WO2022084531A1 - Methods and compositions for treating glioma - Google Patents

Abstract

The present invention relates to a method for treating glioma in a subject in need thereof comprising a step of administering the subject with a therapeutically effective amount of Junction-mediating and regulatory protein (JMY) inhibitor. Inventors have demonstrated that sublethal doses of irradiation promote the migration and invasiveness of human GSC lines using in vitro and in vivo assays. They have shown that radiation-induced migration occurs through the stabilization and nuclear accumulation of the transcription factor hypoxia-inducible factor 1 alpha (HIT la), which drives the transcription of Junction-mediating and regulatory protein (JMY). Interestingly, sub-lethal irradiation did not trigger the HIF1 a/JMY pathway or consistently enhance motility in differentiated glioma cells, suggesting that the pathway is specifically linked to cancer cells with stem-like properties. These data could thus open the way to the development of new therapeutic strategies targeting JMY to improve the efficacy of radiotherapy and prevent glioma recurrence associated with GSC migration.

Description

METHODS AND COMPOSITIONS FOR TREATING GLIOMA

FIELD OF THE INVENTION:

The invention is in field of cancer. More particularly, the invention relates to methods and composition for treating glioma.

BACKGROUND OF THE INVENTION:

Glioblastoma (GBM) is the most common and aggressive type of primary brain tumor (1). The standard GBM treatment includes surgical resection with adjuvant radiotherapy and chemotherapy (2). However, the majority of patients relapse, and only 3% to 5% survive more than three years following treatment (3). The highly infiltrative nature of GBM is thought to contribute to tumor relapse. Ionizing radiation (1 Gy - 20 Gy) has been shown to promote the migration and invasion of human glioblastoma cell lines in vitro ((4-13); for review (14)), indicating that radiation-induced migration of glioma cells may play a role in tumor relapse.

Multiple studies have shown that GBM displays intratumoral heterogeneity with a hierarchical cellular organization stemming from a minor subpopulation known as glioma stemlike cells (GSCs) (15,16). GSCs share some properties with normal neural stem cells (NSCs), including the expression of specific markers, a capacity for self-renewal and the ability to give rise to differentiated cells (17), and they are highly tumorigenic in mice (18). In addition, they differ from other cancer cells, both by their increased resistance to available cancer treatments and their higher invasion capacity (19-21). GSCs are thus thought to be one of the main causes of GBM relapse following treatment (19,22).

SUMMARY OF THE INVENTION:

The invention relates to a method for treating glioma in a subject in need thereof comprising a step of administering the subject with a therapeutically effective amount of Junction-mediating and regulatory protein (JMY) inhibitor. In particular, the invention is defined by claims.

DETAILED DESCRIPTION OF THE INVENTION:

Inventors have demonstrated that sublethal doses of irradiation promote the migration and invasiveness of human GSC lines using in vitro and in vivo assays. They show that radiation- induced migration occurs through the stabilization and nuclear accumulation of the transcription factor hypoxia-inducible factor 1 alpha (HIFla), which drives the transcription of Junctionmediating and regulatory protein (JMY) (23). Interestingly, sub-lethal irradiation did not trigger the HIF1 a/JMY pathway or consistently enhance motility in differentiated glioma cells, suggesting that the pathway is specifically linked to cancer cells with stem-like properties. These data thus open the way to the development of new therapeutic strategies targeting JMY to improve the efficacy of radiotherapy and prevent glioma recurrence associated with GSC migration.

Method for prediction a responsiveness to radiotherapy and/or chemotherapy

In a first aspect, the invention relates to a method for predicting the responsiveness to a radiotherapy and/or chemotherapy by detecting the presence or not of Junction-mediating and regulatory protein (JMY) in a subject suffering from glioma, glioblastoma or glioblastoma recurrence.

Typically, the presence of JMY is detectable by using an imagine agent and/or through any one of the following imaging techniques Planar Scintigraphy (PS) or Single Photon Emission Computed Tomography (SPECT), Positron Emission Tomography (PET), ultrasound imaging such as contrast-enhanced ultrasonography (CEUS), Magnetic Resonance Imaging (MRI) or fluorescence spectroscopy.

As used herein, the term “imaging agent” refers to a compound that can be used to detect specific biological elements (e.g., biomolecules) using imaging techniques.

Method for treating glioma

In a second aspect, the invention relates to method for treating glioma in a subject in need thereof comprising a step of administering the subject with a therapeutically effective amount of Junction-mediating and regulatory protein (JMY) inhibitor.

As used herein, the terms “treating” or “treatment” refer to both prophylactic or preventive treatment as well as curative or disease modifying treatment, including treatment of subject at risk of contracting the disease or suspected to have contracted the disease as well as subject who are ill or have been diagnosed as suffering from a disease or medical condition, and includes suppression of clinical relapse. The treatment may be administered to a subject having a medical disorder or who ultimately may acquire the disorder, in order to prevent, cure, delay the onset of, reduce the severity of, or ameliorate one or more symptoms of a disorder or recurring disorder, or in order to prolong the survival of a subject beyond that expected in the absence of such treatment. By "therapeutic regimen" is meant the pattern of treatment of an illness, e.g., the pattern of dosing used during therapy. A therapeutic regimen may include an induction regimen and a maintenance regimen. The phrase "induction regimen" or "induction period" refers to a therapeutic regimen (or the portion of a therapeutic regimen) that is used for the initial treatment of a disease. The general goal of an induction regimen is to provide a high level of drug to a subject during the initial period of a treatment regimen. An induction regimen may employ (in part or in whole) a "loading regimen", which may include administering a greater dose of the drug than a physician would employ during a maintenance regimen, administering a drug more frequently than a physician would administer the drug during a maintenance regimen, or both. The phrase "maintenance regimen" or "maintenance period" refers to a therapeutic regimen (or the portion of a therapeutic regimen) that is used for the maintenance of a subject during treatment of an illness, e.g., to keep the subject in remission for long periods of time (months or years). A maintenance regimen may employ continuous therapy (e.g., administering a drug at a regular intervals, e.g., weekly, monthly, yearly, etc.) or intermittent therapy (e.g., interrupted treatment, intermittent treatment, treatment at relapse, or treatment upon achievement of a particular predetermined criteria [e.g., pain, disease manifestation, etc.]).

As used herein, the term “glioma” refers to a third of all brain tumors in adults and about 80% of the malignant ones, and frequently carry bad prognosis due to their aggressive behavior and resistance to current treatments. They are classified according to their cell type of origin, their grade and histological features. The glioma may be a brain tumor in children and adults, such as but not limited to a glioblastoma, an oligodendroglioma, or any other tumor of glial origin.

In a particular embodiment, the glioma is glioblastoma.

As used herein, the term “Glioblastomas also known as « glioblastoma multiforme (GBM)” are the most common and malignant primary brain tumors in adults, and account for more than 50% of malignant gliomas. Since 2005, the standard therapy for this tumor includes surgery followed by radiotherapy to 60 Gy in combination with temozolomide (TMZ), allowing an improved survival (Stupp R. et al, 2005). Nevertheless, the prognosis of the patients with a GBM remains very bad, with a median survival of 14.6 months, and a 2-year survival rate of 27.2%, because of a local recurrence mainly due to resistance of the GBM cells to radiotherapy. Glioblastoma, some malignant, invasive and radio/chemoresistant brain tumors, are characterized by prompt relapse. These aggressive properties at least involve, among these heterogeneous tumors, a subpopulation of highly tumorigenic and radioresistant glioblastoma stem-like cells (GSC).

In a third aspect, the invention relates to a method for treating glioblastoma recurrence in a subject in need thereof comprising a step of administering the subject with a therapeutically effective amount of Junction-mediating and regulatory protein (JMY) inhibitor. In the context of the invention, the JMY inhibitor inhibits the JMY activity such as the cell motility under hypoxic conditions by controlling actin dynamics via its nucleation-promoting activity and allows to limit radiation-induced migration of GSCs and hence prevent tumor recurrence following radiotherapy.

As used herein, the term “glioblastoma recurrence” refers to glioblastoma which relapses after a treatment. It means that the glioblastoma does not respond to a therapeutic agent, radio therapeutic agent or chemotherapeutic agent. In a particular embodiment, the relapse is caused mainly in the glioblastoma cells with stem-like properties. As used herein, the term “stem-like properties” refers to cells which express embryonic/fetal stem cells signature. Typically, this type of glioblastoma is called as Glioblastoma Stem Cells (GSC). As used herein the term "Glioblastoma Stem Cells (GSC)" denotes a subpopulation of highly tumorigenic and radioresistant stem cells present in the brain tumor. These cells can express CD133 gene and/or a panel of other genes characteristic of neural stem cells (Nestin, A2B5, 01 ig2, Sox2, etc..) and possess the self-renewal potential (see Cheng L et al. 2010). Thus as used herein, the term "enrichment of stem cells (GSC) in glioblastoma" denotes an over-presence of GSC in glioblastoma.

In a particular embodiment, the glioblastoma is radio-resistant glioblastoma or a chemoresistant glioblastoma.

In another embodiment, the glioblastoma is resistant to treatment using chemotherapeutic compound like Tipifarnib, Temozolomide, Cilengitide (see Stupp R et al, 2014), Bevacizumab (Thomas AA et al., 2014) and EGFR inhibitors like Erlotinib, Gefitinib or Cetuximab.

As used herein, the term “subject” refers to any mammals, such as a rodent, a feline, a canine, and a primate. Particularly, in the present invention, the subject is a human afflicted with or susceptible to be afflicted with glioblastomas. In another embodiment, the subject is a human afflicted with or susceptible to be afflicted with glioblastoma recurrence as described above.

As used herein, the term “JMY” refers to Junction-mediating and regulatory protein. JMY was initially described as a transcriptional cofactor cooperating with p300/CBP to augment p53 signaling during the DNA damage response (23,50). JMY has been reported to accumulate in the nucleus after exposure to ultraviolet light, etoposide and actinomycin, promoting p53-mediated apoptosis. JMY has a role in cell motility under hypoxic conditions by controlling actin dynamics via its nucleation-promoting activity (46,47). Indeed, JMY is a potent actin nucleator and Arp2/3-activating NPF. As used herein, the term “Junction-mediating and regulatory protein (JMY) inhibitor” refers to a natural or synthetic compound that has a biological effect to inhibit the activity or the expression of JMY. More particularly, such compound is capable of inhibiting the activity.

According to the invention, the activity of JMY refers to activation of p53 -mediated apoptosis. Thus, according to the invention the JMY inhibitor is able to prevent or block the interaction of JMY with its ligand. Indeed JMY forms a co-activator complex with p300/CREB- binding protein (p300/CBP), Apoptosis-stimulating protein of p53 (ASPP) and Stress responsive activator of p53 (Strap). In some embodiments, the JMY inhibitor is able to prevent the binding of JMY with p300/CBP, ASPP, Strap, Ubiquitin Carboxyl Extension Protein 52 (UBA52), or actin.

According to the invention, the JMY inhibitor is able to internalize JMY into nucleus. In the cytoplasm, JMY forms cytoplasmic actin-containing structures that promotes actin filament assembly and. In turn, actin regulates nuclear import of JMY. JMY is thus retained in cytoplasm by binding with actin monomers.

Thus, in some embodiments, the JMY inhibitor is able to block the binding of JMY with actin.

Tests for determining the capacity of a compound to be an inhibitor of JMY are well known to the person skilled in the art. In a particular embodiment, the JMY inhibitor acts either on JMY itself or via a regulatory or interacting protein to inhibit the activity of JMY. JMY inhibitor may be determined by any competing assay well known in the art. The binding ability is reflected by the KD measurement. The term "KD", as used herein, is intended to refer to the dissociation constant, which is obtained from the ratio of Kd to Ka (i.e. Kd/Ka) and is expressed as a molar concentration (M). KD values for binding biomolecules can be determined using methods well established in the art. In specific embodiments, an JMY inhibitor that "specifically” binds to JMY is intended to refer to an inhibitor that binds to JMY or a regulatory protein with a KD of IpM or less, lOOnM or less, lOnM or less, or 3nM or less. In specific embodiments, the JMY inhibitor prevents the binding of JMY to its ligands protein. Then a competitive assay may be settled to determine the ability of the agent to inhibit the biological activity of JMY.

In a particular embodiment, the JMY inhibitor is a peptide, petptidomimetic, small organic molecule, antibody, aptamers, siRNA or antisense oligonucleotide. The term “peptidomimetic” refers to a small protein-like chain designed to mimic a peptide. In a particular embodiment, the inhibitor of JMY is an aptamer. Aptamers are a class of molecule that represents an alternative to antibodies in term of molecular recognition. Aptamers are oligonucleotide or oligopeptide sequences with the capacity to recognize virtually any class of target molecules with high affinity and specificity.

In a particular embodiment, the JMY inhibitor is a small organic molecule. The term “small organic molecule” refers to a molecule of a size comparable to those organic molecules generally used in pharmaceuticals. The term excludes biological macromolecules (e.g., proteins, nucleic acids, etc.). Preferred small organic molecules range in size up to about 5000 Da, more preferably up to 2000 Da, and most preferably up to about 1000 Da.

In some embodiments, the JMY inhibitor is an antibody. As used herein, the term “antibody” is used in the broadest sense and specifically covers monoclonal antibodies, polyclonal antibodies, multispecific antibodies (e.g. bispecific antibodies) formed from at least two intact antibodies, and antibody fragments so long as they exhibit the desired biological activity. The term includes antibody fragments that comprise an antigen binding domain such as Fab', Fab, F(ab')2, single domain antibodies (DABs), TandAbs dimer, Fv, scFv (single chain Fv), dsFv, ds-scFv, Fd, linear antibodies, minibodies, diabodies, bispecific antibody fragments, bibody, tribody (scFv-Fab fusions, bispecific or trispecific, respectively); sc-diabody; kappa(lamda) bodies (scFv-CL fusions); BiTE (Bispecific T-cell Engager, scFv-scFv tandems to attract T cells); DVD-Ig (dual variable domain antibody, bispecific format); SIP (small immunoprotein, a kind of minibody); SMIP ("small modular immunopharmaceutical" scFv-Fc dimer; DART (ds-stabilized diabody "Dual Affinity ReTargeting"); small antibody mimetics comprising one or more CDRs and the like. The techniques for preparing and using various antibody -based constructs and fragments are well known in the art (see Kabat et al., 1991, specifically incorporated herein by reference). Diabodies, in particular, are further described in EP 404, 097 and WO 93/1 1 161; whereas linear antibodies are further described in Zapata et al. (1995). Antibodies can be fragmented using conventional techniques. For example, F(ab')2 fragments can be generated by treating the antibody with pepsin. The resulting F(ab')2 fragment can be treated to reduce disulfide bridges to produce Fab' fragments. Papain digestion can lead to the formation of Fab fragments. Fab, Fab' and F(ab')2, scFv, Fv, dsFv, Fd, dAbs, TandAbs, ds-scFv, dimers, minibodies, diabodies, bispecific antibody fragments and other fragments can also be synthesized by recombinant techniques or can be chemically synthesized. Techniques for producing antibody fragments are well known and described in the art. For example, each of Beckman et al., 2006; Holliger & Hudson, 2005; Le Gall et al., 2004; Reff & Heard, 2001 ; Reiter et al., 1996; and Young et al., 1995 further describe and enable the production of effective antibody fragments. In some embodiments, the antibody is a “chimeric” antibody as described in U.S. Pat. No. 4,816,567. In some embodiments, the antibody is a humanized antibody, such as described U.S. Pat. Nos. 6,982,321 and 7,087,409. In some embodiments, the antibody is a human antibody. A “human antibody” such as described in US 6,075,181 and 6,150,584. In some embodiments, the antibody is a single domain antibody such as described in EP 0368 684, WO 06/030220 and WO 06/003388. In a particular embodiment, the inhibitor is a monoclonal antibody. Monoclonal antibodies can be prepared and isolated using any technique that provides for the production of antibody molecules by continuous cell lines in culture. Techniques for production and isolation include but are not limited to the hybridoma technique, the human B- cell hybridoma technique and the EBV-hybridoma technique.

In a particular, the JMY inhibitor is an intrabody having specificity for JMY. As used herein, the term "intrabody" generally refer to an intracellular antibody or antibody fragment. Antibodies, in particular single chain variable antibody fragments (scFv), can be modified for intracellular localization. Such modification may entail for example, the fusion to a stable intracellular protein, such as, e.g., maltose binding protein, or the addition of intracellular trafficking/localization peptide sequences, such as, e.g., the endoplasmic reticulum retention. In some embodiments, the intrabody is a single domain antibody. In some embodiments, the antibody according to the invention is a single domain antibody. The term “single domain antibody” (sdAb) or "VHH" refers to the single heavy chain variable domain of antibodies of the type that can be found in Camelid mammals which are naturally devoid of light chains. Such VHH are also called “nanobody®”. According to the invention, sdAb can particularly be llama sdAb.

In some embodiments, the JMY inhibitor is a short hairpin RNA (shRNA), a small interfering RNA (siRNA) or an antisense oligonucleotide which inhibits the expression of USP14. In a particular embodiment, the inhibitor of JMY expression is siRNA. A short hairpin RNA (shRNA) is a sequence of RNA that makes a tight hairpin turn that can be used to silence gene expression via RNA interference. shRNA is generally expressed using a vector introduced into cells, wherein the vector utilizes the U6 promoter to ensure that the shRNA is always expressed. This vector is usually passed on to daughter cells, allowing the gene silencing to be inherited. The shRNA hairpin structure is cleaved by the cellular machinery into siRNA, which is then bound to the RNA-induced silencing complex (RISC). This complex binds to and cleaves mRNAs that match the siRNA to which it is bound. Small interfering RNA (siRNA), sometimes known as short interfering RNA or silencing RNA, are a class of 20-25 nucleotide- long double- stranded RNA molecules that play a variety of roles in biology. Most notably, siRNA is involved in the RNA interference (RNAi) pathway whereby the siRNA interferes with the expression of a specific gene. Anti-sense oligonucleotides include anti-sense RNA molecules and anti-sense DNA molecules, would act to directly block the translation of the targeted mRNA by binding thereto and thus preventing protein translation or increasing mRNA degradation, thus decreasing the level of the targeted protein, and thus activity, in a cell. For example, antisense oligonucleotides of at least about 15 bases and complementary to unique regions of the mRNA transcript sequence can be synthesized, e.g., by conventional phosphodiester techniques. Methods for using antisense techniques for specifically inhibiting gene expression of genes whose sequence is known are well known in the art (e.g. see U.S. Pat. Nos. 6,566,135; 6,566,131; 6,365,354; 6,410,323; 6,107,091; 6,046,321; and 5,981,732). Antisense oligonucleotides, siRNAs, shRNAs of the invention may be delivered in vivo alone or in association with a vector. In its broadest sense, a "vector" is any vehicle capable of facilitating the transfer of the antisense oligonucleotide, siRNA, shRNA or ribozyme nucleic acid to the cells and typically mast cells. Typically, the vector transports the nucleic acid to cells with reduced degradation relative to the extent of degradation that would result in the absence of the vector. In general, the vectors useful in the invention include, but are not limited to, plasmids, phagemids, viruses, other vehicles derived from viral or bacterial sources that have been manipulated by the insertion or incorporation of the antisense oligonucleotide, siRNA, shRNA or ribozyme nucleic acid sequences. Viral vectors are a preferred type of vector and include, but are not limited to nucleic acid sequences from the following viruses: retrovirus, such as moloney murine leukemia virus, harvey murine sarcoma virus, murine mammary tumor virus, and rous sarcoma virus; adenovirus, adeno-associated virus; S V40-type viruses; polyoma viruses; Epstein-Barr viruses; papilloma viruses; herpes virus; vaccinia virus; polio virus; and RNA virus such as a retrovirus. One can readily employ other vectors not named but known to the art.

In some embodiments, the inhibitor of JMY expression is an endonuclease. In the last few years, staggering advances in sequencing technologies have provided an unprecedentedly detailed overview of the multiple genetic aberrations in cancer. By considerably expanding the list of new potential oncogenes and tumor suppressor genes, these new data strongly emphasize the need of fast and reliable strategies to characterize the normal and pathological function of these genes and assess their role, in particular as driving factors during oncogenesis. As an alternative to more conventional approaches, such as cDNA overexpression or downregulation by RNA interference, the new technologies provide the means to recreate the actual mutations observed in cancer through direct manipulation of the genome. Indeed, natural and engineered nuclease enzymes have attracted considerable attention in the recent years. The mechanism behind endonuclease-based genome inactivating generally requires a first step of DNA single or double strand break, which can then trigger two distinct cellular mechanisms for DNA repair, which can be exploited for DNA inactivating: the errorprone nonhomologous end-joining (NHEJ) and the high-fidelity homology-directed repair (HDR).

In a particular embodiment, the endonuclease is CRISPR-cas. As used herein, the term “CRISPR-cas” has its general meaning in the art and refers to clustered regularly interspaced short palindromic repeats associated which are the segments of prokaryotic DNA containing short repetitions of base sequences.

In some embodiment, the endonuclease is CRISPR-cas9 which is from Streptococcus pyogenes. The CRISPR/Cas9 system has been described in US 8697359 Bl and US 2014/0068797. Originally an adaptive immune system in prokaryotes (Barrangou and Marraffini, 2014), CRISPR has been recently engineered into a new powerful tool for genome editing. It has already been successfully used to target important genes in many cell lines and organisms, including human (Mali et al., 2013, Science, Vol. 339 : 823-826), bacteria (Fabre et al., 2014, PLoS Negl. Trop. Dis., Vol. 8:e2671.), zebrafish (Hwang et al., 2013, PLoS One, Vol. 8:e68708.), C. elegans (Hai et al., 2014 Cell Res. doi: 10.1038/cr.2014.11.), bacteria (Fabre et al., 2014, PLoS Negl. Trop. Dis., Vol. 8:e2671.), plants (Mali et al., 2013, Science, Vol. 339 : 823-826), Xenopus tropicalis (Guo et al., 2014, Development, Vol. 141 : 707-714.), yeast (DiCarlo et al., 2013, Nucleic Acids Res., Vol. 41 : 4336-4343.), Drosophila (Gratz et al., 2014 Genetics, doi: 10.1534/genetics.H3.160713), monkeys (Niu et al., 2014, Cell, Vol. 156 : 836- 843.), rabbits (Yang et al., 2014, J. Mol. Cell Biol., Vol. 6 : 97-99.), pigs (Hai et al., 2014, Cell Res. doi: 10.1038/cr.2014.11.), rats (Ma et al., 2014, Cell Res., Vol. 24 : 122-125.) and mice (Mashiko et al., 2014, Dev. Growth Differ. Vol. 56 : 122-129.). Several groups have now taken advantage of this method to introduce single point mutations (deletions or insertions) in a particular target gene, via a single gRNA. Using a pair of gRNA-directed Cas9 nucleases instead, it is also possible to induce large deletions or genomic rearrangements, such as inversions or translocations. A recent exciting development is the use of the dCas9 version of the CRISPR/Cas9 system to target protein domains for transcriptional regulation, epigenetic modification, and microscopic visualization of specific genome loci.

In some embodiment, the endonuclease is CRISPR-Cpfl which is the more recently characterized CRISPR from Provotella and Francisella 1 (Cpfl) in Zetsche et al. (“Cpfl is a Single RNA-guided Endonuclease of a Class 2 CRISPR-Cas System (2015); Cell; 163, 1-13).

Combined preparation In a forth aspect, the invention relates to i) a JMY inhibitor and ii) a classical treatment as a combined preparation for use by simultaneous, separate or sequential administration in the prevention and/or treatment of glioblastomas and/or glioblastomas recurrence in a subject in need thereof.

As used herein, the terms “combined treatment”, “combined therapy” or “therapy combination” refer to a treatment that uses more than one medication.

As used herein, the term “administration simultaneously” refers to administration of 2 active ingredients by the same route and at the same time or at substantially the same time. The term “administration separately” refers to an administration of 2 active ingredients at the same time or at substantially the same time by different routes. The term “administration sequentially” refers to an administration of 2 active ingredients at different times, the administration route being identical or different.

As used herein, the term “classical treatment” refers to treatments well known in the art and used to treat cancer. In the context of the invention, the classical treatment refers to targeted therapy, radiation therapy, immunotherapy or chemotherapy. Typically, the physician could choose to administer the subject with the JMY inhibitor and as a combined preparation with radiation therapy, targeted therapy, immunotherapy, or chemotherapy, simultaneously, separately or sequentially.

As used herein, the term “administration simultaneously” refers to administration of 2 active ingredients by the same route and at the same time or at substantially the same time. The term “administration separately” refers to an administration of 2 active ingredients at the same time or at substantially the same time by different routes. The term “administration sequentially” refers to an administration of 2 active ingredients at different times, the administration route being identical or different.

In a particular embodiment, the invention relates to i) a JMY inhibitor according to the invention and ii) a radiation therapy used as a combined preparation for use in the prevention and/or treatment of glioblastoma in a subject in need thereof.

Typically, the JMY inhibitor is administered with a radiotherapeutic agent simultaneously, separately or sequentially, as a combined preparation.

The term "radiotherapeutic agent" as used herein, is intended to refer to any radiotherapeutic agent known to one of skill in the art to be effective to treat or ameliorate cancer, without limitation. For instance, the radiotherapeutic agent can be an agent such as those administered in brachytherapy or radionuclide therapy. Such methods can optionally further comprise the administration of one or more additional cancer therapies, such as, but not limited to, chemotherapies, and/or another radiotherapy. As used herein, the term “radiation therapy” or “radiotherapy” have their general meaning in the art and refers the treatment of cancer with ionizing radiation. Ionizing radiation deposits energy that injures or destroys cells in the area being treated (the target tissue) by damaging their genetic material, making it impossible for these cells to continue to grow. One type of radiation therapy commonly used involves photons, e.g. X-rays. Depending on the amount of energy they possess, the rays can be used to destroy cancer cells on the surface of or deeper in the body. The higher the energy of the x-ray beam, the deeper the x-rays can go into the target tissue. Linear accelerators and betatrons produce x- rays of increasingly greater energy. The use of machines to focus radiation (such as x-rays) on a cancer site is called external beam radiation therapy. Gamma rays are another form of photons used in radiation therapy. Gamma rays are produced spontaneously as certain elements (such as radium, uranium, and cobalt 60) release radiation as they decompose, or decay. In some embodiments, the radiation therapy is external radiation therapy. Examples of external radiation therapy include, but are not limited to, conventional external beam radiation therapy; three- dimensional conformal radiation therapy (3D-CRT), which delivers shaped beams to closely fit the shape of a tumor from different directions; intensity modulated radiation therapy (IMRT), e.g., helical tomotherapy, which shapes the radiation beams to closely fit the shape of a tumor and also alters the radiation dose according to the shape of the tumor; conformal proton beam radiation therapy; image-guided radiation therapy (IGRT), which combines scanning and radiation technologies to provide real time images of a tumor to guide the radiation treatment; intraoperative radiation therapy (IORT), which delivers radiation directly to a tumor during surgery; stereotactic radiosurgery, which delivers a large, precise radiation dose to a small tumor area in a single session; hyperfractionated radiation therapy, e.g., continuous hyperfractionated accelerated radiation therapy (CHART), in which more than one treatment (fraction) of radiation therapy are given to a subject per day; and hypofractionated radiation therapy, in which larger doses of radiation therapy per fraction is given but fewer fractions.

In another embodiment, the invention relates to i) a JMY inhibitor according to the invention and ii) a chemotherapeutic agent used as a combined preparation for use in the prevention and/or treatment of glioblastoma in a subject in need thereof.

Typically, the JMY inhibitor is administered with a chemotherapeutic agent simultaneously, separately or sequentially, as a combined preparation. The term "chemotherapeutic agent" refers to chemical compounds that are effective in inhibiting tumor growth. Examples of chemotherapeutic agents include alkylating agents such as thiotepa and cyclosphosphamide; alkyl sulfonates such as busulfan, improsulfan and piposulfan; aziridines such as benzodopa, carboquone, meturedopa, and uredopa; ethylenimines and methylamelamines including altretamine, triethylenemelamine, trietylenephosphoramide, triethylenethiophosphaoramide and trimethylolomelamine; acetogenins (especially bullatacin and bullatacinone); a carnptothecin (including the synthetic analogue topotecan); bryostatin; cally statin; CC-1065 (including its adozelesin, carzelesin and bizelesin synthetic analogues); cryptophycins (particularly cryptophycin 1 and cryptophycin 8); dolastatin; duocarmycin (including the synthetic analogues, KW-2189 and CBI-TMI); eleutherobin; pancrati statin; a sarcodictyin; spongistatin; nitrogen mustards such as chlorambucil, chlornaphazine, cholophosphamide, estramustine, ifosfamide, mechlorethamine, mechlorethamine oxide hydrochloride, melphalan, novembichin, phenesterine, prednimus tine, trofosfamide, uracil mustard; nitrosureas such as carmustine, chlorozotocin, fotemustine, lomustine, nimustine, ranimustine; antibiotics such as the enediyne antibiotics (e.g. calicheamicin, especially calicheamicin (11 and calicheamicin 211, see, e.g., Agnew Chem Inti. Ed. Engl. 33: 183-186 (1994); dynemicin, including dynemicin A; an esperamicin; as well as neocarzinostatin chromophore and related chromoprotein enediyne antiobiotic chromomophores), aclacinomysins, actinomycin, authramycin, azaserine, bleomycins, cactinomycin, carabicin, canninomycin, carzinophilin, chromomycins, dactinomycin, daunorubicin, detorubicin, 6- diazo-5-oxo-L-norleucine, doxorubicin (including morpholino-doxorubicin, cyanomorpholinodoxorubicin, 2-pyrrolino-doxorubicin and deoxydoxorubicin), epirubicin, esorubicin, idanrbicin, marcellomycin, mitomycins, mycophenolic acid, nogalamycin, olivomycins, peplomycin, potfiromycin, puromycin, quelamycin, rodorubicin, streptomgrin, streptozocin, tubercidin, ubenimex, zinostatin, zorubicin; anti-metabolites such as methotrexate and 5- fluorouracil (5-FU); folic acid analogues such as denopterin, methotrexate, pteropterin, trimetrexate; purine analogs such as fludarabine, 6-mercaptopurine, thiamiprine, thioguanine; pyrimidine analogs such as ancitabine, azacitidine, 6-azauridine, carmofur, cytarabine, dideoxyuridine, doxifluridine, enocitabine, floxuridine, 5-FU; androgens such as calusterone, dromostanolone propionate, epitiostanol, mepitiostane, testolactone; anti-adrenals such as aminoglutethimide, mitotane, trilostane; folic acid replenisher such as frolinic acid; aceglatone; aldophospharnide glycoside; aminolevulinic acid; amsacrine; bestrabucil; bisantrene; edatraxate; defofamine; demecolcine; diaziquone; elfornithine; elliptinium acetate; an epothilone; etoglucid; gallium nitrate; hydroxyurea; lentinan; lonidamine; maytansinoids such as maytansine and ansamitocins; mitoguazone; mitoxantrone; mopidamol; nitracrine; pento statin; phenamet; pirarubicin; podophyllinic acid; 2-ethylhydrazide; procarbazine; PSK®; razoxane; rhizoxin; sizofiran; spirogennanium; tenuazonic acid; triaziquone; 2,2',2"- trichlorotriethylamine; trichothecenes (especially T-2 toxin, verracurin A, roridinA and anguidine); urethan; vindesine; dacarbazine; mannomustine; mitobromtol; mitolactol; pipobroman; gacytosine; arabinoside ("Ara-C"); cyclophosphamide; thiotepa; taxoids, e.g. paclitaxel (TAXOL®, Bristol-Myers Squibb Oncology, Princeton, N.].) and doxetaxel (TAXOTERE®, Rhone-Poulenc Rorer, Antony, France); chlorambucil; gemcitabine; 6- thioguanine; mercaptopurine; methotrexate; platinum analogs such as cisplatin and carboplatin; vinblastine; platinum; etoposide (VP- 16); ifosfamide; mitomycin C; mitoxantrone; vincristine; vinorelbine; navelbine; novantrone; teniposide; daunomycin; aminopterin; xeloda; ibandronate; CPT-1 1 ; topoisomerase inhibitor RFS 2000; difluoromethylomithine (DMFO); retinoic acid; capecitabine; and phannaceutically acceptable salts, acids or derivatives of any of the above. Also included in this definition are antihormonal agents that act to regulate or inhibit honnone action on tumors such as anti-estrogens including for example tamoxifen, raloxifene, aromatase inhibiting 4(5)-imidazoles, 4-hydroxytamoxifen, trioxifene, keoxifene, LY117018, onapristone, and toremifene (Fareston); and anti-androgens such as flutamide, nilutamide, bicalutamide, leuprolide, and goserelin; and phannaceutically acceptable salts, acids or derivatives of any of the above.

In another embodiment, the invention relates to i) a JMY inhibitor according to the invention and ii) an immune check point inhibitor used as a combined preparation for use in the prevention and/or treatment of glioblastoma in a subject in need thereof.

Typically, the JMY inhibitor is administered with an immune checkpoint inhibitor simultaneously, separately or sequentially, as a combined preparation. As used herein, the term "immune checkpoint inhibitor" refers to molecules that totally or partially reduce, inhibit, interfere with or modulate one or more immune checkpoint proteins. As used herein, the term "immune checkpoint protein" has its general meaning in the art and refers to a molecule that is expressed by T cells in that either turn up a signal (stimulatory checkpoint molecules) or turn down a signal (inhibitory checkpoint molecules). Immune checkpoint molecules are recognized in the art to constitute immune checkpoint pathways similar to the CTLA-4 and PD-1 dependent pathways (see e.g. Pardoll, 2012. Nature Rev Cancer 12:252-264; Mellman et al. , 2011. Nature 480:480- 489). Examples of stimulatory checkpoint include CD27 CD28 CD40, CD122, CD137, 0X40, GITR, and ICOS. Examples of inhibitory checkpoint molecules include A2AR, B7-H3, B7-H4, BTLA, CTLA-4, CD277, IDO, KIR, PD-1, LAG-3, TIM-3 and VISTA. The Adenosine A2A receptor (A2AR) is regarded as an important checkpoint in cancer therapy because adenosine in the immune microenvironment, leading to the activation of the A2a receptor, is negative immune feedback loop and the tumor microenvironment has relatively high concentrations of adenosine. B7-H3, also called CD276, was originally understood to be a co-stimulatory molecule but is now regarded as co-inhibitory. B7-H4, also called VTCN1, is expressed by tumor cells and tumor-associated macrophages and plays a role in tumour escape. B and T Lymphocyte Attenuator (BTLA) and also called CD272, has HVEM (Herpesvirus Entry Mediator) as its ligand. Surface expression of BTLA is gradually downregulated during differentiation of human CD8+ T cells from the naive to effector cell phenotype, however tumor-specific human CD8+ T cells express high levels of BTLA. CTLA-4, Cytotoxic T- Lymphocyte- Associated protein 4 and also called CD 152. Expression of CTLA-4 on Treg cells serves to control T cell proliferation. IDO, Indoleamine 2,3-dioxygenase, is a tryptophan catabolic enzyme, a related immune-inhibitory enzyme. Another important molecule is TDO, tryptophan 2,3-dioxygenase. IDO is known to suppress T and NK cells, generate and activate Tregs and myeloid-derived suppressor cells, and promote tumour angiogenesis. KIR, Killercell Immunoglobulin-like Receptor, is a receptor for MHC Class I molecules on Natural Killer cells. LAG3, Lymphocyte Activation Gene-3, works to suppress an immune response by action to Tregs as well as direct effects on CD8+ T cells. PD-1, Programmed Death 1 (PD-1) receptor, has two ligands, PD-L1 and PD-L2. This checkpoint is the target of Merck & Co.'s melanoma drug Keytruda, which gained FDA approval in September 2014. An advantage of targeting PD- 1 is that it can restore immune function in the tumor microenvironment. TIM-3, short for T-cell Immunoglobulin domain and Mucin domain 3, expresses on activated human CD4+ T cells and regulates Thl and Thl7 cytokines. TIM-3 acts as a negative regulator of Thl/Tcl function by triggering cell death upon interaction with its ligand, galectin-9. VISTA, Short for V-domain Ig suppressor of T cell activation, VISTA is primarily expressed on hematopoietic cells so that consistent expression of VISTA on leukocytes within tumors may allow VISTA blockade to be effective across a broad range of solid tumors. Tumor cells often take advantage of these checkpoints to escape detection by the immune system. Thus, inhibiting a checkpoint protein on the immune system may enhance the anti -turn or T-cell response.

In some embodiments, an immune checkpoint inhibitor refers to any compound inhibiting the function of an immune checkpoint protein. Inhibition includes reduction of function and full blockade. In some embodiments, the immune checkpoint inhibitor could be an antibody, synthetic or native sequence peptides, small molecules or aptamers which bind to the immune checkpoint proteins and their ligands.

In a particular embodiment, the immune checkpoint inhibitor is an antibody. Typically, antibodies are directed against A2AR, B7-H3, B7-H4, BTLA, CTLA-4, CD277, IDO, KIR, PD-1, LAG-3, TIM-3 or VISTA.

In a particular embodiment, the immune checkpoint inhibitor is an anti -PD-1 antibody such as described in WO2011082400, W02006121168, W02015035606, W02004056875, W02010036959, W02009114335, W02010089411, WO2008156712, WO2011110621, WO2014055648 and WO2014194302. Examples of anti-PD-1 antibodies which are commercialized: Nivolumab (Opdivo®, BMS), Pembrolizumab (also called Lambrolizumab, KEYTRUDA® or MK-3475, MERCK).

In some embodiments, the immune checkpoint inhibitor is an anti-PD-Ll antibody such as described in WO2013079174, W02010077634, W02004004771, WO2014195852, W02010036959, WO2011066389, W02007005874, W02015048520, US8617546 and WO2014055897. Examples of anti-PD-Ll antibodies which are on clinical trial: Atezolizumab (MPDL3280A, Genentech/Roche), Durvalumab (AZD9291, AstraZeneca), Avelumab (also known as MSB0010718C, Merck) and BMS-936559 (BMS).

In some embodiments, the immune checkpoint inhibitor is an anti-PD-L2 antibody such as described in US7709214, US7432059 and US8552154.

In the context of the invention, the immune checkpoint inhibitor inhibits Tim-3 or its ligand.

In a particular embodiment, the immune checkpoint inhibitor is an anti-Tim-3 antibody such as described in WO03063792, WO2011155607, WO2015117002, WO2010117057 and W02013006490.

In some embodiments, the immune checkpoint inhibitor is a small organic molecule.

The term "small organic molecule" as used herein, refers to a molecule of a size comparable to those organic molecules generally used in pharmaceuticals. The term excludes biological macro molecules (e. g. proteins, nucleic acids, etc.). Typically, small organic molecules range in size up to about 5000 Da, more preferably up to 2000 Da, and most preferably up to about 1000 Da.

Typically, the small organic molecules interfere with transduction pathway of A2AR, B7-H3, B7-H4, BTLA, CTLA-4, CD277, IDO, KIR, PD-1, LAG-3, TIM-3 or VISTA.

In a particular embodiment, small organic molecules interfere with transduction pathway of PD-1 and Tim-3. For example, they can interfere with molecules, receptors or enzymes involved in PD-1 and Tim-3 pathway.

In a particular embodiment, the small organic molecules interfere with Indoleamine- pyrrole 2,3-dioxygenase (IDO) inhibitor. IDO is involved in the tryptophan catabolism (Liu et al 2010, Vacchelli et al 2014, Zhai et al 2015). Examples of IDO inhibitors are described in WO 2014150677. Examples of IDO inhibitors include without limitation 1-methyl-tryptophan (IMT), P- (3-benzofuranyl)-alanine, P-(3-benzo(b)thienyl)-alanine), 6-nitro-tryptophan, 6- fluoro-tryptophan, 4-methyl-tryptophan, 5 -methyl tryptophan, 6-methyl-tryptophan, 5- methoxy -tryptophan, 5 -hydroxy -tryptophan, indole 3 -carbinol, 3,3'- diindolylmethane, epigallocatechin gallate, 5-Br-4-Cl-indoxyl 1,3-diacetate, 9- vinylcarbazole, acemetacin, 5- bromo-tryptophan, 5 -bromoindoxyl diacetate, 3- Amino-naphtoic acid, pyrrolidine dithiocarbamate, 4-phenylimidazole a brassinin derivative, a thiohydantoin derivative, a P- carboline derivative or a brassilexin derivative. In a particular embodiment, the IDO inhibitor is selected from 1-methyl-tryptophan, P-(3- benzofuranyl)-alanine, 6-nitro-L-tryptophan, 3- Amino-naphtoic acid and P-[3- benzo(b)thienyl] -alanine or a derivative or prodrug thereof.

In a particular embodiment, the inhibitor of IDO is Epacadostat, (INCB24360, INCB024360) has the following chemical formula in the art and refers to -N-(3-bromo-4- fluorophenyl)-N'-hydroxy-4-{[2-(sulfamoylamino)-ethyl]amino}-l,2,5-oxadiazole-3 carboximidamide :

In a particular embodiment, the inhibitor is BGB324, also called R428, such as described in W02009054864, refers to lH-l,2,4-Triazole-3,5-diamine, l-(6,7-dihydro-5H- benzo[6,7]cyclohepta[l,2-c]pyridazin-3-yl)-N3-[(7S)-6,7,8,9-tetrahydro-7-(l-pyrrolidinyl)- 5H-benzocyclohepten-2-yl]- and has the following formula in the art:

In a particular embodiment, the inhibitor is CA-170 (or AUPM-170): an oral, small molecule immune checkpoint antagonist targeting programmed death ligand-1 (PD-L1) and V- domain Ig suppressor of T cell activation (VISTA) (Liu et al 2015). Preclinical data of CA-170 are presented by Curis Collaborator and Aurigene on November at ACR-NCI-EORTC International Conference on Molecular Targets and Cancer Therapeutics.

In some embodiments, the immune checkpoint inhibitor is an aptamer.

Typically, the aptamers are directed against A2AR, B7-H3, B7-H4, BTLA, CTLA-4, CD277, IDO, KIR, PD-1, LAG-3, TIM-3 or VISTA.

In a particular embodiment, aptamers are DNA aptamers such as described in Prodeus et al 2015. A major disadvantage of aptamers as therapeutic entities is their poor pharmacokinetic profiles, as these short DNA strands are rapidly removed from circulation due to renal filtration. Thus, aptamers according to the invention are conjugated to with high molecular weight polymers such as polyethylene glycol (PEG). In a particular embodiment, the aptamer is an anti -PD-1 aptamer. Particularly, the anti -PD-1 aptamer is MP7 pegylated as described in Prodeus et al 2015.

As used herein the terms "administering" or "administration" refer to the act of injecting or otherwise physically delivering a substance as it exists outside the body (e.g., an inhibitor of JMY) into the subject, such as by, intravenous, intramuscular, enteral, subcutaneous, parenteral, systemic, local, spinal, nasal, topical or epidermal administration (e.g., by injection or infusion). When a disease, or a symptom thereof, is being treated, administration of the substance typically occurs after the onset of the disease or symptoms thereof. When a disease or symptoms thereof, are being prevented, administration of the substance typically occurs before the onset of the disease or symptoms thereof. In a particular embodiment, the JMY inhibitor is administered by intrathecal administration. As used herein, the terms “intrathecal administration” or “intrathecal injection” refer to an injection into the spinal canal (intrathecal space surrounding the spinal cord). Various techniques may be used including, without limitation, lateral cerebroventricular injection through a burrhole or cisternal or lumbar puncture or the like.

A “therapeutically effective amount” is intended for a minimal amount of active agent which is necessary to impart therapeutic benefit to a subject. For example, a "therapeutically effective amount" to a subject is such an amount which induces, ameliorates or otherwise causes an improvement in the pathological symptoms, disease progression or physiological conditions associated with or resistance to succumbing to a disorder. It will be understood that the total daily usage of the compounds of the present invention will be decided by the attending physician within the scope of sound medical judgment. The specific therapeutically effective dose level for any particular subject will depend upon a variety of factors including the disorder being treated and the severity of the disorder; activity of the specific compound employed; the specific composition employed, the age, body weight, general health, sex and diet of the subject; the time of administration, route of administration, and rate of excretion of the specific compound employed; the duration of the treatment; drugs used in combination or coincidential with the specific compound employed; and like factors well known in the medical arts. For example, it is well within the skill of the art to start doses of the compound at levels lower than those required to achieve the desired therapeutic effect and to gradually increase the dosage until the desired effect is achieved. However, the daily dosage of the products may be varied over a wide range from 0.01 to 1,000 mg per adult per day. Typically, the compositions contain 0.01, 0.05, 0.1, 0.5, 1.0, 2.5, 5.0, 10.0, 15.0, 25.0, 50.0, 100, 250 and 500 mg of the active ingredient for the symptomatic adjustment of the dosage to the subject to be treated. A medicament typically contains from about 0.01 mg to about 500 mg of the active ingredient, preferably from 1 mg to about 100 mg of the active ingredient. An effective amount of the drug is ordinarily supplied at a dosage level from 0.0002 mg/kg to about 20 mg/kg of body weight per day, especially from about 0.001 mg/kg to 7 mg/kg of body weight per day.

Pharmaceutical composition

In another aspect, the invention relates to a pharmaceutical composition for use in the treatment of glioblastomas.

In a particular embodiment, the invention relates to a pharmaceutical composition for use in the treatment of glioblastomas recurrence.

In a particular embodiment, the pharmaceutical composition according to the invention comprises a JMY inhibitor.

In a particular embodiment, the pharmaceutical composition according to the invention comprising i) a JMY inhibitor and ii) a classical treatment (chemotherapy, radiation therapy, targeted therapy etc as described above) for use by simultaneous, separate or sequential administration in the prevention and/or treatment of glioblastomas and/or glioblastomas recurrence in a subject in need thereof.

The JMY inhibitors as described above may be combined with pharmaceutically acceptable excipients, and optionally sustained-release matrices, such as biodegradable polymers, to form pharmaceutical compositions.

"Pharmaceutically" or "pharmaceutically acceptable" refer to molecular entities and compositions that do not produce an adverse, allergic or other untoward reaction when administered to a mammal, especially a human, as appropriate. A pharmaceutically acceptable carrier or excipient refers to a non-toxic solid, semi-solid or liquid filler, diluent, encapsulating material or formulation auxiliary of any type. The pharmaceutical compositions of the present invention for oral, sublingual, subcutaneous, intramuscular, intravenous, transdermal, local or rectal administration, the active principle, alone or in combination with another active principle, can be administered in a unit administration form, as a mixture with conventional pharmaceutical supports, to animals and human beings. Suitable unit administration forms comprise oral-route forms such as tablets, gel capsules, powders, granules and oral suspensions or solutions, sublingual and buccal administration forms, aerosols, implants, subcutaneous, transdermal, topical, intraperitoneal, intramuscular, intravenous, subdermal, transdermal, intrathecal and intranasal administration forms and rectal administration forms. Typically, the pharmaceutical compositions contain vehicles which are pharmaceutically acceptable for a formulation capable of being injected. These may be in particular isotonic, sterile, saline solutions (monosodium or disodium phosphate, sodium, potassium, calcium or magnesium chloride and the like or mixtures of such salts), or dry, especially freeze-dried compositions which upon addition, depending on the case, of sterilized water or physiological saline, permit the constitution of injectable solutions. The pharmaceutical forms suitable for injectable use include sterile aqueous solutions or dispersions; formulations including sesame oil, peanut oil or aqueous propylene glycol; and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersions. In all cases, the form must be sterile and must be fluid to the extent that easy syringability exists. It must be stable under the conditions of manufacture and storage and must be preserved against the contaminating action of microorganisms, such as bacteria and fungi. Solutions comprising compounds of the invention as free base or pharmacologically acceptable salts can be prepared in water suitably mixed with a surfactant, such as hydroxypropylcellulose. Dispersions can also be prepared in glycerol, liquid polyethylene glycols, and mixtures thereof and in oils. Under ordinary conditions of storage and use, these preparations contain a preservative to prevent the growth of microorganisms. The polypeptide (or nucleic acid encoding thereof) can be formulated into a composition in a neutral or salt form. Pharmaceutically acceptable salts include the acid addition salts (formed with the free amino groups of the protein) and which are formed with inorganic acids such as, for example, hydrochloric or phosphoric acids, or such organic acids as acetic, oxalic, tartaric, mandelic, and the like. Salts formed with the free carboxyl groups can also be derived from inorganic bases such as, for example, sodium, potassium, ammonium, calcium, or ferric hydroxides, and such organic bases as isopropylamine, trimethylamine, histidine, procaine and the like. The carrier can also be a solvent or dispersion medium containing, for example, water, ethanol, polyol (for example, glycerol, propylene glycol, and liquid polyethylene glycol, and the like), suitable mixtures thereof, and vegetables oils. The proper fluidity can be maintained, for example, by the use of a coating, such as lecithin, by the maintenance of the required particle size in the case of dispersion and by the use of surfactants. The prevention of the action of microorganisms can be brought about by various antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol, sorbic acid, thimerosal, and the like. In many cases, it will be preferable to include isotonic agents, for example, sugars or sodium chloride. Prolonged absorption of the injectable compositions can be brought about by the use in the compositions of agents delaying absorption, for example, aluminium monostearate and gelatin. Sterile injectable solutions are prepared by incorporating the active polypeptides in the required amount in the appropriate solvent with several of the other ingredients enumerated above, as required, followed by filtered sterilization. Generally, dispersions are prepared by incorporating the various sterilized active ingredients into a sterile vehicle which contains the basic dispersion medium and the required other ingredients from those enumerated above. In the case of sterile powders for the preparation of sterile injectable solutions, the preferred methods of preparation are vacuumdrying and freeze-drying techniques which yield a powder of the active ingredient plus any additional desired ingredient from a previously sterile-filtered solution thereof. Upon formulation, solutions will be administered in a manner compatible with the dosage formulation and in such amount as is therapeutically effective. The formulations are easily administered in a variety of dosage forms, such as the type of injectable solutions described above, but drug release capsules and the like can also be employed. For parenteral administration in an aqueous solution, for example, the solution should be suitably buffered if necessary and the liquid diluent first rendered isotonic with sufficient saline or glucose. These particular aqueous solutions are especially suitable for intravenous, intramuscular, subcutaneous and intraperitoneal administration. In this connection, sterile aqueous media which can be employed will be known to those of skill in the art in light of the present disclosure. For example, one dosage could be dissolved in 1 ml of isotonic NaCl solution and either added to 1000 ml of hypodermoclysis fluid or injected at the proposed site of infusion. Some variation in dosage will necessarily occur depending on the condition of the subject being treated. The person responsible for administration will, in any event, determine the appropriate dose for the individual subject.

The pharmaceutical compositions according to the invention and related methods of the invention are useful for treating a subject suffering from glioblastoma and/or glioblastoma recurrence by intrathecal administration of a JMY inhibitor.

Method of screening In a further aspect, the present invention also relates to a method of screening a drug suitable for the treatment of glioblastomas and glioblastoma recurrence comprising i) providing a test compound and ii) determining the ability of said test compound to inhibit the activity of JMY.

Any biological assay well known in the art could be suitable for determining the ability of the test compound to inhibit the activity of JMY. In some embodiments, the assay first comprises determining the ability of the test compound to bind to JMY. In some embodiments, a population of cells is then contacted and activated so as to determine the ability of the test compound to inhibit the activity of JMY. In particular, the effect triggered by the test compound is determined relative to that of a population of immune cells incubated in parallel in the absence of the test compound or in the presence of a control agent either of which is analogous to a negative control condition. The term "control substance", "control agent", or "control compound" as used herein refers a molecule that is inert or has no activity relating to an ability to modulate a biological activity or expression. It is to be understood that test compounds capable of inhibiting the activity of JMY, as determined using in vitro methods described herein, are likely to exhibit similar modulatory capacity in applications in vivo. Typically, the test compound is selected from the group consisting of peptides, petptidomimetics, small organic molecules, aptamers or nucleic acids. For example, the test compound according to the invention may be selected from a library of compounds previously synthesised, or a library of compounds for which the structure is determined in a database, or from a library of compounds that have been synthesised de novo. In some embodiments, the test compound may be selected form small organic molecules.

The invention will be further illustrated by the following figures and examples. However, these examples and figures should not be interpreted in any way as limiting the scope of the present invention.

FIGURES:

Figure 1: TG1N and TG16 have the capacity to generate intracerebral tumors in nude mice and have a high velocity cultured on laminin substrate. Mean migration velocity of bipolar/elongated cells and blebbing GSCs derived from GBM (TGINand TG16) plated on laminin substrate. The mean velocity of TG16 bipolar cells was similar to that of TG1N cells whereas TGI 6 blebbing cells migrated at a significantly slower velocity than their respective bipolar counterparts (14.15 ± 0.9 pm/h, ***p<0.001). TG16 bipolar cells migrated with no predefined direction, in a manner similar to TG1N cells (Supplementary Movies 1 and 2). Further analyses were thus only performed on the bipolar elongated sub-population. Human GSCs adopt a random motility pattern with a high velocity on laminin substrates. Mean migration velocities were calculated from monitoring of 224 TG1N cells, 45 bipolar TGI 6 cells, and 68 blebbing TGI 6 cells every ten minutes over the course of 4 hours (***p < 0.001 and ns: not significant). Similar results were obtained from three independent experiments.

Figure 2: y-irradiation stimulates the migration of GSCs. (A) Dose-dependent effects of radiation on the migration of TG1N and TGI 6 GSCs. Cell motility was monitored by videomicroscopy for successive 4-hour periods from 8 to 28 hours post-irradiation. Graphs show the effects of radiation on cell migration expressed as percentages of the respective unirradiated controls for the indicated period of time after irradiation. Percentages of mean migration velocity were calculated from at least 120 cells (TG1N) and 80 cells (TG16) from two independent experiments (*p < 0.05, **p < 0.01 and ***p < 0.001). (B) Effects of 0.5 Gy irradiation on the migration of human TG1N (top) and TGI 6 cells (bottom). GSCs were irradiated 24 hours after plating. Histograms show the effects of radiation on cell migration expressed as percentages of the respective unirradiated controls during the indicated periods of time after irradiation. At least 80 cells (TG1N) and 90 cells (TGI 6) were tracked every ten minutes over the course of 124 hours for each period of 4 hours. Data were compiled from three independent experiments. (**p < 0.01 and ***p < 0.001). (C) Mean migration velocity of control and irradiated (0.5 Gy) TG1N and TG16 cells from 24 to 28 hours after 0.5 Gy irradiation. Histograms show the mean velocities of irradiated cells and non-irradiated controls (calculated from at least 75 cells per condition; ***p < 0.001).

Figure 3: Irradiation increases the invasiveness of GSCs in vitro and in vivo. (A) Matrigel invasion chambers were used to measure invasiveness of TG1N and TG16 cells after 0.5 Gy irradiation. The results are expressed as percentages of non-irradiated controls (n = 5 chambers per group from 3 independent experiments; **p < 0.01). (B) Quantification of dispersion of unirradiated or irradiated TG1N and TGI 6 cells in coronal slices of mouse brains Data were compiled from two independent experiments including 3 to 5 brains per condition (*p < 0.05).

Figure 4: A rapid and transient nuclear accumulation of HIFla is involved in radiation-induced migration of GSCs. (A) Percentage of intranuclear HIF la-positive cells after DFO treatment or after (0.5 Gy) irradiation (n = 100 cells per condition; ***p < 0.001). (B) YC1 (50 pM) treatment 2 hour prior to irradiation (0.5 Gy) prevented the radiation- induced nuclear accumulation of HIFla in TG1N GSCs. One hour after irradiation or DFO treatment (100 pM), nuclear HIFla fluorescence intensity was determined in at least 50 cells per condition (**p < 0.01 and ***p < 0.001). (C) Effects of YC1 or DFO treatments on TG1N GSCs migration velocity 24 hours PI. Migration velocity was expressed as percentages of the unirradiated control and calculated from at least 80 cells for each condition (**p < 0.01 and ***p < 0.001). (D) HIFla knockdown prevented the radiation-induced migration of TG1N cells. TG1N GSCs were transfected with a siRNA targeting HIFla (siHIFla) or a scramble control (siCt) and irradiated (0.5 Gy) 24 hours later. Twenty-four hours after irradiation, migration velocity was determined and expressed as percentage of the unirradiated control. Data were obtained from at least 70 cells per condition (***p < 0.001).

Figure 5: The HIFla/JMY pathway is involved in radiation-induced migration of GSCs. (A) Quantification of JMY fluorescence intensity. At least 20 cells were scored per condition. (***p < 0.001). (B) Quantification of JMY mRNA levels by RT-qPCR in TG1N cells. Experiments were performed in triplicate (*p < 0.05, **p < 0.01 and ***p < 0.001). (C) JMY promoter activity in TG1N cells was estimated by luciferase reporter assay at different times following irradiation (0.5 Gy). Data obtained from quadruplicates (*p < 0.05, **p < 0.01 and ***p < 0.001). (D) TG1N cells were treated with 50 pM YC1 one hour before irradiation (0.5 Gy). Immunostainings were performed 24 hours after irradiation or after treatment with 100 pM DFO. JMY-fluorescence intensity was measured (n = 30 cells per condition; ***p < 0.001). (E) Quantification of JMY mRNA levels by RT-qPCR in control TG1N cells (shCt) and in HIF la-deficient TG1N cells. Experiments were performed in duplicate (*p < 0.05). (F and G) Twenty-four hours after irradiation (0.5 Gy), cells transfected with siCt or siJMY (F) or transduced with shJMY-TGIN or shCt-TGIN cells (G) were tracked every ten minutes for 4 hours. Data were obtained from at least 65 cells per condition (***p < 0.001). The results are expressed as percentages of unirradiated controls (siCt TG1N cells (F) or shCt TG1N cells (G)). (H) Invasion in Matrigel chambers of ShJMY-TGIN cells and ShCt-TGIN cells after 0.5 Gy radiation. GFP-positive cells present on the lower membrane were numbered. For each condition, results were expressed as percentages of unirradiated ShCt-TGIN cells (n = 3 chambers per group; **p < 0.01). (I) Quantification of the dispersion of unirradiated or irradiated ShJMY-TGIN cells and ShCt-TGIN cells in coronal slices of nude mouse brains 48 h after intrastriatal injections (n = 3-5 brains per condition; *p < 0.05).

Figure 6: Irradiation increases cellular levels of F-actin in a JMY-dependent manner. (A and B) Quantification of phalloidin fluorescence intensity 24 hours after 0.5 Gy irradiation (in cells pretreated or not with 50 pM YC1) or after 100 pM DFO for TG1N (A) and TG16 GSCs (B). At least 35 cells were scored per condition (***p < 0.001). (C and D) Quantification of F-actin fluorescence intensity staining by phalloidin after irradiation (0.5 Gy) or not in GSCs with siCt, siJMY or siHIF la-electroporated TG1N (C) and TGI 6 (D). At least 20 and 25 cells were scored by condition (respectively in TG1N and TGI 6 GSCs; *p < 0.05, ***p < 0.001 and ns: not significant).

Figure 7: Radiation-induced migration is related to sternness. (A) Differentiation markedly reduced the motility of TG16 cells. The mean migration velocities of GSCs (Undiff) and differentiated cancer cells (Diff) were calculated from at least 75 cells per group 24 hours after plating (***p < 0.001 and ns: not significant). (B) Irradiation did not enhance the migration of differentiated cancer cells. Cells were tracked 24 hours after irradiation (0.5 Gy) every ten minutes over the course of 4 hours. The mean migration velocities of control (0 Gy) and irradiated cells were calculated from at least 120 cells per group tracked every ten minutes over the course of 4 hours (ns: not significant). (C) Irradiation did not increase nuclear expression of HIFla in differentiated cells. Immunostainings were performed 1 hour after irradiation (0.5 Gy). Nuclear HIFla fluorescence intensity was measured in at least 50 cells per condition (ns: not significant). (D) Irradiation did not increase JMY expression in differentiated cells. Immunostainings were performed 24 hours after irradiation (0.5 Gy). JMY fluorescence intensity was measured in at least 65 cells per condition (ns: not significant).

Figure 8: ROS are involved in radiation-induced migration of GSCs

TG1N (A, C and E) and TGI 6 (B and D) cells were treated (+) or not treated (-) with 500 mM NAC one hour before irradiation (0.5 Gy) and numbers of ROS-positives cells (A and B), migration velocity (C and D) and cell invasion (E) were analysed 24 hours after irradiation.

(A and B) NAC inhibited the radiation-induced increase of ROS-positive cells estimated by FACS.

(C and D) NAC inhibited the radiation-induced migration velocity of GSCs. Mean velocities were measured over a period of 4 hours by videomicroscopy 24 hours after irradation (60 cells per condition). Histograms show the effects of radiation and/or NAC treatment on cell migration expressed as percentages of the unirradiated control.

(E) NAC inhibited the radiation-induced invasiveness of TG1N cells as measured using invasion assays in Boyden chambers. Histograms show the effects of radiation and/or NAC treatment on cell invasion expressed as percentages of the unirradiated control (n = 3-5 from two independent experiments).

EXAMPLE: Material & Methods

Human glioma stem-like cell (GSC) lines and treatments

The TG1N and TGI 6 GSC lines were obtained from surgical resections carried out at Sainte Anne Hospital (Paris, France) on patients with high-grade gliomas according to the WHO classification^2829,52. Since then they were systematically cultured as tumorospheres in defined stem cell culture condition (serum -free Dulbecco’s Modified Eagle Medium DMEM/F12 supplemented with B27 without vitamin A (IX, Invitrogen), heparin (5 pg/mL, Stem Cell Technologies), human recombinant epidermal growth factor (EGF, 20 ng/ml, Sigma) and human basic fibroblast growth factor (FGF-2, 20 ng/ml, Sigma)) at 37°C in an atmosphere containing 5% CO2. Every week, cells were mechanically dissociated after a 10 min incubation at room temperature with the Accutase cell dissociation reagent (Sigma) and reseeded at 0.5xl0⁶ cells per T75 flask.

Cells were y-irradiated with the indicated doses 24 hours after plating using a ¹³⁷Cs irradiator (IBL637, CIS BIO International or GSR-D1, Gamma-Service Medical GmbH) or with a ⁶⁰Co medical irradiator (Alcyon). When indicated, Deferoxamine (DFO, Interchim), or YC1 (Cayman Chemical) was added 2 hours before irradiation.

Time-lapse microscopy

Cells were plated on 24-well plates (25-35,000 cells /well) coated with laminin (5 pg/mL; Sigma). Videomicroscopy was carried out at least 8 hours after plating using an inverted microscope (Olympus 1X81) coupled with a Coolsnap HQ camera (Princeton Instruments) controlled with Metamorph software (Universal Imaging) as previously described ⁵⁷ or using a NIKON AIR confocal laser microscope (Nikon Corp. Tokyo). Imaging conditions were maintained at 37°C (The Box & The Cube, LIS), 5% CO2 and 18% O2 with a relative humidity of 95% controlled by an active gas supply system (the Brick, LIS). Images were taken of 6-20 fields per condition using a 10X objective (Olympus 1X81) or in mosaic acquisition with a 20X objective (Nikon AIR) every 10 min. Tracking and overlay of individual cell tracks over a period of 4 hours were carried out using the track object function in Metamorph software (Molecular Devices) or using the MTrackJ plugin in Imaged software. Dynamic parameters as migration velocity, mean square displacement (MSD) and directional persistence were calculated with an Excel macro developed by F. Cordelieres (Bordeaux imaging center, UMS 3420 CNRS, France) and/or with the custom-made open-source computer program DiPer ⁵⁸.

Cell cycle analysis

GSCs were collected after accutase treatment, washed with PBS, fixed in 70% ice-cold ethanol and kept at -20°C for 24 hours. Fixed GSCs were then washed in PBS and resuspended in propidium iodide and RNase (50 pg/ml each). The cell suspension was incubated for 15 min at 37°C and cell cycle data was obtained by flow cytometry (LSRII; BD Biosciences) with CellQuest software. Cell cycle distribution was analyzed by using the univariate cell cycle platform in Flow Jo V10 software, the Den Jett Fox model integrated (Tree Star, USA).

Cell viability

Cell viability was estimated by time-lapse microscopy (see above). Just before the beginning of acquisition, the IncuCyte Cytotox Reagent was added in the full media at the concentration of 250 nM as recommended by the manufacturer (Essen Bioscience). Once cells become unhealthy, the plasma membrane integrity diminishes, allowing entry of the IncuCyte Reagent and yielding a 100-1000-fold increase in fluorescence upon binding to DNA. Cytotoxity was estimated by the ratio of dead cells number (red fluorescent cells) on viable cells over time at 8, 12, 16, 20, 24 and 28 hours after irradiation at the doses between 0 to 3 Gy in a mosaic of 2 X 6 fields (objective 20X). Data were obtained in triplicates from two independent experiments. Percentage of cell death was estimated by the number of red-positive (dead) cells vs. the total cell number counted automatically with NIS software.

Cell invasion assay

Experiments were performed using Matrigel invasion chambers (BD Biosciences) as described previously ²⁹. Briefly, 24 hours after irradiation (0.5 Gy), cell suspensions (5 x 10⁴ cells/0.5 mL of medium lacking growth factors, EGF and FGF) were seeded in triplicates onto the upper chamber. Culture medium with growth factors was added to the lower chamber. After 29 h at 37°C, cells still present on the upper surface of the membrane were gently removed with cotton-tipped swabs. Cells that have invaded the lower surface of the membrane were fixed with 4% paraformaldehyde and their nuclei were stained with DAPI (1 pg/ml; Sigma). Membranes were imaged with a Nikon eclipse 50i (objective 10X/NA 0.3) and a Hamamatsu CCD ORCA-05G camera controlled by NIS-element BR V3.2 software equipped with a motorized stage. Nuclei or GFP-positive cells — in experiments involving cells transfected with lentiviral vectors — detected on membranes were numbered and results were expressed as percentage of unirradiated controls.

HIFla and JMY knockdowns

After dissociation, cells were electroporated (1300 V, 10 ms, 3 pulses) with pools of 4- target-specific siRNAs targeting HIFla (ON-TARGETplus SMART pool human HIFla, L- 004018-00, Dharmacon) or of 3 target-specific siRNAs to JMY (siJMY, SC35724, Santa Cruz) using the Neon Transfection System (Life Technologies) according to the manufacturer’s instructions. Negative control (siCt, Santa Cruz SC37007 or ON-TARGETplus non targeting pool; D-001810-10-20) were simultaneously used to evaluate RNAi off-target effects and verify the accuracy of gene specific siRNA dependent RNAi. Transfected cells were then plated on laminin-coated 24-well plates. Knockdown efficiency was assessed 24-48 hours after transfection by RT-qPCR.

Generation of stable Hif la-deficient GSCs was performed using a pTRIP -MND-GFP- Hl-SanDI lentivirus vector ⁵⁹ in which a shRNA targeting 5'- GTGATGAAAGAATTACCGAAT -3' of HIFla (SEQ ID NO: 1) (NM 181054.1, NM_001530.2; hypoxia-inducible factor la subunit) was inserted. The target sequence was available in a database of National RNAi Core Facility of BROAD Institute and the plasmid lentivirus shHIFla was kindly provided to us by Pflumio’s laboratory (INSERM U1274, CEA, DRF-JACOB-IRCM-SCSR-LSHL, UMR Genetic Stability Stem Cells and Radiation).

Generation of stable JMY-deficient GSCs was performed using lentivirus vectors constructed as follows: different hybrids of primers encoding the expected shRNA sequences were annealed by mixing 500pmoles each in NEB2.1 lx buffer (New England Biolabs, Ipswich, MA). After 5 minutes at 100°C, the annealing occurred slowly by cooling down the heat block for overnight in a styrene box. Thus, the different hybrids of primers were inserted in pTRIP- MND-GFP-Hl-SanDI ⁵⁹ under control of Hl promoter by complementary single-strand annealing ⁶⁰. Briefly, the plasmid was digested by N///DI (ThermoFisher Scientific, Waltham, MA) and was treated with T4 DNA polymerase (0.75U) for generating single-strand sequence complementary to single strand extended sequences present in primer hybrids. The annealing reaction was transformed in DH5a-TlR homemade competent cells. Positive clones were validated by DNA sequencing.

A pTRIP -Hl-MND-GFP lentiviral vector expressing a small hairpin directed against HVC (5’- GTGTTGGGTCGCGAAAGG -3’) ⁶¹ (SEQ ID NO: 2) was used as control (shCt).

One day after platting on laminin substrate (5 pg/mL; Sigma), GSCs were transduced with a pool of the three lentiviral vectors at a MOI 5 (MOI-defined as the number of lentiviral particles able to transduce used per HEK-293). Transduced GSCs expressing GFP were then Fac-sorted based on GFP expression and thereafter maintained in culture.

Reverse transcription-quantitative PCR (RT-qPCR)

RNA was extracted using the RNeasy Plus Mini Kit or the RNeasy plus Micro Kit (Qiagen) according to the manufacturer’s instructions. Isolated RNAs were transcribed into cDNA using the High capacity RNA to cDNA Master Mix (Applied Biosystems). Quantitative PCR reactions were performed in 96-well plates in triplicate using SYBR Green Master Mix (Applied Biosystems). The primers used are listed in the following table:

Table 1: Primers used for quantitative Real-Time PCR

Luciferase JMY reporter assay

GSCc (15xl0³ cells) were electroporated using the Neon® transfection system (Thermo Fisher Scientific) with either 50 ng of the control (empty) pLightSwitch empty Prom vector (ref #S790005) or the pLightSwitch Prom reporter plasmid for the JMY gene promoter (#S719700; SwitchGear Genomics), then immediately transferred in 96-well plates previously coated with laminin (5 pg/mL; Sigma). GSCc were irradiated (0.5 Gy) 24 hours after electroporation and Luciferase reporter activity was determined at different time points using the LightSwitch Dual Assay System (SwitchGear Genomics) according to the manufacturer's instructions.

Sub-cellular fractionation and western blot

Cytoplasmic and nuclear protein extraction and protein quantification was performed according to the manufacturer’s recommendations (CelLytic™ NuCLEAR™ Extraction Kit, MERCK and Pierce™ BCA Protein Assay Kit, ThermoFisher respectively). Proteins were separated by PAGE and transferred following standard protocols ⁶². Membranes were first probed using the following primary antibodies: anti-HIFla (BD610958, clone 54 from Bioscience; 1/500), anti-Lamin Bl (sc374015, Santa Cruz; 1/500) or anti-a -tubulin (DM1 A, Sigma; 1/4000). Next, membranes were incubated with secondary IRDye680 and IRDye800 antibodies (respectively 926-68021 and 926-32211, Licor; 1/15000). Bands were detected with the Odyssey Infrared Imaging System (Licor) and quantified using ImageStudio Lite 5.2 software (Licor).

Intracerebral grafts

Swiss^nu/nu mice were maintained with access to food and water ad libitum in a colony room kept at a constant temperature (19°C-22°C) and humidity (40-50%) on a 12: 12 h light/dark cycle. All animal-related procedures were performed in compliance with the European Communities Council Directive of 22 ^th September 2010 (EC/2010/63) and were approved by Comite d’Ethique en Experimentation Animale, Direction de la Recherche Fondamentale, CEA (authorization #A12-029 and #A16-002; CEtEA-CEA DRF IdF).

Cell grafting was performed as previously described ⁶³ using a stereotaxic apparatus (David Kopf model 900 Small Animal Stereotaxic Instrument). 100,000 dissociated cells (2 pL) were inoculated into the two hemispheres using a 33G Hamilton needle (Hamilton Bonaduz) at the following coordinates: anteroposterior: +0.5 mm, dorsoventral: -3 mm and lateral: +1.5 (control cells) and -1.5 mm (irradiated cells). Forty-eight hours after grafting, animals were deeply anesthetized and intracardially perfused with 4% paraformaldehyde in PBS. Brains were removed, postfixed overnight, cryoprotected with 10% sucrose/PBS, and frozen in dry ice-cooled isopentane. A cryostat (Leica CM3050S) was used to prepare serial coronal brain sections (14 pm) with an inter-slice spacing of 60 pm. These sections were mounted in order to analyze the dispersion of grafted cells by immunofluorescence staining with an anti-human nestin antibody (MAB1259, 1/400; R&D Systems, Fig. 2b) or immunodetection of GFP expression as previously described ^29,63. Images were acquired at lOx magnification using NIS Elements software with a Pathfinder-Nikon motorized microscope (Nikon Instruments Inc.).

GSC dispersion in the coronal plane was calculated as the sum of the surfaces in pm² occupied by human nestin-positive or GFP-positive cells in the different coronal slices analyzed.

Immunostaining

Adherent cells were fixed for 10 min in 4% paraformaldehyde in PBS and then permeabilized in 0.1% Triton X-100 in PBS as previously described ²⁹. Cells were then incubated with the primary antibody in blocking buffer for 1 hour at room temperature and then washed and incubated with an Alexa-conjugated secondary antibody (1/1000, Molecular Probes) and with 2 Units of AlexaFluor 594 phalloidin (Thermo Fisher scientific) per coverslip for one hour. Cells were counterstained with DAPI (1 pg/ml, Sigma) and mounted with Fluoromount (Southern Biotech). The primary antibodies used were rabbit anti-HIFla (NB 100-449, Novus Biological), mouse anti-HIFla (NB 100-105, Novus Biological) and MAI-516, Thermo Fisher Scientific), goat anti-JMY (L16, Santa Cruz), mouse anti-JMY (G11, Santa Cruz) and rabbit anti-JMY (M300, Santa Cruz). Images were captured using a BX51 (Olympus) coupled with a Retiga200R camera or using a Leica TCS SPE confocal microscope (Leica Microsystems). Nuclear HIFla, cytoplasmic JMY and F-actin mean fluorescence intensities were measured using DAPI or phalloidin staining for object segmentation with ImageJ software.

Statistical analyses

All values are reported as the mean ± SEM. Statistical significance for two groups was assessed by the unpaired Mann-Whitney test or t-test. For comparison between more groups, a non-parametric ANOVA was performed followed by post hoc tests. As previously reported ⁶⁴, a two-way ANOVA with time and condition was used to compare MSD data. Statview (Abacus Concepts) and Prism Graphpad 7.1 software programs were used. Statistical significance levels are denoted as follow: *p < 0.05, **p < 0.01 and ***p < 0.001.

Results: y-radiation increases the migration velocity and invasive capacity of human GSCs

We used time-lapse videomicroscopy to characterize the motility patterns of two human GSC lines: TG1N and TGI 6, which were obtained from patients with high-grade gliomas ^28,29. Since then they were systematically cultured as tumorospheres in defined stem cell culture conditions, allowing them to keep their GSC properties including their capacity to generate intracerebral tumors in immunodeficient mice (data not shown).

Twenty-four hours after plating on laminin substrate, TG1N and TGI 6 cells adopted a bipolar and elongated shape (data not shown) and displayed high motility (mean velocities of 26.3 ± 0.6 pm/h and 25.7 ± 1.1 pm/h, respectively) without a predefined direction (figure 1 and data not shown), consistently with random motility pattern with high velocity previously reported for other GSC lines ³⁰.

We then determined the effects of different ionizing radiation doses ranging from 0 to 3 Gy on the motility pattern of TG1N and TGI 6 cells. In agreement with the well-known radiation-resistance of GSCs ^23,29, quantification of activated caspase-3 and -7 in irradiated cultures by ELISA revealed minimal increases in apoptosis at 24 hours post-irradiation, even at the highest dose (data not shown). This was further confirmed by using IncuCyte Cytox Reagent to assess cell death by videomicroscopy at different times after irradiation (data not shown). Flow cytometric analysis with propidium iodide DNA staining at 24 hours post- irradiation revealed no effect of 0.5 Gy irradiation on the cell cycle of TG1N and TG16 and only a low G2/M accumulation after 3 Gy in cultures of both cell lines (data not shown). Similarly, the colony formation assay revealed that only the dose of 3 Gy significantly impairs clonogenicity of both TG1N and TGI 6 cells (data not shown).

GSC migration velocity was measured over periods of 4 hours ranging from 8-28 hours post-irradiation. We showed dose-dependent increases of migration velocity of irradiated cells as compared to that of unirradiated controls, which remained stable during this period of time (Fig. 2A). No increase was detected after 0.1 Gy, whereas the highest increase was observed at 8-12 hours after 3 Gy irradiation (1.34- and 1.23-fold increases for TG1N and TG16, respectively, ***p < 0.001; Fig. 2A). Migration velocity decreased thereafter at the highest dose probably due to the cell cycle alterations reported above (data not shown). By contrast, we showed that 0.5 Gy induced a persistent increase in the migration velocity of the two cell lines, which remained detectable up to 52 hours post-irradiation (Fig. 2B).

Irradiated (0.5 Gy) GSCs significantly explored a wider territory than unirradiated controls as shown by cumulative traces (Fig. 2C) and mean square displacement (MSD) measurements (data not shown) of cells tracked from 24 to 28 hours or 24 to 26 hours postirradiation respectively. This occurred without any change in directional persistence estimated either by the end-point method (defined as the ratio of the distance between two points by the actual trajectory; data not shown) or over time (every 10 minutes, data not shown).

We then tested the effect of radiation on GSCs invasiveness using the Matrigel invasion chamber assay. As shown in Figure 3A, 0.5 Gy significantly increased the invasiveness of both GSC lines (TG1N: 221 ± 41% and TG16: 125 ± 11%).

To further explore in vivo the effects of radiation on GSC invasiveness, irradiated (0.5 Gy) TG1N and TG16 cells were stereotaxically injected into the striatum of adult Nude mice (data not shown). Serial coronal brain slices obtained two days after engraftment revealed that human nestin-positive cells exhibited a greater dispersion in the coronal plane, when cells were irradiated prior to injection compared to unirradiated controls (Fig. 3B).

Altogether, our data showed that sublethal doses of irradiation stimulate both the motility and invasive capacity of human GSCs.

Radiation-induced migration of GSCs depends on a rapid and transient nuclear accumulation of HIFla.

HIFl has been shown to play a key role as a transcription factor in hypoxia-induced migration/invasion of several glioblastoma cell lines ^9,31-35. Since HIFla nuclear accumulation has been previously reported to be induced by ionizing radiation in tumor cells ³⁶, we investigated whether HIFla could be involved in the radiation-induced migration/invasion of GSCs.

In normoxia, HIFla is hydroxylated by prolyl hydroxylase (PHD) leading to its recognition by the von Hippel-Lindau protein and subsequent ubiquitination and targeting to the proteasome for rapid degradation ³⁷.

PHD destabilization under hypoxic conditions allows the accumulation of HIFla and its translocation to the nucleus ³⁸, where it forms a heterodimeric transcription factor complex with HIF1B and binds the promoter regions of target genes ³⁹.

To investigate the role of HIFla in radiation-induced migration, we treated our cells with Deferoxamin (DFO), an iron chelator known to stabilize HIFla ⁴⁰. As shown in Figure 3 A, 3B and 3C, 100 pM DFO induced the nuclear accumulation of HIFla in 86 ± 6% of TG1N cells compared to 12 ± 7% of controls (***p < 0.001). Similar data were obtained with TG16 cells (data not shown).

Strikingly, we found a similar nuclear accumulation of HIFla in 70% of irradiated TG1N cells at 1 hour post-irradiation, compared to control cells (Fig. 4A, ***p < 0.001).

This increase remained transient since the percentage of HIF la-positive cells, as well as nuclear HIFla intensity returned to control levels at 4 hours post-irradiation (Fig. 4A and data not shown). Confirming the radiation-induced activation of the HIFla pathway, we showed an increased transcriptomic expression of well-known HIF la target genes in irradiated- GSCs ⁴¹ (data not shown).

We next showed that the radiation-induced accumulation of HIFla did not involve transcriptional regulation, since HIFla mRNA levels remained unchanged in irradiated cells compared to unirradiated controls, consistently with the determinant role of post-transcriptional modifications in HIFla accumulation ⁴² (data not shown).

Interestingly, DFO treatment increased cell velocity (Fig. 4B; ***p < 0.001), mimicking the effects of irradiation (Fig. 4B; **p < 0.01). Similar data were obtained with TG16 cells (data not shown).

To further investigate the importance of HIFla on radiation-induced migration, we then used YC1, a nitric oxide-independent activator of soluble guanylyl cyclase described to indirectly block HIFla expression at the post-transcriptional level ⁴³. We first checked the inhibition efficiency of 50 pM YC1 on HIFla expression induced by DFO in our cells and under the culture conditions used for these cells (data not shown). To this end, we used HIFla knockdown TG1N GSCs generated by lentiviral vector transduction of small-hairpin RNAs against HIF la (shHIF la), which dramatically decreased the HIF la mRNA basal levels; data not shown) and shCt TG1N GSCs, transduced with a lentiviral vector expressing a smallhairpin directed against irrelevant sequence (shCt) ⁴³. Western blot analysis revealed that DFO treatment induced accumulation of HIF la in the nuclear fraction of shCt TG1N GSCs after 2 hours, whereas it was not detected in the cytoplasmic fraction and in untreated controls (data not shown). Finally, YC1 inhibited the effect of DFO treatment on the accumulation of HIFla in the nuclear fraction similarly as the HIFla knockdown (data not shown), showing that YC1 is an efficient inhibitor of HIFla.

Further demonstrating the role of the HIFla pathway in radiation-induced migration, YC1 prevented i) the radiation-induced increase of fluorescence intensity of nuclear HIFla in TG1N (Fig. 4B) and TGI 6 (data not shown), ii) the radiation-induced transcriptomic expression of HIFla target genes ⁴¹ (data not shown) the radiation-induced velocity of GSCs (Fig. 4C, data not shown).

Finally, we treated TG1N and TGI 6 cells with specific siRNAs that decreased HIFla mRNA expression by 88-93% (data not shown). As shown in Fig.4D and data not shown, HIFla knockdown in TG1N and TGI 6 cells inhibited radiation-induced migration compared to control siRNA (siCt)-transfected cells. Altogether, these data strongly demonstrate the key role for HIFla in the radiation-induced GSC migration.

Stimulation of the Hifla/JMY pathway increases radiation-induced GSC migration

Nuclear HIFla is known to bind to hypoxia response elements (HRE) present in the promoters of a large number of genes ⁴⁴ ; these genes encode proteins critical for many important cellular processes, including migration ⁴⁵. Junction-mediating and regulatory protein (JMY) is one of the genes whose transcription is driven by HIFla under hypoxic conditions ⁴⁶. JMY has also been reported to enhance cell motility and invasion via its ability to induce actin nucleation ^47,48.

Immunofluorescence revealed that JMY was significantly up-regulated both in TG1N and TG16 cells 24 hours after 0.5 Gy irradiation (Fig. 5A; ***p < 0.001). RT-qPCR showed an increase in JMY mRNA levels detectable from 8 h post-irradiation and persisting thereafter (Fig. 5B and data not shown). The activation kinetic of JMY after irradiation is comparable to that of other well-known HIFla target genes ⁴¹. Moreover, measurement of JMY promoter activity in TG1N cells using luciferase assays confirmed that irradiation induced the activation of the JMY promoter (Fig. 5C). Strikingly, stabilizing HIFla levels with DFO increased the expression of JMY, whereas blocking HIFla with YC1 prevented the irradiation-induced increase in JMY in both TG1N and TGI 6 cells (Fig. 5D and data not shown).

Finally, to further investigate the importance of HIFla in the radiation-induced increase of JMY, we assessed JMY mRNA expression in HIFla knockdown TG1N and TG16 GSCs ( data not shown) and their respective controls 18 hours after irradiation (0.5Gy). As shown in Fig. 5E and data not shown, JMY mRNA expression increased after irradiation in shCt GSCs cells, but remained unchanged in both HIFla knockdown TG1N and TG16 GSCs. Therefore these data clearly demonstrate that the transcriptional activation of JMY is dependent on HIFla in irradiated GSC.

We next investigated the effects of JMY knockdown using a specific siRNAs that decreased by 64 and 70% JMY mRNA expression in TG1N and TGI 6 cells respectively compared to siCt-transfected cells (data not shown). JMY knockdown did not alter the basal migration rates of TG1N (Fig. 5F) and TG16 cells (data not shown). In contrast, it abolished the effects of radiation on their migration (Fig. 5F and data not shown).

We next obtained TG1N cells stably knocked down for JMY using lentiviral vectors expressing both GFP and shRNAs against JMY. JMY mRNA expression was decreased by 72 % in shJMY-TGIN, as compared to cells expressing a negative control shRNA (shCt-TGIN cells) (data not shown). As reported above using siJMY, the JMY knockdown did not alter the in vitro basal migration rates of TG1N, whereas it completely abolished the radiation-induced migration (Fig. 5G). The stable JMY knockdown prevented also the radiation-induced invasion capacity of TG1N cells, as estimated in the invasion chamber test (Fig. 5H).

ShJMY-TGIN cells and shCt-TGIN cells were then stereotaxically injected into the striatum of nude mice just after irradiation as described above. Analysis of serial coronal brain slices obtained two days after engraftments revealed that contrary to shCt-TGIN cells, 0.5 Gy radiation prior to injection did not increase the dispersion of shJMY-TGIN cells (Fig. 51).

Altogether, these results demonstrate that radiation-induced migration of GSCs is linked to HIF la-dependent cytoplasmic accumulation of JMY. The role of JMY in cell motility has been attributed to its actin nucleation-promoting activity ^46,48. We thus quantified F-actin in irradiated GSCs by measuring Alexa-596 phalloidin staining. Interestingly, 24 hours after irradiation (ie. at the peak of radiation-induced migration (Fig. 2), we showed a significant increase in cellular content of F-actin in irradiated, as well as DFO-treated GSCs (Fig. 6A and B). By contrast, HIFla inhibition by YC1 (Fig. 6A et B) or by siRNAs (Fig. 6C and D), as well as the knockdown of JMY (Fig. 6 C and D), prevented both the increase of F-actin and the radiation-induced migration (Fig. 4E and 5D and data not shown).

Altogether, our data demonstrate that ionizing radiation at sublethal dose enhances the migration of human GSC via the HIF1/JMY pathway involving the nucleation promoting activity of JMY.

Radiation-induced migration is related to GSC sternness

We finally investigated the dynamic behavior of our cell lines cultured under differentiating (diff) conditions (medium supplemented with 10% FBS without FGF2 and EGF) that let them loss their stem cell properties including their capacity to generate brain tumors in immunodeficient mice ²⁹. No obvious morphological changes were observed in diffTGIN which maintained a stable (diffTGIN) migration velocity compared to their parental cells (Fig, 7 A). In contrast, diffFG16 cells presented with a markedly flattened cytoplasm and a significant decrease in migration velocity compared to the parental GSC lines (Fig. 7A).

Interestingly, ionizing radiation did not increase migration velocity (Fig. 7B) nor the expression of HIFla (Fig. 7C) and JMY (Fig. 7D) in the differentiated cell lines, suggesting that the radiation-induced stimulation of cell motility is specific to GSCs due to the lack of activation of the HIFla/JMY pathway in differentiated cells.

In conclusion, we have shown that radiation induces the migration of GSCs through a HIF la-dependent cytoplasmic accumulation of JMY. Indeed, whereas we cannot exclude the involvement of other HIF la-dependent pathway due to the well-known pleiotropic effects of HIFla, our data demonstrate that JMY was absolutely required for this radiation-induced effect. JMY was initially described as a transcriptional cofactor cooperating with p300/CBP to augment p53 signaling during the DNA damage response ^27,51. JMY has been reported to accumulate in the nucleus after exposure to ultraviolet light, etoposide and actinomycin, promoting p53-mediated apoptosis. Since TG1N, but not TG16 ⁵², are p53 proficient, the role of JMY in radiation-induced migration is not related to p53. Moreover, the ionizing radiation doses used in this study did not trigger the nuclear accumulation of JMY and induced very low levels of GSC apoptosis, suggesting that JMY does not act as a transcriptional cofactor in radiation-induced cell migration. Rather, our data show that JMY is functioning through its previously described role in cell motility under hypoxic conditions by controlling actin dynamics via its nucleation-promoting activity ^46,47.

HIFla has been widely considered a prominent cancer drug target due to its role in the regulation of multiple survival pathways in solid hypoxic tumors. However, targeting HIFla is highly challenging and may induce severe side effects due its multiple functions ⁵³'⁵⁶. In this context, specific targeting of JMY could provide new therapeutic perspectives to limit radiation-induced migration of GSCs and hence prevent tumor recurrence following radiotherapy.

Radiation-induced migration of GSCs depends on an increase in reactive oxygen species.

Previous reports showed that reactive oxygen species (ROS) were both necessary and sufficient to activate the transcription factor hypoxia-inducible factor alpha (HIFla) by stabilizing it in the cell77-79. Indeed, under hypoxic conditions, the generation of ROS prevents the hydroxylation of HIFla, thereby stabilizing HIFla and allowing it to translocate to the nucleus and dimerize with HIFla to initiate transcription of target genes87. Therefore, we investigated whether radiation could induce a ROS increase in GSCs. Numbers of ROS-positive cells estimated by using a fluorogenic probe designed to reliably measure ROS in living in GSCs, 28 hours after irradiation (0.5 Gy) showed that the number of ROS-positive cells increased significantly after irradiation in TG1N and TGI 6 GSCs (Figure 8 A and 8B respectively). This increase was concomitant with the increase of migration velocity (Figure 8C and 8D) and of invasiveness (Figure 8E). Moreover, a pre-treatment with the well-known antioxidant N-acetyl cysteine (NAC)73 decreased significantly the ROS level NAC (Figure 8A and 8B) in irradiated cells and prevented concomitantly the radiation-induced migration (Figure 8C et 8D )and the radiation-induced invasiveness (Figure 8E). Altogether, these results indicate that increase of oxidative stress induced by a 0.5 Gy y-irradiation was involved in the activation of radiation-induced migration of human GSCs.

REFERENCES:

Throughout this application, various references describe the state of the art to which this invention pertains. The disclosures of these references are hereby incorporated by reference into the present disclosure.

1 Davis, M. E. Glioblastoma: Overview of Disease and Treatment. Clin J Oncol Nurs 20, S2-8, doi:10.1188/16. CJON.S1.2-8 (2016).

2 Stupp, R. et al. Radiotherapy plus concomitant and adjuvant temozolomide for glioblastoma. N Engl J Med 352, 987-996, doi: 10.1056/NEJMoa043330 (2005).

3 Ostrom, Q. T. et al. The epidemiology of glioma in adults: a "state of the science" review. Neuro Oncol 16, 896-913, doi: 10.1093/neuonc/nou087 (2014). 4 Lee, S. Y. et al. Induction of metastasis, cancer stem cell phenotype, and oncogenic metabolism in cancer cells by ionizing radiation. Mol Cancer 16, 10, doi: 10.1186/S12943-016-0577-4 (2017).

5 Hegedus, B., Zach, J., Czirok, A., Lovey, J. & Vicsek, T. Irradiation and Taxol treatment result in non-monotonous, dose-dependent changes in the motility of glioblastoma cells. J Neurooncol 67 , 147-157 (2004).

6 Zhai, G. G. et al. Radiation enhances the invasive potential of primary glioblastoma cells via activation of the Rho signaling pathway. J Neurooncol

227-237, doi: 10.1007/sl 1060-005-6499-4 (2006).

7 Rieken, S. et al. Carbon ion irradiation inhibits glioma cell migration through downregulation of integrin expression. International journal of radiation oncology, biology, physics 83, 394-399, doi: 10.1016/j ijrobp.2011.06.2004 (2012).

8 Edalat, L. et al. BK K+ channel blockade inhibits radiation-induced migration/brain infiltration of glioblastoma cells. Oncotarget 7, 14259-14278, doi: 10.18632/oncotarget.7423 (2016).

9 Kim, Y. H. et al. Radiation promotes malignant progression of glioma cells through HIF-lalpha stabilization. Cancer Lett 354, 132-141, doi: 10.1016/j. canlet.2014.07.048 (2014).

10 Park, C. M. et al. Ionizing radiation enhances matrix metalloproteinase-2 secretion and invasion of glioma cells through Src/epidermal growth factor receptor-mediated p38/Akt and phosphatidylinositol 3-kinase/Akt signaling pathways. Cancer Res 66, 8511-8519, doi: 10.1158/0008-5472. CAN-05-4340 (2006).

11 Steinle, M. etaL Ionizing radiation induces migration of glioblastoma cells by activating BK K(+) channels. Radiother Oncol 101, 122-126, doi: 10.1016/j. radonc.2011.05.069 (2011).

12 Wild-Bode, C., Weller, M., Rimner, A., Dichgans, J. & Wick, W. Sublethal irradiation promotes migration and invasiveness of glioma cells: implications for radiotherapy of human glioblastoma. Cancer Res 61, 2744-2750 (2001).

13 Badiga, A. V. et al. MMP-2 siRNA inhibits radiation-enhanced invasiveness in glioma cells. PloS one 6, e20614, doi: 10.1371/journal. pone.0020614 (2011).

14 De Bacco, F. etaL Induction of MET by ionizing radiation and its role in radioresistance and invasive growth of cancer. J Natl Cancer Inst 103, 645-661, doi: 10.1093/jnci/djr093 (2011). 15 Moncharmont, C. et al. Radiation-enhanced cell migration/invasion process: a review. Crit Rev Oncol Hematol 92, 133-142, doi: 10.1016/j.critrevonc.2014.05.006 (2014).

16 Nguemgo Kouam, P. et al. Robol and vimentin regulate radiation-induced motility of human glioblastoma cells. PloS one 13, e0198508, doi: 10.1371/journal. pone.0198508 (2018).

17 D' Alessandro, G. et al. Radiation Increases Functional KCa3.1 Expression and Invasiveness in Glioblastoma. Cancers 11, doi: 10.3390/cancersl l030279 (2019).

18 Cheng, L. etal. Elevated invasive potential of glioblastoma stem cells. Biochem Biophys Res Commun 406, 643-648, doi:10.1016/j.bbrc.2011.02.123 (2011).

19 Singh, S. K. et al. Identification of human brain tumour initiating cells. Nature 432, 396-401, doi: 10.1038/nature03128 (2004).

20 Ignatova, T. N. et al. Human cortical glial tumors contain neural stem-like cells expressing astroglial and neuronal markers in vitro. Glia 39, 193-206, doi: 10.1002/glia.10094 (2002).

21 Chen, R. et al. A hierarchy of self-renewing tumor-initiating cell types in glioblastoma. Cancer Cell 17, 362-375, doi:10.1016/j.ccr.2009.12.049 (2010).

22 Kreso, A. & Dick, J. E. Evolution of the cancer stem cell model. Cell Stem Cell 14, 275- 291, doi: 10.1016/j . stem.2014.02.006 (2014).

23 Bao, S. et al. Glioma stem cells promote radioresistance by preferential activation of the DNA damage response. Nature 444, 756-760, doi:10.1038/nature05236 (2006).

24 Qiu, B. et al. Human brain glioma stem cells are more invasive than their differentiated progeny cells in vitro. J Clin Neurosci 19, 130-134, doi:10.1016/j.jocn.2011.06.014 (2012).

25 Rich, J. N. Cancer stem cells in radiation resistance. Cancer Res 67, 8980-8984, doi: 10.1158/0008-5472.CAN-07-0895 (2007).

26 Chen, J. et al. A restricted cell population propagates glioblastoma growth after chemotherapy. Nature 488, 522-526, doi: 10.1038/naturel l287 (2012).

27 Shikama, N. et al. A novel cofactor for p300 that regulates the p53 response. Mol Cell 4, 365-376 (1999).

28 Patru, C. et al. CD133, CD15/SSEA-1, CD34 or side populations do not resume tumorinitiating properties of long-term cultured cancer stem cells from human malignant glio- neuronal tumors. BMC Cancer 10, 66, doi: 10.1186/1471-2407-10-66 (2010).

29 Silvestre, D. C. et al. Alternative lengthening of telomeres in human glioma stem cells. Stem Cells 29, 440-451, doi: 10.1002/stem.600 (2011). 30 Pollard, S. M. et al. Glioma stem cell lines expanded in adherent culture have tumorspecific phenotypes and are suitable for chemical and genetic screens. Cell Stem Cell 4, 568-580, doi: 10.1016/j. stem.2009.03.014 (2009).

31 Fujiwara, S. etal. Silencing hypoxia-inducible factor-lalpha inhibits cell migration and invasion under hypoxic environment in malignant gliomas. Int J Oncol 30, 793-802 (2007).

32 Joseph, J. V. et al. Hypoxia enhances migration and invasion in glioblastoma by promoting a mesenchymal shift mediated by the HIFlalpha-ZEBl axis. Cancer Lett 359, 107-116, doi:10.1016/j.canlet.2015.01.010 (2015).

33 Mendez, O. et al. Knock down of HIF-lalpha in glioma cells reduces migration in vitro and invasion in vivo and impairs their ability to form tumor spheres. Mol Cancer 9, 133, doi: 10.1186/1476-4598-9-133 (2010).

34 Zhang, Y. et al. Melatonin antagonizes hypoxia-mediated glioblastoma cell migration and invasion via inhibition of HIF-lalpha. Journal of pineal research 55, 121-130, doi:10.1111/jpi.12052 (2013).

35 Zhou, X. et al. Geranylgeranyltransferase I regulates HIF-lalpha promoting glioblastoma cell migration and invasion. J Neurooncol 112, 365-374, doi: 10.1007/sl l060-013-1081-y (2013).

36 Moeller, B. J., Cao, Y., Li, C. Y. & Dewhirst, M. W. Radiation activates HIF-1 to regulate vascular radiosensitivity in tumors: role of reoxygenation, free radicals, and stress granules. Cancer Cell 5, 429-441 (2004).

37 Hamanaka, R. B. & Chandel, N. S. Mitochondrial reactive oxygen species regulate hypoxic signaling. Curr Opin Cell Biol 21, 894-899, doi: 10.1016/j.ceb.2009.08.005 (2009).

38 Chandel, N. S. et al. Reactive oxygen species generated at mitochondrial complex III stabilize hypoxia-inducible factor-lalpha during hypoxia: a mechanism of 02 sensing. J Biol Chem 275, 25130-25138, doi: 10.1074/jbc.M001914200 (2000).

39 Jaakkola, P. et al. Targeting of HIF-alpha to the von Hippel-Lindau ubiquitylation complex by 02-regulated prolyl hydroxylation. Science 292, 468-472, doi: 10.1126/science.1059796 (2001).

40 Wang, G. L. & Semenza, G. L. Desferrioxamine induces erythropoietin gene expression and hypoxia-inducible factor 1 DNA-binding activity: implications for models of hypoxia signal transduction. Blood 82, 3610-3615 (1993). Semenza, G. L. Hypoxia-inducible factor 1 : oxygen homeostasis and disease pathophysiology. Trends in molecular medicine 7, 345-350, doi: 10.1016/sl471- 4914(01)02090-1 (2001).

Huang, L. E., Arany, Z., Livingston, D. M. & Bunn, H. F. Activation of hypoxiainducible transcription factor depends primarily upon redox-sensitive stabilization of its alpha subunit. J Biol Chem 271, 32253-32259 (1996).

Chun, Y. S., Yeo, E. J. & Park, J. W. Versatile pharmacological actions of YC-1: antiplatelet to anticancer. Cancer Let 207 , 1-7 (2004).

Dengler, V. L., Galbraith, M. & Espinosa, J. M. Transcriptional regulation by hypoxia inducible factors. Crit Rev Biochem Mol Biol 49, 1-15, doi : 10.3109/10409238.2013.838205 (2014).

Rankin, E. B. & Giaccia, A. J. The role of hypoxia-inducible factors in tumorigenesis. Cell Death Differ 15, 678-685, doi: 10.1038/cdd.2008.21 (2008).

Coutts, A. S. et al. Hypoxia-driven cell motility reflects the interplay between JMY and HLF-lalpha. Oncogene 30, 4835-4842, doi:10.1038/onc.2011.188 (2011).

Coutts, A. S., Weston, L. & La Thangue, N. B. A transcription co-factor integrates cell adhesion and motility with the p53 response. Proc Natl Acad Sci U S A 106, 19872- 19877, doi: 10.1073/pnas.0906785106 (2009).

Zuchero, J. B., Coutts, A. S., Quinlan, M. E., Thangue, N. B. & Mullins, R. D. p53- cofactor JMY is a multifunctional actin nucleation factor. Nat Cell Biol 11, 451-459, doi: 10.1038/ncbl852 (2009).

Alexandru-Abrams, D., Jadus, M. R., Hsu, F. P., Stathopoulos, A. & Bota, D. A. Therapeutic targeting of malignant glioma. Anticancer Agents Med Chem 14, 1075- 1084 (2014).

Li, P., Zhou, C., Xu, L. & Xiao, H. Hypoxia enhances sternness of cancer stem cells in glioblastoma: an in vitro study. Int J Med Sci 10, 399-407, doi: 10.7150/ijms.5407 (2013).

Coutts, A. S., Boulahbel, H., Graham, A. & La Thangue, N. B. Mdm2 targets the p53 transcription cofactor JMY for degradation. EMBO Rep 8, 84-90, doi: 10.1038/sj .embor.7400855 (2007).

El-Habr, E. A. et al. A driver role for GABA metabolism in controlling stem and proliferative cell state through GHB production in glioma. Acta neuropathologica 133, 645-660, doi : 10.1007/s00401-016- 1659-5 (2017). 53 Hu, Y., Liu, J. & Huang, H. Recent agents targeting HIF-lalpha for cancer therapy. J Cell Biochem 114, 498-509, doi: 10.1002/jcb.24390 (2013).

54 Wang, G., Wang, J. J., Fu, X. L., Guang, R. & To, S. T. Advances in the targeting of HIF-lalpha and future therapeutic strategies for glioblastoma multiforme (Review). Oncol Rep 37, 657-670, doi: 10.3892/or.2016.5309 (2017).

55 Onnis, B., Rapisarda, A. & Melillo, G. Development of HIF-1 inhibitors for cancer therapy. J Cell Mol Med 13, 2780-2786, doi: 10.1111/j .1582-4934.2009.00876.X (2009).

56 Xia, Y., Choi, H. K. & Lee, K. Recent advances in hypoxia-inducible factor (HIF)-l inhibitors. Eur JMed Chem 49, 24-40, doi: 10.1016/j.ejmech.2012.01.033 (2012).

57 Gauthier, L. R. et al. Rad51 and DNA-PKcs are involved in the generation of specific telomere aberrations induced by the quadruplex ligand 360 A that impair mitotic cell progression and lead to cell death. Cell Mol Life Sci 69, 629-640, doi: 10.1007/s00018- 011-0767-6 (2012).

58 Gorelik, R. & Gautreau, A. Quantitative and unbiased analysis of directional persistence in cell migration. NatProtoc 9, 1931-1943, doi: 10.1038/nprot.2014.131 (2014).

59 Gerby, B. et al. Optimized gene transfer into human primary leukemic T cell with NOD- SCID/leukemia-initiating cell activity. Leukemia 24, 646-649, doi: 10.1038/leu.2009.235 (2010).

60 Li, M. Z. & Elledge, S. J. Harnessing homologous recombination in vitro to generate recombinant DNA via SLIC. Nature methods 4, 251-256, doi: 10.1038/nmethl010 (2007).

61 Lazrak, M. et al. The bHLH TAL-l/SCL regulates endothelial cell migration and morphogenesis. Journal of cell science 117, 1161-1171, doi: 10.1242/jcs.00969 (2004).

62 Collura, A. etal. Patients with colorectal tumors with microsatellite instability and large deletions in HSP110 T17 have improved response to 5-fluorouracil-based chemotherapy. Gastroenterology 146, 401-411 e401, doi: 10.1053/j.gastro.2013.10.054 (2014).

63 Jeitany, M. et al. A preclinical mouse model of glioma with an alternative mechanism of telomere maintenance (ALT). Int J Cancer 136, 1546-1558, doi: 10.1002/ijc.29171 (2015).

64 Dang, I. et al. Inhibitory signalling to the Arp2/3 complex steers cell migration. Nature 503, 281-284, doi: 10.1038/naturel2611 (2013).

Claims

- 42 -WO 2022/084531 PCT/EP2021/079397 CLAIMS:

1. A method for predicting the responsiveness to a radiotherapy and/or chemotherapy by detecting the presence or not of Junction-mediating and regulatory protein (JMY) in a subject suffering from glioma, glioblastoma or glioblastoma recurrence.

2. A method for treating glioma in a subject in need thereof comprising a step of administering the subject with a therapeutically effective amount of Junction-mediating and regulatory protein (JMY) inhibitor.

3. A method for treating glioblastoma and/or glioblastoma recurrence in a subject in need thereof comprising a step of administering the subject with a therapeutically effective amount of Junction-mediating and regulatory protein (JMY) inhibitor.

4. The method according to claim 3, wherein the glioblastoma is radio-resistant glioblastoma or a chemo-resistant glioblastoma.

5. The method according to any one of claims 2 to 4, wherein the inhibitor is an antibody.

6. The method according to any one of claims 2 to 4, wherein the inhibitor is a small molecule.

7. The method according to any one of claims 2 to 4, wherein the inhibitor is a siRNA or an antisense oligonucleotide.

8. The method according to any one of claims 2 to 7, wherein the inhibitor is administered with radiotherapy simultaneously, separately or sequentially, as a combined preparation.

9. The method according to any one of claims 2 to 7, wherein the inhibitor is administered with a chemotherapeutic agent simultaneously, separately or sequentially, as a combined preparation.

10. The method according to any one of claims 2 to 7, wherein the inhibitor is administered with an immune check point inhibitor simultaneously, separately or sequentially, as a combined preparation. - 43 -

WO 2022/084531 PCT/EP2021/079397

11. A pharmaceutical composition comprising a JMY inhibitor.

12. The pharmaceutical composition according to claim 11 for use in the treatment of glioma.

13. The pharmaceutical composition according to claim 11 for use in the treatment of glioblastomas and/or glioblastomas recurrence.

14. A method of screening a drug suitable for the treatment of glioma comprising i) providing a test compound and ii) determining the ability of said test compound to inhibit the activity of JMY.