OA20196A - DNA-cutting agent. - Google Patents

Abstract

The present invention describes a novel bacterial nuclease of the CRISPR-Cas9 system from the bacterium Clostridium celluloliticum, as well as the use thereof to form strictly specific double-strand breaks in a DNA molecule. This nuclease has unusual properties and may be used as a tool for introducing modifications at strictly defined sites in the genomic DNA sequence of unicellular or multicellular organisms. Thus, the versatility of the available CRISPR-Cas9 systems is increased, which will enable the use of Cas9 nucleases from various organisms for cutting genomic or plasmid DNA in a larger number of specific sites and in wider temperature ranges. Further, provided is more facile editing of the genome of the biotechnologically significant bacterium Clostridium celluloliticum.

Description

DNA-CUTTING AGENT

Field of the Invention

The invention relates to the field of molecular biology and microbiology, in particular, it discloses novel bacterial nucleases ofthe CRISPR-Cas system. The invention may be used as a tool for strictly specific modification of DNA in various organisms.

Background of the Invention

Modification of a DNA sequence is one of the topical problems in today's biotechnology field. Editing and modifying the genomes of eukaryotic and prokaryotic organisms, as well as manipulating DNA in vitro, require the targeted introduction of double-strand breaks into a DNA sequence. To solve this problem, the following techniques are currentiy used: artificial nuclease Systems containing domains of the zinc finger type, TALEN Systems, and bacterial CRISPR-Cas Systems. The first two techniques require laborious optimization of a nuclease amino acid sequence for récognition of a specific DNA sequence. In contrast, when it cornes to CRISPR-Cas Systems, the structures that recognize a DNA target are not proteins, but short guide RNAs. Cutting of a particular DNA target does not require the synthesis of nuclease or its gene de novo, but is made by way of using guide RNAs complementary to the target sequence. It makes CRISPR Cas Systems convenient and efficient means for cutting various DNA sequences. The technique allows for simultaneous cutting of DNA at several régions using guide RNAs of different sequences. Such an approach is also used to simultaneously modify several genes in eukaryotic organisms.

By their nature, CRISPR-Cas Systems are prokaryotic immune Systems capable of highly specific introduction of breaks into a viral genetic material (Mojica F. J. M. et al. Intervening sequences of regularly spaced prokaryotic repeats dérivé from foreign genetic éléments //Journal of molecular évolution. - 2005. - Vol. 60. - Issue 2. - pp. 174-182). The abbreviation CRISPR-Cas stands for Clustered Regularly Interspaced Short Palindromie Repeats and CRISPR associated Genes (Jansen R. et al. Identification of genes that are associated with DNA repeats in prokaryotes //Molecular microbiology. - 2002. - Vol. 43. - Issue 6. - pp. 1565-1575). Ail CRISPR-Cas Systems consist of CRISPR cassettes and genes encoding various Cas proteins (Jansen R. et al., Molecular microbiology. - 2002. - Vol. 43. - issue 6. - pp. 1565-1575). CRISPR cassettes consist of spacers, each having a unique nucléotide sequence, and repeated palindromie repeats (Jansen R. et al., Molecular microbiology. - 2002. - Vol. 43. - Issue 6. - pp. 1565-1575). The transcription of CRISPR cassettes followed by processing thereof results in the formation of guide crRNAs, which together with Cas proteins form an effector complex (Brouns S. J. J. et al. Small CRISPR RNAs guide antiviral defense in prokaryotes / / Science. - 2008. - Vol. 321. - Issue 5891. - pp. 960-964). Due to the complementary pairing between the crRNA and a target DNA site, which is called the protospacer, Cas nuclease recognizes a DNA target and highly specifically introduces a break therein.

CRISPR-Cas Systems with a single effector protein are grouped into six different types (types IVI), depending on Cas proteins that are included in the Systems. The type II CRISPR-Cas9 system is characterized in its simple composition and mechanism of activity, i.e. its functioning requires the formation of an effector complex consisting only of one Cas9 protein and two short RNAs as follows: crRNA and tracer RNA (tracrRNA). The tracer RNA complementarily pairs with a crRNA région, 1 originating from CRISPR repeat, to form a secondary structure necessary for the binding of guide

RNAs to the Cas effector. The Cas9 effector protein is an RNA-dependent DNA endonuciease with two nuclease domains (HNH and RuvC) that introduce breaks into the complementary strands of target

DNA, thus forming a double-strand DNA break (Deltcheva E. et al. CRISPR RNA maturation by transencoded small RNA and host factor RNase III //Nature. - 2011. - Vol. 471. - Issue 7340. - p. 602).

Thus far, several CRISPR-Cas nucleases are known that are capable of targeted and spécifie introduction of double-strand breaks into DNA. One of the main characteristics limiting the use of CRISPR-Cas Systems is a PAM sequence that flanks a DNA target from the 3' end and the presence of which is necessary for the correct récognition of DNA by Cas9 nuclease. Various CRISPR-Cas proteins hâve different PAM sequences that limit the potential for use of the nucleases at any DNA régions. The use of CRISPR-Cas proteins with novel various PAM sequences is necessary to make it possible to modify any DNA région, both in vitro and in the genome of iiving organisms. Modification of eukaryotic genomes also requires the use of the small-sized nucleases to provide AAV-mediated delivery of CRISPR-Cas Systems into cells.

Although a number of techniques for cutting DNA and modifying a genomic DNA sequence are known, there is still a need for novel effective means for modifying DNA in various organisms and at strictly spécifie sites of a DNA sequence. This invention provides a number of properties necessary for solving this problem.

The basis of the invention is the CRISPR Cas system found fh the bacteria Clostridium cellulolyticum. Anaérobie bacteria Clostridium cellulolyticum (C. cellulolyticum) are able to hydrolyze lignocellulose without adding commercial cellulases to form, as end products, lactate, acetate and éthanol (Desvaux M. Clostridium cellulolyticum: model organism of mesophiiic cellulolytic clostridia. FEMS Microbiol Rev. 2005 Sep;29(4):741-64). Such an ability of these microorganisms makes them promising candidates for biofuel producers. The use of producer bacteria such as C. cellulolyticum in biotechnological production will help to make the raw material processing cycle more efficient, increase efficiency and, ultimately, reduce the Ioad on ail components of the biosphère. The genetic engineering methods may significantly improve the microbial metabolic parameters and tilt the balance in favor of the production of more butanol rather than lactate and acetate. For example, a double mutant of the lactate and malate dehydrogenase genes showed the absence of lactate formation and increased butanol yield (Li Y, et al., Combined inactivation of the Clostridium cellulolyticum lactate and malate dehydrogenase genes substantially increases éthanol yield from cellulose and switchgrass fermentations. Biotechnol Biofuels. 2012 Jan 4;5(1 ):2). Thus far, it has not been possible to develop an effective procedure for producing C. cellulolyticum strains with mutations in phosphotransacetylase and acetate kinase genes, which could reduce acetate production. The invention may be used to modify the genome of Clostridium cellulolyticum, as well as that of other Iiving organisms.

Summary of the invention

The object of the présent invention is to provide novel means for modifying a genomic DNA sequence of unicellular or multicellular organisms using CRISPR-Cas9 Systems. The current Systems are of limited use due to a spécifie PAM sequence that must be présent at the 3' end of a DNA région to be modified. Search for novel Cas9 enzymes with other PAM sequences will expand the range of available means for the formation of a double-strand break at desired, strictly spécifie sites in DNA molécules of various organisms.

To solve this problem, the authors characterized the previously predicted type II CRISPR nuclease CcCas9 for C. cellulolyticum, which can be used to introduce directed modifications into the genome of both the above and other organisms. The essential features characterizing the présent invention are as follows: (a) short, two-letter PAM sequence, distinct from other known PAM sequences; (b) small size of the characterized CcCas9 protein, which is 1030 amino acid residues (a.a.r.), which is 23 a.a.r. less than that of the known Cas9 enzyme from Staphylococcus aureus (SaCas9); (c) wide operating température range of the CcCas9 nuclease, which is active at températures from 37 °C to 65 °C with an optimum at 45 ° C, which will make it possible to use same in organisms having various températures.

Said problem is solved by using a protein comprising the amino acid sequence of SEQ ID NO: 1, or comprising an amino acid sequence that is at least 95% identical to the amino acid sequence of SEQ ID NO: 1 and differs from SEQ ID NO: 1 only in non-conserved amino acid residues, to form a double-strand break in a DNA molécule, located immediately before the nucléotide sequence 5’NNNNGNA-3’ in said DNA molécule. N is intended to refer to any of the nucléotides (A, G, C, T). In some embodiments of the invention, this use is characterized in that the double-strand break is formed in a DNA molécule at a température of 37 oC to 65 oC. In preferred embodiments of the invention, this use is characterized in that the double-strand break is formed in a DNA molécule at a température of 37 oC to 55 oC.

Said problem is further solved by using a method for modifying a genomic DNA sequence of a unicellular or multicellular organism, comprising introducing into at least one cell of this organism an effective amount of: a) either a protein comprising the amino acid sequence of SEQ ID NO: 1, or a nucleic acid encoding the protein, comprising the amino acid sequence of SEQ ID NO: 1, and b) either a guide RNA comprising a sequence that forms a duplex with the nucléotide sequence of an organism's genomic DNA région, which is directly adjacent to the nucléotide sequence 5’-NNNNGNA-3’ and interacts with said protein following the formation of the duplex, or a DNA sequence encoding said guide RNA, wherein interaction of said protein with the guide RNA and the nucléotide sequence 5’NNNNGNA-3’ results in the formation of a double-strand break in the genomic DNA sequence immediately adjacent to the sequence 5’-NNNNGNA-3’.

A mixture of crRNA and tracer RNA (tracrRNA), which can form a complex with a target DNA région and CcCas9 protein, may be used as a guide RNA. In preferred embodiments of the invention, a hybrid RNA constructed based on crRNA and tracer RNA may be used as a guide RNA. Methods for constructing a hybrid guide RNA are known to those skilled (Hsu PD, et al., DNA targeting specificity of RNA-guided Cas9 nucleases. Nat Biotechnol. 2013 Sep,'31 (9):827-32).

The invention may be used both for in vitro cutting target DNA, and for modifying the genome of some living organism. The genome may be modified in a direct fashion, i.e. by cutting the genome at a corresponding site, as well as by inserting an exogenous DNA sequence via homologous repair.

Any région of double-strand or single-strand DNA from the genome of an organism other than that used for administration (or a composition of such régions among themselves and with other DNA fragments) may be used as an exogenous DNA sequence, wherein said région (or composition of régions) is intended to be integrated into the site of a double-strand break in target DNA, induced by CcCasS nuclease. In some embodiments of the invention, a région of double-strand DNA from the genome of an organism used for the introduction of CcCas9 protein, but further modified by mutations 3 (substitution of nucléotides), as well as by insertions or délétions of one or more nucléotides, may be used as an exogenous DNA sequence.

The technical resuit of the présent invention is to increase the versatility of the available

CRISPR-Cas9 Systems to enable the use of Cas9 nuclease for cutting genomic or plasmid DNA in a

Iarger number of spécifie sites and wider température ranges.

Brief description of the drawings

Fig. 1. Scheme of CRISPR loci in Clostridium celluloliticum

Fig. 2. Détermination of PAM by in vitro methods. Development of a system for cutting DNA limited to the sequence NNNNGNA.

Fig. 3. Checking of significance of individual PAM positions.

Fig. 4. Checking of protein activity in cutting of various DNA targets.

Fig. 5. Reactions of in vitro cutting of a DNA fragment of the human grin2b gene

Fig. 6. Study of température range of CcCas9 activity.

Fig. 7. Scheme of interaction between the guide RNA and a région of target DNA.

Fig. 8. Alignment of sequences of Cas9 proteins from organisms Staphylococcus aureus (SaCas9), Campylobacter jejuni (CjCas9), and CcCas9.

Non-conserved régions of sequences are underlined.

Detailed disclosure of the invention

As used in the description of the présent invention, the terms includes and including shall be interpreted to mean includes, among other things. Said terms are not intended to be interpreted as consists only of. Unless defined separately, the technical and scientific terms in this application hâve typical meanings generally accepted in the scientific and technical literature.

As used herein, the term percent homology of two sequences is équivalent to the term percent identity of two sequences. The identity of sequences is determined based on a reference sequence. Algorithms for sequence analysis are known in the art, such as BLAST described in Altschul et al., J. Mol. Biol., 215, pp. 403-10 (1990). For the purposes of the présent invention, to détermine the level of identity and similarity between nucléotide sequences and amino acid sequences, the comparison of nucléotide and amino acid sequences may be used, which is performed by the BLAST software package provided by the National Center for Biotechnology Information (http://www.ncbi.nlm.nih.gov/blast) using gapped alignment with standard parameters. Percent identity of two sequences is determined by the number of positions of identical amino acids in these two sequences, taking into account the number of gaps and the length of each gap to be entered for optimal comparison of the two sequences by alignment Percent identity is equal to the number of identical amino acids at given positions taking account of sequence alignment divided by the total number of positions and multiplied by 100.

The term “specifically hybridizes” refers to the association between two single-strand nucleic acid molécules or sufficiently complementary sequences, which permits such hybridization under predetermined conditions typically used in the art.

The phrase a double-strand break located immediately before the nucléotide PAM sequence means that a double-strand break in a target DNA sequence will be made at a distance of 0 to 25 nucléotides before the nucléotide PAM sequence.

A protein comprising a spécifie amino acid sequence is intended to refer to a protein having an amino acid sequence composed of said amino acid sequence and possibly other sequences linked by peptide bonds to said amino acid sequence. An example of other sequences may be a nuclear localization signal (NLS), or other sequences that provide increased functionality for said amino acid sequence.

An exogenous DNA sequence introduced simultaneously with a guide RNA is intended to refer to a DNA sequence prepared specifically for the spécifie modification of a double-strand target DNA at the site of break determined by the specificity of the guide RNA. Such a modification may be, for example, an insertion or délétion of certain nucléotides at the site of a break in target DNA. The exogenous DNA may be either a DNA région from a different organism or a DNA région from the same organism as that of target DNA.

An effective amount of protein and RNA introduced into a cell is intended to refer to such an amount of protein and RNA that, when introduced into said cell, will be able to form a functional complex, i.e. a complex that will specifically bind to target DNA and produce therein a double-strand break at the site determined by the guide RNA and PAM sequence on DNA. The efficiency of this process may be assessed by analyzing target DNA isolated from said cell using conventional techniques known to those skilled.

A protein and RNA may be delivered to a cell by various techniques. For example, a protein may be delivered as a DNA plasmid that encodes a gene of this protein, as an mRNA for translation of this protein in cell cytoplasm, or as a ribonucleoprotein complex that includes this protein and a guide RNA. The delivery may be performed by various techniques known to those skilled.

The nucleic acid encoding system's components may be introduced into a cell directly or indirectly as follows: by way of transfection or transformation of cells by methods known to those skilled, by way of the use of a recombinant virus, by way of manipulations on the cell, such as DNA microinjection, etc.

A ribonucleic complex consisting of a nuclease and guide RNAs and exogenous DNA (if necessary) may be delivered by way of transfecting the complexes into a cell or by way of mechanically introducing the complex into a cell, for example, by way of microinjection.

A nucleic acid molécule encoding the protein to be introduced into a cell may be integrated into the chromosome or may be extrachromosomally replicating DNA. In some embodiments, to ensure effective expression of the protein gene with DNA introduced into a cell, it is necessary to modify the sequence of said DNA in accordance with the cell type in order to optimize the codons for expression, which is due to unequal frequencies of occurrence of synonymous codons in the coding régions of the genome of various organisms. Codon optimization is necessary to increase expression in animal, plant, fungal, or microorganism cells.

For a protein that has a sequence that is at least 95% identical to the amino acid sequence of SEQ ID NO: 1 to function in a eukaryotic cell, it is necessary for this protein to end up in the nucléus of this cell. Therefore, in some embodiments of the invention, a protein having a sequence that is at least 95% identical to the amino acid sequence of SEQ ID NO: 1 and which is further modified at one or both ends by the addition of one or more nuclear localization signais is used to form double-strand breaks in target DNA. For example, a nuclear localization signal from the SV40 virus may be used. To provide efficient delivery to the nucléus, the nuclear localization signal may be separated from the main protein 5 sequence by a spacer sequence, for example, described in Shen B, et al. Génération of gene-modified mice via Cas9/RNA- mediated gene targeting, Cell Res. 2013 May;23(5):720-3. Further, in other embodiments, a different nuclear localization signal or an alternative method for delivering said protein into the cell nucléus may be used.

The présent invention encompasses the use of a protein from the organism of Clostridium cellulolyticum (C. cellulolyticum), which is homologous to the previously characterized Cas9 proteins, to introduce double-strand breaks into DNA molécules at strictly specifïed positions.

In metabolic engineering, editing the genome of C. cellulolyticum is a difficult task due to the lack of efficient editing toois. Methods for targeted genome editing, such as recombineering, group II intron retrotransposition, and allele exchange hâve a number of significant limitations. For example, the procedure of recombination-dependent allele exchange is rather time-consuming and has low efficiency. (Heap J. T. et al. Intégration of DNA into bacterial chromosomes from plasmids without a counter-selection marker //Nucleic acids research. - 2012. - Vol. 40. - Issue 8. - pp. e59-e59). Insertion of long DNA fragments, such as metabolic pathway transfer, is difficult with current genome engineering toois, which require existing recombination sites and/or recombinases (Esvelt K. M., Wang H. H. Genome-scale engineering for Systems and synthetic biology //Molecular Systems biology. 2013. - Vol. 9. - Issue 1. - p. 641). A simple and efficient method is needed for successful genome manipulations and production of mutants with pre-determined properties.

The use of CRISPR nucleases to introduce targeted modifications to the genome has a number of advantages. First, the specificity of the system's activity is determined by a crRNA sequence, which allows for the use of one type of nuclease for ail target loci. Secondly, the technique enables the delivery of several guide RNAs complementary to different gene targets into a cell at once, thereby making it possible to simultaneously modify several genes at once.

Furthermore, the use of the native CRlSPR-Cas9 system from the bacterium C. cellulolyticum will make the system for editing the genome of this organism more facile and efficient, as the procedure will not require the introduction of foreign genes into ceils, maintenance and expression thereof. Instead, it is possible to develop a procedure for introducing guide RNAs, which are directed to target genes, into a bacterium, by means of which the host intracellular CRISPR-Cas9 system will be able to recognize the corresponding DNA targets of the biotechnologically significant bacterium and introduce therein doublestrand breaks.

For the biochemical characterization of Cas9 protein from C. cellulolyticum H10 , the CRISPR locus encoding the main system components (CcCas9, cas1, cas2 protein genes, as well as CRISPR cassette and guide RNAs) was cloned into the single copy bacterial vector pACYC184. The effector ribonucleic complex consisting of Cas9 and a crRNA/tracrRNA (tracer RNA) duplex requires the presence of PAM (protospacer adjusted motif) on a DNA target for récognition and subséquent hydrolysis of DNA, in addition to crRNA spacer-protospacer complementarity. (Mojica F. J. M. et al. Short motif sequences détermine the targets of the prokaryotic CRISPR defence system //Microbiology. - 2009. - Vol. 155. - Issue 3. - pp. 733-740). PAM is a strictly defined sequence of several nucléotides located in type II Systems adjacent to or several nucléotides away from the 3' end of the protospacer on an off-target chain. In the absence of PAM, the hydrolysis of DNA bonds with the formation of a doublestrand break does not take place. The need for the presence of a PAM sequence on a target increases récognition specificity, but at the same time imposes restreints on the sélection of target DNA régions 6 for introducing a break.

To détermine the sequences of the guide RNA of the CRISPR-Cas9 system, RNA sequencing of E.coli DH5alpha bacteria bearing the generated pACYC184_CcCas9 construct was performed. The sequencing showed that the system's CRISPR cassette was actively transcribed, as was the tracer RNA (Fig. 1). Analysis of the crRNA and tracrRNA sequence allowed to contemplate that they may possibly form secondary structures recognized by CcCas9 nuclease.

Further, the authors determined the PAM sequence of CcCas9 protein using bacterial PAM screening. In order to détermine the PAM sequence of CcCas9 protein, E.coli DH5alpha cells bearing the pACYC184_CcCas9 plasmid were transformed by a plasmid library containing the spacer sequence 5’- TAAAAAATAAGCAAGCGATGATATGAATGC-3’ of CRISPR cassette of CcCas9 system flanked by a random seven-letter sequence from the 5’ or 3' end. Plasmids bearing a sequence corresponding to the PAM sequence of CcCas9 System were subjected to dégradation under the action of functional CRISPR-Cas system, whereas the remaining library plasmids were effectively transformed into cells, conferring them résistance to the antibiotic ampicillin. After transformation and incubation of the cells on plates containing the antibiotic, the colonies were washed off the agar surface, and DNA was extracted therefrom using the Qiagen Plasmid Purification Midi kit. Régions containing the randomized PAM sequence were amplified by PCR from the isolated pool of plasmids, and were then subjected to high-throughput sequencing on the Illumina platform. The resulting reads were analyzed by comparing the efficiency of transformation of plasmids with unique PAMs included in the library into cells bearing pACYC184_CcCas9 or into control cells bearing the empty vector pacyc184. The results were analyzed using bioinformatics methods. As a resuit, it was possible to identify the PAM of the CcCas9 system, which is the two-letter sequence NNNNGNA (Fig. 2).

Next, the PAM sequence was further determined by reproducing the cutting reaction in vitro. To détermine the PAM sequence of CcCas9 protein, in vitro cutting of double-strand PAM libraries was used. To this end, it was necessary to obtain ail the components of the CcCas9 effector complex as follows: guide RNAs and a nuclease in a recombinant form. Détermination of the guide RNA sequence by RNA sequencing made it possible to synthesize crRNA and tracrRNA molécules in vitro. The synthesis was carried out using the NEB HiScribe T7 RNA synthesis kit. The double-strand DNA libraries were 374 bp fragments comprising a protospacer sequence flanked by randomized seven nucléotides (5’ NNNNNNN 3’) from the 3’ end:

5’cccggggtaccacggagagatggtggaaatcatctttctcgtgggcatccttgatggccacctcgtcggaa gtgcccacgaggatgacagcaatgccaatgctgggggggctcttctgagaacgagctctgctgcctgacacggcca ggacggccaacaccaaccagaacttgggagaacagcactccgctctgggcttcatcttcaactcgtcgactccctgc aaacacaaagaaagagcatgttaaaataggatctacatcacgtaacctgtcttagaagaggctagatactgcaattc aaggaccttatctcctttcattgagcacN N N N N N Naactccatctaccagcctactctcttatctctggtatt -3’

To eut this target, guide RNAs of the following sequence were used:

tracrRNA:

5AUUAUGGCAUAUCGGAGCCUGAAUUGUUGCUAUAAUAAGGUGCUGGG UUUAGCCCAGACCGCCAAGUUAACCCCGGCAUUUAUUGCUGGGGUAUCUUGU UUU and crRNA:

5’uaucuccuuucauugagcacGUUAUAGCUCCAAUUCAGGCUCCGAUAU

Bold indicates the crRNA sequence complementary to the protospacer (target DNA sequence).

To obtain a recombinant CcCas9 protein, a gene thereof was cloned into the plasmid pET21a.

E. coli Rosetta cells were transformed by the resulting plasmid CcCas9_pET21a. The cells bearing the plasmid were grown to an optical density of OD_600=0.6, then the expression of CcCas9 gene was induced by adding IPTG to a concentration of 1mM. The cells were incubated for 4 hours at 25 °C, after which they were lyzed. The recombinant protein was purified in two stages as follows: by affinity chromatography (NiNTA) and by protein size-exclusion on a Superdex 200 column. The resulting protein was concentrated using Amicon 30 kDa filters. Thereafter, the protein was frozen at minus 80°C and used for in vitro reactions.

The in vitro reaction of cutting linear RAM libraries was performed under the following conditions: IxCutSmart buffer 400 nM CcSas9 100 nM DNA library μΜ crRNA μΜ tracrRNA

The total reaction volume was 20 μΙ.

Clostridium cellulolyticum H10 is common in compost piles and has an optimal division température of 45°C, and, accordingly, the reactions were carried out at this température for 30 minutes.

The cutting resulted in the breaking-up of a portion of the library fragments into two portions having a length of about 50 base pairs (bp) and 324 bp. As a control sample, reactions without crRNA added, an essential component of the Cas effector complex, were used.

The reaction products were applied onto 1.5% agarose gel and subjected to electrophoresis. Uncut DNA fragments with a length of 374 bp were extracted from the gel and prepared for highthroughput sequencing using the NEB NextUltra II kit. The samples were sequenced on the Illumina platform and the sequences were then analyzed using bioinformatics methods where the différence in the représentation of nucléotides at individual positions of RAM (NNNNNNN) was determined as compared to the control sample (Fig. 3).

As a resuit, the authors were able to détermine the RAM sequence of CcCas9 by in vitro methods: NNNNGNA, which completely repeated the resuit obtained in experiments with bacteria.

Next, the significance of individual positions of the PAM sequence was checked. To this end, in vitro reactions were performed in cutting a DNA fragment comprising a DNA target 5’gtgctcaatgaaaggagata-3’ flanked by the PAM sequence GAGAGTA:

5’cccggggtaccacggagagatggtggaaatcatctttctcgtgggcatccttgatggccacctcgtcggaa gtgcccacgaggatgacagcaatgccaatgctgggggggctcttctgagaacgagctctgctgcctgacacggcca ggacggccaacaccaaccagaacttgggagaacagcactccgctctgggcttcatcttcaactcgtcgactccctgc aaacacaaagaaagagcatgttaaaataggatctacatcacgtaacctgtcttagaagaggctagatactgcaattc aaggaccttatctcctttcattgagcac GAGAGTA aactccatctaccagcctactctcttatctctggtatt 3’

The reaction was performed under the following conditions: IxCutSmart buffer 400 nM CcSas9 20 nM DNA μΜ crRNA μΜ tracrRNA

Incubation time was 30 minutes, reaction température was 45 °C. The experiment results confirmée! the PAM sequence for CcCas9 as NNNNGNA -3’. The most conserved amino acid was G at position 5 (see fig. Fig. 4).

The following exemplary embodiments of the method are given for the purpose of disclosing the characteristics of the présent invention and should not be construed as limiting in any way the scope of the invention.

Example 1. Testing the activity of CcCas9 protein in the cutting of various DNA targets.

In order to check the ability of CcCas9 to recognize various DNA sequences flanked by the NNNNGNA 3’ sequence, experiments were conducted on in vitro cutting of DNA targets from a human grin2b gene sequence (see Table 1 below).

Table 1. DNA targets isolated from the human grin2b gene.

DNA target	PAM
ctacatcacgtaacctgtct	tagaAgA
gaacgagctctgctgcctga	cacgGcc
agaacgagctctgctgcctg	acacGgc
acggccaacaccaaccagaa	cttgGgA
tccgctctgggcttcatctt	caactcg
cgactccctgcaaacacaaa	gaaagag
atctacatcacgtaacctgt	cttaGaA
tatctcctttcattgagcac	caaaccc

The in vitro DNA cutting reactions were performed under conditions similar to those of the above-described experiments. As a DNA target, a human grin2b gene fragment with a size of about 500 bp was used:

ttgtctctgcctgtagctgccaatgactatagcaatagcaccttttattgccttgttcaaggatttctgaggcttttga aagtttcattttctctcattctgcagagcaaataccagagataagagagtaggctggtagatggagttgggtttggtgctc aatgaaaggagataaggtccttgaattgcagtatctagcctcttctaagacaggttacgtgatgtagatcctattttaacat gctctttctttgtgtttgcagggagtcgacgagttgaagatgaagcccagagcggagtgctgttctcccaagttctggttgg tgttggccgtcctggccgtgtcaggcagcagagctcgttctcagaagagcccccccagcattggcattgctgtcatcctc gtgggcacttccgacgaggtggccatcaaggatgcccacgagaaagatgatttccaccatctctccgtggtaccccg gg

The experiment results show that CcCas9 in the complex with guide RNAs is able to recognize various DNA targets comprising the PAM sequence NNNNGNA (Fig. 5). In the case of some targets, CcCas9 is tolérant of substitutions at position 7 ofthe PAM sequence.

Example 2. Température range of CcCas9 activity.

To détermine the température range of the CcCas9 protein, experiments were conducted on in vitro cutting of a DNA target under different température conditions.

To this end, the target DNA flanked by the PAM sequence GAGAGTA was subjected to cutting 9 by the CcCas9 effector complex with corresponding guide RNAs at different températures (Fig. 6).

The CcCas9 protein was found to hâve a wide température range of activity. The maximum nuclease activity is achieved at a température of 45 °C, whereas the protein is sufficiently active in the range of 37 °C to 55 °C. Hence, CcCas9 in the complex with guide RNAs is a novel tool for cutting (forming double-strand breaks) in a DNA molécule limited to the sequence 5’-NNNNGNA-3’, with a température range of 37 °C to 55 °C. The scheme of the complex of target DNA with crRNA and tracer RNA (tracrRNA), which together form a guide RNA, is shown in Fig. 7.

Example 3.

Cas9 proteins from closely related organisms belonging to Clostridium. Thus far, only one type Il CRISPR Cas system has been found in Clostridium, which is Cas9 CRISPR Cas system from Clostridium perfringens (Maikova A, et al., New Insights Into Functions and Possible Applications of Clostridium difficile CRISPR-Cas System. Front Microbiol. 2018 Jul 31,'9:1740).

The Cas9 protein from the bacterium Clostridium perfringens is identical to CcCas9 protein by 36% (degree of identity was calculated using the BLASTp software, default parameters). The Cas9 protein from Staphylococcus aureus, which is comparable in size, is identical to CcCas9 by 28% (BLASTp, default parameters).

Hence, the CcCas9 protein differs significantly in the amino acid sequence from other Cas9 proteins studied thus far, including those found in related organisms.

Those skilled in the art of genetic engineering will appreciate that CcCas9 protein sequence variant obtained and characterized by the Applicant may be modified without changing the function of the protein itself (for example, by directed mutagenesis of amino acid residues that do not directly influence the functional activity (Sambrook et al., Molecular Cloning: A Laboratory Manual, (1989), CSH Press, pp. 15.3-15.108)). In particular, those skilled will recognize that non-conserved amino acid residues may be modified, without affecting the residues that are responsible for protein functionality (determining protein function or structure). Examples of such modifications include the substitutions of non-conserved amino acid residues with homologous ones. Some of the régions containing nonconserved amino acid residues are shown in Figure 8. In some embodiments of the invention, it is possible to use a protein comprising an amino acid sequence that is at least 95% identical to the amino acid sequence of SEQ ID NO: 1 and differs from SEQ ID NO: 1 only in non-conserved amino acid residues, to form, in DNA molécule, a double-strand break located immediately before the nucléotide sequence 5’-NNNNGNA-3’ in said DNA molécule. Homologous proteins may be obtained by mutagenesis (for example, site-directed or PCR-mediated mutagenesis) of corresponding nucleic acid molécules, followed by testing the encoded modified Cas9 protein for the préservation of its functions in accordance with the functional analyses described herein.

Example 4. The CcCas9 system described in the présent invention, in combination with guide RNAs, may be used to modify the genomic DNA sequence of a multicellular organism, including a eukaryotic organism. For introducing the CcCas9 system in the complex with guide RNAs into the cells of this organism (into ail cells or into a portion of cells), various approaches known to those skilled may be applied. For example, methods for delivering CRISPR-Cas9 Systems to the cells of organisms hâve been disclosed in the sources (Liu C et al., Delivery strategies of the CRISPR-Cas9 gene-editing system for therapeutic applications. J Control Release. 2017 Nov 28;266:17-26; Lino CA et al., Delivering CRISPR: a review of the challenges and approaches. Drug Deliv. 2018 Nov;25(1 ):123410

1257), and in the sources further disclosed within these sources.

For effective expression of CcCas9 nuclease in eukaryotic cells, it will be désirable to optimize codons for the amino acid sequence of CcCas9 protein by methods known to those skilled (for example, IDT codon optimization tool).

For the effective activity of CcCas9 nuclease in eukaryotic cells, it is necessary to import the protein into the nucléus of a eukaryotic cell. This may be done by way of using a nuclear localization signal from SV40 T-antigen (Lanford et al., Cell, 1986, 46: 575-582) linked to CcCas9 sequence via a spacer sequence described in Shen B, et al. Génération of gene-modified mice via Cas9/RNAmediated gene targeting, Cell Res. 2013 May;23(5):720-3, or without the spacer sequence. Thus, the complété amino acid sequence of nuclease to be transported inside the nucléus of a eukaryotic cell will be the following sequence: MAPKKKRKVGIHGVPAA-CcCas9- KRPAATKKAGQAKKKK (hereinafter referred to as CcCas9 NLS). A protein with the above amino acid sequence may be delivered using at least two approaches.

Gene delivery is accomplished by creating a plasmid bearing the CcCas9 NLS gene under control of a promoter (for example, the CMV promoter) and a sequence encoding guide RNAs under control of the U6 promoter. As DNA targets, DNA sequences flanked by 5’-NNNNGNA-3’ are used, for example, those of the human grin2b gene:

acggccaacaccaaccagaa cgactccctgcaaacacaaa

Thus, the crRNA expression cassette looks as follows:

Gagggcctatttcccatgattccttcatatttgcatatacgatacaaggctgttagagagataattgga attaatttgactgtaaacacaaagatattagtacaaaatacgtgacgtagaaagtaataatttcttgggtagtttg cagttttaaaattatgttttaaaatggactatcatatgcttaccgtaacttgaaagtatttcgatttcttggctttatat atcttgtggaaaggacgaaacacc-acggocaacacoaaccagaaGTTATAGCTCCAATTCAGGCTCCGATATttttt

Bold indicates the U6 promoter sequence, followed by the sequence required for target DNA récognition, while the direct repeat sequence is highlighted in capital letters.

The tracer RNA expression cassette looks as follows:

Gagggcctatttcccatgattccttcatatttgcatatacgatacaaggctgttagagagataattgga attaatttgactgtaaacacaaagatattagtacaaaatacgtgacgtagaaagtaataatttcttgggtagtttg cagttttaaaattatgttttaaaatggactatcatatgcttaccgtaacttgaaagtatttcgatttcttggctttatat atcttgtggaaaggacgaaacaccATT AT GGCAT AT CGG AGCCT GAATT GTT GCTAT AAT AAGGTGCTGGGTTTAGCCCAGACCGCCAAGTTAACCCCGGCATTTATTGCTGG GGTATCTTTGtttt

Bold indicates the U6 promoter sequence, followed by the sequence encoding the tracer RNA.

Plasmid DNA is purified and transfected into human HEK293 cells using Lipofectamine2000 reagent (Thermo Fisher Scientific). The cells are incubated for 72 hours, after which genomic DNA is extracted therefrom using genomic DNA purification columns (Thermo Fisher Scientific). The target DNA site is analyzed by sequencing on the Illumina platform in order to détermine the number of insertions/deletions in DNA that take place in the target site due to a directed double-strand break 11 followed by repair thereof.

Amplification of the target fragments is performed using primers flanking the presumptive site of break introduction, for example, for the above-mentioned grin2b gene sites:

5’-G ACT AT AG C AATAG C AC-3’

5TCAACTCGTCGACTCCCTG-3’

After amplification, samples are prepared according to the Ultra II DNA Library Prep Kit for Illumina (NEB) reagent sample préparation protocol for high-throughput sequencing. Sequencing is then performed on the Illumina platform, 300 cycles, direct reading. The sequencing results are analyzed by bioinformatic methods. An insertion or délétion of several nucléotides in the target DNA sequence is taken as a eut détection.

Delivery as a ribonucleic complex is carried out by incubating recombinant CcCas9 NLS with guide RNAs in the CutSmart buffer (NEB). The recombinant protein is produced from bacterial producer cells by purifying the former by affinity chromatography (NiNTA, Qiagen) with size exclusion (Superdex 200).

The protein is mixed with RNAs in a ratio of 1:2:2 (CcCas9 NLS : crRNA :tracrRNA), the mixture is incubated for 10 minutes at room température, and then transfected into the cells.

Next, the DNA extracted therefrom is analyzed for insertions/deletions at the target DNA site (as described above).

The CcCas9 nuclease characterized in the présent invention from the bacterium Clostridium cellulolyticum has a number of advantages relative to the previously characterized Cas9 proteins.

CcCas9 has a short, two-letter PAM, distinct from other known Cas nucleases, that is required for the system to function. Accrording to the authors, the short PAM GNA located 4 nucléotides away from the protospacer is sufficient for CcSas9. Further, G at position +5 is critical, whereas position +7 is less important, and in vitro hydrolysis was detected not only in the presence of A or T, but also in the presence of C at position +7, although with slightly lower efficiency.

The majority of Cas nucleases known thus far, which are capable of introducing double-strand breaks into DNA, hâve complex multi-letter PAM sequences, limiting the choice of sequences suitable for cutting. Among the Cas nucleases studied that recognize short PAMs, only CcCas9 is able to recognize sequences limited to GNA nucléotides.

The second advantage of:CcCas9 is the small protein size (1030 a.a.r., which is 23 a.a.r. less as compared to that of SaCas9). To date, it is the only small-sized protein studied that has a two-letter PAM sequence.

The third advantage of the CcCas9 system is a wide température range of activity: the nuclease is active at températures of 37 oC to 65 oC with an optimum at 45 oC.

Although the invention has been described with reference to the disclosed embodiments, those skilled in the art will appreciate that the particular embodiments described in detail hâve been provided for the purpose of illustrating the présent invention and are not be construed as in any way limiting the scope of the invention. It will be understood that various modifications may be made without departing from the spirit of the présent invention.

Claims (5)

1. Ciaims

   1. The use of a protein comprising the amino acid sequence of SEQ ID NO: 1, or comprising an amino acid sequence that is at least 95% identical to the amino acid sequence of SEQ ID NO: 1 and differs from SEQ ID NO: 1 only in non-conserved amino acid residues, to form a double-strand break in a DNA molécule, located immediately before the nucléotide sequence 5'-NNNNGNA-3'in said

   DNA molécule.
2. 2. The use of the protein according to Claim 1, characterized in that the double-strand break is formed in the DNA molécule at a température of 37 °C to 65 °C.
3. 3. The use of the protein according to Claim 1, wherein the protein comprises the amino acid sequence of SEQ ID NO: 1.
4. 4. A method for generating a double-strand break in a genomic DNA sequence of a unicellular or multicellular organism directly adjacent to the sequence 5’-NNNNGNA-3’, comprising the introduction into at least one cell of said organism of an effective amount of: a) a protein comprising the amino acid sequence of SEQ ID NO: 1, or a nucleic acid encoding the protein comprising the amino acid sequence of SEQ ID NO: 1, and b) a guide RNA comprising a sequence that forms a duplex with the nucléotide sequence of an organism's genomic DNA région, which is directly adjacent to the nucléotide sequence 5’-NNNNGNA-3’ and interacts with said protein following the formation of the duplex, or a DNA sequence encoding said guide RNA, wherein the interaction of said protein with said guide RNA and the nucléotide sequence 5’NNNNGNA-3’ results in the formation of a double-strand break in the genomic DNA sequence immediately adjacent to the sequence 5’-NNNNGNA-3’.
5. 5. The method according to Claim 4 further comprising the introduction of an exogenous DNA sequence simultaneously with the guide RNA.

   Abstract

   The présent invention describes a novel bacterial nuclease of the CRISPR-Cas9 system from the bacterium Clostridium celluloliticum, as well as the use thereof to form strictly spécifie doublestrand breaks in a DNA molécule. This nuclease has unusual properties and may be used as a tool for introducing modifications at strictly defined sites in the genomic DNA sequence of unicellular or multicellular organisms. Thus, the versatility of the available CRISPR-Cas9 Systems is increased, which will enable the use of Cas9 nucleases from various organisms for cutting genomic or plasmid DNA in a larger number of spécifie sites and in wider température ranges. Further, provided is more facile editing ofthe genome ofthe biotechnologically significant bacterium Clostridium celluloliticum.