to target any polynucleotide sequence of interest.
  • Some examples of conditions or diseases that might be usefully treated using the present system are included in the Tables above and examples of genes currently associated with those conditions are also provided there. However, the genes exemplified are not exhaustive.
  • Example 1 CRISPR Complex Activity in the Nucleus of a Eukaryotic Cell
  • An example type II CRISPR system is the type II CRISPR locus from Streptococcus pyogenes SF370, which contains a cluster of four genes Cas9, Cas1, Cas2, and Csn1, as well as two non-coding RNA elements, tracrRNA and a characteristic array of repetitive sequences (direct repeats) interspaced by short stretches of non-repetitive sequences (spacers, about 30 bp each).
  • DSB targeted DNA double-strand break
  • tracrRNA hybridizes to the direct repeats of pre-crRNA, which is then processed into mature crRNAs containing individual spacer sequences.
  • the mature crRNA:tracrRNA complex directs Cas9 to the DNA target consisting of the protospacer and the corresponding PAM via heteroduplex formation between the spacer region of the crRNA and the protospacer DNA.
  • Cas9 mediates cleavage of target DNA upstream of PAM to create a DSB within the protospacer ( FIG. 2A ).
  • This example describes an example process for adapting this RNA-programmable nuclease system to direct CRISPR complex activity in the nuclei of eukaryotic cells.
  • HEK cell line HEK 293FT Human embryonic kidney (HEK) cell line HEK 293FT (Life Technologies) was maintained in Dulbecco's modified Eagle's Medium (DMEM) supplemented with 10% fetal bovine serum (HyClone), 2 mM GlutaMAX (Life Technologies), 100 U/mL penicillin, and 100 ⁇ g/mL streptomycin at 37° C. with 5% CO 2 incubation.
  • DMEM Dulbecco's modified Eagle's Medium
  • HyClone fetal bovine serum
  • 2 mM GlutaMAX Human neuro2A (N2A) cell line (ATCC) was maintained with DMEM supplemented with 5% fetal bovine serum (HyClone), 2 mM GlutaMAX (Life Technologies), 100 U/mL penicillin, and 100 ⁇ g/mL streptomycin at 37° C. with 5% CO 2 .
  • HEK 293FT or N2A cells were seeded into 24-well plates (Corning) one day prior to transfection at a density of 200,000 cells per well. Cells were transfected using Lipofectamine 2000 (Life Technologies) following the manufacturer's recommended protocol. For each well of a 24-well plate a total of 800 ng of plasmids were used.
  • HEK 293FT or N2A cells were transfected with plasmid DNA as described above. After transfection, the cells were incubated at 37° C. for 72 hours before genomic DNA extraction. Genomic DNA was extracted using the QuickExtract DNA extraction kit (Epicentre) following the manufacturer's protocol. Briefly, cells were resuspended in QuickExtract solution and incubated at 65° C. for 15 minutes and 98° C. for 10 minutes. Extracted genomic DNA was immediately processed or stored at ⁇ 20° C.
  • the genomic region surrounding a CRISPR target site for each gene was PCR amplified, and products were purified using QiaQuick Spin Column (Qiagen) following manufacturer's protocol.
  • a total of 400 ng of the purified PCR products were mixed with 2 ⁇ l 10 ⁇ Taq polymerase PCR buffer (Enzymatics) and ultrapure water to a final volume of 20 ⁇ l, and subjected to a re-annealing process to enable heteroduplex formation: 95° C. for 10 min, 95° C. to 85° C. ramping at ⁇ 2° C./s, 85° C. to 25° C. at ⁇ 0.25° C./s, and 25° C. hold for 1 minute.
  • HEK 293FT and N2A cells were transfected with plasmid DNA, and incubated at 37° C. for 72 hours before genomic DNA extraction as described above.
  • the target genomic region was PCR amplified using primers outside the homology arms of the homologous recombination (HR) template. PCR products were separated on a 1% agarose gel and extracted with MinElute GelExtraction Kit (Qiagen). Purified products were digested with HindIII (Fermentas) and analyzed on a 6% Novex TBE poly-acrylamide gel (Life Technologies).
  • RNA secondary structure prediction was performed using the online webserver RNAfold developed at Institute for Theoretical Chemistry at the University of Vienna, using the centroid structure prediction algorithm (see e.g. A. R. Gruber et al., 2008, Cell 106(1): 23-24; and P A Carr and G M Church, 2009, Nature Biotechnology 27(12): 1151-62).
  • HEK 293FT cells were maintained and transfected as stated above. Cells were harvested by trypsinization followed by washing in phosphate buffered saline (PBS). Total cell RNA was extracted with TRI reagent (Sigma) following manufacturer's protocol. Extracted total RNA was quantified using Nanodrop (Thermo Scientific) and normalized to same concentration.
  • RNAs were mixed with equal volumes of 2 ⁇ loading buffer (Ambion), heated to 95° C. for 5 min, chilled on ice for 1 min, and then loaded onto 8% denaturing polyacrylamide gels (SequaGel, National Diagnostics) after pre-running the gel for at least 30 minutes. The samples were electrophoresed for 1.5 hours at 40 W limit. Afterwards, the RNA was transferred to Hybond N+ membrane (GE Healthcare) at 300 mA in a semi-dry transfer apparatus (Bio-rad) at room temperature for 1.5 hours. The RNA was crosslinked to the membrane using autocrosslink button on Stratagene UV Crosslinker the Stratalinker (Stratagene).
  • the membrane was pre-hybridized in ULTRAhyb-Oligo Hybridization Buffer (Ambion) for 30 min with rotation at 42° C., and probes were then added and hybridized overnight. Probes were ordered from IDT and labeled with [gamma- 32 P] ATP (Perkin Elmer) with T4 polynucleotide kinase (New England Biolabs). The membrane was washed once with pre-warmed (42° C.) 2 ⁇ SSC, 0.5% SDS for 1 min followed by two 30 minute washes at 42° C. The membrane was exposed to a phosphor screen for one hour or overnight at room temperature and then scanned with a phosphorimager (Typhoon).
  • CRISPR locus elements including tracrRNA, Cas9, and leader were PCR amplified from Streptococcus pyogenes SF370 genomic DNA with flanking homology arms for Gibson Assembly. Two BsaI type IIS sites were introduced in between two direct repeats to facilitate easy insertion of spacers ( FIG. 8 ). PCR products were cloned into EcoRV-digested pACYC184 downstream of the tet promoter using Gibson Assembly Master Mix (NEB). Other endogenous CRISPR system elements were omitted, with the exception of the last 50 bp of Csn2.
  • Oligos (Integrated DNA Technology) encoding spacers with complimentary overhangs were cloned into the BsaI-digested vector pDC000 (NEB) and then ligated with T7 ligase (Enzymatics) to generate pCRISPR plasmids.
  • T7 ligase Enzymatics
  • FIG. 6C shows results of a Northern blot analysis of total RNA extracted from 293FT cells transfected with U6 expression constructs carrying long or short tracrRNA, as well as SpCas9 and DR-EMX1(1)-DR. Left and right panels are from 293FT cells transfected without or with SpRNase III, respectively.
  • U6 indicate loading control blotted with a probe targeting human U6 snRNA. Transfection of the short tracrRNA expression construct led to abundant levels of the processed form of tracrRNA ( ⁇ 75 bp). Very low amounts of long tracrRNA are detected on the Northern blot.
  • RNA polymerase III-based U6 promoter was selected to drive the expression of tracrRNA ( FIG. 2C ).
  • a U6 promoter-based construct was developed to express a pre-crRNA array consisting of a single spacer flanked by two direct repeats (DRs, also encompassed by the term “tracr-mate sequences”; FIG. 2C ).
  • the initial spacer was designed to target a 33-base-pair (bp) target site (30-bp protospacer plus a 3-bp CRISPR motif (PAM) sequence satisfying the NGG recognition motif of Cas9) in the human EMX1 locus ( FIG. 2C ), a key gene in the development of the cerebral cortex.
  • bp 33-base-pair
  • PAM 3-bp CRISPR motif
  • HEK 293FT cells were transfected with combinations of CRISPR components. Since DSBs in mammalian nuclei are partially repaired by the non-homologous end joining (NHEJ) pathway, which leads to the formation of indels, the Surveyor assay was used to detect potential cleavage activity at the target EMX1 locus ( FIG. 7 ) (see e.g. Guschin et al., 2010, Methods Mol Biol 649: 247).
  • NHEJ non-homologous end joining
  • FIG. 12 provides an additional Northern blot analysis of crRNA processing in mammalian cells.
  • FIG. 12A illustrates a schematic showing the expression vector for a single spacer flanked by two direct repeats (DR-EMX1(1)-DR). The 30 bp spacer targeting the human EMX1 locus protospacer 1 (see FIG. 6 ) and the direct repeat sequences are shown in the sequence beneath FIG. 12A . The line indicates the region whose reverse-complement sequence was used to generate Northern blot probes for EMX1(1) crRNA detection.
  • FIG. 12B shows a Northern blot analysis of total RNA extracted from 293FT cells transfected with U6 expression constructs carrying DR-EMX1(1)-DR.
  • DR-EMX1(1)-DR was processed into mature crRNAs only in the presence of SpCas9 and short tracrRNA and was not dependent on the presence of SpRNase III.
  • the mature crRNA detected from transfected 293FT total RNA is ⁇ 33 bp and is shorter than the 39-42 bp mature crRNA from S. pyogenes .
  • FIG. 2 illustrates the bacterial CRISPR system described in this example.
  • FIG. 2A illustrates a schematic showing the CRISPR locus 1 from Streptococcus pyogenes SF370 and a proposed mechanism of CRISPR-mediated DNA cleavage by this system.
  • Mature crRNA processed from the direct repeat-spacer array directs Cas9 to genomic targets consisting of complimentary protospacers and a protospacer-adjacent motif (PAM).
  • PAM protospacer-adjacent motif
  • FIG. 2B illustrates engineering of S.
  • FIG. 2C illustrates mammalian expression of SpCas9 and SpRNase III driven by the constitutive EF1a promoter and tracrRNA and pre-crRNA array (DR-Spacer-DR) driven by the RNA Pol3 promoter U6 to promote precise transcription initiation and termination.
  • DR-Spacer-DR pre-crRNA array
  • FIG. 2D illustrates surveyor nuclease assay for SpCas9-mediated minor insertions and deletions.
  • FIG. 2E illustrates a schematic representation of base pairing between target locus and EMX1-targeting crRNA, as well as an example chromatogram showing a micro deletion adjacent to the SpCas9 cleavage site.
  • a chimeric crRNA-tracrRNA hybrid design was adapted, where a mature crRNA (comprising a guide sequence) may be fused to a partial tracrRNA via a stem-loop to mimic the natural crRNA:tracrRNA duplex.
  • a bicistronic expression vector was created to drive co-expression of a chimeric RNA and SpCas9 in transfected cells.
  • the bicistronic vectors were used to express a pre-crRNA (DR-guide sequence-DR) with SpCas9, to induce processing into crRNA with a separately expressed tracrRNA (compare FIG. 11B top and bottom).
  • FIG. 11B top and bottom.
  • FIG. 8 provides schematic illustrations of bicistronic expression vectors for pre-crRNA array ( FIG. 8A ) or chimeric crRNA (represented by the short line downstream of the guide sequence insertion site and upstream of the EF1a promoter in FIG. 8B ) with hSpCas9, showing location of various elements and the point of guide sequence insertion.
  • the expanded sequence around the location of the guide sequence insertion site in FIG. 8B also shows a partial DR sequence (GTTTTAGAGCTA) (SEQ ID NO: 11) and a partial tracrRNA sequence (TAGCAAGTTAAAATAAGGCTAGTCCGTTTTT) (SEQ ID NO: 12).
  • Guide sequences can be inserted between BbsI sites using annealed oligonucleotides.
  • RNA design for the oligonucleotides are shown below the schematic illustrations in FIG. 8 , with appropriate ligation adapters indicated.
  • WPRE represents the Woodchuck hepatitis virus post-transcriptional regulatory element.
  • the efficiency of chimeric RNA-mediated cleavage was tested by targeting the same EMX1. locus described above. Using both Surveyor assay and Sanger sequencing of amplicons, Applicants confirmed that the chimeric RNA design facilitates cleavage of human EMX1 locus with approximately a 4.7% modification rate ( FIG. 3 ).
  • FIG. 13 illustrates the selection of some additional targeted protospacers in human PVALB ( FIG. 13A ) and mouse Th ( FIG. 13B ) loci. Schematics of the gene loci and the location of three protospacers within the last exon of each are provided.
  • the underlined sequences include 30 bp of protospacer sequence and 3 bp at the 3′ end corresponding to the PAM sequences.
  • Protospacers on the sense and anti-sense strands are indicated above and below the DNA sequences, respectively.
  • a modification rate of 6.3% and 0.75% was achieved for the human PV4LB and mouse Th loci respectively, demonstrating the broad applicability of the CRISPR system in modifying different loci across multiple organisms ( FIG. 5 ). While cleavage was only detected with one out of three spacers for each locus using the chimeric constructs, all target sequences were cleaved with efficiency of indel production reaching 27% when using the co-expressed pre-crRNA arrangement ( FIGS. 6 and 13 ).
  • FIG. 11 provides a further illustration that SpCas9 can be reprogrammed to target multiple genomic loci in mammalian cells.
  • FIG. 11A provides a schematic of the human EMX1 locus showing the location of five protospacers, indicated by the underlined sequences.
  • FIG. 11B provides a schematic of the pre-crRNA/trcrRNA complex showing hybridization between the direct repeat region of the pre-crRNA and tracrRNA (top), and a schematic of a chimeric RNA design comprising a 20 bp guide sequence, and tracr mate and tracr sequences consisting of partial direct repeat and tracrRNA sequences hybridized in a hairpin structure (bottom).
  • Results of a Surveyor assay comparing the efficacy of Cas9-mediated cleavage at five protospacers in the human EMX1 locus is illustrated in FIG. 11C .
  • Each protospacer is targeted using either processed pre-crRNA/tracrRNA complex (crRNA) or chimeric RNA (chiRNA).
  • crRNA pre-crRNA/tracrRNA complex
  • chiRNA chimeric RNA
  • RNA Since the secondary structure of RNA can be crucial for intermolecular interactions, a structure prediction algorithm based on minimum free energy and Boltzmann-weighted structure ensemble was used to compare the putative secondary structure of all guide sequences used in the genome targeting experiment (see e.g. Gruber et al., 2008, Nucleic Acids Research, 36: W70). Analysis revealed that in most cases, the effective guide sequences in the chimeric crRNA context were substantially free of secondary structure motifs, whereas the ineffective guide sequences were more likely to form internal secondary structures that could prevent base pairing with the target protospacer DNA. It is thus possible that variability in the spacer secondary structure might impact the efficiency of CRISPR-mediated interference when using a chimeric crRNA.
  • FIG. 22 illustrates single expression vectors incorporating a U6 promoter linked to an insertion site for a guide oligo, and a Cbh promoter linked to SpCas9 coding sequence.
  • the vector shown in FIG. 22 b includes a tracrRNA coding sequence linked to an H1 promoter.
  • FIG. 3A illustrates results of a Surveyor nuclease assay comparing the cleavage efficiency of Cas9 when paired with different mutant chimeric RNAs.
  • Single-base mismatch up to 12-bp 5′ of the PAM substantially abrogated genomic cleavage by SpCas9, whereas spacers with mutations at farther upstream positions retained activity against the original protospacer target ( FIG. 3B ).
  • FIG. 3C provides a schematic showing the design of TALENs targeting EMX1
  • FIG. 4C provides a schematic illustration of the HR strategy, with relative locations of recombination points and primer annealing sequences (arrows). SpCas9 and SpCas9n indeed catalyzed integration of the HR template into the EMX1 locus.
  • FIG. 2A Expression constructs mimicking the natural architecture of CRISPR loci with arrayed spacers ( FIG. 2A ) were constructed to test the possibility of multiplexed sequence targeting.
  • FIG. 4F showing both a schematic design of the crRNA array and a Surveyor blot showing efficient mediation of cleavage.
  • FIG. 4G shows a 1.6% deletion efficacy (3 out of 182 amplicons; FIG. 4G ) was detected. This demonstrates that the CRISPR system can mediate multiplexed editing within a single genome.
  • RNA to program sequence-specific DNA cleavage defines a new class of genome engineering tools for a variety of research and industrial applications.
  • CRISPR system can be further improved to increase the efficiency and versatility of CRISPR targeting.
  • Optimal Cas9 activity may depend on the availability of free Mg2+ at levels higher than that present in the mammalian nucleus (see e.g. Jinek et al., 2012, Science, 337:816), and the preference for an NGG motif immediately downstream of the protospacer restricts the ability to target on average every 12-bp in the human genome ( FIG. 9 , evaluating both plus and minus strands of human chromosomal sequences).
  • FIG. 10 illustrates adaptation of the Type II CRISPR system from CRISPR 1 of Streptococcus thermophilus LMD-9 for heterologous expression in mammalian cells to achieve CRISPR-mediated genome editing.
  • FIG. 10A provides a Schematic illustration of CRISPR 1 from S. thermophilus LMD-9.
  • FIG. 10B illustrates the design of an expression system for the S. thermophilus CRISPR system.
  • Human codon-optimized hStCas9 is expressed using a constitutive EF1 ⁇ promoter. Mature versions of tracrRNA and crRNA are expressed using the U6 promoter to promote precise transcription initiation. Sequences from the mature crRNA and tracrRNA are illustrated. A single base indicated by the lower case “a” in the crRNA sequence is used to remove the polyU sequence, which serves as a RNA polIII transcriptional terminator.
  • FIG. 10C provides a schematic showing guide sequences targeting the human EMX1 locus.
  • FIG. 10D shows the results of hStCas9-mediated cleavage in the target locus using the Surveyor assay. RNA guide spacers 1 and 2 induced 14% and 6.4%, respectively.
  • FIG. 14 provides a schematic of additional protospacer and corresponding PAM sequence targets of the S. thermophilus CRISPR system in the human EMX1 locus. Two protospacer sequences are highlighted and their corresponding PAM sequences satisfying NNAGAAW motif are indicated by underlining 3′ with respect to the corresponding highlighted sequence. Both protospacers target the anti-sense strand.
  • a software program is designed to identify candidate CRISPR target sequences on both strands of an input DNA sequence based on desired guide sequence length and a CRISPR motif sequence (PAM) for a specified CRISPR enzyme.
  • PAM CRISPR motif sequence
  • target sites for Cas9 from S. pyogenes with PAM sequences NGG, may be identified by searching for 5′-N x -NGG-3′ both on the input sequence and on the reverse-complement of the input.
  • target sites for Cas9 of S. thermophilus CRISPR1, with PAM sequence NNAGAAW may be identified by searching for 5′-N x -NNAGAAW-3′ both on the input sequence and on the reverse-complement of the input.
  • thermophilus CRISPR3, with PAM sequence NGGNG may be identified by searching for 5′-N x -NGGNG-3′ both on the input sequence and on the reverse-complement of the input.
  • the value “x” in N may be fixed by the program or specified by the user, such as 20.
  • the program filters out sequences based on the number of times they appear in the relevant reference genome.
  • the filtering step may be based on the seed sequence.
  • results are filtered based on the number of occurrences of the seed:PAM sequence in the relevant genome.
  • the user may be allowed to choose the length of the seed sequence.
  • the user may also be allowed to specify the number of occurrences of the seed:PAM sequence in a genome for purposes of passing the filter.
  • the default is to screen for unique sequences. Filtration level is altered by changing both the length of the seed sequence and the number of occurrences of the sequence in the genome.
  • the program may in addition or alternatively provide the sequence of a guide sequence complementary to the reported target sequence(s) by providing the reverse complement of the identified target sequence(s).
  • An example visualization of some target sites in the human genome is provided in FIG. 18 .
  • FIG. 16 a illustrates a schematic of a bicistronic expression vector for chimeric RNA and Cas9. Cas9 is driven by the CBh promoter and the chimeric RNA is driven by a U6 promoter.
  • the chimeric guide RNA consists of a 20 bp guide sequence (Ns) joined to the tracr sequence (running from the first “U” of the lower strand to the end of the transcript), which is truncated at various positions as indicated.
  • the guide and tracr sequences are separated by the tracr-mate sequence GUUUUAGAGCUA (SEQ ID NO: 13) followed by the loop sequence GAAA.
  • Results of SURVEYOR assays for Cas9-mediated indels at the human EMX1 and PVALB loci are illustrated in FIGS. 16 b and 16 c , respectively. Arrows indicate the expected SURVEYOR fragments.
  • ChiRNAs are indicated by their “+n” designation, and crRNA refers to a hybrid RNA where guide and tracr sequences are expressed as separate transcripts. Quantification of these results, performed in triplicate, are illustrated by histogram in FIGS. 17 a and 17 b , corresponding to FIGS.
  • Protospacer IDs and their corresponding genomic target, protospacer sequence, PAM sequence, and strand location are provided in Table D. Guide sequences were designed to be complementary to the entire protospacer sequence in the case of separate transcripts in the hybrid system, or only to the underlined portion in the case of chimeric RNAs.
  • chiRNA(+n) indicate that up to the +n nucleotide of wild-type tracrRNA is included in the chimeric RNA construct, with values of 48, 54, 67, and 85 used for n.
  • Chimeric RNAs containing longer fragments of wild-type tracrRNA (chiRNA(+67) and chiRNA(+85)) mediated DNA cleavage at all three EMX1 target sites, with chiRNA(+85) in particular demonstrating significantly higher levels of DNA cleavage than the corresponding crRNA/tracrRNA hybrids that expressed guide and tracr sequences in separate transcripts ( FIGS. 16 b and 17 a ).
  • Two sites in the PVALB locus that yielded no detectable cleavage using the hybrid system (guide sequence and tracr sequence expressed as separate transcripts) were also targeted using chiRNAs.
  • chiRNA(+67) and chiRNA(+85) were able to mediate significant cleavage at the two PVALB protospacers ( FIGS. 16 c and 17 b ).
  • the secondary structure formed by the 3′ end of the tracrRNA may play a role in enhancing the rate of CRISPR complex formation.
  • the CRISPR-Cas system is an adaptive immune mechanism against invading exogenous DNA employed by diverse species across bacteria and archaea.
  • the type II CRISPR-Cas9 system consists of a set of genes encoding proteins responsible for the “acquisition” of foreign DNA into the CRISPR locus, as well as a set of genes encoding the “execution” of the DNA cleavage mechanism; these include the DNA nuclease (Cas9), a non-coding transactivating cr-RNA (tracrRNA), and an array of foreign DNA-derived spacers flanked by direct repeats (crRNAs).
  • the tracRNA and crRNA duplex guide the Cas9 nuclease to a target DNA sequence specified by the spacer guide sequences, and mediates double-stranded breaks in the DNA near a short sequence motif in the target DNA that is required for cleavage and specific to each CRISPR-Cas system.
  • the type II CRISPR-Cas systems are found throughout the bacterial kingdom and highly diverse in Cas9 protein sequence and size, tracrRNA and crRNA direct repeat sequence, genome organization of these elements, and the motif requirement for target cleavage.
  • One species may have multiple distinct CRISPR-Cas systems.
  • Applicants analyzed Cas9 orthologs to identify the relevant PAM sequences and the corresponding chimeric guide RNA. Having an expanded set of PAMs provides broader targeting across the genome and also significantly increases the number of unique target sites and provides potential for identifying novel Cas9s with increased levels of specificity in the genome.
  • the specificity of Cas9 orthologs can be evaluated by testing the ability of each Cas9 to tolerate mismatches between the guide RNA and its DNA target.
  • the specificity of SpCas9 has been characterized by testing the effect of mutations in the guide RNA on cleavage efficiency. Libraries of guide RNAs were made with single or multiple mismatches between the guide sequence and the target DNA. Based on these findings, target sites for SpCas9 can be selected based on the following guidelines:
  • a target site within the locus of interest such that potential ‘off-target’ genomic sequences abide by the following four constraints: First and foremost, they should not be followed by a PAM with either 5′-NGG or NAG sequences. Second, their global sequence similarity to the target sequence should be minimized. Third, a maximal number of mismatches should lie within the PAM-proximal region of the off-target site. Finally, a maximal number of mismatches should be consecutive or spaced less than four bases apart.
  • Example 7 Engineering of Plants (Micro-Algae) Using Cas9 to Target and Manipulate Plant Genes
  • Method 1 Applicants deliver Cas9 and guide RNA using a vector that expresses Cas9 under the control of a constitutive promoter such as Hsp70A-Rbc S2 or Beta2-tubulin.
  • a constitutive promoter such as Hsp70A-Rbc S2 or Beta2-tubulin.
  • Method 2 Applicants deliver Cas9 and T7 polymerase using vectors that expresses Cas9 and T7 polymerase under the control of a constitutive promoter such as Hsp70A-Rbc S2 or Beta2-tubulin.
  • Guide RNA will be delivered using a vector containing T7 promoter driving the guide RNA.
  • Method 3 Applicants deliver Cas9 mRNA and in vitro transcribed guide RNA to algae cells.
  • RNA can be in vitro transcribed.
  • Cas9 mRNA will consist of the coding region for Cas9 as well as 3′UTR from Cop1 to ensure stabilization of the Cas9 mRNA.
  • Applicants provide an additional homology directed repair template.
  • T7 promoter T7 promoter, Ns represent targeting sequence
  • Chlamydomonas reinhardtii strain CC-124 and CC-125 from the Chlamydomonas Resource Center will be used for electroporation. Electroporation protocol follows standard recommended protocol from the GeneArt Chlamydomonas Engineering kit.
  • Applicants generate a line of Chlamydomonas reinhardtii that expresses Cas9 constitutively. This can be done by using pChlamy1 (linearized using PvuI) and selecting for hygromycin resistant colonies. Sequence for pChlamy1 containing Cas9 is below. In this way to achieve gene knockout one simply needs to deliver RNA for the guideRNA. For homologous recombination Applicants deliver guideRNA as well as a linearized homologous recombination template.
  • Applicants use PCR, SURVEYOR nuclease assay, and DNA sequencing to verify successful modification.

Abstract

The invention provides for systems, methods, and compositions for altering expression of target gene sequences and related gene products. Provided are vectors and vector systems, some of which encode one or more components of a CRISPR complex, as well as methods for the design and use of such vectors. Also provided are methods of directing CRISPR complex formation in eukaryotic cells and methods for utilizing the CRISPR-Cas system.

Description

    RELATED APPLICATIONS AND INCORPORATION BY REFERENCE
  • This application claims priority to U.S. provisional patent application 61/842,322 having Broad reference BI-2011/008A, entitled CRISPR-CAS SYSTEMS AND METHODS FOR ALTERING EXPRESSION OF GENE PRODUCTS filed on Jul. 2, 2013. Priority is also claimed to U.S. provisional patent applications 61/736,527, 61/748,427, 61/791,409 and 61/835,931 having Broad reference BI-2011/008/WSGR Docket No. 44063-701.101, BI-2011/008/WSGR Docket No. 44063-701.102, Broad reference BI-2011/008/VP Docket No. 44790.02.2003 and BI-2011/008/VP Docket No. 44790.03.2003 respectively, all entitled SYSTEMS METHODS AND COMPOSITIONS FOR SEQUENCE MANIPULATION filed on Dec. 12, 2012, Jan. 2, 2013, Mar. 15, 2013 and Jun. 17, 2013, respectively.
  • The foregoing applications, and all documents cited therein or during their prosecution (“appln cited documents”) and all documents cited or referenced in the appln cited documents, and all documents cited or referenced herein (“herein cited documents”), and all documents cited or referenced in herein cited documents, together with any manufacturer's instructions, descriptions, product specifications, and product sheets for any products mentioned herein or in any document incorporated by reference herein, are hereby incorporated herein by reference, and may be employed in the practice of the invention. More specifically, all referenced documents are incorporated by reference to the same extent as if each individual document was specifically and individually indicated to be incorporated by reference.
  • STATEMENT AS TO FEDERALLY SPONSORED RESEARCH
  • This invention was made with government support under NIH Pioneer Award DP1MH100706, awarded by the National Institutes of Health. The government has certain rights in the invention.
  • FIELD OF THE INVENTION
  • The present invention generally relates to systems, methods and compositions used for the control of gene expression involving sequence targeting, such as genome perturbation or gene-editing, that may use vector systems related to Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR) and components thereof.
  • SEQUENCE LISTING
  • The instant application contains a Sequence Listing which has been submitted in ASCII format via EFS-Web and is hereby incorporated by reference in its entirety. Said ASCII copy, created on Sep. 6, 2013, is named 44790.05.2003_SL.txt and is 56,781 bytes in size.
  • BACKGROUND OF THE INVENTION
  • Recent advances in genome sequencing techniques and analysis methods have significantly accelerated the ability to catalog and map genetic factors associated with a diverse range of biological functions and diseases. Precise genome targeting technologies are needed to enable systematic reverse engineering of causal genetic variations by allowing selective perturbation of individual genetic elements, as well as to advance synthetic biology, biotechnological, and medical applications. Although genome-editing techniques such as designer zinc fingers, transcription activator-like effectors (TALEs), or homing meganucleases are available for producing targeted genome perturbations, there remains a need for new genome engineering technologies that are affordable, easy to set up, scalable, and amenable to targeting multiple positions within the eukaryotic genome.
  • SUMMARY OF THE INVENTION
  • There exists a pressing need for alternative and robust systems and techniques for sequence targeting with a wide array of applications. This invention addresses this need and provides related advantages. The CRISPR/Cas or the CRISPR-Cas system (both terms are used interchangeably throughout this application) does not require the generation of customized proteins to target specific sequences but rather a single Cas enzyme can be programmed by a short RNA molecule to recognize a specific DNA target, in other words the Cas enzyme can be recruited to a specific DNA target using said short RNA molecule. Adding the CRISPR-Cas system to the repertoire of genome sequencing techniques and analysis methods may significantly simplify the methodology and accelerate the ability to catalog and map genetic factors associated with a diverse range of biological functions and diseases. To utilize the CRISPR-Cas system effectively for genome editing without deleterious effects, it is critical to understand aspects of engineering and optimization of these genome engineering tools, which are aspects of the claimed invention.
  • In one aspect, the invention provides a method for altering or modifying expression of one or more gene products. The said method may comprise introducing into a eukaryotic cell containing and expressing DNA molecules encoding the one or more gene products an engineered, non-naturally occurring vector system comprising one or more vectors comprising: a) a first regulatory element operably linked to one or more Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR)-CRISPR associated (Cas) system guide RNAs that hybridize with target sequences in genomic loci of the DNA molecules encoding the one or more gene products, b) a second regulatory element operably linked to a Type-II Cas9 protein, wherein components (a) and (b) are located on same or different vectors of the system, whereby the guide RNAs target the genomic loci of the DNA molecules encoding the one or more gene products and the Cas9 protein cleaves the genomic loci of the DNA molecules encoding the one or more gene products, whereby expression of the one or more gene products is altered; and, wherein the Cas9 protein and the guide RNAs do not naturally occur together. The invention comprehends the expression of two or more gene products being altered and the vectors of the system further comprising one or more nuclear localization signal(s) (NLS(s)). The invention comprehends the guide RNAs comprising a guide sequence fused to a tracr sequence. The invention further comprehends the Cas9 protein being codon optimized for expression in the eukaryotic cell. In a preferred embodiment the eukaryotic cell is a mammalian cell or a human cell. In a further embodiment of the invention, the expression of one or more of the gene products is decreased. In aspects of the invention cleaving the genomic loci of the DNA molecule encoding the gene product encompasses cleaving either one or both strands of the DNA duplex.
  • In one aspect, the invention provides an engineered, programmable, non-naturally occurring CRISPR-Cas system comprising a Cas9 protein and one or more guide RNAs that target the genomic loci of DNA molecules encoding one or more gene products in a eukaryotic cell and the Cas9 protein cleaves the genomic loci of the DNA molecules encoding the one or more gene products, whereby expression of the one or more gene products is altered; and, wherein the Cas9 protein and the guide RNAs do not naturally occur together. The invention comprehends the expression of two or more gene products being altered and the CRISPR-Cas system further comprising one or more NLS(s). The invention comprehends the guide RNAs comprising a guide sequence fused to a tracr sequence. The invention further comprehends the Cas9 protein being codon optimized for expression in the eukaryotic cell. In a preferred embodiment the eukaryotic cell is a mammalian cell or a human cell. In aspects of the invention cleaving the genomic loci of the DNA molecule encoding the gene product encompasses cleaving either one or both strands of the DNA duplex.
  • In another aspect, the invention provides an engineered, non-naturally occurring vector system comprising one or more vectors comprising a) a first regulatory element operably linked to one or more CRISPR-Cas system guide RNAs that hybridize with target sequences in genomic loci of DNA molecules encoding one or more gene products, b) a second regulatory element operably linked to a Type-II Cas9 protein, wherein components (a) and (b) are located on same or different vectors of the system, whereby the guide RNAs target the genomic loci of the DNA molecules encoding the one or more gene products in a eukaryotic cell and the Cas9 protein cleaves the genomic loci of the DNA molecules encoding the one or more gene products, whereby expression of the one or more gene products is altered; and, wherein the Cas9 protein and the guide RNAs do not naturally occur together. The invention comprehends the expression of two or more gene products being altered and the vectors of the system further comprising one or more nuclear localization signal(s) (NLS(s)). The invention comprehends the guide RNAs comprising a guide sequence fused to a tracr sequence. The invention further comprehends the Cas9 protein being codon optimized for expression in the eukaryotic cell. In a preferred embodiment the eukaryotic cell is a mammalian cell or a human cell. In a further embodiment of the invention, the expression of one or more of the gene products is decreased. In aspects of the invention cleaving the genomic loci of the DNA molecule encoding the gene product encompasses cleaving either one or both strands of the DNA duplex.
  • In one aspect, the invention provides a vector system comprising one or more vectors. In some embodiments, the system comprises: (a) a first regulatory element operably linked to a tracr mate sequence and one or more insertion sites for inserting one or more guide sequences upstream of the tracr mate sequence, wherein when expressed, the guide sequence directs sequence-specific binding of a CRISPR complex to a target sequence in a eukaryotic cell, wherein the CRISPR complex comprises a CRISPR enzyme complexed with (1) the guide sequence that is hybridized to the target sequence, and (2) the tracr mate sequence that is hybridized to the tracr sequence; and (b) a second regulatory element operably linked to an enzyme-coding sequence encoding said CRISPR enzyme comprising a nuclear localization sequence; wherein components (a) and (b) are located on the same or different vectors of the system. In some embodiments, component (a) further comprises the tracr sequence downstream of the tracr mate sequence under the control of the first regulatory element. In some embodiments, component (a) further comprises two or more guide sequences operably linked to the first regulatory element, wherein when expressed, each of the two or more guide sequences direct sequence specific binding of a CRISPR complex to a different target sequence in a eukaryotic cell. In some embodiments, the system comprises the tracr sequence under the control of a third regulatory element, such as a polymerase III promoter. In some embodiments, the tracr sequence exhibits at least 50%, 60%, 70%, 80%, 90%, 95%, or 99% of sequence complementarity along the length of the tracr mate sequence when optimally aligned. Determining optimal alignment is within the purview of one of skill in the art. For example, there are publically and commercially available alignment algorithms and programs such as, but not limited to, ClustalW, Smith-Waterman in matlab, Bowtie, Geneious, Biopython and SeqMan. In some embodiments, the CRISPR complex comprises one or more nuclear localization sequences of sufficient strength to drive accumulation of said CRISPR complex in a detectable amount in the nucleus of a eukaryotic cell. Without wishing to be bound by theory, it is believed that a nuclear localization sequence is not necessary for CRISPR complex activity in eukaryotes, but that including such sequences enhances activity of the system, especially as to targeting nucleic acid molecules in the nucleus. In some embodiments, the CRISPR enzyme is a type II CRISPR system enzyme. In some embodiments, the CRISPR enzyme is a Cas9 enzyme. In some embodiments, the Cas9 enzyme is S. pneumoniae, S. pyogenes, or S. thermophilus Cas9, and may include mutated Cas9 derived from these organisms. The enzyme may be a Cas9 homolog or ortholog. In some embodiments, the CRISPR enzyme is codon-optimized for expression in a eukaryotic cell. In some embodiments, the CRISPR enzyme directs cleavage of one or two strands at the location of the target sequence. In some embodiments, the first regulatory element is a polymerase II promoter. In some embodiments, the second regulatory element is a polymerase II promoter. In some embodiments, the guide sequence is at least 15, 16, 17, 18, 19, 20, 25 nucleotides, or between 10-30, or between 15-25, or between 15-20 nucleotides in length. In general, and throughout this specification, the term “vector” refers to a nucleic acid molecule capable of transporting another nucleic acid to which it has been linked. Vectors include, but are not limited to, nucleic acid molecules that are single-stranded, double-stranded, or partially double-stranded; nucleic acid molecules that comprise one or more free ends, no free ends (e.g. circular); nucleic acid molecules that comprise DNA, RNA, or both; and other varieties of polynucleotides known in the art. One type of vector is a “plasmid,” which refers to a circular double stranded DNA loop into which additional DNA segments can be inserted, such as by standard molecular cloning techniques. Another type of vector is a viral vector, wherein virally-derived DNA or RNA sequences are present in the vector for packaging into a virus (e.g. retroviruses, replication defective retroviruses, adenoviruses, replication defective adenoviruses, and adeno-associated viruses). Viral vectors also include polynucleotides carried by a virus for transfection into a host cell. Certain vectors are capable of autonomous replication in a host cell into which they are introduced (e.g. bacterial vectors having a bacterial origin of replication and episomal mammalian vectors). Other vectors (e.g., non-episomal mammalian vectors) are integrated into the genome of a host cell upon introduction into the host cell, and thereby are replicated along with the host genome. Moreover, certain vectors are capable of directing the expression of genes to which they are operatively-linked. Such vectors are referred to herein as “expression vectors.” Common expression vectors of utility in recombinant DNA techniques are often in the form of plasmids.
  • Recombinant expression vectors can comprise a nucleic acid of the invention in a form suitable for expression of the nucleic acid in a host cell, which means that the recombinant expression vectors include one or more regulatory elements, which may be selected on the basis of the host cells to be used for expression, that is operatively-linked to the nucleic acid sequence to be expressed. Within a recombinant expression vector, “operably linked” is intended to mean that the nucleotide sequence of interest is linked to the regulatory element(s) in a manner that allows for expression of the nucleotide sequence (e.g. in an in vitro transcription/translation system or in a host cell when the vector is introduced into the host cell).
  • The term “regulatory element” is intended to include promoters, enhancers, internal ribosomal entry sites (IRES), and other expression control elements (e.g. transcription termination signals, such as polyadenylation signals and poly-U sequences). Such regulatory elements are described, for example, in Goeddel, GENE EXPRESSION TECHNOLOGY: METHODS IN ENZYMOLOGY 185, Academic Press, San Diego, Calif. (1990). Regulatory elements include those that direct constitutive expression of a nucleotide sequence in many types of host cell and those that direct expression of the nucleotide sequence only in certain host cells (e.g., tissue-specific regulatory sequences). A tissue-specific promoter may direct expression primarily in a desired tissue of interest, such as muscle, neuron, bone, skin, blood, specific organs (e.g. liver, pancreas), or particular cell types (e.g. lymphocytes). Regulatory elements may also direct expression in a temporal-dependent manner, such as in a cell-cycle dependent or developmental stage-dependent manner, which may or may not also be tissue or cell-type specific. In some embodiments, a vector comprises one or more pol III promoter (e.g. 1, 2, 3, 4, 5, or more pol I promoters), one or more pol II promoters (e.g. 1, 2, 3, 4, 5, or more pol II promoters), one or more pol I promoters (e.g. 1, 2, 3, 4, 5, or more pol I promoters), or combinations thereof. Examples of pol III promoters include, but are not limited to, U6 and H1 promoters. Examples of pol II promoters include, but are not limited to, the retroviral Rous sarcoma virus (RSV) LTR promoter (optionally with the RSV enhancer), the cytomegalovirus (CMV) promoter (optionally with the CMV enhancer) [see, e.g., Boshart et al, Cell, 41:521-530 (1985)], the SV40 promoter, the dihydrofolate reductase promoter, the β-actin promoter, the phosphoglycerol kinase (PGK) promoter, and the EF1α promoter. Also encompassed by the term “regulatory element” are enhancer elements, such as WPRE; CMV enhancers; the R-U5′ segment in LTR of HTLV-I (Mol. Cell. Biol., Vol. 8(1), p. 466-472, 1988); SV40 enhancer; and the intron sequence between exons 2 and 3 of rabbit β-globin (Proc. Natl. Acad. Sci. USA., Vol. 78(3), p. 1527-31, 1981). It will be appreciated by those skilled in the art that the design of the expression vector can depend on such factors as the choice of the host cell to be transformed, the level of expression desired, etc. A vector can be introduced into host cells to thereby produce transcripts, proteins, or peptides, including fusion proteins or peptides, encoded by nucleic acids as described herein (e.g., clustered regularly interspersed short palindromic repeats (CRISPR) transcripts, proteins, enzymes, mutant forms thereof, fusion proteins thereof, etc.).
  • Advantageous vectors include lentiviruses and adeno-associated viruses, and types of such vectors can also be selected for targeting particular types of cells.
  • In one aspect, the invention provides a eukaryotic host cell comprising (a) a first regulatory element operably linked to a tracr mate sequence and one or more insertion sites for inserting one or more guide sequences upstream of the tracr mate sequence, wherein when expressed, the guide sequence directs sequence-specific binding of a CRISPR complex to a target sequence in a eukaryotic cell, wherein the CRISPR complex comprises a CRISPR enzyme complexed with (1) the guide sequence that is hybridized to the target sequence, and (2) the tracr mate sequence that is hybridized to the tracr sequence; and/or (b) a second regulatory element operably linked to an enzyme-coding sequence encoding said CRISPR enzyme comprising a nuclear localization sequence. In some embodiments, the host cell comprises components (a) and (b). In some embodiments, component (a), component (b), or components (a) and (b) are stably integrated into a genome of the host eukaryotic cell. In some embodiments, component (a) further comprises the tracr sequence downstream of the tracr mate sequence under the control of the first regulatory element. In some embodiments, component (a) further comprises two or more guide sequences operably linked to the first regulatory element, wherein when expressed, each of the two or more guide sequences direct sequence specific binding of a CRISPR complex to a different target sequence in a eukaryotic cell. In some embodiments, the eukaryotic host cell further comprises a third regulatory element, such as a polymerase III promoter, operably linked to said tracr sequence. In some embodiments, the tracr sequence exhibits at least 50%, 60%, 70%, 80%, 90%, 95%, or 99% of sequence complementarity along the length of the tracr mate sequence when optimally aligned. The enzyme may be a Cas9 homolog or ortholog. In some embodiments, the CRISPR enzyme is codon-optimized for expression in a eukaryotic cell. In some embodiments, the CRISPR enzyme directs cleavage of one or two strands at the location of the target sequence. In some embodiments, the CRISPR enzyme lacks DNA strand cleavage activity. In some embodiments, the first regulatory element is a polymerase III promoter. In some embodiments, the second regulatory element is a polymerase II promoter. In some embodiments, the guide sequence is at least 15, 16, 17, 18, 19, 20, 25 nucleotides, or between 10-30, or between 15-25, or between 15-20 nucleotides in length. In an aspect, the invention provides a non-human eukaryotic organism; preferably a multicellular eukaryotic organism, comprising a eukaryotic host cell according to any of the described embodiments. In other aspects, the invention provides a eukaryotic organism; preferably a multicellular eukaryotic organism, comprising a eukaryotic host cell according to any of the described embodiments. The organism in some embodiments of these aspects may be an animal; for example a mammal. Also, the organism may be an arthropod such as an insect. The organism also may be a plant. Further, the organism may be a fungus.
  • In one aspect, the invention provides a kit comprising one or more of the components described herein. In some embodiments, the kit comprises a vector system and instructions for using the kit. In some embodiments, the vector system comprises (a) a first regulatory element operably linked to a tracr mate sequence and one or more insertion sites for inserting one or more guide sequences upstream of the tracr mate sequence, wherein when expressed, the guide sequence directs sequence-specific binding of a CRISPR complex to a target sequence in a eukaryotic cell, wherein the CRISPR complex comprises a CRISPR enzyme complexed with (1) the guide sequence that is hybridized to the target sequence, and (2) the tracr mate sequence that is hybridized to the tracr sequence; and/or (b) a second regulatory element operably linked to an enzyme-coding sequence encoding said CRISPR enzyme comprising a nuclear localization sequence. In some embodiments, the kit comprises components (a) and (b) located on the same or different vectors of the system. In some embodiments, component (a) further comprises the tracr sequence downstream of the tracr mate sequence under the control of the first regulatory element. In some embodiments, component (a) further comprises two or more guide sequences operably linked to the first regulatory element, wherein when expressed, each of the two or more guide sequences direct sequence specific binding of a CRISPR complex to a different target sequence in a eukaryotic cell. In some embodiments, the system further comprises a third regulatory element, such as a polymerase III promoter, operably linked to said tracr sequence. In some embodiments, the tracr sequence exhibits at least 50%, 60%, 70%, 80%, 90%, 95%, or 99% of sequence complementarity along the length of the tracr mate sequence when optimally aligned. In some embodiments, the CRISPR enzyme comprises one or more nuclear localization sequences of sufficient strength to drive accumulation of said CRISPR enzyme in a detectable amount in the nucleus of a eukaryotic cell. In some embodiments, the CRISPR enzyme is a type II CRISPR system enzyme. In some embodiments, the CRISPR enzyme is a Cas9 enzyme. In some embodiments, the Cas9 enzyme is S. pneumoniae, S. pyogenes or S. thermophilus Cas9, and may include mutated Cas9 derived from these organisms. The enzyme may be a Cas9 homolog or ortholog. In some embodiments, the CRISPR enzyme is codon-optimized for expression in a eukaryotic cell. In some embodiments, the CRISPR enzyme directs cleavage of one or two strands at the location of the target sequence. In some embodiments, the CRISPR enzyme lacks DNA strand cleavage activity. In some embodiments, the first regulatory element is a polymerase III promoter. In some embodiments, the second regulatory element is a polymerase II promoter. In some embodiments, the guide sequence is at least 15, 16, 17, 18, 19, 20, 25 nucleotides, or between 10-30, or between 15-25, or between 15-20 nucleotides in length.
  • In one aspect, the invention provides a method of modifying a target polynucleotide in a eukaryotic cell. In some embodiments, the method comprises allowing a CRISPR complex to bind to the target polynucleotide to effect cleavage of said target polynucleotide thereby modifying the target polynucleotide, wherein the CRISPR complex comprises a CRISPR enzyme complexed with a guide sequence hybridized to a target sequence within said target polynucleotide, wherein said guide sequence is linked to a tracr mate sequence which in turn hybridizes to a tracr sequence. In some embodiments, said cleavage comprises cleaving one or two strands at the location of the target sequence by said CRISPR enzyme. In some embodiments, said cleavage results in decreased transcription of a target gene. In some embodiments, the method further comprises repairing said cleaved target polynucleotide by homologous recombination with an exogenous template polynucleotide, wherein said repair results in a mutation comprising an insertion, deletion, or substitution of one or more nucleotides of said target polynucleotide. In some embodiments, said mutation results in one or more amino acid changes in a protein expressed from a gene comprising the target sequence. In some embodiments, the method further comprises delivering one or more vectors to said eukaryotic cell, wherein the one or more vectors drive expression of one or more of: the CRISPR enzyme, the guide sequence linked to the tracr mate sequence, and the tracr sequence. In some embodiments, said vectors are delivered to the eukaryotic cell in a subject. In some embodiments, said modifying takes place in said eukaryotic cell in a cell culture. In some embodiments, the method further comprises isolating said eukaryotic cell from a subject prior to said modifying. In some embodiments, the method further comprises returning said eukaryotic cell and/or cells derived therefrom to said subject.
  • In one aspect, the invention provides a method of modifying expression of a polynucleotide in a eukaryotic cell. In some embodiments, the method comprises allowing a CRISPR complex to bind to the polynucleotide such that said binding results in increased or decreased expression of said polynucleotide; wherein the CRISPR complex comprises a CRISPR enzyme complexed with a guide sequence hybridized to a target sequence within said polynucleotide, wherein said guide sequence is linked to a tracr mate sequence which in turn hybridizes to a tracr sequence. In some embodiments, the method further comprises delivering one or more vectors to said eukaryotic cells, wherein the one or more vectors drive expression of one or more of: the CRISPR enzyme, the guide sequence linked to the tracr mate sequence, and the tracr sequence.
  • In one aspect, the invention provides a method of generating a model eukaryotic cell comprising a mutated disease gene. In some embodiments, a disease gene is any gene associated an increase in the risk of having or developing a disease. In some embodiments, the method comprises (a) introducing one or more vectors into a eukaryotic cell, wherein the one or more vectors drive expression of one or more of: a CRISPR enzyme, a guide sequence linked to a tracr mate sequence, and a tracr sequence; and (b) allowing a CRISPR complex to bind to a target polynucleotide to effect cleavage of the target polynucleotide within said disease gene, wherein the CRISPR complex comprises the CRISPR enzyme complexed with (1) the guide sequence that is hybridized to the target sequence within the target polynucleotide, and (2) the tracr mate sequence that is hybridized to the tracr sequence, thereby generating a model eukaryotic cell comprising a mutated disease gene. In some embodiments, said cleavage comprises cleaving one or two strands at the location of the target sequence by said CRISPR enzyme. In some embodiments, said cleavage results in decreased transcription of a target gene. In some embodiments, the method further comprises repairing said cleaved target polynucleotide by homologous recombination with an exogenous template polynucleotide, wherein said repair results in a mutation comprising an insertion, deletion, or substitution of one or more nucleotides of said target polynucleotide. In some embodiments, said mutation results in one or more amino acid changes in a protein expression from a gene comprising the target sequence.
  • In one aspect, the invention provides a method for developing a biologically active agent that modulates a cell signaling event associated with a disease gene. In some embodiments, a disease gene is any gene associated an increase in the risk of having or developing a disease. In some embodiments, the method comprises (a) contacting a test compound with a model cell of any one of the described embodiments; and (b) detecting a change in a readout that is indicative of a reduction or an augmentation of a cell signaling event associated with said mutation in said disease gene, thereby developing said biologically active agent that modulates said cell signaling event associated with said disease gene.
  • In one aspect, the invention provides a recombinant polynucleotide comprising a guide sequence upstream of a tracr mate sequence, wherein the guide sequence when expressed directs sequence-specific binding of a CRISPR complex to a corresponding target sequence present in a eukaryotic cell. In some embodiments, the target sequence is a viral sequence present in a eukaryotic cell. In some embodiments, the target sequence is a proto-oncogene or an oncogene.
  • In one aspect the invention provides for a method of selecting one or more cell(s) by introducing one or more mutations in a gene in the one or more cell (s), the method comprising: introducing one or more vectors into the cell (s), wherein the one or more vectors drive expression of one or more of: a CRISPR enzyme, a guide sequence linked to a tracr mate sequence, a tracr sequence, and an editing template; wherein the editing template comprises the one or more mutations that abolish CRISPR enzyme cleavage; allowing homologous recombination of the editing template with the target polynucleotide in the cell(s) to be selected; allowing a CRISPR complex to bind to a target polynucleotide to effect cleavage of the target polynucleotide within said gene, wherein the CRISPR complex comprises the CRISPR enzyme complexed with (1) the guide sequence that is hybridized to the target sequence within the target polynucleotide, and (2) the tracr mate sequence that is hybridized to the tracr sequence, wherein binding of the CRISPR complex to the target polynucleotide induces cell death, thereby allowing one or more cell(s) in which one or more mutations have been introduced to be selected. In a preferred embodiment, the CRISPR enzyme is Cas9. In another preferred embodiment of the invention the cell to be selected may be a eukaryotic cell. Aspects of the invention allow for selection of specific cells without requiring a selection marker or a two-step process that may include a counter-selection system Accordingly, it is an object of the invention not to encompass within the invention any previously known product, process of making the product, or method of using the product such that Applicants reserve the right and hereby disclose a disclaimer of any previously known product, process, or method. It is further noted that the invention does not intend to encompass within the scope of the invention any product, process, or making of the product or method of using the product, which does not meet the written description and enablement requirements of the USPTO (35 U.S.C. §112, first paragraph) or the EPO (Article 83 of the EPC), such that Applicants reserve the right and hereby disclose a disclaimer of any previously described product, process of making the product, or method of using the product.
  • It is noted that in this disclosure and particularly in the claims and/or paragraphs, terms such as “comprises”, “comprised”, “comprising” and the like can have the meaning attributed to it in U.S. Patent law; e.g., they can mean “includes”, “included”, “including”, and the like; and that terms such as “consisting essentially of” and “consists essentially of” have the meaning ascribed to them in U.S. Patent law, e.g., they allow for elements not explicitly recited, but exclude elements that are found in the prior art or that affect a basic or novel characteristic of the invention. These and other embodiments are disclosed or are obvious from and encompassed by, the following Detailed Description.
  • BRIEF DESCRIPTION OF THE DRAWINGS
  • The novel features of the invention are set forth with particularity in the appended claims. A better understanding of the features and advantages of the present invention will be obtained by reference to the following detailed description that sets forth illustrative embodiments, in which the principles of the invention are utilized, and the accompanying drawings of which:
  • FIG. 1 shows a schematic model of the CRISPR system. The Cas9 nuclease from Streptococcus pyogenes (yellow) is targeted to genomic DNA by a synthetic guide RNA (sgRNA) consisting of a 20-nt guide sequence (blue) and a scaffold (red). The guide sequence base-pairs with the DNA target (blue), directly upstream of a requisite 5′-NGG protospacer adjacent motif (PAM; magenta), and Cas9 mediates a double-stranded break (DSB) ˜3 bp upstream of the PAM (red triangle).
  • FIG. 2A-F shows an exemplary CRISPR system, a possible mechanism of action, an example adaptation for expression in eukaryotic cells, and results of tests assessing nuclear localization and CRISPR activity. FIG. 2C discloses SEQ ID NOS 23-24, respectively, in order of appearance. FIG. 2E discloses SEQ ID NOS 25-27, respectively, in order of appearance. FIG. 2F discloses SEQ ID NOS 28-32, respectively, in order of appearance.
  • FIG. 3A-D shows results of an evaluation of SpCas9 specificity for an example target. FIG. 3A discloses SEQ ID NOS 33, 26 and 34-44, respectively, in order of appearance. FIG. 3C discloses SEQ ID NO: 33.
  • FIG. 4A-G shows an exemplary vector system and results for its use in directing homologous recombination in eukaryotic cells. FIG. 4E discloses SEQ ID NO: 45. FIG. 4F discloses SEQ ID NOS 46-47, respectively, in order of appearance. FIG. 4G discloses SEQ ID NOS 48-52, respectively, in order of appearance.
  • FIG. 5 provides a table of protospacer sequences ( SEQ ID NOS 16, 15, 14, 53-58, 18, 17 and 59-63, respectively, in order of appearance) and summarizes modification efficiency results for protospacer targets designed based on exemplary S. pyogenes and S. thermophilus CRISPR systems with corresponding PAMs against loci in human and mouse genomes. Cells were transfected with Cas9 and either pre-crRNA/tracrRNA or chimeric RNA, and analyzed 72 hours after transfection. Percent indels are calculated based on Surveyor assay results from indicated cell lines (N=3 for all protospacer targets, errors are S.E.M., N.D. indicates not detectable using the Surveyor assay, and N.T. indicates not tested in this study).
  • FIG. 6A-C shows a comparison of different tracrRNA transcripts for Cas9-mediated gene targeting. FIG. 6A discloses SEQ ID NOS 64-65, respectively, in order of appearance.
  • FIG. 7 shows a schematic of a surveyor nuclease assay for detection of double strand break-induced micro-insertions and -deletions.
  • FIG. 8A-B shows exemplary bicistronic expression vectors for expression of CRISPR system elements in eukaryotic cells. FIG. 8A discloses SEQ ID NOS 66-68, respectively, in order of appearance. FIG. 8B discloses SEQ ID NOS 69-71, respectively, in order of appearance.
  • FIG. 9A-C shows histograms of distances between adjacent S. pyogenes SF370 locus 1 PAM (NGG) (FIG. 9A) and S. thermophilus LMD9 locus 2 PAM (NNAGAAW) (FIG. 9B) in the human genome; and distances for each PAM by chromosome (Chr) (FIG. 9C).
  • FIG. 10A-D shows an exemplary CRISPR system, an example adaptation for expression in eukaryotic cells, and results of tests assessing CRISPR activity. FIG. 10B discloses SEQ ID NOS 72-73, respectively, in order of appearance. FIG. 10C discloses SEQ ID NO: 74.
  • FIG. 11A-C shows exemplary manipulations of a CRISPR system for targeting of genomic loci in mammalian cells. FIG. 11A discloses SEQ ID NO: 75. FIG. 11B discloses SEQ ID NOS 76-78, respectively, in order of appearance.
  • FIG. 12A-B shows the results of a Northern blot analysis of crRNA processing in mammalian cells. FIG. 12A discloses SEQ ID NO: 79.
  • FIG. 13A-B shows an exemplary selection of protospacers in the human PVALB and mouse Th loci. FIG. 13A discloses SEQ ID NO: 80. FIG. 13B discloses SEQ ID NO: 81.
  • FIG. 14 shows example protospacer and corresponding PAM sequence targets of the S. thermophilus CRISPR system in the human EMX1 locus. FIG. 14 discloses SEQ ID NO: 74.
  • FIG. 15 provides a table of sequences (SEQ ID NOS 82-93, respectively, in order of appearance) for primers and probes used for Surveyor, RFLP, genomic sequencing, and Northern blot assays.
  • FIG. 16A-C shows exemplary manipulation of a CRISPR system with chimeric RNAs and results of SURVEYOR assays for system activity in eukaryotic cells. FIG. 16A discloses SEQ ID NO: 94.
  • FIG. 17A-B shows a graphical representation of the results of SURVEYOR assays for CRISPR system activity in eukaryotic cells.
  • FIG. 18 shows an exemplary visualization of some S. pyogenes Cas9 target sites in the human genome using the UCSC genome browser. FIG. 18 discloses SEQ ID NOS 95-173, respectively, in order of appearance.
  • FIG. 19A-D shows a circular depiction of the phylogenetic analysis revealing five families of Cas9s, including three groups of large Cas9s (˜1400 amino acids) and two of small Cas9s (˜1100 amino acids).
  • FIG. 20A-F shows the linear depiction of the phylogenetic analysis revealing five families of Cas9s, including three groups of large Cas9s (˜1400 amino acids) and two of small Cas9s (˜1100 amino acids).
  • FIG. 21A-D shows genome editing via homologous recombination. (a) Schematic of SpCas9 nickase, with D10A mutation in the RuvC I catalytic domain. (b) Schematic representing homologous recombination (HR) at the human EMX1 locus using either sense or antisense single stranded oligonucleotides as repair templates. Red arrow above indicates sgRNA cleavage site; PCR primers for genotyping (Tables J and K) are indicated as arrows in right panel. FIG. 21C discloses SEQ ID NOS 174-176, 174, 177 and 176, respectively, in order of appearance. (c) Sequence of region modified by HR. d, SURVEYOR assay for wildtype (wt) and nickase (D10A) SpCas9-mediated indels at the EMX1 target 1 locus (n=3). Arrows indicate positions of expected fragment sizes.
  • FIG. 22A-B shows single vector designs for SpCas9. FIG. 22A discloses SEQ ID NOS 178-180, respectively, in order of appearance. FIG. 22B discloses SEQ ID NO: 181.
  • The figures herein are for illustrative purposes only and are not necessarily drawn to scale.
  • DETAILED DESCRIPTION OF THE INVENTION
  • The terms “polynucleotide”, “nucleotide”. “nucleotide sequence”, “nucleic acid” and “oligonucleotide” are used interchangeably. They refer to a polymeric form of nucleotides of any length, either deoxyribonucleotides or ribonucleotides, or analogs thereof. Polynucleotides may have any three dimensional structure, and may perform any function, known or unknown. The following are non limiting examples of polynucleotides: coding or non-coding regions of a gene or gene fragment, loci (locus) defined from linkage analysis, exons, introns, messenger RNA (mRNA), transfer RNA, ribosomal RNA, short interfering RNA (siRNA), short-hairpin RNA (shRNA), micro-RNA (miRNA), ribozymes, cDNA, recombinant polynucleotides, branched polynucleotides, plasmids, vectors, isolated DNA of any sequence, isolated RNA of any sequence, nucleic acid probes, and primers. A polynucleotide may comprise one or more modified nucleotides, such as methylated nucleotides and nucleotide analogs. If present, modifications to the nucleotide structure may be imparted before or after assembly of the polymer. The sequence of nucleotides may be interrupted by non nucleotide components. A polynucleotide may be further modified after polymerization, such as by conjugation with a labeling component.
  • In aspects of the invention the terms “chimeric RNA”, “chimeric guide RNA”, “guide RNA”, “single guide RNA” and “synthetic guide RNA” are used interchangeably and refer to the polynucleotide sequence comprising the guide sequence, the tracr sequence and the tracr mate sequence. The term “guide sequence” refers to the about 20 bp sequence within the guide RNA that specifies the target site and may be used interchangeably with the terms “guide” or “spacer”. The term “tracr mate sequence” may also be used interchangeably with the term “direct repeat(s)”. An exemplary CRISPR-Cas system is illustrated in FIG. 1.
  • As used herein the term “wild type” is a term of the art understood by skilled persons and means the typical form of an organism, strain, gene or characteristic as it occurs in nature as distinguished from mutant or variant forms.
  • As used herein the term “variant” should be taken to mean the exhibition of qualities that have a pattern that deviates from what occurs in nature.
  • The terms “non-naturally occurring” or “engineered” are used interchangeably and indicate the involvement of the hand of man. The terms, when referring to nucleic acid molecules or polypeptides mean that the nucleic acid molecule or the polypeptide is at least substantially free from at least one other component with which they are naturally associated in nature and as found in nature.
  • “Complementarity” refers to the ability of a nucleic acid to form hydrogen bond(s) with another nucleic acid sequence by either traditional Watson-Crick or other non-traditional types. A percent complementarity indicates the percentage of residues in a nucleic acid molecule which can form hydrogen bonds (e.g., Watson-Crick base pairing) with a second nucleic acid sequence (e.g., 5, 6, 7, 8, 9, 10 out of 10 being 50%, 60%, 70%, 80%, 90%, and 100% complementary). “Perfectly complementary” means that all the contiguous residues of a nucleic acid sequence will hydrogen bond with the same number of contiguous residues in a second nucleic acid sequence. “Substantially complementary” as used herein refers to a degree of complementarity that is at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%. 97%, 98%, 99%, or 100% over a region of 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 30, 35, 40, 45, 50, or more nucleotides, or refers to two nucleic acids that hybridize under stringent conditions.
  • As used herein, “stringent conditions” for hybridization refer to conditions under which a nucleic acid having complementarity to a target sequence predominantly hybridizes with the target sequence, and substantially does not hybridize to non-target sequences. Stringent conditions are generally sequence-dependent, and vary depending on a number of factors. In general, the longer the sequence, the higher the temperature at which the sequence specifically hybridizes to its target sequence. Non-limiting examples of stringent conditions are described in detail in Tijssen (1993), Laboratory Techniques In Biochemistry And Molecular Biology—Hybridization With Nucleic Acid Probes Part 1, Second Chapter “Overview of principles of hybridization and the strategy of nucleic acid probe assay”, Elsevier, N.Y.
  • “Hybridization” refers to a reaction in which one or more polynucleotides react to form a complex that is stabilized via hydrogen bonding between the bases of the nucleotide residues. The hydrogen bonding may occur by Watson Crick base pairing, Hoogstein binding, or in any other sequence specific manner. The complex may comprise two strands forming a duplex structure, three or more strands forming a multi stranded complex, a single self hybridizing strand, or any combination of these. A hybridization reaction may constitute a step in a more extensive process, such as the initiation of PCR, or the cleavage of a polynucleotide by an enzyme. A sequence capable of hybridizing with a given sequence is referred to as the “complement” of the given sequence.
  • As used herein, “expression” refers to the process by which a polynucleotide is transcribed from a DNA template (such as into and mRNA or other RNA transcript) and/or the process by which a transcribed mRNA is subsequently translated into peptides, polypeptides, or proteins. Transcripts and encoded polypeptides may be collectively referred to as “gene product.” If the polynucleotide is derived from genomic DNA, expression may include splicing of the mRNA in a eukaryotic cell.
  • The terms “polypeptide”, “peptide” and “protein” are used interchangeably herein to refer to polymers of amino acids of any length. The polymer may be linear or branched, it may comprise modified amino acids, and it may be interrupted by non amino acids. The terms also encompass an amino acid polymer that has been modified; for example, disulfide bond formation, glycosylation, lipidation, acetylation, phosphorylation, or any other manipulation, such as conjugation with a labeling component. As used herein the term “amino acid” includes natural and/or unnatural or synthetic amino acids, including glycine and both the D or L optical isomers, and amino acid analogs and peptidomimetics.
  • The terms “subject,” “individual,” and “patient” are used interchangeably herein to refer to a vertebrate, preferably a mammal, more preferably a human. Mammals include, but are not limited to, murines, simians, humans, farm animals, sport animals, and pets. Tissues, cells and their progeny of a biological entity obtained in vivo or cultured in vitro are also encompassed.
  • The terms “therapeutic agent”, “therapeutic capable agent” or “treatment agent” are used interchangeably and refer to a molecule or compound that confers some beneficial effect upon administration to a subject. The beneficial effect includes enablement of diagnostic determinations; amelioration of a disease, symptom, disorder, or pathological condition; reducing or preventing the onset of a disease, symptom, disorder or condition; and generally counteracting a disease, symptom, disorder or pathological condition.
  • As used herein, “treatment” or “treating,” or “palliating” or “ameliorating” are used interchangeably. These terms refer to an approach for obtaining beneficial or desired results including but not limited to a therapeutic benefit and/or a prophylactic benefit. By therapeutic benefit is meant any therapeutically relevant improvement in or effect on one or more diseases, conditions, or symptoms under treatment. For prophylactic benefit, the compositions may be administered to a subject at risk of developing a particular disease, condition, or symptom, or to a subject reporting one or more of the physiological symptoms of a disease, even though the disease, condition, or symptom may not have yet been manifested.
  • The term “effective amount” or “therapeutically effective amount” refers to the amount of an agent that is sufficient to effect beneficial or desired results. The therapeutically effective amount may vary depending upon one or more of: the subject and disease condition being treated, the weight and age of the subject, the severity of the disease condition, the manner of administration and the like, which can readily be determined by one of ordinary skill in the art. The term also applies to a dose that will provide an image for detection by any one of the imaging methods described herein. The specific dose may vary depending on one or more of: the particular agent chosen, the dosing regimen to be followed, whether it is administered in combination with other compounds, timing of administration, the tissue to be imaged, and the physical delivery system in which it is carried.
  • The practice of the present invention employs, unless otherwise indicated, conventional techniques of immunology, biochemistry, chemistry, molecular biology, microbiology, cell biology, genomics and recombinant DNA, which are within the skill of the art. See Sambrook, Fritsch and Maniatis, MOLECULAR CLONING: A LABORATORY MANUAL, 2nd edition (1989); CURRENT PROTOCOLS IN MOLECULAR BIOLOGY (F. M. Ausubel, et al. eds., (1987)); the series METHODS IN ENZYMOLOGY (Academic Press, Inc.): PCR 2: A PRACTICAL APPROACH (M. J. MacPherson, B. D. Hames and G. R. Taylor eds. (1995)), Harlow and Lane, eds. (1988) ANTIBODIES, A LABORATORY MANUAL, and ANIMAL CELL CULTURE (R. I. Freshney, ed. (1987)).
  • Several aspects of the invention relate to vector systems comprising one or more vectors, or vectors as such. Vectors can be designed for expression of CRISPR transcripts (e.g. nucleic acid transcripts, proteins, or enzymes) in prokaryotic or eukaryotic cells. For example, CRISPR transcripts can be expressed in bacterial cells such as Escherichia coli, insect cells (using baculovirus expression vectors), yeast cells, or mammalian cells. Suitable host cells are discussed further in Goeddel, GENE EXPRESSION TECHNOLOGY: METHODS IN ENZYMOLOGY 185, Academic Press, San Diego, Calif. (1990). Alternatively, the recombinant expression vector can be transcribed and translated in vitro, for example using T7 promoter regulatory sequences and T7 polymerase.
  • Vectors may be introduced and propagated in a prokaryote. In some embodiments, a prokaryote is used to amplify copies of a vector to be introduced into a eukaryotic cell or as an intermediate vector in the production of a vector to be introduced into a eukaryotic cell (e.g. amplifying a plasmid as part of a viral vector packaging system). In some embodiments, a prokaryote is used to amplify copies of a vector and express one or more nucleic acids, such as to provide a source of one or more proteins for delivery to a host cell or host organism. Expression of proteins in prokaryotes is most often carried out in Escherichia coli with vectors containing constitutive or inducible promoters directing the expression of either fusion or non-fusion proteins. Fusion vectors add a number of amino acids to a protein encoded therein, such as to the amino terminus of the recombinant protein. Such fusion vectors may serve one or more purposes, such as: (i) to increase expression of recombinant protein; (ii) to increase the solubility of the recombinant protein; and (iii) to aid in the purification of the recombinant protein by acting as a ligand in affinity purification. Often, in fusion expression vectors, a proteolytic cleavage site is introduced at the junction of the fusion moiety and the recombinant protein to enable separation of the recombinant protein from the fusion moiety subsequent to purification of the fusion protein. Such enzymes, and their cognate recognition sequences, include Factor Xa, thrombin and enterokinase. Example fusion expression vectors include pGEX (Pharmacia Biotech Inc; Smith and Johnson, 1988. Gene 67: 31-40), pMAL (New England Biolabs, Beverly, Mass.) and pRIT5 (Pharmacia, Piscataway, N.J.) that fuse glutathione S-transferase (GST), maltose E binding protein, or protein A. respectively, to the target recombinant protein.
  • Examples of suitable inducible non-fusion E. coli expression vectors include pTrc (Amrann et al., (1988) Gene 69:301-315) and pET 11d (Studier et al., GENE EXPRESSION TECHNOLOGY: METHODS IN ENZYMOLOGY 185, Academic Press, San Diego, Calif. (1990) 60-89).
  • In some embodiments, a vector is a yeast expression vector. Examples of vectors for expression in yeast Saccharomyces cerivisae include pYepSec1 (Baldari, et al., 1987. EMBO J. 6: 229-234), pMFa (Kuijan and Herskowitz, 1982. Cell 30: 933-943), pJRY88 (Schultz et al., 1987. Gene 54: 113-123), pYES2 (Invitrogen Corporation, San Diego, Calif.), and picZ (InVitrogen Corp, San Diego, Calif.).
  • In some embodiments, a vector drives protein expression in insect cells using baculovirus expression vectors. Baculovirus vectors available for expression of proteins in cultured insect cells (e.g., SF9 cells) include the pAc series (Smith, et al., 1983. Mol. Cell. Biol. 3: 2156-2165) and the pVL series (Lucklow and Summers, 1989. Virology 170: 31-39).
  • In some embodiments, a vector is capable of driving expression of one or more sequences in mammalian cells using a mammalian expression vector. Examples of mammalian expression vectors include pCDM8 (Seed, 1987. Nature 329: 840) and pMT2PC (Kaufman, et al., 1987. EMBO J. 6: 187-195). When used in mammalian cells, the expression vector's control functions are typically provided by one or more regulatory elements. For example, commonly used promoters are derived from polyoma, adenovirus 2, cytomegalovirus, simian virus 40, and others disclosed herein and known in the art. For other suitable expression systems for both prokaryotic and eukaryotic cells see, e.g., Chapters 16 and 17 of Sambrook, et al., MOLECULAR CLONING: A LABORATORY MANUAL. 2nd ed., Cold Spring Harbor Laboratory, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., 1989.
  • In some embodiments, the recombinant mammalian expression vector is capable of directing expression of the nucleic acid preferentially in a particular cell type (e.g., tissue-specific regulatory elements are used to express the nucleic acid). Tissue-specific regulatory elements are known in the art. Non-limiting examples of suitable tissue-specific promoters include the albumin promoter (liver-specific; Pinkert, et al., 1987. Genes Dev. 1: 268-277), lymphoid-specific promoters (Calame and Eaton, 1988. Adv. Inmmunol. 43: 235-275), in particular promoters of T cell receptors (Winoto and Baltimore, 1989. EMBO J. 8: 729-733) and immunoglobulins (Baneiji, et al., 1983. Cell 33: 729-740; Queen and Baltimore, 1983. Cell 33: 741-748), neuron-specific promoters (e.g., the neurofilament promoter; Byrne and Ruddle, 1989. Proc. Natl. Acad. Sci. USA 86: 5473-5477), pancreas-specific promoters (Edlund, et al., 1985. Science 230: 912-916), and mammary gland-specific promoters (e.g., milk whey promoter; U.S. Pat. No. 4,873,316 and European Application Publication No. 264,166). Developmentally-regulated promoters are also encompassed, e.g., the murine hox promoters (Kessel and Gruss, 1990. Science 249: 374-379) and the α-fetoprotein promoter (Campes and Tilghman, 1989. Genes Dev. 3: 537-546).
  • In some embodiments, a regulatory element is operably linked to one or more elements of a CRISPR system so as to drive expression of the one or more elements of the CRISPR system. In general, CRISPRs (Clustered Regularly Interspaced Short Palindromic Repeats), also known as SPIDRs (SPacer Interspersed Direct Repeats), constitute a family of DNA loci that are usually specific to a particular bacterial species. The CRISPR locus comprises a distinct class of interspersed short sequence repeats (SSRs) that were recognized in E. coli (Ishino et al., J. Bacteriol., 169:5429-5433 [1987]; and Nakata et al., J. Bacteriol., 171:3553-3556 [1989]), and associated genes. Similar interspersed SSRs have been identified in Haloferax mediterranei, Streptococcus pyogenes, Anabaena, and Mycobacterium tuberculosis (See, Groenen et al., Mol. Microbiol., 10:1057-1065 [1993]; Hoe et al., Emerg. Infect. Dis., 5:254-263 [1999]; Masepohl et al., Biochim. Biophys. Acta 1307:26-30 [1996]; and Mojica et al., Mol. Microbiol., 17:85-93 [1995]). The CRISPR loci typically differ from other SSRs by the structure of the repeats, which have been termed short regularly spaced repeats (SRSRs) (Janssen et al., OMICS J. Integ. Biol., 6:23-33 [2002]; and Mojica et al., Mol. Microbiol., 36:244-246 [2000]). In general, the repeats are short elements that occur in clusters that are regularly spaced by unique intervening sequences with a substantially constant length (Mojica et al., [2000], supra). Although the repeat sequences are highly conserved between strains, the number of interspersed repeats and the sequences of the spacer regions typically differ from strain to strain (van Embden et al., J. Bacteriol., 182:2393-2401 [2000]). CRISPR loci have been identified in more than 40 prokaryotes (See e.g., Jansen et al., Mol. Microbiol., 43:1565-1575 [2002]; and Mojica et al., [2005]) including, but not limited to Aeropyrum, Pyrobaculum, Sulfolobus, Archaeoglobus, Halocarcula, Methanobacterium, Methanococcus, Methanosarcina, Methanopyrus, Pyrococcus, Picrophilus, Thermoplasnia, Corynebacterium, Mycobacterium, Streptomyces, Aquifex, Porphyromonas, Chlorobium, Thermus, Bacillus, Listeria, Staphylococcus, Clostridium, Thermoanaerobacter, Mycoplasma, Fusobacterium, Azarcus, Chromobacterium, Neisseria, Nitrosomonas, Desulfovibrio, Geobacter, Myrococcus, Campylobacter, Wolinella, Acinetobacter, Erwinia, Escherichia, Legionella, Methylococcus, Pasteurella, Photobacterium, Salmonella, Xanthomonas, Yersinia, Treponema, and Thermotoga.
  • In general, “CRISPR system” refers collectively to transcripts and other elements involved in the expression of or directing the activity of CRISPR-associated (“Cas”) genes, including sequences encoding a Cas gene, a tracr (trans-activating CRISPR) sequence (e.g. tracrRNA or an active partial tracrRNA), a tracr-mate sequence (encompassing a “direct repeat” and a tracrRNA-processed partial direct repeat in the context of an endogenous CRISPR system), a guide sequence (also referred to as a “spacer” in the context of an endogenous CRISPR system), or other sequences and transcripts from a CRISPR locus. In some embodiments, one or more elements of a CRISPR system is derived from a type 1, type II, or type III CRISPR system. In some embodiments, one or more elements of a CRISPR system is derived from a particular organism comprising an endogenous CRISPR system, such as Streptococcus pyogenes. In general, a CRISPR system is characterized by elements that promote the formation of a CRISPR complex at the site of a target sequence (also referred to as a protospacer in the context of an endogenous CRISPR system). In the context of formation of a CRISPR complex, “target sequence” refers to a sequence to which a guide sequence is designed to have complementarity, where hybridization between a target sequence and a guide sequence promotes the formation of a CRISPR complex. Full complementarity is not necessarily required, provided there is sufficient complementarity to cause hybridization and promote formation of a CRISPR complex. A target sequence may comprise any polynucleotide, such as DNA or RNA polynucleotides. In some embodiments, a target sequence is located in the nucleus or cytoplasm of a cell. In some embodiments, the target sequence may be within an organelle of a eukaryotic cell, for example, mitochondrion or chloroplast. A sequence or template that may be used for recombination into the targeted locus comprising the target sequences is referred to as an “editing template” or “editing polynucleotide” or “editing sequence”. In aspects of the invention, an exogenous template polynucleotide may be referred to as an editing template. In an aspect of the invention the recombination is homologous recombination.
  • Typically, in the context of an endogenous CRISPR system, formation of a CRISPR complex (comprising a guide sequence hybridized to a target sequence and complexed with one or more Cas proteins) results in cleavage of one or both strands in or near (e.g. within 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 50, or more base pairs from) the target sequence. Without wishing to be bound by theory, the tracr sequence, which may comprise or consist of all or a portion of a wild-type tracr sequence (e.g. about or more than about 20, 26, 32, 45, 48, 54, 63, 67, 85, or more nucleotides of a wild-type tracr sequence), may also form part of a CRISPR complex, such as by hybridization along at least a portion of the tracr sequence to all or a portion of a tracr mate sequence that is operably linked to the guide sequence. In some embodiments, the tracr sequence has sufficient complementarity to a tracr mate sequence to hybridize and participate in formation of a CRISPR complex. As with the target sequence, it is believed that complete complementarity is not needed, provided there is sufficient to be functional. In some embodiments, the tracr sequence has at least 50%, 60%, 70%, 80%, 90%, 95% or 99% of sequence complementarity along the length of the tracr mate sequence when optimally aligned. In some embodiments, one or more vectors driving expression of one or more elements of a CRISPR system are introduced into a host cell such that expression of the elements of the CRISPR system direct formation of a CRISPR complex at one or more target sites. For example, a Cas enzyme, a guide sequence linked to a tracr-mate sequence, and a tracr sequence could each be operably linked to separate regulatory elements on separate vectors. Alternatively, two or more of the elements expressed from the same or different regulatory elements, may be combined in a single vector, with one or more additional vectors providing any components of the CRISPR system not included in the first vector. CRISPR system elements that are combined in a single vector may be arranged in any suitable orientation, such as one element located 5′ with respect to (“upstream” of) or 3′ with respect to (“downstream” of) a second element. The coding sequence of one element may be located on the same or opposite strand of the coding sequence of a second element, and oriented in the same or opposite direction. In some embodiments, a single promoter drives expression of a transcript encoding a CRISPR enzyme and one or more of the guide sequence, tracr mate sequence (optionally operably linked to the guide sequence), and a tracr sequence embedded within one or more intron sequences (e.g. each in a different intron, two or more in at least one intron, or all in a single intron). In some embodiments, the CRISPR enzyme, guide sequence, tracr mate sequence, and tracr sequence are operably linked to and expressed from the same promoter. Single vector constructs for SpCas9 are illustrated in FIG. 22.
  • In some embodiments, a vector comprises one or more insertion sites, such as a restriction endonuclease recognition sequence (also referred to as a “cloning site”). In some embodiments, one or more insertion sites (e.g. about or more than about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more insertion sites) are located upstream and/or downstream of one or more sequence elements of one or more vectors. In some embodiments, a vector comprises an insertion site upstream of a tracr mate sequence, and optionally downstream of a regulatory element operably linked to the tracr mate sequence, such that following insertion of a guide sequence into the insertion site and upon expression the guide sequence directs sequence-specific binding of a CRISPR complex to a target sequence in a eukaryotic cell. In some embodiments, a vector comprises two or more insertion sites, each insertion site being located between two tracr mate sequences so as to allow insertion of a guide sequence at each site. In such an arrangement, the two or more guide sequences may comprise two or more copies of a single guide sequence, two or more different guide sequences, or combinations of these. When multiple different guide sequences are used, a single expression construct may be used to target CRISPR activity to multiple different, corresponding target sequences within a cell. For example, a single vector may comprise about or more than about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, or more guide sequences. In some embodiments, about or more than about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more such guide-sequence-containing vectors may be provided, and optionally delivered to a cell.
  • In some embodiments, a vector comprises a regulatory element operably linked to an enzyme-coding sequence encoding a CRISPR enzyme, such as a Cas protein. Non-limiting examples of Cas proteins include Cas1, Cas1B, Cas2, Cas3, Cas4, Cas5, Cas6, Cas7, Cas8, Cas9 (also known as Csn1 and Csx12), Cas10, Csy1, Csy2, Csy3, Cse1, Cse2, Csc1, Csc2, Csa5, Csn2, Csm2, Csm3, Csm4, Csm5, Csm6, Cmr1, Cmr3, Cmr4, Cmr5, Cmr6, Csb1, Csb2, Csb3, Csx17, Csx14, Csx10, Csx16, CsaX, Csx3, Csx1, Csx15, Csf1, Csf2, Csf3, Csf4, homologs thereof, or modified versions thereof. These enzymes are known; for example, the amino acid sequence of S. pyogenes Cas9 protein may be found in the SwissProt database under accession number Q99ZW2. In some embodiments, the unmodified CRISPR enzyme has DNA cleavage activity, such as Cas9. In some embodiments the CRISPR enzyme is Cas9, and may be Cas9 from S. pyogenes or S. pneumoniae. In some embodiments, the CRISPR enzyme directs cleavage of one or both strands at the location of a target sequence, such as within the target sequence and/or within the complement of the target sequence. In some embodiments, the CRISPR enzyme directs cleavage of one or both strands within about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 50, 100, 200, 500, or more base pairs from the first or last nucleotide of a target sequence. In some embodiments, a vector encodes a CRISPR enzyme that is mutated to with respect to a corresponding wild-type enzyme such that the mutated CRISPR enzyme lacks the ability to cleave one or both strands of a target polynucleotide containing a target sequence. For example, an aspartate-to-alanine substitution (D10A) in the RuvC I catalytic domain of Cas9 from S. pyogenes converts Cas9 from a nuclease that cleaves both strands to a nickase (cleaves a single strand). Other examples of mutations that render Cas9 a nickase include, without limitation, H840A, N854A, and N863A. In aspects of the invention, nickases may be used for genome editing via homologous recombination, For example, FIG. 21 shows genome editing via homologous recombination. FIG. 21 (a) shows the schematic of SpCas9 nickase, with D10A mutation in the RuvC I catalytic domain. (b) Schematic representing homologous recombination (HR) at the human EMX1 locus using either sense or antisense single stranded oligonucleotides as repair templates. (c) Sequence of region modified by HR. d, SURVEYOR assay for wildtype (wt) and nickase (D10A) SpCas9-mediated indels at the EMX1 target 1 locus (n=3). Arrows indicate positions of expected fragment sizes.
  • In some embodiments, a Cas9 nickase may be used in combination with guide sequence(s), e.g., two guide sequences, which target respectively sense and antisense strands of the DNA target. This combination allows both strands to be nicked and used to induce NHEJ. Applicants have demonstrated (data not shown) the efficacy of two nickase targets (i.e., sgRNAs targeted at the same location but to different strands of DNA) in inducing mutagenic NHEJ. A single nickase (Cas9-D10A with a single sgRNA) is unable to induce NHEJ and create indels but Applicants have shown that double nickase (Cas9-D10A and two sgRNAs targeted to different strands at the same location) can do so in human embryonic stem cells (hESCs). The efficiency is about 50% of nuclease (i.e., regular Cas9 without D10 mutation) in hESCs.
  • As a further example, two or more catalytic domains of Cas9 (RuvC I, RuvC II, and RuvC III) may be mutated to produce a mutated Cas9 substantially lacking all DNA cleavage activity. In some embodiments, a D10A mutation is combined with one or more of H840A, N854A, or N863A mutations to produce a Cas9 enzyme substantially lacking all DNA cleavage activity. In some embodiments, a CRISPR enzyme is considered to substantially lack all DNA cleavage activity when the DNA cleavage activity of the mutated enzyme is less than about 25%, 10%, 5%, 1%, 0.1%, 0.01%, or lower with respect to its non-mutated form. Other mutations may be useful; where the Cas9 or other CRISPR enzyme is from a species other than S. pyogenes, mutations in corresponding amino acids may be made to achieve similar effects.
  • In some embodiments, an enzyme coding sequence encoding a CRISPR enzyme is codon optimized for expression in particular cells, such as eukaryotic cells. The eukaryotic cells may be those of or derived from a particular organism, such as a mammal, including but not limited to human, mouse, rat, rabbit, dog, or non-human primate. In general, codon optimization refers to a process of modifying a nucleic acid sequence for enhanced expression in the host cells of interest by replacing at least one codon (e.g. about or more than about 1, 2, 3, 4, 5, 10, 15, 20, 25, 50, or more codons) of the native sequence with codons that are more frequently or most frequently used in the genes of that host cell while maintaining the native amino acid sequence. Various species exhibit particular bias for certain codons of a particular amino acid. Codon bias (differences in codon usage between organisms) often correlates with the efficiency of translation of messenger RNA (mRNA), which is in turn believed to be dependent on, among other things, the properties of the codons being translated and the availability of particular transfer RNA (tRNA) molecules. The predominance of selected tRNAs in a cell is generally a reflection of the codons used most frequently in peptide synthesis. Accordingly, genes can be tailored for optimal gene expression in a given organism based on codon optimization. Codon usage tables are readily available, for example, at the “Codon Usage Database”, and these tables can be adapted in a number of ways. See Nakamura, Y., et al. “Codon usage tabulated from the international DNA sequence databases: status for the year 2000” Nucl. Acids Res. 28:292 (2000). Computer algorithms for codon optimizing a particular sequence for expression in a particular host cell are also available, such as Gene Forge (Aptagen; Jacobus, Pa.), are also available. In some embodiments, one or more codons (e.g. 1, 2, 3, 4, 5, 10, 15, 20, 25, 50, or more, or all codons) in a sequence encoding a CRISPR enzyme correspond to the most frequently used codon for a particular amino acid.
  • In general, a guide sequence is any polynucleotide sequence having sufficient complementarity with a target polynucleotide sequence to hybridize with the target sequence and direct sequence-specific binding of a CRISPR complex to the target sequence. In some embodiments, the degree of complementarity between a guide sequence and its corresponding target sequence, when optimally aligned using a suitable alignment algorithm, is about or more than about 50%, 60%, 75%, 80%, 85%, 90%, 95%, 97.5%, 99%, or more. Optimal alignment may be determined with the use of any suitable algorithm for aligning sequences, non-limiting example of which include the Smith-Waterman algorithm, the Needleman-Wunsch algorithm, algorithms based on the Burrows-Wheeler Transform (e.g. the Burrows Wheeler Aligner), ClustalW, Clustal X, BLAT, Novoalign (Novocraft Technologies, ELAND (Illumina, San Diego, Calif.), SOAP (available at soap.genomics.org.cn), and Maq (available at maq.sourceforge.net). In some embodiments, a guide sequence is about or more than about 5, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 35, 40, 45, 50, 75, or more nucleotides in length. In some embodiments, a guide sequence is less than about 75, 50, 45, 40, 35, 30, 25, 20, 15, 12, or fewer nucleotides in length. The ability of a guide sequence to direct sequence-specific binding of a CRISPR complex to a target sequence may be assessed by any suitable assay. For example, the components of a CRISPR system sufficient to form a CRISPR complex, including the guide sequence to be tested, may be provided to a host cell having the corresponding target sequence, such as by transfection with vectors encoding the components of the CRISPR sequence, followed by an assessment of preferential cleavage within the target sequence, such as by Surveyor assay as described herein. Similarly, cleavage of a target polynucleotide sequence may be evaluated in a test tube by providing the target sequence, components of a CRISPR complex, including the guide sequence to be tested and a control guide sequence different from the test guide sequence, and comparing binding or rate of cleavage at the target sequence between the test and control guide sequence reactions. Other assays are possible, and will occur to those skilled in the art.
  • A guide sequence may be selected to target any target sequence. In some embodiments, the target sequence is a sequence within a genome of a cell. Exemplary target sequences include those that are unique in the target genome. For example, for the S. pyogenes Cas9, a unique target sequence in a genome may include a Cas9 target site of the form MMMMMMMMNNNNNNNNNNNNXGG where NNNNNNNNNNNNXGG (N is A, G, T, or C; and X can be anything) has a single occurrence in the genome. A unique target sequence in a genome may include an S. pyogenes Cas9 target site of the form MMMMMMMMMNNNNNNNNNNNXGG where NNNNNNNNNNNXGG (N is A, G, T, or C; and X can be anything) has a single occurrence in the genome. For the S. thermophilus CRISPR1 Cas9, a unique target sequence in a genome may include a Cas9 target site of the form MMMMMMMMNNNNNNNNNNNNXXAGAAW (SEQ ID NO: 1) where NNNNNNNNNNNNXXAGAAW (SEQ ID NO: 2) (N is A, G, T, or C; X can be anything; and W is A or T) has a single occurrence in the genome. A unique target sequence in a genome may include an S. thermophilus CRISPR1 Cas9 target site of the form MMMMMMMMMNNNNNNNNNNNXXAGAAW (SEQ ID NO: 3) where NNNNNNNNNNNXXAGAAW (SEQ ID NO: 4) (N is A, G, T, or C; X can be anything; and W is A or T) has a single occurrence in the genome. For the S. pyogenes Cas9, a unique target sequence in a genome may include a Cas9 target site of the form MMMMMMMMNNNNNNNNNNNNXGGXG where NNNNNNNNNNNNXGGXG (N is A, G, T, or C; and X can be anything) has a single occurrence in the genome. A unique target sequence in a genome may include an S. pyogenes Cas9 target site of the form MMMMMMMMMNNNNNNNNNNNXGGXG where NNNNNNNNNNNXGGXG (N is A, G, T, or C; and X can be anything) has a single occurrence in the genome. In each of these sequences “M” may be A, G, T, or C, and need not be considered in identifying a sequence as unique.
  • In some embodiments, a guide sequence is selected to reduce the degree of secondary structure within the guide sequence. Secondary structure may be determined by any suitable polynucleotide folding algorithm. Some programs are based on calculating the minimal Gibbs free energy. An example of one such algorithm is mFold, as described by Zuker and Stiegler (Nucleic Acids Res. 9 (1981), 133-148). Another example folding algorithm is the online webserver RNAfold, developed at Institute for Theoretical Chemistry at the University of Vienna, using the centroid structure prediction algorithm (see e.g. A. R. Gruber et al., 2008, Cell 106(1): 23-24; and P A Carr and G M Church, 2009, Nature Biotechnology 27(12): 1151-62). Further algorithms may be found in U.S. application Ser. No. 61/836,080 (attorney docket 44790.11.2022; Broad Reference BI-2013/004A); incorporated herein by reference.
  • In general, a tracr mate sequence includes any sequence that has sufficient complementarity with a tracr sequence to promote one or more of: (1) excision of a guide sequence flanked by tracr mate sequences in a cell containing the corresponding tracr sequence; and (2) formation of a CRISPR complex at a target sequence, wherein the CRISPR complex comprises the tracr mate sequence hybridized to the tracr sequence. In general, degree of complementarity is with reference to the optimal alignment of the tracr mate sequence and tracr sequence, along the length of the shorter of the two sequences. Optimal alignment may be determined by any suitable alignment algorithm, and may further account for secondary structures, such as self-complementarity within either the tracr sequence or tracr mate sequence. In some embodiments, the degree of complementarity between the tracr sequence and tracr mate sequence along the length of the shorter of the two when optimally aligned is about or more than about 25%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 97.5%, 99%, or higher. Example illustrations of optimal alignment between a tracr sequence and a tracr mate sequence are provided in FIGS. 10B and 11B. In some embodiments, the tracr sequence is about or more than about 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 40, 50, or more nucleotides in length. In some embodiments, the tracr sequence and tracr mate sequence are contained within a single transcript, such that hybridization between the two produces a transcript having a secondary structure, such as a hairpin. Preferred loop forming sequences for use in hairpin structures are four nucleotides in length, and most preferably have the sequence GAAA. However, longer or shorter loop sequences may be used, as may alternative sequences. The sequences preferably include a nucleotide triplet (for example, AAA), and an additional nucleotide (for example C or G). Examples of loop forming sequences include CAAA and AAAG. In an embodiment of the invention, the transcript or transcribed polynucleotide sequence has at least two or more hairpins. In preferred embodiments, the transcript has two, three, four or five hairpins. In a further embodiment of the invention, the transcript has at most five hairpins. In some embodiments, the single transcript further includes a transcription termination sequence; preferably this is a polyT sequence, for example six T nucleotides. An example illustration of such a hairpin structure is provided in the lower portion of FIG. 11B, where the portion of the sequence 5′ of the final “N” and upstream of the loop corresponds to the tracr mate sequence, and the portion of the sequence 3′ of the loop corresponds to the tracr sequence. Further non-limiting examples of single polynucleotides comprising a guide sequence, a tracr mate sequence, and a tracr sequence are as follows (listed 5′ to 3′), where “N” represents a base of a guide sequence, the first block of lower case letters represent the tracr mate sequence, and the second block of lower case letters represent the tracr sequence, and the final poly-T sequence represents the transcription terminator: (1) NNNNNNNNNNNNNNNNNNNNgtttttgtactctcaagatttaGAAAtaaatcttgcagaagctacaaagataaggctt catgccgaaatcaacaccctgtcattttatggcagggtgttttcgttatttaaTTTTTT (SEQ ID NO: 5); (2) NNNNNNNNNNNNNNNNNNNNgtttttgtactctcaGAAAtgcagaagctacaaagataaggcttcatgccgaaatca acaccctgtcattttatggcagggtgttttcgttatttaaTTTTTT (SEQ ID NO: 6); (3) NNNNNNNNNNNNNNNNNNNgtttttgtactctcaGAAAtgcagaagctacaaagataaggcttcatgccgaaatca acaccctgtcattttatggcagggtgtTTTTTT (SEQ ID NO: 7); (4) NNNNNNNNNNNNNNNNNNNNgtttttagagctaGAAAtagcaagttaaaataaggctagtccgttatcaacttgaaaa agtggcaccgagtcggtgcTTTTTT (SEQ ID NO: 8); (5) NNNNNNNNNNNNNNNNNNNgttttagagctaGAAATAGcaagttaaaataaggctagtccgttatcaacttgaa aaagtgTTTTTT (SEQ ID NO: 9); and (6) NNNNNNNNNNNNNNNNNNNNgttttagagctagAAATAGcaagttaaaataaggctagtccgttatcaTTTTT TTT (SEQ ID NO: 10). In some embodiments, sequences (1) to (3) are used in combination with Cas9 from S. thermophilus CRISPR1. In some embodiments, sequences (4) to (6) are used in combination with Cas9 from S. pyogenes. In some embodiments, the tracr sequence is a separate transcript from a transcript comprising the tracr mate sequence (such as illustrated in the top portion of FIG. 11B).
  • In some embodiments, the CRISPR enzyme is part of a fusion protein comprising one or more heterologous protein domains (e.g. about or more than about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more domains in addition to the CRISPR enzyme). A CRISPR enzyme fusion protein may comprise any additional protein sequence, and optionally a linker sequence between any two domains. Examples of protein domains that may be fused to a CRISPR enzyme include, without limitation, epitope tags, reporter gene sequences, and protein domains having one or more of the following activities: methylase activity, demethylase activity, transcription activation activity, transcription repression activity, transcription release factor activity, histone modification activity, RNA cleavage activity and nucleic acid binding activity. Non-limiting examples of epitope tags include histidine (His) tags, V5 tags, FLAG tags, influenza hemagglutinin (HA) tags, Myc tags, VSV-G tags, and thioredoxin (Trx) tags. Examples of reporter genes include, but are not limited to, glutathione-S-transferase (GST), horseradish peroxidase (HRP), chloramphenicol acetyltransferase (CAT) beta-galactosidase, beta-glucuronidase, luciferase, green fluorescent protein (GFP), HcRed, DsRed, cyan fluorescent protein (CFP), yellow fluorescent protein (YFP), and autofluorescent proteins including blue fluorescent protein (BFP). A CRISPR enzyme may be fused to a gene sequence encoding a protein or a fragment of a protein that bind DNA molecules or bind other cellular molecules, including but not limited to maltose binding protein (MBP), S-tag, Lex A DNA binding domain (DBD) fusions, GAL4A DNA binding domain fusions, and herpes simplex virus (HSV) BP16 protein fusions. Additional domains that may form part of a fusion protein comprising a CRISPR enzyme are described in US20110059502, incorporated herein by reference. In some embodiments, a tagged CRISPR enzyme is used to identify the location of a target sequence.
  • In an aspect of the invention, a reporter gene which includes but is not limited to glutathione-S-transferase (GST), horseradish peroxidase (HRP), chloramphenicol acetyltransferase (CAT) beta-galactosidase, beta-glucuronidase, luciferase, green fluorescent protein (GFP), HcRed, DsRed, cyan fluorescent protein (CFP), yellow fluorescent protein (YFP), and autofluorescent proteins including blue fluorescent protein (BFP), may be introduced into a cell to encode a gene product which serves as a marker by which to measure the alteration or modification of expression of the gene product. In a further embodiment of the invention, the DNA molecule encoding the gene product may be introduced into the cell via a vector. In a preferred embodiment of the invention the gene product is luciferase. In a further embodiment of the invention the expression of the gene product is decreased.
  • In some aspects, the invention provides methods comprising delivering one or more polynucleotides, such as or one or more vectors as described herein, one or more transcripts thereof, and/or one or proteins transcribed therefrom, to a host cell. In some aspects, the invention further provides cells produced by such methods, and organisms (such as animals, plants, or fungi) comprising or produced from such cells. In some embodiments, a CRISPR enzyme in combination with (and optionally complexed with) a guide sequence is delivered to a cell. Conventional viral and non-viral based gene transfer methods can be used to introduce nucleic acids in mammalian cells or target tissues. Such methods can be used to administer nucleic acids encoding components of a CRISPR system to cells in culture, or in a host organism. Non-viral vector delivery systems include DNA plasmids, RNA (e.g. a transcript of a vector described herein), naked nucleic acid, and nucleic acid complexed with a delivery vehicle, such as a liposome. Viral vector delivery systems include DNA and RNA viruses, which have either episomal or integrated genomes after delivery to the cell. For a review of gene therapy procedures, see Anderson, Science 256:808-813 (1992); Nabel & Felgner, TIBTECH 11:211-217 (1993); Mitani & Caskey, TIBTECH 11:162-166 (1993); Dillon. TIBTECH 11:167-175 (1993); Miller, Nature 357:455-460 (1992); Van Brunt, Biotechnology 6(10): 1149-1154 (1988); Vigne, Restorative Neurology and Neuroscience 8:35-36 (1995); Kremer & Perricaudet, British Medical Bulletin 51(1):31-44 (1995); Haddada et al., in Current Topics in Microbiology and Immunology Doerfler and Böhm (eds) (1995); and Yu et al., Gene Therapy 1:13-26 (1994).
  • Methods of non-viral delivery of nucleic acids include lipofection, nucleofection, microinjection, biolistics, virosomes, liposomes, immunoliposomes, polycation or lipid:nucleic acid conjugates, naked DNA, artificial virions, and agent-enhanced uptake of DNA. Lipofection is described in e.g., U.S. Pat. Nos. 5,049,386, 4,946,787; and 4,897,355) and lipofection reagents are sold commercially (e.g., Transfectam™ and Lipofectin™). Cationic and neutral lipids that are suitable for efficient receptor-recognition lipofection of polynucleotides include those of Felgner, WO 91/17424; WO 91/16024. Delivery can be to cells (e.g. in vitro or ex vivo administration) or target tissues (e.g. in vivo administration).
  • The preparation of lipid:nucleic acid complexes, including targeted liposomes such as immunolipid complexes, is well known to one of skill in the art (see, e.g., Crystal, Science 270:404-410 (1995); Blaese et al., Cancer Gene Ther. 2:291-297 (1995); Behr et al., Bioconjugate Chem. 5:382-389 (1994); Remy et al., Bioconjugate Chem. 5:647-654 (1994); Gao et al., Gene Therapy 2:710-722 (1995); Ahmad et al., Cancer Res. 52:4817-4820 (1992); U.S. Pat. Nos. 4,186,183, 4,217,344, 4,235,871, 4,261,975, 4,485,054, 4,501,728, 4,774,085, 4,837,028, and 4,946,787).
  • The use of RNA or DNA viral based systems for the delivery of nucleic acids take advantage of highly evolved processes for targeting a virus to specific cells in the body and trafficking the viral payload to the nucleus. Viral vectors can be administered directly to patients (in vivo) or they can be used to treat cells in vitro, and the modified cells may optionally be administered to patients (ex vivo). Conventional viral based systems could include retroviral, lentivirus, adenoviral, adeno-associated and herpes simplex virus vectors for gene transfer. Integration in the host genome is possible with the retrovirus, lentivirus, and adeno-associated virus gene transfer methods, often resulting in long term expression of the inserted transgene. Additionally, high transduction efficiencies have been observed in many different cell types and target tissues.
  • The tropism of a retrovirus can be altered by incorporating foreign envelope proteins, expanding the potential target population of target cells. Lentiviral vectors are retroviral vectors that are able to transduce or infect non-dividing cells and typically produce high viral titers. Selection of a retroviral gene transfer system would therefore depend on the target tissue. Retroviral vectors are comprised of cis-acting long terminal repeats with packaging capacity for up to 6-10 kb of foreign sequence. The minimum cis-acting LTRs are sufficient for replication and packaging of the vectors, which are then used to integrate the therapeutic gene into the target cell to provide permanent transgene expression. Widely used retroviral vectors include those based upon murine leukemia virus (MuLV), gibbon ape leukemia virus (GaLV), Simian Immuno deficiency virus (SIV), human immuno deficiency virus (HIV), and combinations thereof (see, e.g., Buchscher et al., J. Virol. 66:2731-2739 (1992); Johann et al., J. Virol. 66:1635-1640 (1992); Sommnerfelt et al., Virol. 176:58-59 (1990); Wilson et al., J. Virol. 63:2374-2378 (1989); Miller et al., J. Virol. 65:2220-2224 (1991); PCT/US94/05700). In applications where transient expression is preferred, adenoviral based systems may be used. Adenoviral based vectors are capable of very high transduction efficiency in many cell types and do not require cell division. With such vectors, high titer and levels of expression have been obtained. This vector can be produced in large quantities in a relatively simple system. Adeno-associated virus (“AAV”) vectors may also be used to transduce cells with target nucleic acids, e.g., in the in vitro production of nucleic acids and peptides, and for in vivo and ex vivo gene therapy procedures (see, e.g., West et al., Virology 160:38-47 (1987); U.S. Pat. No. 4,797,368; WO 93/24641; Kotin, Human Gene Therapy 5:793-801 (1994); Muzyczka, J. Clin. Invest. 94:1351 (1994). Construction of recombinant AAV vectors are described in a number of publications, including U.S. Pat. No. 5,173,414; Tratschin et al., Mol. Cell. Biol. 5:3251-3260 (1985); Tratschin, et al., Mol. Cell. Biol. 4:2072-2081 (1984); Hermonat & Muzyczka, PNAS 81:6466-6470 (1984); and Samulski et al., J. Virol. 63:03822-3828 (1989).
  • Packaging cells are typically used to form virus particles that are capable of infecting a host cell. Such cells include 293 cells, which package adenovirus, and ψ2 cells or PA317 cells, which package retrovirus. Viral vectors used in gene therapy are usually generated by producing a cell line that packages a nucleic acid vector into a viral particle. The vectors typically contain the minimal viral sequences required for packaging and subsequent integration into a host, other viral sequences being replaced by an expression cassette for the polynucleotide(s) to be expressed. The missing viral functions are typically supplied in trans by the packaging cell line. For example, AAV vectors used in gene therapy typically only possess ITR sequences from the AAV genome which are required for packaging and integration into the host genome. Viral DNA is packaged in a cell line, which contains a helper plasmid encoding the other AAV genes, namely rep and cap, but lacking ITR sequences. The cell line may also be infected with adenovirus as a helper. The helper virus promotes replication of the AAV vector and expression of AAV genes from the helper plasmid. The helper plasmid is not packaged in significant amounts due to a lack of ITR sequences. Contamination with adenovirus can be reduced by, e.g., heat treatment to which adenovirus is more sensitive than AAV. Additional methods for the delivery of nucleic acids to cells are known to those skilled in the art. See, for example, US20030087817, incorporated herein by reference.
  • In some embodiments, a host cell is transiently or non-transiently transfected with one or more vectors described herein. In some embodiments, a cell is transfected as it naturally occurs in a subject. In some embodiments, a cell that is transfected is taken from a subject. In some embodiments, the cell is derived from cells taken from a subject, such as a cell line. A wide variety of cell lines for tissue culture are known in the art. Examples of cell lines include, but are not limited to, C8161, CCRF-CEM, MOLT, mIMCD-3, NHDF, HeLa-S3, Huh1, Huh4, Huh7, HUVEC, HASMC, HEKn, HEKa, MiaPaCell, Panc1, PC-3, TF1, CTLL-2, C1R, Rat6, CV1, RPTE, A10, T24, J82, A375, ARH-77, Calu1, SW480, SW620, SKOV3, SK-UT, CaCo2, P388D1, SEM-K2, WEHI-231, HB56, TIB55, Jurkat, J45.01, LRMB, Bcl-1, BC-3, IC21, DLD2, Raw264.7, NRK, NRK-52E, MRC5, MEF, Hep G2, HeLa B, HeLa T4, COS, COS-1, COS-6, COS-M6A, BS-C-1 monkey kidney epithelial, BALB/3T3 mouse embryo fibroblast, 3T3 Swiss, 3T3-L1, 132-d5 human fetal fibroblasts; 10.1 mouse fibroblasts, 293-T, 3T3, 721, 9L, A2780, A2780ADR, A2780cis, A172, A20, A253, A431, A-549, ALC, B16, B35, BCP-1 cells, BEAS-2B, bEnd.3, BHK-21, BR 293, BxPC3, C3H-10T1/2, C6/36, Cal-27, CHO, CHO-7, CHO-IR, CHO-K1, CHO-K2, CHO-T, CHO Dhfr −/−, COR-L23, COR-L23/CPR, COR-L235010, COR-L23/R23, COS-7, COV-434, CML T1, CMT, CT26, D17, DH82, DU145, DuCaP, EL4, EM2, EM3, EMT6/AR1, EMT6/AR10.0, FM3, H1299, H69, HB54, HB55, HCA2, HEK-293, HeLa, Hepa1c1c7, HL-60, HMEC, HT-29, Jurkat, JY cells, K562 cells, Ku812, KCL22, KG1, KYO1, LNCap, Ma-Mel 1-48, MC-38, MCF-7, MCF-10A, MDA-MB-231, MDA-MB-468, MDA-MB-435, MDCK II, MDCK II, MOR/0.2R, MONO-MAC 6, MTD-1A, MyEnd, NCI-H69/CPR, NCI-H69/LX10, NCI-H69/LX20, NCI-H69/LX4, NIH-3T3, NALM-1, NW-145, OPCN/OPCT cell lines, Peer, PNT-1A/PNT 2, RenCa, RIN-5F, RMA/RMAS, Saos-2 cells, Sf-9, SkBr3, T2, T-47D, T84, THP1 cell line, U373, U87, U937, VCaP, Vero cells, WM39, WT-49, X63, YAC-1, YAR, and transgenic varieties thereof. Cell lines are available from a variety of sources known to those with skill in the art (see, e.g., the American Type Culture Collection (ATCC) (Manassas, Va.)). In some embodiments, a cell transfected with one or more vectors described herein is used to establish a new cell line comprising one or more vector-derived sequences. In some embodiments, a cell transiently transfected with the components of a CRISPR system as described herein (such as by transient transfection of one or more vectors, or transfection with RNA), and modified through the activity of a CRISPR complex, is used to establish a new cell line comprising cells containing the modification but lacking any other exogenous sequence. In some embodiments, cells transiently or non-transiently transfected with one or more vectors described herein, or cell lines derived from such cells are used in assessing one or more test compounds.
  • In some embodiments, one or more vectors described herein are used to produce a non-human transgenic animal or transgenic plant. In some embodiments, the transgenic animal is a mammal, such as a mouse, rat, or rabbit. In certain embodiments, the organism or subject is a plant. In certain embodiments, the organism or subject or plant is algae. Methods for producing transgenic plants and animals are known in the art, and generally begin with a method of cell transfection, such as described herein. Transgenic animals are also provided, as are transgenic plants, especially crops and algae. The transgenic animal or plant may be useful in applications outside of providing a disease model. These may include food or feed production through expression of, for instance, higher protein, carbohydrate, nutrient or vitamins levels than would normally be seen in the wildtype. In this regard, transgenic plants, especially pulses and tubers, and animals, especially mammals such as livestock (cows, sheep, goats and pigs), but also poultry and edible insects, are preferred.
  • Transgenic algae or other plants such as rape may be particularly useful in the production of vegetable oils or biofuels such as alcohols (especially methanol and ethanol), for instance. These may be engineered to express or overexpress high levels of oil or alcohols for use in the oil or biofuel industries.
  • In one aspect, the invention provides for methods of modifying a target polynucleotide in a eukaryotic cell, which may be in vivo, ex vivo or in vitro. In some embodiments, the method comprises sampling a cell or population of cells from a human or non-human animal or plant (including micro-algae), and modifying the cell or cells. Culturing may occur at any stage ex vivo. The cell or cells may even be re-introduced into the non-human animal or plant (including micro-algae).
  • In one aspect, the invention provides for methods of modifying a target polynucleotide in a eukaryotic cell. In some embodiments, the method comprises allowing a CRISPR complex to bind to the target polynucleotide to effect cleavage of said target polynucleotide thereby modifying the target polynucleotide, wherein the CRISPR complex comprises a CRISPR enzyme complexed with a guide sequence hybridized to a target sequence within said target polynucleotide, wherein said guide sequence is linked to a tracr mate sequence which in turn hybridizes to a tracr sequence.
  • In one aspect, the invention provides a method of modifying expression of a polynucleotide in a eukaryotic cell. In some embodiments, the method comprises allowing a CRISPR complex to bind to the polynucleotide such that said binding results in increased or decreased expression of said polynucleotide; wherein the CRISPR complex comprises a CRISPR enzyme complexed with a guide sequence hybridized to a target sequence within said polynucleotide, wherein said guide sequence is linked to a tracr mate sequence which in turn hybridizes to a tracr sequence.
  • With recent advances in crop genomics, the ability to use CRISPR-Cas systems to perform efficient and cost effective gene editing and manipulation will allow the rapid selection and comparison of single and multiplexed genetic manipulations to transform such genomes for improved production and enhanced traits. In this regard reference is made to US patents and publications: U.S. Pat. No. 6,603,061—Agrobacterium-Mediated Plant Transformation Method; U.S. Pat. No. 7,868,149—Plant Genome Sequences and Uses Thereof and US 2009/0100536—Transgenic Plants with Enhanced Agronomic Traits, all the contents and disclosure of each of which are herein incorporated by reference in their entirety. In the practice of the invention, the contents and disclosure of Morrell et al “Crop genomics:advances and applications” Nat Rev Genet. 2011 Dec. 29; 13(2):85-96 are also herein incorporated by reference in their entirety.
  • In plants, pathogens are often host-specific. For example, Fusarium oxysporum f. sp. lycopersici causes tomato wilt but attacks only tomato, and F. oxysporum f. dianthii Puccinia graminis f. sp. tritici attacks only wheat. Plants have existing and induced defenses to resist most pathogens. Mutations and recombination events across plant generations lead to genetic variability that gives rise to susceptibility, especially as pathogens reproduce with more frequency than plants. In plants there can be non-host resistance, e.g., the host and pathogen are incompatible. There can also be Horizontal Resistance, e.g., partial resistance against all races of a pathogen, typically controlled by many genes and Vertical Resistance, e.g., complete resistance to some races of a pathogen but not to other races, typically controlled by a few genes. In a Gene-for-Gene level, plants and pathogens evolve together, and the genetic changes in one balance changes in other. Accordingly, using Natural Variability, breeders combine most useful genes for Yield, Quality, Uniformity, Hardiness, Resistance. The sources of resistance genes include native or foreign Varieties, Heirloom Varieties, Wild Plant Relatives, and Induced Mutations, e.g., treating plant material with mutagenic agents. Using the present invention, plant breeders are provided with a new tool to induce mutations. Accordingly, one skilled in the art can analyze the genome of sources of resistance genes, and in Varieties having desired characteristics or traits employ the present invention to induce the rise of resistance genes, with more precision than previous mutagenic agents and hence accelerate and improve plant breeding programs.
  • In one aspect, the invention provides kits containing any one or more of the elements disclosed in the above methods and compositions. In some embodiments, the kit comprises a vector system and instructions for using the kit. In some embodiments, the vector system comprises (a) a first regulatory element operably linked to a tracr mate sequence and one or more insertion sites for inserting a guide sequence upstream of the tracr mate sequence, wherein when expressed, the guide sequence directs sequence-specific binding of a CRISPR complex to a target sequence in a eukaryotic cell, wherein the CRISPR complex comprises a CRISPR enzyme complexed with (1) the guide sequence that is hybridized to the target sequence, and (2) the tracr mate sequence that is hybridized to the tracr sequence; and/or (b) a second regulatory element operably linked to an enzyme-coding sequence encoding said CRISPR enzyme comprising a nuclear localization sequence. Elements may be provided individually or in combinations, and may be provided in any suitable container, such as a vial, a bottle, or a tube. In some embodiments, the kit includes instructions in one or more languages, for example in more than one language.
  • In some embodiments, a kit comprises one or more reagents for use in a process utilizing one or more of the elements described herein. Reagents may be provided in any suitable container. For example, a kit may provide one or more reaction or storage buffers. Reagents may be provided in a form that is usable in a particular assay, or in a form that requires addition of one or more other components before use (e.g. in concentrate or lyophilized form). A buffer can be any buffer, including but not limited to a sodium carbonate buffer, a sodium bicarbonate buffer, a borate buffer, a Tris buffer, a MOPS buffer, a HEPES buffer, and combinations thereof. In some embodiments, the buffer is alkaline. In some embodiments, the buffer has a pH from about 7 to about 10. In some embodiments, the kit comprises one or more oligonucleotides corresponding to a guide sequence for insertion into a vector so as to operably link the guide sequence and a regulatory element. In some embodiments, the kit comprises a homologous recombination template polynucleotide.
  • In one aspect, the invention provides methods for using one or more elements of a CRISPR system. The CRISPR complex of the invention provides an effective means for modifying a target polynucleotide. The CRISPR complex of the invention has a wide variety of utility including modifying (e.g., deleting, inserting, translocating, inactivating, activating) a target polynucleotide in a multiplicity of cell types. As such the CRISPR complex of the invention has a broad spectrum of applications in, e.g., gene therapy, drug screening, disease diagnosis, and prognosis. An exemplary CRISPR complex comprises a CRISPR enzyme complexed with a guide sequence hybridized to a target sequence within the target polynucleotide. The guide sequence is linked to a tracr mate sequence, which in turn hybridizes to a tracr sequence.
  • The target polynucleotide of a CRISPR complex can be any polynucleotide endogenous or exogenous to the eukaryotic cell. For example, the target polynucleotide can be a polynucleotide residing in the nucleus of the eukaryotic cell. The target polynucleotide can be a sequence coding a gene product (e.g., a protein) or a non-coding sequence (e.g., a regulatory polynucleotide or a junk DNA). Without wishing to be bound by theory, it is believed that the target sequence should be associated with a PAM (protospacer adjacent motif); that is, a short sequence recognized by the CRISPR complex. The precise sequence and length requirements for the PAM differ depending on the CRISPR enzyme used, but PAMs are typically 2-5 base pair sequences adjacent the protospacer (that is, the target sequence) Examples of PAM sequences are given in the examples section below, and the skilled person will be able to identify further PAM sequences for use with a given CRISPR enzyme.
  • The target polynucleotide of a CRISPR complex may include a number of disease-associated genes and polynucleotides as well as signaling biochemical pathway-associated genes and polynucleotides as listed in U.S. provisional patent applications 61/736,527 and 61/748,427 having Broad reference BI-2011/008/WSGR Docket No. 44063-701.101 and BI-2011/008/WSGR Docket No. 44063-701.102 respectively, both entitled SYSTEMS METHODS AND COMPOSITIONS FOR SEQUENCE MANIPULATION filed on Dec. 12, 2012 and Jan. 2, 2013, respectively, the contents of all of which are herein incorporated by reference in their entirety.
  • Examples of target polynucleotides include a sequence associated with a signaling biochemical pathway, e.g., a signaling biochemical pathway-associated gene or polynucleotide. Examples of target polynucleotides include a disease associated gene or polynucleotide. A “disease-associated” gene or polynucleotide refers to any gene or polynucleotide which is yielding transcription or translation products at an abnormal level or in an abnormal form in cells derived from a disease-affected tissues compared with tissues or cells of a non disease control. It may be a gene that becomes expressed at an abnormally high level; it may be a gene that becomes expressed at an abnormally low level, where the altered expression correlates with the occurrence and/or progression of the disease. A disease-associated gene also refers to a gene possessing mutation(s) or genetic variation that is directly responsible or is in linkage disequilibrium with a gene(s) that is responsible for the etiology of a disease. The transcribed or translated products may be known or unknown, and may be at a normal or abnormal level.
  • Examples of disease-associated genes and polynucleotides are available from McKusick-Nathans Institute of Genetic Medicine, Johns Hopkins University (Baltimore, Md.) and National Center for Biotechnology Information, National Library of Medicine (Bethesda, Md.), available on the World Wide Web.
  • Examples of disease-associated genes and polynucleotides are listed in Tables A and B. Disease specific information is available from McKusick-Nathans Institute of Genetic Medicine, Johns Hopkins University (Baltimore, Md.) and National Center for Biotechnology Information, National Library of Medicine (Bethesda, Md.), available on the World Wide Web. Examples of signaling biochemical pathway-associated genes and polynucleotides are listed in Table C.
  • Mutations in these genes and pathways can result in production of improper proteins or proteins in improper amounts which affect function. Further examples of genes, diseases and proteins are hereby incorporated by reference from US Provisional application. Such genes, proteins and pathways may be the target polynucleotide of a CRISPR complex.
  • TABLE A
    DISEASE/DISORDERS GENE(S)
    Neoplasia PTEN; ATM; ATR; EGFR; ERBB2; ERBB3; ERBB4;
    Notch1; Notch2; Notch3; Notch4; AKT; AKT2; AKT3; HIF;
    HIF1a; HIF3a; Met; HRG; Bcl2; PPAR alpha; PPAR
    gamma; WTI (Wilms Tumor); FGF Receptor Family
    members (5 members: 1, 2, 3, 4, 5); CDKN2a; APC; RB
    (retinoblastoma); MEN1; VHL; BRCA1; BRCA2; AR
    (Androgen Receptor); TSG101; IGF; IGF Receptor; Igf1 (4
    variants); Igf2 (3 variants); Igf 1 Receptor; Igf 2 Receptor;
    Bax; Bcl2; caspases family (9 members:
    1, 2, 3, 4, 6, 7, 8, 9, 12); Kras; Ape
    Age-related Macular Aber; Ccl2; Cc2; cp (ceruloplasmin); Timp3; eathepsinD;
    Degeneration Vldlr; Ccr2
    Schizophrenia Neuregulin1 (Nrg1); Erb4 (receptor for Neuregulin);
    Complexin1 (Cplx1); Tph1 Tryptophan hydroxylase; Tph2
    Tryptophan hydroxylase 2; Neurexin 1; GSK3; GSK3a;
    GSK3b
    Disorders 5-HTT (Slc6a4); COMT; DRD (Drd1a); SLC6A3; DAOA;
    DTNBP1; Dao (Dao1)
    Trinucleotide Repeat HTT (Huntington's Dx); SBMA/SMAX1/AR (Kennedy's
    Disorders Dx); FXN/X25 (Friedrich's Ataxia); ATX3 (Machado-
    Joseph's Dx); ATXN1 and ATXN2 (spinocerebellar
    ataxias); DMPK (myotonic dystrophy); Atrophin-1 and Atn1
    (DRPLA Dx); CBP (Creb-BP-global instability); VLDLR
    (Alzheimer's); Atxn7; Atxn10
    Fragile X Syndrome FMR2; FXR1; FXR2; mGLUR5
    Secretase Related. APH-1 (alpha and beta); Presenilin (Psen1); nicastrin
    Disorders Ncstn); PEN-2
    Others Nos1; Parp1; Nat1; Nat2
    Prion-related disorders Prp
    ALS SOD1; ALS2; STEX; FUS; TARDBP; VEGF (VEGF-a;
    VEGF-b; VEGF-c)
    Drug addiction Prkce (alcohol); Drd2; Drd4; ABAT (alcohol); GRIA2;
    Grm5; Grin1; Htr1b; Grin2a; Drd3; Pdyn; Gria1 (alcohol)
    Autism Mecp2; BZRAP1; MDGA2; Sema5A; Neurexin 1; Fragile X
    (FMR2 (AFF2); FXR1; FXR2; Mglur5)
    Alzheimer's Disease E1; CHIP; UCH; UBB; Tau; LRP; PICALM; Clusterin; PS1;
    SORL1; CR1; Vldlr; Uba1; Uba3; CHIP28 (Aqp1,
    Aquaporin 1); Uchl1; Uchl3; APP
    Inflammation IL-10; IL-1 (IL-1a; IL-1b); IL-13; IL-17 (IL-17a (CTLA8); IL-
    17b; IL-17c; IL-17d; IL-17f); II-23; Cx3cr1; ptpn22; TNFa;
    NOD2/CARD15 for IBD; IL-6; IL-12 (IL-12a; IL-12b);
    CTLA4; Cx3cl1
    Parkinson's Disease x-Synuelein; DJ-1; LRRK2; Parkin; PINK1
  • TABLE B
    Blood and Anemia (CDAN1, CDA1, RPS19, DBA, PKLR, PK1, NT5C3, UMPH1,
    coagulation diseases PSN1, RHAG, RH50A, NRAMP2, SPTB, ALAS2, ANH1, ASB,
    and disorders ABCB7, ABC7, ASAT); Bare lymphocyte syndrome (TAPBP, TPSN,
    TAP2, ABCB3, PSF2, RING11, MHC2TA, C2TA, RFX5, RFXAP,
    RFX5) Bleeding disorders (TBXA2R ,P2RX1, P2X1); Factor H and
    factor H-like 1 (HF1, CFH, HUS); Factor V and factor VIII (MCFD2);
    Factor VII deficiency (F7); Factor X deficiency (F10); Factor XI
    deficiency (F11); Factor XII deficiency (F12, HAF); Factor XIIIA
    deficiency (F13A1, F13A); Factor XIIIB deficiency (F13B); Fanconi
    anemia (FANCA, FACA, FA1, FA, FAA, FAAP95, FAAP90, FLJ34064,
    FANCB, FANCC, FACC, BRCA2, FANCDl, FANCD2, FANCD,
    FACD, FAD, FANCE, FACE, FANCF, XRCC9, FANCG, BRIP1,
    BACH1, FANCJ, PHF9, FANCL, FANCM, KIAA1596);
    Hemophagocytic lymphohistiocytosis disorders (PRF1, HPLH2,
    UNC13D, MUNC13-4, HPLH3, HLH3, FHL3); Hemophilia A (F8, F8C,
    HEMA); Hemophilia B (F9, HEMB), Hemorrhagic disorders (PI, ATT,
    F5); Leukocyde deficiencies and disorders (ITGB2, CD18, LCAMB,
    LAD, EIF2B1, EIF2BA, EIF2B2, EIF2B3, EIF2B5, LVWM, CACH,
    CLE, EIF2B4); Sickle cell anemia (HBB); Thalassemia (HBA2, HBB,
    HBD, LCRB, HBA1).
    Cell dysregulation B-cell non-Hodgkin lymphoma (BCL7A, BCL7); Leukemia (TAL1,
    and oncology TCL5, SCL, TAL2, FLT3, NBS1, NBS, ZNFN1A1, IK1, LYF1,
    diseases and disorders HOXD4, HOX4B, BCR, CML, PHL, ALL, ARNT, KRAS2, RASK2,
    GMPS, AF10, ARHGEF12, LARG, KIAA0382, CALM, CLTH,
    CEBPA, CEBP, CHIC2, BTL, FLT3, KIT, PBT, LPP, NPM1, NUP214,
    D9S46E, CAN, CAIN, RUNX1, CBFA2, AML1, WHSC1L1, NSD3,
    FLT3; AF1Q, NPM1, NUMA1, ZNF145, PLZF, PML, MYL, STAT5B,
    AF10, CALM, CLTH, ARL11, ARLTS1, P2RX7, P2X7, BCR, CML,
    PHL, ALL, GRAF, NF1, VRNF, WSS, NFNS, PTPN11, PTP2C, SHP2,
    NS1, BCL2, CCND1, PRAD1, BCL1, TCRA, GATA1, GF1, ERYF1,
    NFE1, ABL1, NQO1, DIA4, NMOR1, NUP214, D9S46E, CAN, CAIN).
    Inflammation and AIDS (KIR3DL1, NKAT3, NKB1, AMB11, KIR3DS1, IFNG, CXCL12,
    immune related SDF1); Autoimmune lymphoproliferative syndrome (TNFRSF6, APT1,
    diseases and disorders FAS, CD95, ALPS1A); Combined immunodeficiency, (IL2RG,
    SCIDX1, SCIDX, IMD4); HIV-1 (CCL5, SCYA5, D17S136E, TCP228),
    HIV susceptibility or infection (IL10, CSIF, CMKBR2, CCR2,
    CMKBR5, CCCKR5 (CCU)); Immunodeficiencies (CD3E, CD3G,
    AICDA, AID, HIGM2, TNFRSF5, CD40, UNG, DGU, HIGM4,
    TNFSF5, CD40LG, HIGM1, IGM, FOXP3, IPEX, AIID, XPID, PIDX,
    TNFRSF14B, TACI); Inflammation (IL-10, IL-1 (IL-1a, IL-1b), IL-13,
    IL-17 (IL-17a (CTLA8), IL-17b, IL-17c, IL-17d, IL-17F), II-23, Cx3cr1,
    ptpn22, TNFa, NOD2/CARD15 for IBD, IL-6, IL-12 (IL-12a, IL-12b),
    CTLA4, Cx3cl1); Severe combined immunodeficiencies (SCIDs)(JAK3,
    JAKL, DCLRE1C, ARTEMIS, SCIDA, RAG1, RAG2, ADA, PTPRC,
    CD45, LCA, IL7R, CD3D, T3D, IL2RG, SCIDM, SCIDX, IMD4).
    Metabolic, liver, Amyloid neuropathy (TTR, PALB); Amyloidosis (APOA1, APP, AAA,
    kidney and protein CVAP, AD1, GSN, FGA, LYZ, TTR, PALB); Cirrhosis (KRT18, KRT8,
    diseases and disorders CIRH1A, NAIC, TEX292, KIAA1988); Cystic fibrosis (CFTR, ABCC7,
    CF, MRP7); Glycogen storage diseases (SLC2A2, GLUT2, G6PC,
    G6PT, G6PT1, GAA, LAMP2, LAMPB, AGL, GDE, GBE1, GYS2,
    PYGL, PFKM); Hepatic adenoma, 142330 (TCF1, HNF1A, MODY3),
    Hepatic failure, early onset, and neurologic disorder (SCOD1, SCO1),
    Hepatic lipase deficiency (LIPC), Hepatoblastoma cancer and.
    carcinomas (CTNNB1, PDGFRL, PDGRL, PRLTS, AXIN1, AXIN,
    CTNNB1, TP53, P53, LFS1, IGF2R, MPR1, MET, CASP8, MCH5;
    Medullary cystic kidney disease (UMOD, HNFJ, FJHN, MCKD2,
    ADMCKD2); Phenylketonuria (PAH, PKU1, QDPR, DHPR, PTS);
    Polycystic kidney and hepatic disease (FCYT, PKU1, ARPKD, PKD1,
    PKD2, PKD4, PKDTS, PRKCSH, G19P1, PCLD, SEC63).
    Muscular/Skeletal Becker muscular dystrophy (DMD, BMD, MYF6), Duchenne Muscular
    diseases and disorders Dystrophy (DMD, BMD); Emery-Dreifuss muscular dystrophy (LMNA,
    LMN1, EMD2, FPLD, CMD1A, HGPS, LGMD1B, LMNA, LMN1,
    EMD2, FPLD, CMD1A); Facioscapulohumeral muscular dystrophy
    (FSHMa1A, FSHD1A); Muscular dystrophy (FKRP, MDC1C,
    LGMD2I, LAMA2, LAMM, LARGE, KIAA0609, MDC1D, FCMD,
    TTID, MYOT, CAPN3, CANP3, DYSF, LGMD2B, SGCG, LGMD2C,
    DMDA1, SCG3, SGCA, ADL, DAG2, LGMD2D, DMDA2, SGCB,
    LGMD2E, SGCD, SGD, LGMD2F, CMD1L, TCAP, LGMD2G,
    CMD1N, TRIM32, HT2A, LGMD2H, FKRP, MDC1C, LGMD2I, TTN,
    CMD1G, TMD, LGMD2J, POMT1, CAV3, LGMD1C, SEPN1, SELN,
    RSMD1, PLEC1, PLTN, EBS1); Osteopetrosis (LRP5, BMND1, LRP7,
    LR3, OPPG, VBCH2, CLCN7, CLC7, OPTA2, OSTM1, GL, TCIRG1,
    TIRC7, OC116, OPTB1); Muscular atrophy (VAPB, VAPC, ALS8,
    SMN1, SMA1, SMA2, SMA3, SMA4, BSCL2, SPG17, GARS, SMAD1,
    CMT2D, HEXB, IGHMBP2, SMUBP2, CATF1, SMARD1),
    Neurological and ALS (SOD1, ALS2, STEX, FUS, TARDBP, VEGF (VEGF-a, VEGF-b,
    neuronal diseases and VEGF-c); Alzheimer disease (APP, AAA, CVAP, AD1, APOE, AD2,
    disorders PSEN2, AD4, STM2, APBB2, FE65L1, NOS3, PLAU, URK, ACE,
    DCP1, ACE1, MPO, PACIP1, PAXIP1L, PTIP, A2M, BLMH, BMH,
    PSEN1, AD3); Autism (Mecp2, BZRAP1, MDGA2, Sema5A, Neurexin1
    GLO1, MECP2, RTT, PPMX, MRX16, MRX79, NLGN3, NLGN4,
    KIAA1260, AUTSX2); Fragile X Syndrome (FMR2, FXR1, FXR2,
    mGLUR5); Huntington's disease and disease like disorders (HD, IT15,
    PRNP, PRIP, JPH3, JP3, HDL2, TBP, SCA17); Parkinson disease
    (NR4A2, NURR1, NOT, TINUR, SNCAIP, TBP, SCA17, SNCA,
    NACP, PARK1, PARK4, DJ1, PARK7, LRRK2, PARK8, PINK1,
    PARK6, UCHL1, PARK5, SNCA, NACP, PARK1, PARK4, PRKN,
    PARK2, PDJ, DBH, NDUFV2); Rett syndrome (MECP2, RTT, PPMX,
    MRX16, MRX79, CDKL5, STK9, MECP2, RTT, PPMX, MRX16,
    MRX79, x-Synuclein, DJ-1); Schizophrenia (Neuregulin1 (Nrg1), Erb4
    (receptor for Neuregulin), Complexin1 (Cplx1), Tph1 Tryptophan
    hydroxylase, Tph2, Tryptophan hydroxylase 2, Neurexin 1, GSK3,
    GSK3a, GSK3b, 5-HTT (Slc6a4), COMT, DRD (Drd1a), SLC6A3,
    DAOA, DTNBP1, Dao (Dao1)); Secretase Related Disorders (APH-1
    (alpha and beta), Presenitin (Psen1), nicastrin, (Ncstn), PEN-2, Nos1,
    Parp1, Nat1, Nat2); Trinucleotide Repeat Disorders (HTT (Huntington's
    Dx), SBMA/SMAX1/AR (Kennedy's Dx), FXN/X25 (Friedrich's
    Ataxia), ATX3 (Machado-Joseph's Dx), ATXN1 and ATXN2
    (spinocerebellar ataxias), DMPK (myotonic dystrophy), Atrophin-1 and
    Atn1 (DRPLA Dx), CBP (Creb-BP-global instability), VLDLR
    (Alzheimer's), Atxn7, Atxn.10).
    Occular diseases and Age-related macular degeneration (Abcr, Ccl2, Cc2, cp (ceruloplasmin),
    disorders Timp3, cathepsinD, VIdlr, Ccr2); Cataract (CRYAA, CRYA1, CRYBB2,
    CRYB2, PITX3, BFSP2, CP49, CP47, CRYAA, CRYA1, PAX6, AN2,
    MGDA, CRYBA1, CRYB1, CRYGC, CRYG3, CCL, LIM2, MP19,
    CRYGD, CRYG4, BFSP2, CP49, CP47, HSF4, CTM, HST4, CTM,
    MIP, AQP0, CRYAB, CRYA2, CTPP2, CRYBB1, CRYGD, CRYG4,
    CRYBB2, CRYB2, CRYGC, CRYG3, CCL, CRYAA, CRYA1, GJA8,
    CX50, CAE1, GJA3, CX46, CZP3, CAE3, CCM1, CAM, KRIT1);
    Corneal clouding and dystrophy (APOA1, TGFBI, CSD2, CDGG1,
    CSD, BIGH3, CDG2, TACSTD2, TROP2, M1S1, VSX1, RINX, PPCD,
    PPD, KTCN, COL8A2, FECD, PPCD2, PIP5K3, CFD); Cornea plana
    congenital (KERA, CNA2); Glaucoma (MYOC, TIGR, GLC1A, JOAG,
    GPOA, OPTN, GLC1E, FIP2, HYPL, NRP, CYP1B1, GLC3A, OPA1,
    NTG, NPG, CYP1B1, GLC3A); Leber congenital amaurosis (CRB1,
    RP12, CRX, CORD2, CRD, RPGRIP1, LCA6, CORD9, RPE65, RP20,
    AIPL1, LCA4, GUCY2D, GUC2D, LCA1, CORD6, RDH12, LCA3);
    Macular dystrophy (ELOVL4, ADMD, STGD2, STGD3, RDS, RP7,
    PRPH2, PRPH, AVMD, AOFMD, VMD2).
    Epilepsy, myoclonic EPM2A, MELF, EPM2
    Lafora type, 254780
    Epilepsy, myoclonic, NHLRC1, EPM2A, EPM2B
    Lafora type, 254780
    Duchenne muscular DMD, BMD
    dystrophy, 310200 (3)
    AIDS, delayed/rapid KIR3DL1, NKAT3, NKB1, AMB11
    progression to (3) KIR3DS1
    AIDS, rapid IFNG
    progression to,
    609423 (3)
    AIDS, resistance to (3) CXCL12, SDF1
    Alpha 1-Antitrypsin SERPINA1 [serpin peptidase inhibitor, clade A (alpha-1 antiproteinase,
    Deficiency antitrypsin), member 1]; SERPINA2 [serpin peptidase inhibitor, clade A
    alpha-1 antiproteinase, antitrypsin), member 2]; SERPINA3 [serpin
    peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member
    3]; SERPINA5 [serpin peptidase inhibitor, clade A (alpha-1
    antiproteinase, antitrypsin), member 5]; SERPINA6 [serpin peptidase
    inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 6];
    SERPINA7 [serpin peptidase inhibitor, clade A (alpha-1 antiproteinase,
    antitrypsin), member 7];″ AND ″SERPINA6 (serpin peptidase inhibitor,
    clade A (alpha-1 antiproteinase, antitrypsin), member 6)
  • TABLE C
    CELLULAR
    FUNCTION GENES
    PI3K/AKT Signaling PRKCE; ITGAM; ITGA5; IRAK1; PRKAA2; EIF2AK2;
    PTEN; EIF4E; PRKCZ; GRK6; MAPK1; TSC1; PLK1;
    AKT2; IKBKB; PIK3CA; CDK8; CDKN1B; NFKB2; BCL2;
    PIK3CB; PPP2R1A; MAPK8; BCL2L1; MAPK3; TSC2;
    ITGA1; KRAS; EIF4EBP1; RELA; PRKCD; NOS3;
    PRKAA1; MAPK9; CDK2; PPP2CA; PIM1; ITGB7;
    YWHAZ; ILK; TP53; RAF1; IKBKG; RELB; DYRK1A;
    CDKN1A; ITGB1; MAP2K2; JAK1; AKT1; JAK2; PIK3R1;
    CHUK; PDPK1; PPP2R5C; CTNNB1; MAP2K1; NFKB1;
    PAK3; ITGB3; CCND1; GSK3A; FRAP1; SFN; ITGA2;
    TTK; CSNK1A1; BRAF; GSK3B; AKT3; FOXO1; SGK;
    HSP90AA1; RPS6KB1
    ERK/MAPK Signaling PRKCE; ITGAM; ITGA5; HSPB1; IRAK1; PRKAA2;
    EIF2AK2; RAC1; RAP1A; TLN1; EIF4E; ELK1; GRK6;
    MAPK1; RAC2; PLK1; AKT2; PIK3CA; CDK8; CREB1;
    PRKC1; PTK2; FOS; RPS6KA4; PIK3CB; PPP2R1A;
    PIK3C3; MAPK8; MAPK3; ITGA1; ETS1; KRAS; MYCN;
    EIF4EBP1; PPARG; PRKCD; PRKAA1; MAPK9; SRC;
    CDK2; PPP2CA; PIM1; PIK3C2A; ITGB7; YWHAZ;
    PPP1CC; KSR1; PXN; RAF1; FYN; DYRK1A; ITGB1;
    MAP2K2; PAK4; PIK3R1; STAT3; PPP2R5C; MAP2K1;
    PAK3; ITGB3; ESR1; ITGA2; MYC; TTK; CSNK1A1;
    CRKL; BRAF; ATF4; PRKCA; SRF; STAT1; SGK
    Glucocorticol Receptor RAC1; TAF4B; EP300; SMAD2; TRAF6; PCAF; ELK1;
    Signaling MAPK1; SMAD3; AKT2; IKBKB; NCOR2; UBE2I;
    PIK3CA; CREB1; FOS; HSPA5; NFKB2; BCL2;
    MAP3K14; STAT5B; PIK3CB; PIK3C3; MAPK8; BCL2L1;
    MAPK3; TSC22D3; MAPK10; NRIP1; KRAS; MAPK13;
    RELA; STAT5A; MAPK9; NOS2A; PBX1; NR3C1;
    PIK3C2A; CDKN1C; TRAF2; SERPINE1; NCOA3;
    MAPK14; TNF; RAF1; IKBKG; MAP3K7; CREBBP;
    CDKN1A; MAP2K2 ; JAK1; IL8; NCOA2; AKT1; JAK2;
    PIK3R1; CHUK; STAT3; MAP2K1; NFKB1; TGEBR1;
    ESR1; SMAD4; CEBPB; JUN; AR; AKT3; CCL2; MMP1;
    STAT1; IL6; HSP90AA1
    Axonal Guidance PRKCE; ITGAM; ROCK1; ITGA5; CXCR4; ADAM12;
    Signaling IGF1; RAC1; RAP1A; EIF4E; PRKCZ; NRP1; NTRK2;
    ARGEF7; SMO; ROCK2; MAPK1; PGF; RAC2;
    PTPN11; GNAS; AKT2; PIK3CA; ERBB2; PRKCI; PTK2;
    CFL1; GNAQ; PIK3CB; CXCL12; PIK3C3; WNT11;
    PRKD1; GNB2L1; ABL1; MAPK3; ITGA1; KRAS; RHOA;
    PRKCD; PIK3C2A; ITGB7; GLI2; PXN; VASP; RAF1;
    FYN; ITGB1; MAP2K2; PAK4; ADAM17; AKT1; PIK3R1;
    GLI1; WNT5A; ADAM10; MAP2K1; PAK3; ITGB3;
    CDC42; VEGFA; ITGA2; EPHA8; CRKL; RND1; GSK3B;
    AKT3; PRKCA
    Ephrin Receptor PRKCE; ITGAM; ROCK1; ITGA5; CXCR4; IRAK1;
    Signaling PRKAA2; EIF2AK2; RAC1; RAP1A: GRK6; ROCK2;
    MAPK1; PGF; RAC2; PTPN11; GNAS; PLK1; AKT2;
    DOK1; CDK8; CREB1; PTK2; CFL1; GNAQ; MAP3K14;
    CXCL12; MAPK8; GNB2L1; ABL1; MAPK3; ITGA1;
    KRAS; RHOA; PRKCD; PRKAA1; MAPK9; SRC; CDK2;
    PIM1; ITGB7; PXN; RAF1; FYN; DYRK1A; ITGB1;
    MAP2K2; PAK4; AKT1; JAK2 ; STAT3; ADAM10;
    MAP2K1; PAK3; ITGB3; CDC42; VEGFA; ITGA2;
    EPHA8; TTK; CSNK1A1; CRKL; BRAF; PTPN13; ATF4;
    AKT3; SGK
    Actin Cytoskeleton ACTN4; PRKCE; ITGAM; ROCK1; ITGA5; IRAK1;
    Signaling PRKAA2; EIF2AK2; RAC1; INS; ARHGEF7; GRK6;
    ROCK2; MAPK1; RAC2; PLK1; AKT2; PIK3CA; CDK8;
    PTK2; CFL1; PIK3CB; MYH9; DIAPH1; PIK3C3; MAPK8;
    F2R; MAPK3; SLC9A1; ITGA1; KRAS; RHOA; PRKCD;
    PRKAA1; MAPK9; CDK2; PIM1; PIK3C2A; ITGB7;
    PPP1CC; PXN; VIL2; RAF1; GSN; DYRK1A; ITGB1;
    MAP2K2; PAK4; PIP5K1A; PIK3R1; MAP2K1; PAK3;
    ITGB3; CDC42; APC; ITGA2; TTK; CSNK1A1; CRKL;
    BRAF; VAV3; SGK
    Huntington's Disease PRKCE; IGF1; EP300; RCOR1; PRKCZ; HDAC4; TGM2;
    Signaling MAPK1; CAPNS1; AKT2; EGFR; NCOR2; SP1; CAPN2;
    PIK3CA; HDAC5; CREB1; PRKC1; HSPA5; REST;
    GNAQ; PIK3CB; PIK3C3; MAPK8; IGF1R; PRKD1;
    GNB2L1; BCL2L1; CAPN1; IMAPK3; CASP8; HDAC2;
    HDAC7A; PRKCD; HDAC11; MAPK9; HDAC9; PIK3C2A;
    HDAC3; TP53; CASP9; CREBBP; AKT1; PIK3R1;
    PDPK1; CASP1; APAF1; FRAP1; CASP2; JUN; BAX;
    ATF4; AKT3; PRKCA; CLTC; SGK; HDAC6; CASP3
    Apoptosis Signaling PRKCE; ROCK1; BID; IRAK1; PRKAA2; EIF2AK2; BAK1;
    BIRC4; GRK6; MAPK1; CAPNS1; PLK1; AKT2; IKBKB;
    CAPN2; CDK8; FAS; NFKB2; BCL2; MAP3K14; MAPK8;
    BCL2L1; CAPN1; MAPK3; CASP8; KRAS; RELA;
    PRKCD; PRKAA1; MAPK9; CDK2; PIM1; TP53; TNF;
    RAF1; IKBKG; RELB; CASP9; DYRK1A; MAP2K2;
    CHUK; APAF1; MAP2K1; NFKB1; PAK3; LMNA; CASP2;
    BIRC2; TTK; CSNK1A1; BRAF; BAX; PRKCA; SGK;
    CASP3; BIRC3; PARP1
    B Cell Receptor RAC1; PTEN; LYN; ELK1; MAPK1; RAC2; PTPN11;
    Signaling AKT2; IKBKB; PIK3CA; CREB1; SYK; NFKB2; CAMK2A;
    MAP3K14; PIK3CB; PIK3C3; MAPK8; BCL2L1; ABL1;
    MAPK3; ETS1; KRAS; MAPK13; RELA; PTPN6; MAPK9;
    EGR1; PIK3C2A; BTK; MAPK14; RAF1; IKBKG; RELB;
    MAP3K7; MAP2K2; AKT1; PIK3R1; CHUK; MAP2K1;
    NFKB1; CDC42; GSK3A; FRAP1; BCL6; BCL10; JUN;
    GSK3B; ATF4; AKT3; VAV3; RPS6KB1
    Leukocyte Extravasation ACTN4; CD44; PRKCE; ITGAM; ROCK1; CXCR4; CYBA;
    Signaling RAC1; RAP1A; PRKCZ; ROCK2; RAC2; PTPN11;
    MMP14; PIK3CA; PRKCI; PTK2; PIK3CB; CXCL12;
    PIK3C3; MAPK8; PRKBI; ABL1; MAPK10; CYBB;
    MAPK13; RHOA; PRKCD; MAPK9; SRC; PIK3C2A; BTK;
    MAPK14; NOX1; PXN; VIL2; VASP; ITGB1; MAP2K2;
    CTNND1; PIK3R1; CTNNB1; CLDN1; CDC42; F11R; ITK;
    CRKL; VAV3; CTTN; PRKCA; MMP1; MMP9
    Itegrin Signaling ACTN4; ITGAM; ROCK1; ITGA5; RAC1; PTEN; RAP1A;
    TLN1; ARHGEF7; MAPK1; RAC2; CAPNS1; AKT2;
    CAPN2; PIK3CA; PTK2; PIK3CB; PIK3C3; MAPK8;
    CAV1; CAPN1; ABL1; MAPK3; ITGA1; KRAS; RHOA;
    SRC; PIK3C2A; ITGB7; PPP 1CC; ILK; PXN; VASP;
    RAF1; FYN; ITGB1; MAP2K2; PAK4; AKT1; PIK3R1;
    TNK2; MAP2K1; PAK3; ITGB3; CDC42; RND3; ITGA2;
    CRKL; BRAF; GSK3B; AKT3
    Acute Phase Response IRAK1; SOD2; MYD88; TRAF6; ELK1; MAPK1; PTPN11;
    Signaling AKT2; IKBKB; PIK3CA; FOS; NFKB2; MAP3K14;
    PIK3CB; MAPK8; RIPK1; MAPK3; IL6ST; KRAS;
    MAPK13; IL6R; RELA; SOCS1; MAPK9; FTL; NR3C1;
    TRAF2; SERPINE1; MAPK14; TNF; RAF1; PDK1;
    IKBKG; RELB; MAP3K7; MAP2K2; AKT1; JAK2; PIK3R1;
    CHUK; STAT3; MAP2K1; NFKB1; FRAP1; CEBPB; JUN;
    AKT3; IL2R1; IL6
    PTEN Signaling ITGAM; ITGA5; RAC1; PTEN; PRKCZ; BCL2L11;
    MAPK1; RAC2; AKT2; EGFR; IKBKB; CBL; PIK3CA;
    CDKN1B; PTK2; NFKB2; BCL2; PIK3CB; BCL2L1;
    MAPK3; ITGA1; KRAS; ITGB7; ILK; PDGFRB; INSR;
    RAF1; IKBKG; CASP9; CDKN1A; ITGB1; MAP2K2;
    AKT1; PIK3R1; CHUK; PDGFRA; PDPK1; MAP2K1;
    NFKB1; ITGB3; CDC42; CCND1; GSK3A; ITGA2;
    GSK3B; AKT3; FOXO1; CASP3; RPS6KB1
    p53 Signaling PTEN; EP300; BBC3; PCAF; FASN; BRCA1; GADD45A;
    BIRC5; AKT2; PIK3CA; CHEK1; TP53INP1; BCL2;
    PIK3CB; PIK3C3; MAPK8; THBS1; ATR; BCL2L1; E2F1;
    PMAIP1; CHEK2; TNFRSF10B; TP73; RB1; HDAC9;
    CDK2; PIK3C2A; MAPK14; TP53; LRDD; CDKN1A;
    HIPK2; AKT1; PIK3R1; RRM2B; APAF1; CTNNB1;
    SIRT1; CCND1; PRKDC; ATM; SFN; CDKN2A; JUN;
    SNAI2; GSK3B; BAX; AKT3
    Aryl Hydrocarbon HSPR1; EP300; FASN; TGM2; RXRA; MAPK1; NQO1;
    Receptor NCOR2; SP1; ARNT; CDKN1B; FOS; CHEK1;
    Signaling SMARCA4; NFKB2; MAPK8; ALDH1A1; ATR; E2F1;
    MAPK3; NRIP1; CHEK2; RELA; TP73; GSTP1; RB1;
    SRC; CDK2; AHR; NFE2L2; NCOA3; TP53; TNF;
    CDKN 1A; NCOA2; APAF1; NFKB1; CCND1; ATM; ESR1;
    CDKN2A; MYC; JUN; ESR2; BAX; IL6; CYP1B1;
    HSP90AA1
    Xenobiotic Metabolism PRKCE; EP300; PRKCZ; RXRA; MAPK1; NQO1;
    Signaling NCOR2; PIK3CA; ARNT; PRKC1; NFKB2; CAMK2A;
    PIK3CB; PPP2R1A; PIK3C3; MAPK8; PRKD1;
    ALDH1A1; MAPK3; NRIP1; KRAS; MAPK13; PRKCD;
    GSTP1; MAPK9; NOS2A; ABCB1; AHR; PPP2CA; FTL;
    NFE2L2; PIK3C2A; PPARGC1A; MAPK14; TNF; RAF1;
    CREBBP; MAP2K2; PIK3R1; PPP2R5C; MAP2K1;
    NFKB1; KEAP1; PRKCA; EIF2AK3; IL6; CYP1B1;
    HSP90AA1
    SAPK/JNK Signaling PRKCE; IRAK1; PRKAA2; EIF2AK2; RAC1; ELK1;
    GRK6; MAPK1; GADD45A; RAC2; PLK1; AKT2; PIK3CA;
    FADD; CDK8; PIK3CB; PIK3C3; MAPK8; RIPK1;
    GNB2L1; IRS1; MAPK3; MAPK10; DAXX; KRAS;
    PRKCD; PRKAA1; MAPK9; CDK2; PIM1; PIK3C2A;
    TRAF2; TP53; LCK; MAP3K7; DYRK1A; MAP2K2;
    PIK3R1; MAP2K1; PAK3; CDC42; JUN; TTK; CSNK1A1 ;
    CRKL; BRAF; SGK
    PPAr/RXR Signaling PRKAA2; EP300; INS; SMAD2; TRAF6; PPARA; FASN;
    RXRA; MAPK1; SMAD3; GNAS; IKBKB; NCOR2;
    ABCA1; GNAQ; NFKB2; MAP3K14; STAT5B; MAPK8;
    IRS1; MAPK3; KRAS; RELA; PRKAA1; PPARGC1A;
    NCOA3; MAPK14; INSR; RAF1; IKBKG; RELB; MAP3K7;
    CREBBP; MAP2K2; JAK2; CHUK; MAP2K1; NFKB1;
    TGFBR1; SMAD4; JUN; ILI1R1; PRKCA; IL6; HSP90AA1;
    ADIPOQ
    NF-KB Signaling IRAK1; EIF2AK2; EP300; INS; MYD88; PRKCZ; TRAF6;
    TNK1; AKT2; EGFR; IKBKB; PIK3CA; BTRC; NFKB2;
    MAP3K14; PIK3CB; PIK3C3; MAPK8; RIPK1; HDAC2;
    KRAS; RELA; PIK3C2A; TRAF2; TLR4; PDGFRB; TNF;
    INSR; LCK; IKBKG; RELB; MAP3K7; CREBBP; AKT1;
    PIK3R1; CHUK; PDGFRA; NFKB1; TLR2; BCL10;
    GSK3B; AKT3; TNFAIP3; IL1R1
    Neuregulin Signaling ERBB4; PRKCE; ITGAM; ITGA5; PTEN; PRKCZ; ELK1;
    MAPK1; PTPN11; AKT2; EGFR; ERBB2; PRKCI;
    CDKN1B; STAT5B; PRKD1; MAPK3; ITGA1; KRAS;
    PRKCD; STAT5A; SRC; ITGB7; RAF1; ITGB1; MAP2K2;
    ADAM17; AKT1; PIK3R1; PDPK1; MAP2K1; ITGB3;
    EREG; FRAP1; PSEN1; ITGA2; MYC; NRG1; CRKL;
    AKT3; PRKCA; HSP90AA1; RPS6KB1
    Wnt & Beta catenin CD44; EP300; LRP6; DVL3; CSNK1E; GJA1; SMO;
    Signaling AKT2; PIN1; CDH1; BTRC; GNAQ; MARK2; PPP2R1A;
    WNT11; SRC; DKK1; PPP2CA; SOX6; SFRP2; ILK;
    LEF1; SOX9; TP53; MAP3K7; CREBBP; TCF7L2; AKT1;
    PPP2R5C; WNT5A; LRP5; CTNNB1; TGFBR1; CCND1;
    GSK3A; DVL1; APC; CDKN2A; MYC; CSNK1A1; GSK3B;
    AKT3; SOX2
    Insulin Receptor PTEN; INS; EIF4E; PTPN1; PRKCZ; MAPK1; TSC1;
    Signaling PTPN11; AKT2; CBL; PIK3CA; PRKCI; PIK3CB; PIK3C3;
    MAPK8; IRS1; MAPK3; TSC2; KRAS; EIF4EBP1;
    SLC2A4; PIK3C2A; PPP1CC; INSR; RAF1; FYN;
    MAP2K2; JAK1; AKT1; JAK2; PIK3R1; PDPK1; MAP2K1;
    GSK3A; FRAP1; CRKL; GSK3B; AKT3; FOXO1; SGK;
    RPS6KB1
    IL-6 Signaling HSPB1; TRAF6; MAPKAPK2; ELK1; MAPK1; PTPN11;
    IKBKB; FOS; NFKB2; MAP3K14; MAPK8; MAPK3;
    MAPK10; IL6ST; KRAS; MAPK13; IL6R; RELA; SOCS1;
    MAPK9; ABCB1; TRAF2; MAPK14; TNF; RAF1; IKBKG;
    RELB; MAP3K7; MAP2K2; IL8; JAK2; CHUK; STAT3;
    MAP2K1; NFKB1; CEBPB; JUN; IL1R1; SRF; IL6
    Hepatic Cholestasis PRKCE; IRAK1; INS; MYD88; PRKCZ; TRAF6; PPARA;
    RXRA; IKBKB; PRKCI; NFKB2; MAP3K14; MAPK8;
    PRKD1; MAPK10; RELA; PRKCD; MAPK9; ABCB1;
    TRAF2; TLR4; TNF; INSR; IKBKG; RELB; MAP3K7; IL8;
    CHUK; NR1H2; TJP2; NFKB1; ESR1; SREBF1; FGFR4;
    JUN; IL1R1; PRKCA; IL6
    IGF-1 Signaling IGF1; PRKCZ; ELK1; MAPK1; PTPN11; NEDD4; AKT2;
    PIK3CA; PRKCI; PTK2; FOS; PIK3CB; PIK3C3; MAPK8;
    IGF1R; IRS1; MAPK3; IGFBP7; KRAS; PIK3C2A;
    YWHAZ; PXN; RAF1; CASP9; MAP2K2; AKT1; PIK3R1;
    PDPK1; MAP2K1; IGFBP2; SFN; JUN; CYR61; AKT3;
    FOXO1; SRF; CTGF; RPS6KB1
    NRF2-mediated PRKCE; EP300; SOD2; PRKCZ; MAPK1; SQSTM1;
    Oxidative NQO1; PIK3CA; PRKCI; FOS; PIK3CB; PIK3C3; MAPK8;
    Stress Response PRKD1; MAPK3; KRAS; PRKCD; GSTP1; MAPK9; FTL;
    NFE2L2; PIK3C2A; MAPK14; RAF1; MAP3K7; CREBBP;
    MAP2K2; AKT1; PIK3R1; MAP2K1; PPIB; JUN; KEAP1;
    GSK3B; ATF4; PRKCA; EIF2AK3; HSP90AA1
    Hepatic Fibrosis/Hepatic EDN1; IGF1; KDR; FLT1; SMAD2; FGFR1; MET; PGF;
    Stellate Cell Activation SMAD3; EGFR; FAS; CSF1; NFKB2; BCL2; MYH9;
    IGF1R; IL6R; RELA; TLR4; PDGFRB; TNF; RELB; IL8;
    PDGFRA; NFKB1; TGFBR1; SMAD4; VEGFA; BAX;
    IL1R1; CCL2; HGF; MMP1; STAT1; IL6; CTGF; MMP9
    PPAR Signaling EP300; INS; TRAF6; PPARA; RXRA; MAPK1; IKBKB;
    NCOR2; FOS; NFKB2; MAP3K14; STAT5B; MAPK3;
    NRIP1; KRAS; PPARG; RELA; STAT5A; TRAF2;
    PPARGC1A; PDGFRB; TNF; INSR; RAF1; IKBKG;
    RELB; MAP3K7; CREBBP; MAP2K2; CHUK; PDGFRA;
    MAP2K1; NFKB1; JUN; IL1R1; HSP90AA1
    Fc Epsilon RI Signaling PRKCE; RAC1; PRKCZ; LYN; MAPK1; RAC2; PTPN11;
    AKT2; PIK3CA; SYK; PRKCI; PIK3CB; PIK3C3; MAPK8;
    PRKD1; MAPK3; MAPK10; KRAS; MAPK13; PRKCD;
    MAPK9; PIK3C2A; BTK; MAPK14; TNF; RAF1; FYN;
    MAP2K2; AKT 1; PIK3R11; PDPK1; MAP2K1; AKT3;
    VAV3; PRKCA
    G-Protein Coupled PRKCE; RAP1A; RGS16; MAPK1; GNAS; AKT2; IKBKB;
    Receptor Signaling PIK3CA; CREB1; GNAQ; NFKB2; CAMK2A; PIK3CB;
    PIK3C3; MAPK3; KRAS; RELA; SRC; PIK3C2A; RAF1;
    IKBKG; RELB; FYN; MAP2K2; AKT1; PIK3R1; CHUK;
    PDPK1; STAT3; MAP2K1; NFKB1; BRAF; ATF4; AKT3;
    PRKCA
    Inositol Phosphate PRKCE; IRAK1; PRKAA2; EIF2AK2; PTEN; GRK6;
    Metabolism MAPK1; PLK1; AKT2; PIK3CA; CDK8; PIK3CB; PIK3C3;
    MAPK8; MAPK3; PRKCD; PRKAA1; MAPK9; CDK2;
    PIM1; PIK3C2A; DYRK1A; MAP2K2; PIP5K1A; PIK3R1;
    MAP2K1; PAK3; ATM; TTK; CSNK1A1; BRAF; SGK
    PDGF Signaling EIF2AK2; ELK1; ABL2; MAPK1; PIK3CA; FOS; PIK3CB;
    PIK3C3; MAPK8; CAV1; ABL1; MAPK3; KRAS; SRC;
    PIK3C2A; PDGFRB; RAF1; MAP2K2; JAK1; JAK2;
    PIK3R1; PDGFRA; STAT3; SPHK1; MAP2K1; MYC;
    JUN; CRKL; PRKCA; SRF; STAT1; SPHK2
    VEGF Signaling ACTN4; ROCK1; KDR; FLT1; ROCK2; MAPK1; PGF;
    AKT2; PIK3CA; ARNT; PTK2; BCL2; PIK3CB; PIK3C3;
    BCL2L1; MAPK3; KRAS; HIF1A; NOS3; PIK3C2A; PXN;
    RAF1; MAP2K2; ELAVL1; AKT1; PIK3R1; MAP2K1; SFN;
    VEGFA; AKT3; FOXO1; PRKCA
    Natural Killer Cell PRKCE; RAC1; PRKCZ; MAPK1; RAC2; PTPN11;
    Signaling KIR2DL3; AKT2; PIK3CA; SYK; PRKCI; PIK3CB;
    PIK3C3; PRKD1; MAPK3; KRAS; PRKCD; PTPN6;
    PIK3C2A; LCK; RAF1; FYN; MAP2K2; PAK4; AKT1;
    PIK3R1; MAP2K1; PAK3; AKT3; VAV3; PRKCA
    Cell Cycle: G1/S HDAC4; SMAD3; SUV39H1; HDAC5; CDKN1B; BTRC;
    Checkpoint Regulation ATR; ABL1; E2F1; HDAC2; HDAC7A; RB1; HDAC11;
    HDAC9; CDK2; E2F2; HDACS; TP53; CDKN1A; CCND1;
    E2F4; ATM; RBL2; SMAD4; CDKN2A; MYC; NRG1;
    GSK3B; RBL1; HDAC6
    T Cell Receptor RAC1; ELK1; MAPK1; IKBK13; CBL; PIK3CA; FOS;
    Signaling NFKB2; PIK3CB; PIK3C3; MAPK8; MAPK3; KRAS;
    RELA; PIK3C2A; BTK; LCK; RAF1; IKBKG; RELB; FYN;
    MAP2K2; PIK3R1; CHUK; MAP2K1; NFKB1; ITK; BCL10
    JUN; VAV3
    Death Receptor Signaling CRADD; HSPB1; BID; BIRC4; TBK1; IKBKB; FADD;
    FAS; NFKB2; BCL2; MAP3K14; MAPK8; RIPK1; CASP8;
    DAXX; TNFRSF10B; RELA; TRAF2; TNF; IKBKG; RELB;
    CASP9; CHUK; APAF1; NFKB1; CASP2; BIRC2; CASP3;
    BIRC3
    FGF Signaling RAC1; FGFR1; MET; MAPKAPK2; MAPK1; PTPN11;
    AKT2; PIK3CA; CREB1; PIK3CB; PIK3C3; MAPK8;
    MAPK3; MAPK13; PTPN6; PIK3C2A; MAPK14; RAF1;
    AKT1; PIK3R1; STAT3; MAP2K1; .FGFR4; CRKL; ATF;
    AKT3; PRKCA; HGF
    GM-CSF Signaling LYN; ELK1; MAPK1; PTPN11; AKT2; PIK3CA; CAMK2A;
    STAT5B; PIK3CB; PIK3C3; GNB2LI; BCL2L1; MAPK3;
    ETS1; KRAS; RUNX1; PIM1; PIK3C2A; RAF1; MAP2K2;
    AKT1; JAK2; PIK3R1; STAT3; MAP2K1; CCND1; AKT3;
    STAT1
    Amyotrophic Lateral BID; IGF1; RAC1; BIRC4; PGF; CAPNS1; CAPN2;
    Sclerosis Signaling PIK3CA; BCL2; PIK3CB; PIK3C3; BCL2L1; CAPN1;
    PIK3C2A; TP53; CASP9; PIK3R1; RAB5A; CASP1;
    APAF1; VEGFA; BIRC2; BAX; AKT3; CASP3; BIRC3
    JAK/Stat Signaling PTPN1; MAPK1; PTPN11; AKT2; PIK3CA; STAT5B;
    PIK3CB; PIK3C3; MAPK3; KRAS; SOCS1; STAT5A;
    PTPN6; PIK3C2A; RAF1; CDKN1A; MAP2K2; JAK1;
    AKT1; JAK2; PIK3R1; STAT3; MAP2K1; FRAP1; AKT3;
    STAT1
    Nicotinate and PRKCE; IRAK1; PRKAA2; EIF2AK2; GRK6; MAPK1;
    Nicotinamide PLK1; AKT2; CDK8; MAPK8; MAPK3; PRKCD; PRKAA1;
    Metabolism PBEF1; MAPK9; CDK2; PIMI; DYRK1A; MAP2K2;
    MAP2K1; PAK3; NT5E; TTK; CSNK1A1; BRAF; SGK
    Chernokine Signaling CXCR4; ROCK2; MAPK1; PTK2; FOS; CFL1; GNAQ;
    CAMK2A; CXCL12; MAPK8; MAPK3; KRAS; MAPK13;
    RHOA; CCR3; SRC; PPP1CC; MAPK14; NOX1; RAF1;
    MAP2K2; MAP2K1; JUN; CCL2; PRKCA
    IL-2 Signaling ELK1; MAPK1; PTPN11; AKT2; PIK3CA; SYK; FOS;
    STAT5B; PIK3CB; PIK3C3; MAPK8; MAPK3; KRAS;
    SOCS1; STAT5A; PIK3C2A; LCK; RAF1; MAP2K2;
    JAK1; AKT1; PIK3R1; MAP2K1; JUN; AKT3
    Synaptic Long Term PRKCE; IGF1; PRKCZ; PRDX6; LYN; MAPK1; GNAS;
    Depression PRKCI; GNAQ; PPP2R1A; IGF1R; PRKD1; MAPK3;
    KRAS; GRN; PRKCD; NOS3; NOS2A; PPP2CA;
    YWHAZ; RAF1; MAP2K2; PPP2R5C; MAP2K1; PRKCA
    Estrogen Receptor TAF4B; EP300; CARM1; PCAF; MAPK1; NCOR2;
    Signaling SMARCA4; MAPK3; NRIP1; KRAS; SRC; NR3C1;
    HDAC3; PPARGC1A; RBM9; NCOA3; RAF1; CREBBP;
    MAP2K2: NCOA2; MAP2K1; PRKDC; ESR1; ESR2
    Protein Ubiquitination TRAF6; SMURF1; BIRC4; BRCAl; UCHLI; NEDD4;
    Pathway CBL; UBE2I; BTRC; HSPA5; USP7; USP10; FBXW7;
    USP9X; STUB1; USP22; B2M; BIRC2; PARK2; USP8;
    USP1; VHL; HSP90AA1; BIRC3
    IL-10 Signaling TRAF6; CCR1; ELK1; IKBKB; SP1; FOS; NFKB2;
    MAP3K14; MAPK8; MAPK13; RELA; MAPK14; TNF;
    IKBKG; RELB; MAP3K7; JAK1; CHUK; STAT3; NFKB1;
    JUN; IL1R1; IL6
    VDR/RXR Activation PRKCE; EP300; PRKCZ; RXRA; GADD45A; HES1;
    NCOR2; SP1; PRKCI; CDKN1B; PRKD; PRKCD;
    RUNX2; KLF4; YY1; NCOA3; CDKN1A; NCOA2; SPP1;
    LRP5; CEBPB; FOXO1; PRKCA
    TGF-beta Signaling EP300; SMAD2; SMURF1; MAPK1; SMAD3; SMAD1;
    FOS; MAPK8; MAPK3; KRAS; MAPK9; RUNX2;
    SERPINE1; RAF1; MAP3K7; CREBBP; MAP2K2;
    MAP2K1; TGEBR1; SMAD4; JUN; SMAD5
    Toll-like Receptor IRAK1; EIF2AK2; MYD88; TRAF6; PPARA; ELK1;
    Signaling IKBKB; FOS; NFKB2; MAP3K14; MAPK8; MAPK13;
    RELA; TLR4; MAPK14; IKBKG; RELB; MAP3K7; CHUK;
    NFKB1; TLR2; JUN
    p38 MAPK Signaling HSPB1; IRAK1; TRAF6; MAPKAPK2; ELK1; FADD; FAS;
    CREB1; DDIT3; RPS6KA4; DAXX; MAPK13; TRAF2;
    MAPK14; TNF; MAP3K7; TGFBR1; MYC; ATF4; IL1R1;
    SRF; STAT1
    Neurotrophin/TRK NTRK2; MAPK1; PTPN11; PIK3CA; CREB1; FOS;
    Signaling PIK3CB; PIK3C3; MAPK8; MAPK3; KRAS; PIK3C2A;
    RAF1; MAP2K2; AKT1; PIK3R1; PDPK1; MAP2K1;
    CDC42; JUN; ATF4
    FXR/RXR Activation INS; PPARA; FASN; RXRA; AKT2; SDC1; MAPK8;
    APOB; MAPK10; PPARG; MTTP; MAPK9; PPARGC1A;
    TNF; CREBBP; AKT1; SREBF1; FGFR4; AKT3; FOXO1
    Synaptic Long Term PRKCE; RAP1A; EP300; PRKCZ; MAPK1; CREB1;
    Potentiation PRKC1; GNAQ; CAMK2A; PRKD1; MAPK3; KRAS;
    PRKCD; PPP1CC; RAF1; CREBBP; MAP2K2; MAP2K1;
    ATF4; PRKCA
    Calcium Signaling RAP1A; EP300; HDAC4; MAPK1; HDAC5; CREB1;
    CAMK2A; MYH9; MAPK3; HDAC2; HDAC7A; HDAC11;
    HDAC9; HDAC3; CREBBP; CALR; CAMKK2; ATF4;
    HDAC6
    EGF Signaling ELK1; MAPK1; EGFR; PIK3CA; FOS; PIK3CB; PIK3C3;
    MAPK8; MAPK3; PIK3C2A; RAF1; JAK1; PIK3R1;
    STAT3; MAP2K1; JUN; PRKCA; SRF; STAT1
    Hypoxia Signaling in the EDN1; PTEN; EP300; NQO1; UBE21; CREB1; ARNT;
    Cardiovascular System HIF1A; SLC2A4; NOS3; TP53; LDHA; AKT1; ATM;
    VEGFA; JUN; ATF4; VHL; HSP90AA1
    LPS/IL-1 Mediated IRAK1; MYD88; TRAF6; PPARA; RXRA; ABCA1;
    Inhibition MAPK8; ALDH1A1; GSTP1; MAPK9; ABCB1; TRAF2;
    of RXR Function TLR4; TNF; MAP3K7; NR1H2; SREBF1; JUN; IL1R1
    LXR/RXR Activation FASN; RXRA; NCOR2; ABCA1; NFKB2; IRF3; RELA;
    NOS2A; TLR4; TNF; RELB; LDLR; NR1H2; NFKB1;
    SREBF1; IL1R1; CCL2; IL6; MMP9
    Amyloid Processing PRKCE; CSNK1E; MAPK1; CAPNS1; AKT2; CAPN2;
    CAPN1; MAPK3; MAPK13; MAPT; MAPK14; AKT1;
    PSEN1; CSNK1A1; GSK3B; AKT3; APP
    IL-4 Signaling AKT2; PIK3CA; PIK3CE3; PIK3C3; IRS1; KRAS; SOCS1;
    PTPN6; NR3C1; PIK3C2A; JAK1; AKT1; JAK2; PIK3R1;
    FRAP1; AKT3; RPS6KB1
    Cell Cycle: G2/M DNA EP300; PCAF; BRCA1; GADD45A; PLK1; BTRC;
    Damage Checkpoint CHEK1; ATR; CHEK2; YWHAZ; TP53; CDKN1A;
    Regulation PRKDC; ATM; SFN; CDKN2A
    Nitric Oxide Signaling in KDR; FLT1; PGF; AKT2; PIK3CA; PIK3CB; PIK3C3;
    the Cardiovascular CAV1; PRKCD; NOS3; PIK3C2A; AKT1; PIK3R1;
    System VEGFA; AKT3; HSP90AA1
    Purine Metabolism NME2; SMARCA4; MYH9; RRM2; ADAR; EIF2AK4;
    PKM2; ENTPD1; RAD51; RRM2B; TJP2; RAD51C;
    NT5E; POLD1; NME1
    cAMP-mediated RAP1A; MAPK1; GNAS; CREB1; CAMK2A; MAPK3;
    Signaling SRC; RAF1; MAP2K2; STAT3; MAP2K1; BRAF; ATF4
    Mitochondrial SOD2; MAPK8; CASP8; MAPK10; MAPK9; CASP9;
    Dysfunction PARK7; PSEN1; PARK2; APP; CASP3
    Notch Signaling HES1; JAG1; NUMB; NOTCH4; ADAM17; NOTCH2;
    PSEN1; NOTCH:3; NOTCH 1; DLL4
    Endoplasmic Reticulum HSPA5; MAPK8; XBP1; TRAF2; ATF6; CASP9; ATF4;
    Stress Pathway EIF2AK3; CASP3
    Pyrimidine Metabolism NME2; AICDA; RRM2; EIF2AK4; ENTPD1; RRM2B;
    NT5E; POLD1; NME1
    Parkinson's Signaling UCHL1; MAPK8; MAPK13; MAPK14; CASP9; PARK7;
    PARK2; CASP3
    Cardiac & Beta GNAS; GNAQ; PPP2R1A; GNB2L1; PPP2CA; PPP1CC;
    Adrenergic PPP2R5C
    Signaling
    Glycolysis/Giuconeogenesis HK2; GCK; GPI; ALDH1A1; PKM2; LDHA; HK1
    Interferon Signaling IRF1; SOCS1; JAK1; JAK2; IFITM1; STAT1; IFIT3
    Sonic Hedgehog ARRB2; SMO; GL12; DYRK1A; GLI1; GSK3B; DYRK1B
    Signaling
    Glycerophospholipid PLD1; GRN; GPAM; YWHAZ; SPHK1; SPHK2
    Metabolism
    Phospholipid PRDX6; PLD1; GRN; YWHAZ; SPHK1; SPHK2
    Degradation
    Tryptophan Metabolism SIAH2; PRMT5; NEDD4; ALDH1A1; CYP1B1; SIAH1
    Lysine Degradation SUV39H1; EHMT2; NSD1; SETD7; PPP2R5C
    Nucleotide Excision ERCC5; ERCC4; XPA; XPC; ERCC1
    Repair
    Pathway
    Starch and Sucrose UCHL1; HK2; GCK; GPI; HK1
    Metabolism
    Aminosugars Metabolism NQO1; HK2; GCK; HK1
    Arachidonic Acid PRDX6; GRN; YWHAZ; CYP1B1
    Metabolism
    Circadian Rhythm CSNK1E; CREB1; ATF4; NR1D1
    Signaling
    Coagulation System BDKRB1; F2R; SERPINE1; F3
    Dopamine Receptor PPP2R1A; PPP2CA; PPP1CC; PPP2R5C
    Signaling
    Glutathione Metabolism IDH2; GSTP1; ANPEP; IDH1
    Glycerolipid Metabolism ALDH1A1; GPAM; SPHK1; SPHK2
    Linoleic Acid PRDX6; GRN; YWHAZ; CYP1B1
    Metabolism
    Methionine Metabolism DNMT1; DNMT3B; AHCY; DMNT3A
    Pyruvate Metabolism GLO1; ALDH1A1; PKM2; LDHA
    Arginine and Proline ALDH1A1; NOS3; NOS2A
    Metabolism
    Eicosanoid Signaling PRDX6; GRN; YWHAZ
    Fructose and Mannose HK2; GCK; HK1
    Metabolism
    Galactose Metabolism HK2; GCK; HK1
    Stilbene, Cournarine and PRDX6; PRDX1; TYR
    Lignin Biosynthesis
    Antigen Presentation CALR; B2M
    Pathway
    Biosynthesis of Steroids NQO1; DHCR7
    Butanoate Metabolism ALDH1A1; NLGN1
    Citrate Cycle IDH2; IDH1
    Fatty Acid Metabolism ALDH1A1; CYP1B1
    Glycerophospholipid PRDX6; CHKA
    Metabolism
    Histidine Metabolism PRM T5; ALDH1A1
    Inositol Metabolism ERO1L; APEX1
    Metabolism of GSTP1; CYP1B1
    Xenobiotics
    by Cytochrome p450
    Methane Metabolism PRDX6; PRDX1
    Phenylalanine PRDX6; PRDX1
    Metabolism
    Propanoate Metabolism ALDH1A1; LDHA
    Selenoamino Acid PRMT5; AHCY
    Metabolism
    Sphingolipid Metabolism. SPHK1; SPHK2
    Aminophosphonate PRMT5
    Metabolism
    Androgen and Estrogen PRMT5
    Metabolism
    Ascorbate and Aldarate ALDH1A1
    Metabolism
    Bile Acid Biosynthesis ALDH1A1
    Cysteine Metabolism LDHA
    Fatty Acid Biosynthesis FASN
    Glutamate Receptor GNB2L1
    Signaling
    NRF2-mediated PRDX1
    Oxidative
    Stress Response
    Pentose Phosphate GPI
    Pathway
    Pentose and Glucuronate UCHL1
    interconversions
    Retinol Metabolism ALDH1A1
    Riboflavin Metabolism TYR
    Tyrosine Metabolism PRMT5, TYR
    Ubiquinone Biosynthesis PRMT5
    Valine, Leucine and ALDH1A1
    Isoleucine Degradation
    Glycine, Serine and CHKA
    Threonine Metabolism
    Lysine Degradation ALDH1A1
    Pain/Taste TRPM5; TRPA1
    Pain TRPM7; TRPC5; TRPC6; TRPC1; Cnr1; cnr2; Grk2;
    Trpa1; Pomc; Cgrp; Crf; Pka; Era; Nr2b; TRPM5; Prkaca;
    Prkacb; Prkar1a; Prkar2a
    Mitochondrial Function AIF; CytC; SMAC (Diablo); Aifm-1; Aifm-2
    Developmental BMP-4; Chordin (Chrd); Noggin (Nog); WNT (WM2;
    Neurology Wnt2b; Wnt3a; Wnt4; Wnt5a; Wnt6; Wnt7b; Wnt8b;
    Wnt9a; Wnt9b; Wnt10a; Wnt10b; Wnt16); beta-catenin;
    Dkk-1; Frizzled related proteins; Otx-2; Gbx2; FGF-8;
    Reelin; Dab1; unc-86 (Pou4f1 or Bm3a); Numb; Reln
  • Embodiments of the invention also relate to methods and compositions related to knocking out genes, amplifying genes and repairing particular mutations associated with DNA repeat instability and neurological disorders (Robert D. Wells, Tetsuo Ashizawa, Genetic Instabilities and Neurological Diseases, Second Edition, Academic Press, Oct. 13, 2011—Medical). Specific aspects of tandem repeat sequences have been found to be responsible for more than twenty human diseases (New insights into repeat instability: role of RNA.DNA hybrids. McIvor E I, Polak U, Napierala M. RNA Biol. 2010 September-October; 7(5):551-8). The CRISPR-Cas system may be harnessed to correct these defects of genomic instability.
  • A further aspect of the invention relates to utilizing the CRISPR-Cas system for correcting defects in the EMP2A and EMP2B genes that have been identified to be associated with Lafora disease. Lafora disease is an autosomal recessive condition which is characterized by progressive myoclonus epilepsy which may start as epileptic seizures in adolescence. A few cases of the disease may be caused by mutations in genes yet to be identified. The disease causes seizures, muscle spasms, difficulty walking, dementia, and eventually death. There is currently no therapy that has proven effective against disease progression. Other genetic abnormalities associated with epilepsy may also be targeted by the CRISPR-Cas system and the underlying genetics is further described in Genetics of Epilepsy and Genetic Epilepsies, edited by Giuliano Avanzini, Jeffrey L. Noebels, Mariani Foundation Paediatric Neurology: 20; 2009).
  • In yet another aspect of the invention, the CRISPR-Cas system may be used to correct ocular defects that arise from several genetic mutations further described in Genetic Diseases of the Eye, Second Edition, edited by Elias I. Traboulsi, Oxford University Press, 2012.
  • Several further aspects of the invention relate to correcting defects associated with a wide range of genetic diseases which are further described on the website of the National Institutes of Health under the topic subsection Genetic Disorders (website at health.nih.gov/topic/GeneticDisorders). The genetic brain diseases may include but are not limited to Adrenoleukodystrophy, Agenesis of the Corpus Callosum, Aicardi Syndrome, Alpers' Disease. Alzheimer's Disease, Barth Syndrome, Batten Disease, CADASIL, Cerebellar Degeneration, Fabry's Disease, Gerstmann-Straussler-Scheinker Disease, Huntington's Disease and other Triplet Repeat Disorders, Leigh's Disease, Lesch-Nyhan Syndrome, Menkes Disease, Mitochondrial Myopathies and NINDS Colpocephaly. These diseases are further described on the website of the National Institutes of Health under the subsection Genetic Brain Disorders.
  • In some embodiments, the condition may be neoplasia. In some embodiments, where the condition is neoplasia, the genes to be targeted are any of those listed in Table A (in this case PTEN asn so forth). In some embodiments, the condition may be Age-related Macular Degeneration. In some embodiments, the condition may be a Schizophrenic Disorder. In some embodiments, the condition may be a Trinucleotide Repeat Disorder. In some embodiments, the condition may be Fragile X Syndrome. In some embodiments, the condition may be a Secretase Related Disorder. In some embodiments, the condition may be a Prion—related disorder. In some embodiments, the condition may be ALS. In some embodiments, the condition may be a drug addiction. In some embodiments, the condition may be Autism. In some embodiments, the condition may be Alzheimer's Disease. In some embodiments, the condition may be inflammation. In some embodiments, the condition may be Parkinson's Disease.
  • Examples of proteins associated with Parkinson's disease include but are not limited to α-synuclein, DJ-1, LRRK2, PINK1, Parkin, UCHL1, Synphilin-1, and NURR1.
  • Examples of addiction-related proteins may include ABAT for example.
  • Examples of inflammation-related proteins may include the monocyte chemoattractant protein-1 (MCP1) encoded by the Ccr2 gene, the C—C chemokine receptor type 5 (CCR5) encoded by the Ccr5 gene, the IgG receptor IIB (FCGR2b, also termed CD32) encoded by the Fcgr2b gene, or the Fe epsilon R1g (FCER1g) protein encoded by the Fcer1g gene, for example.
  • Examples of cardiovascular diseases associated proteins may include IL1B (interleukin 1, beta), XDH (xanthine dehydrogenase), TP53 (tumor protein p53), PTGIS (prostaglandin 12 (prostacyclin) synthase), MB (myoglobin), IL4 (interleukin 4), ANGPT1 (angiopoietin 1), ABCG8 (ATP-binding cassette, sub-family G (WHITE), member 8), or CTSK (cathepsin K), for example.
  • Examples of Alzheimer's disease associated proteins may include the very low density lipoprotein receptor protein (VLDLR) encoded by the VLDLR gene, the ubiquitin-like modifier activating enzyme 1 (UBA1) encoded by the UBA1 gene, or the NEDD8-activating enzyme E1 catalytic subunit protein (UBE1C) encoded by the UBA3 gene, for example.
  • Examples of proteins associated Autism Spectrum Disorder may include the benzodiazapine receptor (peripheral) associated protein 1 (BZRAP1) encoded by the BZRAP1 gene, the AF4/FMR2 family member 2 protein (AFF2) encoded by the AFF2 gene (also termed MFR2), the fragile X mental retardation autosomal homolog 1 protein (FXR1) encoded by the FXR1 gene, or the fragile X mental retardation autosomal homolog 2 protein (FXR2) encoded by the FXR2 gene, for example.
  • Examples of proteins associated Macular Degeneration may include the ATP-binding cassette, sub-family A (ABC1) member 4 protein (ABCA4) encoded by the ABCR gene, the apolipoprotein E protein (APOE) encoded by the APOE gene, or the chemokine (C—C motif) Ligand 2 protein (CCL2) encoded by the CCL2 gene, for example.
  • Examples of proteins associated Schizophrenia may include NRG1, ErbB4, CPLX1, TPH1, TPH2, NRXN1, GSK3A, BDNF, DISC1, GSK3B, and combinations thereof.
  • Examples of proteins involved in tumor suppression may include ATM (ataxia telangiectasia mutated), ATR (ataxia telangiectasia and Rad3 related), EGFR (epidermal growth factor receptor), ERBB2 (v-erb-b2 erythroblastic leukemia viral oncogene homolog 2), ERBB3 (v-erb-b2 erythroblastic leukemia viral oncogene homolog 3), ERBB4 (v-erb-b2 erythroblastic leukemia viral oncogene homolog 4), Notch 1, Notch 2, Notch 3, or Notch 4, for example.
  • Examples of proteins associated with a secretase disorder may include PSENEN (presenilin enhancer 2 homolog (C. elegans)), CTSB (cathepsin B), PSEN1 (presenilin 1), APP (amyloid beta (A4) precursor protein), APH1B (anterior pharynx defective 1 homolog B (C. elegans)), PSEN2 (presenilin 2 (Alzheimer disease 4)), or BACE1 (beta-site APP-cleaving enzyme 1), for example.
  • Examples of proteins associated with Amyotrophic Lateral Sclerosis may include SOD1 (superoxide dismutase 1), ALS2 (amyotrophic lateral sclerosis 2), FUS (fused in sarcoma), TARDBP (TAR DNA binding protein), VAGFA (vascular endothelial growth factor A), VAGFB (vascular endothelial growth factor B), and VAGFC (vascular endothelial growth factor C), and any combination thereof.
  • Examples of proteins associated with prion diseases may include SOD1 (superoxide dismutase 1), ALS2 (amyotrophic lateral sclerosis 2), FUS (fused in sarcoma), TARDBP (TAR DNA binding protein), VAGFA (vascular endothelial growth factor A), VAGFB (vascular endothelial growth factor B), and VAGFC (vascular endothelial growth factor C), and any combination thereof.
  • Examples of proteins related to neurodegenerative conditions in prion disorders may include A2M (Alpha-2-Macroglobulin), AATF (Apoptosis antagonizing transcription factor), ACPP (Acid phosphatase prostate), ACTA2 (Actin alpha 2 smooth muscle aorta), ADAM22 (ADAM metallopeptidase domain), ADORA3 (Adenosine A3 receptor), or ADRA1D (Alpha-1D adrenergic receptor for Alpha-1D adrenoreceptor), for example.
  • Examples of proteins associated with Immunodeficiency may include A2M [alpha-2-macroglobulin]; AANAT [arylalkylamine N-acetyltransferase]; ABCA1 [ATP-binding cassette, sub-family A (ABC1), member 1]; ABCA2 [ATP-binding cassette, sub-family A (ABC1), member 2]; or ABCA3 [ATP-binding cassette, sub-family A (ABC1), member 3]; for example.
  • Examples of proteins associated with Trinucleotide Repeat Disorders include AR (androgen receptor), FMR1 (fragile X mental retardation 1), HTT (huntingtin), or DMPK (dystrophia myotonica-protein kinase), FXN (frataxin), ATXN2 (ataxin 2). for example.
  • Examples of proteins associated with Neurotransmission Disorders include SST (somatostatin), NOS1 (nitric oxide synthase 1 (neuronal)), ADRA2A (adrenergic, alpha-2A-, receptor), ADRA2C (adrenergic, alpha-2C-, receptor), TACR1 (tachykinin receptor 1), or HTR2c (5-hydroxytryptamine (serotonin) receptor 2C), for example.
  • Examples of neurodevelopmental-associated sequences include A2BP1 [ataxin 2-binding protein 1], AADAT [aminoadipate aminotransferase], AANAT [arylalkylamine N-acetyltransferase], ABAT [4-aminobutyrate aminotransferase], ABCA1 [ATP-binding cassette, sub-family A (ABC1), member 1], or ABCA13 [ATP-binding cassette, sub-family A (ABC1), member 13], for example.
  • Further examples of preferred conditions treatable with the present system include may be selected from: Aicardi-Goutières Syndrome; Alexander Disease; Allan-Herndon-Dudley Syndrome; POLG-Related Disorders; Alpha-Mannosidosis (Type II and III); Alström Syndrome; Angelman; Syndrome; Ataxia-Telangiectasia; Neuronal Ceroid-Lipofuscinoses; Beta-Thalassemia; Bilateral Optic Atrophy and (Infantile) Optic Atrophy Type 1; Retinoblastoma (bilateral); Canavan Disease; Cerebrooculofacioskeletal Syndrome 1 [COFS1]; Cerebrotendinous Xanthomatosis; Cornelia de Lange Syndrome; MAPT-Related Disorders; Genetic Prion Diseases; Dravet Syndrome; Early-Onset Familial Alzheimer Disease; Friedreich Ataxia [FRDA]; Fryns Syndrome; Fucosidosis; Fukuyama Congenital Muscular Dystrophy; Galactosialidosis; Gaucher Disease; Organic Acidemias; Hemophagocytic Lymphohistiocytosis; Hutchinson-Gilford Progeria Syndrome; Mucolipidosis II; Infantile Free Sialic Acid Storage Disease; PLA2G6-Associated Neurodegeneration; Jervell and Lange-Nielsen Syndrome; Junctional Epidermolysis Bullosa; Huntington Disease; Krabbe Disease (Infantile); Mitochondrial DNA-Associated Leigh Syndrome and NARP; Lesch-Nyhan Syndrome; LIS1-Associated Lissencephaly; Lowe Syndrome; Maple Syrup Urine Disease; MECP2 Duplication Syndrome; ATP7A-Related Copper Transport Disorders; LAMA2-Related Muscular Dystrophy; Arylsulfatase A Deficiency; Mucopolysaccharidosis Types I, II or III; Peroxisome Biogenesis Disorders, Zellweger Syndrome Spectrum; Neurodegeneration with Brain Iron Accumulation Disorders; Acid Sphingomyelinase Deficiency; Niemann-Pick Disease Type C; Glycine Encephalopathy; ARX-Related Disorders; Urea Cycle Disorders; COLIA1/2-Related Osteogenesis Imperfecta; Mitochondrial DNA Deletion Syndromes; PLP1-Related Disorders; Perry Syndrome; Phelan-McDermid Syndrome; Glycogen Storage Disease Type II (Pompe Disease) (Infantile); MAPT-Related Disorders; MECP2-Related Disorders; Rhizomelic Chondrodysplasia Punctata Type 1; Roberts Syndrome; Sandhoff Disease; Schindler Disease—Type 1; Adenosine Deaminase Deficiency; Smith-Lemli-Opitz Syndrome; Spinal Muscular Atrophy, Infantile-Onset Spinocerebellar Ataxia; Hexosaminidase A Deficiency; Thanatophoric Dysplasia Type 1; Collagen Type VI-Related Disorders; Usher Syndrome Type I; Congenital Muscular Dystrophy; Wolf-Hirschhorn Syndrome; Lysosomal Acid Lipase Deficiency; and Xeroderma Pigmentosum.
  • As will be apparent, it is envisaged that the present system can be used to target any polynucleotide sequence of interest. Some examples of conditions or diseases that might be usefully treated using the present system are included in the Tables above and examples of genes currently associated with those conditions are also provided there. However, the genes exemplified are not exhaustive.
  • EXAMPLES
  • The following examples are given for the purpose of illustrating various embodiments of the invention and are not meant to limit the present invention in any fashion. The present examples, along with the methods described herein are presently representative of preferred embodiments, are exemplary, and are not intended as limitations on the scope of the invention. Changes therein and other uses which are encompassed within the spirit of the invention as defined by the scope of the claims will occur to those skilled in the art.
  • Example 1: CRISPR Complex Activity in the Nucleus of a Eukaryotic Cell
  • An example type II CRISPR system is the type II CRISPR locus from Streptococcus pyogenes SF370, which contains a cluster of four genes Cas9, Cas1, Cas2, and Csn1, as well as two non-coding RNA elements, tracrRNA and a characteristic array of repetitive sequences (direct repeats) interspaced by short stretches of non-repetitive sequences (spacers, about 30 bp each). In this system, targeted DNA double-strand break (DSB) is generated in four sequential steps (FIG. 2A). First, two non-coding RNAs, the pre-crRNA array and tracrRNA, are transcribed from the CRISPR locus. Second, tracrRNA hybridizes to the direct repeats of pre-crRNA, which is then processed into mature crRNAs containing individual spacer sequences. Third, the mature crRNA:tracrRNA complex directs Cas9 to the DNA target consisting of the protospacer and the corresponding PAM via heteroduplex formation between the spacer region of the crRNA and the protospacer DNA. Finally, Cas9 mediates cleavage of target DNA upstream of PAM to create a DSB within the protospacer (FIG. 2A). This example describes an example process for adapting this RNA-programmable nuclease system to direct CRISPR complex activity in the nuclei of eukaryotic cells.
  • Cell Culture and Transfection
  • Human embryonic kidney (HEK) cell line HEK 293FT (Life Technologies) was maintained in Dulbecco's modified Eagle's Medium (DMEM) supplemented with 10% fetal bovine serum (HyClone), 2 mM GlutaMAX (Life Technologies), 100 U/mL penicillin, and 100 μg/mL streptomycin at 37° C. with 5% CO2 incubation. Mouse neuro2A (N2A) cell line (ATCC) was maintained with DMEM supplemented with 5% fetal bovine serum (HyClone), 2 mM GlutaMAX (Life Technologies), 100 U/mL penicillin, and 100 μg/mL streptomycin at 37° C. with 5% CO2.
  • HEK 293FT or N2A cells were seeded into 24-well plates (Corning) one day prior to transfection at a density of 200,000 cells per well. Cells were transfected using Lipofectamine 2000 (Life Technologies) following the manufacturer's recommended protocol. For each well of a 24-well plate a total of 800 ng of plasmids were used.
  • Surveyor Assay and Sequencing Analysis for Genome Modification
  • HEK 293FT or N2A cells were transfected with plasmid DNA as described above. After transfection, the cells were incubated at 37° C. for 72 hours before genomic DNA extraction. Genomic DNA was extracted using the QuickExtract DNA extraction kit (Epicentre) following the manufacturer's protocol. Briefly, cells were resuspended in QuickExtract solution and incubated at 65° C. for 15 minutes and 98° C. for 10 minutes. Extracted genomic DNA was immediately processed or stored at −20° C.
  • The genomic region surrounding a CRISPR target site for each gene was PCR amplified, and products were purified using QiaQuick Spin Column (Qiagen) following manufacturer's protocol. A total of 400 ng of the purified PCR products were mixed with 2 μl 10× Taq polymerase PCR buffer (Enzymatics) and ultrapure water to a final volume of 20 μl, and subjected to a re-annealing process to enable heteroduplex formation: 95° C. for 10 min, 95° C. to 85° C. ramping at −2° C./s, 85° C. to 25° C. at −0.25° C./s, and 25° C. hold for 1 minute. After re-annealing, products were treated with Surveyor nuclease and Surveyor enhancer S (Transgenomics) following the manufacturer's recommended protocol, and analyzed on 4-20% Novex TBE poly-acrylamide gels (Life Technologies). Gels were stained with SYBR Gold DNA stain (Life Technologies) for 30 minutes and imaged with a Gel Doc gel imaging system (Bio-rad). Quantification was based on relative band intensities, as a measure of the fraction of cleaved DNA. FIG. 7 provides a schematic illustration of this Surveyor assay.
  • Restriction fragment length polymorphism assay for detection of homologous recombination.
  • HEK 293FT and N2A cells were transfected with plasmid DNA, and incubated at 37° C. for 72 hours before genomic DNA extraction as described above. The target genomic region was PCR amplified using primers outside the homology arms of the homologous recombination (HR) template. PCR products were separated on a 1% agarose gel and extracted with MinElute GelExtraction Kit (Qiagen). Purified products were digested with HindIII (Fermentas) and analyzed on a 6% Novex TBE poly-acrylamide gel (Life Technologies).
  • RNA Secondary Structure Prediction and Analysis
  • RNA secondary structure prediction was performed using the online webserver RNAfold developed at Institute for Theoretical Chemistry at the University of Vienna, using the centroid structure prediction algorithm (see e.g. A. R. Gruber et al., 2008, Cell 106(1): 23-24; and P A Carr and G M Church, 2009, Nature Biotechnology 27(12): 1151-62).
  • RNA Purification
  • HEK 293FT cells were maintained and transfected as stated above. Cells were harvested by trypsinization followed by washing in phosphate buffered saline (PBS). Total cell RNA was extracted with TRI reagent (Sigma) following manufacturer's protocol. Extracted total RNA was quantified using Nanodrop (Thermo Scientific) and normalized to same concentration.
  • Northern Blot Analysis of crRNA and tracrRNA Expression in Mammalian Cells
  • RNAs were mixed with equal volumes of 2× loading buffer (Ambion), heated to 95° C. for 5 min, chilled on ice for 1 min, and then loaded onto 8% denaturing polyacrylamide gels (SequaGel, National Diagnostics) after pre-running the gel for at least 30 minutes. The samples were electrophoresed for 1.5 hours at 40 W limit. Afterwards, the RNA was transferred to Hybond N+ membrane (GE Healthcare) at 300 mA in a semi-dry transfer apparatus (Bio-rad) at room temperature for 1.5 hours. The RNA was crosslinked to the membrane using autocrosslink button on Stratagene UV Crosslinker the Stratalinker (Stratagene). The membrane was pre-hybridized in ULTRAhyb-Oligo Hybridization Buffer (Ambion) for 30 min with rotation at 42° C., and probes were then added and hybridized overnight. Probes were ordered from IDT and labeled with [gamma-32P] ATP (Perkin Elmer) with T4 polynucleotide kinase (New England Biolabs). The membrane was washed once with pre-warmed (42° C.) 2×SSC, 0.5% SDS for 1 min followed by two 30 minute washes at 42° C. The membrane was exposed to a phosphor screen for one hour or overnight at room temperature and then scanned with a phosphorimager (Typhoon).
  • Bacterial CRISPR System Construction and Evaluation
  • CRISPR locus elements, including tracrRNA, Cas9, and leader were PCR amplified from Streptococcus pyogenes SF370 genomic DNA with flanking homology arms for Gibson Assembly. Two BsaI type IIS sites were introduced in between two direct repeats to facilitate easy insertion of spacers (FIG. 8). PCR products were cloned into EcoRV-digested pACYC184 downstream of the tet promoter using Gibson Assembly Master Mix (NEB). Other endogenous CRISPR system elements were omitted, with the exception of the last 50 bp of Csn2. Oligos (Integrated DNA Technology) encoding spacers with complimentary overhangs were cloned into the BsaI-digested vector pDC000 (NEB) and then ligated with T7 ligase (Enzymatics) to generate pCRISPR plasmids. Challenge plasmids containing spacers with PAM
  • expression in mammalian cells (expression constructs illustrated in FIG. 6A, with functionality as determined by results of the Surveyor assay shown in FIG. 6B). Transcription start sites are marked as +1, and transcription terminator and the sequence probed by northern blot are also indicated. Expression of processed tracrRNA was also confirmed by Northern blot. FIG. 6C shows results of a Northern blot analysis of total RNA extracted from 293FT cells transfected with U6 expression constructs carrying long or short tracrRNA, as well as SpCas9 and DR-EMX1(1)-DR. Left and right panels are from 293FT cells transfected without or with SpRNase III, respectively. U6 indicate loading control blotted with a probe targeting human U6 snRNA. Transfection of the short tracrRNA expression construct led to abundant levels of the processed form of tracrRNA (˜75 bp). Very low amounts of long tracrRNA are detected on the Northern blot.
  • To promote precise transcriptional initiation, the RNA polymerase III-based U6 promoter was selected to drive the expression of tracrRNA (FIG. 2C). Similarly, a U6 promoter-based construct was developed to express a pre-crRNA array consisting of a single spacer flanked by two direct repeats (DRs, also encompassed by the term “tracr-mate sequences”; FIG. 2C). The initial spacer was designed to target a 33-base-pair (bp) target site (30-bp protospacer plus a 3-bp CRISPR motif (PAM) sequence satisfying the NGG recognition motif of Cas9) in the human EMX1 locus (FIG. 2C), a key gene in the development of the cerebral cortex.
  • To test whether heterologous expression of the CRISPR system (SpCas9, SpRNase III, tracrRNA, and pre-crRNA) in mammalian cells can achieve targeted cleavage of mammalian chromosomes, HEK 293FT cells were transfected with combinations of CRISPR components. Since DSBs in mammalian nuclei are partially repaired by the non-homologous end joining (NHEJ) pathway, which leads to the formation of indels, the Surveyor assay was used to detect potential cleavage activity at the target EMX1 locus (FIG. 7) (see e.g. Guschin et al., 2010, Methods Mol Biol 649: 247). Co-transfection of all four CRISPR components was able to induce up to 5.0% cleavage in the protospacer (see FIG. 2D). Co-transfection of all CRISPR components minus SpRNase III also induced up to 4.7% indel in the protospacer, suggesting that there may be endogenous mammalian RNases that are capable of assisting with crRNA maturation, such as for example the related Dicer and Drosha enzymes. Removing any of the remaining three components abolished the genome cleavage activity of the CRISPR system (FIG. 2D). Sanger sequencing of amplicons containing the target locus verified the cleavage activity: in 43 sequenced clones, 5 mutated alleles (11.6%) were found. Similar experiments using a variety of guide sequences produced indel percentages as high as 29% (see FIGS. 3-6, 10, and 11). These results define a three-component system for efficient CRISPR-mediated genome modification in mammalian cells. To optimize the cleavage efficiency, Applicants also tested whether different isoforms of tracrRNA affected the cleavage efficiency and found that, in this example system, only the short (89-bp) transcript form was able to mediate cleavage of the human EMX1 genomic locus (FIG. 6B).
  • FIG. 12 provides an additional Northern blot analysis of crRNA processing in mammalian cells. FIG. 12A illustrates a schematic showing the expression vector for a single spacer flanked by two direct repeats (DR-EMX1(1)-DR). The 30 bp spacer targeting the human EMX1 locus protospacer 1 (see FIG. 6) and the direct repeat sequences are shown in the sequence beneath FIG. 12A. The line indicates the region whose reverse-complement sequence was used to generate Northern blot probes for EMX1(1) crRNA detection. FIG. 12B shows a Northern blot analysis of total RNA extracted from 293FT cells transfected with U6 expression constructs carrying DR-EMX1(1)-DR. Left and right panels are from 293FT cells transfected without or with SpRNase III respectively. DR-EMX1(1)-DR was processed into mature crRNAs only in the presence of SpCas9 and short tracrRNA and was not dependent on the presence of SpRNase III. The mature crRNA detected from transfected 293FT total RNA is ˜33 bp and is shorter than the 39-42 bp mature crRNA from S. pyogenes. These results demonstrate that a CRISPR system can be transplanted into eukaryotic cells and reprogrammed to facilitate cleavage of endogenous mammalian target polynucleotides.
  • FIG. 2 illustrates the bacterial CRISPR system described in this example. FIG. 2A illustrates a schematic showing the CRISPR locus 1 from Streptococcus pyogenes SF370 and a proposed mechanism of CRISPR-mediated DNA cleavage by this system. Mature crRNA processed from the direct repeat-spacer array directs Cas9 to genomic targets consisting of complimentary protospacers and a protospacer-adjacent motif (PAM). Upon target-spacer base pairing, Cas9 mediates a double-strand break in the target DNA. FIG. 2B illustrates engineering of S. pyogenes Cas9 (SpCas9) and RNase III (SpRNase III) with nuclear localization signals (NLSs) to enable import into the mammalian nucleus. FIG. 2C illustrates mammalian expression of SpCas9 and SpRNase III driven by the constitutive EF1a promoter and tracrRNA and pre-crRNA array (DR-Spacer-DR) driven by the RNA Pol3 promoter U6 to promote precise transcription initiation and termination. A protospacer from the human EMX1 locus with a satisfactory PAM sequence is used as the spacer in the pre-crRNA array. FIG. 2D illustrates surveyor nuclease assay for SpCas9-mediated minor insertions and deletions. SpCas9 was expressed with and without SpRNase III, tracrRNA, and a pre-crRNA array carrying the EMX1-target spacer. FIG. 2E illustrates a schematic representation of base pairing between target locus and EMX1-targeting crRNA, as well as an example chromatogram showing a micro deletion adjacent to the SpCas9 cleavage site. FIG. 2F illustrates mutated alleles identified from sequencing analysis of 43 clonal amplicons showing a variety of micro insertions and deletions. Dashes indicate deleted bases, and non-aligned or mismatched bases indicate insertions or mutations. Scale bar=10 μm.
  • To further simplify the three-component system, a chimeric crRNA-tracrRNA hybrid design was adapted, where a mature crRNA (comprising a guide sequence) may be fused to a partial tracrRNA via a stem-loop to mimic the natural crRNA:tracrRNA duplex. To increase co-delivery efficiency, a bicistronic expression vector was created to drive co-expression of a chimeric RNA and SpCas9 in transfected cells. In parallel, the bicistronic vectors were used to express a pre-crRNA (DR-guide sequence-DR) with SpCas9, to induce processing into crRNA with a separately expressed tracrRNA (compare FIG. 11B top and bottom). FIG. 8 provides schematic illustrations of bicistronic expression vectors for pre-crRNA array (FIG. 8A) or chimeric crRNA (represented by the short line downstream of the guide sequence insertion site and upstream of the EF1a promoter in FIG. 8B) with hSpCas9, showing location of various elements and the point of guide sequence insertion. The expanded sequence around the location of the guide sequence insertion site in FIG. 8B also shows a partial DR sequence (GTTTTAGAGCTA) (SEQ ID NO: 11) and a partial tracrRNA sequence (TAGCAAGTTAAAATAAGGCTAGTCCGTTTTT) (SEQ ID NO: 12). Guide sequences can be inserted between BbsI sites using annealed oligonucleotides. Sequence design for the oligonucleotides are shown below the schematic illustrations in FIG. 8, with appropriate ligation adapters indicated. WPRE represents the Woodchuck hepatitis virus post-transcriptional regulatory element. The efficiency of chimeric RNA-mediated cleavage was tested by targeting the same EMX1. locus described above. Using both Surveyor assay and Sanger sequencing of amplicons, Applicants confirmed that the chimeric RNA design facilitates cleavage of human EMX1 locus with approximately a 4.7% modification rate (FIG. 3).
  • Generalizability of CRISPR-mediated cleavage in eukaryotic cells was tested by targeting additional genomic loci in both human and mouse cells by designing chimeric RNA targeting multiple sites in the human EMX1 and PVALB, as well as the mouse Th loci. FIG. 13 illustrates the selection of some additional targeted protospacers in human PVALB (FIG. 13A) and mouse Th (FIG. 13B) loci. Schematics of the gene loci and the location of three protospacers within the last exon of each are provided. The underlined sequences include 30 bp of protospacer sequence and 3 bp at the 3′ end corresponding to the PAM sequences. Protospacers on the sense and anti-sense strands are indicated above and below the DNA sequences, respectively. A modification rate of 6.3% and 0.75% was achieved for the human PV4LB and mouse Th loci respectively, demonstrating the broad applicability of the CRISPR system in modifying different loci across multiple organisms (FIG. 5). While cleavage was only detected with one out of three spacers for each locus using the chimeric constructs, all target sequences were cleaved with efficiency of indel production reaching 27% when using the co-expressed pre-crRNA arrangement (FIGS. 6 and 13).
  • FIG. 11 provides a further illustration that SpCas9 can be reprogrammed to target multiple genomic loci in mammalian cells. FIG. 11A provides a schematic of the human EMX1 locus showing the location of five protospacers, indicated by the underlined sequences. FIG. 11B provides a schematic of the pre-crRNA/trcrRNA complex showing hybridization between the direct repeat region of the pre-crRNA and tracrRNA (top), and a schematic of a chimeric RNA design comprising a 20 bp guide sequence, and tracr mate and tracr sequences consisting of partial direct repeat and tracrRNA sequences hybridized in a hairpin structure (bottom). Results of a Surveyor assay comparing the efficacy of Cas9-mediated cleavage at five protospacers in the human EMX1 locus is illustrated in FIG. 11C. Each protospacer is targeted using either processed pre-crRNA/tracrRNA complex (crRNA) or chimeric RNA (chiRNA).
  • Since the secondary structure of RNA can be crucial for intermolecular interactions, a structure prediction algorithm based on minimum free energy and Boltzmann-weighted structure ensemble was used to compare the putative secondary structure of all guide sequences used in the genome targeting experiment (see e.g. Gruber et al., 2008, Nucleic Acids Research, 36: W70). Analysis revealed that in most cases, the effective guide sequences in the chimeric crRNA context were substantially free of secondary structure motifs, whereas the ineffective guide sequences were more likely to form internal secondary structures that could prevent base pairing with the target protospacer DNA. It is thus possible that variability in the spacer secondary structure might impact the efficiency of CRISPR-mediated interference when using a chimeric crRNA.
  • Further vector designs for SpCas9 are shown in FIG. 22, which illustrates single expression vectors incorporating a U6 promoter linked to an insertion site for a guide oligo, and a Cbh promoter linked to SpCas9 coding sequence. The vector shown in FIG. 22b includes a tracrRNA coding sequence linked to an H1 promoter.
  • In the bacterial assay, all spacers facilitated efficient CRISPR interference (FIG. 3C). These results suggest that there may be additional factors affecting the efficiency of CRISPR activity in mammalian cells.
  • To investigate the specificity of CRISPR-mediated cleavage, the effect of single-nucleotide mutations in the guide sequence on protospacer cleavage in the mammalian genome was analyzed using a series of EMX1-targeting chimeric crRNAs with single point mutations (FIG. 3A). FIG. 3B illustrates results of a Surveyor nuclease assay comparing the cleavage efficiency of Cas9 when paired with different mutant chimeric RNAs. Single-base mismatch up to 12-bp 5′ of the PAM substantially abrogated genomic cleavage by SpCas9, whereas spacers with mutations at farther upstream positions retained activity against the original protospacer target (FIG. 3B). In addition to the PAM, SpCas9 has single-base specificity within the last 12-bp of the spacer. Furthermore, CRISPR is able to mediate genomic cleavage as efficiently as a pair of TALE nucleases (TALEN) targeting the same EMX1 protospacer. FIG. 3C provides a schematic showing the design of TALENs targeting EMX1, and FIG. 3D shows a Surveyor gel comparing the efficiency of TALEN and Cas9 (n=3).
  • Having established a set of components for achieving CRISPR-mediated gene editing in mammalian cells through the error-prone NHEJ mechanism, the ability of CRISPR to stimulate homologous recombination (HR), a high fidelity gene repair pathway for making precise edits in the genome, was tested. The wild type SpCas9 is able to mediate site-specific DSBs, which can be repaired through both NHEJ and HR. In addition, an aspartate-to-alanine substitution (D10A) in the RuvC I catalytic domain of SpCas9 was engineered to convert the nuclease into a nickase (SpCas9n; illustrated in FIG. 4A) (see e.g. Sapranausaks et al., 2011, Nucleic Acids Research, 39: 9275; Gasiunas et al., 2012, Proc. Natl. Acad. Sci. USA, 109:E2579), such that nicked genomic DNA undergoes the high-fidelity homology-directed repair (HDR). Surveyor assay confirmed that SpCas9n does not generate indels at the EMX1 protospacer target. As illustrated in FIG. 4B, co-expression of EMX1-targeting chimeric crRNA with SpCas9 produced indels in the target site, whereas co-expression with SpCas9n did not (n=3). Moreover, sequencing of 327 amplicons did not detect any indels induced by SpCas9n. The same locus was selected to test CRISPR-mediated HR by co-transfecting HEK 293FT cells with the chimeric RNA targeting EMX1, hSpCas9 or hSpCas9n, as well as a HR template to introduce a pair of restriction sites (HindIII and NheI) near the protospacer. FIG. 4C provides a schematic illustration of the HR strategy, with relative locations of recombination points and primer annealing sequences (arrows). SpCas9 and SpCas9n indeed catalyzed integration of the HR template into the EMX1 locus. PCR amplification of the target region followed by restriction digest with HindIII revealed cleavage products corresponding to expected fragment sizes (arrows in restriction fragment length polymorphism gel analysis shown in FIG. 4D), with SpCas9 and SpCas9n mediating similar levels of HR efficiencies. Applicants further verified HR using Sanger sequencing of genomic amplicons (FIG. 4E). These results demonstrate the utility of CRISPR for facilitating targeted gene insertion in the mammalian genome. Given the 14-bp (12-bp from the spacer and 2-bp from the PAM) target specificity of the wild type SpCas9. the availability of a nickase can significantly reduce the likelihood of off-target modifications, since single strand breaks are not substrates for the error-prone NHEJ pathway.
  • Expression constructs mimicking the natural architecture of CRISPR loci with arrayed spacers (FIG. 2A) were constructed to test the possibility of multiplexed sequence targeting. Using a single CRISPR array encoding a pair of EMX1- and PVALB-targeting spacers, efficient cleavage at both loci was detected (FIG. 4F, showing both a schematic design of the crRNA array and a Surveyor blot showing efficient mediation of cleavage). Targeted deletion of larger genomic regions through concurrent DSBs using spacers against two targets within EMX1 spaced by 119 bp was also tested, and a 1.6% deletion efficacy (3 out of 182 amplicons; FIG. 4G) was detected. This demonstrates that the CRISPR system can mediate multiplexed editing within a single genome.
  • Example 2: CRISPR System Modifications and Alternatives
  • The ability to use RNA to program sequence-specific DNA cleavage defines a new class of genome engineering tools for a variety of research and industrial applications. Several aspects of the CRISPR system can be further improved to increase the efficiency and versatility of CRISPR targeting. Optimal Cas9 activity may depend on the availability of free Mg2+ at levels higher than that present in the mammalian nucleus (see e.g. Jinek et al., 2012, Science, 337:816), and the preference for an NGG motif immediately downstream of the protospacer restricts the ability to target on average every 12-bp in the human genome (FIG. 9, evaluating both plus and minus strands of human chromosomal sequences). Some of these constraints can be overcome by exploring the diversity of CRISPR loci across the microbial metagenome (see e.g. Makarova et al., 2011, Nat Rev Microbiol, 9:467). Other CRISPR loci may be transplanted into the mammalian cellular milieu by a process similar to that described in Example 1. For example, FIG. 10 illustrates adaptation of the Type II CRISPR system from CRISPR 1 of Streptococcus thermophilus LMD-9 for heterologous expression in mammalian cells to achieve CRISPR-mediated genome editing. FIG. 10A provides a Schematic illustration of CRISPR 1 from S. thermophilus LMD-9. FIG. 10B illustrates the design of an expression system for the S. thermophilus CRISPR system. Human codon-optimized hStCas9 is expressed using a constitutive EF1α promoter. Mature versions of tracrRNA and crRNA are expressed using the U6 promoter to promote precise transcription initiation. Sequences from the mature crRNA and tracrRNA are illustrated. A single base indicated by the lower case “a” in the crRNA sequence is used to remove the polyU sequence, which serves as a RNA polIII transcriptional terminator. FIG. 10C provides a schematic showing guide sequences targeting the human EMX1 locus. FIG. 10D shows the results of hStCas9-mediated cleavage in the target locus using the Surveyor assay. RNA guide spacers 1 and 2 induced 14% and 6.4%, respectively. Statistical analysis of cleavage activity across biological replica at these two protospacer sites is also provided in FIG. 5. FIG. 14 provides a schematic of additional protospacer and corresponding PAM sequence targets of the S. thermophilus CRISPR system in the human EMX1 locus. Two protospacer sequences are highlighted and their corresponding PAM sequences satisfying NNAGAAW motif are indicated by underlining 3′ with respect to the corresponding highlighted sequence. Both protospacers target the anti-sense strand.
  • Example 3: Sample Target Sequence Selection Algorithm
  • A software program is designed to identify candidate CRISPR target sequences on both strands of an input DNA sequence based on desired guide sequence length and a CRISPR motif sequence (PAM) for a specified CRISPR enzyme. For example, target sites for Cas9 from S. pyogenes, with PAM sequences NGG, may be identified by searching for 5′-Nx-NGG-3′ both on the input sequence and on the reverse-complement of the input. Likewise, target sites for Cas9 of S. thermophilus CRISPR1, with PAM sequence NNAGAAW, may be identified by searching for 5′-Nx-NNAGAAW-3′ both on the input sequence and on the reverse-complement of the input. Likewise, target sites for Cas9 of S. thermophilus CRISPR3, with PAM sequence NGGNG, may be identified by searching for 5′-Nx-NGGNG-3′ both on the input sequence and on the reverse-complement of the input. The value “x” in N, may be fixed by the program or specified by the user, such as 20.
  • Since multiple occurrences in the genome of the DNA target site may lead to nonspecific genome editing, after identifying all potential sites, the program filters out sequences based on the number of times they appear in the relevant reference genome. For those CRISPR enzymes for which sequence specificity is determined by a ‘seed’ sequence, such as the 11-12 bp 5′ from the PAM sequence, including the PAM sequence itself, the filtering step may be based on the seed sequence. Thus, to avoid editing at additional genomic loci, results are filtered based on the number of occurrences of the seed:PAM sequence in the relevant genome. The user may be allowed to choose the length of the seed sequence. The user may also be allowed to specify the number of occurrences of the seed:PAM sequence in a genome for purposes of passing the filter. The default is to screen for unique sequences. Filtration level is altered by changing both the length of the seed sequence and the number of occurrences of the sequence in the genome. The program may in addition or alternatively provide the sequence of a guide sequence complementary to the reported target sequence(s) by providing the reverse complement of the identified target sequence(s). An example visualization of some target sites in the human genome is provided in FIG. 18.
  • Further details of methods and algorithms to optimize sequence selection can be found in U.S. application Ser. No. 61/064,798 (Attorney docket 44790.11.2022; Broad Reference BI-2012/084); incorporated herein by reference.
  • Example 4: Evaluation of Multiple Chimeric crRNA-tracrRNA Hybrids
  • This example describes results obtained for chimeric RNAs (chiRNAs; comprising a guide sequence, a tracr mate sequence, and a tracr sequence in a single transcript) having tracr sequences that incorporate different lengths of wild-type tracrRNA sequence. FIG. 16a illustrates a schematic of a bicistronic expression vector for chimeric RNA and Cas9. Cas9 is driven by the CBh promoter and the chimeric RNA is driven by a U6 promoter. The chimeric guide RNA consists of a 20 bp guide sequence (Ns) joined to the tracr sequence (running from the first “U” of the lower strand to the end of the transcript), which is truncated at various positions as indicated. The guide and tracr sequences are separated by the tracr-mate sequence GUUUUAGAGCUA (SEQ ID NO: 13) followed by the loop sequence GAAA. Results of SURVEYOR assays for Cas9-mediated indels at the human EMX1 and PVALB loci are illustrated in FIGS. 16b and 16c , respectively. Arrows indicate the expected SURVEYOR fragments. ChiRNAs are indicated by their “+n” designation, and crRNA refers to a hybrid RNA where guide and tracr sequences are expressed as separate transcripts. Quantification of these results, performed in triplicate, are illustrated by histogram in FIGS. 17a and 17b , corresponding to FIGS. 16b and 16c , respectively (“N.D.” indicates no indels detected). Protospacer IDs and their corresponding genomic target, protospacer sequence, PAM sequence, and strand location are provided in Table D. Guide sequences were designed to be complementary to the entire protospacer sequence in the case of separate transcripts in the hybrid system, or only to the underlined portion in the case of chimeric RNAs.
  • TABLE D
    proto- SEQ
    spacer genomic ID
    ID target protospacer sequence (5′ to 3′) PAM NO: strand
    1 EMX1 GGACATCGATGTCACCTCCAATGACTAGGG TGG 14 +
    2 EMX1 CATTGGAGGTGACATCGATGTCCTCCCCAT TGG 15 -
    3 EMX1 GGAAGGGCCTGAGTCCGAGCAGAAGAAGAA GGG 16 +
    4 PVALB GGTGGCGAGAGGGGCCGAGATTGGGTGTTC AGG 17 +
    5 PVALB ATGcAGGAGGGTGGCGAGAGGGGCCGAGAT TGG 18 +
  • Further details to optimize guide sequences can be found in U.S. application Ser. No. 61/836,127 (Attorney docket 44790.08.2022; Broad Reference B1-2013/004G); incorporated herein by reference.
  • Initially, three sites within the EMX1 locus in human HEK 293FT cells were targeted. Genome modification efficiency of each chiRNA was assessed using the SURVEYOR nuclease assay, which detects mutations resulting from DNA double-strand breaks (DSBs) and their subsequent repair by the non-homologous end joining (NHEJ) DNA damage repair pathway. Constructs designated chiRNA(+n) indicate that up to the +n nucleotide of wild-type tracrRNA is included in the chimeric RNA construct, with values of 48, 54, 67, and 85 used for n. Chimeric RNAs containing longer fragments of wild-type tracrRNA (chiRNA(+67) and chiRNA(+85)) mediated DNA cleavage at all three EMX1 target sites, with chiRNA(+85) in particular demonstrating significantly higher levels of DNA cleavage than the corresponding crRNA/tracrRNA hybrids that expressed guide and tracr sequences in separate transcripts (FIGS. 16b and 17a ). Two sites in the PVALB locus that yielded no detectable cleavage using the hybrid system (guide sequence and tracr sequence expressed as separate transcripts) were also targeted using chiRNAs. chiRNA(+67) and chiRNA(+85) were able to mediate significant cleavage at the two PVALB protospacers (FIGS. 16c and 17b ).
  • For all five targets in the EMX1 and PVALB loci, a consistent increase in genome modification efficiency with increasing tracr sequence length was observed. Without wishing to be bound by any theory, the secondary structure formed by the 3′ end of the tracrRNA may play a role in enhancing the rate of CRISPR complex formation.
  • Example 5: Cas9 Diversity
  • The CRISPR-Cas system is an adaptive immune mechanism against invading exogenous DNA employed by diverse species across bacteria and archaea. The type II CRISPR-Cas9 system consists of a set of genes encoding proteins responsible for the “acquisition” of foreign DNA into the CRISPR locus, as well as a set of genes encoding the “execution” of the DNA cleavage mechanism; these include the DNA nuclease (Cas9), a non-coding transactivating cr-RNA (tracrRNA), and an array of foreign DNA-derived spacers flanked by direct repeats (crRNAs). Upon maturation by Cas9, the tracRNA and crRNA duplex guide the Cas9 nuclease to a target DNA sequence specified by the spacer guide sequences, and mediates double-stranded breaks in the DNA near a short sequence motif in the target DNA that is required for cleavage and specific to each CRISPR-Cas system. The type II CRISPR-Cas systems are found throughout the bacterial kingdom and highly diverse in Cas9 protein sequence and size, tracrRNA and crRNA direct repeat sequence, genome organization of these elements, and the motif requirement for target cleavage. One species may have multiple distinct CRISPR-Cas systems.
  • Applicants evaluated 207 putative Cas9s from bacterial species identified based on sequence homology to known Cas9s and structures orthologous to known subdomains, including the HNH endonuclease domain and the RuvC endonuclease domains [information from the Eugene Koonin and Kira Makarova]. Phylogenetic analysis based on the protein sequence conservation of this set revealed five families of Cas9s, including three groups of large Cas9s (˜1400 amino acids) and two of small Cas9s (˜1100 amino acids) (see FIGS. 19 and 20A-F).
  • Further details of Cas9s and mutations of the Cas9 enzyme to convert into a nickase or DNA binding protein and use of same with altered functionality can be found in U.S. application Ser. Nos. 61/836,101 and 61/835,936 (Attorney docket 44790.09.2022 and 4790.07.2022 and Broad Reference BI-2013/004E and BI-2013/004F respectively) incorporated herein by reference.
  • Example 6: Cas9 Orthologs
  • Applicants analyzed Cas9 orthologs to identify the relevant PAM sequences and the corresponding chimeric guide RNA. Having an expanded set of PAMs provides broader targeting across the genome and also significantly increases the number of unique target sites and provides potential for identifying novel Cas9s with increased levels of specificity in the genome.
  • The specificity of Cas9 orthologs can be evaluated by testing the ability of each Cas9 to tolerate mismatches between the guide RNA and its DNA target. For example, the specificity of SpCas9 has been characterized by testing the effect of mutations in the guide RNA on cleavage efficiency. Libraries of guide RNAs were made with single or multiple mismatches between the guide sequence and the target DNA. Based on these findings, target sites for SpCas9 can be selected based on the following guidelines:
  • To maximize SpCas9 specificity for editing a particular gene, one should choose a target site within the locus of interest such that potential ‘off-target’ genomic sequences abide by the following four constraints: First and foremost, they should not be followed by a PAM with either 5′-NGG or NAG sequences. Second, their global sequence similarity to the target sequence should be minimized. Third, a maximal number of mismatches should lie within the PAM-proximal region of the off-target site. Finally, a maximal number of mismatches should be consecutive or spaced less than four bases apart.
  • Similar methods can be used to evaluate the specificity of other Cas9 orthologs and to establish criteria for the selection of specific target sites within the genomes of target species. As mentioned previously phylogenetic analysis based on the protein sequence conservation of this set revealed five families of Cas9s, including three groups of large Cas9s (˜1400 amino acids) and two of small Cas9s (˜1100 amino acids) (see FIGS. 19 and 20A-F). Further details on Cas orthologs can be found in U.S. application Ser. Nos. 61/836,101 and 61/835,936 (Attorney docket 44790.09.2022 and 4790.07.2022 and Broad Reference BI-2013/004E and BI-2013/004F respectively) incorporated herein by reference.
  • Example 7: Engineering of Plants (Micro-Algae) Using Cas9 to Target and Manipulate Plant Genes
  • Methods of Delivering Cas9
  • Method 1: Applicants deliver Cas9 and guide RNA using a vector that expresses Cas9 under the control of a constitutive promoter such as Hsp70A-Rbc S2 or Beta2-tubulin.
  • Method 2: Applicants deliver Cas9 and T7 polymerase using vectors that expresses Cas9 and T7 polymerase under the control of a constitutive promoter such as Hsp70A-Rbc S2 or Beta2-tubulin. Guide RNA will be delivered using a vector containing T7 promoter driving the guide RNA.
  • Method 3: Applicants deliver Cas9 mRNA and in vitro transcribed guide RNA to algae cells. RNA can be in vitro transcribed. Cas9 mRNA will consist of the coding region for Cas9 as well as 3′UTR from Cop1 to ensure stabilization of the Cas9 mRNA.
  • For Homologous recombination, Applicants provide an additional homology directed repair template.
  • Sequence for a cassette driving the expression of Cas9 under the control of beta-2 tubulin promoter, followed by the 3′ UTR of Cop1.
  • (SEQ ID NO: 19)
    TCTTTCTTGCGCTATGACACTTCCAGCAAAAGGTAGGGCGGGCTGCGAGA
    CGGCTTCCCGGCGCTGCATGCAACACCGATGATGCTTCGACCCCCCGAAG
    CTCCTTCGGGGCTGCATGGGCGCTCCGATGCCGCTCCAGGGCGAGCGCTT
    TTTTAAATAGCCAGGCCCCCGATTGCAAAGACATTATAGCGAGCTACCAA
    AGCCATATTCAAACACCTAGATCACTACCACTTCTACACAGGCCACTCGA
    GCTTGTGATCGCACTCCGCTAAGGGGGCGCCTCTTCCTCTTCGTTTCAGT
    CACAACCCGCAAACATGTACCCATACGATGTTCCAGATTACGCTTCGCCG
    AAGAAAAAGCGCAAGGTCGAAGCGTCCGACAAGAAGTACAGCATCGGCCT
    GGACATCGGCACCAACTCTGTGGGCFGGGCCGTGATCACCGACGAGTACA
    AGGTGCCCAGCAAGAAATTCAAGGTGCTGGGCAACACCGACCGGCACAGC
    ATCAAGAAGAACCTGATCGGAGCCCTGCTGTTCGACAGCGGCGAAACAGC
    CGAGGCCACCCGGCTGAAGAGAACCGCCAGAAGAAGATACACCAGACGGA
    AGAACCGGATCTGCTATCTGCAAGAGATCTTCAGCAACGAGATGGCCAAG
    GTGGACGACAGCTTCTTCCACAGACTGGAAGAGTCCTTCCTGGTGGAAGA
    GGATAAGAAGCACGAGCGGCACCCCATCTTCGGCAACATCGTGGACGAGG
    TGGCCTACCACGAGAAGTACCCCACCATCTACCACCTGAGAAAGAAACTG
    GTGGACAGCACCGACAAGGCCGACCTGCGGCTGATCTATCTGGCCCTGGC
    CCACATGATCAAGTTCCGGGGCCACTTCCTGATCGAGGGCGACCTGAACC
    CCGACAACAGCGACGTGGACAAGCTGTTCATCCAGCTGGTGCAGACCTAC
    AACCAGCTGTTCGAGGAAAACCCCATCAACGCCAGCGGCGTGGACGCCAA
    GGCCATCCTGTCTGCCAGACTGAGCAAGAGCAGACGGCTGGAAAATCTGA
    TCGCCCAGCTGCCCGGCGAGAAGAAGAATGGCCTGTTCGGCAACCTGATT
    GCCCTGAGCCTGGGCCTGACCCCCAACTTCAAGAGCAACTTCGACCTGGC
    CGAGGATGCCAAACTGCAGCTGAGCAAGGACACCTACGACGACGACCTGG
    ACAACCTGCTGGCCCAGATCGGCGACCAGTACGCCGACCTGTTTGTGGCC
    GCCAAGAACCTGTCCGACGCCATCCTGCTGAGCGACATCCTGAGAGTGAA
    CACCGAGATCACCAAGGCCCCCCTGAGCGCCTCTATGATCAAGAGATACG
    ACGAGCACCACCAGGACCTGACCCTGCTGAAAGCTCTCGTGCGGCAGCAG
    CTGCCTGAGAAGTACAAAGAGATTTTCTTCGACCAGAGCAAGAACGGCTA
    CGCCGGCTACATTGACGGCGGAGCCAGCCAGGAAGAGTTCTACAAGTTCA
    TCAAGCCCATCCTGGAAAAGATGGACGGCACCGAGGAACTGCTCGTGAAG
    CTGAACAGAGAGGACCTGCTGCGGAAGCAGCGGACCTTCGACAACGGCAG
    CATCCCCCACCAGATCCACCTGGGAGAGCTGCACGCCATTCTGCGGCGGC
    AGGAAGATTTTTACCCATTCCTGAAGGACAACCGGGAAAAGATCGAGAAG
    ATCCTGACCTTCCGCATCCCCTACTACGTGGGCCCTCTGGCCAGGGGAAA
    CAGCAGATTCGCCTGGATGACCAGAAAGAGCGAGGAAACCATCACCCCCT
    GGAACTTCGAGGAAGTGGTGGACAAGGGCGCTTCCGCCCAGAGCTTCATC
    GAGCGGATGACCAACTTCGATAAGAACCTGCCCAACGAGAAGGTGCTGCC
    CAAGCACAGCCTGCTGTACGAGTACTTCACCGTGTATAACGAGCTGACCA
    AAGTGAAATACGTGACCGAGGGAATGAGAAAGCCCGCCTTCCTGAGCGGC
    GAGCAGAAAAAGGCCATCGTGGACCTGCTGTTCAAGACCAACCGGAAAGT
    GACCGTGAAGCAGCTGAAAGAGGACTACTTCAAGAAAATCGAGTGCTTCG
    ACTCCGTGGAAATCTCCGGCGTGGAAGATCGGTTCAACGCCTCCCTGGGC
    ACATACCACGATCTGCTGAAAATTATCAAGGACAAGGACTTCCTGGACAA
    TGAGGAAAACGAGGACATTCTGGAAGATATCGTGCTGACCCTGACACTGT
    TTGAGGACAGAGAGATGATCGAGGAACGGCTGAAAACCTATGCCCACCTG
    TTCGACGACAAAGTGATGAAGCAGCTGAAGCGGCGGAGATACACCGGCTG
    GGGCAGGCTGAGCCGGAAGCTGATCAACGGCATCCGGGACAAGCAGTCCG
    GCAAGAGAATCCTGGATTTCCTGAAGTCCGACGGETTCGCCAACAGAAAC
    TTCATGCAGCTGATCCACGACGACAGCCTGACCTTTAAAGAGGACATCCA
    GAAAGCCCAGGTGTCCGGCCAGGGCGATAGCCTGCACGAGCACATTGCCA
    ATCTGGCCGGCAGCCCCGCCATTAAGAAGGGCATCCTGCAGACAGTGAAG
    GTGGTGGACGAGCTCGTGAAAGTGATGGGCCGGCACAAGCCCGAGAACAT
    CGTGATCGAAATGGCCAGAGAGAACCAGACCACCCAGAAGGGACAGAAGA
    ACAGCCGCGAGAGAATGAAGCGGATCGAAGAGGGCATCAAAGAGCTGGGC
    AGCCAGATCCTGAAAGAACACCCCGTGGAAAACACCCAGCTGCAGAACGA
    GAAGCTGTACCTGTACTACCTGGAGAATGGGCGGGATATGTACGTGGACC
    AGGAACTGGACATCAACCGGCTGTCCGACTACGATGTGGACCATATCGTG
    CCTCAGAGCTTTCTGAAGGACGACTCCATCGACAACAAGGTGCTGACCAG
    AAGCGACAAGAACCGGGGCAAGAGCGACAACGTGCCCTCCGAAGAGGTCG
    TGAAGAAGATGAAGAACTACTGGCGGCAGCTGCTGAACGCCAAGCTGATT
    ACCCAGAGAAAGTTCGACAATCTGACCAAGGCCGAGAGAGGCCTGCCTGA
    GCGAACTGGATAAGGCCGGCTTCATCAAGAGACAGCTGGTGGAAACCCGG
    CAGATCACAAAGCACGTGGCACAGATCCTGGACTCCCGGATGAACACTAA
    GTACGACGAGAATGACAAGCTGATCCGGGAAGTGAAAGTGATCACCCTGA
    AGTCCAAGCTGGTGTCCGATTTCCGGAAGGATTTCCAGTTTTACAAAGTG
    CGCGAGATCAACAACTACCACCACGCCCACGACGCCTACCTGAACGCCGT
    CGTGGGAACCGCCCTGATCAAAAAGTACCCTAAGCTGGAAAGCGAGTTCG
    TGTACGGCGACTACAAGGTGTACGACGTGCGGAAGATGATCGCCAAGAGC
    GAGCAGGAAATCGGCAAGGCTACCGCCAAGTACTTCTTCTACAGCAACAT
    CATGAACTTTTTCAAGACCGAGATTACCCTGGCCAACGGCGAGATCCGGA
    AGCGGCCTCTGATCGAGACAAACGGCGAAACCGGGGAGATCGTGTGGGAT
    AAGGGCCGGGATTTTGCCACCGTGCGGAAAGTGCTGAGCATGCCCCAAGT
    GAATATCGTGAAAAAGACCGAGGTGCAGACAGGCGGCTTCAGCAAAGAGT
    CTATCCTGCCCAAGAGGAACAGCGATAAGCTGATCGCCAGAAAGAAGGAC
    TGGGACCCTAAGAAGTACGGCGGCTTCGACAGCCCCACCGTGGCCTATTC
    TGTGCTGGTGGTGGCCAAAGTGGAAAAGGGCAAGTCCAAGAAACTGAAGA
    GTGTGAAAGAGCTGCTGGGGATCACCATCATGGAAAGAAGCAGCTTCGAG
    AAGAATCCCATCGACTTTCTGGAAGCCAAGGGCTACAAAGAAGTGAAAAA
    GGACCTGATCATCAAGCTGCCTAAGTACTCCCTGTTCGAGCTGGAAAACG
    GCCGGAAGAGAATGCAAGCCTCTGCCGGCGAACTGCAGAAGGGAAACGAA
    CTGGCCCTGCCCTCCAAATATGTGAACTTCCTGTACCTGGCCAGCCACTA
    TGAGAAGCTGAAGGGCTCCCCCGAGGATAATGAGCAGAAACAGCTGTTTG
    TGGAACAGCACAAGCACTACCTGGACGAGATCATCGAGCAGATCAGCGAG
    TTCTCCAAGAGAGTGATCCTGGCCGACGCTAATCTGGACAAAGTGCTGTC
    CGCCTACAACAAGCACCGGGATAAGCCCATCAGAGAGCAGGCCGAGAATA
    TCATCCACCTGTTTACCCTGACCAATCTGGGAGCCCCTGCCGCCTTCAAG
    TACTTTGACACCACCATCGACCGGAAGAGGTACACCAGCACCAAAGAGCT
    TGGTGGACGCCACCCTGATCCACCAGAGCATCACCGGCCTGTACGAGACA
    CGGATCGACCTGTCTCAGCTGGGAGGCGACAGCCCCAAGAAGAAGAGAAA
    GGTGGAGGCCAGCTAAGGATCCGGCAAGACTGGCCCCGCTTGGCAACGCA
    ACAGTGAGCCCCTCCCTAGTGTGTTTGGGGATGTGACTATGTATTCGTGT
    GTTGGCCAACGGGTCAACCCGAACAGATTGATACCCGCCTTGGCATTTCC
    TGTCAGAATGTAACGTCAGTTGATGGTACT
  • Sequence for a cassette driving the expression of T7 polymerase under the control of beta-2 tubulin promoter, followed by the 3′ UTR of Cop1:
  • (SEQ ID NO: 20)
    TCTTTCTTGCGCTATGACACTTCCAGCAAAAGGTAGGGCGGGGTGCGAGA
    CGGCTTCCCGGCGCTGCATGCAACACCGATGATGCTTCGACCCCCCGAAG
    CTCCTTCGGGGCTGCATGGGCGCTCCGATGCCGCTCCAGGGCGAGCGCTG
    TTTAAATAGCCAGGCCCCCGATTGCAAAGACATTATAGCGAGCTACCAAA
    GCCATATTCAAACACCTAGATCACTACCACTTCTACACAGGCCACTCGAG
    CTTGTGATCGCACTCCGCTAAGGGGGCGCCTCTTCCTCTTCGTTTCAGTC
    ACAACCCGCAAACatgcctaagaagaagaggaaggttaacacgattaaca
    tcgctaagaacgacttctctgacatcgaactggctgctatcccgttcaac
    actoggctgaccattacggtgagcgtttagctcgcgaacagttggccctt
    gagcatgagtcttacgagatgggtgaagcacgcttccgcaagatgtttga
    gcgtcaacttaaagctggtgaggttgcggataacgctgccgccaagccta
    catcactaccctactccctaagatgattgcacgcatcaacgactggtttg
    aggaagtgaaagctaagcgcggcaagcgcccgacagccaccagttcctgc
    aagaaatcaagccggaagccgtagcgtacatcaccattaagaccactctg
    gcttgcctaaccagtgctgacaatacaaccgttcaggctgtagcaagcgc
    aatcggtcgggccattgaggacgaggctcgcttcggtcgtatccgtgacc
    ttgaagctaagcacttcaagaaaaacgagaggaacaactcaacaagcgcg
    tagggcacgtctacaagaaagcatttatgcaagagtcgaggagacatgct
    ctctaagggtctactcggtggcgaggcgtggtcttcgtggcataaggaag
    actctattcatgtaggagtacgctgcatcgagatgctcattgagtcaacc
    ggaatggttagcttacaccgccaaaatgctggcgtagtaggtcaagactc
    tgagactatcgaactcgcacctgaatacgctgaggctatcgcaacccgtg
    caggtgcgctggctggcatctctccgatgttccaaccttgcgtagttcct
    cctaagccgtggactggcattactggtggtggctattgggctaacggtcg
    tcgtcctctggcgctggtgcgtactcacagtaagaaagcactgatgcgct
    acgaagacgtttacatgcctgaggtgtacaaagcgattaacattgcgcaa
    aacaccgcatggaaaatcaacaagaaagtcctagcggtcgccaacgtaat
    caccaagtggaagcattgtccggtcgaggacatctttgcgattgagcgtg
    aagaactcccgatgaaaccggaagacatcgacatgaatcctgaggactca
    ccgcgtggaaacgtgctgccgctgctgtgtaccgcaaggacaaggctcgc
    aagtctcgccgtatcagccttgagttcatgcttgagcaagccaataagtt
    tgctaaccataaggccataggttcccttacaacatggactggcgcggtcg
    tgtttacgctgtgtcaatgttcaacccgcaaggtaacgatatgaccaaag
    gactgcttacgctggcgaaaggtaaaccaatcggtaaggaaggttactac
    tggctgaaaatccacggtgcaaactgtgcgggtgtcgacaaggttccgtt
    ccctgagcgcatcaagttcattgaggaaaaccacgagaacatcatggctt
    gcgctaagtctccactggagaacacttggtgggctgagcaagattctccg
    ttctgcttccttgcgttctgctttgagtacgctggggtacagcaccacgg
    cctgagctataactgctcccaccgctggcgtttgacgggtcttgctctgg
    catccagcacttctccgcgatgaccgagatgaggtaggtggtcgcgcggt
    taacttgcttcctagtgaaaccgttcaggacatctacgggattgttgcta
    agaaagtcaacgagattctacaagcagacgcaatcaatgggaccgataac
    gaagtagttaccgtgaccgatgagaacactggtgaaatctctgagaaagt
    caagctgggcactaaggcactggctggtcaatggctggcttacggtgtta
    ctcgcagtgtgactaagcgacagtcatgacgctggcttacgggtccaaag
    agttcggcttccgtcaacaagtgctggaagataccattcagccagctatt
    gattccggcaagggtctgatgttcactcagccgaatcaggctgctggata
    catggctaagctgatttgggaatctgtgagcgtgacggtggtagctgcgg
    ttgaagcaatgaactggcttaagtctgctgctaagctgctggctgctgag
    gtcaaagataagaagactggagagattcttcgcaagcgttgcgctgtgca
    ttgggtaactcctgatggtttccctgtgtggcaggaatacaagaagccta
    ttcagacgcgcttgaacctgatgttcctcggtcagttccgcttacagcct
    accattaacaccaacaaagatagcgagattgatgcacacaaacaggagtc
    tggtatcgctcctaactttgtacacagccaagacggtagccaccttcgta
    agactgtagtgtgggcacacgagaagtacggaatcgaatcttttgcactg
    attcacgactccttcggtacgattccggctgacgctgcgaacctgttcaa
    agcagtgcgcgaaactatggttgacacatatgagtcttgtgatgtactgg
    ctgatactacgaccagttcgagaccagageacgagtctcaattggacaaa
    atgccagcacttccggctaaaggtaacttgaacctccgtgacatcttaga
    gtcggacttcgcgttcgcgtaaGGATCCGGCAAGACTGGCCCCGCTTGGC
    AACGCAACAGTGAGCCCCTCCCTAGTGTGTTTGGGGATGTGACTATGTAT
    TCGTGTGTTGGCCAACGGGTCAACCCGAACAGATTGATACCCGCCTTGGC
    ATTTCCTGTCAGAATGTAACGTCAGTTGATGGTACT
  • Sequence of guide RNA driven by the T7 promoter (T7 promoter, Ns represent targeting sequence):
  • (SEQ ID NO: 21)
    gaaatTAATACGACTCACTATANNNNNNNNNNNNNNNNNNNNgttttaga
    gctaGAAAtagcaagttaaaataaggctagtccgttatcaacttgaaaaa
    gtggcaccgagtcggtgcttttttt 
  • Gene Delivery:
  • Chlamydomonas reinhardtii strain CC-124 and CC-125 from the Chlamydomonas Resource Center will be used for electroporation. Electroporation protocol follows standard recommended protocol from the GeneArt Chlamydomonas Engineering kit.
  • Also, Applicants generate a line of Chlamydomonas reinhardtii that expresses Cas9 constitutively. This can be done by using pChlamy1 (linearized using PvuI) and selecting for hygromycin resistant colonies. Sequence for pChlamy1 containing Cas9 is below. In this way to achieve gene knockout one simply needs to deliver RNA for the guideRNA. For homologous recombination Applicants deliver guideRNA as well as a linearized homologous recombination template.
  • pChlamy1-Cas9:
    (SEQ ID NO: 22)
    TGCGGTATTTCACACCGCATCAGGTGGCACTTTTCGGGGAAATGTGCGCG
    GAACCCCTATGTTTATTTTTCTAANTACATTCAAATATTTTATCCGCTCA
    TGAGATTATCAAAAAGGATCTTCACCTAGATCCTTTTAAATTAAAAATGA
    AGTTTTAAATCAATCTAAAGTATATATGAGTAAACTTGGTCTGACAGTTA
    CCAATGCTTAATCAGTGAGGCACCTATCTCAGCGATCTGTCTATTTCGTT
    CATCCATAGTTGCCTGACTCCCCGTCGTGTAGATAACTACGATACGGGAG
    GGCTTACCATCTGGCCCCAGTGCTGCAATGATACCGCGAGACCCACGCTC
    ACCGGCTCCAGATTTATCAGCAATAAACCAGCCAGCCGGAAGGGCCGAGC
    GCAGAAGTGGTCCTGCAAGTTATCCGCCTCCATCCAGTCTATTAATTGTT
    GCCGGGAAGCTAGAGTAAGTAGTTCGCCAGTTAATAGTTTGCGCAACGTT
    GTTGCCATTTGCTACAGGCATCGTGGTGTCACGCTCGTCGTTTGGTATGG
    CTCATTCAGCTCCGGTTCCCAACGATCAAGGCGAGTTACATGATCCCCCA
    TGTTGTGCAAAAAAGCGGTTAGCTCCTTCGGTCCTCCGATCGTTGTCAGA
    AGTAAGTTGGCCGCAGTGTTATCACTCATGGTTATGGCAGCACTGCATAA
    TTCTCTTACTGTCATGCCATCCGTAAGATGCTTTTCTGTGACTGGTGAGT
    ACTCAACCAAGTCATTCTGAGAATAGTTTTATGCGGCGACCGAGTTGCTC
    TTGCCCGGCGTCAATACGGGATAATACCGCGCCACATAGCAGAACTTTAA
    AAGTGCTCATCATTGGAAAACGTTCTTCGGGGCGAAAACTCTCAAGGATC
    TTACCGCTGTTGAGATCCAGTTCGATGTAACCCACTCGTGCACCCAACTG
    ATCTTCAGCATCTTTTACTTTCACCAGCGTTTCTGGGTGAGCAAAAACAG
    GAAGGCAAAATGCCGCAAAAAAGGGAATAAGGGCGACACGGAAATGTTGA
    ATACTCATACTCTTCGTTTTCAATATTTTTTGAAGCATTTATCAGGGTTA
    TTGTCTCATGACCAAAATCCCTTAACGTGAGTTTTCGTTCCACTGAGCGT
    CAGACCCCGTAGAAAAGATCAAAGGATCTTCTTGAGATCCTTTTTTTCTG
    CGCGTAATCTGCTGCTTGCAAACAAAAAAACCACCGCTACCAGCGGTGGT
    TTGTTTGCCGGATCAAGAGCTACCAACTCTTTTTCCGAAGGTAACTGGCT
    TCAGCAGAGCGCAGATACCAAATACTGTTCTTCTAGTGTAGCCGTAGTTA
    GGCCACCACTTCAAGAACTCTGTAGCACCGCCTACATACCTCGCTCTGCT
    AATCCTGTTACCAGTGGCTGTTGCCAGTGGCGATAAGTCGTGTGTACCGG
    GTTGGACTCAAGACGATAGTTACCGGATAAGGCGCAGCGGTCGGGCTGAA
    CGGGGGGTTCGTGCACACAGCCCAGCTTGGAGCGAACGACCTACACCGAA
    CTGAGATACCTACAGCGTGAGCTATGAGAAAGCGCCACGCTTCCCGAAGG
    GAGAAAGGCGGACAGGTATCCGGTAAGCGGCAGGGTCGGAACAGGAGAGC
    GCACGAGGGAGCTTCCAGGGGGAAACGCCTGGTATCTTTATAGTCCTGTC
    GGGTTTCGCCACGCTGACTTGAGCGTCGATTTTTTGTGATGCTCGTCAGG
    GGGGCGGAGCCTATGGAAAAACGCCAGCAACGCGGCCTTTTTACGGTTCC
    TGGCCTTTTGCTGGCCTTTTGCTCACATGTTGTTCCTGCGTTATCCCCTG
    ATTTCTGTGGATAACCGTATTACCGCCTTTGAGTGAGCTGATACCGCTCG
    CCGCAGCCGAACGACCGAGCGCAGCGAGTCAGTGAGCGAGGAAGCGTTCG
    CTGAGGCTTGACATGATTGGTGCGTATGTTTGTATGAAGCTACAGGACTG
    ATTTGGCGGGCTATGAGGGCGGGGGAAGCTCTGGAAGGGCCGCGATGGGG
    CGCGCGGCGTCCAGAAGGCGCCATACGGCCCGCTGGCGGCACCCATCCGG
    TATAAAAGCCCGCGACCCCGAACGGTGACCTCCACTTTCAGCGACAAACG
    AGCACTTATACATACGCGACTATTCTGCCGCTATTTACATTTAACCACTC
    AGCTTTAGCTTTTAAGATCCCATCAAGCTTGCATGCCGGGCGCGCCAGAA
    GGAGCGCAGCCAAACCAGGATGATGTTTTTGATGGGGTTTTTTGAGCACT
    TGCAACCCTTATCCGGAAGCCCCCTGGCCCACAAAGGCTAGGCGCCAATG
    CAAGCAGTTCGCATGCAGCCCCTGGAGCGGTGCCCTCCTGATAAACCGGC
    CAGGGGGCCTATGTTCTTTACTTTTTTACAAGAGAAGTCACTCAACATCT
    TAAACUGGCCAGGTGAGTCGACGAGCAAGCCCGGCGGATCAGGCAGCGTG
    CTTGCAGATTTGACTTGCAACGCCCGCATTGTGTCGACGAAGGCTTTTGG
    CTCCTCTGTCGCTGTCTCAAGCAGCATCTAACCCTGCGTCGCCGTTTCCA
    TTTGCAGGAGATTCGAGGTACCATGTACCCATACGATGTTCCAGATTACG
    CTTCGCCGAAGAAAAAGCGCAAGGTCGAAGCGTCCGACAAGAAGTACAGC
    ATCGGCCTGGACATCGGCACCAACTCTGTGGGCTGGGCCGTGATCACCGA
    CGAGTACAAGGTGCCCAGCAAGAAATTCAAGGTGCTGGGCAACACCGACC
    GGCACAGCATCAAGAAGAACCTGATTTCGGAGCCCTGCTTTGTTCGACAG
    CGGCGAAACAGCCGAGGCCACCCGGCTGAAGAGAACCGCCAGAAGAAGAT
    ACACCAGACGGAAGAACCGGATCTGCTATCTGCAAGAGATCTTCAGCAAC
    GAGATGGCCAAGGTGGACGACAGCTTCTTCCACAGACTGGAAGAGTCCTC
    CCTGGTGGAAGAGGATAAGAAGCACGAGCGGCACCCCATCTTCGGCAACA
    TCGTGGACGAGGTGGCCTACCACGAGAAGTACCCCACCATCTACCACCTG
    AGAAAGAAACTGGTGGACAGCACCGACAAGGCCGACCTGCGGCTGATCTA
    TCTGGCCCTGGCCCACATGATCAAGTTCCGGGGCCACTTCCTGATCGAGG
    GCGACCTGAACCCCGACAACAGCGACGTGGACAAGCTGTTCATCCAGCTG
    GTGCAGACCTACAACCAGCTGTTCGAGGAAAACCCCATCAACGCCAGCGG
    CGTGGACGCCAAGGCCATCCTGTCTGCCAGACTGAGCAAGAGCAGACGGC
    TGGAAAATCTGATCGCCCAGCTGCCCGGCGAGAAGAAGAATGGCCTGTTC
    GGCAACCTGATTGCCCTGAGCCTGGGCCTGACCCCCAACTTCAAGAGCAA
    CTTCGACCTGGCCGAGGATGCCAAACTGCAGCTGAGCAAGGACACCTACG
    ACGACGACCTGGACAACCTGCTGGCCCAGATCGGCGACCAGTACGCCGAC
    CTGTTTCTGGCCGCCAAGAACCTGTCCGACGCCATCCTGCTGAGCGACAT
    CCTGAGAGTGAACACCGAGATCACCAAGGCCCCCCTGAGCGCCTCTATGA
    TCAAGAGATACGACGAGCACCACCAGGACCTGACCCTGCTGAAAGCTCTC
    GTGCGGCAGCAGCTGCCTGAGAAGTACAAAGAGATTTTTTCGACCAGAGC
    AAGAACGGCTACGCCGGCTACATTGACGGCGGAGCCAGCCAGGAAGAGTT
    CTTACAAGTTTCATCAAGCCCATCCTTGGAAAAGATGGACGGCACCGAGG
    AACTGCTCGTGAAGCTGAACAGAGAGGACCTGCTGCGGAAGCAGCGGACC
    TTCGACAACGGCAGCATCCCCCACCAGATCCACGGGGAGAGCTTTCACGC
    CATTCTGCGGCGGCAGGAAGATTTTTACCCATTCCTGAAGGACAACCGGG
    AAAAGATCGAGAAGATCCTGACCTTCCGCATCCCCTACTACGTGGGCCCT
    CTGGCCAGGGGAAACAGCAGATTCGCCTGGATGACCAGAAAGAGCGAGGA
    AACCATCACCCCCTGGAACTTCGAGGAAGTGGTGGACAAGGGCGCTTCCG
    CCGAGAGCTTGATCGAGCGGATGACCAACTTCGATAAGAACCTGCCCAAC
    GAGAAGGTGCTTTCCAAGCACAGCCTGCTGTACGAGTACTTCACCGTGTA
    TAACGAGCTGACCAAAGTGAAATACGTGACCGAGGGAATGAGAAAGCCCG
    CCTTCCTGAGCGGCGAGCAGAAAAAGGCCATCGTGGACCTGCTGTTCAAG
    ACCAACCGGAAAGTGACCGTGAAGCAGCTGAAAGAGGACTACTTCAAGAA
    AATCGAGTGCTTCGACTCCGTGGAAATCTCCGGCGTGGAAGATCGGTTCA
    ACGCCTCCCTGGGCACATACCACGATCTGCTGAAAATTATCAAGGACAAG
    GACTTCCTGGACAATGAGGAAAACGAGGACATTCTGGAAGATATCGTGCT
    GACCCTGACACTGTTTGAGGACAGAGAGATGATCGAGGAACGGCTGAAAA
    CCTATGCCCACCTTTTTCGACGACAAAGTGATGAAGCAGCTGAAGCGGCG
    GAGATACACCGGCTGGGGCAGGCTGAGCCGGAAGCTGATCAACGGCATCC
    GGGACAAGCAGTCCGGCAAGACAATCCTGGATTTCCTGAAGTCCGACGGC
    TTCGCCAACAGAAACTTGATGGAGCTGATCCACGACGACAGCCTGACCTT
    TAAAGAGGACATCCAGAAAGCCCAGGTGTCCGGCCAGGGCGATAGCCTGC
    ACGAGCACATTGCCAATCTGGCCGGCAGCCCCGCCATTAAGAAGGGCATC
    CTGCAGACAGTGAAGGTGGTGGACGAGCTCGTTTGAAAGTGATGGGCCGG
    CACAAGCCCGAGAACATTTCGTGATCGAAATGGCCAGAGAGAACCAGACC
    ACCCAGAAGGGACAGAAGAACAGCCGCGAGAGAATGAAGCGGATCGAAGA
    GGGCATCAAAGAGCTGGGCAGCCAGATCCTGAAAGAACACCCCGTGGAAA
    ACACCCAGCTGCAGAACGAGAAGCTGTACCTGTACTACCTGCAGAATGGG
    CGGGATATGTACGTGGACCAGGAACTGGAGATCAACCGGCTGTCCGACTA
    CGATGTGGACCATATCGTGCCTCAGAGCTTTCTGAAGGACGACTCCATCG
    ACAACAAGGTGCTGACCAGAAGCGACAAGAACCGGGGCAAGAGCGACAAC
    GTGCCCTCCGAAGAGGTCGTGAAGAAGATGAAGAAGACTGGCGGCAGCTG
    CTGAACGCCAAGCTGATTTTACCCAGAGAAAGTTCGACAATCTGACCAAG
    GCCGAGAGAGGCGGCCTGAGCGAACTGGATAAGGCCGGCTTCATCAAGAG
    ACAGCTGGTGGAAACCCGGCAGATCACAAAGCACGTGGCACAGATCCTGG
    ACTCCCGGATGAACACTAAGTACGACGAGAATGACAAGCTGATCCGGGAA
    GTGAAAGTGATCACCCTGAAGTCCAAGCTGGTGTCCGATTTCCGGAAGGA
    TTTCCAGTTTTACAAAGTGCGCGAGATCAACAACTACCACCACGCCCACG
    ACGCCTACCTGAACGCCGTCGTGGGAACCGCCCTGATCAAAAAGTACCCT
    AAGCTGGAAAGCGAGTTCGTGTACGGCGACTACAAGGTGTACGACGTGCG
    GAAGATGATCGCCAAGAGCGAGCAGGAAATCGGCAAGGCTACCGCCAAGT
    ACTTCTTCTACAGCAACATCATGAACTTTTTCAAGACCGAGATTACCCTG
    GCCAACGGCGAGATCCGGAAGCGGCCTCTGATCGAGACAAACGGCGAAAC
    CGGGGAGATCGTGTGGGATAAGGGCCGGGATTTTGCCACCGTGCGGAAAG
    TGCTGAGCATGCCCCAAGTGAATATCGTGAAAAAGACCGAGGTGCAGACA
    GGCGGCTTCAGCAAAGAGTCTATCCTGCCCAAGAGGAACAGCGATAAGCT
    GATCGCCAGAAAGAAGGACTGGGACCGAAGAAGTACGGCGGCTTCGACAG
    CCCCACCGTGGCCTATTCTGTGCTGGTGGTGGCCAAAGTGGAAAAGGGCA
    AGTCCAAGAAACTGAAGAGTGTGAAAGAGCTGCTGGGGATCACCATCATG
    GAAAGAAGCAGCTTCGAGAAGAATCCCATCGACTTTCTGGAAGCCAAGGG
    CTACAAAGAAGTGAAAAAGGACCTGATCATCAAGCTGCCTAAGTACTCCC
    TGTTCGAGCTGGAAAACGGCCGGAAGAGAATGCTGGCCTCTGCCGGCGAA
    CTGCAGAAGGGAAACGAACTGGTTTTGTTTTCCAAATATGTGAACTTCCT
    GTACCTGGCCAGCCACTATGAGAAGCTGAAGGGCTCCCCCGAGGATAATG
    AGCAGAAACAGCTGTTTGTGGAACAGCACAAGCACTACCTGGACGAGATC
    ATCGAGCAGATCAGCGAGTTCTCCAAGAGAGTGATCCTGGCCGACGCTAA
    TCTGGACAAAGTGCTGTCCGCCTACAACAAGCACCGGGATAAGCCCATCA
    GAGAGCAGGCCGAGAATATCATCCACCTGTTTACCCTGACCAATCTGGGA
    GCCCCTGCCGCCTTCAAGTACTTTGACACCACCATCGACCGGAAGAGGTA
    CACCAGCACCAAAGAGGTGCTGGACGCCACCCTGATCCACCAGAGCATCA
    CCGGCCTGTACGAGACACGGATCGACCTGTCTCAGCTGGGAGGCGACAGC
    CCCAAGAAGAAGAGAAAGGTGGAGGCCAGCTAACATATGATTCGAATGTC
    TTTCGCGCTATGAcACTTCCAGCAAAAGGTAGGGCGGGCTGCGAGACGGC
    TTCCCGGCGCTGCATGCAACACCGATGATGCTTCGACCCCCCGAAGCTCC
    TTCGGGGCTGCATGGGCGCTCCGATGCCGCTCCAGGGCGAGCGCTGTTTA
    AATAGCCAGGCCCCCGATTGCAAAGACATTATAGCGAGCTACCAAAGCCA
    TATTCAAACACCTAGATCACTACCACTTCTACACAGGCCACTCGAGGTTG
    TGATCGCACTCCGCTAAGGGGGCGCCTCTTCCTCTTCGTTTCAGTCACAA
    CCCGCAAACATGACACAAGAATCCCTGTTACTTCTCGACCGTATTGATTC
    GGATGATTCCTACGCGAGCGTGCGGAACGACCAGGAATTCTGGGAGGTGA
    GTCGACGAGCAAGCCCGGCGGATCAGGCAGCGTGCTTGCAGATTTGACTT
    GCAACGCCCGCATTGTGTCGACGAAGGCTTTTGGCTCCTCTGTCGCTGTC
    TCAAGCAGCATCTAACCCTGCGTCGCCGTTTCCATTTGCAGCCGCTGGCC
    CGCCGAGCCCTGGAGGAGCTCGGGCTGCCGGTGCCGCCGGTGGGCGGTTT
    TGCCCGGCGAGAGCACCAACCCCGTACTGGTCGGCGAGCCCGGCCCGGTG
    ATCAAGCTGTTCGGCGAGCACTGGTGCGGTCCGGAGACCCTCGCGTTTCG
    GAGTTTCGGAGGCGTACGCGGTCCTGGCGGACGCCCCGGTGCCGGTGCCC
    CGCCTCCTCGGCCGCGGCGAGCTGCGGCCCGGCACCGGAGCCTGGCCGTG
    GCCCTACCTGGTGATGAGCCGGATGACCGGCACCACCTGGCGGTCCGCGA
    TGGACGGCACGACCGACCGGAACGCGCTGCTCGCCCTGGCCCGCGAACTC
    GGCCGGGTGCTCGGCCGGCTGCACAGGGTGCCGCTGACCGGGAACACCGT
    GCTCACCCCCCATTCCGAGGTCTTCCCGGAACTGCTGCGGGAACGCCGCG
    CGGCGACCGTCGAGGACCACCGCGGGTGGGGCTACCTCTCGCCCCGGCTG
    CTGGACCGCCTGGAGGACTGGCTGCCGGACGTGGACACGCTGCTGGCCGG
    CCGCGAACCCCGGTTCGTCCACGGCGACCTGCACGGGACCAACATCTTCG
    TGGACCTGGCCGCGACCGAGGTCACCGGGATTTCGTCGACTTCACCGACG
    TTTCTATGCGGGAGACTCCCGCTACAGCCTTTGGTGCAACTGCATCTCAA
    CGCCTTCCGGGGCGACCGCGAGATCCTGGCCGCGCTGCTCGACGGGGCGC
    AGTGGAAGCGGACCGAGGACTTCGCCCGCGAACTGCTCGCCTTCACCTTC
    CTGCACGACTTCGAGGTGTTCGAGGAGACCCCGGGGATCTCTCCGGCTTC
    ACCGATCCGGAGGAACTGGCGCAGTTCCTCTGGGGGCCGCCGGACACCGC
    CCCCGGCGCCTGATAAGGATCCGGCAAGACTTTGGCCCCGCTTTGGCAAC
    GCAACAGTGAGCCCGCCCTAGTGTGTTTGGGGATGTGACTATGTATTCGT
    GTGTTGGCCAACGGGTCAACCCGAACACATTGATACCCGCGTTTGGCATT
    TCCTGTCAGAATGTTTAACGTCATTTTGATGGTACT.
  • For all modified Chlamydomonas reinhardtii cells, Applicants use PCR, SURVEYOR nuclease assay, and DNA sequencing to verify successful modification.
  • While preferred embodiments of the present invention have been shown and described herein, it will be obvious to those skilled in the art that such embodiments are provided by way of example only. Numerous variations, changes, and substitutions will now occur to those skilled in the art without departing from the invention. It should be understood that various alternatives to the embodiments of the invention described herein may be employed in practicing the invention. It is intended that the following claims define the scope of the invention and that methods and structures within the scope of these claims and their equivalents be covered thereby.
  • REFERENCES
    • 1. Urnov, F. D., Rebar, E. J., Holmes, M. C., Zhang, H. S. & Gregory, P. D. Genome editing with engineered zinc finger nucleases. Nat. Rev. Genet. 11, 636-646 (2010).
    • 2. Bogdanove, A. J. & Voytas, D. F. TAL effectors: customizable proteins for DNA targeting. Science 333, 1843-1846 (2011).
    • 3. Stoddard, B. L. Homing endonuclease structure and function. Q. Rev. Biophys. 38, 49-95 (2005).
    • 4. Bae, T. & Schneewind, O. Allelic replacement in Staphylococcus aureus with inducible counter-selection. Plasmid 55, 58-63 (2006).
    • 5. Sung, C. K., Li, H., Claverys, J. P. & Morrison, D. A. An rpsL cassette, janus, for gene replacement through negative selection in Streptococcus pneumoniae. Appl. Environ. Microbiol. 67, 5190-5196 (2001).
    • 6. Sharan, S. K., Thomason, L. C., Kuznetsov, S. G. & Court, D. L. Recombineering: a homologous recombination-based method of genetic engineering. Nat. Protoc. 4, 206-223 (2009).
    • 7. Jinek, M. et al. A programmable dual-RNA-guided DNA endonuclease in adaptive bacterial immunity. Science 337, 816-821 (2012).
    • 8. Deveau, H., Garneau, J. E. & Moineau, S. CRISPR/Cas system and its role in phage-bacteria interactions. Annu. Rev. Microbiol. 64, 475-493 (2010).
    • 9. Horvath, P. & Barrangou, R. CRISPR/Cas, the immune system of bacteria and archaea. Science 327, 167-170 (2010).
    • 10. Terns, M. P. & Terns, R. M. CRISPR-based adaptive immune systems. Curr. Opin. Microbiol. 14, 321-327 (2011).
    • 11. van der Oost, J., Jore, M. M., Westra, E. R., Lundgren, M. & Brouns, S. J. CRISPR-based adaptive and heritable immunity in prokaryotes. Trends. Biochem. Sci. 34, 401-407 (2009).
    • 12. Brouns, S. J. et al. Small CRISPR RNAs guide antiviral defense in prokaryotes. Science 321, 960-964 (2008).
    • 13. Carte, J., Wang, R., Li, H., Terns, R. M. & Terns, M. P. Cas6 is an endoribonuclease that generates guide RNAs for invader defense in prokaryotes. Genes Dev. 22, 3489-3496 (2008).
    • 14. Deltcheva, E. et al. CRISPR RNA maturation by trans-encoded small RNA and host factor RNase III. Nature 471, 602-607 (2011).
    • 15. Hatoum-Aslan, A., Maniv, I. & Marraffini, L. A. Mature clustered, regularly interspaced, short palindromic repeats RNA (crRNA) length is measured by a ruler mechanism anchored at the precursor processing site. Proc. Natl. Acad. Sci. U.S.A. 108, 21218-21222 (2011).
    • 16. Haurwitz, R. E., Jinek. M., Wiedenheft, B., Zhou, K. & Doudna, J. A. Sequence- and structure-specific RNA processing by a CRISPR endonuclease. Science 329, 1355-1358 (2010).
    • 17. Deveau, H. et al. Phage response to CRISPR-encoded resistance in Streptococcus thermophilus. J. Bacteriol. 190, 1390-1400 (2008).
    • 18. Gasiunas, G., Barrangou, R., Horvath, P. & Siksnys, V. Cas9-crRNA ribonucleoprotein complex mediates specific DNA cleavage for adaptive immunity in bacteria. Proc. Natl. Acad. Sci. U.S.A. (2012).
    • 19. Makarova, K. S., Aravind, L., Wolf, Y. I. & Koonin, E. V. Unification of Cas protein families and a simple scenario for the origin and evolution of CRISPR-Cas systems. Biol. Direct. 6, 38 (2011).
    • 20. Barrangou, R. RNA-mediated programmable DNA cleavage. Nat. Biotechnol. 30, 836-838 (2012).
    • 21. Brouns, S. J. Molecular biology. A Swiss army knife of immunity. Science 337, 808-809 (2012).
    • 22. Carroll, D. A CRISPR Approach to Gene Targeting. Mol. Ther. 20, 1658-1660 (2012).
    • 23. Bikard, D., Hatoum-Aslan, A., Mucida, D. & Marraffini, L. A. CRISPR interference can prevent natural transformation and virulence acquisition during in vivo bacterial infection. Cell Host Microbe 12, 177-186 (2012).
    • 24. Sapranauskas, R. et al. The Streptococcus thermophilus CRISPR/Cas system provides immunity in Escherichia coli. Nucleic Acids Res. (2011).
    • 25. Semenova, E. et al. Interference by clustered regularly interspaced short palindromic repeat (CRISPR) RNA is governed by a seed sequence. Proc. Natl. Acad. Sci. U.S.A. (2011).
    • 26. Wiedenheft, B. et al. RNA-guided complex from a bacterial immune system enhances target recognition through seed sequence interactions. Proc. Natl. Acad. Sci. U.S.A. (2011).
    • 27. Zahner, D. & Hakenbeck, R. The Streptococcus pneumoniae beta-galactosidase is a surface protein. J. Bacteriol. 182, 5919-5921 (2000).
    • 28. Marraffini, L. A., Dedent, A. C. & Schneewind, O. Sortases and the art of anchoring proteins to the envelopes of gram-positive bacteria. Microbiol. Mol. Biol. Rev. 70, 192-221 (2006).
    • 29. Motamedi, M. R., Szigety, S. K. & Rosenberg, S. M. Double-strand-break repair recombination in Escherichia coli: physical evidence for a DNA replication mechanism in vivo. Genes Dev. 13, 2889-2903 (1999).
    • 30. Hosaka, T. et al. The novel mutation K87E in ribosomal protein S12 enhances protein synthesis activity during the late growth phase in Escherichia coli. Mol. Genet. Genomics 271, 317-324 (2004).
    • 31. Costantino, N. & Court, D. L. Enhanced levels of lambda Red-mediated recombinants in mismatch repair mutants. Proc. Natl. Acad. Sci. U.S.A. 100, 15748-15753 (2003).
    • 32. Edgar, R. & Qimron. U. The Escherichia coli CRISPR system protects from lambda lysogenization, lysogens, and prophage induction. J. Bacteriol. 192, 6291-6294 (2010).
    • 33. Marraffini, L. A. & Sontheimer, E. J. Self versus non-self discrimination during CRISPR RNA-directed immunity. Nature 463, 568-571 (2010).
    • 34. Fischer, S. et al. An archaeal immune system can detect multiple Protospacer Adjacent Motifs (PAMs) to target invader DNA. J. Biol. Chem. 287, 33351-33363 (2012).
    • 35. Gudbergsdottir, S. et al. Dynamic properties of the Sulfolobus CRISPR/Cas and CRISPR/Cmr systems when challenged with vector-borne viral and plasmid genes and protospacers. Mol. Microbiol. 79, 35-49 (2011).
    • 36. Wang, H. H. et al. Genome-scale promoter engineering by coselection MAGE. Nat Methods 9, 591-593 (2012).
    • 37. Cong, L. et al. Multiplex Genome Engineering Using CRISPR/Cas Systems. Science In press (2013).
    • 38. Mali, P. et al. RNA-Guided Human Genome Engineering via Cas9. Science In press (2013).
    • 39. Hoskins, J. et al. Genome of the bacterium Streptococcus pneumoniae strain R6. J. Bacteriol. 183, 5709-5717 (2001).
    • 40. Havarstein, L. S., Coomaraswamy, G. & Morrison, D. A. An unmodified heptadecapeptide pheromone induces competence for genetic transformation in Streptococcus pneumoniae. Proc. Natl. Acad. Sci. U.S.A. 92, 11140-11144 (1995).
    • 41. Horinouchi, S. & Weisblum, B. Nucleotide sequence and functional map of pC 194, a plasmid that specifies inducible chloramphenicol resistance. J. Bacteriol. 150, 815-825 (1982).
    • 42. Horton, R. M. In Vitro Recombination and Mutagenesis of DNA: SOEing Together Tailor-Made Genes. Methods Mol. Biol. 15, 251-261 (1993).
    • 43. Podbielski, A., Spellerberg, B., Woischnik, M., Pohl, B. & Lutticken, R. Novel series of plasmid vectors for gene inactivation and expression analysis in group A streptococci (GAS). Gene 177, 137-147 (1996).
    • 44. Husmann, L. K., Scott, J. R., Lindahl, G. & Stenberg, L. Expression of the Arp protein, a member of the M protein family, is not sufficient to inhibit phagocytosis of Streptococcus pyogenes. Infection and immunity 63, 345-348 (1995).
    • 45. Gibson, D. G. et al. Enzymatic assembly of DNA molecules up to several hundred kilobases. Nat Methods 6, 343-345 (2009).
    • 46. Garneau J. E. et al. The CRISPR/Cas bacterial immune system cleaves bacteriophage and plasmid DNA. Nature 468, 67-71(4 Nov. 2010)
    • 47. Barrangou R. et al. CRISPR provides acquired resistance against viruses in prokaryotes. Science. 2007 Mar. 23; 315(5819): 1709-12.
    • 48. Ishino Y. et al. Nucleotide sequence of the iap gene, responsible for alkaline phosphatase isozyme conversion in Escherichia coli, and identification of the gene product. J Bacteriol. 1987 December; 169(12):5429-33.
    • 49. Mojica F. J. M et al. Biological significance of a family of regularly spaced repeats in the genomes of Archaea, Bacteria and mitochondria. Molecular Microbiology (2000) 36(1), 244-246.
    • 50. Jansen R. et al. Identification of genes that are associated with DNA repeats in prokaryotes. Molecular Microbiology (2002) 43(6), 1565-1575.

Claims (7)

1-50. (canceled)
51. A method of selecting one or more prokaryotic cell(s), comprising:
(a) introducing to a population of prokaryotic cells an engineered, programmable, non-naturally occurring CRISPR-Cas system comprising a Cas protein and one or more guide RNAs that target genomic loci of DNA molecules encoding one or more gene products in prokaryotic cell(s) of the population, wherein the one or more guide RNAs comprise a guide sequence, a tracr sequence, and a tracr mate sequence, and wherein the Cas protein and the one or more guide RNAs do not naturally occur together;
(b) allowing the Cas protein to cleave the genomic loci of the DNA molecules encoding the one or more gene products,
wherein cleavage of the genomic loci induces cell death, thereby allowing one or more prokaryotic cell(s) having one or more mutations in the genomic loci to be selected.
52. The method of claim 51, wherein the Cas protein is a type II CRISPR system Cas protein.
53. The method of claim 52, wherein the Cas protein is Cas9 enzyme.
54. The method of claim 53, wherein the Cas9 enzyme is a Streptococcus pyogenes Cas9 enzyme.
55. The method of claim 51, wherein the prokaryotic cells are S. pneumoniae.
56. The method of claim 51, wherein the one or more guide RNAs target an antibiotic resistance gene.
US15/217,489 2012-12-12 2016-07-22 Crispr-cas systems and methods for altering expression of gene products Abandoned US20170175142A1 (en)

Priority Applications (2)

Application Number Priority Date Filing Date Title
US15/217,489 US20170175142A1 (en) 2012-12-12 2016-07-22 Crispr-cas systems and methods for altering expression of gene products
US16/177,403 US20190153476A1 (en) 2012-12-12 2018-10-31 Crispr-cas systems for altering expression of gene products

Applications Claiming Priority (9)

Application Number Priority Date Filing Date Title
US201261736527P 2012-12-12 2012-12-12
US201361748427P 2013-01-02 2013-01-02
US201361791409P 2013-03-15 2013-03-15
US201361835931P 2013-06-17 2013-06-17
US201361842322P 2013-07-02 2013-07-02
US14/054,414 US8697359B1 (en) 2012-12-12 2013-10-15 CRISPR-Cas systems and methods for altering expression of gene products
US14/183,429 US8771945B1 (en) 2012-12-12 2014-02-18 CRISPR-Cas systems and methods for altering expression of gene products
US14/324,960 US20150184139A1 (en) 2012-12-12 2014-07-07 Crispr-cas systems and methods for altering expression of gene products
US15/217,489 US20170175142A1 (en) 2012-12-12 2016-07-22 Crispr-cas systems and methods for altering expression of gene products

Related Parent Applications (1)

Application Number Title Priority Date Filing Date
US14/324,960 Continuation US20150184139A1 (en) 2012-12-12 2014-07-07 Crispr-cas systems and methods for altering expression of gene products

Related Child Applications (1)

Application Number Title Priority Date Filing Date
US16/177,403 Continuation US20190153476A1 (en) 2012-12-12 2018-10-31 Crispr-cas systems for altering expression of gene products

Publications (1)

Publication Number Publication Date
US20170175142A1 true US20170175142A1 (en) 2017-06-22

Family

ID=50441380

Family Applications (8)

Application Number Title Priority Date Filing Date
US14/054,414 Active US8697359B1 (en) 2012-12-12 2013-10-15 CRISPR-Cas systems and methods for altering expression of gene products
US14/183,429 Active US8771945B1 (en) 2012-12-12 2014-02-18 CRISPR-Cas systems and methods for altering expression of gene products
US14/256,912 Active US8945839B2 (en) 2012-12-12 2014-04-18 CRISPR-Cas systems and methods for altering expression of gene products
US14/324,960 Abandoned US20150184139A1 (en) 2012-12-12 2014-07-07 Crispr-cas systems and methods for altering expression of gene products
US14/681,382 Abandoned US20150203872A1 (en) 2012-12-12 2015-04-08 Crispr-cas systems and methods for altering expression of gene products
US15/160,710 Pending US20160281072A1 (en) 2012-12-12 2016-05-20 Crispr-cas systems and methods for altering expression of gene products
US15/217,489 Abandoned US20170175142A1 (en) 2012-12-12 2016-07-22 Crispr-cas systems and methods for altering expression of gene products
US16/177,403 Pending US20190153476A1 (en) 2012-12-12 2018-10-31 Crispr-cas systems for altering expression of gene products

Family Applications Before (6)

Application Number Title Priority Date Filing Date
US14/054,414 Active US8697359B1 (en) 2012-12-12 2013-10-15 CRISPR-Cas systems and methods for altering expression of gene products
US14/183,429 Active US8771945B1 (en) 2012-12-12 2014-02-18 CRISPR-Cas systems and methods for altering expression of gene products
US14/256,912 Active US8945839B2 (en) 2012-12-12 2014-04-18 CRISPR-Cas systems and methods for altering expression of gene products
US14/324,960 Abandoned US20150184139A1 (en) 2012-12-12 2014-07-07 Crispr-cas systems and methods for altering expression of gene products
US14/681,382 Abandoned US20150203872A1 (en) 2012-12-12 2015-04-08 Crispr-cas systems and methods for altering expression of gene products
US15/160,710 Pending US20160281072A1 (en) 2012-12-12 2016-05-20 Crispr-cas systems and methods for altering expression of gene products

Family Applications After (1)

Application Number Title Priority Date Filing Date
US16/177,403 Pending US20190153476A1 (en) 2012-12-12 2018-10-31 Crispr-cas systems for altering expression of gene products

Country Status (15)

Country Link
US (8) US8697359B1 (en)
EP (2) EP2998400A1 (en)
JP (5) JP6545621B2 (en)
KR (1) KR20150107739A (en)
CN (3) CN106170549B (en)
AU (4) AU2013359238B2 (en)
BR (1) BR112015013785A2 (en)
CA (1) CA2894688A1 (en)
DK (1) DK2764103T3 (en)
ES (1) ES2552535T3 (en)
HK (2) HK1201290A1 (en)
PL (1) PL2764103T3 (en)
PT (1) PT2764103E (en)
RU (1) RU2687451C1 (en)
WO (1) WO2014093661A2 (en)

Cited By (48)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US10113167B2 (en) 2012-05-25 2018-10-30 The Regents Of The University Of California Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription
US10166255B2 (en) 2015-07-31 2019-01-01 Regents Of The University Of Minnesota Intracellular genomic transplant and methods of therapy
US10190137B2 (en) 2013-11-07 2019-01-29 Editas Medicine, Inc. CRISPR-related methods and compositions with governing gRNAS
US10278372B2 (en) 2014-12-10 2019-05-07 Regents Of The University Of Minnesota Genetically modified cells, tissues, and organs for treating disease
US10300138B2 (en) 2016-06-05 2019-05-28 Snipr Technologies Limited Selectively altering microbiota for immune modulation
US10323236B2 (en) 2011-07-22 2019-06-18 President And Fellows Of Harvard College Evaluation and improvement of nuclease cleavage specificity
US10428319B2 (en) 2017-06-09 2019-10-01 Editas Medicine, Inc. Engineered Cas9 nucleases
US10463049B2 (en) 2015-05-06 2019-11-05 Snipr Technologies Limited Altering microbial populations and modifying microbiota
US10465176B2 (en) 2013-12-12 2019-11-05 President And Fellows Of Harvard College Cas variants for gene editing
US10508298B2 (en) 2013-08-09 2019-12-17 President And Fellows Of Harvard College Methods for identifying a target site of a CAS9 nuclease
US10597679B2 (en) 2013-09-06 2020-03-24 President And Fellows Of Harvard College Switchable Cas9 nucleases and uses thereof
EP3636763A1 (en) 2018-10-14 2020-04-15 SNIPR Biome ApS. Products, uses & methods
US10682410B2 (en) 2013-09-06 2020-06-16 President And Fellows Of Harvard College Delivery system for functional nucleases
US10704062B2 (en) 2014-07-30 2020-07-07 President And Fellows Of Harvard College CAS9 proteins including ligand-dependent inteins
WO2020150633A1 (en) * 2019-01-18 2020-07-23 Orthobio Therapeutics, Inc. Gene editing to improve joint function
US10745677B2 (en) 2016-12-23 2020-08-18 President And Fellows Of Harvard College Editing of CCR5 receptor gene to protect against HIV infection
US10760075B2 (en) 2018-04-30 2020-09-01 Snipr Biome Aps Treating and preventing microbial infections
US10858639B2 (en) 2013-09-06 2020-12-08 President And Fellows Of Harvard College CAS9 variants and uses thereof
US10912797B2 (en) 2016-10-18 2021-02-09 Intima Bioscience, Inc. Tumor infiltrating lymphocytes and methods of therapy
US10947530B2 (en) 2016-08-03 2021-03-16 President And Fellows Of Harvard College Adenosine nucleobase editors and uses thereof
US11046948B2 (en) 2013-08-22 2021-06-29 President And Fellows Of Harvard College Engineered transcription activator-like effector (TALE) domains and uses thereof
US11078483B1 (en) 2016-09-02 2021-08-03 KSQ Therapeutics, Inc. Methods for measuring and improving CRISPR reagent function
US11078481B1 (en) 2016-08-03 2021-08-03 KSQ Therapeutics, Inc. Methods for screening for cancer targets
US11098325B2 (en) 2017-06-30 2021-08-24 Intima Bioscience, Inc. Adeno-associated viral vectors for gene therapy
WO2021239758A1 (en) 2020-05-27 2021-12-02 Snipr Biome Aps. Multiplex crispr/cas system for modifying cell genomes
US11214780B2 (en) 2015-10-23 2022-01-04 President And Fellows Of Harvard College Nucleobase editors and uses thereof
US11236313B2 (en) 2016-04-13 2022-02-01 Editas Medicine, Inc. Cas9 fusion molecules, gene editing systems, and methods of use thereof
US11268082B2 (en) 2017-03-23 2022-03-08 President And Fellows Of Harvard College Nucleobase editors comprising nucleic acid programmable DNA binding proteins
US11306324B2 (en) 2016-10-14 2022-04-19 President And Fellows Of Harvard College AAV delivery of nucleobase editors
US11319532B2 (en) 2017-08-30 2022-05-03 President And Fellows Of Harvard College High efficiency base editors comprising Gam
US11371030B2 (en) 2017-05-31 2022-06-28 The University Of Tokyo Modified Cas9 protein and use thereof
US11390884B2 (en) 2015-05-11 2022-07-19 Editas Medicine, Inc. Optimized CRISPR/cas9 systems and methods for gene editing in stem cells
US11447770B1 (en) 2019-03-19 2022-09-20 The Broad Institute, Inc. Methods and compositions for prime editing nucleotide sequences
US11499151B2 (en) 2017-04-28 2022-11-15 Editas Medicine, Inc. Methods and systems for analyzing guide RNA molecules
US11542509B2 (en) 2016-08-24 2023-01-03 President And Fellows Of Harvard College Incorporation of unnatural amino acids into proteins using base editing
US11542496B2 (en) 2017-03-10 2023-01-03 President And Fellows Of Harvard College Cytosine to guanine base editor
US11560566B2 (en) 2017-05-12 2023-01-24 President And Fellows Of Harvard College Aptazyme-embedded guide RNAs for use with CRISPR-Cas9 in genome editing and transcriptional activation
US11597924B2 (en) 2016-03-25 2023-03-07 Editas Medicine, Inc. Genome editing systems comprising repair-modulating enzyme molecules and methods of their use
US11661590B2 (en) 2016-08-09 2023-05-30 President And Fellows Of Harvard College Programmable CAS9-recombinase fusion proteins and uses thereof
US11667911B2 (en) 2015-09-24 2023-06-06 Editas Medicine, Inc. Use of exonucleases to improve CRISPR/CAS-mediated genome editing
US11680268B2 (en) 2014-11-07 2023-06-20 Editas Medicine, Inc. Methods for improving CRISPR/Cas-mediated genome-editing
US11732274B2 (en) 2017-07-28 2023-08-22 President And Fellows Of Harvard College Methods and compositions for evolving base editors using phage-assisted continuous evolution (PACE)
US11795443B2 (en) 2017-10-16 2023-10-24 The Broad Institute, Inc. Uses of adenosine base editors
US11866726B2 (en) 2017-07-14 2024-01-09 Editas Medicine, Inc. Systems and methods for targeted integration and genome editing and detection thereof using integrated priming sites
US11898179B2 (en) 2017-03-09 2024-02-13 President And Fellows Of Harvard College Suppression of pain by gene editing
US11911415B2 (en) 2015-06-09 2024-02-27 Editas Medicine, Inc. CRISPR/Cas-related methods and compositions for improving transplantation
US11912985B2 (en) 2020-05-08 2024-02-27 The Broad Institute, Inc. Methods and compositions for simultaneous editing of both strands of a target double-stranded nucleotide sequence
US11970711B2 (en) 2021-09-21 2024-04-30 The Regents Of The University Of California Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription

Families Citing this family (1128)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US9314005B2 (en) 2009-07-01 2016-04-19 Transposagen Biopharmaceuticals, Inc. Genetically modified rat models for severe combined immunodeficiency (SCID)
EP2579711B1 (en) 2010-06-11 2019-04-17 Regeneron Pharmaceuticals, Inc. Production of fertile xy female animals from xy es cells
US9730967B2 (en) 2011-02-04 2017-08-15 Katherine Rose Kovarik Method and system for treating cancer cachexia
US11191665B2 (en) 2011-02-04 2021-12-07 Joseph E. Kovarik Method and system for reducing the likelihood of a porphyromonas gingivalis infection in a human being
US10314865B2 (en) 2011-02-04 2019-06-11 Katherine Rose Kovarik Method and system for treating cancer and other age-related diseases by extending the healthspan of a human
US11844720B2 (en) 2011-02-04 2023-12-19 Seed Health, Inc. Method and system to reduce the likelihood of dental caries and halitosis
US10842834B2 (en) 2016-01-06 2020-11-24 Joseph E. Kovarik Method and system for reducing the likelihood of developing liver cancer in an individual diagnosed with non-alcoholic fatty liver disease
US10583033B2 (en) 2011-02-04 2020-03-10 Katherine Rose Kovarik Method and system for reducing the likelihood of a porphyromonas gingivalis infection in a human being
US11419903B2 (en) 2015-11-30 2022-08-23 Seed Health, Inc. Method and system for reducing the likelihood of osteoporosis
US11951140B2 (en) 2011-02-04 2024-04-09 Seed Health, Inc. Modulation of an individual's gut microbiome to address osteoporosis and bone disease
US10512661B2 (en) 2011-02-04 2019-12-24 Joseph E. Kovarik Method and system for reducing the likelihood of developing liver cancer in an individual diagnosed with non-alcoholic fatty liver disease
US11951139B2 (en) 2015-11-30 2024-04-09 Seed Health, Inc. Method and system for reducing the likelihood of osteoporosis
US11273187B2 (en) 2015-11-30 2022-03-15 Joseph E. Kovarik Method and system for reducing the likelihood of developing depression in an individual
US9528124B2 (en) 2013-08-27 2016-12-27 Recombinetics, Inc. Efficient non-meiotic allele introgression
US10920242B2 (en) 2011-02-25 2021-02-16 Recombinetics, Inc. Non-meiotic allele introgression
HUE047507T2 (en) 2011-10-17 2020-04-28 Massachusetts Inst Technology Intracellular delivery
RU2663354C2 (en) 2011-12-16 2018-08-03 Таргитджин Байотекнолоджиз Лтд Compositions and methods for modification of specified target nucleic acid sequence
US11021737B2 (en) 2011-12-22 2021-06-01 President And Fellows Of Harvard College Compositions and methods for analyte detection
GB201122458D0 (en) 2011-12-30 2012-02-08 Univ Wageningen Modified cascade ribonucleoproteins and uses thereof
EP2825663B1 (en) 2012-03-13 2019-08-07 Board of Trustees of the University of Arkansas Separatome-based protein expression and purification platform
US9637739B2 (en) 2012-03-20 2017-05-02 Vilnius University RNA-directed DNA cleavage by the Cas9-crRNA complex
SG10201702445TA (en) 2012-04-25 2017-04-27 Regeneron Pharma Nuclease-mediated targeting with large targeting vectors
CA2877290A1 (en) 2012-06-19 2013-12-27 Daniel F. Voytas Gene targeting in plants using dna viruses
AU2013289206B2 (en) 2012-07-11 2018-08-09 Sangamo Therapeutics, Inc. Methods and compositions for the treatment of lysosomal storage diseases
US10648001B2 (en) 2012-07-11 2020-05-12 Sangamo Therapeutics, Inc. Method of treating mucopolysaccharidosis type I or II
ES2757623T3 (en) * 2012-07-25 2020-04-29 Broad Inst Inc Inducible DNA binding proteins and genomic disruption tools and applications thereof
JP6517143B2 (en) 2012-10-23 2019-05-22 ツールゲン インコーポレイテッド Composition for cleaving target DNA comprising guide RNA specific for target DNA and CAS protein encoding nucleic acid or CAS protein, and use thereof
WO2014066830A1 (en) * 2012-10-25 2014-05-01 Department Of Veterans Affairs Composition and methods for the prevention and treatment of diet-induced obesity
KR102006880B1 (en) 2012-12-06 2019-08-02 시그마-알드리치 컴퍼니., 엘엘씨 Crispr-based genome modification and regulation
PT2898075E (en) 2012-12-12 2016-06-16 Harvard College Engineering and optimization of improved systems, methods and enzyme compositions for sequence manipulation
PT2896697E (en) * 2012-12-12 2015-12-31 Massachusetts Inst Technology Engineering of systems, methods and optimized guide compositions for sequence manipulation
EP4286402A3 (en) 2012-12-12 2024-02-14 The Broad Institute, Inc. Crispr-cas component systems, methods and compositions for sequence manipulation
WO2014093718A1 (en) 2012-12-12 2014-06-19 The Broad Institute, Inc. Methods, systems, and apparatus for identifying target sequences for cas enzymes or crispr-cas systems for target sequences and conveying results thereof
IL239317B (en) 2012-12-12 2022-07-01 Broad Inst Inc Delivery, engineering and optimization of systems, methods and compositions for sequence manipulation and therapeutic applications
EP3434776A1 (en) 2012-12-12 2019-01-30 The Broad Institute, Inc. Methods, models, systems, and apparatus for identifying target sequences for cas enzymes or crispr-cas systems for target sequences and conveying results thereof
US8697359B1 (en) 2012-12-12 2014-04-15 The Broad Institute, Inc. CRISPR-Cas systems and methods for altering expression of gene products
DK2931898T3 (en) 2012-12-12 2016-06-20 Massachusetts Inst Technology CONSTRUCTION AND OPTIMIZATION OF SYSTEMS, PROCEDURES AND COMPOSITIONS FOR SEQUENCE MANIPULATION WITH FUNCTIONAL DOMAINS
SG11201504621RA (en) 2012-12-17 2015-07-30 Harvard College Rna-guided human genome engineering
CA2898184A1 (en) 2013-01-16 2014-07-24 Emory University Cas9-nucleic acid complexes and uses related thereto
PT2963113T (en) * 2013-02-14 2020-02-14 Univ Osaka Method for isolating specific genomic region using molecule binding specifically to endogenous dna sequence
ES2904803T3 (en) 2013-02-20 2022-04-06 Regeneron Pharma Genetic modification of rats
US10138509B2 (en) 2013-03-12 2018-11-27 President And Fellows Of Harvard College Method for generating a three-dimensional nucleic acid containing matrix
WO2014153118A1 (en) * 2013-03-14 2014-09-25 The Board Of Trustees Of The Leland Stanford Junior University Treatment of diseases and conditions associated with dysregulation of mammalian target of rapamycin complex 1 (mtorc1)
ES2901396T3 (en) 2013-03-14 2022-03-22 Caribou Biosciences Inc Nucleic Acid Targeting Nucleic Acid Compositions and Methods
US10119133B2 (en) 2013-03-15 2018-11-06 The General Hospital Corporation Using truncated guide RNAs (tru-gRNAs) to increase specificity for RNA-guided genome editing
US10760064B2 (en) 2013-03-15 2020-09-01 The General Hospital Corporation RNA-guided targeting of genetic and epigenomic regulatory proteins to specific genomic loci
US20140273235A1 (en) * 2013-03-15 2014-09-18 Regents Of The University Of Minnesota ENGINEERING PLANT GENOMES USING CRISPR/Cas SYSTEMS
US20140273230A1 (en) * 2013-03-15 2014-09-18 Sigma-Aldrich Co., Llc Crispr-based genome modification and regulation
US9234213B2 (en) 2013-03-15 2016-01-12 System Biosciences, Llc Compositions and methods directed to CRISPR/Cas genomic engineering systems
US9957515B2 (en) 2013-03-15 2018-05-01 Cibus Us Llc Methods and compositions for targeted gene modification
JP2016522679A (en) 2013-04-04 2016-08-04 プレジデント アンド フェローズ オブ ハーバード カレッジ Therapeutic use of genome editing with the CRISPR / Cas system
RS58255B1 (en) 2013-04-16 2019-03-29 Regeneron Pharma Targeted modification of rat genome
WO2014172470A2 (en) * 2013-04-16 2014-10-23 Whitehead Institute For Biomedical Research Methods of mutating, modifying or modulating nucleic acid in a cell or nonhuman mammal
EP2997146A4 (en) 2013-05-15 2017-04-26 Sangamo BioSciences, Inc. Methods and compositions for treatment of a genetic condition
WO2014186686A2 (en) * 2013-05-17 2014-11-20 Two Blades Foundation Targeted mutagenesis and genome engineering in plants using rna-guided cas nucleases
EP3778899A1 (en) 2013-05-22 2021-02-17 Northwestern University Rna-directed dna cleavage and gene editing by cas9 enzyme from neisseria meningitidis
WO2014194190A1 (en) 2013-05-30 2014-12-04 The Penn State Research Foundation Gene targeting and genetic modification of plants via rna-guided genome editing
US9267135B2 (en) 2013-06-04 2016-02-23 President And Fellows Of Harvard College RNA-guided transcriptional regulation
WO2014197568A2 (en) * 2013-06-04 2014-12-11 President And Fellows Of Harvard College Rna-guideded transcriptional regulation
AU2014274840B2 (en) * 2013-06-05 2020-03-12 Duke University RNA-guided gene editing and gene regulation
EP3008181B1 (en) 2013-06-11 2019-11-06 The Regents of The University of California Methods and compositions for target dna modification
KR20160044457A (en) 2013-06-17 2016-04-25 더 브로드 인스티튜트, 인코퍼레이티드 Delivery, engineering and optimization of tandem guide systems, methods and compositions for sequence manipulation
AU2014281027A1 (en) 2013-06-17 2016-01-28 Massachusetts Institute Of Technology Optimized CRISPR-Cas double nickase systems, methods and compositions for sequence manipulation
RU2716420C2 (en) 2013-06-17 2020-03-11 Те Брод Инститьют Инк. Delivery and use of systems of crispr-cas, vectors and compositions for targeted action and therapy in liver
WO2014204727A1 (en) * 2013-06-17 2014-12-24 The Broad Institute Inc. Functional genomics using crispr-cas systems, compositions methods, screens and applications thereof
SG10201710487VA (en) * 2013-06-17 2018-01-30 Broad Inst Inc Delivery, Use and Therapeutic Applications of the Crispr-Cas Systems and Compositions for Targeting Disorders and Diseases Using Viral Components
US10011850B2 (en) 2013-06-21 2018-07-03 The General Hospital Corporation Using RNA-guided FokI Nucleases (RFNs) to increase specificity for RNA-Guided Genome Editing
JP2016528890A (en) 2013-07-09 2016-09-23 プレジデント アンド フェローズ オブ ハーバード カレッジ Therapeutic use of genome editing using the CRISPR / Cas system
EP3666892A1 (en) 2013-07-10 2020-06-17 President and Fellows of Harvard College Orthogonal cas9 proteins for rna-guided gene regulation and editing
WO2015010114A1 (en) 2013-07-19 2015-01-22 Larix Bioscience, Llc Methods and compositions for producing double allele knock outs
US11060083B2 (en) 2013-07-19 2021-07-13 Larix Bioscience Llc Methods and compositions for producing double allele knock outs
US11306328B2 (en) 2013-07-26 2022-04-19 President And Fellows Of Harvard College Genome engineering
AU2014306423B2 (en) 2013-08-16 2019-04-18 Massachusetts Institute Of Technology Selective delivery of material to cells
CN105916989A (en) 2013-08-22 2016-08-31 纳幕尔杜邦公司 A soybean U6 polymerase III promoter and methods of use
CA2920899C (en) 2013-08-28 2023-02-28 Sangamo Biosciences, Inc. Compositions for linking dna-binding domains and cleavage domains
US20160251410A1 (en) 2013-09-03 2016-09-01 Yissum Research Development Company Of The Hebrew University Of Jerusalem Ltd. Compositions and methods for expressing recombinant polypeptides
US9822371B2 (en) 2013-09-17 2017-11-21 The Board Of Trustees Of The University Of Arkansas E. coli separatome-based protein expression and purification platform
EP3418379B1 (en) * 2013-09-18 2020-12-09 Kymab Limited Methods, cells & organisms
WO2015048690A1 (en) * 2013-09-27 2015-04-02 The Regents Of The University Of California Optimized small guide rnas and methods of use
WO2015057976A1 (en) 2013-10-17 2015-04-23 Sangamo Biosciences, Inc. Delivery methods and compositions for nuclease-mediated genome engineering in hematopoietic stem cells
DK3441468T3 (en) 2013-10-17 2021-07-26 Sangamo Therapeutics Inc Delivery methods and compositions for nuclease-mediated genome manipulation
US10767156B2 (en) 2013-10-24 2020-09-08 Yeda Research And Development Co., Ltd. Polynucleotides encoding BREX system polypeptides and methods of using same
WO2015065964A1 (en) * 2013-10-28 2015-05-07 The Broad Institute Inc. Functional genomics using crispr-cas systems, compositions, methods, screens and applications thereof
US10584358B2 (en) * 2013-10-30 2020-03-10 North Carolina State University Compositions and methods related to a type-II CRISPR-Cas system in Lactobacillus buchneri
WO2015070062A1 (en) * 2013-11-07 2015-05-14 Massachusetts Institute Of Technology Cell-based genomic recorded accumulative memory
US10787684B2 (en) 2013-11-19 2020-09-29 President And Fellows Of Harvard College Large gene excision and insertion
US9074199B1 (en) 2013-11-19 2015-07-07 President And Fellows Of Harvard College Mutant Cas9 proteins
WO2015088643A1 (en) 2013-12-11 2015-06-18 Regeneron Pharmaceuticals, Inc. Methods and compositions for the targeted modification of a genome
SG10201804976YA (en) 2013-12-12 2018-07-30 Broad Inst Inc Delivery, Use and Therapeutic Applications of the Crispr-Cas Systems and Compositions for Genome Editing
RU2016128077A (en) 2013-12-12 2018-12-06 Те Брод Инститьют Инк. DELIVERY, APPLICATION AND APPLICATIONS IN THE THERAPY OF CRISPR-CAS SYSTEMS AND COMPOSITIONS FOR TREATMENT OF CONDITIONED HBV AND VIRAL DISEASES AND DISORDERS
WO2015089473A1 (en) 2013-12-12 2015-06-18 The Broad Institute Inc. Engineering of systems, methods and optimized guide compositions with new architectures for sequence manipulation
EP3835419A1 (en) * 2013-12-12 2021-06-16 The Regents of The University of California Methods and compositions for modifying a single stranded target nucleic acid
JP6793547B2 (en) 2013-12-12 2020-12-02 ザ・ブロード・インスティテュート・インコーポレイテッド Optimization Function Systems, methods and compositions for sequence manipulation with the CRISPR-Cas system
WO2015089364A1 (en) 2013-12-12 2015-06-18 The Broad Institute Inc. Crystal structure of a crispr-cas system, and uses thereof
AU2014362248A1 (en) 2013-12-12 2016-06-16 Massachusetts Institute Of Technology Compositions and methods of use of CRISPR-Cas systems in nucleotide repeat disorders
WO2015089419A2 (en) 2013-12-12 2015-06-18 The Broad Institute Inc. Delivery, use and therapeutic applications of the crispr-cas systems and compositions for targeting disorders and diseases using particle delivery components
AU2014361834B2 (en) 2013-12-12 2020-10-22 Massachusetts Institute Of Technology CRISPR-Cas systems and methods for altering expression of gene products, structural information and inducible modular Cas enzymes
WO2015089375A1 (en) 2013-12-13 2015-06-18 The General Hospital Corporation Soluble high molecular weight (hmw) tau species and applications thereof
CA2931684C (en) 2013-12-19 2024-02-20 Novartis Ag Human mesothelin chimeric antigen receptors and uses thereof
US11826388B2 (en) 2013-12-20 2023-11-28 Seed Health, Inc. Topical application of Lactobacillus crispatus to ameliorate barrier damage and inflammation
US11833177B2 (en) 2013-12-20 2023-12-05 Seed Health, Inc. Probiotic to enhance an individual's skin microbiome
US11839632B2 (en) 2013-12-20 2023-12-12 Seed Health, Inc. Topical application of CRISPR-modified bacteria to treat acne vulgaris
WO2015103026A2 (en) 2014-01-03 2015-07-09 The Regents Of The University Of Michigan Treatment of neurological disorders
US9850525B2 (en) * 2014-01-29 2017-12-26 Agilent Technologies, Inc. CAS9-based isothermal method of detection of specific DNA sequence
GB201401707D0 (en) * 2014-01-31 2014-03-19 Sec Dep For Health The Adeno-associated viral vectors
KR102496984B1 (en) 2014-02-11 2023-02-06 더 리전츠 오브 더 유니버시티 오브 콜로라도, 어 바디 코퍼레이트 Crispr enabled multiplexed genome engineering
US10287590B2 (en) * 2014-02-12 2019-05-14 Dna2.0, Inc. Methods for generating libraries with co-varying regions of polynuleotides for genome modification
WO2015126927A2 (en) 2014-02-18 2015-08-27 Duke University Compositions for the inactivation of virus replication and methods of making and using the same
AU2015222944A1 (en) 2014-02-27 2016-09-08 Massachusetts Institute Of Technology T cell balance gene expression, compositions of matters and methods of use thereof
WO2015131101A1 (en) 2014-02-27 2015-09-03 Monsanto Technology Llc Compositions and methods for site directed genomic modification
WO2015134812A1 (en) 2014-03-05 2015-09-11 Editas Medicine, Inc. Crispr/cas-related methods and compositions for treating usher syndrome and retinitis pigmentosa
EP3613854A1 (en) * 2014-03-05 2020-02-26 National University Corporation Kobe University Genomic sequence modification method for specifically converting nucleic acid bases of targeted dna sequence, and molecular complex for use in same
US11339437B2 (en) 2014-03-10 2022-05-24 Editas Medicine, Inc. Compositions and methods for treating CEP290-associated disease
US9938521B2 (en) 2014-03-10 2018-04-10 Editas Medicine, Inc. CRISPR/CAS-related methods and compositions for treating leber's congenital amaurosis 10 (LCA10)
US11141493B2 (en) 2014-03-10 2021-10-12 Editas Medicine, Inc. Compositions and methods for treating CEP290-associated disease
EP3116533B1 (en) * 2014-03-12 2020-08-12 Precision Biosciences, Inc. Dystrophin gene exon deletion using engineered nucleases
RS65213B1 (en) 2014-03-14 2024-03-29 Cibus Us Llc Methods and compositions for increasing efficiency of targeted gene modification using oligonucleotide-mediated gene repair
EP3593812A3 (en) 2014-03-15 2020-05-27 Novartis AG Treatment of cancer using chimeric antigen receptor
WO2015139139A1 (en) * 2014-03-20 2015-09-24 UNIVERSITé LAVAL Crispr-based methods and products for increasing frataxin levels and uses thereof
EP3122880B1 (en) * 2014-03-26 2021-05-05 Editas Medicine, Inc. Crispr/cas-related methods and compositions for treating sickle cell disease
PL3129470T3 (en) 2014-04-07 2021-11-29 Novartis Ag Treatment of cancer using anti-cd19 chimeric antigen receptor
CN106460003A (en) 2014-04-08 2017-02-22 北卡罗来纳州立大学 Methods and compositions for RNA-directed repression of transcription using CRISPR-associated genes
SG10201809157VA (en) * 2014-04-18 2018-11-29 Editas Medicine Inc Crispr-cas-related methods, compositions and components for cancer immunotherapy
CA2946378A1 (en) * 2014-04-22 2015-10-29 Q-State Biosciences, Inc. Analysis of compounds for pain and sensory disorders
WO2015168404A1 (en) * 2014-04-30 2015-11-05 Massachusetts Institute Of Technology Toehold-gated guide rna for programmable cas9 circuitry with rna input
GB201407852D0 (en) 2014-05-02 2014-06-18 Iontas Ltd Preparation of libraries od protein variants expressed in eukaryotic cells and use for selecting binding molecules
EP3142707A4 (en) 2014-05-13 2018-02-21 Sangamo Therapeutics, Inc. Methods and compositions for prevention or treatment of a disease
AU2015266767A1 (en) 2014-05-30 2016-12-08 The Board Of Trustees Of The Leland Stanford Junior University Compositions and methods to treat latent viral infections
WO2015188056A1 (en) 2014-06-05 2015-12-10 Sangamo Biosciences, Inc. Methods and compositions for nuclease design
RU2704283C9 (en) 2014-06-06 2020-02-07 Регенерон Фармасьютикалз, Инк. Methods and compositions for modifying target locus
WO2015191693A2 (en) 2014-06-10 2015-12-17 Massachusetts Institute Of Technology Method for gene editing
CA2952121A1 (en) 2014-06-13 2015-12-17 Childrens' Medical Center Corporation Products and methods to isolate mitochondria
CN106852157B (en) 2014-06-16 2022-04-12 约翰斯·霍普金斯大学 Compositions and methods for expressing CRISPR guide RNA using H1 promoter
BR112016030145A8 (en) 2014-06-23 2018-12-11 Regeneron Pharma methods for assembling at least two nucleic acids and two or more nucleic acids
WO2015200378A1 (en) 2014-06-23 2015-12-30 The General Hospital Corporation Genomewide unbiased identification of dsbs evaluated by sequencing (guide-seq)
ES2694629T3 (en) * 2014-06-26 2018-12-26 Regeneron Pharmaceuticals, Inc. Methods and compositions for objective genetic modifications and methods of use
US20180187172A1 (en) * 2014-07-01 2018-07-05 Board Of Regents, The University Of Texas System Regulated gene expression from viral vectors
WO2016005985A2 (en) 2014-07-09 2016-01-14 Yissum Research Development Company Of The Hebrew University Of Jerusalem Ltd. Method for reprogramming cells
WO2016007347A1 (en) 2014-07-11 2016-01-14 E. I. Du Pont De Nemours And Company Compositions and methods for producing plants resistant to glyphosate herbicide
WO2016011080A2 (en) * 2014-07-14 2016-01-21 The Regents Of The University Of California Crispr/cas transcriptional modulation
EP3169310A1 (en) 2014-07-15 2017-05-24 Life Technologies Corporation Compositions with lipid aggregates and methods for efficient delivery of molecules to cells
WO2016014530A1 (en) 2014-07-21 2016-01-28 Novartis Ag Combinations of low, immune enhancing. doses of mtor inhibitors and cars
US11542488B2 (en) 2014-07-21 2023-01-03 Novartis Ag Sortase synthesized chimeric antigen receptors
TWI750110B (en) 2014-07-21 2021-12-21 瑞士商諾華公司 Treatment of cancer using humanized anti- bcma chimeric antigen receptor
KR102594343B1 (en) 2014-07-21 2023-10-26 노파르티스 아게 Treatment of cancer using a cd33 chimeric antigen receptor
US9816074B2 (en) 2014-07-25 2017-11-14 Sangamo Therapeutics, Inc. Methods and compositions for modulating nuclease-mediated genome engineering in hematopoietic stem cells
US9757420B2 (en) 2014-07-25 2017-09-12 Sangamo Therapeutics, Inc. Gene editing for HIV gene therapy
WO2016019144A2 (en) 2014-07-30 2016-02-04 Sangamo Biosciences, Inc. Gene correction of scid-related genes in hematopoietic stem and progenitor cells
ES2781175T3 (en) 2014-07-31 2020-08-31 Novartis Ag Optimized subset of T cells containing a chimeric antigen receptor
WO2016022931A1 (en) * 2014-08-07 2016-02-11 The Rockefeller University Compositions and methods for transcription-based crispr-cas dna editing
US9932566B2 (en) 2014-08-07 2018-04-03 Agilent Technologies, Inc. CIS-blocked guide RNA
US10513711B2 (en) 2014-08-13 2019-12-24 Dupont Us Holding, Llc Genetic targeting in non-conventional yeast using an RNA-guided endonuclease
CA2958200A1 (en) 2014-08-14 2016-02-18 Novartis Ag Treatment of cancer using a gfr alpha-4 chimeric antigen receptor
US11071289B2 (en) 2014-08-14 2021-07-27 Biocytogen Boston Corp DNA knock-in system
EP3180426B1 (en) 2014-08-17 2019-12-25 The Broad Institute, Inc. Genome editing using cas9 nickases
US10435685B2 (en) 2014-08-19 2019-10-08 Pacific Biosciences Of California, Inc. Compositions and methods for enrichment of nucleic acids
PT3183268T (en) 2014-08-19 2020-05-15 Novartis Ag Anti-cd123 chimeric antigen receptor (car) for use in cancer treatment
KR20170036801A (en) 2014-08-19 2017-04-03 프레지던트 앤드 펠로우즈 오브 하바드 칼리지 Rna-guided systems for probing and mapping of nucleic acids
WO2016033246A1 (en) 2014-08-27 2016-03-03 Caribou Biosciences, Inc. Methods for increasing cas9-mediated engineering efficiency
EP3186375A4 (en) 2014-08-28 2019-03-13 North Carolina State University Novel cas9 proteins and guiding features for dna targeting and genome editing
WO2016036754A1 (en) 2014-09-02 2016-03-10 The Regents Of The University Of California Methods and compositions for rna-directed target dna modification
EP3191578B1 (en) 2014-09-12 2020-11-04 Whitehead Institute for Biomedical Research Cells expressing apolipoprotein e and uses thereof
CA2956487A1 (en) 2014-09-12 2016-03-17 E. I. Du Pont De Nemours And Company Generation of site-specific-integration sites for complex trait loci in corn and soybean, and methods of use
IL234638A0 (en) 2014-09-14 2014-12-02 Yeda Res & Dev Nmda receptor antagonists for treating gaucher disease
EP3194570B1 (en) 2014-09-16 2021-06-30 Sangamo Therapeutics, Inc. Methods and compositions for nuclease-mediated genome engineering and correction in hematopoietic stem cells
AU2015317608B2 (en) 2014-09-17 2021-03-11 Novartis Ag Targeting cytotoxic cells with chimeric receptors for adoptive immunotherapy
WO2016049024A2 (en) 2014-09-24 2016-03-31 The Broad Institute Inc. Delivery, use and therapeutic applications of the crispr-cas systems and compositions for modeling competition of multiple cancer mutations in vivo
WO2016049163A2 (en) 2014-09-24 2016-03-31 The Broad Institute Inc. Use and production of chd8+/- transgenic animals with behavioral phenotypes characteristic of autism spectrum disorder
WO2016049251A1 (en) 2014-09-24 2016-03-31 The Broad Institute Inc. Delivery, use and therapeutic applications of the crispr-cas systems and compositions for modeling mutations in leukocytes
US10040048B1 (en) 2014-09-25 2018-08-07 Synthego Corporation Automated modular system and method for production of biopolymers
WO2016049258A2 (en) 2014-09-25 2016-03-31 The Broad Institute Inc. Functional screening with optimized functional crispr-cas systems
US10370673B2 (en) 2014-09-26 2019-08-06 Purecircle Sdn Bhd Single nucleotide polymorphism (SNP) markers for stevia
WO2016054032A1 (en) 2014-09-29 2016-04-07 The Jackson Laboratory High efficiency, high throughput generation of genetically modified mammals by electroporation
CA2963080A1 (en) 2014-10-01 2016-04-07 The General Hospital Corporation Methods for increasing efficiency of nuclease-induced homology-directed repair
ES2741387T3 (en) 2014-10-15 2020-02-10 Regeneron Pharma Methods and compositions for generating or maintaining pluripotent cells
WO2016061523A1 (en) 2014-10-17 2016-04-21 Howard Hughes Medical Institute Genomic probes
US10612042B2 (en) 2014-10-24 2020-04-07 Avectas Limited Delivery across cell plasma membranes
US20170247762A1 (en) 2014-10-27 2017-08-31 The Board Institute Inc. Compositions, methods and use of synthetic lethal screening
JP2017533702A (en) 2014-10-31 2017-11-16 マサチューセッツ インスティテュート オブ テクノロジー Delivery of biomolecules to immune cells
KR102546296B1 (en) * 2014-10-31 2023-06-21 더 트러스티스 오브 더 유니버시티 오브 펜실베니아 Altering gene expression in modified t cells and uses thereof
US20190100769A1 (en) 2014-10-31 2019-04-04 Massachusetts Institute Of Technology Massively parallel combinatorial genetics for crispr
CA2966731C (en) 2014-11-06 2023-01-31 E. I. Du Pont De Nemours And Company Peptide-mediated delivery of rna-guided endonuclease into cells
WO2016077624A1 (en) 2014-11-12 2016-05-19 Nmc, Inc. Transgenic plants with engineered redox sensitive modulation of photosynthetic antenna complex pigments and methods for making the same
US11470826B2 (en) 2014-11-17 2022-10-18 National University Corporation Tokyo Medical And Dental University Method of conveniently producing genetically modified non-human mammal with high efficiency
PT3221457T (en) 2014-11-21 2019-06-27 Regeneron Pharma Methods and compositions for targeted genetic modification using paired guide rnas
KR101833433B1 (en) 2014-11-25 2018-02-28 한국생명공학연구원 Production of cell line for porcine T-cell and B-cell immunodeficiency and a method of manufacturing
WO2016086197A1 (en) 2014-11-25 2016-06-02 The Brigham And Women's Hospital, Inc. Method of identifying and treating a person having a predisposition to or afflicted with a cardiometabolic disease
WO2016086227A2 (en) 2014-11-26 2016-06-02 The Regents Of The University Of California Therapeutic compositions comprising transcription factors and methods of making and using the same
GB201421096D0 (en) 2014-11-27 2015-01-14 Imp Innovations Ltd Genome editing methods
WO2016089433A1 (en) 2014-12-03 2016-06-09 Agilent Technologies, Inc. Guide rna with chemical modifications
WO2016094874A1 (en) 2014-12-12 2016-06-16 The Broad Institute Inc. Escorted and functionalized guides for crispr-cas systems
EP3230452A1 (en) 2014-12-12 2017-10-18 The Broad Institute Inc. Dead guides for crispr transcription factors
WO2016094880A1 (en) 2014-12-12 2016-06-16 The Broad Institute Inc. Delivery, use and therapeutic applications of crispr systems and compositions for genome editing as to hematopoietic stem cells (hscs)
EP3985115A1 (en) 2014-12-12 2022-04-20 The Broad Institute, Inc. Protected guide rnas (pgrnas)
US10889834B2 (en) 2014-12-15 2021-01-12 Sangamo Therapeutics, Inc. Methods and compositions for enhancing targeted transgene integration
US20170327834A1 (en) 2014-12-15 2017-11-16 Syngenta Participations Ag Pesticidal microrna carriers and use thereof
JP6842417B2 (en) 2014-12-16 2021-03-17 シー3ジェイ セラピューティクス インコーポレイテッド Compositions and Methods for In vitro Viral Genome Engineering
JP6814142B2 (en) 2014-12-16 2021-01-13 ダニスコ・ユーエス・インク Fungal Genome Modification System and Usage
WO2016100562A1 (en) 2014-12-16 2016-06-23 Danisco Us Inc Compositions and methods for helper strain-mediated fungal genome modification
AU2015364282B2 (en) * 2014-12-18 2021-04-15 Integrated Dna Technologies, Inc. CRISPR-based compositions and methods of use
KR102530821B1 (en) 2014-12-19 2023-05-10 리제너론 파마슈티칼스 인코포레이티드 Methods and compositions for targeted genetic modification through single-step multiple targeting
WO2016098078A2 (en) 2014-12-19 2016-06-23 Novartis Ag Dimerization switches and uses thereof
US10196613B2 (en) 2014-12-19 2019-02-05 Regeneron Pharmaceuticals, Inc. Stem cells for modeling type 2 diabetes
WO2016100974A1 (en) 2014-12-19 2016-06-23 The Broad Institute Inc. Unbiased identification of double-strand breaks and genomic rearrangement by genome-wide insert capture sequencing
ES2785329T3 (en) 2014-12-23 2020-10-06 Syngenta Participations Ag Methods and Compositions for Identifying and Enriching Cells Comprising Site-Specific Genomic Modifications
WO2016106236A1 (en) 2014-12-23 2016-06-30 The Broad Institute Inc. Rna-targeting system
AU2015369725A1 (en) 2014-12-24 2017-06-29 Massachusetts Institute Of Technology CRISPR having or associated with destabilization domains
WO2016108926A1 (en) 2014-12-30 2016-07-07 The Broad Institute Inc. Crispr mediated in vivo modeling and genetic screening of tumor growth and metastasis
AU2015373893B2 (en) * 2014-12-31 2021-07-29 Synthetic Genomics, Inc. Compositions and methods for high efficiency in vivo genome editing
CA2971626A1 (en) * 2015-01-12 2016-07-21 Massachusetts Institute Of Technology Gene editing through microfluidic delivery
EP3245232B1 (en) 2015-01-12 2021-04-21 The Regents of The University of California Heterodimeric cas9 and methods of use thereof
WO2016112963A1 (en) 2015-01-13 2016-07-21 Riboxx Gmbh Delivery of biomolecules into cells
AR103446A1 (en) * 2015-01-19 2017-05-10 Inst Genetics & Dev Biolog Cas METHOD FOR PRECISION TO MODIFY A PLANT THROUGH THE TRANSITIONAL EXPRESSION OF GENES
WO2016118726A2 (en) 2015-01-21 2016-07-28 Sangamo Biosciences, Inc. Methods and compositions for identification of highly specific nucleases
AU2016212529B2 (en) 2015-01-27 2018-11-01 Institute Of Genetics And Developmental Biology, Chinese Academy Of Sciences A method for site-directed modification of whole plant through gene transient expression
FI3250691T3 (en) 2015-01-28 2023-08-24 Caribou Biosciences Inc Crispr hybrid dna/rna polynucleotides and methods of use
US11180792B2 (en) 2015-01-28 2021-11-23 The Regents Of The University Of California Methods and compositions for labeling a single-stranded target nucleic acid
WO2016120480A1 (en) 2015-01-29 2016-08-04 Meiogenix Method for inducing targeted meiotic recombinations
WO2016124920A1 (en) 2015-02-03 2016-08-11 The Institute Of Genetics And Developmental Biology Rice plants with altered seed phenotype and quality
US10793868B2 (en) 2015-02-03 2020-10-06 Institute Of Genetics And Developmental Biology Chinese Academy Of Sciences Plants with increased seed size
HRP20220890T1 (en) 2015-02-06 2022-10-14 National University Of Singapore Methods for enhancing efficacy of therapeutic immune cells
EP3262193A2 (en) 2015-02-26 2018-01-03 The Broad Institute Inc. T cell balance gene expression, compositions of matters and methods of use thereof
TW201702380A (en) * 2015-02-27 2017-01-16 再生元醫藥公司 Host cell protein modification
EP3265567B1 (en) 2015-03-02 2020-07-29 Conagen Inc. Regulatory elements from labyrinthulomycetes microorganisms
WO2016138574A1 (en) 2015-03-02 2016-09-09 Sinai Health System Homologous recombination factors
KR20230156800A (en) 2015-03-03 2023-11-14 더 제너럴 하스피탈 코포레이션 Engineered crispr-cas9 nucleases with altered pam specificity
WO2016142427A1 (en) 2015-03-10 2016-09-15 INSERM (Institut National de la Santé et de la Recherche Médicale) Method ank kit for reprogramming somatic cells
WO2016145516A1 (en) 2015-03-13 2016-09-22 Deep Genomics Incorporated System and method for training neural networks
US10066256B2 (en) 2015-03-17 2018-09-04 Bio-Rad Laboratories, Inc. Detection of genome editing
US20180064748A1 (en) 2015-03-27 2018-03-08 Yeda Research And Development Co. Ltd. Methods of treating motor neuron diseases
CN107567499A (en) 2015-03-27 2018-01-09 纳幕尔杜邦公司 Soybean U6 small nuclear RNAs gene promoter and its purposes in the constitutive expression of plant MicroRNA gene
EP3277805A1 (en) 2015-03-31 2018-02-07 Exeligen Scientific, Inc. Cas 9 retroviral integrase and cas 9 recombinase systems for targeted incorporation of a dna sequence into a genome of a cell or organism
CN107787367B (en) 2015-04-06 2021-10-26 里兰斯坦福初级大学理事会 Chemically modified guide RNAs for CRISPR/CAS mediated gene regulation
US11214779B2 (en) 2015-04-08 2022-01-04 University of Pittsburgh—of the Commonwealth System of Higher Education Activatable CRISPR/CAS9 for spatial and temporal control of genome editing
GB201506509D0 (en) 2015-04-16 2015-06-03 Univ Wageningen Nuclease-mediated genome editing
EP3286211A1 (en) 2015-04-23 2018-02-28 Novartis AG Treatment of cancer using chimeric antigen receptor and protein kinase a blocker
EP3286571B1 (en) 2015-04-24 2021-08-18 Editas Medicine, Inc. Evaluation of cas9 molecule/guide rna molecule complexes
WO2016176652A2 (en) 2015-04-29 2016-11-03 Fred Hutchinson Cancer Research Center Modified stem cells and uses thereof
WO2016179038A1 (en) * 2015-05-01 2016-11-10 Spark Therapeutics, Inc. ADENO-ASSOCIATED VIRUS-MEDIATED CRISPR-Cas9 TREATMENT OF OCULAR DISEASE
US10179918B2 (en) 2015-05-07 2019-01-15 Sangamo Therapeutics, Inc. Methods and compositions for increasing transgene activity
WO2016182893A1 (en) 2015-05-08 2016-11-17 Teh Broad Institute Inc. Functional genomics using crispr-cas systems for saturating mutagenesis of non-coding elements, compositions, methods, libraries and applications thereof
CA2985816A1 (en) 2015-05-15 2016-11-24 The General Hospital Corporation Antagonistic anti-tumor necrosis factor receptor superfamily antibodies
AU2016265255B2 (en) 2015-05-16 2022-03-17 Genzyme Corporation Gene editing of deep intronic mutations
CN114634943A (en) 2015-05-18 2022-06-17 T细胞受体治疗公司 Compositions and methods for reprogramming TCRs using fusion proteins
EP3095870A1 (en) 2015-05-19 2016-11-23 Kws Saat Se Methods for the in planta transformation of plants and manufacturing processes and products based and obtainable therefrom
DE102015006335A1 (en) 2015-05-19 2016-11-24 Kws Saat Se Methods and constructs for targeted nucleic acid editing in plants
DE102015014252A1 (en) 2015-11-05 2017-05-11 Kws Saat Se Methods and constructs for targeted nucleic acid editing in plants
EP3297642B1 (en) 2015-05-22 2019-09-11 STCube & Co., Inc. Screening methods for targets for cancer therapy
US10117911B2 (en) 2015-05-29 2018-11-06 Agenovir Corporation Compositions and methods to treat herpes simplex virus infections
KR102377189B1 (en) 2015-05-29 2022-03-22 리제너론 파마슈티칼스 인코포레이티드 C9orf72 - non-human animals having a disruption in a c9orf72 locus
EP3303585A4 (en) 2015-06-03 2018-10-31 Board of Regents of the University of Nebraska Dna editing using single-stranded dna
EP3303634B1 (en) 2015-06-03 2023-08-30 The Regents of The University of California Cas9 variants and methods of use thereof
US20180296537A1 (en) 2015-06-05 2018-10-18 Novartis Ag Methods and compositions for diagnosing, treating, and monitoring treatment of shank3 deficiency associated disorders
US10185803B2 (en) 2015-06-15 2019-01-22 Deep Genomics Incorporated Systems and methods for classifying, prioritizing and interpreting genetic variants and therapies using a deep neural network
WO2016205680A1 (en) 2015-06-17 2016-12-22 The Uab Research Foundation Crispr/cas9 complex for introducing a functional polypeptide into cells of blood cell lineage
WO2016205728A1 (en) 2015-06-17 2016-12-22 Massachusetts Institute Of Technology Crispr mediated recording of cellular events
WO2016205703A1 (en) 2015-06-17 2016-12-22 The Uab Research Foundation Crispr/cas9 complex for genomic editing
KR102575342B1 (en) 2015-06-18 2023-09-05 더 브로드 인스티튜트, 인코퍼레이티드 CRISPR enzyme mutations that reduce off-target effects
EP3436575A1 (en) 2015-06-18 2019-02-06 The Broad Institute Inc. Novel crispr enzymes and systems
FI3430134T3 (en) 2015-06-18 2023-01-13 Novel crispr enzymes and systems
WO2016205745A2 (en) 2015-06-18 2016-12-22 The Broad Institute Inc. Cell sorting
WO2016205759A1 (en) 2015-06-18 2016-12-22 The Broad Institute Inc. Engineering and optimization of systems, methods, enzymes and guide scaffolds of cas9 orthologs and variants for sequence manipulation
US9957501B2 (en) 2015-06-18 2018-05-01 Sangamo Therapeutics, Inc. Nuclease-mediated regulation of gene expression
US10648020B2 (en) 2015-06-18 2020-05-12 The Broad Institute, Inc. CRISPR enzymes and systems
US9790490B2 (en) * 2015-06-18 2017-10-17 The Broad Institute Inc. CRISPR enzymes and systems
US10669528B2 (en) 2015-06-25 2020-06-02 Children's Medical Center Corporation Methods and compositions relating to hematopoietic stem cell expansion, enrichment, and maintenance
US11414657B2 (en) 2015-06-29 2022-08-16 Ionis Pharmaceuticals, Inc. Modified CRISPR RNA and modified single CRISPR RNA and uses thereof
CN107922911A (en) 2015-07-09 2018-04-17 麻省理工学院 Material is delivered to cytode
CA2991301A1 (en) 2015-07-13 2017-01-19 Sangamo Therapeutics, Inc. Delivery methods and compositions for nuclease-mediated genome engineering
EP3957731A1 (en) 2015-07-15 2022-02-23 Rutgers, The State University of New Jersey Nuclease-independent targeted gene editing platform and uses thereof
US10682390B2 (en) 2015-07-16 2020-06-16 Biokine Therapeutics Ltd. Compositions and methods for treating cancer
AU2016295291A1 (en) 2015-07-17 2018-02-08 Institute Of Genetics And Developmental Biology Chinese Academy Of Sciences Wheat plants resistant to powdery mildew
WO2017015101A1 (en) * 2015-07-17 2017-01-26 University Of Washington Methods for maximizing the efficiency of targeted gene correction
JP6937740B2 (en) 2015-07-28 2021-09-22 ダニスコ・ユーエス・インク Genome editing system and usage
AU2016301195B2 (en) 2015-08-06 2022-09-01 Dana-Farber Cancer Institute, Inc. Targeted protein degradation to attenuate adoptive T-cell therapy associated adverse inflammatory responses
WO2017024317A2 (en) 2015-08-06 2017-02-09 Dana-Farber Cancer Institute, Inc. Methods to induce targeted protein degradation through bifunctional molecules
US9580727B1 (en) 2015-08-07 2017-02-28 Caribou Biosciences, Inc. Compositions and methods of engineered CRISPR-Cas9 systems using split-nexus Cas9-associated polynucleotides
WO2017027392A1 (en) 2015-08-07 2017-02-16 Novartis Ag Treatment of cancer using chimeric cd3 receptor proteins
CA3033617A1 (en) 2015-08-11 2017-02-16 Anie Philip Peptidic tgf-beta antagonists
EP3334746B1 (en) 2015-08-14 2021-11-24 The University Of Sydney Connexin 45 inhibition for therapy
JP2018527920A (en) 2015-08-14 2018-09-27 インスティテュート・オブ・ジェネティクス・アンド・ディヴェロプメンタル・バイオロジー、チャイニーズ・アカデミー・オブ・サイエンシズInstitute of Genetics and Developmental Biology, Chinese Academy of Sciences Method for obtaining glyphosate-tolerant rice by site-specific nucleotide substitution
EP3337908A4 (en) 2015-08-18 2019-01-23 The Broad Institute, Inc. Methods and compositions for altering function and structure of chromatin loops and/or domains
CA2995582A1 (en) * 2015-08-19 2017-02-23 Children's Research Institute, Children's National Medical Center Compositions and methods for treating graft versus host disease
IL288662B2 (en) 2015-08-25 2023-09-01 Univ Duke Compositions and methods of improving specificity in genomic engineering using rna-guided endonucleases
US9512446B1 (en) 2015-08-28 2016-12-06 The General Hospital Corporation Engineered CRISPR-Cas9 nucleases
US9926546B2 (en) 2015-08-28 2018-03-27 The General Hospital Corporation Engineered CRISPR-Cas9 nucleases
CN108350449B (en) 2015-08-28 2022-05-31 通用医疗公司 Engineered CRISPR-Cas9 nuclease
EP3344575B1 (en) 2015-09-04 2020-04-15 SQZ Biotechnologies Company Intracellular delivery of biomolecules to cells comprising a cell wall
EP3348638B1 (en) 2015-09-09 2022-12-14 National University Corporation Kobe University Method for converting genome sequence of gram-positive bacterium by specifically converting nucleic acid base of targeted dna sequence, and molecular complex used in same
IL241462A0 (en) 2015-09-10 2015-11-30 Yeda Res & Dev Heterologous engineering of betalain pigments in plants
AU2016319110B2 (en) 2015-09-11 2022-01-27 The General Hospital Corporation Full interrogation of nuclease DSBs and sequencing (FIND-seq)
CN105132427B (en) * 2015-09-21 2019-01-08 新疆畜牧科学院生物技术研究所 A kind of dual-gene method for obtaining gene editing sheep of specific knockdown mediated with RNA and its dedicated sgRNA
AU2016331185A1 (en) 2015-09-30 2018-04-26 The General Hospital Corporation Comprehensive in vitro reporting of cleavage events by sequencing (CIRCLE-seq)
WO2017059241A1 (en) 2015-10-02 2017-04-06 The United States Of America, As Represented By The Secretary, Department Of Health And Human Services Lentiviral protein delivery system for rna-guided genome editing
EP4108255A1 (en) 2015-10-05 2022-12-28 Precision Biosciences, Inc. Genetically-modified cells comprising a modified human t cell receptor alpha constant region gene
US10799535B2 (en) 2015-10-05 2020-10-13 Precision Biosciences, Inc. Engineered meganucleases with recognition sequences found in the human T cell receptor alpha constant region gene
US20190255107A1 (en) 2015-10-09 2019-08-22 The Brigham And Women's Hospital, Inc. Modulation of novel immune checkpoint targets
KR102628801B1 (en) 2015-10-12 2024-01-25 이아이디피, 인크. Protective DNA templates and methods of use for intracellular genetic modification and increased homologous recombination
EP3362571A4 (en) 2015-10-13 2019-07-10 Duke University Genome engineering with type i crispr systems in eukaryotic cells
MX2018004546A (en) 2015-10-16 2019-04-15 Univ Columbia Compositions and methods for inhibition of lineage specific antigens.
EP3362074B1 (en) 2015-10-16 2023-08-09 President and Fellows of Harvard College Regulatory t cell pd-1 modulation for regulating t cell effector immune responses
EP3365454A1 (en) * 2015-10-20 2018-08-29 10X Genomics, Inc. Methods and systems for high throughput single cell genetic manipulation
WO2017070605A1 (en) 2015-10-22 2017-04-27 The Broad Institute Inc. Type vi-b crispr enzymes and systems
EP3365461B1 (en) * 2015-10-22 2020-10-14 Institut National de la Sante et de la Recherche Medicale (INSERM) Endonuclease-barcoding
DK3350327T3 (en) 2015-10-23 2019-01-21 Caribou Biosciences Inc CONSTRUCTED CRISPR CLASS-2-NUCLEIC ACID TARGETING-NUCLEIC ACID
EP3159407A1 (en) 2015-10-23 2017-04-26 Silence Therapeutics (London) Ltd Guide rnas, methods and uses
US11492670B2 (en) * 2015-10-27 2022-11-08 The Broad Institute Inc. Compositions and methods for targeting cancer-specific sequence variations
WO2017075451A1 (en) 2015-10-28 2017-05-04 The Broad Institute Inc. Compositions and methods for evaluating and modulating immune responses by detecting and targeting pou2af1
WO2017075465A1 (en) 2015-10-28 2017-05-04 The Broad Institute Inc. Compositions and methods for evaluating and modulating immune responses by detecting and targeting gata3
US11092607B2 (en) 2015-10-28 2021-08-17 The Board Institute, Inc. Multiplex analysis of single cell constituents
WO2017075294A1 (en) 2015-10-28 2017-05-04 The Board Institute Inc. Assays for massively combinatorial perturbation profiling and cellular circuit reconstruction
WO2017075478A2 (en) 2015-10-28 2017-05-04 The Broad Institute Inc. Compositions and methods for evaluating and modulating immune responses by use of immune cell gene signatures
AU2016343978A1 (en) 2015-10-29 2018-05-17 Dana-Farber Cancer Institute, Inc. Methods for identification, assessment, prevention, and treatment of metabolic disorders using PM20D1 and N-lipidated amino acids
CA3004285A1 (en) 2015-11-03 2017-05-11 President And Fellows Of Harvard College Method and apparatus for volumetric imaging of a three-dimensional nucleic acid containing matrix
EP4036228A1 (en) 2015-11-13 2022-08-03 Avellino Lab USA, Inc. Methods for the treatment of corneal dystrophies
US10669320B2 (en) 2015-11-18 2020-06-02 The Regents Of The University Of Michigan Mps1 and KNL1 phosphorylation system
UA125929C2 (en) 2015-11-18 2022-07-13 Сінгента Партісіпейшнс Аг Haploid induction compositions and methods for use therefor
WO2017087708A1 (en) 2015-11-19 2017-05-26 The Brigham And Women's Hospital, Inc. Lymphocyte antigen cd5-like (cd5l)-interleukin 12b (p40) heterodimers in immunity
AU2016361350B2 (en) 2015-11-23 2023-04-06 Sangamo Therapeutics, Inc. Methods and compositions for engineering immunity
AU2016359629B2 (en) * 2015-11-23 2023-03-09 Ranjan BATRA Tracking and manipulating cellular RNA via nuclear delivery of CRISPR/Cas9
WO2017090761A1 (en) 2015-11-27 2017-06-01 国立大学法人神戸大学 Method for converting monocot plant genome sequence in which nucleic acid base in targeted dna sequence is specifically converted, and molecular complex used therein
WO2017095946A1 (en) 2015-11-30 2017-06-08 Flagship Pioneering, Inc. Methods and compositions relating to chondrisomes
CN105296518A (en) * 2015-12-01 2016-02-03 中国农业大学 Homologous arm vector construction method used for CRISPR/Cas 9 technology
MX2018005392A (en) 2015-12-04 2019-05-30 Caribou Biosciences Inc Engineered nucleic-acid targeting nucleic acids.
WO2017100376A2 (en) 2015-12-07 2017-06-15 Zymergen, Inc. Promoters from corynebacterium glutamicum
US9988624B2 (en) 2015-12-07 2018-06-05 Zymergen Inc. Microbial strain improvement by a HTP genomic engineering platform
US11208649B2 (en) 2015-12-07 2021-12-28 Zymergen Inc. HTP genomic engineering platform
WO2017106251A1 (en) * 2015-12-14 2017-06-22 President And Fellows Of Harvard College Cas discrimination using tuned guide rna
AU2016374253B2 (en) 2015-12-18 2021-10-21 Sangamo Therapeutics, Inc. Targeted disruption of the MHC cell receptor
EP3390624A4 (en) 2015-12-18 2019-07-10 The Regents of The University of California Modified site-directed modifying polypeptides and methods of use thereof
CA3008413A1 (en) 2015-12-18 2017-06-22 Sangamo Therapeutics, Inc. Targeted disruption of the t cell receptor
WO2017112620A1 (en) 2015-12-22 2017-06-29 North Carolina State University Methods and compositions for delivery of crispr based antimicrobials
EP3394092A1 (en) 2015-12-23 2018-10-31 Fred Hutchinson Cancer Research Center High affinity t cell receptors and uses thereof
WO2017115268A1 (en) * 2015-12-28 2017-07-06 Novartis Ag Compositions and methods for the treatment of hemoglobinopathies
ES2944597T3 (en) 2015-12-30 2023-06-22 Novartis Ag Enhanced Efficacy Immune Effector Cell Therapies
CN109312315B (en) * 2015-12-30 2023-06-09 阿维塔斯有限公司 Carrier-free delivery of gene-editing proteins and compositions to cells and tissues
RU2021121824A (en) 2016-01-04 2021-08-18 Те Борд Оф Трастиз Оф Те Лилэнд Стэнфорд Джуниор Юниверсити GENE THERAPY FOR RECESSIVE DYSTROPHIC BULLOUS EPIDERMOLYSIS USING GENETICALLY CORRECTED AUTOLOGICAL KERATINOCYTES
CA3009127A1 (en) 2016-01-06 2017-07-13 Yeda Research And Development Co. Ltd. Compositions and methods for treating malignant, autoimmune and inflammatory diseases
EA201891614A1 (en) 2016-01-11 2019-02-28 Те Борд Оф Трастиз Оф Те Лилэнд Стэнфорд Джуниор Юниверсити CHEMICAL PROTEINS AND METHODS OF IMMUNOTHERAPY
EA201891619A1 (en) 2016-01-11 2019-02-28 Те Борд Оф Трастиз Оф Те Лилэнд Стэнфорд Джуниор Юниверсити CHEMERAL PROTEINS AND METHODS OF REGULATING GENE EXPRESSION
CN109414001A (en) 2016-01-15 2019-03-01 杰克逊实验室 Pass through the non-human mammal for the genetic modification that the multi-cycle electroporation of CAS9 albumen generates
WO2017125931A1 (en) 2016-01-21 2017-07-27 The State Of Israel, Ministry Of Agriculture & Rural Development, Agricultural Research Organization (Aro) (Volcani Center) Parthenocarpic plants and methods of producing same
US11261433B2 (en) 2016-01-31 2022-03-01 Hadasit Medical Research Services And Development Ltd. Autosomal-identical pluripotent stem cell populations having non-identical sex chromosomal composition and uses thereof
CA3011049A1 (en) 2016-02-02 2017-08-10 Sangamo Therapeutics, Inc. Compositions for linking dna-binding domains and cleavage domains
EA201891629A1 (en) 2016-02-09 2019-03-29 Сибас Юс Ллс METHODS AND COMPOSITIONS FOR IMPROVING THE EFFICIENCY OF TARGETED MODIFICATION OF GENES WITH THE APPLICATION OF MEDIATED OLIGONUCLEOTIDE REPAIR GENES
US10876129B2 (en) 2016-02-12 2020-12-29 Ceres, Inc. Methods and materials for high throughput testing of mutagenized allele combinations
WO2017138008A2 (en) 2016-02-14 2017-08-17 Yeda Research And Development Co. Ltd. Methods of modulating protein exocytosis and uses of same in therapy
EP3416663B1 (en) 2016-02-18 2021-04-14 The Penn State Research Foundation Generating gabaergic neurons in brains
WO2017143071A1 (en) 2016-02-18 2017-08-24 The Regents Of The University Of California Methods and compositions for gene editing in stem cells
EP3420102B1 (en) 2016-02-22 2024-04-03 Massachusetts Institute of Technology Methods for identifying and modulating immune phenotypes
US11530253B2 (en) 2016-02-25 2022-12-20 The Children's Medical Center Corporation Customized class switch of immunoglobulin genes in lymphoma and hybridoma by CRISPR/CAS9 technology
CA3015665C (en) 2016-02-26 2020-09-22 Lanzatech New Zealand Limited Crispr/cas systems for c1-fixing bacteria
WO2017153982A1 (en) 2016-03-06 2017-09-14 Yeda Research And Development Co. Ltd. Method for modulating myelination
EP3429603B1 (en) 2016-03-15 2021-12-29 Children's Medical Center Corporation Methods and compositions relating to hematopoietic stem cell expansion
WO2017161005A1 (en) 2016-03-16 2017-09-21 Synthetic Genomics, Inc. Production of proteins in labyrinthulomycetes
JP2019515654A (en) 2016-03-16 2019-06-13 ザ ジェイ. デヴィッド グラッドストーン インスティテューツ Methods and compositions for treating obesity and / or diabetes, and methods and compositions for identifying candidate treatment agents
US11427861B2 (en) 2016-03-17 2022-08-30 Massachusetts Institute Of Technology Methods for identifying and modulating co-occurant cellular phenotypes
EP3219799A1 (en) 2016-03-17 2017-09-20 IMBA-Institut für Molekulare Biotechnologie GmbH Conditional crispr sgrna expression
KR20190080825A (en) 2016-03-21 2019-07-08 다나-파버 캔서 인스티튜트 인크. T-cell dysfunction state-specific gene expression regulators and their uses
US11512311B2 (en) 2016-03-25 2022-11-29 Editas Medicine, Inc. Systems and methods for treating alpha 1-antitrypsin (A1AT) deficiency
CA3021027A1 (en) 2016-04-15 2017-10-19 Novartis Ag Compositions and methods for selective expression of chimeric antigen receptors
PT3443075T (en) 2016-04-15 2022-12-16 Memorial Sloan Kettering Cancer Center Transgenic t cell and chimeric antigen receptor t cell compositions and related methods
AU2017253107B2 (en) 2016-04-19 2023-07-20 Massachusetts Institute Of Technology CPF1 complexes with reduced indel activity
KR101929239B1 (en) * 2016-04-22 2018-12-17 한양대학교 산학협력단 Method for gene editing in microalgae using RGEN RNP
WO2017189525A1 (en) 2016-04-25 2017-11-02 President And Fellows Of Harvard College Hybridization chain reaction methods for in situ molecular detection
US10752904B2 (en) 2016-04-26 2020-08-25 Massachusetts Institute Of Technology Extensible recombinase cascades
WO2017192544A1 (en) 2016-05-02 2017-11-09 Massachusetts Institute Of Technology AMPHIPHILIC NANOPARTICLES FOR CODELIVERY OF WATER-INSOLUBLE SMALL MOLECULES AND RNAi
US20200325483A1 (en) * 2016-05-12 2020-10-15 Brian P. Hanley Safe delivery of crispr and other gene therapies to large fractions of somatic cells in humans and animals
NZ747857A (en) 2016-05-20 2023-01-27 Regeneron Pharma Methods for breaking immunological tolerance using multiple guide rnas
CA3025171A1 (en) 2016-05-24 2017-11-30 Indiana University Research And Technology Corporation Ku inhibitors and their use for gene editing
RU2741786C2 (en) 2016-05-25 2021-01-28 Энсэрм (Энститю Насьональ Де Ла Санте Э Де Ла Решерш Медикаль) Methods and compositions for treating tumors
KR20220147710A (en) 2016-06-02 2022-11-03 시그마-알드리치 컴퍼니., 엘엘씨 Using programmable dna binding proteins to enhance targeted genome modification
US10767175B2 (en) 2016-06-08 2020-09-08 Agilent Technologies, Inc. High specificity genome editing using chemically modified guide RNAs
US11708588B2 (en) * 2016-06-16 2023-07-25 Adam Brian Robertson Gene editing
CA3028158A1 (en) 2016-06-17 2017-12-21 The Broad Institute, Inc. Type vi crispr orthologs and systems
US11293021B1 (en) 2016-06-23 2022-04-05 Inscripta, Inc. Automated cell processing methods, modules, instruments, and systems
CA3029254A1 (en) 2016-06-24 2017-12-28 The Regents Of The University Of Colorado, A Body Corporate Methods for generating barcoded combinatorial libraries
US11471462B2 (en) 2016-06-27 2022-10-18 The Broad Institute, Inc. Compositions and methods for detecting and treating diabetes
US10544411B2 (en) 2016-06-30 2020-01-28 Zymergen Inc. Methods for generating a glucose permease library and uses thereof
JP2019519242A (en) 2016-06-30 2019-07-11 ザイマージェン インコーポレイテッド Method for generating a bacterial hemoglobin library and its use
JP7033583B2 (en) 2016-07-13 2022-03-10 バーテックス ファーマシューティカルズ インコーポレイテッド Methods, compositions and kits for increasing genome editing efficiency
WO2018013918A2 (en) 2016-07-15 2018-01-18 Novartis Ag Treatment and prevention of cytokine release syndrome using a chimeric antigen receptor in combination with a kinase inhibitor
CN106191061B (en) * 2016-07-18 2019-06-18 暨南大学 A kind of sgRNA targeting sequencing of special target people ABCG2 gene and its application
US20190309283A1 (en) * 2016-07-19 2019-10-10 Biodynamics Laboratory, Inc. Method for preparing long-chain single-stranded dna
AU2017302657A1 (en) 2016-07-29 2019-02-14 Regeneron Pharmaceuticals, Inc. Mice comprising mutations resulting in expression of c-truncated fibrillin-1
AU2017305404B2 (en) 2016-08-02 2023-11-30 Editas Medicine, Inc. Compositions and methods for treating CEP290 associated disease
CA3032498A1 (en) 2016-08-02 2018-02-08 TCR2 Therapeutics Inc. Compositions and methods for tcr reprogramming using fusion proteins
WO2018030457A1 (en) 2016-08-10 2018-02-15 武田薬品工業株式会社 Method for modifying target site in genome of eukaryotic cell, and method for detecting presence or absence of nucleic acid sequence to be detected at target site
KR101710026B1 (en) 2016-08-10 2017-02-27 주식회사 무진메디 Composition comprising delivery carrier of nano-liposome having Cas9 protein and guide RNA
EP4056701A1 (en) 2016-08-12 2022-09-14 Nexuspiral Inc. Genome editing method
US20210166783A1 (en) 2016-08-17 2021-06-03 The Broad Institute, Inc. Methods for identifying class 2 crispr-cas systems
EP3500671A4 (en) 2016-08-17 2020-07-29 The Broad Institute, Inc. Novel crispr enzymes and systems
WO2018035364A1 (en) 2016-08-17 2018-02-22 The Broad Institute Inc. Product and methods useful for modulating and evaluating immune responses
IL247368A0 (en) 2016-08-18 2016-11-30 Yeda Res & Dev Diagnostic and therapeutic uses of exosomes
RU2019103691A (en) * 2016-08-19 2020-09-22 Тулджен Инкорпорейтед ARTIFICIALLY DESIGNED SYSTEM OF ANGIOGENESIS REGULATION
US20190185850A1 (en) * 2016-08-20 2019-06-20 Avellino Lab Usa, Inc. Single guide rna/crispr/cas9 systems, and methods of use thereof
WO2020225754A1 (en) 2019-05-06 2020-11-12 Mcmullen Tara Crispr gene editing for autosomal dominant diseases
IL264792B2 (en) 2016-08-24 2023-10-01 Sangamo Therapeutics Inc Engineered target-specific zinc finger nucleases
WO2018049009A2 (en) 2016-09-07 2018-03-15 Sangamo Therapeutics, Inc. Modulation of liver genes
WO2018049025A2 (en) 2016-09-07 2018-03-15 The Broad Institute Inc. Compositions and methods for evaluating and modulating immune responses
JP2019533139A (en) 2016-09-08 2019-11-14 アンスティチュ ナショナル ドゥ ラ サンテ エ ドゥ ラ ルシェルシュ メディカル Methods for diagnosing and treating nephrotic syndrome
IL247752A0 (en) 2016-09-11 2016-11-30 Yeda Res & Dev Compositions and methods for regulating gene expression for targeted mutagenesis
CA3036854A1 (en) 2016-09-15 2018-03-22 Labcyte Inc. High-efficiency transfection of biological cells using sonoporation
CA3034643A1 (en) 2016-09-20 2018-03-29 Ellen Weisberg Compositions and methods for identification, assessment, prevention, and treatment of aml using usp10 biomarkers and modulators
CA3035075A1 (en) 2016-09-23 2018-03-29 Fred Hutchinson Cancer Research Center Tcrs specific for minor histocompatibility (h) antigen ha-1 and uses thereof
US20190225974A1 (en) 2016-09-23 2019-07-25 BASF Agricultural Solutions Seed US LLC Targeted genome optimization in plants
EP3519577A1 (en) 2016-09-28 2019-08-07 Novartis AG Porous membrane-based macromolecule delivery system
AU2017336094A1 (en) 2016-09-29 2019-04-18 Immunitybio, Inc. HLA class I-deficient NK-92 cells with decreased immunogenicity
GB2569733B (en) 2016-09-30 2022-09-14 Univ California RNA-guided nucleic acid modifying enzymes and methods of use thereof
AU2017336100B2 (en) * 2016-09-30 2023-11-30 Regeneron Pharmaceuticals, Inc. Non-human animals having a hexanucleotide repeat expansion in a C9ORF72 locus
ES2811500T3 (en) 2016-10-04 2021-03-12 Prec Biosciences Inc Costimulatory domains for use in genetically modified cells
US10669539B2 (en) 2016-10-06 2020-06-02 Pioneer Biolabs, Llc Methods and compositions for generating CRISPR guide RNA libraries
US11242542B2 (en) 2016-10-07 2022-02-08 Integrated Dna Technologies, Inc. S. pyogenes Cas9 mutant genes and polypeptides encoded by same
CA3036745A1 (en) 2016-10-07 2018-04-12 TCR2 Therapeutics Inc. Compositions and methods for t-cell receptors reprogramming using fusion proteins
US20200016202A1 (en) 2016-10-07 2020-01-16 The Brigham And Women's Hospital, Inc. Modulation of novel immune checkpoint targets
WO2018068053A2 (en) 2016-10-07 2018-04-12 Integrated Dna Technologies, Inc. S. pyogenes cas9 mutant genes and polypeptides encoded by same
WO2018069232A1 (en) 2016-10-10 2018-04-19 INSERM (Institut National de la Santé et de la Recherche Médicale) Methods for predicting the risk of having cardiac hypertrophy
GB201617559D0 (en) 2016-10-17 2016-11-30 University Court Of The University Of Edinburgh The Swine comprising modified cd163 and associated methods
AU2017345430A1 (en) 2016-10-20 2019-05-02 Sangamo Therapeutics, Inc. Methods and compositions for the treatment of Fabry disease
WO2018081531A2 (en) 2016-10-28 2018-05-03 Ariad Pharmaceuticals, Inc. Methods for human t-cell activation
CN106637421B (en) * 2016-10-28 2019-12-27 博雅缉因(北京)生物科技有限公司 Construction of double sgRNA library and method for applying double sgRNA library to high-throughput functional screening research
CA3041668A1 (en) 2016-10-31 2018-05-03 Sangamo Therapeutics, Inc. Gene correction of scid-related genes in hematopoietic stem and progenitor cells
WO2018076335A1 (en) 2016-10-31 2018-05-03 Institute Of Genetics And Developmental Biology, Chinese Academy Of Sciences Compositions and methods for enhancing abiotic stress tolerance
US10633454B2 (en) 2016-11-01 2020-04-28 Conagen Inc. Expression of modified glycoproteins and glycopeptides
WO2018083606A1 (en) 2016-11-01 2018-05-11 Novartis Ag Methods and compositions for enhancing gene editing
CA3042259A1 (en) 2016-11-04 2018-05-11 Flagship Pioneering Innovations V. Inc. Novel plant cells, plants, and seeds
WO2018144097A1 (en) 2016-11-04 2018-08-09 Akeagen Llc Genetically modified non-human animals and methods for producing heavy chain-only antibodies
US20190345500A1 (en) 2016-11-14 2019-11-14 |Nserm (Institut National De La Santé Et De La Recherche Médicale) Methods and pharmaceutical compositions for modulating stem cells proliferation or differentiation
WO2018093797A1 (en) 2016-11-15 2018-05-24 The Schepens Eye Research Institute, Inc. Compositions and methods for the treatment of aberrant angiogenesis
US11851491B2 (en) 2016-11-22 2023-12-26 TCR2 Therapeutics Inc. Compositions and methods for TCR reprogramming using fusion proteins
CN110268049A (en) 2016-11-22 2019-09-20 新加坡国立大学 CD7 for T cell malignant tumour immunotherapy expresses retarding agent and Chimeric antigen receptor
AU2017364084A1 (en) 2016-11-22 2019-05-16 Integrated Dna Technologies, Inc. CRISPR/Cpf1 systems and methods
EP3545095A1 (en) 2016-11-28 2019-10-02 Yeda Research and Development Co., Ltd. Isolated polynucleotides and polypeptides and methods of using same for expressing an expression product of interest
WO2018100190A1 (en) 2016-12-02 2018-06-07 INSERM (Institut National de la Santé et de la Recherche Médicale) Methods and compositions for diagnosing renal cell carcinoma
US9816093B1 (en) 2016-12-06 2017-11-14 Caribou Biosciences, Inc. Engineered nucleic acid-targeting nucleic acids
CA3046199A1 (en) 2016-12-08 2018-06-14 Case Western Reserve University Methods and compositions for enhancing functional myelin production
US11293022B2 (en) 2016-12-12 2022-04-05 Integrated Dna Technologies, Inc. Genome editing enhancement
CA3045134A1 (en) 2016-12-14 2018-06-21 Ligandal, Inc. Compositions and methods for nucleic acid and/or protein payload delivery
JP2020513754A (en) 2016-12-21 2020-05-21 ティーシーアール2 セラピューティクス インク. T cells engineered for cancer treatment
EP4095228A1 (en) 2016-12-22 2022-11-30 Avectas Limited System for vector-free intracellular delivery by reversible permeabilisation
WO2018126087A1 (en) 2016-12-29 2018-07-05 Applied Stemcell, Inc. Gene editing method using virus
WO2018122771A1 (en) 2016-12-29 2018-07-05 Ukko Inc. Methods for identifying and de-epitoping allergenic polypeptides
US11859219B1 (en) 2016-12-30 2024-01-02 Flagship Pioneering Innovations V, Inc. Methods of altering a target nucleotide sequence with an RNA-guided nuclease and a single guide RNA
WO2018127585A1 (en) 2017-01-06 2018-07-12 Txcell Monospecific regulatory t cell population with cytotoxicity for b cells
EP3346001A1 (en) 2017-01-06 2018-07-11 TXCell Monospecific regulatory t cell population with cytotoxicity for b cells
JP7118072B2 (en) 2017-01-06 2022-08-15 イミュニティーバイオ インコーポレイテッド Genetically modified NK-92 cells with reduced CD96/TIGIT expression
DK3565891T3 (en) 2017-01-09 2023-07-24 Whitehead Inst Biomedical Res METHODS OF ALTERING GENE EXPRESSION BY DISRUPTING TRANSCRIPTION FACTOR MULTIMERS THAT STRUCTURE REGULATORY LOOPS
CN106636204B (en) * 2017-01-09 2019-08-23 华中农业大学 A kind of albefaction Misgurnus auguillicaudatus breeding method that can stablize heredity
US11519009B2 (en) 2017-01-09 2022-12-06 University Of Massachusetts Complexes for gene deletion and editing
GB201700380D0 (en) 2017-01-10 2017-02-22 Plant Bioscience Ltd Methods of increasing seed yield
JP7215716B2 (en) 2017-01-13 2023-01-31 学校法人自治医科大学 AAV vectors for disrupting coagulation-related factor genes on the liver genome
EP3571321A1 (en) 2017-01-23 2019-11-27 Regeneron Pharmaceuticals, Inc. Hydroxysteroid 17-beta dehydrogenase 13 (hsd17b13) variants and uses thereof
EP3574005B1 (en) 2017-01-26 2021-12-15 Novartis AG Cd28 compositions and methods for chimeric antigen receptor therapy
US11624071B2 (en) 2017-01-28 2023-04-11 Inari Agriculture Technology, Inc. Method of creating a plurality of targeted insertions in a plant cell
EP3577134A1 (en) 2017-01-31 2019-12-11 Novartis AG Treatment of cancer using chimeric t cell receptor proteins having multiple specificities
TW201839136A (en) 2017-02-06 2018-11-01 瑞士商諾華公司 Compositions and methods for the treatment of hemoglobinopathies
IL250479A0 (en) 2017-02-06 2017-03-30 Sorek Rotem Isolated cells genetically modified to express a disarm system having an anti-phage activity and methods of producing same
WO2018148246A1 (en) 2017-02-07 2018-08-16 Massachusetts Institute Of Technology Methods and compositions for rna-guided genetic circuits
EP3580212A4 (en) 2017-02-08 2021-03-17 Dana Farber Cancer Institute, Inc. Regulating chimeric antigen receptors
WO2018146481A1 (en) 2017-02-09 2018-08-16 Fujian Agriculture And Forestry University Expression of a phosphate transporter for improving plant yield
EP3579872A1 (en) 2017-02-10 2019-12-18 INSERM (Institut National de la Santé et de la Recherche Médicale) Methods and pharmaceutical compositions for the treatment of cancers associated with activation of the mapk pathway
CA3049989A1 (en) 2017-02-10 2018-08-16 Zymergen Inc. A modular universal plasmid design strategy for the assembly and editing of multiple dna constructs for multiple hosts
EP3583118A1 (en) 2017-02-17 2019-12-25 Denali Therapeutics Inc. Transferrin receptor transgenic models
WO2018154418A1 (en) * 2017-02-22 2018-08-30 Crispr Therapeutics Ag Materials and methods for treatment of early onset parkinson's disease (park1) and other synuclein, alpha (snca) gene related conditions or disorders
EP3589647A1 (en) 2017-02-28 2020-01-08 Novartis AG Shp inhibitor compositions and uses for chimeric antigen receptor therapy
EP3596217A1 (en) 2017-03-14 2020-01-22 Editas Medicine, Inc. Systems and methods for the treatment of hemoglobinopathies
SG11201908527SA (en) 2017-03-15 2019-10-30 Hutchinson Fred Cancer Res High affinity mage-a1-specific tcrs and uses thereof
EP3596207B1 (en) 2017-03-15 2023-12-20 The Broad Institute, Inc. Novel cas13b orthologues crispr enzymes and systems
EP3595645A1 (en) 2017-03-15 2020-01-22 INSERM (Institut National de la Santé et de la Recherche Médicale) Pharmaceutical compositions for the treatment of thrombosis in patients suffering from a myeloproliferative neoplasm
US11771703B2 (en) 2017-03-17 2023-10-03 The Johns Hopkins University Targeted epigenetic therapy against distal regulatory element of TGFβ2 expression
WO2018170515A1 (en) 2017-03-17 2018-09-20 The Broad Institute, Inc. Methods for identifying and modulating co-occurant cellular phenotypes
EP3600269A1 (en) 2017-03-24 2020-02-05 INSERM - Institut National de la Santé et de la Recherche Médicale Gfi1 inhibitors for the treatment of hyperglycemia
WO2018172785A1 (en) 2017-03-24 2018-09-27 Institute Of Genetics And Developmental Biology, Chinese Academy Of Sciences Methods for increasing grain yield
US20210186982A1 (en) 2017-03-24 2021-06-24 Universite Nice Sophia Antipolis Methods and compositions for treating melanoma
WO2018183580A1 (en) * 2017-03-29 2018-10-04 The Broad Institute, Inc Compositions and methods for treatment of peroxisome proliferator-activated receptor gamma (pparg) activated cancer
US20210275543A1 (en) 2017-03-30 2021-09-09 Nserm (Institut National De La Santé Et De La Recherche Médicale) Methods for the treatment of mitochondrial genetic diseases
US11913075B2 (en) 2017-04-01 2024-02-27 The Broad Institute, Inc. Methods and compositions for detecting and modulating an immunotherapy resistance gene signature in cancer
EP3607071A1 (en) * 2017-04-06 2020-02-12 DSM IP Assets B.V. Self-guiding integration construct (sgic)
US20200071773A1 (en) 2017-04-12 2020-03-05 Massachusetts Eye And Ear Infirmary Tumor signature for metastasis, compositions of matter methods of use thereof
JP2020516285A (en) 2017-04-12 2020-06-11 ザ・ブロード・インスティテュート・インコーポレイテッド New VI type CRISPR ortholog and system
WO2018191520A1 (en) 2017-04-12 2018-10-18 The Broad Institute, Inc. Respiratory and sweat gland ionocytes
AU2018253115B2 (en) 2017-04-12 2022-08-11 Edigene Biotechnology, Inc. Aryl hydrocarbon receptor antagonists and uses thereof
WO2018191750A2 (en) 2017-04-14 2018-10-18 The Broad Institute Inc. Novel delivery of large payloads
WO2018195129A1 (en) 2017-04-17 2018-10-25 University Of Maryland, College Park Embryonic cell cultures and methods of using the same
EP3612629A1 (en) 2017-04-18 2020-02-26 The Broad Institute, Inc. Compositions for detecting secretion and methods of use
US11834670B2 (en) * 2017-04-19 2023-12-05 Global Life Sciences Solutions Usa Llc Site-specific DNA modification using a donor DNA repair template having tandem repeat sequences
WO2018193075A1 (en) 2017-04-21 2018-10-25 INSERM (Institut National de la Santé et de la Recherche Médicale) Methods and pharmaceutical compositions for the treatment of diseases associated with reduced cftr function
AU2018254619B2 (en) 2017-04-21 2022-07-21 The General Hospital Corporation Variants of Cpf1 (CAS12a) with altered PAM specificity
US20200384115A1 (en) 2017-04-21 2020-12-10 The Broad Institute , Inc. Targeted delivery to beta cells
WO2018201051A1 (en) 2017-04-28 2018-11-01 Novartis Ag Bcma-targeting agent, and combination therapy with a gamma secretase inhibitor
WO2018201056A1 (en) 2017-04-28 2018-11-01 Novartis Ag Cells expressing a bcma-targeting chimeric antigen receptor, and combination therapy with a gamma secretase inhibitor
CN110799492B (en) 2017-04-28 2023-06-27 爱康泰生治疗公司 Novel carbonyl lipid and lipid nanoparticle formulations for delivery of nucleic acids
US11655275B2 (en) 2017-05-03 2023-05-23 Sangamo Therapeutics, Inc. Methods and compositions for modification of a cystic fibrosis transmembrane conductance regulator (CFTR) gene
WO2018204777A2 (en) 2017-05-05 2018-11-08 The Broad Institute, Inc. Methods for identification and modification of lncrna associated with target genotypes and phenotypes
IL252151A0 (en) 2017-05-07 2017-07-31 Fainzilber Michael Methods of treating psychiatric stress disorders
EP3634493A1 (en) 2017-05-08 2020-04-15 Precision BioSciences, Inc. Nucleic acid molecules encoding an engineered antigen receptor and an inhibitory nucleic acid molecule and methods of use thereof
CA3062595A1 (en) 2017-05-10 2018-11-15 The Regents Of The University Of California Directed editing of cellular rna via nuclear delivery of crispr/cas9
US20200171022A1 (en) 2017-05-17 2020-06-04 Inserm (Institut National De La Santé Et Da La Recherche Médicale) Flt3 inhibitors for improving pain treatments by opioids
CN111417727A (en) 2017-05-18 2020-07-14 博德研究所 Systems, methods, and compositions for targeted nucleic acid editing
US10780119B2 (en) 2017-05-24 2020-09-22 Effector Therapeutics Inc. Methods and compositions for cellular immunotherapy
EP3634984A1 (en) 2017-05-25 2020-04-15 Institute Of Genetics And Developmental Biology, Chinese Academy Of Sciences Methods for increasing grain productivity
US11326157B2 (en) 2017-05-25 2022-05-10 The General Hospital Corporation Base editors with improved precision and specificity
EP3409104A1 (en) 2017-05-31 2018-12-05 Vilmorin et Cie Tomato plant resistant to tomato yellow leaf curl virus, powdery mildew, and nematodes
EP3409106A1 (en) 2017-06-01 2018-12-05 Vilmorin et Cie Tolerance in plants of solanum lycopersicum to the tobamovirus tomato brown rugose fruit virus (tbrfv)
WO2020249996A1 (en) 2019-06-14 2020-12-17 Vilmorin & Cie Resistance in plants of solanum lycopersicum to the tobamovirus tomato brown rugose fruit virus
EP3635113A4 (en) 2017-06-05 2021-03-17 Fred Hutchinson Cancer Research Center Genomic safe harbors for genetic therapies in human stem cells and engineered nanoparticles to provide targeted genetic therapies
EP3634983A1 (en) 2017-06-05 2020-04-15 Consejo Superior de Investigaciones Científicas (CSIC) - Delegación Andalucía Targeting of gluten by genome editing
ES2875579T3 (en) 2017-06-06 2021-11-10 Zymergen Inc HTP genomic engineering platform to improve Escherichia coli
US11820822B2 (en) 2017-06-06 2023-11-21 Dana-Farber Cancer Institute, Inc. Methods for sensitizing cancer cells to T cell-mediated killing by modulating molecular pathways
JP7227162B2 (en) 2017-06-06 2023-02-21 ザイマージェン インコーポレイテッド HTP Genome Engineering Platform for Improving Fungal Strains
WO2018224615A1 (en) 2017-06-08 2018-12-13 INSERM (Institut National de la Santé et de la Recherche Médicale) Methods and compositions for treating hyperpigmentation disorders
US11845942B2 (en) 2017-06-09 2023-12-19 Vilmorin & Cie Compositions and methods for genome editing
CA3066750A1 (en) 2017-06-13 2018-12-20 Flagship Pioneering Innovations V, Inc. Compositions comprising curons and uses thereof
US11845954B2 (en) 2017-06-14 2023-12-19 Technische Universität Dresden Methods and means for genetic alteration of genomes utilizing designer DNA recombining enzymes
EP3638218A4 (en) 2017-06-14 2021-06-09 The Broad Institute, Inc. Compositions and methods targeting complement component 3 for inhibiting tumor growth
CA3067382A1 (en) 2017-06-15 2018-12-20 The Regents Of The University Of California Targeted non-viral dna insertions
US11512287B2 (en) 2017-06-16 2022-11-29 Sangamo Therapeutics, Inc. Targeted disruption of T cell and/or HLA receptors
DK3538645T3 (en) 2017-06-20 2021-04-19 Inst Curie IMMUNE CELLS MISSING SUV39H1
US10011849B1 (en) 2017-06-23 2018-07-03 Inscripta, Inc. Nucleic acid-guided nucleases
RU2022103603A (en) 2017-06-23 2022-03-11 Инскрипта, Инк. NUCLEIC ACID-DIRECTED NUCLEASE
US9982279B1 (en) 2017-06-23 2018-05-29 Inscripta, Inc. Nucleic acid-guided nucleases
CN111328290A (en) 2017-06-26 2020-06-23 博德研究所 CRISPR/CAS-adenine deaminase-based compositions, systems, and methods for targeted nucleic acid editing
ES2913457T3 (en) 2017-06-30 2022-06-02 Inscripta Inc Automated Cell Processing Methods, Modules, Instruments and Systems
WO2019005957A1 (en) 2017-06-30 2019-01-03 Precision Biosciences, Inc. Genetically-modified t cells comprising a modified intron in the t cell receptor alpha gene
US20200140896A1 (en) 2017-06-30 2020-05-07 Novartis Ag Methods for the treatment of disease with gene editing systems
AU2018301393A1 (en) 2017-07-11 2020-02-06 Compass Therapeutics Llc Agonist antibodies that bind human CD137 and uses thereof
WO2019014664A1 (en) * 2017-07-14 2019-01-17 Dana-Farber Cancer Institute, Inc. Modulating biomarkers to increase tumor immunity and improve the efficacy of cancer immunotherapy
WO2019011118A1 (en) 2017-07-14 2019-01-17 苏州克睿基因生物科技有限公司 Gene editing system and gene editing method
US20190316101A1 (en) 2017-07-18 2019-10-17 Howard Hughes Medical Institute Methods and compositions for genetically manipulating genes and cells
WO2019016310A1 (en) 2017-07-20 2019-01-24 INSERM (Institut National de la Santé et de la Recherche Médicale) Methods and compositions for treating cancers
IL253642A0 (en) 2017-07-24 2017-09-28 Seger Rony Combination therapy for the treatment of cancer
WO2019023291A2 (en) 2017-07-25 2019-01-31 Dana-Farber Cancer Institute, Inc. Compositions and methods for making and decoding paired-guide rna libraries and uses thereof
EP3658173A1 (en) 2017-07-25 2020-06-03 INSERM (Institut National de la Santé et de la Recherche Médicale) Methods and pharmaceutical compositions for modulating monocytopoiesis
CN110891419A (en) 2017-07-31 2020-03-17 瑞泽恩制药公司 Evaluation of CRISPR/CAS-induced in vivo recombination with exogenous donor nucleic acids
NZ761655A (en) 2017-07-31 2024-03-22 Reflection Biotechnologies Ltd Cellular models of and therapies for ocular diseases
CA3068072A1 (en) 2017-07-31 2019-02-07 Regeneron Pharmaceuticals, Inc. Methods and compositions for assessing crispr/cas-mediated disruption or excision and crispr/cas-induced recombination with an exogenous donor nucleic acid in vivo
CA3067872A1 (en) 2017-07-31 2019-02-07 Regeneron Pharmaceuticals, Inc. Cas-transgenic mouse embryonic stem cells and mice and uses thereof
JP7207665B2 (en) 2017-08-04 2023-01-18 北京大学 TALE RVDs that specifically recognize DNA bases modified by methylation and uses thereof
WO2019028686A1 (en) 2017-08-08 2019-02-14 北京大学 Gene knockout method
CN111263810A (en) * 2017-08-22 2020-06-09 纳匹基因公司 Organelle genome modification using polynucleotide directed endonucleases
EP3672612A4 (en) 2017-08-23 2021-09-29 The General Hospital Corporation Engineered crispr-cas9 nucleases with altered pam specificity
WO2019038771A1 (en) 2017-08-23 2019-02-28 Technion Research & Development Foundation Limited Compositions and methods for improving alcohol tolerance in yeast
CN111655861A (en) 2017-08-24 2020-09-11 内布拉斯加大学董事委员会 Methods and compositions for in situ germline genome engineering
WO2019038417A1 (en) 2017-08-25 2019-02-28 Institute Of Genetics And Developmental Biology, Chinese Academy Of Sciences Methods for increasing grain yield
US10738327B2 (en) 2017-08-28 2020-08-11 Inscripta, Inc. Electroporation cuvettes for automation
EP3675880B1 (en) 2017-09-01 2023-06-07 The Johns Hopkins University Targeted epigenetic therapy for inherited aortic aneurysm condition
CN107446859B (en) * 2017-09-02 2020-12-18 河南省农业科学院畜牧兽医研究所 Mycoplasma gallisepticum and application thereof
EP3680331A4 (en) 2017-09-05 2021-06-09 The University Of Tokyo Modified cas9 protein, and use thereof
US20210106618A1 (en) 2017-09-06 2021-04-15 Fred Hutchinson Cancer Research Center Methods for improving adoptive cell therapy
CA3071661A1 (en) 2017-09-06 2019-03-14 Fred Hutchinson Cancer Research Center Strep-tag specific chimeric receptors and uses thereof
US20200262879A1 (en) 2017-09-11 2020-08-20 Insideoutbio, Inc. Methods and compositions to enhance the immunogenicity of tumors
WO2019055862A1 (en) 2017-09-14 2019-03-21 Fred Hutchinson Cancer Research Center High affinity t cell receptors and uses thereof
CN109517796A (en) 2017-09-18 2019-03-26 博雅辑因(北京)生物科技有限公司 A kind of gene editing T cell and application thereof
EP3684914A4 (en) 2017-09-18 2021-06-02 Futuragene Israel Ltd. Tissue-specific expression control of della polypeptides
WO2019057649A1 (en) 2017-09-19 2019-03-28 INSERM (Institut National de la Santé et de la Recherche Médicale) Methods and pharmaceutical compositions for the treatment of acute myeloid leukemia
US20200268837A1 (en) 2017-09-20 2020-08-27 INSERM (Institut National de la Santé et de la Recherche Médicale) Methods and pharmaceutical compositions for modulating autophagy
BR112020005519A2 (en) 2017-09-20 2020-10-27 The University Of British Columbia new anti-hla-a2 antibodies and their uses
US11534471B2 (en) 2017-09-21 2022-12-27 Dana-Farber Cancer Institute, Inc. Isolation, preservation, compositions and uses of extracts from justicia plants
CN111511388A (en) 2017-09-21 2020-08-07 博德研究所 Systems, methods, and compositions for targeted nucleic acid editing
KR101896847B1 (en) 2017-09-22 2018-09-07 한국생명공학연구원 Composition for Inhibiting Gene Expression comprising Nuclease-Deactivated Cpf1 and Uses Thereof
MX2020003589A (en) 2017-09-29 2020-07-22 Regeneron Pharma Non-human animals comprising a humanized.
US11603536B2 (en) * 2017-09-29 2023-03-14 Inari Agriculture Technology, Inc. Methods for efficient maize genome editing
CN111372650A (en) 2017-09-30 2020-07-03 因思科瑞普特公司 Flow-through electroporation apparatus
EP3692057B9 (en) 2017-10-03 2023-10-04 Precision BioSciences, Inc. Modified epidermal growth factor receptor peptides for use in genetically-modified cells
EP3692152A4 (en) 2017-10-04 2021-12-01 The Broad Institute, Inc. Methods and compositions for altering function and structure of chromatin loops and/or domains
CA3076740A1 (en) * 2017-10-06 2019-04-11 Oregon Health & Science University Compositions and methods for editing rna
WO2019075197A1 (en) 2017-10-11 2019-04-18 The General Hospital Corporation Methods for detecting site-specific and spurious genomic deamination induced by base editing technologies
US10709085B2 (en) 2017-10-13 2020-07-14 Bejo Zaden Bv Lettuce variety ‘80020-0911-007’
WO2019079362A1 (en) 2017-10-16 2019-04-25 Massachusetts Institute Of Technology Mycobacterium tuberculosis host-pathogen interaction
JP2021502330A (en) 2017-10-20 2021-01-28 フレッド ハッチンソン キャンサー リサーチ センター Compositions and immunotherapeutic methods targeting TIGIT and / or CD112R or comprising CD226 overexpression
MX2020004063A (en) 2017-10-20 2020-10-05 Hutchinson Fred Cancer Res Systems and methods to produce b cells genetically modified to express selected antibodies.
US11690856B2 (en) 2017-10-23 2023-07-04 Inserm (Institut National De La Sante Et De La Recherche Medicale) Compounds for treating CMV related diseases
SG11202003798TA (en) 2017-10-27 2020-05-28 Univ California Targeted replacement of endogenous t cell receptors
CN109722415B (en) 2017-10-27 2021-01-26 博雅辑因(北京)生物科技有限公司 Hematopoietic stem cell culture composition, culture medium and hematopoietic stem cell culture method
WO2019089826A1 (en) 2017-10-31 2019-05-09 Magenta Therapeutics Inc. Compositions and methods for the expansion of hematopoietic stem and progenitor cells
US20210179709A1 (en) 2017-10-31 2021-06-17 Novartis Ag Anti-car compositions and methods
CN111683669A (en) 2017-10-31 2020-09-18 美真达治疗公司 Compositions and methods for hematopoietic stem and progenitor cell transplantation therapy
WO2019089753A2 (en) 2017-10-31 2019-05-09 Compass Therapeutics Llc Cd137 antibodies and pd-1 antagonists and uses thereof
WO2019089803A1 (en) 2017-10-31 2019-05-09 The Broad Institute, Inc. Methods and compositions for studying cell evolution
EP3704238B1 (en) 2017-11-01 2024-01-03 Precision Biosciences, Inc. Engineered nucleases that target human and canine factor viii genes as a treatment for hemophilia a
WO2019087113A1 (en) 2017-11-01 2019-05-09 Novartis Ag Synthetic rnas and methods of use
WO2019094725A2 (en) 2017-11-09 2019-05-16 Sangamo Therapeutics, Inc. Genetic modification of cytokine inducible sh2-containing protein (cish) gene
WO2019094983A1 (en) 2017-11-13 2019-05-16 The Broad Institute, Inc. Methods and compositions for treating cancer by targeting the clec2d-klrb1 pathway
AU2018369784B2 (en) 2017-11-14 2023-06-01 Massachusetts Eye And Ear Infirmary RUNX1 inhibition for treatment of proliferative vitreoretinopathy and conditions associated with epithelial to mesenchymal transition
IL255664A0 (en) 2017-11-14 2017-12-31 Shachar Idit Hematopoietic stem cells with improved properties
BR112020009663A2 (en) 2017-11-17 2020-11-10 Iovance Biotherapeutics, Inc. method for the expansion of tumor infiltrating lymphocytes (tils) in a therapeutic population of tils, method for the treatment of an individual with cancer, composition
WO2019099823A1 (en) * 2017-11-17 2019-05-23 Stc.Unm Therapy for myotonic dystrophy type 1 via genome editing of the dmpk gene
US11851497B2 (en) 2017-11-20 2023-12-26 Compass Therapeutics Llc CD137 antibodies and tumor antigen-targeting antibodies and uses thereof
JP2021503885A (en) 2017-11-22 2021-02-15 アイオバンス バイオセラピューティクス,インコーポレイテッド Expanded culture of peripheral blood lymphocytes (PBL) from peripheral blood
JP7408036B2 (en) 2017-11-24 2024-01-05 アンスティチュ ナショナル ドゥ ラ サンテ エ ドゥ ラ ルシェルシュ メディカル Methods and compositions for treating cancer
WO2019101995A1 (en) 2017-11-27 2019-05-31 INSERM (Institut National de la Santé et de la Recherche Médicale) Methods and pharmaceutical compositions for cardiac regeneration
SG11202004980RA (en) 2017-11-28 2020-06-29 Mirimus Inc METHODS OF GENETIC MEDIATED ENGINEERING OF RNAi MODELS
WO2019109047A1 (en) 2017-12-01 2019-06-06 Fred Hutchinson Cancer Research Center Binding proteins specific for 5t4 and uses thereof
GB201720351D0 (en) 2017-12-06 2018-01-17 Iontas Ltd Selecting for developability in drug discovery
AU2018378804A1 (en) 2017-12-06 2020-06-11 Ensoma, Inc. Dosing regimens for the mobilization of hematopoietic stem and progenitor cells
WO2019113506A1 (en) 2017-12-07 2019-06-13 The Broad Institute, Inc. Methods and compositions for multiplexing single cell and single nuclei sequencing
WO2019113463A1 (en) 2017-12-08 2019-06-13 Synthetic Genomics, Inc. Improving algal lipid productivity via genetic modification of a tpr domain containing protein
CA3084191A1 (en) 2017-12-15 2019-06-20 Danisco Us Inc. Cas9 variants and methods of use
CN107868123B (en) 2017-12-25 2020-05-12 中国农业科学院作物科学研究所 Gene capable of simultaneously improving plant yield and resistance and application thereof
WO2019133881A1 (en) 2017-12-29 2019-07-04 Rubius Therapeutics, Inc. Gene editing and targeted transcriptional modulation for enginerering erythroid cells
US20200338132A1 (en) 2018-01-03 2020-10-29 Magenta Therapeutics Inc. Compositions and methods for the expansion of hematopoietic stem and progenitor cells and treatment of inherited metabolic disorders
US20210072244A1 (en) 2018-01-04 2021-03-11 INSERM (Institut National de la Santé et de la Recherche Médicale) Methods and compositions for treating melanoma resistant
AU2019207703A1 (en) 2018-01-09 2020-07-16 Cibus Europe B.V. Shatterproof genes and mutations
WO2019140278A1 (en) 2018-01-11 2019-07-18 Fred Hutchinson Cancer Research Center Immunotherapy targeting core binding factor antigens
WO2019138083A1 (en) 2018-01-12 2019-07-18 Basf Se Gene underlying the number of spikelets per spike qtl in wheat on chromosome 7a
CN111757876B (en) 2018-01-17 2024-03-22 沃泰克斯药物股份有限公司 DNA-PK inhibitors
ES2940786T3 (en) 2018-01-17 2023-05-11 Vertex Pharma Quinoxalinone Compounds, Compositions, Methods, and Kits to Increase Genome Editing Efficiency
EP3740479A1 (en) 2018-01-17 2020-11-25 Vertex Pharmaceuticals Incorporated Dna-pk inhibitors
US20210054064A1 (en) 2018-01-24 2021-02-25 INSERM (Institut National de la Santé et de la Recherche Médicale Antagonists of il-33 for use in methods for preventing ischemia reperfusion injusry in an organ
US20190233816A1 (en) * 2018-01-26 2019-08-01 Massachusetts Institute Of Technology Structure-guided chemical modification of guide rna and its applications
US11220694B1 (en) 2018-01-29 2022-01-11 Inari Agriculture, Inc. Rice cells and rice plants
US11926835B1 (en) * 2018-01-29 2024-03-12 Inari Agriculture Technology, Inc. Methods for efficient tomato genome editing
IL257225A (en) 2018-01-29 2018-04-09 Yeda Res & Dev Treatment of sarcoma
US11802288B1 (en) * 2018-01-29 2023-10-31 Inari Agriculture Technology, Inc. Methods for efficient soybean genome editing
CN112041659A (en) * 2018-02-06 2020-12-04 瓦罗贝克两合公司 Microfluidic devices, systems, infrastructures, uses thereof, and methods for genetic engineering using same
KR20200119239A (en) 2018-02-08 2020-10-19 지머젠 인코포레이티드 Genome editing using CRISPR in Corynebacterium
BR112020014242A2 (en) 2018-02-14 2020-12-15 Institute Of Genetics And Developmental Biology, Chinese Academy Of Sciences METHODS OF INCREASING THE EFFICIENCY OF NUTRIENT USE
CA3091311A1 (en) 2018-02-16 2019-08-22 Inserm (Institut National De La Sante Et De La Recherche Medicale) Use of antagonists of cxcr3b for treating vitiligo
WO2019165116A1 (en) 2018-02-26 2019-08-29 Fred Hutchinson Cancer Research Center Compositions and methods for cellular immunotherapy
BR112020018658A2 (en) 2018-03-15 2020-12-29 KSQ Therapeutics, Inc. GENE REGULATION COMPOSITIONS AND METHODS FOR IMPROVED IMU-NOTERAPY
KR20240038811A (en) 2018-03-19 2024-03-25 리제너론 파마슈티칼스 인코포레이티드 Transcription modulation in animals using crispr/cas systems
WO2019190874A1 (en) 2018-03-29 2019-10-03 Inscripta, Inc. Automated control of cell growth rates for induction and transformation
WO2019193375A1 (en) 2018-04-04 2019-10-10 INSERM (Institut National de la Santé et de la Recherche Médicale) Use of fzd7 inhibitors for the treatment of retinal neovascularization
IT201800004253A1 (en) 2018-04-05 2019-10-05 Compositions and methods for the treatment of hereditary dominant catecholaminergic polymorphic ventricular tachycardia.
JP2021520781A (en) 2018-04-06 2021-08-26 チルドレンズ メディカル センター コーポレーションChildren’S Medical Center Corporation Compositions and Methods for Somatic Cell Reprogramming and Imprinting Modulation
WO2019200122A1 (en) 2018-04-12 2019-10-17 Precision Biosciences, Inc. Optimized engineered nucleases having specificity for the human t cell receptor alpha constant region gene
SG11202010116PA (en) 2018-04-13 2020-11-27 Sangamo Therapeutics France Chimeric antigen receptor specific for interleukin-23 receptor
WO2019200004A1 (en) 2018-04-13 2019-10-17 Inscripta, Inc. Automated cell processing instruments comprising reagent cartridges
CN112313241A (en) 2018-04-17 2021-02-02 总医院公司 Sensitive in vitro assay of substrate preference and site for nucleic acid binding, modification, and cleavage reagents
WO2019204585A1 (en) 2018-04-19 2019-10-24 Massachusetts Institute Of Technology Single-stranded break detection in double-stranded dna
AU2019255789A1 (en) 2018-04-19 2020-10-22 The Regents Of The University Of California Compositions and methods for gene editing
US10858761B2 (en) 2018-04-24 2020-12-08 Inscripta, Inc. Nucleic acid-guided editing of exogenous polynucleotides in heterologous cells
US10501738B2 (en) 2018-04-24 2019-12-10 Inscripta, Inc. Automated instrumentation for production of peptide libraries
PL3560330T3 (en) 2018-04-24 2022-09-19 KWS SAAT SE & Co. KGaA Plants with improved digestibility and marker haplotypes
US10526598B2 (en) 2018-04-24 2020-01-07 Inscripta, Inc. Methods for identifying T-cell receptor antigens
US11957695B2 (en) 2018-04-26 2024-04-16 The Broad Institute, Inc. Methods and compositions targeting glucocorticoid signaling for modulating immune responses
CN108707621B (en) 2018-04-26 2021-02-12 中国农业科学院作物科学研究所 CRISPR/Cpf1 system-mediated homologous recombination method taking RNA transcript as repair template
WO2019210268A2 (en) 2018-04-27 2019-10-31 The Broad Institute, Inc. Sequencing-based proteomics
KR20210005138A (en) 2018-04-27 2021-01-13 이오반스 바이오테라퓨틱스, 인크. Closure method for expansion and gene editing of tumor infiltrating lymphocytes and their use in immunotherapy
WO2019210153A1 (en) 2018-04-27 2019-10-31 Novartis Ag Car t cell therapies with enhanced efficacy
JP2021522385A (en) 2018-04-27 2021-08-30 ジーンエディット インコーポレイテッド Use for delivery of cationic polymers and their biomolecules
CN110184301B (en) * 2018-04-28 2023-02-24 辉大(上海)生物科技有限公司 Efficient and accurate targeted integration through Tild-CRISPR
WO2019213660A2 (en) 2018-05-04 2019-11-07 The Broad Institute, Inc. Compositions and methods for modulating cgrp signaling to regulate innate lymphoid cell inflammatory responses
WO2019216338A1 (en) 2018-05-08 2019-11-14 国立大学法人大阪大学 Method for producing homozygous cells
WO2019217837A1 (en) 2018-05-11 2019-11-14 Memorial Sloan-Kettering Cancer Center T cell receptors targeting pik3ca mutations and uses thereof
GB2589246A (en) 2018-05-16 2021-05-26 Synthego Corp Methods and systems for guide RNA design and use
US11690921B2 (en) 2018-05-18 2023-07-04 Sangamo Therapeutics, Inc. Delivery of target specific nucleases
GB201808424D0 (en) 2018-05-23 2018-07-11 Lucite Int Uk Ltd Methods for producing BMA and MMA using genetically modified microorganisms
WO2019232542A2 (en) 2018-06-01 2019-12-05 Massachusetts Institute Of Technology Methods and compositions for detecting and modulating microenvironment gene signatures from the csf of metastasis patients
US20210261901A1 (en) 2018-06-01 2021-08-26 Avectas Limited Cell engineering platform
US11866719B1 (en) 2018-06-04 2024-01-09 Inari Agriculture Technology, Inc. Heterologous integration of regulatory elements to alter gene expression in wheat cells and wheat plants
KR20210018437A (en) 2018-06-07 2021-02-17 더 브리검 앤드 우먼즈 하스피털, 인크. Method for producing hematopoietic stem cells
EP3806888B1 (en) 2018-06-12 2024-01-31 Obsidian Therapeutics, Inc. Pde5 derived regulatory constructs and methods of use in immunotherapy
CN112203725A (en) 2018-06-13 2021-01-08 诺华股份有限公司 BCMA chimeric antigen receptors and uses thereof
WO2019237386A1 (en) * 2018-06-16 2019-12-19 深圳市博奥康生物科技有限公司 Method for knocking out human ct1.1 gene
BR112020025319A2 (en) 2018-06-26 2021-03-09 The Broad Institute Inc. COMPOSITIONS, SYSTEMS AND METHODS OF AMPLIFICATION BASED ON CRISPR / CAS AND TRANSPOSASE
SG11202012786RA (en) 2018-06-26 2021-01-28 Massachusetts Inst Technology Crispr effector system based amplification methods, systems, and diagnostics
US11629179B2 (en) 2018-06-29 2023-04-18 Stichting Het Nederlands Kanker Instituut—Antoni van Leeuwenhoek Ziekenhuis TWEAK-receptor agonists for use in combination with immunotherapy of a cancer
WO2020005341A1 (en) 2018-06-29 2020-01-02 Icahn School Of Medicine At Mount Sinai Anc80 encoding sphingolipid-metabolizing proteins
EP4070802A1 (en) 2018-06-30 2022-10-12 Inscripta, Inc. Instruments, modules, and methods for improved detection of edited sequences in live cells
US20210292381A1 (en) 2018-07-04 2021-09-23 Ukko Inc. Methods of de-epitoping wheat proteins and use of same for the treatment of celiac disease
CA3105925A1 (en) * 2018-07-10 2020-01-16 Alia Therapeutics S.R.L. Vesicles for traceless delivery of guide rna molecules and/or guide rna molecule/rna-guided nuclease complex(es) and a production method thereof
EP3821012A4 (en) 2018-07-13 2022-04-20 The Regents of The University of California Retrotransposon-based delivery vehicle and methods of use thereof
WO2020018964A1 (en) 2018-07-20 2020-01-23 Fred Hutchinson Cancer Research Center Compositions and methods for controlled expression of antigen-specific receptors
KR20210053898A (en) 2018-07-31 2021-05-12 더 브로드 인스티튜트, 인코퍼레이티드 New CRISPR enzyme and system
WO2020028686A1 (en) * 2018-08-01 2020-02-06 New York University Targeting piezo1 for treatment of cancer and infectious diseases
WO2020030634A1 (en) 2018-08-06 2020-02-13 INSERM (Institut National de la Santé et de la Recherche Médicale) Methods and compositions for treating cancers
CN113286884A (en) 2018-08-07 2021-08-20 博德研究所 Novel CAS12B enzymes and systems
CA3109253A1 (en) 2018-08-10 2020-02-13 Sangamo Therapeutics France New car constructs comprising tnfr2 domains
EP3607819A1 (en) 2018-08-10 2020-02-12 Vilmorin et Cie Resistance to xanthomonas campestris pv. campestris (xcc) in cauliflower
US11142740B2 (en) 2018-08-14 2021-10-12 Inscripta, Inc. Detection of nuclease edited sequences in automated modules and instruments
US10532324B1 (en) 2018-08-14 2020-01-14 Inscripta, Inc. Instruments, modules, and methods for improved detection of edited sequences in live cells
US10752874B2 (en) 2018-08-14 2020-08-25 Inscripta, Inc. Instruments, modules, and methods for improved detection of edited sequences in live cells
CA3107002A1 (en) 2018-08-15 2020-04-30 Zymergen Inc. Applications of crispri in high throughput metabolic engineering
WO2020041387A1 (en) 2018-08-20 2020-02-27 The Brigham And Women's Hospital, Inc. Degradation domain modifications for spatio-temporal control of rna-guided nucleases
US20210317429A1 (en) 2018-08-20 2021-10-14 The Broad Institute, Inc. Methods and compositions for optochemical control of crispr-cas9
WO2020041384A1 (en) 2018-08-20 2020-02-27 The Broad Institute, Inc. 3-phenyl-2-cyano-azetidine derivatives, inhibitors of rna-guided nuclease activity
CA3109496A1 (en) 2018-08-22 2020-02-27 Fred Hutchinson Cancer Research Center Immunotherapy targeting kras or her2 antigens
AU2019326408A1 (en) 2018-08-23 2021-03-11 Sangamo Therapeutics, Inc. Engineered target specific base editors
WO2020047099A1 (en) 2018-08-28 2020-03-05 Fred Hutchinson Cancer Research Center Methods and compositions for adoptive t cell therapy incorporating induced notch signaling
BR112021003670A2 (en) 2018-08-28 2021-05-18 Vor Biopharma, Inc. genetically modified hematopoietic stem cells and their uses
US11479762B1 (en) 2018-08-31 2022-10-25 Inari Agriculture Technology, Inc. Compositions, systems, and methods for genome editing
AU2019333914A1 (en) 2018-09-04 2021-04-22 Magenta Therapeutics Inc. Aryl hydrocarbon receptor antagonists and methods of use
WO2020048942A1 (en) 2018-09-04 2020-03-12 INSERM (Institut National de la Santé et de la Recherche Médicale) Methods and pharmaceutical compositions for enhancing cytotoxic t lymphocyte-dependent immune responses
WO2020049026A1 (en) 2018-09-05 2020-03-12 INSERM (Institut National de la Santé et de la Recherche Médicale) Methods and compositions for treating asthma and allergic diseases
WO2020051283A1 (en) * 2018-09-05 2020-03-12 The Regents Of The University Of California Generation of heritably gene-edited plants without tissue culture
WO2020051507A1 (en) 2018-09-06 2020-03-12 The Broad Institute, Inc. Nucleic acid assemblies for use in targeted delivery
EP3846837A4 (en) * 2018-09-07 2022-09-14 The J. David Gladstone Institutes, A Testamentary Trust Established under The Will of J. David Gladstone Hiv or hcv detection with crispr-cas13a
US20220047567A1 (en) 2018-09-10 2022-02-17 INSERM (Institut National de la Santé et de la Recherche Médicale) Methods for the treatment of neurofibromatosis
US20220098613A1 (en) 2018-09-12 2022-03-31 Fred Hutchinson Cancer Research Center Reducing cd33 expression to selectively protect therapeutic cells
EP3852813A4 (en) 2018-09-18 2022-06-22 VNV Newco Inc. Arc-based capsids and uses thereof
EP4234570A3 (en) 2018-09-18 2023-12-13 Sangamo Therapeutics, Inc. Programmed cell death 1 (pd1) specific nucleases
WO2020061391A1 (en) * 2018-09-20 2020-03-26 The Trustees Of Columbia University In The City Of New York Methods for inhibiting tumor cells using inhibitors of foxo3a antagonists
AU2019342197A1 (en) 2018-09-21 2021-04-15 President And Fellows Of Harvard College Methods and compositions for treating diabetes, and methods for enriching mRNA coding for secreted proteins
WO2020068702A1 (en) 2018-09-24 2020-04-02 Fred Hutchinson Cancer Research Center Chimeric receptor proteins and uses thereof
WO2020064702A1 (en) 2018-09-25 2020-04-02 INSERM (Institut National de la Santé et de la Recherche Médicale) Use of antagonists of th17 cytokines for the treatment of bronchial remodeling in patients suffering from allergic asthma
GB201815672D0 (en) 2018-09-26 2018-11-07 Innes John Centre Methods for altering starch granule size profile
WO2020072248A1 (en) 2018-10-01 2020-04-09 North Carolina State University Recombinant type i crispr-cas system
WO2020070062A1 (en) 2018-10-01 2020-04-09 INSERM (Institut National de la Santé et de la Recherche Médicale) Use of tim-3 inhibitors for the treatment of exacerbations in patients suffering from severe asthma
EP3862430A4 (en) 2018-10-04 2022-06-15 Kaneka Corporation Dna construct to be used in genome editing of plant
WO2020074937A1 (en) 2018-10-09 2020-04-16 INSERM (Institut National de la Santé et de la Recherche Médicale) Use of alpha-v-integrin (cd51) inhibitors for the treatment of cardiac fibrosis
WO2020077236A1 (en) 2018-10-12 2020-04-16 The Broad Institute, Inc. Method for extracting nuclei or whole cells from formalin-fixed paraffin-embedded tissues
WO2020081730A2 (en) 2018-10-16 2020-04-23 Massachusetts Institute Of Technology Methods and compositions for modulating microenvironment
WO2020079162A1 (en) 2018-10-18 2020-04-23 INSERM (Institut National de la Santé et de la Recherche Médicale) Methods for inducing full ablation of hematopoiesis
US11214781B2 (en) 2018-10-22 2022-01-04 Inscripta, Inc. Engineered enzyme
CN113227368B (en) 2018-10-22 2023-07-07 因思科瑞普特公司 Engineered enzymes
US20210371590A1 (en) 2018-10-24 2021-12-02 GenEdit, Inc. Cationic polymer with alkyl side chains and use for biomolecule delivery
US20210386788A1 (en) 2018-10-24 2021-12-16 Obsidian Therapeutics, Inc. Er tunable protein regulation
US11407995B1 (en) 2018-10-26 2022-08-09 Inari Agriculture Technology, Inc. RNA-guided nucleases and DNA binding proteins
IL262658A (en) 2018-10-28 2020-04-30 Memorial Sloan Kettering Cancer Center Prevention of age related clonal hematopoiesis and diseases associated therewith
US11066663B2 (en) 2018-10-31 2021-07-20 Zymergen Inc. Multiplexed deterministic assembly of DNA libraries
WO2020092140A2 (en) 2018-11-02 2020-05-07 Insideoutbio, Inc. Methods and compositions to induce or suppress immune responses through the use of membrane bound complement split products
US11434477B1 (en) 2018-11-02 2022-09-06 Inari Agriculture Technology, Inc. RNA-guided nucleases and DNA binding proteins
US20200140533A1 (en) 2018-11-02 2020-05-07 Annexon, Inc. Compositions and methods for treating brain injury
EP3877512A2 (en) 2018-11-05 2021-09-15 Iovance Biotherapeutics, Inc. Selection of improved tumor reactive t-cells
CN113272421A (en) 2018-11-05 2021-08-17 艾欧凡斯生物治疗公司 Method for generating tumor infiltrating lymphocytes and use thereof in immunotherapy
MX2021004775A (en) 2018-11-05 2021-06-08 Iovance Biotherapeutics Inc Expansion of tils utilizing akt pathway inhibitors.
WO2020096989A1 (en) 2018-11-05 2020-05-14 Iovance Biotherapeutics, Inc. Treatment of nsclc patients refractory for anti-pd-1 antibody
BR112021009036A2 (en) 2018-11-08 2021-08-24 Sutro Biopharma, Inc. E coli strains showing an oxidative cytoplasm
MX2021005308A (en) 2018-11-09 2021-09-08 Fred Hutchinson Cancer Center Star T cell receptors specific for mesothelin and their use in immunotherapy.
SG11202104864QA (en) 2018-11-13 2021-06-29 Compass Therapeutics Llc Multispecific binding constructs against checkpoint molecules and uses thereof
EP3653708A1 (en) 2018-11-14 2020-05-20 Evonik Operations GmbH Isomaltulose production
US20220282275A1 (en) 2018-11-15 2022-09-08 The Broad Institute, Inc. G-to-t base editors and uses thereof
KR20210096143A (en) 2018-11-26 2021-08-04 아소시아시온 센트로 데 인베스티가시온 코오페라티바 엔 비오시엔시아스-시스 비오구네 Methods for diagnosing and/or treating acute or chronic liver, kidney or lung disease
RU2712497C1 (en) * 2018-11-26 2020-01-29 Автономная некоммерческая образовательная организация высшего образования Сколковский институт науки и технологий DNA POLYMER BASED ON Cas9 PROTEIN FROM BIOTECHNOLOGICALLY SIGNIFICANT BACTERIUM CLOSTRIDIUM CELLULOLYTICUM
RU2712492C1 (en) * 2018-11-26 2020-01-29 Автономная некоммерческая образовательная организация высшего образования Сколковский институт науки и технологий DNA PROTEASE CUTTING AGENT BASED ON Cas9 PROTEIN FROM DEFLUVIIMONAS SP.
EP3896155A4 (en) 2018-12-12 2022-08-17 Kyushu University, National University Corporation Production method for genome-edited cells
US11166996B2 (en) 2018-12-12 2021-11-09 Flagship Pioneering Innovations V, Inc. Anellovirus compositions and methods of use
EP3893898B1 (en) 2018-12-13 2024-04-03 Versiti Blood Research Institute Foundation, Inc. Method of treating autoimmune and inflammatory diseases using b cells
AU2019398351A1 (en) 2018-12-14 2021-06-03 Pioneer Hi-Bred International, Inc. Novel CRISPR-Cas systems for genome editing
WO2020131586A2 (en) 2018-12-17 2020-06-25 The Broad Institute, Inc. Methods for identifying neoantigens
US11384344B2 (en) 2018-12-17 2022-07-12 The Broad Institute, Inc. CRISPR-associated transposase systems and methods of use thereof
EP3898949A1 (en) 2018-12-19 2021-10-27 Iovance Biotherapeutics, Inc. Methods of expanding tumor infiltrating lymphocytes using engineered cytokine receptor pairs and uses thereof
CN113227375A (en) 2018-12-20 2021-08-06 原住民股份有限公司 Synthetic microRNA mimetics
JP7449291B2 (en) 2018-12-20 2024-03-13 リジェネロン・ファーマシューティカルズ・インコーポレイテッド Nuclease-mediated repeat expansion
EP3898661A1 (en) 2018-12-21 2021-10-27 Precision BioSciences, Inc. Genetic modification of the hydroxyacid oxidase 1 gene for treatment of primary hyperoxaluria
WO2020136216A1 (en) 2018-12-27 2020-07-02 INSERM (Institut National de la Santé et de la Recherche Médicale) Methods of identifying subjects having or at risk of having a coagulation related disorder
AU2020205150A1 (en) 2019-01-03 2021-07-22 Assistance Publique-Hôpitaux De Paris (Aphp) Methods and pharmaceutical compositions for enhancing CD8+ T cell-dependent immune responses in subjects suffering from cancer
US11739156B2 (en) 2019-01-06 2023-08-29 The Broad Institute, Inc. Massachusetts Institute of Technology Methods and compositions for overcoming immunosuppression
WO2020146805A1 (en) 2019-01-11 2020-07-16 Acuitas Therapeutics, Inc. Lipids for lipid nanoparticle delivery of active agents
CA3126761C (en) 2019-01-15 2023-01-10 Seminis Vegetable Seeds, Inc. Green bean plants with improved disease resistance
EP3911669A1 (en) 2019-01-16 2021-11-24 INSERM (Institut National de la Santé et de la Recherche Médicale) Variants of erythroferrone and their use
WO2020161083A1 (en) 2019-02-04 2020-08-13 INSERM (Institut National de la Santé et de la Recherche Médicale) Methods and compositions for modulating blood-brain barrier
US11946040B2 (en) 2019-02-04 2024-04-02 The General Hospital Corporation Adenine DNA base editor variants with reduced off-target RNA editing
EP3826664A4 (en) 2019-02-06 2022-10-26 Sangamo Therapeutics, Inc. Method for the treatment of mucopolysaccharidosis type i
WO2020163856A1 (en) 2019-02-10 2020-08-13 The J. David Gladstone Institutes, A Testamentary Trust Established Under The Will Of J. David Gladstone Modified mitochondrion and methods of use thereof
WO2020168315A1 (en) 2019-02-15 2020-08-20 Just-Evotec Biologics, Inc. Automated biomanufacturing systems, facilities, and processes
WO2020169472A2 (en) 2019-02-18 2020-08-27 INSERM (Institut National de la Santé et de la Recherche Médicale) Methods of inducing phenotypic changes in macrophages
GB2596461B (en) 2019-02-20 2023-09-27 Fred Hutchinson Cancer Center Binding proteins specific for RAS neoantigens and uses thereof
MX2021010288A (en) 2019-03-01 2021-09-23 Iovance Biotherapeutics Inc Expansion of tumor infiltrating lymphocytes from liquid tumors and therapeutic uses thereof.
EP3934417A1 (en) 2019-03-05 2022-01-12 The State of Israel - Ministry of Agriculture & Rural Development, Agricultural Research Organization (ARO) (Volcani Center) Genome-edited birds
KR20210149060A (en) 2019-03-07 2021-12-08 더 트러스티스 오브 컬럼비아 유니버시티 인 더 시티 오브 뉴욕 RNA-induced DNA integration using TN7-like transposons
AU2020231380A1 (en) 2019-03-07 2021-09-23 The Regents Of The University Of California CRISPR-Cas effector polypeptides and methods of use thereof
KR20210136997A (en) 2019-03-08 2021-11-17 지머젠 인코포레이티드 Iterative genome editing in microorganisms
US11053515B2 (en) 2019-03-08 2021-07-06 Zymergen Inc. Pooled genome editing in microbes
EP3935159A1 (en) 2019-03-08 2022-01-12 Obsidian Therapeutics, Inc. Human carbonic anhydrase 2 compositions and methods for tunable regulation
WO2020185867A1 (en) 2019-03-11 2020-09-17 Sorrento Therapeutics, Inc. Improved process for integration of dna constructs using rna-guided endonucleases
SG11202109745PA (en) 2019-03-11 2021-10-28 Hutchinson Fred Cancer Res High avidity wt1 t cell receptors and uses thereof
US20220177863A1 (en) 2019-03-18 2022-06-09 The Broad Institute, Inc. Type vii crispr proteins and systems
IL286359B1 (en) 2019-03-18 2024-02-01 Regeneron Pharma Crispr/cas dropout screening platform to reveal genetic vulnerabilities associated with tau aggregation
EP4317950A3 (en) 2019-03-18 2024-04-17 Regeneron Pharmaceuticals, Inc. Crispr/cas screening platform to identify genetic modifiers of tau seeding or aggregation
US11001831B2 (en) 2019-03-25 2021-05-11 Inscripta, Inc. Simultaneous multiplex genome editing in yeast
AU2020247900A1 (en) 2019-03-25 2021-11-04 Inscripta, Inc. Simultaneous multiplex genome editing in yeast
WO2020193740A1 (en) 2019-03-28 2020-10-01 INSERM (Institut National de la Santé et de la Recherche Médicale) New strategy for treating pancreatic cancer
US20220249511A1 (en) 2019-03-29 2022-08-11 INSERM (Institut National de la Santé et de la Recherche Médicale) Methods for the treatment of keloid, hypertrophic scars and/or hyperpigmentation disorders
US20220175848A1 (en) 2019-04-01 2022-06-09 The Broad Institute, Inc. Methods and compositions for cell therapy
WO2020206036A1 (en) 2019-04-01 2020-10-08 The Broad Institute, Inc. Novel nucleic acid modifier
EP3947737A2 (en) 2019-04-02 2022-02-09 INSERM (Institut National de la Santé et de la Recherche Médicale) Methods of predicting and preventing cancer in patients having premalignant lesions
EP3946384A1 (en) 2019-04-02 2022-02-09 Sangamo Therapeutics, Inc. Methods for the treatment of beta-thalassemia
EP4332115A2 (en) 2019-04-03 2024-03-06 Precision Biosciences, Inc. Genetically-modified immune cells comprising a microrna-adapted shrna (shrnamir)
BR112021019512A2 (en) 2019-04-03 2022-02-15 Regeneron Pharma Methods for inserting an antigen-binding protein coding sequence and for treating or prophylaxis of a disease in an animal, animal, cell, genome, exogenous donor nucleic acid, safe harbor gene, and nuclease agent or a or more nucleic acids
WO2020206134A1 (en) 2019-04-04 2020-10-08 Regeneron Pharmaceuticals, Inc. Methods for scarless introduction of targeted modifications into targeting vectors
US11737435B2 (en) 2019-04-04 2023-08-29 Regeneron Pharmaceuticals, Inc. Non-human animals comprising a humanized coagulation factor 12 locus
EP3947656A1 (en) 2019-04-05 2022-02-09 Danisco US Inc. Methods for polynucleotide integration into the genome of bacillus using dual circular recombinant dna constructs and compositions thereof
WO2020206202A1 (en) 2019-04-05 2020-10-08 Danisco Us Inc Methods for integrating a donor dna sequence into the genome of bacillus using linear recombinant dna constructs and compositions thereof
EP3947646A1 (en) 2019-04-05 2022-02-09 Precision BioSciences, Inc. Methods of preparing populations of genetically-modified immune cells
WO2020208082A1 (en) 2019-04-09 2020-10-15 INSERM (Institut National de la Santé et de la Recherche Médicale) Method for treating cmv related diseases
BR112021021095A2 (en) 2019-04-23 2022-02-08 Genedit Inc Cationic polymer with alkyl side chains
EP3959320A1 (en) 2019-04-24 2022-03-02 Novartis AG Compositions and methods for selective protein degradation
US20220220565A1 (en) 2019-04-30 2022-07-14 INSERM (Institut National de la Santé et de la Recherche Médicale) Methods and compositions for treating melanoma
EP3964579A4 (en) 2019-04-30 2023-07-26 EdiGene (GuangZhou) Inc. Method for predicting effectiveness of treatment of hemoglobinopathy
UY38693A (en) 2019-05-13 2020-12-31 Kws Saat Se & Co Kgaa DROUGHT TOLERANCE IN CORN
US20220249559A1 (en) 2019-05-13 2022-08-11 Iovance Biotherapeutics, Inc. Methods and compositions for selecting tumor infiltrating lymphocytes and uses of the same in immunotherapy
US20220220169A1 (en) 2019-05-15 2022-07-14 Insideoutbio, Inc. Modular Therapeutics for the Treatment of Inflammatory Diseases and Cancer
WO2020236645A1 (en) * 2019-05-17 2020-11-26 Beth Israel Deaconess Medical Center, Inc. Compositions and methods for homology directed repair
US20220235340A1 (en) 2019-05-20 2022-07-28 The Broad Institute, Inc. Novel crispr-cas systems and uses thereof
WO2020236972A2 (en) 2019-05-20 2020-11-26 The Broad Institute, Inc. Non-class i multi-component nucleic acid targeting systems
CN113924367A (en) 2019-05-23 2022-01-11 南京农业大学 Method for improving rice grain yield
WO2020239623A1 (en) 2019-05-24 2020-12-03 INSERM (Institut National de la Santé et de la Recherche Médicale) Use of ngal inhibitors for the treating chronic wound
AR118995A1 (en) 2019-05-25 2021-11-17 Kws Saat Se & Co Kgaa HAPLOID INDUCTION ENHANCER
EP3976015A1 (en) 2019-05-28 2022-04-06 Genedit Inc. Polymer comprising multiple functionalized sidechains for biomolecule delivery
US20220243178A1 (en) 2019-05-31 2022-08-04 The Broad Institute, Inc. Methods for treating metabolic disorders by targeting adcy5
EP3980012A1 (en) 2019-06-04 2022-04-13 Institut National de la Santé et de la Recherche Médicale (INSERM) A neuropilin antagonist in combination with a p38alpha-kinase inhibitor for the treatment of cancer
EP3801011A1 (en) 2019-06-04 2021-04-14 Regeneron Pharmaceuticals, Inc. Non-human animals comprising a humanized ttr locus with a beta-slip mutation and methods of use
WO2020245208A1 (en) 2019-06-04 2020-12-10 INSERM (Institut National de la Santé et de la Recherche Médicale) Use of cd9 as a biomarker and as a biotarget in glomerulonephritis or glomerulosclerosis
WO2020244759A1 (en) 2019-06-05 2020-12-10 Klemm & Sohn Gmbh & Co. Kg New plants having a white foliage phenotype
WO2020247587A1 (en) 2019-06-06 2020-12-10 Inscripta, Inc. Curing for recursive nucleic acid-guided cell editing
MX2021015122A (en) 2019-06-07 2022-04-06 Regeneron Pharma Non-human animals comprising a humanized albumin locus.
RU2722933C1 (en) * 2019-06-11 2020-06-05 Автономная некоммерческая образовательная организация высшего образования Сколковский институт науки и технологий Dna protease cutting agent based on cas9 protein from demequina sediminicola bacteria
WO2020249769A1 (en) 2019-06-14 2020-12-17 INSERM (Institut National de la Santé et de la Recherche Médicale) Methods and compositions for treating ocular diseases related to mitochondrial dna maintenance
CA3137765A1 (en) 2019-06-14 2020-12-17 Regeneron Pharmaceuticals, Inc. Models of tauopathy
US10907125B2 (en) 2019-06-20 2021-02-02 Inscripta, Inc. Flow through electroporation modules and instrumentation
WO2020254850A1 (en) 2019-06-21 2020-12-24 Vilmorin & Cie Improvement of quality and permanence of green color of peppers at maturity and over-maturity
CN114008070A (en) 2019-06-21 2022-02-01 因思科瑞普特公司 Whole genome rationally designed mutations leading to increased lysine production in E.coli
CN114450326A (en) 2019-06-24 2022-05-06 普罗美加公司 Modified polyamine polymers for delivery of biomolecules into cells
US10927385B2 (en) 2019-06-25 2021-02-23 Inscripta, Inc. Increased nucleic-acid guided cell editing in yeast
EP3990633A1 (en) 2019-06-25 2022-05-04 Inari Agriculture Technology, Inc. Improved homology dependent repair genome editing
MX2021015433A (en) 2019-07-02 2022-06-08 Hutchinson Fred Cancer Res Recombinant ad35 vectors and related gene therapy improvements.
EP3993786A1 (en) 2019-07-02 2022-05-11 INSERM (Institut National de la Santé et de la Recherche Médicale) Methods for the prophylactic treatment of cancer in patients suffering from pancreatitis
WO2021001431A1 (en) 2019-07-02 2021-01-07 INSERM (Institut National de la Santé et de la Recherche Médicale) Use of pi3ka-selective inhibitors for treating metastatic disease in patients suffering from pancreatic cancer
EP3994268A1 (en) 2019-07-04 2022-05-11 Ukko Inc. De-epitoped alpha gliadin and use of same for the management of celiac disease and gluten sensitivity
US10653731B1 (en) 2019-07-15 2020-05-19 Vigene Biosciences Inc. Recombinantly-modified adeno-associated virus (rAAV) having improved packaging efficiency
US10801042B1 (en) 2019-07-15 2020-10-13 Vigene Biosciences, Inc. Use of ion concentrations to increase the packaging efficiency of recombinant adeno-associated virus
US10557149B1 (en) 2019-07-15 2020-02-11 Vigene Biosciences, Inc. Recombinantly-modified adeno-associated virus helper vectors and their use to improve the packaging efficiency of recombinantly-modified adeno-associated virus
IL268111A (en) 2019-07-16 2021-01-31 Fainzilber Michael Methods of treating pain
WO2021009299A1 (en) 2019-07-17 2021-01-21 INSERM (Institut National de la Santé et de la Recherche Médicale) Bcl-xl:fkbp12 fusion proteins suitable for screening agents capable of slowing down the aging process
US20220251572A1 (en) 2019-07-23 2022-08-11 Mnemo Therapeutics Immune cells defective for suv39h1
EP4003325A1 (en) 2019-07-24 2022-06-01 INSERM (Institut National de la Santé et de la Recherche Médicale) Inhibitors of the sting pathway for the treatment of hidradenitis suppurativa
WO2021016608A1 (en) 2019-07-25 2021-01-28 Precision Biosciences, Inc. Compositions and methods for sequential stacking of nucleic acid sequences into a genomic locus
WO2021019272A1 (en) 2019-07-31 2021-02-04 Vilmorin & Cie Tolerance to tolcndv in cucumber
CN114401743A (en) 2019-08-02 2022-04-26 法国国家健康和医学研究院 Use of neutralizing granzyme B for providing cardioprotection in a subject who has experienced a myocardial infarction
EP3772542A1 (en) 2019-08-07 2021-02-10 KWS SAAT SE & Co. KGaA Modifying genetic variation in crops by modulating the pachytene checkpoint protein 2
WO2021028359A1 (en) 2019-08-09 2021-02-18 Sangamo Therapeutics France Controlled expression of chimeric antigen receptors in t cells
US20220409661A1 (en) 2019-08-20 2022-12-29 Fred Hutchinson Cancer Research Center T-cell immunotherapy specific for wt-1
EP4017526A1 (en) 2019-08-20 2022-06-29 Precision BioSciences, Inc. Lymphodepletion dosing regimens for cellular immunotherapies
WO2021035170A1 (en) 2019-08-21 2021-02-25 Precision Biosciences, Inc. Compositions and methods for tcr reprogramming using fusion proteins
US20220298501A1 (en) 2019-08-30 2022-09-22 The Broad Institute, Inc. Crispr-associated mu transposase systems
WO2021043278A1 (en) 2019-09-04 2021-03-11 博雅辑因(北京)生物科技有限公司 Method for evaluating gene editing therapy based on off-target assessment
WO2021044012A1 (en) 2019-09-05 2021-03-11 INSERM (Institut National de la Santé et de la Recherche Médicale) Method of treatment and pronostic of acute myeloid leukemia
MX2022002722A (en) 2019-09-05 2022-06-09 Inst Genetics & Developmental Biology Cas Methods of improving seed size and quality.
US20220348937A1 (en) 2019-09-06 2022-11-03 Obsidian Therapeutics, Inc. Compositions and methods for dhfr tunable protein regulation
GB201913060D0 (en) 2019-09-10 2019-10-23 Innes John Centre Methods of increasing biotic stress resistance in plants
WO2021047775A1 (en) 2019-09-12 2021-03-18 INSERM (Institut National de la Santé et de la Recherche Médicale) Use of inhibitors of tgfb/activinb signaling pathway for the treatment of patients suffering from medulloblastoma group 3
US20210079394A1 (en) 2019-09-13 2021-03-18 Regeneron Pharmaceuticals, Inc. Transcription modulation in animals using crispr/cas systems delivered by lipid nanoparticles
CN115175996A (en) 2019-09-20 2022-10-11 博德研究所 Novel type VI CRISPR enzymes and systems
CN114391040A (en) 2019-09-23 2022-04-22 欧米茄治疗公司 Compositions and methods for modulating apolipoprotein B (APOB) gene expression
EP4041894A1 (en) 2019-09-23 2022-08-17 Omega Therapeutics, Inc. COMPOSITIONS AND METHODS FOR MODULATING HEPATOCYTE NUCLEAR FACTOR 4-ALPHA (HNF4a) GENE EXPRESSION
US11542513B2 (en) 2019-09-26 2023-01-03 Seminis Vegetable Seeds, Inc. Lettuce plants having resistance to Nasonovia ribisnigri biotype Nr:1
WO2021063968A1 (en) 2019-09-30 2021-04-08 INSERM (Institut National de la Santé et de la Recherche Médicale) Method and composition for diagnosing chronic obstructive pulmonary disease
GB201914137D0 (en) 2019-10-01 2019-11-13 Univ Leeds Innovations Ltd Modified Plants
EP4037714A1 (en) 2019-10-03 2022-08-10 INSERM (Institut National de la Santé et de la Recherche Médicale) Methods and compositions for modulating macrophages polarization
CA3153197A1 (en) 2019-10-03 2021-04-08 Ryan T. Gill Crispr systems with engineered dual guide nucleic acids
WO2021072244A1 (en) 2019-10-11 2021-04-15 Beth Israel Deaconess Medical Center, Inc. Anti-tn antibodies and uses thereof
WO2021072031A1 (en) 2019-10-11 2021-04-15 Insideoutbio, Inc. Methods and compositions for the manufacture and use of circular dna encoded therapeutics for genetic disorders and other diseases
EP3808766A1 (en) 2019-10-15 2021-04-21 Sangamo Therapeutics France Chimeric antigen receptor specific for interleukin-23 receptor
EP4045522A1 (en) 2019-10-17 2022-08-24 KWS SAAT SE & Co. KGaA Enhanced disease resistance of crops by downregulation of repressor genes
WO2021078359A1 (en) 2019-10-21 2021-04-29 INSERM (Institut National de la Santé et de la Recherche Médicale) Use of inhibitors of cubilin for the treatment of chronic kidney diseases
EP4048295A1 (en) 2019-10-25 2022-08-31 Iovance Biotherapeutics, Inc. Gene editing of tumor infiltrating lymphocytes and uses of same in immunotherapy
WO2021081468A1 (en) * 2019-10-25 2021-04-29 The Johns Hokins University A crispr-cas9 platform with an intrinsic off-switch and enhanced specificity
WO2021083959A1 (en) 2019-10-29 2021-05-06 INSERM (Institut National de la Santé et de la Recherche Médicale) Methods and compositions for treating uveal melanoma
IL270306A (en) 2019-10-30 2021-05-31 Yeda Res & Dev Prevention and treatment of pre-myeloid and myeloid malignancies
US20220411479A1 (en) 2019-10-30 2022-12-29 Precision Biosciences, Inc. Cd20 chimeric antigen receptors and methods of use for immunotherapy
WO2021087406A1 (en) 2019-11-01 2021-05-06 Magenta Therapeutics, Inc. Dosing regimens for the mobilization of hematopoietic stem and progentor cells
GB201916020D0 (en) 2019-11-04 2019-12-18 Univ Of Essex Enterprise Limited Crispr-mediated identification of biotinylated proteins and chromatin regions
EP4054651A1 (en) 2019-11-08 2022-09-14 Regeneron Pharmaceuticals, Inc. Crispr and aav strategies for x-linked juvenile retinoschisis therapy
AU2020382017A1 (en) * 2019-11-13 2022-05-12 Crispr Therapeutics Ag Methods of manufacturing CAR-T cells
CA3158122A1 (en) * 2019-11-13 2021-05-20 Hui Yu Manufacturing process for making t cells expressing chimeric antigen receptors
EP4057802A1 (en) 2019-11-14 2022-09-21 Vilmorin & Cie Resistance to acidovorax valerianellae in corn salad
WO2021102059A1 (en) 2019-11-19 2021-05-27 Inscripta, Inc. Methods for increasing observed editing in bacteria
KR20220104766A (en) 2019-11-22 2022-07-26 프레지던트 앤드 펠로우즈 오브 하바드 칼리지 Ionic liquids for drug delivery
JP2023503429A (en) 2019-11-22 2023-01-30 アンスティチュ ナショナル ドゥ ラ サンテ エ ドゥ ラ ルシェルシュ メディカル Adrenomedullin inhibitors for the treatment of acute myeloid leukemia by eradicating leukemic stem cells
WO2021108363A1 (en) 2019-11-25 2021-06-03 Regeneron Pharmaceuticals, Inc. Crispr/cas-mediated upregulation of humanized ttr allele
AU2020391215A1 (en) 2019-11-27 2022-06-02 Bayer Healthcare Llc Methods of synthesizing RNA molecules
BR112022010153A2 (en) 2019-11-27 2022-08-09 Promega Corp PEPTIDES, NUCLEIC ACID, POLYPEPTIDE, COMPOSITION, BIOLUMINESCENT COMPLEX, METHODS, DIPEPTIDE, SYSTEM AND KIT
JP2023503979A (en) 2019-11-27 2023-02-01 アンスティチュ ナショナル ドゥ ラ サンテ エ ドゥ ラ ルシェルシュ メディカル Use of neuropilin antagonists in the treatment of endometriosis.
EP4069285A1 (en) 2019-12-06 2022-10-12 Precision BioSciences, Inc. Methods for cancer immunotherapy, using lymphodepletion regimens and cd19, cd20 or bcma allogeneic car t cells
US10883095B1 (en) 2019-12-10 2021-01-05 Inscripta, Inc. Mad nucleases
CA3161104A1 (en) 2019-12-11 2021-06-17 Cecile Chartier-Courtaud Processes for the production of tumor infiltrating lymphocytes (tils) and methods of using the same
US20230000063A1 (en) 2019-12-13 2023-01-05 Chugai Seiyaku Kabushiki Kaisha System for detecting extracellular purinergic receptor ligand, and non-human animal having the system introduced thereinto
WO2021118927A1 (en) 2019-12-13 2021-06-17 Insideoutbio, Inc. Methods and compositions for targeted delivery of nucleic acid therapeutics
US10704033B1 (en) 2019-12-13 2020-07-07 Inscripta, Inc. Nucleic acid-guided nucleases
IL292895A (en) 2019-12-18 2022-07-01 Inscripta Inc Cascade/dcas3 complementation assays for in vivo detection of nucleic acid-guided nuclease edited cells
GB201918902D0 (en) 2019-12-19 2020-02-05 Genome Res Ltd Cell differentiation
IL271656A (en) 2019-12-22 2021-06-30 Yeda Res & Dev Systems and methods for identifying cells that have undergone genome editing
US11060141B1 (en) 2019-12-23 2021-07-13 Stilla Technologies Multiplex drop-off digital polymerase chain reaction methods
EP4086340A1 (en) 2019-12-30 2022-11-09 Edigene Biotechnology Inc. Universal car-t targeting t-cell lymphoma cell and preparation method therefor and use thereof
US20230054266A1 (en) 2019-12-30 2023-02-23 Edigene Biotechnology Inc. Method for purifying ucart cell and use thereof
WO2021138560A2 (en) 2020-01-02 2021-07-08 The Trustees Of Columbia University In The City Of New York Programmable and portable crispr-cas transcriptional activation in bacteria
US10689669B1 (en) 2020-01-11 2020-06-23 Inscripta, Inc. Automated multi-module cell processing methods, instruments, and systems
CN116234906A (en) 2020-01-13 2023-06-06 萨那生物技术股份有限公司 Modification of blood group antigens
WO2021144426A1 (en) 2020-01-17 2021-07-22 INSERM (Institut National de la Santé et de la Recherche Médicale) Methods and compositions for treating melanoma
US20230073514A1 (en) 2020-01-21 2023-03-09 Limagrain Europe Wheat haploid inducer plant and uses
AU2021211713A1 (en) 2020-01-23 2022-08-25 The Children's Medical Center Corporation Stroma-free T cell differentiation from human pluripotent stem cells
US11225674B2 (en) 2020-01-27 2022-01-18 Inscripta, Inc. Electroporation modules and instrumentation
EP4096647A1 (en) 2020-01-30 2022-12-07 Yeda Research and Development Co. Ltd Treating acute liver disease with tlr-mik inhibitors
EP4099818A1 (en) 2020-02-07 2022-12-14 Institute Of Genetics And Developmental Biology, Chinese Academy Of Sciences Methods of controlling grain size and weight
WO2021165508A1 (en) 2020-02-21 2021-08-26 Biogemma Prime editing technology for plant genome engineering
EP3872190A1 (en) 2020-02-26 2021-09-01 Antibodies-Online GmbH A method of using cut&run or cut&tag to validate crispr-cas targeting
US20230183377A1 (en) 2020-02-26 2023-06-15 Sorrento Therapeutics, Inc. Activatable antigen binding proteins with universal masking moieties
CN115485385A (en) 2020-03-04 2022-12-16 瑞泽恩制药公司 Methods and compositions for sensitizing tumor cells to immunotherapy
JP2023517326A (en) 2020-03-11 2023-04-25 オメガ セラピューティクス, インコーポレイテッド Compositions and methods for modulating forkhead box P3 (FOXP3) gene expression
CN115916823A (en) 2020-03-20 2023-04-04 法国国家健康和医学研究院 Chimeric antigen receptor specific to human CD45RC and uses thereof
WO2021191678A1 (en) 2020-03-23 2021-09-30 Avectas Limited Engineering of dendritic cells for generation of vaccines against sars-cov-2
WO2021195079A1 (en) 2020-03-23 2021-09-30 Regeneron Pharmaceuticals, Inc. Non-human animals comprising a humanized ttr locus comprising a v30m mutation and methods of use
WO2021193865A1 (en) 2020-03-26 2021-09-30 国立研究開発法人農業・食品産業技術総合研究機構 Method for producing temperature-sensitive male sterile plant
US20230263121A1 (en) 2020-03-31 2023-08-24 Elo Life Systems Modulation of endogenous mogroside pathway genes in watermelon and other cucurbits
WO2021202938A1 (en) 2020-04-03 2021-10-07 Creyon Bio, Inc. Oligonucleotide-based machine learning
US20230147287A1 (en) 2020-04-06 2023-05-11 LogoMix, Inc. Genome engineering method and genome engineering kit
US20230132275A1 (en) 2020-04-08 2023-04-27 INSERM (Institut National de la Santé et de la Recherche Médicale) Use of cdon inhibitors for the treatment of endothelial dysfunction
JP2023522848A (en) 2020-04-08 2023-06-01 アストラゼネカ・アクチエボラーグ Compositions and methods for improved site-specific modification
MX2022012778A (en) 2020-04-14 2023-01-16 Academisch Ziekenhuis Leiden Methods for induction of endogenous tandem duplication events.
NL2025344B1 (en) 2020-04-14 2021-10-26 Academisch Ziekenhuis Leiden Methods for induction of endogenous tandem duplication events
WO2021216622A1 (en) 2020-04-21 2021-10-28 Aspen Neuroscience, Inc. Gene editing of gba1 in stem cells and method of use of cells differentiated therefrom
WO2021216623A1 (en) 2020-04-21 2021-10-28 Aspen Neuroscience, Inc. Gene editing of lrrk2 in stem cells and method of use of cells differentiated therefrom
WO2021217082A1 (en) 2020-04-23 2021-10-28 Genedit Inc. Polymer with cationic and hydrophobic side chains
EP4139345A1 (en) 2020-04-24 2023-03-01 Sorrento Therapeutics, Inc. Memory dimeric antigen receptors
US20210332388A1 (en) 2020-04-24 2021-10-28 Inscripta, Inc. Compositions, methods, modules and instruments for automated nucleic acid-guided nuclease editing in mammalian cells
AU2021263754A1 (en) 2020-04-27 2022-12-01 Ensoma, Inc. Methods and compositions for transducing hematopoietic stem and progenitor cells in vivo
US20210340586A1 (en) 2020-04-30 2021-11-04 Sutro Biopharma, Inc. Methods of Producing Full-Length Antibodies Using E. coli
GB202006463D0 (en) 2020-05-01 2020-06-17 Innes John Centre Metabolic engineering of plants enriched in L-DOPA
TW202208617A (en) 2020-05-04 2022-03-01 美商艾歐凡斯生物治療公司 Processes for production of tumor infiltrating lymphocytes and uses of the same in immunotherapy
EP4146797A1 (en) 2020-05-06 2023-03-15 Orchard Therapeutics (Europe) Limited Treatment for neurodegenerative diseases
WO2021224401A1 (en) 2020-05-07 2021-11-11 INSERM (Institut National de la Santé et de la Recherche Médicale) Methods and compositions for determining a reference range of β-galactose exposure platelet
US20230183664A1 (en) 2020-05-11 2023-06-15 Precision Biosciences, Inc. Self-limiting viral vectors encoding nucleases
US11787841B2 (en) 2020-05-19 2023-10-17 Inscripta, Inc. Rationally-designed mutations to the thrA gene for enhanced lysine production in E. coli
AR122206A1 (en) 2020-05-29 2022-08-24 Kws Saat Se & Co Kgaa INDUCTION OF HAPLOIDS IN PLANTS
WO2021245435A1 (en) 2020-06-03 2021-12-09 Vilmorin & Cie Melon plants resistant to scab disease, aphids and powdery mildew
US11946077B2 (en) * 2020-06-04 2024-04-02 Emendobio Inc. OMNI-59, 61, 67, 76, 79, 80, 81, and 82 CRISPR nucleases
JP2023527925A (en) 2020-06-05 2023-06-30 ビルモラン エ コンパニー Resistance to ToBRFV in tomato plants
JP2023530234A (en) 2020-06-05 2023-07-14 ザ・ブロード・インスティテュート・インコーポレイテッド Compositions and methods for treating neoplasms
JP2023527578A (en) 2020-06-05 2023-06-29 アンスティチュ ナショナル ドゥ ラ サンテ エ ドゥ ラ ルシェルシュ メディカル Methods and pharmaceutical compositions for treating eye diseases
WO2021252920A1 (en) 2020-06-11 2021-12-16 Novartis Ag Zbtb32 inhibitors and uses thereof
WO2021255204A1 (en) 2020-06-18 2021-12-23 INSERM (Institut National de la Santé et de la Recherche Médicale) New strategy for treating pancreatic cancer
WO2022008597A1 (en) 2020-07-08 2022-01-13 INSERM (Institut National de la Santé et de la Recherche Médicale) Methods and pharmaceutical composition for the treatment of infectious diseases
AU2021204717A1 (en) 2020-07-15 2022-02-03 Seminis Vegetable Seeds, Inc. Green Bean Plants with Improved Disease Resistance
KR20230074713A (en) 2020-07-30 2023-05-31 엥스띠뛰 퀴리 Immune cells defective in SOCS1
US20230323299A1 (en) 2020-08-03 2023-10-12 Inserm (Institut National De La Santé Et De La Recherch Médicale) Population of treg cells functionally committed to exert a regulatory activity and their use for adoptive therapy
WO2022035793A1 (en) 2020-08-10 2022-02-17 Precision Biosciences, Inc. Antibodies and fragments specific for b-cell maturation antigen and uses thereof
WO2022034474A1 (en) 2020-08-10 2022-02-17 Novartis Ag Treatments for retinal degenerative diseases
US20230304047A1 (en) 2020-08-11 2023-09-28 University Of Oslo Improved gene editing
AU2021328478A1 (en) 2020-08-20 2023-04-20 A2 Biotherapeutics, Inc. Compositions and methods for treating egfr positive cancers
CA3188862A1 (en) 2020-08-20 2022-02-24 Carl Alexander Kamb Compositions and methods for treating mesothelin positive cancers
CN116724052A (en) 2020-08-20 2023-09-08 A2生物治疗股份有限公司 Compositions and methods for treating CEACAM positive cancers
WO2022046760A2 (en) 2020-08-25 2022-03-03 Kite Pharma, Inc. T cells with improved functionality
WO2022056254A2 (en) 2020-09-11 2022-03-17 LifeEDIT Therapeutics, Inc. Dna modifying enzymes and active fragments and variants thereof and methods of use
US11299731B1 (en) 2020-09-15 2022-04-12 Inscripta, Inc. CRISPR editing to embed nucleic acid landing pads into genomes of live cells
EP4214311A2 (en) 2020-09-18 2023-07-26 Artisan Development Labs, Inc. Constructs and uses thereof for efficient and specific genome editing
WO2022066973A1 (en) 2020-09-24 2022-03-31 Fred Hutchinson Cancer Research Center Immunotherapy targeting pbk or oip5 antigens
JP2023542528A (en) 2020-09-24 2023-10-10 フレッド ハッチンソン キャンサー センター Immunotherapy targeting SOX2 antigen
US20230348874A1 (en) 2020-10-02 2023-11-02 Limagrain Europe Crispr-mediated directed codon re-write
MA60153A1 (en) 2020-10-02 2023-08-31 Vilmorin & Cie MELON WITH EXTENDED SHELF LIFE
KR20230113283A (en) 2020-10-05 2023-07-28 프로탈릭스 리미티드 Dicer-Like Knockout Plant Cells
JP2023544387A (en) 2020-10-05 2023-10-23 アンスティチュ ナショナル ドゥ ラ サンテ エ ドゥ ラ ルシェルシュ メディカル GDF3 as a biomarker and biotarget in postischemic cardiac remodeling
WO2022076606A1 (en) 2020-10-06 2022-04-14 Iovance Biotherapeutics, Inc. Treatment of nsclc patients with tumor infiltrating lymphocyte therapies
WO2022076353A1 (en) 2020-10-06 2022-04-14 Fred Hutchinson Cancer Research Center Compositions and methods for treating mage-a1-expressing disease
JP2023546359A (en) 2020-10-06 2023-11-02 アイオバンス バイオセラピューティクス,インコーポレイテッド Treatment of NSCLC patients with tumor-infiltrating lymphocyte therapy
WO2022076547A1 (en) 2020-10-07 2022-04-14 Precision Biosciences, Inc. Lipid nanoparticle compositions
WO2022079719A1 (en) 2020-10-15 2022-04-21 Yeda Research And Development Co. Ltd. Method of treating myeloid malignancies
WO2022084531A1 (en) 2020-10-23 2022-04-28 INSERM (Institut National de la Santé et de la Recherche Médicale) Methods and compositions for treating glioma
CR20230175A (en) 2020-10-23 2023-07-26 Elo Life Systems Inc Methods for producing vanilla plants with improved flavor and agronomic production
CA3194664A1 (en) 2020-10-23 2022-04-28 Xi Chen Compositions and methods for t-cell receptor identification
US11332744B1 (en) 2020-10-26 2022-05-17 Arsenal Biosciences, Inc. Safe harbor loci
RU2762831C1 (en) * 2020-10-26 2021-12-23 Федеральное государственное бюджетное научное учреждение "Всероссийский научно-исследовательский институт сельскохозяйственной биотехнологии" (ФГБНУ ВНИИСБ) Rna-conductor molecule for genomic editing of promoter region of vrn-a1 gene of monocotyledonous cereals using crispr/cas9 system
RU2749307C1 (en) * 2020-10-30 2021-06-08 Федеральное государственное бюджетное научное учреждение "Всероссийский научно-исследовательский институт сельскохозяйственной биотехнологии" (ФГБНУ ВНИИСБ) New compact type ii cas9 nuclease from anoxybacillus flavithermus
US11512297B2 (en) 2020-11-09 2022-11-29 Inscripta, Inc. Affinity tag for recombination protein recruitment
US20240033358A1 (en) 2020-11-13 2024-02-01 Novartis Ag Combination therapies with chimeric antigen receptor (car)-expressing cells
EP4244391A1 (en) 2020-11-16 2023-09-20 INSERM (Institut National de la Santé et de la Recherche Médicale) Methods and compositions for predicting and treating uveal melanoma
EP4001429A1 (en) 2020-11-16 2022-05-25 Antibodies-Online GmbH Analysis of crispr-cas binding and cleavage sites followed by high-throughput sequencing (abc-seq)
CA3200350A1 (en) 2020-11-26 2022-06-02 Yanay OFRAN Modified high molecular weight glutenin subunit and uses thereof
EP4256052A1 (en) 2020-12-02 2023-10-11 Decibel Therapeutics, Inc. Crispr sam biosensor cell lines and methods of use thereof
JP2023551722A (en) 2020-12-03 2023-12-12 ビルモラン エ コンパニー Tomato plants and corresponding resistance genes with resistance to ToBRFV, TMV, ToMV, and ToMMV
CA3201767A1 (en) 2020-12-14 2022-06-23 Thomas M. Schmitt Compositions and methods for cellular immunotherapy
JP2024500403A (en) 2020-12-17 2024-01-09 アイオバンス バイオセラピューティクス,インコーポレイテッド Treatment of cancer with tumor-infiltrating lymphocytes
IL279559A (en) 2020-12-17 2022-07-01 Yeda Res & Dev Controlling ubiquitination of mlkl for treatment of disease
WO2022133140A1 (en) 2020-12-17 2022-06-23 Iovance Biotherapeutics, Inc. Treatment with tumor infiltrating lymphocyte therapies in combination with ctla-4 and pd-1 inhibitors
WO2022130388A2 (en) 2020-12-18 2022-06-23 Yeda Research And Development Co. Ltd. Compositions for use in the treatment of chd2 haploinsufficiency and methods of identifying same
CA3202599A1 (en) 2020-12-18 2022-06-23 Johnathan Andrew Napier Increasing the accumulation of epa and dha in recombinant camelina
IL303892A (en) 2020-12-23 2023-08-01 Flagship Pioneering Innovations V Inc In vitro assembly of anellovirus capsids enclosing rna
CN116709908A (en) 2020-12-23 2023-09-05 中国科学院遗传与发育生物学研究所 Method for controlling grain size
EP4269580A1 (en) 2020-12-25 2023-11-01 Logomix, Inc. Method for causing large-scale deletions in genomic dna and method for analyzing genomic dna
AU2021415461A1 (en) 2021-01-04 2023-08-17 Inscripta, Inc. Mad nucleases
US11332742B1 (en) 2021-01-07 2022-05-17 Inscripta, Inc. Mad nucleases
EP4284823A1 (en) 2021-01-28 2023-12-06 Precision BioSciences, Inc. Modulation of tgf beta signaling in genetically-modified eukaryotic cells
AR124712A1 (en) 2021-01-29 2023-04-26 Merck Sharp & Dohme COMPOSITIONS OF PROGRAMMED DEATH RECEPTOR 1 (PD-1) ANTIBODIES AND METHODS FOR OBTAINING THE COMPOSITIONS THEREOF
TW202241508A (en) 2021-01-29 2022-11-01 美商艾歐凡斯生物治療公司 Cytokine associated tumor infiltrating lymphocytes compositions and methods
WO2022162646A1 (en) 2021-02-01 2022-08-04 Avectas Limited Delivery platform
KR20230147109A (en) 2021-02-16 2023-10-20 에이투 바이오쎄라퓨틱스, 인크. Compositions and methods for treating HER2 positive cancer
US11884924B2 (en) 2021-02-16 2024-01-30 Inscripta, Inc. Dual strand nucleic acid-guided nickase editing
WO2022187278A1 (en) * 2021-03-01 2022-09-09 The Johns Hopkins University Nucleic acid detection and analysis systems
JP6944226B1 (en) 2021-03-03 2021-10-06 株式会社Logomix How to modify and detect genomic DNA
JP2024509194A (en) 2021-03-05 2024-02-29 ザ ボード オブ トラスティーズ オブ ザ レランド スタンフォード ジュニア ユニバーシティー In vivo DNA assembly and analysis
WO2022197776A1 (en) 2021-03-16 2022-09-22 Magenta Therapeutics, Inc. Dosing regimens for hematopoietic stem cell mobilization for stem cell transplants in multiple myeloma patients
EP4308118A1 (en) 2021-03-17 2024-01-24 Institut National de la Santé et de la Recherche Médicale (INSERM) Methods and compositions for treating melanoma
EP4308691A1 (en) 2021-03-19 2024-01-24 Iovance Biotherapeutics, Inc. Methods for tumor infiltrating lymphocyte (til) expansion related to cd39/cd69 selection and gene knockout in tils
CN117295817A (en) 2021-03-22 2023-12-26 生命编辑制药股份有限公司 DNA modifying enzymes and active fragments and variants thereof and methods of use
AU2022249318A1 (en) 2021-03-31 2023-10-12 Entrada Therapeutics, Inc. Cyclic cell penetrating peptides
WO2022208489A1 (en) 2021-04-02 2022-10-06 Vilmorin & Cie Semi-determinate or determinate growth habit trait in cucurbita
EP4320234A2 (en) 2021-04-07 2024-02-14 Astrazeneca AB Compositions and methods for site-specific modification
EP4320153A1 (en) 2021-04-09 2024-02-14 INSERM (Institut National de la Santé et de la Recherche Médicale) Methods for the treatment of anaplastic large cell lymphoma
JP2024514649A (en) 2021-04-16 2024-04-02 ビーム セラピューティクス インク. Genetic modification of hepatocytes
JP2024515189A (en) 2021-04-19 2024-04-05 アイオバンス バイオセラピューティクス,インコーポレイテッド Chimeric costimulatory receptors, chemokine receptors, and their uses in cellular immunotherapy - Patents.com
WO2022225978A1 (en) 2021-04-21 2022-10-27 The Regents Of The University Of California Use of a split dcas fusion protein system for epigenetic editing
WO2022226316A1 (en) 2021-04-22 2022-10-27 Precision Biosciences, Inc. Compositions and methods for generating male sterile plants
WO2022223791A1 (en) 2021-04-23 2022-10-27 INSERM (Institut National de la Santé et de la Recherche Médicale) Methods and compositions for treating cell senescence accumulation related disease
WO2022235929A1 (en) 2021-05-05 2022-11-10 Radius Pharmaceuticals, Inc. Animal model having homologous recombination of mouse pth1 receptor
US20220356264A1 (en) * 2021-05-06 2022-11-10 New York University Inhibition of atf7ip and setdb1 for cancer treatment
EP4337263A1 (en) 2021-05-10 2024-03-20 Entrada Therapeutics, Inc. Compositions and methods for modulating interferon regulatory factor-5 (irf-5) activity
KR20240017813A (en) 2021-05-10 2024-02-08 이슘 리서치 디벨롭먼트 컴퍼니 오브 더 히브루 유니버시티 오브 예루살렘 엘티디. Pharmaceutical composition for treating neurological diseases
AU2022271873A1 (en) 2021-05-10 2024-01-04 Entrada Therapeutics, Inc. Compositions and methods for intracellular therapeutics
EP4337261A2 (en) 2021-05-10 2024-03-20 Entrada Therapeutics, Inc. Compositions and methods for modulating mrna splicing
WO2022240824A1 (en) 2021-05-13 2022-11-17 The United States Of America, As Represented By The Secretary, Department Of Health And Human Services Compositions and methods for treating sickle cell diseases
WO2022245754A1 (en) 2021-05-17 2022-11-24 Iovance Biotherapeutics, Inc. Pd-1 gene-edited tumor infiltrating lymphocytes and uses of same in immunotherapy
WO2022256448A2 (en) 2021-06-01 2022-12-08 Artisan Development Labs, Inc. Compositions and methods for targeting, editing, or modifying genes
CA3222341A1 (en) 2021-06-11 2022-12-15 Kunwoo Lee Biodegradable polymer comprising side chains with polyamine and polyalkylene oxide groups
WO2022264132A1 (en) 2021-06-13 2022-12-22 Yissum Research Development Company Of The Hebrew University Of Jerusalem Ltd. Method for reprogramming human cells
WO2022266287A1 (en) * 2021-06-16 2022-12-22 The Regents Of The University Of Michigan Compositions and methods to transfect, test, and treat skin cells
CA3223311A1 (en) 2021-06-18 2022-12-22 Andrea BARGHETTI Compositions and methods for targeting, editing or modifying human genes
WO2022271818A1 (en) 2021-06-23 2022-12-29 Entrada Therapeutics, Inc. Antisense compounds and methods for targeting cug repeats
FR3124522A1 (en) 2021-06-25 2022-12-30 François CHERBONNEAU Composition and method allowing genome editing
WO2023283359A2 (en) 2021-07-07 2023-01-12 Omega Therapeutics, Inc. Compositions and methods for modulating secreted frizzled receptor protein 1 (sfrp1) gene expression
TW202317602A (en) 2021-07-15 2023-05-01 福瑞德哈金森腫瘤中心 Chimeric polypeptides
WO2023287707A1 (en) 2021-07-15 2023-01-19 Just-Evotec Biologics, Inc. Bidirectional tangential flow filtration (tff) perfusion system
CA3226111A1 (en) 2021-07-22 2023-01-26 Iovance Biotherapeutics, Inc. Method for cryopreservation of solid tumor fragments
WO2023009716A1 (en) 2021-07-28 2023-02-02 Iovance Biotherapeutics, Inc. Treatment of cancer patients with tumor infiltrating lymphocyte therapies in combination with kras inhibitors
WO2023006933A1 (en) 2021-07-30 2023-02-02 KWS SAAT SE & Co. KGaA Plants with improved digestibility and marker haplotypes
WO2023010133A2 (en) 2021-07-30 2023-02-02 Tune Therapeutics, Inc. Compositions and methods for modulating expression of frataxin (fxn)
CA3227105A1 (en) 2021-07-30 2023-02-02 Tune Therapeutics, Inc. Compositions and methods for modulating expression of methyl-cpg binding protein 2 (mecp2)
CA3226947A1 (en) 2021-08-03 2023-02-09 Muhammad YASSIN Engineered tcr complex and methods of using same
EP4130028A1 (en) 2021-08-03 2023-02-08 Rhazes Therapeutics Ltd Engineered tcr complex and methods of using same
AU2022324708A1 (en) 2021-08-06 2024-02-15 Kws Vegetables B.V. Durable downy mildew resistance in spinach
IL310564A (en) 2021-08-06 2024-03-01 Vilmorin & Cie Resistance to leveillula taurica in pepper
WO2023031885A1 (en) 2021-09-02 2023-03-09 SESVanderHave NV Methods and compositions for ppo herbicide tolerance
JP7125727B1 (en) 2021-09-07 2022-08-25 国立大学法人千葉大学 Compositions for modifying nucleic acid sequences and methods for modifying target sites in nucleic acid sequences
CA3230927A1 (en) 2021-09-10 2023-03-16 Agilent Technologies, Inc. Guide rnas with chemical modification for prime editing
GB202113075D0 (en) 2021-09-14 2021-10-27 Innes John Centre Methods of improving vitamin d levels in plants
GB202113933D0 (en) 2021-09-29 2021-11-10 Genome Res Ltd Methods for gene editing
WO2023052508A2 (en) 2021-09-30 2023-04-06 Astrazeneca Ab Use of inhibitors to increase efficiency of crispr/cas insertions
WO2023060186A1 (en) 2021-10-07 2023-04-13 Hepatx Corporation Methods of tracking donor cells in a recipient
CA3233824A1 (en) 2021-10-08 2023-04-13 Samir Mitragotri Ionic liquids for drug delivery
CA3234612A1 (en) 2021-10-14 2023-04-20 Weedout Ltd. Methods of weed control
WO2023064872A1 (en) 2021-10-14 2023-04-20 Precision Biosciences, Inc. Combinations of anti-bcma car t cells and gamma secretase inhibitors
WO2023070003A1 (en) 2021-10-19 2023-04-27 Precision Biosciences, Inc. Gene editing methods for treating alpha-1 antitrypsin (aat) deficiency
AR127482A1 (en) 2021-10-27 2024-01-31 Iovance Biotherapeutics Inc SYSTEMS AND METHODS TO COORDINATE THE MANUFACTURE OF CELLS FOR PATIENT-SPECIFIC IMMUNOTHERAPY
WO2023077053A2 (en) 2021-10-28 2023-05-04 Regeneron Pharmaceuticals, Inc. Crispr/cas-related methods and compositions for knocking out c5
WO2023077148A1 (en) 2021-11-01 2023-05-04 Tome Biosciences, Inc. Single construct platform for simultaneous delivery of gene editing machinery and nucleic acid cargo
WO2023078900A1 (en) 2021-11-03 2023-05-11 INSERM (Institut National de la Santé et de la Recherche Médicale) Methods and compositions for treating triple negative breast cancer (tnbc)
WO2023081756A1 (en) 2021-11-03 2023-05-11 The J. David Gladstone Institutes, A Testamentary Trust Established Under The Will Of J. David Gladstone Precise genome editing using retrons
WO2023086803A1 (en) 2021-11-10 2023-05-19 Iovance Biotherapeutics, Inc. Methods of expansion treatment utilizing cd8 tumor infiltrating lymphocytes
WO2023086847A1 (en) 2021-11-10 2023-05-19 Encodia, Inc. Methods for barcoding macromolecules in individual cells
WO2023091910A1 (en) 2021-11-16 2023-05-25 Precision Biosciences, Inc. Methods for cancer immunotherapy
WO2023093862A1 (en) 2021-11-26 2023-06-01 Epigenic Therapeutics Inc. Method of modulating pcsk9 and uses thereof
WO2023108047A1 (en) 2021-12-08 2023-06-15 Regeneron Pharmaceuticals, Inc. Mutant myocilin disease model and uses thereof
US20230193310A1 (en) 2021-12-10 2023-06-22 Seminis Vegetabe Seeds, Inc. Lettuce plants having resistance to downy mildew
GB202118058D0 (en) 2021-12-14 2022-01-26 Univ Warwick Methods to increase yields in crops
US20230279442A1 (en) 2021-12-15 2023-09-07 Versitech Limited Engineered cas9-nucleases and method of use thereof
WO2023111173A1 (en) 2021-12-16 2023-06-22 INSERM (Institut National de la Santé et de la Recherche Médicale) An ezh2 degrader or inhibitor for use in the treatment of resistant acute myeloid leukemia
BE1030047B1 (en) 2021-12-17 2023-07-17 Anheuser Busch Inbev Sa METHODS FOR PREVENTING INHIBITION OF FLAVOR PRODUCTION IN YEAST
TW202342498A (en) 2021-12-17 2023-11-01 美商薩那生物科技公司 Modified paramyxoviridae fusion glycoproteins
WO2023115041A1 (en) 2021-12-17 2023-06-22 Sana Biotechnology, Inc. Modified paramyxoviridae attachment glycoproteins
WO2023122805A1 (en) 2021-12-20 2023-06-29 Vestaron Corporation Sorbitol driven selection pressure method
WO2023118165A1 (en) 2021-12-21 2023-06-29 INSERM (Institut National de la Santé et de la Recherche Médicale) Methods and compositions for treating melanoma
WO2023122764A1 (en) 2021-12-22 2023-06-29 Tome Biosciences, Inc. Co-delivery of a gene editor construct and a donor template
WO2023122800A1 (en) 2021-12-23 2023-06-29 University Of Massachusetts Therapeutic treatment for fragile x-associated disorder
WO2023126458A1 (en) 2021-12-28 2023-07-06 Mnemo Therapeutics Immune cells with inactivated suv39h1 and modified tcr
WO2023133595A2 (en) 2022-01-10 2023-07-13 Sana Biotechnology, Inc. Methods of ex vivo dosing and administration of lipid particles or viral vectors and related systems and uses
WO2023137471A1 (en) 2022-01-14 2023-07-20 Tune Therapeutics, Inc. Compositions, systems, and methods for programming t cell phenotypes through targeted gene activation
WO2023137472A2 (en) 2022-01-14 2023-07-20 Tune Therapeutics, Inc. Compositions, systems, and methods for programming t cell phenotypes through targeted gene repression
WO2023141602A2 (en) 2022-01-21 2023-07-27 Renagade Therapeutics Management Inc. Engineered retrons and methods of use
WO2023144235A1 (en) 2022-01-27 2023-08-03 INSERM (Institut National de la Santé et de la Recherche Médicale) Methods for monitoring and treating warburg effect in patients with pi3k-related disorders
WO2023147488A1 (en) 2022-01-28 2023-08-03 Iovance Biotherapeutics, Inc. Cytokine associated tumor infiltrating lymphocytes compositions and methods
WO2023150518A1 (en) 2022-02-01 2023-08-10 Sana Biotechnology, Inc. Cd3-targeted lentiviral vectors and uses thereof
WO2023150620A1 (en) 2022-02-02 2023-08-10 Regeneron Pharmaceuticals, Inc. Crispr-mediated transgene insertion in neonatal cells
WO2023150647A1 (en) 2022-02-02 2023-08-10 Sana Biotechnology, Inc. Methods of repeat dosing and administration of lipid particles or viral vectors and related systems and uses
WO2023152164A1 (en) 2022-02-08 2023-08-17 University Of Glasgow Modified ion channels
WO2023156906A1 (en) 2022-02-15 2023-08-24 Futuragene Israel Ltd A bacillus thuringiensis pesticidal protein (bt pp) combination useful for plant protection
WO2023158732A1 (en) 2022-02-16 2023-08-24 Dana-Farber Cancer Institute, Inc. Methods for decreasing pathologic alpha-synuclein using agents that modulate fndc5 or biologically active fragments thereof
WO2023156587A1 (en) 2022-02-18 2023-08-24 INSERM (Institut National de la Santé et de la Recherche Médicale) Use of tcr-deficient car-tregs in combination with anti-tcr complex monoclonal antibodies for inducing durable tolerance
WO2023167882A1 (en) 2022-03-01 2023-09-07 Artisan Development Labs, Inc. Composition and methods for transgene insertion
EP4256950A1 (en) 2022-04-06 2023-10-11 Vilmorin et Cie Tolerance to cgmmv in cucumber
WO2023196877A1 (en) 2022-04-06 2023-10-12 Iovance Biotherapeutics, Inc. Treatment of nsclc patients with tumor infiltrating lymphocyte therapies
WO2023201369A1 (en) 2022-04-15 2023-10-19 Iovance Biotherapeutics, Inc. Til expansion processes using specific cytokine combinations and/or akti treatment
WO2023205744A1 (en) 2022-04-20 2023-10-26 Tome Biosciences, Inc. Programmable gene insertion compositions
WO2023212677A2 (en) 2022-04-29 2023-11-02 Regeneron Pharmaceuticals, Inc. Identification of tissue-specific extragenic safe harbors for gene therapy approaches
WO2023215725A1 (en) 2022-05-02 2023-11-09 Fred Hutchinson Cancer Center Compositions and methods for cellular immunotherapy
WO2023215831A1 (en) 2022-05-04 2023-11-09 Tome Biosciences, Inc. Guide rna compositions for programmable gene insertion
WO2023215498A2 (en) 2022-05-05 2023-11-09 Modernatx, Inc. Compositions and methods for cd28 antagonism
WO2023219933A1 (en) 2022-05-09 2023-11-16 Entrada Therapeutics, Inc. Compositions and methods for delivery of nucleic acid therapeutics
WO2023220035A1 (en) 2022-05-09 2023-11-16 Synteny Therapeutics, Inc. Erythroparvovirus compositions and methods for gene therapy
WO2023220603A1 (en) 2022-05-09 2023-11-16 Regeneron Pharmaceuticals, Inc. Vectors and methods for in vivo antibody production
WO2023220040A1 (en) 2022-05-09 2023-11-16 Synteny Therapeutics, Inc. Erythroparvovirus with a modified capsid for gene therapy
WO2023220043A1 (en) 2022-05-09 2023-11-16 Synteny Therapeutics, Inc. Erythroparvovirus with a modified genome for gene therapy
WO2023220608A1 (en) 2022-05-10 2023-11-16 Iovance Biotherapeutics, Inc. Treatment of cancer patients with tumor infiltrating lymphocyte therapies in combination with an il-15r agonist
WO2023225670A2 (en) 2022-05-20 2023-11-23 Tome Biosciences, Inc. Ex vivo programmable gene insertion
EP4279085A1 (en) 2022-05-20 2023-11-22 Mnemo Therapeutics Compositions and methods for treating a refractory or relapsed cancer or a chronic infectious disease
WO2023225410A2 (en) 2022-05-20 2023-11-23 Artisan Development Labs, Inc. Systems and methods for assessing risk of genome editing events
WO2023230549A2 (en) 2022-05-25 2023-11-30 Flagship Pioneering Innovations Vii, Llc Compositions and methods for modulation of tumor suppressors and oncogenes
WO2023230578A2 (en) 2022-05-25 2023-11-30 Flagship Pioneering Innovations Vii, Llc Compositions and methods for modulating circulating factors
WO2023230570A2 (en) 2022-05-25 2023-11-30 Flagship Pioneering Innovations Vii, Llc Compositions and methods for modulating genetic drivers
WO2023230573A2 (en) 2022-05-25 2023-11-30 Flagship Pioneering Innovations Vii, Llc Compositions and methods for modulation of immune responses
WO2023230566A2 (en) 2022-05-25 2023-11-30 Flagship Pioneering Innovations Vii, Llc Compositions and methods for modulating cytokines
WO2023235726A2 (en) 2022-05-31 2023-12-07 Regeneron Pharmaceuticals, Inc. Crispr interference therapeutics for c9orf72 repeat expansion disease
WO2023235725A2 (en) 2022-05-31 2023-12-07 Regeneron Pharmaceuticals, Inc. Crispr-based therapeutics for c9orf72 repeat expansion disease
WO2023240282A1 (en) 2022-06-10 2023-12-14 Umoja Biopharma, Inc. Engineered stem cells and uses thereof
US20230404003A1 (en) 2022-06-21 2023-12-21 Seminis Vegetable Seeds, Inc. Novel qtls conferring resistance to cucumber mosaic virus
WO2023250511A2 (en) 2022-06-24 2023-12-28 Tune Therapeutics, Inc. Compositions, systems, and methods for reducing low-density lipoprotein through targeted gene repression
EP4299733A1 (en) 2022-06-30 2024-01-03 Inari Agriculture Technology, Inc. Compositions, systems, and methods for genome editing
WO2024005863A1 (en) 2022-06-30 2024-01-04 Inari Agriculture Technology, Inc. Compositions, systems, and methods for genome editing
GB2621813A (en) 2022-06-30 2024-02-28 Univ Newcastle Preventing disease recurrence in Mitochondrial replacement therapy
WO2024005864A1 (en) 2022-06-30 2024-01-04 Inari Agriculture Technology, Inc. Compositions, systems, and methods for genome editing
EP4299739A1 (en) 2022-06-30 2024-01-03 Inari Agriculture Technology, Inc. Compositions, systems, and methods for genome editing
WO2024008752A1 (en) 2022-07-05 2024-01-11 John Innes Centre Methods to increase iron content in plants
WO2024008799A1 (en) 2022-07-06 2024-01-11 Institut National de la Santé et de la Recherche Médicale Methods for the treatment of proliferative glomerulonephritis
WO2024015881A2 (en) 2022-07-12 2024-01-18 Tune Therapeutics, Inc. Compositions, systems, and methods for targeted transcriptional activation
WO2024020346A2 (en) 2022-07-18 2024-01-25 Renagade Therapeutics Management Inc. Gene editing components, systems, and methods of use
WO2024020587A2 (en) 2022-07-22 2024-01-25 Tome Biosciences, Inc. Pleiopluripotent stem cell programmable gene insertion
WO2024026474A1 (en) 2022-07-29 2024-02-01 Regeneron Pharmaceuticals, Inc. Compositions and methods for transferrin receptor (tfr)-mediated delivery to the brain and muscle
WO2024026406A2 (en) 2022-07-29 2024-02-01 Vestaron Corporation Next Generation ACTX Peptides
LU502613B1 (en) 2022-08-01 2024-02-01 Plant Bioscience Ltd Methods of altering the starch granule profile in plants
WO2024028433A1 (en) 2022-08-04 2024-02-08 Institut National de la Santé et de la Recherche Médicale Methods for the treatment of lymphoproliferative disorders
US20240067969A1 (en) 2022-08-19 2024-02-29 Tune Therapeutics, Inc. Compositions, systems, and methods for regulation of hepatitis b virus through targeted gene repression
WO2024040222A1 (en) 2022-08-19 2024-02-22 Generation Bio Co. Cleavable closed-ended dna (cedna) and methods of use thereof
WO2024044655A1 (en) 2022-08-24 2024-02-29 Sana Biotechnology, Inc. Delivery of heterologous proteins
WO2024042489A1 (en) 2022-08-25 2024-02-29 LifeEDIT Therapeutics, Inc. Chemical modification of guide rnas with locked nucleic acid for rna guided nuclease-mediated gene editing
WO2024044723A1 (en) 2022-08-25 2024-02-29 Renagade Therapeutics Management Inc. Engineered retrons and methods of use
WO2024042199A1 (en) 2022-08-26 2024-02-29 KWS SAAT SE & Co. KGaA Use of paired genes in hybrid breeding
WO2024047110A1 (en) 2022-08-31 2024-03-07 Institut National de la Santé et de la Recherche Médicale Method to generate more efficient car-t cells
WO2024050544A2 (en) 2022-09-01 2024-03-07 J.R. Simplot Company Enhanced targeted knock-in frequency in host genomes through crispr exonuclease processing
WO2024047605A1 (en) 2022-09-01 2024-03-07 SESVanderHave NV Methods and compositions for ppo herbicide tolerance
WO2024052318A1 (en) 2022-09-06 2024-03-14 Institut National de la Santé et de la Recherche Médicale Novel dual split car-t cells for the treatment of cd38-positive hematological malignancies
WO2024056659A1 (en) 2022-09-13 2024-03-21 Institut National de la Santé et de la Recherche Médicale Method for treating prostate cancer and other epithelial cancers
WO2024059618A2 (en) 2022-09-13 2024-03-21 Arsenal Biosciences, Inc. Immune cells having co-expressed tgfbr shrnas
WO2024056902A2 (en) 2022-09-16 2024-03-21 Christopher Shaw Compositions and methods for treating neurological diseases
WO2024059824A2 (en) 2022-09-16 2024-03-21 Arsenal Biosciences, Inc. Immune cells with combination gene perturbations
WO2024064642A2 (en) 2022-09-19 2024-03-28 Tune Therapeutics, Inc. Compositions, systems, and methods for modulating t cell function
WO2024064838A1 (en) 2022-09-21 2024-03-28 Sana Biotechnology, Inc. Lipid particles comprising variant paramyxovirus attachment glycoproteins and uses thereof
WO2024062138A1 (en) 2022-09-23 2024-03-28 Mnemo Therapeutics Immune cells comprising a modified suv39h1 gene
WO2024073606A1 (en) 2022-09-28 2024-04-04 Regeneron Pharmaceuticals, Inc. Antibody resistant modified receptors to enhance cell-based therapies
GB202214410D0 (en) 2022-09-30 2022-11-16 Ivy Farm Tech Limited genetically modified cells

Family Cites Families (57)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4217344A (en) 1976-06-23 1980-08-12 L'oreal Compositions containing aqueous dispersions of lipid spheres
US4235871A (en) 1978-02-24 1980-11-25 Papahadjopoulos Demetrios P Method of encapsulating biologically active materials in lipid vesicles
US4186183A (en) 1978-03-29 1980-01-29 The United States Of America As Represented By The Secretary Of The Army Liposome carriers in chemotherapy of leishmaniasis
US4261975A (en) 1979-09-19 1981-04-14 Merck & Co., Inc. Viral liposome particle
US4485054A (en) 1982-10-04 1984-11-27 Lipoderm Pharmaceuticals Limited Method of encapsulating biologically active materials in multilamellar lipid vesicles (MLV)
US4501728A (en) 1983-01-06 1985-02-26 Technology Unlimited, Inc. Masking of liposomes from RES recognition
US4946787A (en) 1985-01-07 1990-08-07 Syntex (U.S.A.) Inc. N-(ω,(ω-1)-dialkyloxy)- and N-(ω,(ω-1)-dialkenyloxy)-alk-1-yl-N,N,N-tetrasubstituted ammonium lipids and uses therefor
US5049386A (en) 1985-01-07 1991-09-17 Syntex (U.S.A.) Inc. N-ω,(ω-1)-dialkyloxy)- and N-(ω,(ω-1)-dialkenyloxy)Alk-1-YL-N,N,N-tetrasubstituted ammonium lipids and uses therefor
US4897355A (en) 1985-01-07 1990-01-30 Syntex (U.S.A.) Inc. N[ω,(ω-1)-dialkyloxy]- and N-[ω,(ω-1)-dialkenyloxy]-alk-1-yl-N,N,N-tetrasubstituted ammonium lipids and uses therefor
US4797368A (en) 1985-03-15 1989-01-10 The United States Of America As Represented By The Department Of Health And Human Services Adeno-associated virus as eukaryotic expression vector
US4774085A (en) 1985-07-09 1988-09-27 501 Board of Regents, Univ. of Texas Pharmaceutical administration systems containing a mixture of immunomodulators
DE3751873T2 (en) 1986-04-09 1997-02-13 Genzyme Corp Genetically transformed animals that secrete a desired protein in milk
US4837028A (en) 1986-12-24 1989-06-06 Liposome Technology, Inc. Liposomes with enhanced circulation time
US4873316A (en) 1987-06-23 1989-10-10 Biogen, Inc. Isolation of exogenous recombinant proteins from the milk of transgenic mammals
US5264618A (en) 1990-04-19 1993-11-23 Vical, Inc. Cationic lipids for intracellular delivery of biologically active molecules
AU7979491A (en) 1990-05-03 1991-11-27 Vical, Inc. Intracellular delivery of biologically active substances by means of self-assembling lipid complexes
US5173414A (en) 1990-10-30 1992-12-22 Applied Immune Sciences, Inc. Production of recombinant adeno-associated virus vectors
US5587308A (en) 1992-06-02 1996-12-24 The United States Of America As Represented By The Department Of Health & Human Services Modified adeno-associated virus vector capable of expression from a novel promoter
US6534261B1 (en) 1999-01-12 2003-03-18 Sangamo Biosciences, Inc. Regulation of endogenous gene expression in cells using zinc finger proteins
US7868149B2 (en) 1999-07-20 2011-01-11 Monsanto Technology Llc Plant genome sequence and uses thereof
US6479808B1 (en) 1999-07-07 2002-11-12 The United States Of America As Represented By The Administrator Of The National Aeronautics And Space Administration Method and systems for collecting data from multiple fields of view
US6603061B1 (en) 1999-07-29 2003-08-05 Monsanto Company Agrobacterium-mediated plant transformation method
US7033744B2 (en) * 2001-03-16 2006-04-25 Naoya Kobayashi Method for proliferating a liver cell, a liver cell obtained thereby, and use thereof
US20090100536A1 (en) 2001-12-04 2009-04-16 Monsanto Company Transgenic plants with enhanced agronomic traits
US20050220796A1 (en) 2004-03-31 2005-10-06 Dynan William S Compositions and methods for modulating DNA repair
CA2615532C (en) * 2005-07-26 2016-06-28 Sangamo Biosciences, Inc. Targeted integration and expression of exogenous nucleic acid sequences
NZ592231A (en) * 2007-03-02 2012-07-27 Danisco Methods to generate bacteriophage resistant bacterial strains and produce bacteriophage CRISPR loci phage mutants
US8546553B2 (en) 2008-07-25 2013-10-01 University Of Georgia Research Foundation, Inc. Prokaryotic RNAi-like system and methods of use
US20100076057A1 (en) 2008-09-23 2010-03-25 Northwestern University TARGET DNA INTERFERENCE WITH crRNA
US9404098B2 (en) 2008-11-06 2016-08-02 University Of Georgia Research Foundation, Inc. Method for cleaving a target RNA using a Cas6 polypeptide
EP2352369B1 (en) * 2008-12-04 2017-04-26 Sangamo BioSciences, Inc. Genome editing in rats using zinc-finger nucleases
US8889394B2 (en) 2009-09-07 2014-11-18 Empire Technology Development Llc Multiple domain proteins
US10087431B2 (en) 2010-03-10 2018-10-02 The Regents Of The University Of California Methods of generating nucleic acid fragments
KR101867359B1 (en) 2010-05-10 2018-07-23 더 리젠츠 오브 더 유니버시티 오브 캘리포니아 Endoribonuclease compositions and methods of use thereof
WO2011146121A1 (en) 2010-05-17 2011-11-24 Sangamo Biosciences, Inc. Novel dna-binding proteins and uses thereof
US9405700B2 (en) 2010-11-04 2016-08-02 Sonics, Inc. Methods and apparatus for virtualization in an integrated circuit
JP5607827B2 (en) 2011-05-30 2014-10-15 トヨタ自動車株式会社 High-strength polypropylene fiber and method for producing the same
US20140113376A1 (en) 2011-06-01 2014-04-24 Rotem Sorek Compositions and methods for downregulating prokaryotic genes
GB201122458D0 (en) 2011-12-30 2012-02-08 Univ Wageningen Modified cascade ribonucleoproteins and uses thereof
US9637739B2 (en) * 2012-03-20 2017-05-02 Vilnius University RNA-directed DNA cleavage by the Cas9-crRNA complex
WO2013141680A1 (en) 2012-03-20 2013-09-26 Vilnius University RNA-DIRECTED DNA CLEAVAGE BY THE Cas9-crRNA COMPLEX
RS64622B1 (en) * 2012-05-25 2023-10-31 Univ California Methods and compositions for rna-directed target dna modification and for rna-directed modulation of transcription
JP6517143B2 (en) 2012-10-23 2019-05-22 ツールゲン インコーポレイテッド Composition for cleaving target DNA comprising guide RNA specific for target DNA and CAS protein encoding nucleic acid or CAS protein, and use thereof
KR102006880B1 (en) 2012-12-06 2019-08-02 시그마-알드리치 컴퍼니., 엘엘씨 Crispr-based genome modification and regulation
WO2014093479A1 (en) 2012-12-11 2014-06-19 Montana State University Crispr (clustered regularly interspaced short palindromic repeats) rna-guided control of gene regulation
PT2896697E (en) 2012-12-12 2015-12-31 Massachusetts Inst Technology Engineering of systems, methods and optimized guide compositions for sequence manipulation
PT2898075E (en) 2012-12-12 2016-06-16 Harvard College Engineering and optimization of improved systems, methods and enzyme compositions for sequence manipulation
WO2014093718A1 (en) 2012-12-12 2014-06-19 The Broad Institute, Inc. Methods, systems, and apparatus for identifying target sequences for cas enzymes or crispr-cas systems for target sequences and conveying results thereof
US8697359B1 (en) 2012-12-12 2014-04-15 The Broad Institute, Inc. CRISPR-Cas systems and methods for altering expression of gene products
WO2014093701A1 (en) 2012-12-12 2014-06-19 The Broad Institute, Inc. Functional genomics using crispr-cas systems, compositions, methods, knock out libraries and applications thereof
EP3434776A1 (en) 2012-12-12 2019-01-30 The Broad Institute, Inc. Methods, models, systems, and apparatus for identifying target sequences for cas enzymes or crispr-cas systems for target sequences and conveying results thereof
EP4286402A3 (en) 2012-12-12 2024-02-14 The Broad Institute, Inc. Crispr-cas component systems, methods and compositions for sequence manipulation
DK2931898T3 (en) 2012-12-12 2016-06-20 Massachusetts Inst Technology CONSTRUCTION AND OPTIMIZATION OF SYSTEMS, PROCEDURES AND COMPOSITIONS FOR SEQUENCE MANIPULATION WITH FUNCTIONAL DOMAINS
WO2014093694A1 (en) 2012-12-12 2014-06-19 The Broad Institute, Inc. Crispr-cas nickase systems, methods and compositions for sequence manipulation in eukaryotes
IL239317B (en) 2012-12-12 2022-07-01 Broad Inst Inc Delivery, engineering and optimization of systems, methods and compositions for sequence manipulation and therapeutic applications
SG11201504621RA (en) 2012-12-17 2015-07-30 Harvard College Rna-guided human genome engineering
JP6244391B2 (en) * 2016-03-17 2017-12-06 本田技研工業株式会社 vehicle

Cited By (169)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US10323236B2 (en) 2011-07-22 2019-06-18 President And Fellows Of Harvard College Evaluation and improvement of nuclease cleavage specificity
US10570419B2 (en) 2012-05-25 2020-02-25 The Regents Of The University Of California Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription
US11814645B2 (en) 2012-05-25 2023-11-14 The Regents Of The University Of California Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription
US10227611B2 (en) 2012-05-25 2019-03-12 The Regents Of The University Of California Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription
US10266850B2 (en) 2012-05-25 2019-04-23 The Regents Of The University Of California Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription
US11001863B2 (en) 2012-05-25 2021-05-11 The Regents Of The University Of California Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription
US10113167B2 (en) 2012-05-25 2018-10-30 The Regents Of The University Of California Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription
US11401532B2 (en) 2012-05-25 2022-08-02 The Regents Of The University Of California Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription
US10301651B2 (en) 2012-05-25 2019-05-28 The Regents Of The University Of California Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription
US10308961B2 (en) 2012-05-25 2019-06-04 The Regents Of The University Of California Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription
US11473108B2 (en) 2012-05-25 2022-10-18 The Regents Of The University Of California Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription
US10337029B2 (en) 2012-05-25 2019-07-02 The Regents Of The University Of California Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription
US10351878B2 (en) 2012-05-25 2019-07-16 The Regents Of The University Of California Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription
US10358659B2 (en) 2012-05-25 2019-07-23 The Regents Of The University Of California Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription
US10358658B2 (en) 2012-05-25 2019-07-23 The Regents Of The University Of California Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription
US10988782B2 (en) 2012-05-25 2021-04-27 The Regents Of The University Of California Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription
US10385360B2 (en) 2012-05-25 2019-08-20 The Regents Of The University Of California Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription
US10400253B2 (en) 2012-05-25 2019-09-03 The Regents Of The University Of California Methods and compositions or RNA-directed target DNA modification and for RNA-directed modulation of transcription
US11549127B2 (en) 2012-05-25 2023-01-10 The Regents Of The University Of California Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription
US10407697B2 (en) 2012-05-25 2019-09-10 The Regents Of The University Of California Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription
US10415061B2 (en) 2012-05-25 2019-09-17 The Regents Of The University Of California Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription
US10421980B2 (en) 2012-05-25 2019-09-24 The Regents Of The University Of California Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription
US11332761B2 (en) 2012-05-25 2022-05-17 The Regenis of Wie University of California Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription
US10428352B2 (en) 2012-05-25 2019-10-01 The Regents Of The University Of California Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription
US10443076B2 (en) 2012-05-25 2019-10-15 The Regents Of The University Of California Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription
US11008589B2 (en) 2012-05-25 2021-05-18 The Regents Of The University Of California Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription
US10982230B2 (en) 2012-05-25 2021-04-20 The Regents Of The University Of California Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription
US10487341B2 (en) 2012-05-25 2019-11-26 The Regents Of The University Of California Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription
US10982231B2 (en) 2012-05-25 2021-04-20 The Regents Of The University Of California Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription
US11008590B2 (en) 2012-05-25 2021-05-18 The Regents Of The University Of California Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription
US10513712B2 (en) 2012-05-25 2019-12-24 The Regents Of The University Of California Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription
US10519467B2 (en) 2012-05-25 2019-12-31 The Regents Of The University Of California Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription
US10526619B2 (en) 2012-05-25 2020-01-07 The Regents Of The University Of California Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription
US11293034B2 (en) 2012-05-25 2022-04-05 The Regents Of The University Of California Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription
US10533190B2 (en) 2012-05-25 2020-01-14 The Regents Of The University Of California Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription
US10550407B2 (en) 2012-05-25 2020-02-04 The Regents Of The University Of California Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription
US11274318B2 (en) 2012-05-25 2022-03-15 The Regents Of The University Of California Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription
US11028412B2 (en) 2012-05-25 2021-06-08 The Regents Of The University Of California Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription
US10988780B2 (en) 2012-05-25 2021-04-27 The Regents Of The University Of California Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription
US10577631B2 (en) 2012-05-25 2020-03-03 The Regents Of The University Of California Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription
US11242543B2 (en) 2012-05-25 2022-02-08 The Regents Of The University Of California Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription
US10597680B2 (en) 2012-05-25 2020-03-24 The Regents Of The University Of California Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription
US10900054B2 (en) 2012-05-25 2021-01-26 The Regents Of The University Of California Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription
US10793878B1 (en) 2012-05-25 2020-10-06 The Regents Of The University Of California Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription
US11634730B2 (en) 2012-05-25 2023-04-25 The Regents Of The University Of California Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription
US10612045B2 (en) 2012-05-25 2020-04-07 The Regents Of The University Of California Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription
US10774344B1 (en) 2012-05-25 2020-09-15 The Regents Of The University Of California Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription
US10626419B2 (en) 2012-05-25 2020-04-21 The Regents Of The University Of California Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription
US11186849B2 (en) 2012-05-25 2021-11-30 The Regents Of The University Of California Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription
US10563227B2 (en) 2012-05-25 2020-02-18 The Regents Of The University Of California Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription
US10640791B2 (en) 2012-05-25 2020-05-05 The Regents Of The University Of California Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription
US11674159B2 (en) 2012-05-25 2023-06-13 The Regents Of The University Of California Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription
US10669560B2 (en) 2012-05-25 2020-06-02 The Regents Of The University Of California Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription
US10676759B2 (en) 2012-05-25 2020-06-09 The Regents Of The University Of California Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription
US11479794B2 (en) 2012-05-25 2022-10-25 The Regents Of The University Of California Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription
US10752920B2 (en) 2012-05-25 2020-08-25 The Regents Of The University Of California Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription
US11920181B2 (en) 2013-08-09 2024-03-05 President And Fellows Of Harvard College Nuclease profiling system
US10508298B2 (en) 2013-08-09 2019-12-17 President And Fellows Of Harvard College Methods for identifying a target site of a CAS9 nuclease
US10954548B2 (en) 2013-08-09 2021-03-23 President And Fellows Of Harvard College Nuclease profiling system
US11046948B2 (en) 2013-08-22 2021-06-29 President And Fellows Of Harvard College Engineered transcription activator-like effector (TALE) domains and uses thereof
US10682410B2 (en) 2013-09-06 2020-06-16 President And Fellows Of Harvard College Delivery system for functional nucleases
US10597679B2 (en) 2013-09-06 2020-03-24 President And Fellows Of Harvard College Switchable Cas9 nucleases and uses thereof
US11299755B2 (en) 2013-09-06 2022-04-12 President And Fellows Of Harvard College Switchable CAS9 nucleases and uses thereof
US10912833B2 (en) 2013-09-06 2021-02-09 President And Fellows Of Harvard College Delivery of negatively charged proteins using cationic lipids
US10858639B2 (en) 2013-09-06 2020-12-08 President And Fellows Of Harvard College CAS9 variants and uses thereof
US10640788B2 (en) 2013-11-07 2020-05-05 Editas Medicine, Inc. CRISPR-related methods and compositions with governing gRNAs
US10190137B2 (en) 2013-11-07 2019-01-29 Editas Medicine, Inc. CRISPR-related methods and compositions with governing gRNAS
US11390887B2 (en) 2013-11-07 2022-07-19 Editas Medicine, Inc. CRISPR-related methods and compositions with governing gRNAS
US11124782B2 (en) 2013-12-12 2021-09-21 President And Fellows Of Harvard College Cas variants for gene editing
US11053481B2 (en) 2013-12-12 2021-07-06 President And Fellows Of Harvard College Fusions of Cas9 domains and nucleic acid-editing domains
US10465176B2 (en) 2013-12-12 2019-11-05 President And Fellows Of Harvard College Cas variants for gene editing
US10704062B2 (en) 2014-07-30 2020-07-07 President And Fellows Of Harvard College CAS9 proteins including ligand-dependent inteins
US11578343B2 (en) 2014-07-30 2023-02-14 President And Fellows Of Harvard College CAS9 proteins including ligand-dependent inteins
US11680268B2 (en) 2014-11-07 2023-06-20 Editas Medicine, Inc. Methods for improving CRISPR/Cas-mediated genome-editing
US10278372B2 (en) 2014-12-10 2019-05-07 Regents Of The University Of Minnesota Genetically modified cells, tissues, and organs for treating disease
US10993419B2 (en) 2014-12-10 2021-05-04 Regents Of The University Of Minnesota Genetically modified cells, tissues, and organs for treating disease
US11234418B2 (en) 2014-12-10 2022-02-01 Regents Of The University Of Minnesota Genetically modified cells, tissues, and organs for treating disease
US11844760B2 (en) 2015-05-06 2023-12-19 Snipr Technologies Limited Altering microbial populations and modifying microbiota
US11612617B2 (en) 2015-05-06 2023-03-28 Snipr Technologies Limited Altering microbial populations and modifying microbiota
US10506812B2 (en) 2015-05-06 2019-12-17 Snipr Technologies Limited Altering microbial populations and modifying microbiota
US11517582B2 (en) 2015-05-06 2022-12-06 Snipr Technologies Limited Altering microbial populations and modifying microbiota
US11400110B2 (en) 2015-05-06 2022-08-02 Snipr Technologies Limited Altering microbial populations and modifying microbiota
US10561148B2 (en) 2015-05-06 2020-02-18 Snipr Technologies Limited Altering microbial populations and modifying microbiota
US10582712B2 (en) 2015-05-06 2020-03-10 Snipr Technologies Limited Altering microbial populations and modifying microbiota
US10524477B2 (en) 2015-05-06 2020-01-07 Snipr Technologies Limited Altering microbial populations and modifying microbiota
US10463049B2 (en) 2015-05-06 2019-11-05 Snipr Technologies Limited Altering microbial populations and modifying microbiota
US10624349B2 (en) 2015-05-06 2020-04-21 Snipr Technologies Limited Altering microbial populations and modifying microbiota
US11642363B2 (en) 2015-05-06 2023-05-09 Snipr Technologies Limited Altering microbial populations and modifying microbiota
US11147830B2 (en) 2015-05-06 2021-10-19 Snipr Technologies Limited Altering microbial populations and modifying microbiota
US11547716B2 (en) 2015-05-06 2023-01-10 Snipr Technologies Limited Altering microbial populations and modifying microbiota
US11390884B2 (en) 2015-05-11 2022-07-19 Editas Medicine, Inc. Optimized CRISPR/cas9 systems and methods for gene editing in stem cells
US11911415B2 (en) 2015-06-09 2024-02-27 Editas Medicine, Inc. CRISPR/Cas-related methods and compositions for improving transplantation
US11583556B2 (en) 2015-07-31 2023-02-21 Regents Of The University Of Minnesota Modified cells and methods of therapy
US11642375B2 (en) 2015-07-31 2023-05-09 Intima Bioscience, Inc. Intracellular genomic transplant and methods of therapy
US10406177B2 (en) 2015-07-31 2019-09-10 Regents Of The University Of Minnesota Modified cells and methods of therapy
US11147837B2 (en) 2015-07-31 2021-10-19 Regents Of The University Of Minnesota Modified cells and methods of therapy
US11925664B2 (en) 2015-07-31 2024-03-12 Intima Bioscience, Inc. Intracellular genomic transplant and methods of therapy
US11642374B2 (en) 2015-07-31 2023-05-09 Intima Bioscience, Inc. Intracellular genomic transplant and methods of therapy
US11266692B2 (en) 2015-07-31 2022-03-08 Regents Of The University Of Minnesota Intracellular genomic transplant and methods of therapy
US11903966B2 (en) 2015-07-31 2024-02-20 Regents Of The University Of Minnesota Intracellular genomic transplant and methods of therapy
US10166255B2 (en) 2015-07-31 2019-01-01 Regents Of The University Of Minnesota Intracellular genomic transplant and methods of therapy
US11667911B2 (en) 2015-09-24 2023-06-06 Editas Medicine, Inc. Use of exonucleases to improve CRISPR/CAS-mediated genome editing
US11214780B2 (en) 2015-10-23 2022-01-04 President And Fellows Of Harvard College Nucleobase editors and uses thereof
US11597924B2 (en) 2016-03-25 2023-03-07 Editas Medicine, Inc. Genome editing systems comprising repair-modulating enzyme molecules and methods of their use
US11236313B2 (en) 2016-04-13 2022-02-01 Editas Medicine, Inc. Cas9 fusion molecules, gene editing systems, and methods of use thereof
US11351252B2 (en) 2016-06-05 2022-06-07 Snipr Technologies Limited Selectively altering microbiota for immune modulation
US10300138B2 (en) 2016-06-05 2019-05-28 Snipr Technologies Limited Selectively altering microbiota for immune modulation
US10596255B2 (en) 2016-06-05 2020-03-24 Snipr Technologies Limited Selectively altering microbiota for immune modulation
US10603379B2 (en) 2016-06-05 2020-03-31 Snipr Technologies Limited Selectively altering microbiota for immune modulation
US11141481B2 (en) 2016-06-05 2021-10-12 Snipr Technologies Limited Selectively altering microbiota for immune modulation
US11291723B2 (en) 2016-06-05 2022-04-05 Snipr Technologies Limited Selectively altering microbiota for immune modulation
US10953090B2 (en) 2016-06-05 2021-03-23 Snipr Technologies Limited Selectively altering microbiota for immune modulation
US11471531B2 (en) 2016-06-05 2022-10-18 Snipr Technologies Limited Selectively altering microbiota for immune modulation
US11471530B2 (en) 2016-06-05 2022-10-18 Snipr Technologies Limited Selectively altering microbiota for immune modulation
US10363308B2 (en) 2016-06-05 2019-07-30 Snipr Technologies Limited Selectively altering microbiota for immune modulation
US10300139B2 (en) 2016-06-05 2019-05-28 Snipr Technologies Limited Selectively altering microbiota for immune modulation
US10765740B2 (en) 2016-06-05 2020-09-08 Snipr Technologies Limited Selectively altering microbiota for immune modulation
US11912987B2 (en) 2016-08-03 2024-02-27 KSQ Therapeutics, Inc. Methods for screening for cancer targets
US11702651B2 (en) 2016-08-03 2023-07-18 President And Fellows Of Harvard College Adenosine nucleobase editors and uses thereof
US11078481B1 (en) 2016-08-03 2021-08-03 KSQ Therapeutics, Inc. Methods for screening for cancer targets
US10947530B2 (en) 2016-08-03 2021-03-16 President And Fellows Of Harvard College Adenosine nucleobase editors and uses thereof
US11661590B2 (en) 2016-08-09 2023-05-30 President And Fellows Of Harvard College Programmable CAS9-recombinase fusion proteins and uses thereof
US11542509B2 (en) 2016-08-24 2023-01-03 President And Fellows Of Harvard College Incorporation of unnatural amino acids into proteins using base editing
US11078483B1 (en) 2016-09-02 2021-08-03 KSQ Therapeutics, Inc. Methods for measuring and improving CRISPR reagent function
US11946163B2 (en) 2016-09-02 2024-04-02 KSQ Therapeutics, Inc. Methods for measuring and improving CRISPR reagent function
US11306324B2 (en) 2016-10-14 2022-04-19 President And Fellows Of Harvard College AAV delivery of nucleobase editors
US10912797B2 (en) 2016-10-18 2021-02-09 Intima Bioscience, Inc. Tumor infiltrating lymphocytes and methods of therapy
US11154574B2 (en) 2016-10-18 2021-10-26 Regents Of The University Of Minnesota Tumor infiltrating lymphocytes and methods of therapy
US10745677B2 (en) 2016-12-23 2020-08-18 President And Fellows Of Harvard College Editing of CCR5 receptor gene to protect against HIV infection
US11820969B2 (en) 2016-12-23 2023-11-21 President And Fellows Of Harvard College Editing of CCR2 receptor gene to protect against HIV infection
US11898179B2 (en) 2017-03-09 2024-02-13 President And Fellows Of Harvard College Suppression of pain by gene editing
US11542496B2 (en) 2017-03-10 2023-01-03 President And Fellows Of Harvard College Cytosine to guanine base editor
US11268082B2 (en) 2017-03-23 2022-03-08 President And Fellows Of Harvard College Nucleobase editors comprising nucleic acid programmable DNA binding proteins
US11499151B2 (en) 2017-04-28 2022-11-15 Editas Medicine, Inc. Methods and systems for analyzing guide RNA molecules
US11560566B2 (en) 2017-05-12 2023-01-24 President And Fellows Of Harvard College Aptazyme-embedded guide RNAs for use with CRISPR-Cas9 in genome editing and transcriptional activation
US11702645B2 (en) 2017-05-31 2023-07-18 The University Of Tokyo Polynucleotide encoding modified CAS9 protein
US11371030B2 (en) 2017-05-31 2022-06-28 The University Of Tokyo Modified Cas9 protein and use thereof
US10428319B2 (en) 2017-06-09 2019-10-01 Editas Medicine, Inc. Engineered Cas9 nucleases
US11098297B2 (en) 2017-06-09 2021-08-24 Editas Medicine, Inc. Engineered Cas9 nucleases
US11098325B2 (en) 2017-06-30 2021-08-24 Intima Bioscience, Inc. Adeno-associated viral vectors for gene therapy
US11866726B2 (en) 2017-07-14 2024-01-09 Editas Medicine, Inc. Systems and methods for targeted integration and genome editing and detection thereof using integrated priming sites
US11732274B2 (en) 2017-07-28 2023-08-22 President And Fellows Of Harvard College Methods and compositions for evolving base editors using phage-assisted continuous evolution (PACE)
US11319532B2 (en) 2017-08-30 2022-05-03 President And Fellows Of Harvard College High efficiency base editors comprising Gam
US11932884B2 (en) 2017-08-30 2024-03-19 President And Fellows Of Harvard College High efficiency base editors comprising Gam
US11795443B2 (en) 2017-10-16 2023-10-24 The Broad Institute, Inc. Uses of adenosine base editors
US10760075B2 (en) 2018-04-30 2020-09-01 Snipr Biome Aps Treating and preventing microbial infections
US11485973B2 (en) 2018-04-30 2022-11-01 Snipr Biome Aps Treating and preventing microbial infections
US11421227B2 (en) 2018-04-30 2022-08-23 Snipr Biome Aps Treating and preventing microbial infections
US10920222B2 (en) 2018-04-30 2021-02-16 Snipr Biome Aps Treating and preventing microbial infections
US11643653B2 (en) 2018-04-30 2023-05-09 Snipr Biome Aps Treating and preventing microbial infections
US11788085B2 (en) 2018-04-30 2023-10-17 Snipr Biome Aps Treating and preventing microbial infections
US11851663B2 (en) 2018-10-14 2023-12-26 Snipr Biome Aps Single-vector type I vectors
WO2020078893A1 (en) 2018-10-14 2020-04-23 Snipr Biome Aps. Products, uses & methods
EP4170036A1 (en) 2018-10-14 2023-04-26 SNIPR Biome ApS. Products, uses & methods
US11629350B2 (en) 2018-10-14 2023-04-18 Snipr Biome Aps Single-vector type I vectors
DE112019005139T5 (en) 2018-10-14 2021-07-15 Snipr Biome Aps. Products, uses and processes
EP3636763A1 (en) 2018-10-14 2020-04-15 SNIPR Biome ApS. Products, uses & methods
EP3831947A1 (en) 2018-10-14 2021-06-09 SNIPR Biome ApS. Products, uses & methods
US11578333B2 (en) 2018-10-14 2023-02-14 Snipr Biome Aps Single-vector type I vectors
US11324838B2 (en) 2019-01-18 2022-05-10 Orthobio Therapeutics, Inc. Gene editing to improve joint function
US11033590B2 (en) 2019-01-18 2021-06-15 Orthobio Therapeutics, Inc. Gene editing to improve joint function
WO2020150633A1 (en) * 2019-01-18 2020-07-23 Orthobio Therapeutics, Inc. Gene editing to improve joint function
US11643652B2 (en) 2019-03-19 2023-05-09 The Broad Institute, Inc. Methods and compositions for prime editing nucleotide sequences
US11447770B1 (en) 2019-03-19 2022-09-20 The Broad Institute, Inc. Methods and compositions for prime editing nucleotide sequences
US11795452B2 (en) 2019-03-19 2023-10-24 The Broad Institute, Inc. Methods and compositions for prime editing nucleotide sequences
US11912985B2 (en) 2020-05-08 2024-02-27 The Broad Institute, Inc. Methods and compositions for simultaneous editing of both strands of a target double-stranded nucleotide sequence
WO2021239758A1 (en) 2020-05-27 2021-12-02 Snipr Biome Aps. Multiplex crispr/cas system for modifying cell genomes
FR3110916A1 (en) 2020-05-27 2021-12-03 Snipr Biome Aps PRODUCTS & METHODS
US11970711B2 (en) 2021-09-21 2024-04-30 The Regents Of The University Of California Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription

Also Published As

Publication number Publication date
ES2552535T3 (en) 2015-11-30
RU2687451C1 (en) 2019-05-13
AU2019201608B2 (en) 2021-12-09
US8945839B2 (en) 2015-02-03
JP7463436B2 (en) 2024-04-08
JP2021104055A (en) 2021-07-26
US20140170753A1 (en) 2014-06-19
US8771945B1 (en) 2014-07-08
WO2014093661A3 (en) 2014-08-07
WO2014093661A9 (en) 2014-10-16
US20150203872A1 (en) 2015-07-23
US20160281072A1 (en) 2016-09-29
AU2019201608A1 (en) 2019-04-04
HK1216259A1 (en) 2016-10-28
US20140227787A1 (en) 2014-08-14
JP2016500262A (en) 2016-01-12
PL2764103T3 (en) 2016-05-31
JP7090775B2 (en) 2022-06-24
CA2894688A1 (en) 2014-06-19
KR20150107739A (en) 2015-09-23
AU2016244244B2 (en) 2018-12-13
JP6545621B2 (en) 2019-07-17
AU2016244244A1 (en) 2016-11-03
JP2022113799A (en) 2022-08-04
BR112015013785A2 (en) 2017-07-11
EP2764103A2 (en) 2014-08-13
AU2013359238A1 (en) 2015-07-30
JP6870015B2 (en) 2021-05-12
RU2019112514A (en) 2019-06-13
PT2764103E (en) 2015-11-18
CN106480080A (en) 2017-03-08
US8697359B1 (en) 2014-04-15
WO2014093661A2 (en) 2014-06-19
HK1201290A1 (en) 2015-08-28
AU2013359238B2 (en) 2016-07-14
CN106480080B (en) 2020-02-28
AU2022201052A1 (en) 2022-03-10
JP2019115348A (en) 2019-07-18
EP2998400A1 (en) 2016-03-23
JP6723094B2 (en) 2020-07-15
CN106170549B (en) 2020-02-21
EP2764103B1 (en) 2015-08-19
DK2764103T3 (en) 2015-11-16
US20190153476A1 (en) 2019-05-23
CN111187772A (en) 2020-05-22
CN106170549A (en) 2016-11-30
JP2016171817A (en) 2016-09-29
US20150184139A1 (en) 2015-07-02

Similar Documents

Publication Publication Date Title
US20230340505A1 (en) Crispr-cas component systems, methods and compositions for sequence manipulation
AU2016244244B2 (en) CRISPR-Cas systems and methods for altering expression of gene products
AU2016244241B2 (en) Engineering of systems, methods and optimized guide compositions for sequence manipulation
EP2921557B1 (en) Engineering of systems, methods and optimized guide compositions for sequence manipulation
US8932814B2 (en) CRISPR-Cas nickase systems, methods and compositions for sequence manipulation in eukaryotes
US11708588B2 (en) Gene editing

Legal Events

Date Code Title Description
AS Assignment

Owner name: THE ROCKEFELLER UNIVERSITY, NEW YORK

Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNOR:MARRAFFINI, LUCIANO;REEL/FRAME:039422/0799

Effective date: 20140725

AS Assignment

Owner name: MASSACHUSETTS INSTITUTE OF TECHNOLOGY, MASSACHUSET

Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNOR:ZHANG, FENG;REEL/FRAME:043023/0768

Effective date: 20140724

Owner name: THE BROAD INSTITUTE, INC., MASSACHUSETTS

Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNOR:ZHANG, FENG;REEL/FRAME:043023/0768

Effective date: 20140724

STCB Information on status: application discontinuation

Free format text: ABANDONED -- FAILURE TO PAY ISSUE FEE