EA041935B1 - DNA CUTTER BASED ON Cas9 PROTEIN FROM BACTERIA Pasteurella Pneumotropica - Google Patents

Description

SUBSTANCE: invention relates to biotechnology, namely to new Cas enzymes, nucleases of CRISPR-Cas systems, used for cutting DNA and editing the genome of various organisms. This technology can be used in the future for gene therapy of human hereditary diseases, as well as for editing the genome of other organisms.

State of the art

Changing the DNA sequence is one of the urgent tasks of biotechnology today. Editing and modifying the genomes of eukaryotic and prokaryotic organisms, as well as manipulations with DNA in vitro, require the targeted introduction of double-strand breaks in DNA sequences.

To solve this problem, the following methods are currently used: artificial nuclease systems containing zinc finger domains, TALEN systems, and bacterial CRISPR-Cas systems. The first two methods require labor-intensive optimization of the nuclease amino acid sequence to recognize a particular DNA sequence. In contrast to them, in the case of CRISPR-Cas systems, the structures that recognize the target DNA are not proteins, but short guide RNAs. Cutting a specific target DNA does not require de novo synthesis of the nuclease or its gene, but is achieved through the use of guide RNAs complementary to the target sequence. This makes CRISPR Cas systems convenient and efficient tools for cutting various DNA sequences. The technique allows one-time cutting of DNA in several regions using guide RNAs of different sequences. This approach is used, among other things, to simultaneously change several genes in eukaryotic organisms.

By their nature, CRISPR-Cas systems are prokaryotic immune systems capable of highly specific ruptures in the genetic material of viruses (Mojica F.J.M. et al. Intervening sequences of regularly spaced prokaryotic repeats derive from foreign genetic elements // Journal of molecular evolution. - 2005. - Vol 80. - No. 2. - P. 174-182). The abbreviation CRISPR-Cas stands for Clustered Regularly Interspaced Short Palindromic Repeats and CRISPR associated genes (Jansen R. et al. identification of genes that are associated with DMA repeats in prokaryotes // Molecular microbiology. - 2002. Vol. 43. - No. 8 . - P. 1565-1575), which translated from English means short palindromic repeats, regularly arranged in groups, and the genes associated with them. All CRISPR-Cas systems consist of CRISPR cassettes and genes encoding various Cas proteins (Jansen R. et al., Molecular microbiology. - 2002. - Vol. 43. - No. 6. - P. 1565-1575). CRISPR cassettes consist of spacer sequences, each having a unique nucleotide sequence, and repetitive palindromic repeats (Jansen R. et al., Molecular microbiology. - 2002. - Vol. 43. - No. 6. - P. 1565-1575). As a result of transcription of CRISPR cassettes and their subsequent processing, guide crRNAs are formed, which, together with Cas proteins, form an effector complex (Brouns S.J.J. et al. Small CRISPR RNAs guide antiviral defense in prokaryotes // Science. - 2008. - Vol. 321. - No. 5891. - P. 960-984). By complementary pairing of crRNA with a target DNA region, called a protospacer, Cas nuclease recognizes the target DNA and introduces a break in it in a highly specific manner.

CRISPR-Cas systems represented by a single effector protein are divided into six different types (from I to VI) depending on the Cas proteins that make up the systems. In 2013, it was first proposed to use the type II CRISPR-Cas9 system for editing the genomic DNA of human cells (Cong L., et al., Multiplex genome engineering using CRISPR/Cas systems. Science. 2013 Feb 15; 339(6121 ):819-23). The type II CRISPR-Cas9 system is characterized by a simple composition and mechanism of operation: its functioning requires the formation of an effector complex consisting of only one Cas9 protein and two short RNAs: crRNA (crRNA) and tracer RNA (tracrRNA). The tracer RNA pairs complementarily with a region of crRNA derived from the CRISPR repeat, forming a secondary structure necessary for binding guide RNAs to the Cas effector. Guide RNA sequencing is an important step in the characterization of previously unstudied Cas orthologues. The effector protein Cas9 is an RNA-dependent DNA endonuclease with two nuclease domains (HNH and RuvC) that introduce breaks in the complementary strands of the target DNA, thus forming a double-strand DNA break (Deitcheva E. et al. CRISPR RNA maturation by trans-encoded small RNA and host factor RNase III //Nature.-2011.-Vol.471.-No.7340.-P.602).

To date, several CRISPR-Cas nucleases are known that can introduce double-strand breaks in DNA in a targeted and specific manner. CRISPR-Cas9 technology is one of the most modern and rapidly developing methods for introducing breaks into the DNA of various organisms, ranging from bacterial strains to human cells, as well as in vitro (Song M. The CRISPR/Cas9 system: Their delivery, in vivo and ex vivo applications and clinical development by startups Biotechnol Prog 2017 Jul 33(4):1035-1045).

The effector ribonucleic complex, consisting of Cas9 and a duplex of crRNA and tracrRNA, for recognition and subsequent hydrolysis of DNA, in addition to the complementary correspondence of the crRNA spacer and protospacer, requires the presence of PAM (from the English PAM - protospacer adjusted motif) on

- 1 041935

Target DNA (Mojica F.J.M. et al., 2009). PAM is a strictly defined sequence of several nucleotides located in type II systems close to or a few nucleotides from the 3'-end of the protospacer on the non-targeted strand. In the absence of PAM, hydrolysis of DNA bonds with the formation of a double-strand break does not occur. The need for the presence of a PAM sequence on the target increases the specificity of recognition, but at the same time imposes a restriction on the choice of target DNA regions in which a break must be introduced. Thus, the presence of the desired PAM sequence, which flanking the target DNA from the 3' end, is a characteristic that limits the use of CRISPR-Cas systems on any DNA regions.

Different CRISPR-Cas proteins use different, original PAM sequences for their work. The use of CRISPR-Cas proteins with new diverse PAM sequences is necessary to ensure the possibility of changing any DNA region, both in vitro and in the genome of living organisms. Altering eukaryotic genomes also requires the use of small nucleases to enable delivery of CRISPR-Cas systems to cells via AAV viruses.

Despite the popularity of a number of methods for cutting DNA and changing the sequence of genomic DNA, today there is a need for new effective tools for modifying DNA in various organisms and at strictly defined places in the DNA sequence.

The essence of the invention

The objective of the present invention is to create new tools for changing the sequence of genomic DNA of unicellular or multicellular organisms based on CRISPR-Cas9 systems. Current systems are of limited use due to the specific PAM sequence that must be present at the 3' end of the DNA region to be modified. The search for new Cas9 enzymes with other PAM sequences will expand the arsenal of available tools for the formation of a double-strand break in the necessary, strictly defined places in the DNA molecules of different organisms. To solve this problem, the authors characterized the CRISPR type II nuclease PpCas9, previously predicted for the bacterium Pasteurella pneumotropica (P. pneumotropica), which can be used to introduce targeted changes in the genome of both this and other organisms. The essential features that distinguish the present invention are (a) a short PAM sequence different from other known ones; (b) the relatively small size of the characterized PpCas9 protein - 1055 amino acid residues (a.a.).

This problem is solved by using a protein containing the amino acid sequence of SEQ ID NO: 1 or containing an amino acid sequence that is at least 95% identical to the amino acid sequence of SEQ ID NO: 1 and differs compared to SEQ ID NO: 1 only in non-conservative amino acids. residues, to form a double-strand break in the DNA molecule, located immediately before the nucleotide sequence 5'-NNNN(A/G)T-3' in the specified DNA molecule. In some embodiments of the invention, this application is characterized in that the formation of a double-strand break in the DNA molecule occurs at a temperature of from 35 to 45°C.

This problem is also solved by creating a method for changing the genomic DNA sequence of a unicellular or multicellular organism, which includes introducing into at least one cell of this organism an effective amount of a) either a protein containing the amino acid sequence of SEQ ID NO: 1, or a nucleic acid encoding a protein containing amino acid sequence SEQ ID NO: 1; and b) either a guide RNA containing a sequence that forms a duplex with the nucleotide sequence of a portion of the organism's genomic DNA immediately adjacent to the 5'-NNNN(A/G)T-3' nucleotide sequence and interacts with said protein after duplex formation, or the sequence DNA encoding said guide RNA; in this case, the interaction of the specified protein with the guide RNA and the 5'-NNNN(A/G)T-3' nucleotide sequence leads to the formation of a double-strand break in the genomic DNA sequence immediately adjacent to the 5'-NNNN(A/G)T-3 sequence '. In some embodiments of the invention, this method is characterized in that it further includes the introduction of an exogenous DNA sequence simultaneously with the guide RNA.

As a guide RNA, a mixture of crRNA (crRNA) and tracer RNA (tracrRNA) can be used, capable of forming a complex with the target DNA site and the PpCas9 protein. In preferred embodiments of the invention, a hybrid RNA constructed from crRNA and tracer RNA can be used as guide RNA. Methods for constructing a hybrid guide RNA are known in the art (Hsu P.D., et al., DNA targeting specificity of RNA-guided Cas9 nucleases. Nat. Biotechnol. 2013 Sep; 31(9):827-32). One of the options for constructing hybrid RNA is disclosed in the examples below.

The invention can be used both for cutting the target DNA in vitro and for modifying the genome of any living organism. Genome modification can be carried out in a direct way - by cutting the genome at the appropriate site, as well as by inserting an exogenous DNA sequence due to homologous repair.

Any part of a double strand can be used as an exogenous DNA sequence.

- 2 041935 howling or single-stranded DNA from the genome of an organism other than the organism used for administration (or a mixture of such regions with each other and with other DNA fragments), while this region (or a mixture of regions) is intended to be integrated into the site of a double-strand break in the target DNA formed by the action of PpCas9 nuclease. In some embodiments of the invention, a portion of double-stranded DNA from the genome of an organism used when introducing the PpCas9 protein, but altered by mutations (substitution of nucleotides), as well as insertions or deletions of one or more nucleotides, can be used as an exogenous DNA sequence.

The technical result of the present invention is to increase the versatility of available CRISPR-Cas9 systems, allowing the use of the Cas9 nuclease to cut genomic or plasmid DNA at more specific sites and specific conditions.

Brief description of the drawings

Fig. Fig. 1. Scheme of the CRISPR PpCas9 system locus. DR - direct repeat, or direct repeat is a regularly repeated section that is part of a CRISPR cassette.

Fig. 2. PAM screening in vitro. Scheme of the experiment.

Fig. Fig. 3. Cutting fragments of the 7N library with PpCas9 nuclease at different reaction temperatures.

Fig. 4. (A) Analysis of the results of in vitro screening of PpCas9 nuclease using the calculation of the logarithm of the change in the proportion of each specific nucleotide at each PAM position (FC). (B) PAM Logo nuclease PpCas9. For each position, the frequencies of representation of adenine, cytosine, thymine, and guanine are indicated. The height of the letters corresponds to the frequency of the presence of the nucleotide in the given position of the PAM sequence.

Fig. 5. Testing the effect of single nucleotide substitutions in the first position of PAM on the efficiency of cutting the target DNA with the PpCas9 nuclease.

Fig. 6. Checking the significance of nucleotide positions in the PAM sequence of PpCas9.

Fig. Fig. 7. Checking the effect of the substitution of A for G at the 6th position of PAM on the efficiency of cutting the target DNA with the PpCas9 nuclease.

Fig. 8. Testing the effect of single nucleotide substitutions in the 7th position of PAM on the efficiency of cutting the target DNA with the PpCas9 nuclease.

Fig. 9. Cutting various DNA sites using the PpCas9 protein. Lanes 1 and 2 are positive controls.

Fig. 10. Verification of PpCas9 PAM nuclease recognition of the CAGCATT sequence. Lanes 1 and 2 are positive controls.

Fig. 11. Schematic of the PpCas9 DNA cutting tool.

Fig. 12. Target DNA cutting experiment. Hybrid guide RNAs of various lengths were used.

Fig. 13. Alignment of the amino acid sequences of PpCas9 and Cas9 proteins from Staphylococcus aureus using the NCBI BLASTp program (default parameters).

Detailed disclosure of the invention

In the description of this invention, the terms includes and including are interpreted as meaning includes, among other things. These terms are not intended to be construed as consisting solely of. Unless otherwise defined, technical and scientific terms in this document have the standard meanings generally accepted in the scientific and technical literature.

As used herein, the term percent homology of two sequences is equivalent to the term percent identity of two sequences. Sequence identity is determined based on the reference sequence. Algorithms for sequence analysis are known in the art, such as BLAST as described in Altschul et al., J. Mol. Biol., 215, p. 403-10 (1990). For the purposes of the present invention, comparison of nucleotide and amino acid sequences using the BLAST software package provided by the National Center for Biotechnology Information (http://www.ncbi.nlm.nih) can be used to determine the level of identity and similarity between nucleotide sequences and amino acid sequences. .gov/blast) using a broken alignment with default settings. The percent identity of two sequences is determined by the number of positions of identical amino acids in these two sequences, taking into account the number of gaps and the length of each gap, which must be entered for optimal matching of two sequences by alignment. The percent identity is equal to the number of identical amino acids at given positions, taking into account the alignment of the sequences, divided by the total number of positions and multiplied by 100.

The term specifically hybridizes refers to an association between two single-stranded nucleic acid molecules, or sufficiently complementary sequences, to permit such hybridization under predetermined conditions commonly used in the art.

Phrase double-strand break located immediately before the nucleotide sequence

- 3 041935 PAM accuracy means that a double-strand break in the target DNA sequence will be made at a distance of 0 to 25 nucleotides before the PAM nucleotide sequence.

An exogenous DNA sequence introduced simultaneously with a guide RNA is to be understood as a DNA sequence prepared specifically for the specific modification of a double-stranded target DNA at the break site determined by the specificity of the guide RNA. Such a modification may be, for example, the insertion or deletion of certain nucleotides at the site of a break in the target DNA. Exogenous DNA can be either a stretch of DNA from another organism or a stretch of DNA from the same organism as the target DNA.

A protein containing a specific amino acid sequence is to be understood as a protein having an amino acid sequence composed of the specified amino acid sequence and possibly other sequences linked by peptide bonds to the specified amino acid sequence. Other sequences are exemplified by the nuclear localization signal (NLS) sequence or other sequences that provide increased functionality for the specified amino acid sequence.

An exogenous DNA sequence introduced simultaneously with a guide RNA is to be understood as a DNA sequence prepared specifically for the specific modification of a double-stranded target DNA at the break site determined by the specificity of the guide RNA. Such a modification may be, for example, the insertion or deletion of certain nucleotides at the site of a break in the target DNA. Exogenous DNA can be either a stretch of DNA from another organism or a stretch of DNA from the same organism as the target DNA.

An effective amount of protein and RNA introduced into a cell should be understood as such an amount of protein and RNA that, when it enters the specified cell, will be able to form a functional complex, i.e. a complex that will specifically bind to the target DNA and produce a double-strand break in it at a location determined by the guide RNA and PAM sequence on the DNA. The efficiency of this process can be assessed by analyzing the target DNA isolated from said cell using standard methods known to those skilled in the art.

Delivery of protein and RNA into the cell can be carried out in various ways. For example, a protein can be delivered as a DNA plasmid that encodes the gene for that protein, as an mRNA for translation of that protein in the cytoplasm of a cell, or as a ribonucleoprotein complex that includes the protein and a guide RNA. Delivery can be accomplished by various methods known to those skilled in the art.

The nucleic acid encoding the components of the system can be introduced into the cell, directly or indirectly, by transfection or transformation of cells by methods known to those skilled in the art, by the use of a recombinant virus, by cell manipulation such as DNA microinjection, and the like.

Delivery of a ribonucleic complex consisting of a nuclease and guide RNAs and exogenous DNA (if necessary) can be carried out by transfection of the complexes into the cell or by mechanical introduction of the complex into the cell, for example, microinjection.

The nucleic acid molecule encoding the protein to be introduced into the cell may be integrated into a chromosome or may be extrachromosomally replicating DNA. In some embodiments, to ensure efficient expression of a protein gene with DNA introduced into a cell, it is necessary to change the sequence of this DNA in accordance with the cell type in order to optimize codons during expression due to the uneven frequency of occurrence of synonymous codons in the coding regions of the genome of different organisms. Codon optimization is required to increase expression in animal, plant, fungal, or microbial cells.

For a protein having a sequence that is at least 95% identical to the amino acid sequence of SEQ ID NO: 1 to function in a eukaryotic cell, the protein must be in the nucleus of that cell. Therefore, in some embodiments of the invention, a protein having a sequence that is at least 95% identical to the amino acid sequence of SEQ ID NO: 1 is used to form double-strand breaks in the target DNA, and which is further modified at one or both ends with the addition of one or more nuclear signals. localization. For example, a nuclear localization signal from the SV40 virus can be used. For efficient delivery to the nucleus, the nuclear localization signal can be separated from the main protein sequence by a spacer sequence, such as that described in Shen B., et al. Generation of gene-modified mice via Cas9/RNA-mediated gene targeting, Cell Res. May 2013; 23(5):720-3. Also, in other embodiments, a different nuclear localization signal or alternative method of delivering said protein to the cell nucleus can be used.

The present invention encompasses the use of a protein from P. pneumotropica homologous to previously characterized Cas9 proteins to introduce double-strand breaks in DNA molecules at well-defined positions. The use of CRISPR nucleases to introduce targeted changes in the genome has a number of advantages. First, the specificity of the system's action is determined by the crRNA sequence, which makes it possible to use one type of nuclease for all target loci. In

- 4 041935 secondly, the technique makes it possible to deliver into the cell several guide RNAs that are complementary to different target genes at once, which makes it possible to carry out a one-time change in several genes at once.

PpCas9 - Cas nuclease found in the bacteria Pasteurella pneumotropica ATCC 35149, which are pathogens of rodents that live in the lungs of animals. Pasteurella pneumotropica (P. pneumotropica) CRISPR Cas9 system (hereinafter CRISPR PpCas9) belongs to type IIC CRISPR Cas systems and consists of a CRISPR cassette carrying four direct repeats (DR) with a sequence of 5'ATTATAGCACTGCGAAATGAAAAAGGGAGCTACAAC3' separated by sequences of unique spacers. None of the spacers of the system matches in sequence with currently known bacteriophages or plasmids, which makes it impossible to determine the required PpCas9 PAM by bioinformatic analysis. The CRISPR cassette is adjacent to the gene of the Cas9 effector protein PpCas9, as well as the genes of the Casl and Cas2 proteins involved in adaptation and incorporation of new spacers. Next to the Cas genes, a sequence partially complementary to direct repeats was found, folding into a characteristic secondary structure, the putative tracer RNA (tracrRNA) (Fig. 1).

Knowledge of the characteristic architecture of the PHK-Cas protein complex of PS-type systems made it possible to predict the direction of transcription of the CRISPR cassette: pre-crRNA is transcribed in the opposite direction from Cas genes (Fig. 1).

Thus, sequence analysis of the PpCas9 locus made it possible to predict the tracer and guide RNA sequences (Table 1).

Table 1 Bioinformatically determined guide RNA sequences of the CRISPR PpCas9 system.

Bold indicates the direct repeat sequence DR

Name Subsequence ppCa&9 tRNA 5GCGAAATGAAAAAOGUUGUUACAAUAAGAGAUGAAUUUCUCGCAAAG CTCUGQCUCUUGAAAUUUGGGUUUCAAGAGGCAUCUUUUU-a' PpCas9 crRNA 5-xxxxxxxxkXXXXXXXxxxxGUUGUAGCUCCCUUUUUCAUUUCGC-3'

To test PpCas9 nuclease activity and determine the required PpCas9 PAM motif, experiments were performed to recreate the DNA cutting reaction in vitro. To determine the PAM sequence of the PpCas9 protein, in vitro cutting of double-stranded PAM libraries was used. To do this, it was necessary to obtain all components of the PpCas9 effector complex: guide RNA and nuclease in recombinant form. Sequencing of guide RNAs made it possible to synthesize crRNA and tracrRNA molecules in vitro. Synthesis was performed using the NEB Hi Scribe T7 RNA synthesis kit. Double-stranded DNA libraries were fragments of 374 base pairs (bp) containing the protospacer sequence flanked by randomized seven nucleotides (5'-NNNNNNNN-3') from the 3'-end:

5’cccggggtaccacggagagatggtggaaatcatctttttcgtgggcatccttgatggccacctcgtcggaagtgcccacgaggatga cagcaatgccaatgctgggggggctcttctgagaacgagctctgctgcctgacacggccaggacggccaacaccaaccagaactt gggagaacagcactccgctctgggcttcatcttcaactcg -3

Guide RNAs of the following sequence were used to cut this target: tracrRNA:

’ GCGAAATGAAAAACGUUGUUAC AAUAAGAGAUGAAUUUCUCGC AAAGCTCUGCC UCUUGAAAUUUCGGUUUCAAGAGGCAUCUUUUU and crRNA:

5' uaucuccuuucauugagcacGUUGUAGCUCCCUUUUUCAUUUCGC.

The crRNA sequence complementary to the protospacer (target DNA sequence) is highlighted in bold.

To obtain the recombinant PpCas9 protein, its gene was cloned into the pET21a plasmid. The DNA synthesized by Integrated DNA Technologies was used as the DNA encoding the gene. The sequence was codon-optimized to eliminate rare codons found in the P. pneumotropica genome. E. coli Rosetta cells were transformed with the resulting plasmid pET21 a-6xHis-PpCas9.

500 µl of overnight culture were diluted in 500 ml of LB medium and the cells were grown at 37°C until

- 5 041935 achieve an optical density of 0.6 rel. The synthesis of the target protein was induced by adding IPTG to a concentration of 1 mM, after which the cells were incubated at 20°C for 6 h. Then, the cells were centrifuged at a speed of 5000xg for 30 min, and the resulting cell pellets were frozen at -20°C.

The pellets were thawed on ice for 30 min, resuspended in 15 ml of lysis buffer (Tris-HCl 50 mM pH 8, 500 mM NaCl, β-mercaptoethanol 1 mM, imidazole 10 mM) supplemented with 15 mg of lysozyme, and again incubated on ice for 30 min. The cells were then disrupted by sonication for 30 min and centrifuged for 40 min at 16000xg. The resulting supernatant was passed through a 0.2 µm filter and applied to a HisTrap HP 1 mL column (GE Healthcare) at a rate of 1 mL/min.

Chromatography was performed using an AKTA FPLC chromatograph (GE Healthcare) at 1 ml/min. The protein loaded column was washed with 20 ml of lysis buffer with the addition of 30 mM imidazole, after which the protein was washed with lysis buffer with the addition of 300 mM imidazole.

The affinity chromatography protein fraction was then passed through a Superdex 200 10/300 GL gel filtration column (24 ml) equilibrated with the following buffer: Tris-HCl 50 mM pH 8, 500 mM NaCl, 1 mM DTT. Using an Amicon concentrator (with a 30 kDa filter), fractions corresponding to the monomeric form of the PpCas9 protein were concentrated to 3 mg/ml, after which the purified protein was stored at -80°C in a buffer containing 10% glycerol.

In vitro cutting reaction of linear PAM libraries was carried out in a volume of 20 µl under the following conditions. The reaction mixture consisted of 1X CutSmart buffer (NEB), 5 mM DTT, 100 nM PAM library, 2 μM tRNA/crRNA, 400 nM PpCas9 protein. Samples containing no RNA were prepared in a similar way as controls. Samples were incubated at different temperatures and analyzed by gel electrophoresis in 2% agarose gel. In the case of correct recognition and specific cutting of DNA by the PpCas9 protein, two DNA fragments of the order of 326 and 48 base pairs in length should be formed (see Fig. 2).

The results of the experiment showed that PpCas9 has nuclease activity and cuts part of the PAM library fragments. The temperature gradient (Fig. 3) showed that the protein is active in the temperature range of 35-45°C. Subsequently, the working temperature was 42°C.

The library cutting reaction was repeated under adjusted conditions. The reaction products were loaded onto a 1.5% agarose gel and subjected to electrophoresis. Uncut DNA fragments 374 bp long. were extracted from the gel and prepared for high throughput sequencing using the NEB NextUltra II kit. The samples were sequenced on the lllumina platform and then the sequences were analyzed by bioformational methods: the difference in the presence of nucleotides in individual PAM positions (NNNNNNNN) was determined in comparison with the control sample using the approach described in (Maxwell C.S., et al., A detailed cell-free transcription -translation-based assay to decipher CRISPR protospacer-adjacent motifs Methods 2018 Jul 1; 143:48-57). In addition, a PAM logo was built to analyze the results (Fig. 4).

Both approaches to data analysis (Fig. 4) indicate the significance of 5, 6 and 7 PAM positions. Thus, as a result of in vitro analysis, it was possible to establish a putative PAM sequence for PpCas9: NNNNATT. However, this sequence is only conjectural due to the inaccuracy of the results obtained by screening approaches to the determination of PAM.

In this regard, in order to clarify the sequence, the significance of individual positions of the PAM sequence was checked. For this, in vitro reactions were carried out for cutting DNA fragments containing the target DNA 5'-atctcctttcattgagcac-3' flanked by the PAM sequence CAACATT or its derivatives:

5’cccggggtaccacggagagatggtggaaatcatctttttcgtgggcatccttgatggccacctcgtcggaagtgcccacgaggatga cagcaatgccaatgctgggggggctcttctgagaacgagctctgctgcctgacacggccaggacggccaacaccaaccagaactt gggagaacagcactccgctctgggcttcatcttcaactcg tcgactccctgcaaacacaaagaaagagcatgttaaaataggatctacatcac gtaacctgtcttagaagaggctagatactgcaattcaaggaccttatctcctttcattgagcacCAACATTaactccatcta ccagcctactctcttatctctggtatt-3’

All DNA cutting reactions were carried out under the following conditions:

ixCutSmart buffer,

400 nM PpCas9, nM DNA, μM crRNA, μM tracrRNA, incubation time - 30 min, reaction temperature - 42°C.

The replacement of the first position of PAM with all four possible nucleotide variants did not affect the efficiency of the protein (Fig. 5).

- 6 041935

The predicted significance of the fifth and sixth positions was confirmed experimentally by single nucleotide substitutions (purine to pyrimidine and vice versa) at each of the PAM positions. With substitutions in the fifth and sixth positions, the protein practically stopped working. The substitution at the seventh position reduced the efficiency of PpCas9 by a factor of two, reflecting the reduced requirements for the nucleotide at this position (Fig. 6). Thus, according to the results of in vitro PAM screening of the PpCas9 nuclease in the fifth position of PAM, the most probable nucleotides are adenine or guanine, which was confirmed experimentally (Fig. 7). Replacing A with G did not reduce the efficiency of cutting the fragment in any way.

According to the results of in vitro screening, fragments with T or C in the seventh position should be recognized more efficiently. To finally check the significance of nucleotides in this position, additional experiments were carried out. The results of in vitro tests showed that when the nucleotide 'T' in the seventh position is replaced by A or G, the cutting efficiency is reduced by 40-50% (Fig. 8). Thus, the seventh position of PAM is less conservative compared to the fifth and sixth positions: purines in the seventh position only reduce the recognition efficiency, but do not prevent the PpCas9 protein from making double-strand breaks in DNA.

As a result of the research, the following conclusion was made: PAM recognized by the PpCas9 nuclease corresponds to the following formula: 5'-NNNN(A/G)T-3'. The sequences NNNNRTY (NNNN(A/G)-T-(T/C)) are recognized more efficiently than the sequences NNNNRTR (NNNN-(A/G)-T-(A/G)).

The following examples of the implementation of the method are given in order to disclose the characteristics of the present invention, and should not be construed as in any way limiting the scope of the invention.

Example 1 Testing the activity of the PpCas9 protein in cutting various target DNAs.

In order to test the ability of PpCas9 to recognize different DNA sequences flanked by the 5'-NNNN(A/G)T-3' sequence, in vitro cutting experiments on DNA targets from the human grin2b gene sequence were performed (Table 2).

table 2

DNA targets of the human grin2b gene____

sequence RAM TATGTGGTTTGATTGAGGAG G A A A WITH WITH G CAGCTGAAGTAATGTTAGAG WITH WITH A WITH A T T AATAAGAAAAAACATTATTAT WITH A WITH WITH A T T GGGGGTATAAGTAGAGAAGC G WITH T G WITH A T CGTTCTCAGAAGAGCCCCCC WITH A G WITH A T T CCCACGAGAAAGATGATTTC WITH A WITH WITH A T With

In the cutting reaction, the PCR fragment of the grin2b gene carrying recognition sites (Table 2) presumably recognized by PpCas9 according to the PAM consensus 5'-NNNN(A/G)T-3' was used as a target. To recognize these sequences, crRNAs were synthesized that direct PpCas9 to these sites.

The cutting reactions were carried out under the conditions adjusted for PpCas9, the result is shown in FIG. 9. From FIG. 9 shows that the PpCas9 enzyme successfully cut three of the four targets with the appropriate PAM.

The target in lane six had the PAM sequence CAGCATT, which, according to the predictions based on the results of depletion analysis, should be effectively recognized by the protein. However, this fragment was not recognized in this experiment.

Therefore, an additional check of PAM CAGCATT was made on another target protospacer, limited by the same PAM (Fig. 10). In this case, PAM was effectively recognized, leading to DNA cutting. Thus, the protein has some additional preference for the target DNA sequence, possibly related to the secondary structure of the DNA.

Thus, the conducted research tests showed the presence of nuclease activity in PpCas9, and also made it possible to determine its PAM sequence and verify the sequences of guide RNAs.

The PpCas9 ribonucleoprotein complex specifically introduces breaks in the target, limited by PAM 5'-NNNN(A/G)T-3' from the 5' end of the protospacer. A schematic of the PpCas9-RNA complex is shown in FIG. eleven.

Example 2 Use of a hybrid guide RNA to cut a target DNA.

sgRNA is a form of guide RNA that is a fusion of tracrRNA (tracer RNA) and crRNA. To select the optimal sgRNA, three variants of this sequence were constructed, differing in the length of the tracrRNA - crRNA duplex. RNA was synthesized in vitro and subjected to target DNA cutting experiments (FIG. 12).

The following RNA sequences were used as fusion RNAs:

- 7 041935

- sgRNAI 25DR: UAUCUCCUUUCAUUGAGCACGUUGUAGCUCCCUUUUUCAUUUCGCGAAAGCGAA AUGA AAAACGUUGUUACAAUAGAGAUGAAUUUCUCGCAAAGCTCTGCCUCUUGAAAUU UCGG UUUCAAGAGGCAUCUUUUU

- sgRNA2 36DR

UAUCUCCUUUCAUUGAGCACGUUGUAGCUCCCUUUUUCAUUUCGCAGUGCUAU AAUG AAAAUUAUAGCACUGCGAAAUGAAAAAACGUUGUUACAAUAAGAGAUGAAUUUCU CGCAAA GCUCUGCCUCUUGAAAUUUCGGUUUCAAGAGGCAUCUUUUU

Bold indicates the 20-nucleotide sequence that provides pairing with the target DNA (variable part of sgRNA). In addition, a control sample without RNA was made in the experiment, as well as a positive control - cutting the target with crRNA + trRNA.

The sequence containing the recognition site 5'tatctcctttcattgagcac3' with the corresponding PAMCAACATT consensus was used as the target DNA:

5’cccggggtaccacggagagatggtggaaatcatctttttcgtgggcatccttgatggccacctcgtcggaagtgcccacgaggatga cagcaatgccaatgctgggggggctcttctgagaacgagctctgctgcctgacacggccaggacggccaacaccaaccagaactt gggagaacagcactccgctctgggcttcatcttcaactcg - 3

The recognition site is indicated in bold type, PAM in capital letters.

The reaction was carried out under the following conditions:

concentration of DNA sequence containing PAM (CAACATT), 20 nM;

protein concentration - 400 nm;

RNA concentration -2 μM;

incubation time - 30 min;

incubation temperature - 37°C.

The matched sgRNA1 and sgRNA2 proved to be as efficient as native tracrRNA and crRNA sequences, with cleavage occurring in over 80% of the target DNA (FIG. 12).

These fusion RNA variants can be used to cut any other target DNA by changing the sequence that directly pairs with the target DNA.

Example 3 Cas9 proteins from closely related organisms belonging to P. pneumotropica.

To date, not a single enzyme of the CRISPR-Cas9 system has been characterized in P. pneumotropica. Comparable in size, the Cas9 protein from Staphylococcus aureus is 28% identical to PpCas9 (Fig. 13, the degree of identity was calculated using the BLASTp program, default parameters). A similar degree of identity exists for other known Cas9 proteins (not shown).

Thus, the PpCas9 protein differs significantly in amino acid sequence from other Cas9 proteins studied to date.

It is obvious to a specialist in the field of genetic engineering that the PpCas9 protein sequence variant obtained and characterized in this description can be changed without changing the function of the protein itself (for example, by site-directed mutagenesis of amino acid residues that do not directly affect functional activity (Sambrook et al., Molecular Cloning: ALaboratory Manual, (1989), CSHPress, pp. 15.3-15.108)). In particular, one skilled in the art will be aware that non-conservative amino acid residues can be changed without affecting residues that determine the functionality of the protein (determining its function or structure). Examples of such changes are the replacement of non-conservative amino acid residues with homologous ones. Some of the regions containing non-conservative amino acid residues are shown in FIG. 12. In some embodiments of the invention, it is possible to use a protein containing an amino acid sequence that is at least 95% identical to the amino acid sequence of SEQ ID NO: 1 and differs from SEQ ID NO: 1 only in non-conservative amino acid residues to form a double-stranded break in the DNA molecule located immediately before the nucleotide sequence 5'-NNNN(A/G)T-3' in the specified DNA molecule. Homologous proteins can be obtained by mutagenesis (eg, site-directed or PCR-mediated mutagenesis) of the appropriate nucleic acid molecules, followed by testing the encoded modified Cas9 protein for retention of its functions in accordance with the functional assays described here.

Example 4

The PpCas9 system described in the present invention in combination with guide RNAs can be used to change the genomic DNA sequence of a multicellular organism, including a eukaryotic one. To introduce the PpCas9 system in complex with guide RNAs into the cells of this organism (in all cells or in some cells), various approaches can be applied, known

- 8 041935 specialists. For example, delivery strategies of the CRISPR-Cas9 gene-editing system for therapeutic applications. J. Control Release. 2017 Nov 28; 266:17- 26; Lino C.A. et al., Delivering CRISPR: a review of the challenges and approaches. Drug Deliv. 2018 Nov; 25(1):1234-1257) and in the sources disclosed within those sources.

For efficient expression of the PpCas9 nuclease in eukaryotic cells, it will be desirable to perform codon optimization for the amino acid sequence of the PpCas9 protein by methods known to those skilled in the art (eg, IDT codon optimization tool).

For the PpCas9 nuclease to work effectively in eukaryotic cells, it is necessary to ensure the import of this protein into the eukaryotic cell nucleus. This can be done using the nuclear localization signal from the SV40 T antigen (Lanford et al., Cell, 1986, 46:575-582) fused to the PpCas9 sequence using the spacer sequence described in Shen B., et al. Generation of gene-modified mice via Cas9/RNA-mediated gene targeting, Cell Res. May 2013; 23(5):720-3, or without it. Thus, the complete amino acid sequence of a nuclease transported into the nucleus of a eukaryotic cell will be the following sequence: MAPKKKRKVGIHGVPAA-PpCas9-KRPAATKKAGQAKKKK (hereinafter PpCas9 NLS). At least two approaches can be used to deliver a protein with the above amino acid sequence.

Delivery as a gene is accomplished by creating a plasmid carrying the PpCas9 NLS gene under the regulation of a promoter (eg CMV promoter) and a sequence encoding guide RNAs under the regulation of the U6 promoter. As DNA targets, DNA sequences flanked by 5'-NNNN(G/A)T-3' are used, for example, sequences of the human grin2b gene:

’-C AGCTGAAGTAATGTTAGAG-3 ’

Thus, the sgPHK expression cassette looks like this: gtaacttgaaagtatttcgatttcttggcttttatatcttgtggaaaggacgaaacaccg CAGCTGAAGTAATGTTAGAGGTTGTAGCTCCCTTTTTCATTTCGCGAAAGCGAAATG AAAA

ACGTTGTTACATAAGAGATGAATTTCTCGCAAAGCTCTGCCTCTTGAAATTTCGGTT TCAA

GAGGCATCTTTTT

The sequence of the U6 promoter is in bold, followed by the sequence necessary for recognition of the target DNA, and then comes the sequence that forms the sgRNA structure.

Plasmid DNA was purified and transfected into human HEK293 cells using the Lipofectamine 2000 reagent (Thermo Fisher Scientific). Cells are incubated for 72 hours, after which genomic DNA is isolated using genomic DNA purification columns (Thermo Fisher Scientific). The target DNA site is analyzed by sequencing on the lllumina platform to determine the number of DNA insertion-deletions occurring at the target site due to directed double-strand break and its subsequent repair.

To amplify the target fragments, primers flanking the presumed site of the break are used.

After amplification, samples are prepared using the Ultra II DNA Library Prep Kit for lllumina (NEB) reagent protocol to prepare samples for high throughput sequencing. This is followed by sequencing on the lllumina 300 cycles platform, direct reading. The sequencing results are analyzed by bioinformatic methods. The insertion or deletion of several nucleotides in the target DNA sequence is taken as a cut detection.

Delivery in the form of a ribonucleic complex is carried out by incubation of the recombinant form of PpCas9 NLS with guide RNAs in CutSmart Buffer (NEB). The recombinant protein is obtained from bacterial producer cells by purifying it by size separation affinity chromatography (NiNTA, Qiagen) (Superdex 200).

The protein is mixed with RNA in a ratio of 1:2 (PpCas9 NLS:sgRNA), incubated for 10 min at room temperature, then the mixture is transfected into cells.

Next, the DNA extracted from them is analyzed for insertions-deletions in the target DNA site (as described above).

The nuclease PpCas9 from the bacterium Pasieureila prseumotropsca characterized in the present invention has a number of advantages over previously characterized Cas9 proteins.

PpCas9 has a short, two-letter motif, different from other known PAM Cas nucleases, which is necessary for the functioning of the system. The invention showed that the presence of a short PAM motif (RT) located 4 nucleotides from the protospacer is sufficient for PpCas9 to function.

The majority of Cas nucleases known to date that are capable of introducing double-strand breaks in DNA have complex multi-letter PAM sequences that limit the choice of sequence.

- 9 041935 pieces suitable for cutting. Among the studied Cas nucleases that recognize short PAMs, only PpCas9 can recognize sequences flanked by the RT motif.

The second advantage of PpCas9 is the small size of the protein (1055 a.a.). To date, it is the only small-sized protein studied that has a two-letter RT PAM sequence.

PpCas9 is a novel, small-sized Cas nuclease that has a short, easy-to-use PAM that differs from currently known PAM sequences from other nucleases. The PpCas9 protein cuts various DNA targets with high efficiency, including at 37°C, and can become the basis of a new tool for genomic editing.

While the invention has been described with reference to the disclosed embodiments, it should be apparent to those skilled in the art that the specific instances described in detail are for the purpose of illustrating the present invention only and should not be construed as limiting the scope of the invention in any way. It should be clear that various modifications are possible without departing from the essence of the present invention.

Claims (5)

1. The use of a protein containing the amino acid sequence of SEQ ID NO: 1 or containing an amino acid sequence that is at least 95% identical to the amino acid sequence of SEQ ID NO: 1 and differs from SEQ ID NO: 1 only in non-conservative amino acid residues, for the formation of a double-strand break in the DNA molecule, located immediately before the nucleotide sequence 5'-NNNN(A/G)T-3' in the specified DNA molecule. 2. The use according to claim 1, characterized in that the formation of a double-strand break in the DNA molecule occurs at a temperature of from 35 to 45°C. 3. The use of a protein according to claim 1, where the protein contains the amino acid sequence of SEQ ID NO: 1. 4. A method for altering the genomic DNA sequence of a unicellular or multicellular organism, comprising introducing into at least one cell of this organism an effective amount of a) either a protein containing the amino acid sequence of SEQ ID NO: 1, or a nucleic acid encoding a protein containing the amino acid sequence of SEQ ID NO: 1; and b) either a guide RNA containing a sequence that forms a duplex with the nucleotide sequence of a portion of the organism's genomic DNA immediately adjacent to the 5'-NNNN(A/G)T-3' nucleotide sequence and interacts with said protein after duplex formation, or the sequence DNA encoding said guide RNA; in this case, the interaction of the specified protein with the guide RNA and the 5'-NNNN(A/G)T-3' nucleotide sequence leads to the formation of a double-strand break in the genomic DNA sequence immediately adjacent to the 5'-NNNN(A/G)T-3 sequence '. 5. The method of claim 4, further comprising administering the exogenous DNA sequence simultaneously with the guide RNA.