RU2722933C1 - Dna protease cutting agent based on cas9 protein from demequina sediminicola bacteria - Google Patents

Abstract

FIELD: biotechnology.

SUBSTANCE: invention relates to biotechnology and concerns application of protein containing amino acid sequence SEQ ID NO: 1 or containing an amino acid sequence which is at least 95 % identical to the amino acid sequence SEQ ID NO: 1 and has differences compared to SEQ ID NO: 1 only in non-conservative amino acid residues, to form double-strand break in DNA molecule located immediately before nucleotide sequence 5'-NN/GNNACN-3' in said DNA molecule.

EFFECT: invention allows to achieve simplification of biotechnologically significant bacteria genome editing.

5 cl, 8 dwg, 2 tbl, 3 ex

Description

Technical field

The invention relates to biotechnology, in particular, to new Cas enzymes, nucleases of CRISPR-Cas systems used for cutting DNA and editing the genome of various organisms. This technology can be used in the future for gene therapy of hereditary human diseases, as well as for editing the genome of other organisms.

State of the art

Changing the DNA sequence is one of the urgent tasks of biotechnology today. Editing and modifying the genomes of eukaryotic and prokaryotic organisms, as well as manipulating DNA in vitro, require the introduction of double-strand breaks in the DNA sequence.

To solve this problem, the following methods are currently used: artificial nuclease systems containing zinc finger domains, TALEN systems, and bacterial CRISPR-Cas systems. The first two methods require the laborious optimization of the nuclease amino acid sequence to recognize a specific DNA sequence. In contrast, in the case of CRISPR-Cas systems, the structures recognizing the target DNA are not proteins, but short RNA guides. Cutting a specific target DNA does not require the synthesis of a nuclease or its de novo gene, but is achieved through the use of RNA guides complementary to the target sequence. This makes CRISPR Cas systems convenient and effective tools for cutting various DNA sequences. The technique allows for simultaneous DNA cutting in several regions using guiding RNAs of different sequences. This approach is also used to simultaneously change several genes in eukaryotic organisms.

By their nature, CRISPR-Cas systems are prokaryotic immune systems capable of introducing breaks into the genetic material of viruses highly specifically (Mojica FJM et al. Intervening sequences of regularly spaced prokaryotic repeats derive from foreign genetic elements // Journal of molecular evolution. - 2005. - T. 60. - No. 2. - S. 174-182). The acronym CRISPR-Cas stands for “Clustered Regularly Interspaced Short Palindromic Repeats and CRISPR associated genes” (Jansen R. et al. Identification of genes that are associated with DNA repeats in prokaryotes // Molecular microbiology. - 2002. - T. 43. - No. 6. - S. 1565-1575), which is translated from English as “short palindromic repeats regularly arranged in groups and genes associated with them”. All CRISPR-Cas systems consist of CRISPR cassettes and genes encoding various Cas proteins (Jansen R. et al., Molecular microbiology. - 2002. - T. 43. - No. 6. - P. 1565-1575). CRISPR cassettes consist of spacer sequences, each of which has a unique nucleotide sequence, and repeating palindromic repeats (Jansen R. et al., Molecular microbiology. - 2002. - T. 43. - No. 6. - P. 1565-1575 ) As a result of transcription of CRISPR cassettes and their subsequent processing, guiding cRRNAs are formed, which together with Cas proteins form an effector complex (Brouns SJJ et al. Small CRISPR RNAs guide antiviral defense in prokaryotes // Science. - 2008. - T. 321. - No. 5891. - S. 960-964). Due to the complementary pairing of cRRNA with the target DNA region, called the protospacer, Cas nuclease recognizes the target DNA and introduces a gap specifically into it.

CRISPR-Cas systems, represented by a single effector protein, are divided into six different types (from I to VI) depending on the Cas proteins that make up the systems. In 2013, it was first proposed to use the type II CRISPR-Cas9 system for editing the genomic DNA of human cells (Cong L, et al., Multiplex genome engineering using CRISPR / Cas systems. Science. 2013 Feb 15; 339 (6121) : 819-23). The CRISPR-Cas9 system of type II is distinguished by the simplicity of the composition and mechanism of operation: for its functioning, the formation of an effector complex consisting of only one Cas9 protein and two short RNAs: crRNA (crRNA) and tracer RNA (tracrRNA, or tRRNA) is necessary. Tracer RNA mates complementary to the cRRNA region originating from the CRISPR repeat, forming the secondary structure necessary for binding of the RNA guides to the Cas effector. Determining the sequence of RNA guides is an important step in characterizing previously unexplored Cas orthologs. The Cas9 effector protein is an RNA-dependent DNA endonuclease with two nuclease domains (HNH and RuvC) that breaks the complementary strands of the target DNA, thereby forming a double-stranded DNA break (Deltcheva E. et al. CRISPR RNA maturation by trans-encoded small RNA and host factor RNase III // Nature. - 2011. - T. 471. - No. 7340. - S. 602).

To date, several CRISPR-Cas nucleases are known that are capable of specifically and specifically introducing double-stranded DNA breaks. CRISPR-Cas9 technology is one of the most modern and rapidly developing methods for introducing DNA breaks in various organisms, from bacterial strains to human cells, as well as in vitro (Song M. The CRISPR / Cas9 system: Their delivery, in vivo and ex vivo applications and clinical development by startups. Biotechnol Prog. 2017 Jul; 33 (4): 1035-1045).

For recognition and subsequent hydrolysis of DNA, an effector ribonucleic complex consisting of Cas9 and a duplex of cRRNA and trarRNA, in addition to the complementary correspondence of the cRRNA spacer and protospacer, requires the presence of PAM (from the English “PAM” - protospacer adjusted motif) on the target DNA (Mojica FJM et al. 2009). PAM is a strictly defined sequence of several nucleotides located in type II systems adjacent to or several nucleotides from the 3’ end of the protospacer on a non-target chain. In the absence of PAM, hydrolysis of bonds in DNA with the formation of double-strand break does not occur. The need for the presence of the PAM sequence on the target increases the specificity of recognition, but at the same time imposes a limitation on the choice of target DNA regions into which a gap must be introduced. Thus, the presence of the desired PAM sequence that flans the target DNA from the 3'-end is a characteristic that limits the use of CRISPR-Cas systems at any DNA sites.

Different CRISPR-Cas proteins use different, original PAM sequences for their work. The use of CRISPR-Cas proteins with various new PAM sequences is necessary to ensure the possibility of changing any part of the DNA, both in vitro and in the genome of living organisms. Changing eukaryotic genomes also requires the use of small nucleases to ensure the delivery of CRISPR-Cas systems to cells via AAV viruses.

Despite the popularity of a number of methods for cutting DNA and changing the sequence of genomic DNA, today there remains a need for new effective tools for modifying DNA in various organisms and in strictly defined places of the DNA sequence.

SUMMARY OF THE INVENTION

The present invention is the creation of new tools for changing the sequence of genomic DNA of unicellular or multicellular organisms based on CRISPR-Cas9 systems. Current systems have limited use due to the specific PAM sequence that must be present at the 3'-end of the DNA site undergoing modification. The search for new Cas9 enzymes with other PAM sequences will expand the arsenal of available tools for the formation of double-strand break in the necessary, strictly defined places in the DNA molecules of different organisms. To solve this problem, the authors characterized previously predicted for the bacterium Demequina sediminicola ( D. sediminicola )

CRISPR nuclease II type DsCas9, which can be used to introduce targeted changes in the genome of this and other organisms. The essential features that distinguish the present invention are: (a) a short, different from other known PAM sequence; (b) the relatively small size of the characterized protein DsCas9 - 1021 amino acid residues (a.o.).

This problem is solved by the use of a protein containing the amino acid sequence of SEQ ID NO: 1, or containing an amino acid sequence that is at least 95% identical to the amino acid sequence of SEQ ID NO: 1 and has differences compared to SEQ ID NO: 1 only in non-conservative amino acid residues, for the formation of double-strand break in the DNA molecule located immediately before the nucleotide sequence 5'-NA / GNNACN-3 'in the specified DNA molecule. In preferred embodiments of the invention, this use is characterized in that the formation of a double-strand break in the DNA molecule occurs at a temperature of 37 ^about C.

This problem is also solved by creating a method for changing the genomic DNA sequence of a unicellular or multicellular organism, including the introduction into an at least one cell of this organism of an effective amount of: a) either a protein containing the amino acid sequence of SEQ ID NO: 1, or a nucleic acid encoding a protein, containing the amino acid sequence of SEQ ID NO: 1, and b) or an RNA guide containing a sequence that forms a duplex with the nucleotide sequence of a portion of the body’s genomic DNA directly adjacent to the 5'-NA / GNNACN-3 'nucleotide sequence and interacts with the protein after the formation of a duplex, or a DNA sequence encoding the specified guide RNA; in this case, the interaction of the indicated protein with the RNA guide and the 5’- NA / GNNACN-3 ’nucleotide sequence leads to the formation of a double-strand break in the genomic DNA sequence directly adjacent to the 5’-NA / GNNACN-3’ sequence. In some embodiments of the invention, the method is characterized in that it further comprises introducing an exogenous DNA sequence simultaneously with the RNA guide.

A mixture of cRRNA (crRNA) and tracer RNA (tracrRNA) capable of complexing with the target DNA region and DsCas9 protein can be used as an RNA guide. In preferred embodiments of the invention, a hybrid RNA constructed on the basis of cRRNA and tracer RNA can be used as a guide RNA. Methods for constructing a hybrid RNA guide are known to those skilled in the art (Hsu PD, et al., DNA targeting specificity of RNA-guided Cas9 nucleases. Nat Biotechnol. 2013 Sep; 31 (9): 827-32).

The invention can be used both for cutting the target DNA in vitro, and for modifying the genome of any living organism. Modification of the genome can be carried out in a direct way - by cutting the genome in the corresponding site, as well as by inserting an exogenous DNA sequence due to homologous repair.

As an exogenous DNA sequence, any portion of double-stranded or single-stranded DNA from the genome of an organism other than the organism used during introduction (or a mixture of such sections between themselves and with other DNA fragments) can be used, while this section (or a mixture of sections) is intended for integration into the double-stranded gap in the target DNA formed by the action of DsCas9 nuclease. In some embodiments, a double-stranded portion of the DNA from the body’s genome used when the DsCas9 protein is introduced but modified by mutations (nucleotide substitution) as well as insertions or deletions of one or more nucleotides can be used as an exogenous DNA sequence.

The technical result of the present invention is to increase the versatility of the available CRISPR-Cas9 systems, allowing the use of Cas9 nuclease to cut genomic or plasmid DNA in more specific sites and specific conditions.

Brief Description of Drawings

FIG. 1. Schematic diagram of the locus device CRISPR DsCas9 system. DR - direct repeat, or direct repeat - a regularly repeated section that is part of the CRISPR cassette.

FIG. 2. Alignment of the reads obtained by sequencing small RNA extracted from cells carrying the CRISPR DsCas9 system onto the sequence of the CRISPR cassette. DR - direct repeat; spacer - a spacer, a unique sequence of CRISPR cassettes located between two direct repeats; NT - nucleotides.

FIG. 3. (A) PAM in vitro screening, experimental design. (B) Analysis of the results of in vitro screening of PpCas9 nuclease to determine PAM. For each position, the frequencies of adenine, cytosine, thymine, and guanine are indicated. The height of the letters corresponds to the frequency of the nucleotide in this position of the PAM sequence.

FIG. 4. DNA digestion with the PAM sequence of AACAACG protein DsCas9 in various conditions. M is a marker; 1 - DsCas9, RNA 1X; 2 - DsCas9 2X, RNA 2X; 3 - DsCas9 2X, RNA 1X; 4 - control (without adding RNA).

FIG. 5. The effect of single nucleotide substitutions in the PAM sequence on the nuclease activity of the DsCas9 protein. Specific DNA cleavage with various PAM variants. The corresponding PAM sequences are listed below in columns from top to bottom. The arrow indicates the position of the DNA cutting product.

FIG. 6. In vitro verification of the specific nuclease activity of DsCas9 at various targets within the human Grin2B gene. PAM sequences: 1 - AACAACT, 2 - CACAACC, 3 - AACTACT, 4 - CACGACT, 5 - TACAAAA.

FIG. 7. Scheme of the DsCas9 ribonucleoprotein complex with DR RNA guides - direct repeat.

FIG. 8. Alignment of the amino acid sequences of the proteins DsCas9 (upper sequence) and Cas9 from Staphylococcus aureus (lower sequence) using the NCBI BLASTp program (default parameters).

Detailed Disclosure of Invention

In the description of the present invention, the terms “includes” and “including” are interpreted as meaning “includes, among other things.” These terms are not intended to be construed as “consists of only”. Unless defined separately, technical and scientific terms in this application have standard meanings generally accepted in the scientific and technical literature.

As used herein, the term “percent homology of two sequences” is equivalent to the term “percent identity of two sequences”. The identity of the sequences is determined based on the reference sequence. Algorithms for sequence analysis are known in the art, such as BLAST described in Altschul et al., J. Mol. Biol., 215, pp. 403-10 (1990). For the purposes of the present invention, to compare the level of identity and similarity between nucleotide sequences and amino acid sequences, a comparison of nucleotide and amino acid sequences can be used using the Blast software package provided by the National Center for Biotechnology Information (http: //www.ncbi.nlm.nih .gov / blast) using breaks containing alignment with standard parameters. The percentage of identity of two sequences is determined by the number of positions of identical amino acids in these two sequences, taking into account the number of spaces and the length of each space that must be entered for optimal comparison of the two sequences by alignment. The percentage of identity is equal to the number of identical amino acids in these positions, taking into account sequence alignment, divided by the total number of positions and multiplied by 100.

The term “specifically hybridizes” refers to the association between two single-stranded nucleic acid molecules or sufficiently complementary sequences that permit such hybridization under the predetermined conditions commonly used in the art.

The phrase "double-stranded break immediately prior to the PAM nucleotide sequence" means that a double-strand break in the target DNA sequence will be produced at a distance of 0 to 25 nucleotides in front of the PAM nucleotide sequence.

By an exogenous DNA sequence introduced simultaneously with an RNA guide, one should understand a DNA sequence prepared specifically for the specific modification of double-stranded target DNA at the site of the break determined by the specificity of the RNA guide. Such a modification may, for example, be the insertion or deletion of certain nucleotides at the site of breakage of the target DNA. Exogenous DNA can serve as a portion of DNA from another organism, or a portion of DNA from the same organism as the target DNA.

By a protein containing a specific amino acid sequence is meant a protein having an amino acid sequence made up of a specified amino acid sequence and possibly other sequences connected by peptide bonds to the specified amino acid sequence. An example of other sequences may be a nuclear localization signal (NLS) sequence, or other sequences providing enhanced functionality for a specified amino acid sequence.

By an exogenous DNA sequence introduced simultaneously with an RNA guide, one should understand a DNA sequence prepared specifically for the specific modification of double-stranded target DNA at the site of the break determined by the specificity of the RNA guide. Such a modification may, for example, be the insertion or deletion of certain nucleotides at the site of breakage of the target DNA. Exogenous DNA can serve as a portion of DNA from another organism, or a portion of DNA from the same organism as the target DNA.

An effective amount of protein and RNA introduced into a cell should be understood to mean such an amount of protein and RNA that, when it enters the specified cell, it will be able to form a functional complex, that is, a complex that will specifically bind to the target DNA and produce a double-stranded break in it at the place determined guide RNA and PAM sequence on DNA. The effectiveness of this process can be assessed by analyzing the target DNA isolated from the indicated cell using standard methods known to those skilled in the art.

The delivery of protein and RNA to the cell can be carried out in various ways. For example, a protein can be delivered in the form of a DNA plasmid that encodes a gene for this protein, as an mRNA for translation of this protein in the cytoplasm of a cell, or as a ribonucleoprotein complex comprising this protein and RNA-guiding. Delivery can be carried out by various methods known to those skilled in the art.

The nucleic acid encoding the components of the system can be introduced into the cell directly or indirectly: by transfection or transformation of cells by methods known to those skilled in the art, by using a recombinant virus, by manipulating the cell, such as microinjection of DNA, etc.

The delivery of a ribonucleic complex consisting of nuclease and directing RNA and exogenous DNA (if necessary) can be accomplished by transfecting the complexes into the cell or by mechanically introducing the complex into the cell, for example, microinjection.

A nucleic acid molecule encoding a protein that needs to be introduced into a cell can be integrated into the chromosome or can be extrachromosomally replicating DNA. In some embodiments, to ensure efficient expression of a protein gene with DNA introduced into the cell, it is necessary to change the sequence of this DNA according to the type of cell in order to optimize codons for expression, due to the uneven frequency of occurrence of synonymous codons in the coding regions of the genome of various organisms. Codon optimization is necessary to increase expression in the cells of animals, plants, fungi, or microorganisms.

For the functioning of a protein having a sequence that is at least 95% identical to the amino acid sequence of SEQ ID NO: 1 in a eukaryotic cell, this protein must be in the nucleus of this cell. Therefore, in some embodiments of the invention, a protein having a sequence that is at least 95% identical to the amino acid sequence of SEQ ID NO: 1 and which is further modified at one or both ends by adding one or more nuclear localization signals. For example, a nuclear localization signal from the SV40 virus can be used. For efficient delivery to the nucleus, a nuclear localization signal can be separated from the main protein sequence by a spacer sequence, for example as described in Shen B, et al. "Generation of gene-modified mice via Cas9 / RNA-mediated gene targeting", Cell Res. 2013 May; 23 (5): 720-3. Also, in other embodiments, another nuclear localization signal, or an alternative method for delivering said protein to the cell nucleus, may be used.

The present invention encompasses the use of a protein from the body of D. sediminicola , homologous to the previously characterized Cas9 proteins, for introducing double-stranded breaks in DNA molecules in strictly defined positions. The use of CRISPR nucleases to introduce targeted changes in the genome has several advantages. First, the specificity of the action of the system is determined by the cRRNA sequence, which allows one type of nuclease to be used for all target loci. Secondly, the technique allows you to deliver several directing RNAs complementary to different target genes into the cell at once, which allows for a one-time change of several genes at once.

DsCas9 - Cas nuclease found in the present invention in the bacteria D. sediminicola. The CRISPR Cas9 system from the bacterium Demequina sediminicola belongs to IIC type systems and has a locus device characteristic of Cas9 systems. The CRISPR cartridge contains 33 direct repeats (DR, direct repeats) in sequence

GTTGCGGCCAGAGCTCATTTCCCAGAGCGATAGGCT, interspersed with unique sequences, spacers. The adaptation module responsible for embedding new spacers in the CRISPR cassette is represented by the Cas1 and Cas2 genes. A sequence of tracer RNA (tracrRNA, trRNA) was identified next to the gene for the effector Cas9 protein (Fig. 1).

For the biochemical characterization of Cas9 protein fromD. sediminicola (DsCas9) the locus encoding the main components of the system (genes of the CcCas9, cas1, cas2 proteins, as well as part of the CRSIPR cassette and tracer RNA) was cloned into the small copy bacterial vector pACYC184. The resulting vector was transformed into cellsE. coli, which further conducted a study of the activity of the system.

Determination of the sequence of guiding RNA.

Verification of CRISPR DsCas9 gene expression in E. coli was performed by sequencing small RNAs extracted from E. coli cells carrying the CRISPR system. An analysis of the results of sequencing made it possible to determine the sequence of guiding RNAs (Table 1, Fig. 2).

Table 1. RIS guide sequences of the CRISPR DsCas9 system.

Title Sequence DsCas9 trRNA CCUAUCGCUCUGGGAAAUGGGCUCUGCCGCuAACAAGGAGAAACUUGUUGGAUCAGGACUCCACAAGAUGAGACGGCUCCCUCGUGGGGCCGUUUUCUUUUU DsCas9 CrRNA XXXXXXXXXXXXXXXXXXXXX GUUGCGGCCAGAGCUCAUUUUCCCAGAGCGAUAGGCU

Determination of the PAM sequence of the DsCas9 protein. Bacterial PAM screening.

Interference is the process of protecting bacterial cells from foreign DNA using CRSIPR Cas systems. To determine the PAM sequence of the DsCas9 protein, E. coli BL21 Star cells carrying the DsCas9_pACYC184 plasmid were transformed with a library of plasmids containing the spacer sequence of the 5'-TTCATGCACGAAGTCCTCCGCCGCATGTCC-3 'CRISPR cassette of the DsCas9 sequentially randomized or 5-spaced randomized sequence.

Plasmids carrying the sequence corresponding to the DsCas9 PAM system were degraded by the CRISPR Cas system, while the remaining plasmids of the library were effectively transformed into cells, giving them resistance to the antibiotic ampicillin. After transformation and incubation of the cells on antibiotic plates, the colonies were washed off the surface of the agar and DNA was extracted from them using the Qiagen Plasmid Purification Midi kit. Sites including a randomized PAM sequence were amplified from the allocated pool of PCR plasmids, which were then subjected to highly efficient sequencing on the Illumina platform. The reads were analyzed: the efficiency of transformation of plasmids with unique PAMs included in the library, into cells carrying DsCas9_pACYC184, or into control cells carrying the empty vector pACYC184 was compared. The results obtained were analyzed by bioinformatics methods. As a result, it was possible to identify the Ps of the DsCas9 system - the three-letter sequence NA / GNNACN with the 3 ’end of the protospacer (Fig. 3).

To verify the activity of DsCas9 nuclease and determine the motif required for DsCas9 PAM, experiments were performed to recreate the DNA cutting reaction in vitro .

To verify the nuclease activity of DsCas9 in an in vitro screening, the following reaction components were required:

1) Recombinant protein DsCas9

2) csRNA DsCas9

3) tracer RNA DsCas9

4) DNA target

The determination of the sequence of RNA guides by RNA sequencing (Table 1) allowed the synthesis of crRNA and tracrRNA molecules in vitro . The synthesis was performed using the NEB HiScribe T7 RNA synthesis kit. The double-stranded target DNAs were RNA fragments of 374 nucleotide pairs (bp) containing a protospacer sequence flanked by the corresponding PAM sequences from the 3 'end: 5'-

XXXXXXX - variable PAM plot. Different PAM sequences were used depending on the experimental conditions.

RNA guides of the following sequence were used to cut such targets:

DsCas9 tracrRNA:

CCUAUCGCUCUGGGAAAUGGGCUCUGCCGCuAACAAGGAGAAACUUGUUGGAUCAGGACUCCACAAGAUGAGACGGCUCCCUCGUGGGGCCGUUUUCUUUUU

DsCas9 CrRNA 1:

uaucuccuuucauugagcac GUUGCGGCCAGAGCUCAUUUCCCAGAGCGAUAGGCU

or

DsCas9 CrRNA 2:

ucaaggaccuuaucuccuuucauugagcac GUUGCGGCCAGAGCUCAUUUCCCAGAGCGAUAGGCU

To obtain the recombinant protein DsCas9, its gene was cloned into the plasmid pET21a. From the N-terminus, an MBP protein was added to the DsCas9 sequence to increase solubility. Rosetta E. coli cells were transformed with the resulting plasmid pET21a MBP_DsCas9_6xHis.

500 l of the overnight culture was diluted in 500 ml of medium LB, and the cells were grown at ³⁷ ° C until the optical density 0.6 RLU Synthesis of the desired protein induced by addition of IPTG to a concentration of 1 mM, and the cells were incubated ^at 20 ° C for 6 hours. Then the cells were centrifuged at a speed of 5000 g for 30 minutes, the resulting precipitates were frozen at a temperature of -20 ^o C.

Precipitation was thawed on ice for 30 minutes, resuspended in 15 ml of lysis buffer (Tris-HCl 50 mM pH 8, 500 mM NaCl, β-mercaptoethanol 1 mM, imidazole 10 mM) with the addition of 15 mg lysozyme and again incubated on ice for 30 minutes. Then the cells were destroyed by exposure to ultrasound for 30 minutes and centrifuged for 40 minutes at a speed of 16000 g. The resulting supernatant was passed through a 0.2 μm filter and applied onto a HisTrap HP 1 mL column (GE Healthcare) at a rate of 1 ml / min.

Chromatography was performed using an AKTA FPLC chromatograph (GE Healthcare) at a rate of 1 ml / min. The protein-coated column was washed with 20 ml of lysis buffer supplemented with 30 mM imidazole, after which the protein was washed with lysis buffer supplemented with 300 mM imidazole.

Then, the protein fraction obtained by affinity chromatography was passed through a Superdex 200 10/300 GL gel filtration column (24 ml), equilibrated with the following buffer: Tris-HCl 50 mM pH 8, 500 mM NaCl, 1 mM DTT. With Amicon concentrator (filtered on a 30 kDa) fractions corresponding to the monomeric form of the protein DsCas9, concentrated to 3 mg / ml, after which the purified protein was stored at -80 ^{° C} in buffer containing 10% glycerol.

An in vitro DNA cutting reaction was carried out under the following conditions.

The reaction mixture consisted of:

1X CutSmart Buffer (NEB),

5 mM DTT,

40 nM DNA target

2 μM tRNA / cRRNA,

400 nM DsCas9 protein.

The reaction was carried out at a temperature of 37 ° C

Several specific PAM sequences presumably recognized by DsCas9 nuclease were selected from in vivo screening data. Target DNA carrying these PAM sequences was tested for nuclease cut efficiency. As a result, the DsCas9 protein recognized the following 7-nucleotide PAM sequence: 5'-AACAACG-3 ', in accordance with the PAM consensus 5'-NA / GNNACN-3' (Fig. 4).

The length of the RNA did not affect the activity of DsCas9, and therefore, a shorter RNA guide, DsCas9 cRRNA 1, was chosen for work.

In order to identify the positions of the PAM sequence that are significant for specific recognition of DsCas9, target DNAs containing single nucleotide substitutions in the 5'-AACAACG-3 'sequence were synthesized. Each of the 7 PAM nucleotides was alternately replaced from purine to pyrimidine or vice versa. The result of the in vitro DsCas9 cutting reaction of such target DNAs showed the significance of nucleotide C at the 6th position of the PAM sequence (Fig. 5). Replacing C with G at this position led to a violation of the specific recognition of the target by nuclease, which led to the prevention of cutting. Substitutions in the remaining positions did not affect the nuclease activity of DsCas9, which may indicate a strict requirement for the nucleotide composition of PAM sequence only in the 6th position.

As a result of in vitro studies, as well as studies of the operation of the system in bacteria, the following conclusion was made: the PAM recognized by DsCas9 nuclease corresponds to the following formula 5’-NA / GNNACN-3 ’. And only C in the sixth position is a strict requirement of DsCas9.

The following examples of the method are given in order to disclose the characteristics of the present invention and should not be construed as in any way limiting the scope of the invention.

Example 1 Testing the activity of the DsCas9 protein in cutting various target DNAs.

The use of Cas nucleases for introducing double-strand breaks at various sites of human DNA cells requires the effective recognition by nuclease of different target DNAs. Therefore, the next step in the biochemical characterization of DsCas9 after determining and validating the PAM sequence was to verify the efficiency of protein cutting of various DNA sites in vitro .

The ability of DsCas9 to cut various targets was tested on a PCR fragment of the human gene grin2b, length 1592 base pairs.

gagagagatggccaaggcttatattctatagagcattatgtccttagtttgatgcatagaataagatttagggtcatatgtggaagtaaaaaggaaggagttctttgtaggtaaaaggtggcaaattatatgaaaatacggtatcagtcattttagggaagtcacgactataggatggcatcaggaaaaaaaaaggaacatttttcaaatgtggctctaacattacttcagctgctaatggtatttgtttaagtttctgtattttggtgtataaatagattggagtaatatgtgttccttataataattggttatatgagaggcagttccacgtagtgtaatagaacacatattggaatacaaaagtcagaagatctgggttcaggtttgtttcacttaattgattggttcatggtcttagaacacttagcttctctgagccttggcgtcaacatttataaaaatggtgataataatgtttttcttattttattccctactgggtcattgtaaggatcaattgaggcaatgttttaaaactactagtcatgtatcagttgttcttgtagtttaatattaagagccagatactaacaaggttactaaagaattttctggctgttgtcctcattgaggcaaacataaggtgaaggcagcaagaatgcagggcttgtgtacttatagccccccacatccagtttatccagcccatgttctgttgctcacctctgctgagcacgtttttctgctcactttgtctggccttgctttccttcagcccaagaacagtacaagggtgggctgtaacaggagggccaggagatttgtgtatgcatactcgcatggctacctggaccactcacaacctcttttcctcctttgtctctgcctgtagctgccaatgactatagcaatagcaccttttattgccttgttcaaggatttctgaggcttttgaaagtttcattttctctcattctgcagagcaaataccagagat aagagagtaggctggtagatggagttgggtttggtgctcaatgaaaggagataaggtccttgaattgcagtatctagcctcttctaagacaggttacgtgatgtagatcctattttaacatgctctttctttgtgtttgcagggagtcgacgagttgaagatgaagcccagagcggagtgctgttctcccaagttctggttggtgttggccgtcctggccgtgtcaggcagcagagctcgttctcagaagagcccccccagcattggcattgctgtcatcctcgtgggcacttccgacgaggtggccatcaaggatgcccacgagaaagatgatttccaccatctctccgtggtaccccgggtggaactggtagccatgaatgagaccgacccaaagagcatcatcacccgcatctgtgatctcatgtctgaccggaagatccagggggtggtgtttgctgatgacacagaccaggaagccatcgcccagatcctcgatttcatttcagcacagactctcacccccatcctgggcatccacgggggctcctctatgataatggcagataaggtaaaaaggggctgcagggag

Five sites with PAM sequences presumably recognized by DsCas9 based on in vivo and in vitro data were selected on this site (Table 2):

Table 2. The sequences of PAM and the corresponding prosseiser located on the human grin2b gene.

PAM (5’-3 ’) Protospacer (5’-3 ’) Aacact TCTTAATATTAAACTACAAG CACAACC GCATGGCTACCTGGACCACT Actact CAATTGAGGCAATGTTTTAA CACGACT ATCAGTCATTTTAGGGAAGT Tacaaaa TAATAGAACACATATTGGAA

To recognize these sites, cRRNAs were synthesized with a direct repeat (DR) sequence of DsCas9 and a spacer sequence corresponding to the selected protospacer.

Next, an in vitro reaction was performed by cutting the target DNA with the DsCas9 protein in combination with the obtained cRRNA and tracer RNA. The reactions were carried out according to the standard scheme.

The DsCas9 enzyme successfully recognized and cut all five targets (Fig. 6). The protein has been shown to be highly effective in specific DNA cleavage for all five targets. DNA cutting is specific: the reaction products have the length expected in accordance with the position of the DNA recognition site.

Thus, the conducted research tests showed the presence of nuclease activity in DsCas9, and also allowed us to determine its PAM sequence and verify the sequence of the directing RNAs.

The DsCas9 ribonucleoprotein complex specifically introduces target gaps limited by the PAM 5’-NA / GNNACN-3 ’c 3’ end of the protospacer. The scheme of the DsCas9 RNA complex is shown in FIG. 7.

Example 2 Cas9 proteins from closely related organisms belonging to D. sediminicola.

To date, no enzyme of the CRISPR-Cas9 system has been characterized in D. sediminicola . A comparable Cas9 protein from Staphylococcus aureus is 30% identical to DsCas9 (Fig. 8, the degree of identity was calculated using the BLASTp program, default parameters). A similar degree of identity was established for other known Cas9 proteins (not shown).

Thus, the DsCas9 protein is significantly different in amino acid sequence from other Cas9 proteins studied to date.

It is obvious to a person skilled in the field of genetic engineering that the version of the DsCas9 protein obtained and characterized in this Description can be changed without changing the function of the protein itself (for example, by directed mutagenesis of amino acid residues that do not directly affect functional activity (Sambrook et al., Molecular Cloning: A Laboratory Manual, (1989), CSH Press, pp. 15.3-15.108)). In particular, one skilled in the art knows that non-conservative amino acid residues can be changed without affecting the residues that determine the functionality of the protein (determining its function or structure). Examples of such changes are the replacement of non-conservative amino acid residues with homologous ones. Some of the sites containing non-conservative amino acid residues are shown in FIG. 12. In some embodiments of the invention, it is possible to use a protein containing an amino acid sequence that is at least 95% identical to the amino acid sequence of SEQ ID NO: 1 and has differences compared to SEQ ID NO: 1 only in non-conservative amino acid residues, for the formation of double-stranded a gap in the DNA molecule located immediately before the nucleotide sequence of 5'-NA / GNNACN-3 'in the specified DNA molecule. Homologous proteins can be obtained by mutagenesis (e.g., site-directed or PCR-mediated mutagenesis) of the corresponding nucleic acid molecules, followed by testing the encoded modified Cas9 protein to maintain its functions in accordance with the functional assays described here.

Example 3 The DsCas9 system described in the present invention in combination with RNA directors can be used to change the sequence of the genomic DNA of a multicellular organism, including a eukaryotic one. For the introduction of the DsCas9 system in combination with directing RNA into the cells of this organism (to all cells or to part of cells), various approaches known to those skilled in the art can be applied. For example, methods for delivering CRISPR-Cas9 systems to cells of organisms are disclosed in sources (Liu C et al., Delivery strategies of the CRISPR-Cas9 gene-editing system for therapeutic applications. J Control Release. 2017 Nov 28; 266: 17-26; Lino CA et al., Delivering CRISPR: a review of the challenges and approaches. Drug Deliv. 2018 Nov; 25 (1): 1234-1257), and in the sources disclosed within these sources.

For efficient expression of DsCas9 nuclease in eukaryotic cells, it will be desirable to optimize the codons for the amino acid sequence of the DsCas9 protein by methods known to those skilled in the art (e.g., IDT codon optimization tool).

For the effective functioning of DsCas9 nuclease in eukaryotic cells, it is necessary to import this protein into the nucleus of the eukaryotic cell. For this, a nuclear localization signal from the SV40 virus T-antigen (Lanford et al., Cell, 1986, 46: 575–582) connected to the DsCas9 sequence using the spacer sequence described in Shen B, et al. "Generation of gene-modified mice via Cas9 / RNA-mediated gene targeting", Cell Res. 2013 May; 23 (5): 720-3 or without. Thus, the complete amino acid sequence of the nuclease transported into the nucleus of a eukaryotic cell will be the following sequence: MAPKKKRKVGIHGVPAA-DsCas9-KRPAATKKAGQAKKKK (hereinafter DsCas9 NLS). At least two approaches can be used to deliver a protein with the above amino acid sequence.

Delivery in the form of a gene is accomplished by creating a plasmid carrying the DsCas9 NLS gene under the regulation of the promoter (for example, the CMV promoter) and a sequence encoding RNA guides under the regulation of the U6 promoter. As DNA targets, DNA sequences flanked by 3’-NA / GNNACN-5 ’are used, for example, the sequences of the human grin2b gene:

5’-TCTTAATATTAAACTACAAG-3 ’

Thus, the cRRNA expression cassette is as follows:

Gagggcctatttcccatgattccttcatatttgcatatacgatacaaggctgttagagagataattggaattaatttgactgtaaacacaaagatattagtacaaaatacgtgacgtagaaagtaataatttcttgggtagtttgcagttttaaaattatgttttaaaatggactatcatatgcttaccgtaacttgaaagtatttcgatttcttggctttatatatcttgtggaaaggacgaaacaccg TCTTAATATTAAACTACAAG GUUGCGGCCAGAGCUCAUUUCCCAGAGCGAUAGGCU

The bold sequence of the U6 promoter is shown in bold, then the sequence necessary for recognition of the target DNA, the sequence of the direct repeat is highlighted in red.

The cassette for the expression of tracer RNA is as follows:

gagggcctatttcccatgattccttcatatttgcatatacgatacaaggctgttagagagataattggaattaatttgactgtaaacacaaagatattagtacaaaatacgtgacgtagaaagtaataatttcttgggtagtttgcagttttaaaattatgttttaaaatggactatcatatgcttaccgtaacttgaaagtatttcgatttcttggctttatatatcttgtggaaaggacgaaacaccgCCTATCGCTCTGGGAAATGGGCTCTGCCGCTAACAAGGAGAAACTTGTTGGATCAGGACTCCACAAGATGAGACGGCTCCCTCGTGGGGCCGTTTTCTTTTT

The sequence of the U6 promoter is highlighted in bold, followed by the sequence encoding tracer RNA.

Plasmid DNA is purified and transfected into HEK293 human cells using Lipofectamine 2000 reagent (Thermo Fisher Scientific). Cells are incubated for 72 hours, after which genomic DNA is isolated from them using genomic DNA purification columns (Thermo Fisher Scientific). The target DNA site is analyzed by sequencing on the Illumina platform to determine the number of insertions-deletions in the DNA occurring in the target site due to directional double-strand break and its subsequent repair.

For amplification of the target fragments, primers flanking the putative gap site are used.

After amplification, samples are prepared using the Ultra II DNA Library Prep Kit for Illumina (NEB) reagent protocol to prepare samples for high throughput sequencing. Then sequencing is carried out on the Illumina 300cycles platform, direct reading. Sequencing results are analyzed by bioinformatics methods. An insertion or deletion of several nucleotides in the target DNA sequence is taken as a cut detection.

Delivery in the form of a ribonucleic complex is carried out by incubation of the recombinant form of DsCas9 NLS with RNA guides in CutSmart buffer (NEB). Recombinant protein is obtained from bacterial producer cells by purification using affinity chromatography (NiNTA, Qiagen) by size separation (Superdex 200).

The protein is mixed with RNA in a ratio of 1: 2: 2 (DsCas9 NLS: crRNA: tracrRNA), incubated for 10 minutes at room temperature, then the mixture is transfected into cells.

The following is an analysis of the DNA extracted from them for insertion deletions in the target DNA site (as described above).

The DsCas9 nuclease described in the present invention from the bacterium D. sediminicola has several advantages over the previously characterized Cas9 proteins.

DsCas9 has a short, three-letter, distinct from other Cas casinucleases PAM motif necessary for the functioning of the system. In the invention, it was shown that for the functioning of DsCas9, the presence of a short PAM motif located several nucleotides from the protospacer is sufficient.

Today, the majority of Cas nucleases capable of introducing double-stranded DNA breaks have complex multi-letter PAM sequences that limit the choice of sequences suitable for cutting. Among Cas nucleases studied that recognize short PAM, only DsCas9 can recognize sequences flanked by a 3’-NA / GNNACN-5 ’motif. Despite the three-letter PAM, the possibility of using purines A or G in the second position expands the range of targets that can be changed.

The second advantage of DsCas9 is the small size of the protein (1021 a.o.). To date, this is the only small protein studied that has the NA / GNNACN PAM sequence.

DsСas9 is a new, small-sized Cas nuclease, which has a relatively short, easy to use PAM, which differs from the currently known PAM sequences of other nucleases. Protein DsCas9 cuts various target DNAs at 37 ° C with high efficiency, and can become the basis of a new genomic editing tool.

Although the invention has been described with reference to the disclosed embodiments, it should be apparent to those skilled in the art that the specific cases described in detail are for illustrative purposes only and should not be construed as limiting the scope of the invention in any way. It should be understood that various modifications are possible without departing from the gist of the present invention.

--->

LIST OF SEQUENCES

<110> Autonomous non-profit educational organization of higher education "Skolkovo Institute of Science and Technology"

<120> DNA CUTTING AGENT BASED ON CAS9 PROTEIN FROM DEMEQUINA SEDIMINICOLA BACTERIA

<130> 1

<160> 2

<210> 1

<211> 1021

<212> PRT

<213> Demequina sediminicola

<220>

<223> protein homologous to Cas9

<400> 1

Met Thr Gly Thr Asp Ala Thr Ala His Ser His Thr Pro Tyr Arg Leu

1 5 10 15

Gly Leu Asp Val Gly Thr Gly Ser Leu Gly Trp Ala Val Val Glu Leu

20 25 30

Asp Thr Asp Gly Asn Pro Val Arg Ile Val Arg Thr Gly Ser Arg Ile

35 40 45

Tyr Gly Ser Gly Arg Lys Pro Lys Asp Phe Ser Ser Leu Ala Ala Asp

50 55 60

Arg Arg Ala Ala Arg Gln Met Arg Lys Gln Arg Asp Arg Tyr Leu Gln

65 70 75 80

Arg Arg Thr Arg Leu Met His Glu Leu Val Ala Ala Gly Leu Met Pro

85 90 95

Glu Ala Glu Val Glu Arg Gln Lys Leu Lys Asp Leu Asn Pro Tyr Leu

100 105 110

Leu Arg Ala Arg Gly Val Lys Glu Glu Leu Thr Ala His Glu Leu Gly

115 120 125

Arg Ala Leu Phe His Leu Gln Gln Arg Arg Gly Phe Lys Ser Asn Arg

130 135 140

Lys Thr Asp Arg Lys Asp Asp Asp Arg Ser Ala Met Lys Ser Ala Ile

145 150 155 160

Ala Ser Leu Gln Ser Asp Leu Gly Asp Asp Thr Leu Gly Thr Tyr Met

165 170 175

Trp Lys Arg Ile Gln Asn Gly Glu Ser Val Arg Ser Arg Pro Arg Lys

180 185 190

Val Gly Ser Lys Asn Glu Tyr Asp Phe Tyr Val Asn Arg Ala Met Val

195 200 205

Glu Asp Glu Phe Asn Gln Leu Trp Asp Tyr Gln Ser Gln Ser His Gly

210 215 220

Asp Leu Leu Thr Asp Glu Ala Arg Ile Arg Val His Asp Ala Ile Phe

225 230 235 240

Ser Gln Arg Pro Leu Lys Pro Val Asp Pro Gly Arg Cys Thr Phe Glu

245 250 255

Thr Asp Gln Arg Arg Ala Pro Lys Ala Leu Pro Ser Ser Gln Leu Phe

260 265 270

Arg Ile Tyr Gln Glu Leu Asn Ala Ile Arg Val Ile Asp Pro Phe Ser

275,280,285

Ser Asp Gln Ala Asp Arg Pro Leu Thr Arg Gln Glu Arg Asp Ala Gly

290 295 300

Ala Ser Phe Leu Leu Gly Arg Val Lys Ala Thr Phe Pro Gln Leu Lys

305 310 315 320

Lys Ala Met Phe Gly Pro Thr Lys Leu Gln Leu Ser Leu Glu Tyr Gly

325 330 335

Glu Arg Lys Asn Ile Leu Gly Asp Val Val Gly Ser Glu Leu Arg Lys

340 345 350

Ala Gln His Ile Gly Pro Asp Trp Glu Thr Tyr Asp Leu Ala Thr Gln

355 360 365

Asp Leu Ile Val Thr Ile Leu Leu Glu Ala Asp Thr Asp Asp Glu Val

370 375 380

Ile Glu Arg Leu Gln Ala Glu Ser Ser Leu Ser Leu Asp Gln Val His

385 390 395 400

Gly Ala Leu Glu Ala Pro Leu Pro Asp Asp Tyr Leu Arg Leu Ser His

405 410 415

Arg Ala Ile Gly Lys Ile Leu Pro His Leu Lys Asp Glu Trp Asn Glu

420 425 430

Glu Gly Asn Ala Pro Val Met Tyr Asp Ala Ala Val Arg Ala Ala Gly

435 440 445

Tyr Gln Ser His Ser Glu Phe His Ser Gly Val Leu Glu Asp Thr Leu

450 455 460

Pro Tyr Tyr Gly Lys Val Leu Lys Arg Tyr Thr Gln Glu Val Ser Gly

465 470 475 480

Ser Ser Gln Ala Ala Thr Asn Pro Asp Glu Trp Glu Phe Gly Lys Ile

485 490 495

Ala Asn Pro Thr Val His Ile Gly Leu Asn Gln Ile Arg Thr Val Val

500 505 510

Asn Ser Leu Ile Asp Arg Tyr Gly Leu Pro Thr Gln Ile His Val Glu

515 520 525

Val Ala Arg Asp Leu Gly Gln Ser Ala Glu Gly Arg Arg Glu Ala Ala

530 535 540

Ser Asn Arg Ala Lys Asn Glu Arg Ala Asn Glu Ala Leu Asn Ala Arg

545 550 555 560

Leu Thr Glu Leu Gly Gln Arg Thr Asn Phe Ala Asn Arg Glu Arg Leu

565 570 575

Arg Leu Tyr Asp Glu Ile Ser Val Leu Asn His Arg Cys Val Leu Thr

580 585 590

Gly Ile Pro Ile Glu Met Ser Arg Leu Phe Thr Asn Asp Tyr Gln Val

595 600 605

Asp His Ile Leu Pro Phe Ser Arg Thr Leu Asp Asp Ser Arg Gly Asn

610 615 620

Lys Ile Leu Val His His Thr Ala Asn Gln Phe Lys Gly Ala Arg Ser

625 630 635 640

Pro Phe Glu Ala Tyr Ser Glu Thr Ala Asp Trp Asp His Ile Leu Gln

645 650 655

Arg Ala Ser Asp Ala Phe Gly Ala Thr Ser Pro Lys Phe Lys Arg Phe

660 665 670

Ser Ala Asp Ala Met Asp Arg Tyr Ser Asn Gly Glu Gln Asp Phe Ile

675 680 685

Ala Arg Gln Leu Asn Asp Thr Ser Tyr Leu Ala Arg Val Thr Arg Glu

690 695,700

Tyr Leu Gly Ser Ile Val Asp Pro Asp Arg Ile Leu Ala Thr Pro Gly

705 710 715 720

Arg Leu Thr Ser Leu Leu Arg His His Trp Gly Leu Asn Gly Leu Leu

725 730 735

Ser Asp Ala Ala Glu Lys Asn Arg Ser Asp His Arg His His Ala Ile

740 745 750

Asp Ala Leu Val Val Ala Leu Ser Glu Arg Val Thr Leu Lys Ala Val

755,760,765

Thr Asp Ala Asn Arg Arg Ala Gly Asp Gln Gly Ile Glu Arg Leu Leu

770 775 780

Val Asp Leu Pro Gln Pro Trp Glu Gly Phe Ala Asp His Ala Arg Glu

785 790 795 800

Ser Val Asp Arg Ile Val Val Ser His Lys Pro Asp His Asn Glu Lys

805 810 815

Gly Gln Leu His Glu Glu Thr Ala Tyr Gly Val Leu Glu Gly Pro Asp

820 825 830

Lys Lys Gly Arg Phe Leu Thr Arg Lys Arg Ile Thr Asp Pro Ala Lys

835 840 845

Gly Val Val Gly Ser Trp Glu Gln Pro Lys Trp Arg Asp Val Ile Pro

850 855 860

Leu Tyr Arg Arg Gly Glu Gly Pro Asp Ser Thr Leu Pro Tyr Lys Ala

865 870 875 880

Tyr Ile Gly Gly Ser Asn Tyr Cys Ile Glu Ile Val Arg Thr Ala Lys

885 890 895

Gly Lys Trp Ala Gly Glu Val Val Ser Thr His Thr Ala Asn Thr Ala

900 905 910

Glu Tyr Arg Ala Phe Met Ala Glu Pro Gly Ala Tyr Arg Ala Gln Ser

915 920 925

Tyr Ala Gly Gly Asp Leu Val Met Arg Leu Ile Ala Asn Asp Thr Ile

930 935 940

Ala Ile Glu Val Gly Asp Ala Gly Arg Gln Ile Met Arg Leu Cys Gln

945 950 955 960

Leu Glu Thr Val Gly Ala Met Tyr Phe Ala Asn Val Arg Glu Gly Asn

965 970 975

Val Ala Ala Arg Ser Arg Ala Arg Asp Asn Asp Phe Ser Leu Leu Lys

980 985 990

Lys Ala Ala Ser Thr Leu Gln Pro Leu Lys Ala Arg Arg Val Phe Val

995 1000 1005

Asp Pro Ile Gly Arg Val Phe Asp Pro Asp Phe Lys Glu

1010 1015 1020

<210> 2

<211> 3066

<212> DNA

<213> Demequina sediminicola

<220>

<223> protein homologous to Cas9

<400> 2

atgactggca ctgacgccac agcacactcg cacacgccgt accgcctcgg gctcgatgta 60

gggacaggat ctttgggttg ggccgtcgtt gaactcgata ccgacggcaa tcctgtccgc 120

atcgtgcgca ccggctcgcg gatctatggg agcgggcgca aacccaagga cttttcatcg 180

ttagcggccg accggcgtgc cgcacgtcag atgcgcaagc aacgcgaccg ctatcttcaa 240

cgccgcacgc gcctcatgca tgaactggtg gccgccggtc tgatgcccga ggccgaggtg 300

gagcggcaga agctcaagga tctcaacccc tacctgctac gcgctcgtgg ggttaaagag 360

gaactgaccg cccacgaact tggcagggct ctctttcatc tccagcagcg ccgtggcttc 420

aagtcaaatc gcaagacaga ccgcaaggac gacgaccgca gcgcgatgaa gagcgccatc 480

gcatcgctcc aatccgactt gggcgacgac acccttggca cgtacatgtg gaagcggatc 540

cagaacggcg aatctgtgcg gtcccgtccg cgaaaggtcg ggtcaaagaa cgagtacgac 600

ttttacgtga accgcgcgat ggtcgaggat gagttcaatc agttgtggga ctaccaaagc 660

cagtcccacg gcgacctcct cacggacgaa gcccgcatcc gcgttcatga cgccatcttt 720

agccaacgtc cgctcaagcc ggtggacccg gggcgctgca cgttcgaaac agatcagcga 780

cgcgcaccga aggcactccc gagctctcaa ctgttccgca tctaccaaga acttaacgcg 840

atcagagtga tcgatccgtt ctcatcagac caagcagatc gacccctgac gcgtcaggag 900

cgcgatgccg gcgcatcgtt cctcctgggc agggtgaagg ccaccttccc tcaactcaag 960

aaggcgatgt ttgggcccac aaagctccaa ctctcacttg agtacggaga acgcaagaac 1020

atcctgggtg acgtcgtagg aagcgagttg cgcaaagcgc agcacatcgg cccagactgg 1080

gagacgtatg acctcgccac ccaggacctc atcgtgacga tcctgctcga ggcagacact 1140

gacgatgaag tgatcgagcg gcttcaggct gagtcgtcgc tatcgctcga tcaggtccac 1200

ggcgcgcttg aggcaccact cccggacgac tacctacggc tgagccatcg tgcgattggc 1260

aagatcctgc ctcatctcaa ggatgaatgg aatgaagagg gcaatgcacc ggtgatgtat 1320

gacgcggccg tccgtgccgc gggataccaa tcgcactcag agttccacag cggtgttctt 1380

gaagacacgc tcccctatta cgggaaggtg ctgaagcgat acacgcaaga ggtctccggg 1440

agcagccaag ctgctacgaa ccctgacgaa tgggagttcg gcaagatcgc caatccgacc 1500

gtgcacatcg gcctcaatca gatccgcacc gtcgtgaact cactgattga ccgctacggc 1560

ctgcccacac agattcatgt cgaggtagcc cgcgacttgg gccagtcggc tgagggaagg 1620

cgtgaagcag cgtccaaccg tgccaagaat gaacgagcaa acgaagcgct caacgcccgc 1680

ctgaccgaac tgggacaacg caccaacttt gccaatcggg agcggctgcg cctctacgat 1740

gagatctcag tcctcaatca caggtgtgtc ctgacaggca tccccatcga gatgtcgcga 1800

ctgttcacca atgactatca ggttgaccac atcctgccgt tctcccggac cctggacgac 1860

tcgcgcggaa acaagattct ggttcaccac acggccaatc agttcaaggg cgcccggagc 1920

cccttcgagg catactcgga gacggcagac tgggatcaca tccttcaacg cgcaagcgat 1980

gcctttggcg ctacgagccc caagttcaag cgcttttctg ccgacgccat ggacaggtac 2040

tcgaacggcg agcaagactt catcgcccgc caactcaacg acaccagcta cctggcacga 2100

gtgacacgcg agtatctagg gagcatcgtg gatcccgacc ggatcctagc cacaccgggc 2160

agacttactt cgctcttgcg ccaccactgg gggctcaatg gcctgctatc cgatgccgcg 2220

gagaagaacc gctcagatca ccggcaccac gccatcgatg cccttgtcgt tgcactcagt 2280

gagcgagtaa ctctaaaggc cgtcaccgac gccaaccgtc gtgccggtga ccaaggcatc 2340

gaacgcttgc tagtcgacct cccccagccg tgggagggct ttgcggatca tgcccgtgag 2400

tctgttgatc gcattgtggt gtctcacaag ccagatcaca atgagaaagg ccagctccac 2460

gaagagaccg cctatggagt cctggaaggg cccgacaaaa agggcaggtt cctcacccgc 2520

aagcgcatca cggaccctgc caaaggtgtg gtaggcagtt gggagcaacc caagtggcgt 2580

gacgtcattc cgctgtacag gcgcggcgag gggccagact cgacccttcc ctacaaggct 2640

tacattggcg gctccaacta ctgcatcgag atcgtccgaa ctgccaaggg gaaatgggct 2700

ggggaggtag tctccacgca caccgccaac acggccgagt atcgcgcttt catggcagag 2760

ccgggcgcgt atcgcgccca gagttacgcc ggtggtgacc tcgtcatgcg gctcatcgcc 2820

aatgacacca tcgcaatcga agtcggcgat gcgggtcgcc agatcatgag gctgtgccag 2880

ttggagacgg tcggagctat gtacttcgca aatgtgcgtg aaggcaacgt cgcagcacgt 2940

tcacgggctc gagacaacga cttttcgttg ctcaagaagg cggcaagcac acttcagcca 3000

ctcaaggctc ggagagtctt tgttgatccc attggcaggg tttttgaccc tgatttcaag 3060

gagtag 3066

<---

Claims (6)

1. The use of a protein containing the amino acid sequence of SEQ ID NO: 1 or containing an amino acid sequence that is at least 95% identical to the amino acid sequence of SEQ ID NO: 1 and has differences compared to SEQ ID NO: 1 only in non-conservative amino acid residues, for the formation of double-strand break in the DNA molecule located immediately before the nucleotide sequence 5'-NA / GNNACN-3 'in the specified DNA molecule. 2. The use of the protein according to claim 1, characterized in that the formation of double-strand break in the DNA molecule occurs at a temperature of 37 ° C. 3. The use of the protein of claim 1, wherein the protein contains the amino acid sequence of SEQ ID NO: 1. 4. A method of forming a double-strand break in the genomic DNA sequence of a unicellular or multicellular organism directly adjacent to the 5'-NA / GNNACN-3 'sequence, comprising introducing into at least one cell of this organism an effective amount of: a) a protein containing the SEQ amino acid sequence ID NO: 1, or a nucleic acid that encodes a protein containing the amino acid sequence of SEQ ID NO: 1, and b) an RNA guide containing a sequence that forms a duplex with the nucleotide sequence of a portion of the body's genomic DNA directly adjacent to the 5'-NA / GNNACN-3 'and interacting with the specified protein after the formation of a duplex, or a DNA sequence encoding the specified guide RNA; wherein the interaction of the indicated protein with the indicated RNA guide and the 5'-NA / GNNACN-3 'nucleotide sequence leads to the formation of a double-stranded gap in the genomic DNA sequence directly adjacent to the 5'-NA / GNNACN-3' sequence. 5. The method of claim 4, further comprising administering an exogenous DNA sequence simultaneously with the RNA guide.

Images