WO2023206871A1

WO2023206871A1 - Optimized crispr/spcas12f1 system, engineered guide rna and use thereof

Info

Publication number: WO2023206871A1
Application number: PCT/CN2022/113354
Authority: WO
Inventors: 季泉江; 王玉珏; 吴兆韡
Original assignee: 上海科技大学
Priority date: 2022-04-25
Filing date: 2022-08-18
Publication date: 2023-11-02
Also published as: CN116987693A

Abstract

Provided are an optimized CRISPR/SpCas12f1 system, an engineered guide RNA and use thereof. The CRISPR/SpCas12f1 genome editing system comprises: an expression construct comprising an SpCas12f1 nuclease; and an expression construct comprising an expressed DNA sequence for a guide RNA corresponding to the SpCas12f1 nuclease and a targeting sequence of a target sequence. Also provided is a method for optimizing a guide RNA corresponding to an SpCas12f1 nuclease, comprising: modifying tracrRNA and crRNA individually or in combination. By using the gene editing system of the present invention, a target gene in a cell can be accurately edited; by using the optimized guide RNA of the present invention, the editing efficiency and applicability of the editing system can be greatly improved.

Description

An optimized CRISPR/SpCas12f1 system, engineered guide RNA and its applications

Technical field

The invention belongs to the field of biotechnology and relates to an optimized CRISPR/SpCas12f1 system, engineered guide RNA and its application. Specifically, it relates to an engineered guide RNA and a gene editing method based on an extremely small CRISPR/SpCas12f1 system.

Background technique

Clustered regularly interspaced short palindromic repeats (CRISPR) and its associated genes (Cas) function as adaptive immune systems in many archaea and bacteria and have evolved into versatile genome editing tools. The CRISPR-Cas system uses three steps to protect microorganisms from foreign invasion: (1) adaptation, in which Cas proteins capture foreign nucleic acid fragments (spacers) and insert them into the CRISPR array; (2) processing of transcripts from the CRISPR array to produce mature CRISPR RNA (crRNAs); (3) Interference, crRNAs guide the Cas protein to target and cut the homologous sequence of the new invader. The use of genome editing technology can promote cell engineering, the generation of model animals, the development of new plant varieties and genetic screening, etc. It is also expected to play a role in gene therapy of cancer, genetic diseases and infectious diseases.

Currently, CRISPR/Cas9 and CRISPR/Cas12a are the most widely used genome editing systems, but the large size of these two systems limits their use in fields such as gene therapy. Recently, some small-sized V-F subtype proteins - Cas12f, which are composed of approximately 400–700 amino acid residues and contain a RuvC nuclease domain, have been discovered. These small-sized proteins can help solve the problem of adeno-associated virus vector packaging. . SyntrophomonaspalmitaticaCas12f1 (SpCas12f1, 497 amino acids) was originally reported to only show E. coli plasmid interference activity. A subsequent study revealed that SpCas12f1 can also target target genes in eukaryotic cells and trigger gene insertion and deletion, but its efficiency is only 0.1%-3.6%. Therefore, it is particularly urgent to optimize small molecular weight or small size gene editing systems to make them efficient and precise gene editing tools.

Contents of the invention

In response to the above problems, the purpose of the present invention is to solve the shortcomings of small nuclease gene editing within the framework of the existing technology and provide an optimized CRISPR/SpCas12f1 system and its efficient gene editing method. The optimized gene editing system and method provided by the present invention can achieve efficient and precise editing of target genes or target genomes in vitro (including cells) or in vivo, greatly improving the gene editing efficiency of the small CRISPR/SpCas12f1 system.

One of the purposes of the present invention is to provide a guide RNA, which is characterized in that it includes a tracr RNA sequence and a crRNA sequence; the crRNA sequence includes a gene targeting segment capable of hybridizing with a target sequence and a tracr partner sequence; the The tracr RNA sequence and the tracr partner sequence constitute the backbone sequence of the guide RNA; the gene targeting segment that hybridizes to the target sequence can be determined based on the target gene for editing;

Wherein, the tracrRNA includes the nucleotide sequence shown in SEQ ID NO. 111 or a variant sequence having at least 50% identity with it;

The tracr partner sequence includes the nucleotide sequence shown in SEQ ID NO. 112 or a variant sequence having at least 50% identity with it.

Another object of the present invention is to provide an isolated polynucleotide encoding the guide RNA as described above.

Another object of the present invention is to provide a construct containing an isolated polynucleotide as described above.

Another object of the present invention is to provide an expression system, which contains the construct as described above or an exogenous polynucleotide as described above integrated into the genome.

Another object of the present invention is to provide a gene editing system, which includes the guide RNA or its encoding polynucleotide as described above; the editing system further includes a nuclease or its encoding polynucleotide.

Another object of the present invention is to provide a gene editing method that contacts the target gene with the gene editing system as described above to achieve editing of the target gene.

Another object of the present invention is to provide the guide RNA, isolated polynucleotide, construct, expression system, gene editing system, pharmaceutical composition or method described above in vivo, ex vivo cell or cell-free environment. Applications in gene editing of target genes and/or their related polypeptides.

Another object of the present invention is to provide a genetically modified cell, which is obtained by gene editing using the gene editing system or method described above.

The positive progressive effects of the present invention include:

(1) The present invention conducted in-depth exploration of the gRNA of SpCas12f1 through multiple rounds of gRNA transformation, thereby determining the gRNA with the highest editing efficiency and transforming the CRISPR/SpCas12f1 system into an efficient and accurate genome editing tool. Compared with the original gRNA_MS1, the optimal version of gRNA can increase the efficiency of gene insertion and gene deletion in all tested targets by approximately 2-9 times.

(2) gRNA remodeling in the present invention significantly reduces the size of gRNA, and the engineered SpCas12f1 system is smaller, providing more possibilities for gene editing and gene therapy for AAV delivery. This compact CRISPR system has broad application prospects in genome editing.

(3) The present invention tested the editing efficiency of a total of 32 targeted sequences on 9 endogenous genes in a mammalian cell genome editing experiment, thereby improving the applicability of the small CRISPR system in cell gene editing.

Description of the drawings

Figure 1 is a schematic diagram of the initial version of gRNA_MS1 of SpCas12f1 nuclease in Example 1.

Figure 2 is a diagram showing the gene editing results in human cells mediated by SpCas12f1 nuclease and the corresponding initial version of gRNA_MS1 in Example 1. The results showed that SpCas12f1 nuclease successfully achieved gene editing of multiple genes on the mammalian cell genome.

Figure 3 is a schematic diagram of the specific modification sites and corresponding base lengths of SpCas12f1 nuclease gRNA engineering in Example 2.

Figure 4 is a diagram showing the gene editing results in mammalian cells mediated by SpCas12f1 nuclease and corresponding different versions of gRNA in Example 2. The results showed that the editing efficiency of the partially engineered gRNA was higher than that of the initial version gRNA_MS1, with the highest efficiency being gRNA_MS13.

Figure 5 is a diagram showing the comparison results of gene editing in mammalian cells mediated by SpCas12f1 nuclease and the corresponding initial version (MS1) and optimal version (MS13) of gRNA in Example 3. The results showed that gRNA_MS13 greatly improved the gene editing efficiency of nuclease in mammalian cells.

Detailed ways

In order to better explain the purpose, technical solutions and positive progressive effects of the present invention, the present invention will be further elaborated below with reference to the accompanying drawings and specific embodiments. It should be understood that these examples are only used to illustrate the invention and are not intended to limit the scope of the invention. In addition, it should be understood that after reading the teachings of the present invention, those skilled in the art can make various changes or modifications to the present invention, and these equivalent forms also fall within the scope defined by the appended claims of this application. For example, a single base editing system based on SpCas12f1 was developed by fusing inactivated SpCas12f1 and base deaminase; a Prime editing system based on SpCas12f1 was developed by fusing inactivated SpCas12f1 and reverse transcriptase; a SpCas12f1-based Prime editing system was developed by fusing inactivated SpCas12f1 and transcription activator to develop a transcription activation system based on SpCas12f1; by fusing inactivated SpCas12f1 and a nucleic acid epigenetic modification enzyme, an epigenetic modification system based on SpCas12f1 was developed; using inactivated SpCas12f1, a transcription repression system based on SpCas12f1 was developed.

The CRISPR system mainly used in the present invention is the V-F type CRISPR system, in which the effector protein is mainly Syntrophomonaspalmitatica Cas12f (SpCas12f1) nuclease. SpCas12f1 nuclease can accurately locate the target gene under the guidance of the corresponding guide RNA, cut the genomic DNA, and achieve double-stranded breaks in the genomic DNA. Utilizing the host cell's own or exogenous repair mechanisms, this system can efficiently and accurately achieve gene editing in living cells.

The invention provides a guide RNA (gRNA), which includes a trans-activating CRISPR RNA (tracrRNA) sequence and a crRNA sequence; the crRNA sequence includes a gene targeting segment capable of hybridizing with a target sequence and a tracr partner sequence (gene The targeting segment and the tracr partner sequence are connected to obtain the RNA sequence (crRNA));

The guide RNA of the present invention includes one or more of the complementary base pairs in the tracrRNA, and the tracrRNA is obtained by exchanging positions of the paired bases. For example, the base A at position 13 of tracrRNA is complementary to the base U at position 50. The tracrRNA obtained after setting position 13 to U and position 50 to A can also achieve the technical effects of the present invention.

The guide RNA of the present invention includes one or more base pairs of complementary pairs between tracrRNA and tracr partner sequence, and the tracrRNA and tracr partner sequence are obtained by exchanging positions of the paired bases. For example, base A at position 70 of tracrRNA is complementary to base U at position 10 of the tracr partner. The tracrRNA and tracr obtained after setting base 70 of tracrRNA to U and position 10 of the tracr partner to A The counterpart sequence can also achieve the technical effects of the present invention.

In the guide RNA of the present invention, the gene targeting segment is a nucleotide sequence complementary to the target sequence in the target gene and is located at the 3' end of the crRNA sequence; the gene targeting segment identifies the target The PAM sequence on the sequence; the preferred PAM sequence is at least one of 5'-NTTC and 5'-GTTT, where N is A, T, C, G; further preferably the PAM sequence is 5'-GTTC, 5'-TTTC and 5'-ATTC at least either. The gene targeting segment targets a nucleic acid fragment with a length of 12 to 40 bp after the PAM sequence; for example, it can be 13-20, 18-25, 22-32, 26-37, 30-38, 32-40 nucleotides The length of the acid is preferably 20 bp. In one embodiment, the gene targeting segment is preferably an RNA sequence corresponding to a 20 bp length nucleic acid fragment following the PAM sequence. In one embodiment, the gene targeting segment is selected from SEQ ID NO. 168. In the present invention, the complementarity percentage between the targeting segment of the guide RNA and the target sequence of the target gene can be at least 50% (for example, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, at least 99% or 100%).

In some embodiments, the gRNA further comprises a transcription terminator.

In the guide RNA of the present invention, the guide RNA can be two strands, one strand includes a tracrRNA sequence, and the other strand includes a crRNA sequence, wherein the tracr partner sequence hybridizes with the tracrRNA sequence and forms a stem-loop structure. In the guide RNA of the present invention, the crRNA sequence and the tracrRNA sequence can be connected together to form a single guide RNA skeleton sequence, that is, the guide RNA is a strand, which sequentially contains from the 5' end to the 3' end. The tracr RNA sequence and crRNA sequence. When the guide RNA is one strand, the 3' end of the tracr RNA sequence is directly connected to the 5' end of the crRNA sequence or connected through a connecting strand; preferably, the connecting strand is connected, and the connecting strand is selected from oligonucleotides ; Preferably, the number of oligonucleotides in the connecting chain is 3 to 18 nt; further preferably, the connecting chain is AAGG.

In the guide RNA of the present invention, the crRNA and tracrRNA sequences are two separate RNA sequences and can mediate the activity of nuclease such as SpCas12f1 endonuclease when they exist simultaneously. Or the complete guide RNA expression construct for the target sequence obtained by connecting the guide RNA backbone sequence and the DNA-targeting segment that hybridizes to the target sequence can also mediate the activity of nucleases such as SpCas12f1 endonuclease.

In the guide RNA of the present invention, the gene targeting segment includes a nucleotide sequence complementary to a sequence in the target gene, and the gene targeting sequence interacts with the target gene in a sequence-specific manner through hybridization (i.e., base pairing). interaction. The gene targeting sequence of the gRNA can be modified, for example, by genetic engineering, so that the gRNA hybridizes to any desired sequence within the target gene. gRNA guides the bound polypeptide to a specific nucleotide sequence within the target gene through the above-mentioned gene targeting sequence.

The guide RNA of the present invention also contains a stem-loop structure, which forms a protein-binding structure that interacts with nucleases such as SpCas12f1. In some embodiments, the protein binding structure of the gRNA includes 4 stem-loop structures, including stem-

loop

1, 2, 3, and 4.

In some embodiments, the target gene is a DNA sequence. In some embodiments, the target gene is an RNA sequence.

The invention also provides methods for modifying the guide RNA, including but not limited to individual modifications and combined modifications of trans-activating CRISPR RNA (tracrRNA) and CRISPR RNA (crRNA). The transformation methods include but are not limited to truncation or extension of tracrRNA or crRNA, and the connection between tracrRNA and crRNA. In a preferred embodiment of the present invention, tracrRNA and crRNA are connected with AAGG.

In the guide RNA of the present invention, the variant sequence of tracrRNA refers to adding, reducing or replacing part of the nucleosides at the 5' end and/or 3' end of the nucleotide sequence shown in SEQ ID NO. 111 Sequence obtained after acid. Preferably, the variant sequence of tracrRNA refers to a sequence obtained by reducing nucleotides at the 5' end and/or 3' end of the nucleotide sequence shown in SEQ ID NO. 111, that is, it can only Reduce or truncate a certain number of nucleotides at the 5' end, or reduce or truncate a certain number of nucleotides at the 3' end only, or reduce or truncate a certain number of nucleosides at both the 5' and 3' ends. acid. Further preferably, the variant sequence of tracrRNA refers to a sequence obtained by reducing 1 to 30 nt nucleotides from the 5' end and/or 3' end of the nucleotide sequence shown in SEQ ID NO. 111. More preferably, the variant sequence of tracrRNA refers to a reduction of 4 to 16 nt nucleotides at the 5' end of the nucleotide sequence shown in SEQ ID NO. 111, and/or, in the SEQ ID NO. The 3' end of the nucleotide sequence shown in NO. 111 is reduced by 3 to 28 nt nucleotides.

The variant sequence of the tracr partner sequence refers to a sequence obtained by adding, reducing or replacing part of the nucleotides at the 5' end and/or 3' end of the nucleotide sequence shown in SEQ ID NO. 112 ; Preferably, the variant sequence of the tracr partner sequence refers to a sequence obtained by reducing nucleotides at the 5' end and/or 3' end of the nucleotide sequence shown in SEQ ID NO. 112. That is, you can reduce or truncate a certain number of nucleotides only at the 5' end, or reduce or truncate a certain number of nucleotides only at the 3' end, or reduce or truncate a certain number of nucleotides at both the 5' and 3' ends. number of nucleotides. Further preferably, the variant sequence of the tracr partner sequence refers to a sequence obtained by reducing 3 to 28 nt nucleotides from the 5' end of the nucleotide sequence shown in SEQ ID NO. 112. More preferably, the variant sequence of the tracr partner sequence refers to a reduction of 8 to 21 nt nucleotides at the 5' end of the nucleotide sequence shown in SEQ ID NO. 112.

In some preferred embodiments, the variant sequence of tracrRNA refers to a sequence obtained by reducing 7nt nucleotides at the 5' end of the nucleotide sequence shown in SEQ ID NO. 111; preferably, the tracrRNA The variant sequence is shown in SEQ ID NO.114;

In other preferred embodiments, the variant sequence of tracrRNA refers to a sequence obtained by reducing 6nt nucleotides at the 3' end of the nucleotide sequence shown in SEQ ID NO. 111; preferably, the The variant sequence of tracrRNA is shown in SEQ ID NO.120;

In other preferred embodiments, the variant sequence of the tracr partner sequence refers to a sequence obtained by reducing 8 nt nucleotides at the 5' end of the nucleotide sequence shown in SEQ ID NO. 112; preferably , the variant sequence of the tracr partner sequence is shown in SEQ ID NO.130;

In other preferred embodiments, the variant sequence of tracrRNA refers to reducing 7nt nucleotides at the 5' end of the nucleotide sequence shown in SEQ ID NO. 111 and reducing 6nt nucleotides at the 3' end. The sequence obtained by acid; Preferably, the variant sequence of tracrRNA is as shown in SEQ ID NO. 138;

In other preferred embodiments, the variant sequence of tracrRNA refers to reducing 7nt nucleotides at the 5' end of the nucleotide sequence shown in SEQ ID NO. 111 and reducing 6nt nucleotides at the 3' end. The sequence obtained by acid; Preferably, the variant sequence of tracrRNA is as shown in SEQ ID NO. 144;

In other preferred embodiments, the variant sequence of the tracr partner sequence refers to a sequence obtained by reducing 21nt nucleotides at the 3' end of the nucleotide sequence shown in SEQ ID NO. 112; preferably , the variant sequence of the tracr partner sequence is shown in SEQ ID NO. 148.

In other preferred embodiments, the nucleotide sequence of the backbone sequence of the guide RNA is shown in SEQ ID NO. 116. In other preferred embodiments, the nucleotide sequence of the backbone sequence of the guide RNA is shown in SEQ ID NO. 122. In other preferred embodiments, the nucleotide sequence of the backbone sequence of the guide RNA is shown in SEQ ID NO. 131. In other preferred embodiments, the nucleotide sequence of the backbone sequence of the guide RNA is shown in SEQ ID NO. 140. In other preferred embodiments, the variant sequence of the tracrRNA is shown in SEQ ID NO.144, and the variant sequence of the tracr partner sequence is shown in SEQ ID NO.145; preferably, the tracrRNA and The tracr partner sequences are connected through connecting strands; further preferably, the nucleotide sequence of the backbone sequence of the guide RNA is as shown in SEQ ID NO. 146. In other preferred embodiments, the variant sequence of the tracrRNA is shown in SEQ ID NO. 147, and the variant sequence of the tracr partner sequence is shown in SEQ ID NO. 148; preferably, the tracrRNA and The tracr partner sequences are connected through connecting strands; further preferably, the nucleotide sequence of the backbone sequence of the guide RNA is as shown in SEQ ID NO. 149. The preferred guide RNA targets the same target sequence in mammalian cell genome editing. Show higher gene deletion and/or gene cleavage efficiency.

The present invention also provides modified gRNA, which can be used to achieve hybridization with any desired sequence within the target gene through modification; or, by modifying the gRNA to change the characteristics of the gRNA itself, such as enhancing the stability of the gRNA through modification, including But it is not limited to increasing its resistance to ribonuclease (RNase) degradation present in the cell, thereby extending its half-life in the cell; alternatively, it can be modified to enhance the content of gRNA and endonuclease (such as SpCas12f1 The formation of the CRISPR-SpCas12f1 genome editing complex or its stability; alternatively, it can be used to enhance the specificity of the genome editing complex through modification; alternatively, it can be used to enhance the interaction between the genome editing complex and the genome The initiation site, stability or kinetics of the interaction between the target sequences; alternatively, it can be modified to reduce the likelihood or extent of the RNA introduced into the cell to trigger an innate immune response, etc. In the present invention, various characteristics of the CRISPR-SpCas12f1 system (as described below) can be changed by modifying the gRNA, such as enhancing the formation, on-target activity, specificity, stability or kinetics of the CRISPR-SpCas12f1 genome editing complex. characteristic. RNA can be modified using modification methods known in the art, including but not limited to 2'-fluoro and 2'-amino modifications on the ribose and base residues of the pyrimidine or the reverse base at the 3' end of the RNA. . In the present invention, any modification or combination of modifications can be used to modify gRNA. In some embodiments, the sgRNA introduced into the cell is modified to edit any one or more genomic loci.

The invention also provides an isolated polynucleotide encoding the guide RNA as described in any one of the above.

The invention also provides a construct comprising an isolated polynucleotide as described above. The construct can usually be constructed by inserting the isolated polynucleotide into a suitable expression vector, and those skilled in the art can select a suitable expression vector. The construct may, for example, be a recombinant expression vector, and any suitable expression vector may be used as long as it is compatible with the host cell, including, but not limited to, viral vectors (e.g., vaccinia virus-based viral vectors; poliovirus; Adenovirus; adeno-associated virus; SV40; herpes simplex virus; human immunodeficiency virus; retroviral vectors (e.g., murine leukemia virus, spleen necrosis virus, and vectors derived from retroviruses, such as Rous sarcoma virus, Harvey Sarcoma virus, avian leukemia virus, lentivirus, human immunodeficiency virus, myeloproliferative sarcoma virus and mammary tumor virus), etc.

In certain embodiments, multiple gRNAs are used simultaneously in the same cell to simultaneously regulate transcription of different locations on the same target gene or different target genes. When multiple gRNAs are used at the same time, they can exist on the same expression vector or on different vectors, or they can be expressed simultaneously; when they exist on the same vector, they can be expressed under the same control element.

In certain embodiments, a nucleotide sequence encoding a gRNA is operably linked to a control element, such as a transcription control element, such as a promoter. In certain embodiments, a nucleotide sequence encoding a gRNA is operably linked to an inducible promoter. In certain embodiments, a nucleotide sequence encoding a gRNA is operably linked to a constitutive promoter. Transcriptional control elements may function in eukaryotic cells, such as mammalian cells (HEK293T cells); or in prokaryotic cells, such as bacterial or archaeal cells. In certain embodiments, a nucleotide sequence encoding a gRNA is operably linked to a plurality of control elements that permit expression of the nucleotide sequence encoding the gRNA in both prokaryotic and eukaryotic cells.

In the present invention, the gRNA can be synthesized by artificial synthesis, for example, by chemical methods, so that it can be easily modified in various ways. The modification can adopt any modification method known in the art, for example, using a polyA tail, adding a 5' cap analog, a 5' or 3' untranslated region (UTR), and the 5' or 3' end including phosphorothioate 2 '-O-methyl nucleotide or treated with phosphatase to remove the 5' terminal phosphate, etc.

In some embodiments, the nucleotide sequence encoding a gRNA contains one or more modifications that may be used, for example, to enhance activity, stability or specificity, alter delivery, reduce the innate immune response in the host cell, or for Other enhancements.

In some embodiments, one or more targeting moieties or conjugates that enhance the activity, cellular distribution, or cellular uptake of the nucleotide sequence encoding the gRNA are chemically linked to the gRNA. The targeting moiety or conjugate may include a conjugate group covalently bonded to a functional group; the conjugate group includes reporter molecules, polyamines, polyethylene glycol. In some embodiments, a group that enhances pharmacodynamic properties is attached to the gRNA, including groups that improve uptake, enhance resistance to degradation, and/or enhance sequence-specific hybridization to the target nucleic acid. group.

In the present invention, the nucleic acid containing the polynucleotide encoding gRNA may be a nucleic acid mimetic. For example, polynucleotide mimetic peptide nucleic acids with excellent hybridization properties.

In the present invention, the gRNA, or polynucleotide encoding gRNA, is applicable to any biological or in vitro environment, including but not limited to bacteria, archaea, fungi, protists, plants or animals. Accordingly, suitable target cells include, but are not limited to, bacterial cells, archaeal cells, fungal cells, protist cells, plant cells or animal cells. Applicable target cells can be any type of cells, including stem cells, somatic cells, etc.

The present invention also provides an expression system, which contains the construct as described above or an exogenous polynucleotide as described above integrated into the genome. The host cell of the expression system is selected from eukaryotic cells or prokaryotic cells; preferably, the host cell is selected from mouse cells and human cells.

The present invention also provides a gene editing system, which includes the guide RNA or its encoding polynucleotide as described in any one of the above; further, it may also include a nuclease or its encoding polynucleotide.

In the editing system of the present invention, the polynucleotide encoding the nuclease includes: a coding sequence encoding only a nuclease; a nuclease coding sequence and various additional coding sequences; a nuclease coding sequence (and optional additional coding sequences) and non-coding sequences. The polynucleotide encoding the guide RNA includes: a coding sequence encoding only the guide RNA; a coding sequence of the guide RNA and various additional coding sequences; a coding sequence of the guide RNA (and optional additional coding sequences) and non-coding sequences. In some embodiments, the base editing system includes one or more vectors; the one or more vectors include (i) a first regulatory element operably linked to the nuclease The coding polynucleotide; and (ii) a second regulatory element operably linked to the coding polynucleotide of the guide RNA nucleotide sequence; the (i) and (ii) are located on the same or different carriers. In some embodiments, the base editing system comprises (i) a nuclease or a variant thereof, and (ii) a vector comprising the coding sequence of the guide RNA. In another embodiment, the system includes a gRNA and nuclease complex.

The first regulatory element may regulate the transcription of a polynucleotide encoding the nuclease or a variant thereof. The polynucleotide encoding the nuclease or its variant may be one or more, and the first regulatory element may be one or more. The second regulatory element can regulate the transcription of the polynucleotide encoding the guide RNA. The guide RNA encoding polynucleotide may be one or more, and the second regulatory element may be one or more.

The system of the present invention may contain one gRNA or multiple gRNAs simultaneously. In one embodiment, the system includes multiple gRNAs simultaneously to simultaneously modify different positions on the same target DNA or different target DNAs. In one embodiment, two or more guide RNAs target the same gene or transcript or locus. In one embodiment, two or more guide RNAs target different unrelated loci. In some embodiments, two or more guide RNAs target different but related loci.

In the gene editing system of the present invention, the nuclease is a CRISPR nuclease; preferably, the nuclease is selected from Cas9, Cas12, Cas13 protein family or variants thereof; further preferably, the Cas nuclease is selected from nSpCas9 and its mutants, SaCas9 and its mutants, Cas12a and its mutants, or Cas12f and its mutants; more preferably, it is SpCas12f1 nuclease or its mutants. In some embodiments, SpCas12f1 nuclease is provided directly as a protein; for example, spheroplast transformation can be used to transform fungi with exogenous proteins and/or nucleic acids. SpCas12f1 nuclease can be introduced into cells by any suitable method, such as injection. The gene editing system of the present invention recognizes the PAM sequence on the target sequence; preferably the PAM sequence is at least one of 5'-NTTC and 5'-GTTT, where N is A, T, C, G; further preferably the PAM sequence Be at least any one of 5'-GTTC, 5'-TTTC and 5'-ATTC. The gene editing system targets nucleic acid fragments with a length of 12 to 40 bp after the PAM sequence, and the preferred length is 20 bp. The gene editing system targets at least one target sequence in the genome of the cell.

In certain embodiments, the nucleic acid encoding SpCas12f1 nuclease is DNA. In certain embodiments, the nucleic acid encoding SpCas12f1 nuclease is RNA. In certain embodiments, the nucleic acid encoding SpCas12f1 nuclease is an expression vector, such as a recombinant expression vector. Any suitable expression vector may be used so long as it is compatible with the host cell, including, but not limited to, viral vectors (e.g., vaccinia virus-based viral vectors; poliovirus; adenovirus; adeno-associated virus; SV40; herpes simplex Viruses; human immunodeficiency virus; retroviral vectors (e.g., murine leukemia virus, spleen necrosis virus, and vectors derived from retroviruses, such as Rous sarcoma virus, Harvey sarcoma virus, avian leukemia virus, lentivirus, human immunodeficiency virus, myeloproliferative sarcoma virus and breast tumor virus), etc.

In one embodiment, the nucleic acid encoding the SpCas12f1 nuclease is shown in SEQ ID NO. 40. In one embodiment, the invention provides a SpCas12f1 nuclease codon-optimized polynucleotide sequence that is at least 90%, 92%, 93%, 94%, 95%, 96%, 97% identical to SEQ ID NO: 42 , 98%, 99%, 99.2%, 99.5%, 99.8%, 99.9% or 100% sequence homology. In a preferred embodiment, the better coding sequence of the SpCas12f1 nuclease optimized for human codons is shown in SEQ ID NO. 42 in the sequence listing, which encodes one or more functional SpCas12f1 domains, or encodes A polypeptide that has the same function as the polypeptide encoded by the original native nucleotide sequence.

In certain embodiments, a nucleotide sequence encoding a SpCas12f1 nuclease is operably linked to a control element, such as a transcription control element, such as a promoter. In certain embodiments, the nucleotide sequence encoding SpCas12f1 nuclease is operably linked to an inducible promoter. In certain embodiments, the nucleotide sequence encoding SpCas12f1 nuclease is operably linked to a constitutive promoter. Transcriptional control elements may function in eukaryotic cells, such as mammalian cells (HEK293T cells); or in prokaryotic cells, such as bacterial or archaeal cells. In certain embodiments, the nucleotide sequence encoding the SpCas12f1 nuclease is operably linked to a plurality of control elements that allow expression of the nucleotide sequence encoding the SpCas12f1 nuclease in both prokaryotic and eukaryotic cells. In some embodiments, the polynucleotide sequence encoding SpCas12fl nuclease is operably linked to a suitable nuclear localization signal for expression in a cellular or in vitro environment.

In the present invention, the polynucleotide encoding SpCas12f1 nuclease can be synthesized artificially, for example, chemically, so that it can be easily modified in various ways. The modification may adopt any modification method known in the art. In some embodiments, the polynucleotide encoding SpCas12f1 nuclease contains one or more modifications, thereby enabling easy incorporation of a number of modifications, such as enhancing transcriptional activity, altering enzymatic activity, improving its translation or stability ( For example, increasing its resistance to proteolysis, degradation) or specificity, changing solubility, changing delivery, and reducing the innate immune response in host cells. The modification may adopt any modification method known in the art. In some embodiments, any one or more genomic loci are edited by modifying the DNA or RNA encoding the SpCas12f1 nuclease introduced into the cell. In some embodiments, the nucleic acid sequence encoding SpCas12f1 nuclease is a modified nucleic acid, eg, codon optimized. The modification may be a single modification or a combination of modifications.

In the present invention, the nucleic acid comprising the polynucleotide encoding SpCas12f1 nuclease may be a nucleic acid mimetic. For example, polynucleotide mimetic peptide nucleic acids with excellent hybridization properties.

In the present invention, the SpCas12f1 nuclease or the polynucleotide encoding SpCas12f1 nuclease is suitable for use in any biological or in vitro environment, including but not limited to bacteria, archaea, fungi, protists, plants or animals. Accordingly, suitable target cells include but are not limited to eukaryotic cells and prokaryotic cells, such as bacterial cells, archaeal cells, fungal cells, protist cells, plant cells or animal cells; the eukaryotic cells include mammalian cells and Plant cells, the prokaryotic cells include Escherichia coli and Klebsiella pneumoniae. Applicable target cells can be any type of cells, including stem cells, somatic cells, etc. The present invention is preferably used for mammalian cells HEK293T cells. The cells may be in vivo or ex vivo. In certain embodiments, the SpCas12f1 nuclease or nucleic acid encoding the SpCas12f1 nuclease is formulated in liposomes or lipid nanoparticles.

In the system of the present invention, SpCas12f1 nuclease and gRNA can form a complex in the host cell to identify the PAM sequence on the target gene (such as target DNA) sequence; the target sequence of the CRISPR/SpCas12f1 gene editing system is A nucleic acid fragment (such as a DNA fragment) of 20 bp in length following the PAM sequence. In one embodiment, the complex can selectively modulate the transcription of target DNA in a host cell. The CRISPR/SpCas12f1 gene editing system can cut the double strands of targeted DNA, causing DNA breaks.

In one embodiment, the system includes a recombinant expression vector. In one embodiment, the system comprises a recombinant expression vector comprising (i) a nucleotide sequence encoding a gRNA, wherein the gRNA comprises: (a) a core comprising a sequence complementary to a sequence in the target DNA and (b) a second segment that interacts with SpCas12f1 nuclease; and (ii) a nucleotide sequence encoding SpCas12f1 nuclease, wherein said SpCas12f1 nuclease comprises: (a) an RNA-binding moiety that interacts with the gRNA; and (b) an active moiety that modulates transcription within the target DNA, wherein the site of regulated transcription within the target DNA is determined by the gRNA.

In the present invention, SpCas12f1 nuclease variants can also be formed through modification, mutation, DNA shuffling, etc., so that the SpCas12f1 nuclease variants have improved desired characteristics, such as function, activity, kinetics, half-life, etc. The modification may be, for example, the deletion, insertion or substitution of amino acids, or may be, for example, the replacement of the "" of the SpCas12f1 nuclease with a homologous or heterologous cleavage domain from a different nuclease (for example, the HNH domain of a CRISPR-related nuclease). Cleavage domain"); for example, the DNA target of SpCas12f1 nuclease can be changed by any modification method of DNA binding and/or DNA modifying proteins known in the art, such as methylation, demethylation, acetylation, etc. tropism. The DNA shuffling refers to the exchange of sequence fragments between DNA sequences of SpCas12f1 nucleases from different sources to generate chimeric DNA sequences encoding synthetic proteins with RNA-guided endonuclease activity. The modification, mutation, DNA shuffling, etc. may be used singly or in combination.

Specifically, the SpCas12f1 nuclease of the present invention can be:

(1) Wild-type SpCas12f1 nuclease or a fragment thereof, which has RNA-guided nucleic acid binding activity; the SpCas12f1 nuclease is derived from Syntrophomonaspalmitatica Cas12f1, and the amino acid sequence is as shown in SEQ ID NO.40; Preferably, the SpCas12f1 nuclease The humanized codon-optimized nucleic acid sequence is shown in SEQ ID NO.42;

(II) A variant having at least 50% sequence homology with the amino acid sequence of (I) and having RNA-guided nucleic acid binding activity;

(III) according to (I) or (II), which further includes a nuclear localization signal fragment;

(IV) Subject to (I) or (II) or (III), which further includes:

(a) One or more modifications or mutations that produce an endonuclease activity that is significantly reduced compared to before the modification or mutation, or that results in a loss of endonuclease activity; and/or

(b) Polypeptides or domains with other functional activities;

(V) According to (I) or (II) or (III), the SpCas12f1 nuclease has endonuclease activity.

In some embodiments, the SpCas12f1 can be used in combination with other enzyme components or other components to further develop various potential applications of the SpCas12f1 nuclease. As non-limiting examples of SpCas12f1 nuclease variants under (IV), for example, a single base editing system based on SpCas12f1 nuclease is developed by fusing inactivated SpCas12f1 and a base deaminase; by fusing inactivated SpCas12f1 and Reverse transcriptase develops a Prime editing system based on SpCas12f1 nuclease; by fusing inactivated SpCas12f1 and a transcription activator, a transcription activation system based on SpCas12f1 nuclease is developed; by fusing inactivated SpCas12f1 and a nucleic acid epigenetic modification enzyme, a SpCas12f1-based transcription activation system is developed Nuclease epigenetic modification system; using inactivated SpCas12f1, develop a transcription inhibition system based on SpCas12f1 nuclease.

SpCas12f1 nuclease variants may have the following specific properties, including but not limited to:

Has enhanced or reduced ability to bind to the target, or retains the ability to bind to the target;

Has enhanced or reduced endoribonuclease and/or endonuclease activity, or retained endoribonuclease and/or endonuclease activity;

It has deaminase activity, which can act on cytosine, guanine or adenine bases and then replicate and repair them within the cell through the deamination site to produce guanine, thymine and guanine respectively;

Have the activity of regulating the transcription of target DNA, either by increasing or decreasing the transcription of target DNA at a specific position in the target DNA;

Have altered DNA targeting;

increase or decrease or maintain stability;

Can cleave the complementary strand of the target DNA, but has a reduced ability to cleave the non-complementary strand of the target DNA;

Can cleave the non-complementary strand of the target DNA, but has a reduced ability to cleave the complementary strand of the target DNA;

Has a reduced ability to cleave both the complementary and non-complementary strands of target DNA;

It has enzymatic activity that modifies DNA-related polypeptides (such as histones). The enzymatic activity can be methyltransferase activity, demethylase activity, acetyltransferase activity, deacetylase activity, kinase activity, phosphatase activity, ubiquitin activity, etc. One or more of peptide ligase activity, deubiquitinating activity, ribosylation activity, etc. (the covalent modification of proteins is catalyzed by these enzyme activities; for example, SpCas12f1 nuclease variants catalyze covalent modification of proteins through methylation, acetylation function, ubiquitination, phosphorylation, etc., to modify histones to cause structural changes in histone-related DNA, thereby controlling the structure and properties of DNA).

In some embodiments, the SpCas12f1 nuclease variant has no cleavage activity. In some embodiments, SpCas12f1 nuclease variants have single-strand cleavage activity. In some embodiments, the SpCas12f1 nuclease variant has double-stranded cleavage activity.

Having enhanced activity or ability means having an activity or ability that is increased by at least 1%, 5%, 10%, 20%, 30%, 40%, or 50% compared to wild-type SpCas12f1 nuclease.

Having reduced activity and ability refers to having an activity or ability of less than 50%, less than 40%, less than 30%, less than 20%, less than 10%, less than 5%, or less than 1% relative to wild-type SpCas12f1 nuclease.

These small SpCas12fl and variants thereof described herein may be used in any of the systems, compositions, kits and methods described below in the invention.

If not otherwise stated, the terms "SpCas12f1" and "SpCas12f1 nuclease" include wild-type SpCas12f1 nuclease and all variants thereof. Those skilled in the art can determine the type of SpCas12f1 nuclease variant by routine means without limitation. Those cited above.

Each component in the system of the present invention can be transported by means of carriers. For example, for polynucleotides, methods that can be used include, but are not limited to, nanoparticles, liposomes, ribonucleoproteins, small molecule RNA-conjugates, chimeras, and RNA-fusion protein complexes, etc.

The system of the present invention may further include one or more donor templates. In certain embodiments, the donor template includes donor sequences for insertion of a target gene.

The system of the present invention may further comprise a dimeric FOK1 nuclease, a complete or partially or completely defective SpCas12f1 nuclease or a gRNA connected to the dimeric FOK1 nuclease to guide the process through one or more gRNA molecules. Directs endonuclease cleavage when reaching one or more specific DNA target sites.

The system of the present invention can edit or modify DNA at multiple locations in cells for gene therapy, including but not limited to gene therapy for diseases, biological research, and improvement or enhancement of crop resistance. Yield etc.

The present invention also provides a composition comprising one or more of the SpCas12f1 nuclease or the polynucleotide encoding the same, gRNA or the polynucleotide encoding the same, a recombinant expression vector, and a system as described above, and also Acceptable carriers, media, etc. may be included. The acceptable carriers and media such as sterile water or physiological saline, stabilizers, excipients, antioxidants (ascorbic acid, etc.), buffers (phosphoric acid, citric acid, other organic acids, etc.), preservatives, surface Active agents (PEG, Tween, etc.), chelating agents (EDTA, etc.), adhesives, etc. Moreover, it may also contain other low molecular weight polypeptides; proteins such as serum albumin, gelatin or immunoglobulin; amino acids such as glycine, glutamine, asparagine, arginine and lysine; sugars such as polysaccharides and monosaccharides or Carbohydrates; sugar alcohols such as mannitol or sorbitol. When preparing aqueous solutions for injection, such as physiological saline, isotonic solutions containing glucose or other auxiliary drugs, such as D-sorbitol, D-mannose, D-mannitol, and sodium chloride, appropriate Solubilizers include alcohols (ethanol, etc.), polyols (propylene glycol, PEG, etc.), nonionic surfactants (Tween 80, HCO-50), etc. In some embodiments, the composition includes gRNA and a buffer for stabilizing the nucleic acid.

The present invention also provides a kit comprising the system or composition as described above. The kit may further include one or more additional reagents, for example selected from: dilution buffer; wash buffer; control reagents, etc. In some embodiments, the kit includes (a) a SpCas12f1 nuclease or a nucleic acid encoding a SpCas12f1 nuclease as described above; and (b) a gRNA or a nucleic acid encoding the gRNA, wherein the gRNA is capable of converting The SpCas12f1 nuclease or variant thereof is directed to a target polynucleotide sequence. In certain embodiments, the kit further contains a donor template comprising a heterologous polynucleotide sequence capable of being inserted into the target polynucleotide sequence.

The present invention also provides a gene editing method, which involves contacting the target gene with the gene editing system as described above to achieve editing of the target gene. The methods of the present invention can be used to target, edit, modify or manipulate target genes (such as target DNA) in cells or in vivo, ex vivo cells or cell-free systems, and the methods include: adding the SpCas12f1 nuclease as described above Or the polynucleotide encoding it, gRNA or the polynucleotide encoding it, recombinant expression vector, system, composition, etc. are introduced into the kit in vivo, in vitro cells or cell-free systems to target, edit and modify the target gene. or manipulation. In one embodiment, the method includes the following:

(a) introducing the SpCas12f1 nuclease or nucleic acid encoding the SpCas12f1 nuclease into an in vivo, ex vivo cell or cell-free system; and

(b) introducing the gRNA (sgRNA) or a nucleic acid (e.g., DNA) suitable for in situ production of such sgRNA; and

(c) contacting the cell or target gene with SpCas12f1 nuclease or a nucleic acid encoding SpCas12f1 nuclease, a gRNA (sgRNA), or a nucleic acid suitable for producing such sgRNA in situ to produce one or more cleavages in the target gene , nicking or editing; wherein the SpCas12f1 nuclease is directed to the target gene via its processed or unprocessed form of gRNA.

In some embodiments, the gene editing method of the present invention includes the following steps:

i) introducing the SpCas12f1 nuclease or its encoding polynucleotide and the guide RNA or its encoding polynucleotide into a cell;

ii) Produce one or more nicks in a target gene mediated by the SpCas12f1 nuclease, or target, edit, modify or manipulate the target gene.

Each parameter condition in the gene editing method of the present invention can be adjusted according to common knowledge in the field. For example, the concentration of the expression vector including nuclease and guide RNA is preferably 1 μg; the cells are transfected and then The time for editing is preferably 72 hours.

In the gene editing method of the present invention, the SpCas12f1 nuclease is guided to the target gene through a processed or unprocessed form of guide RNA. The SpCas12f1 nuclease and guide RNA form a complex to recognize the PAM sequence on the target gene. In some preferred embodiments, the method further includes the step of introducing a donor template comprising a heterologous polynucleotide sequence into the cell.

The present invention also provides the above-mentioned guide RNA, isolated polynucleotide, construct, expression system, gene editing system, pharmaceutical composition or said method for targeting genes and genes in vivo, ex vivo cells or cell-free environment. /or its related peptides for use in gene editing. The in vitro cells are selected from at least one of bacterial cells, archaeal cells, fungal cells, protist cells, viral cells, plant cells and animal cells. The gene editing is selected from the group consisting of: gene cutting, gene deletion, gene insertion, point mutation, transcription inhibition, transcription activation, base editing and guided editing, including but not limited to:

Cut target genes;

Manipulate the expression of target genes;

Genetically modify target genes;

Genetically modified target gene-related peptides;

For intentional and controlled damage at any desired location on a target gene;

For intentional and controlled repair at any desired location on a target gene;

Modify the target gene in a manner other than introducing a double-strand break (SpCas12f1 nuclease has an enzymatic activity that modifies the target gene in a manner other than introducing a double-strand break; the enzymatic activity may be possessed by SpCas12f1 itself, or by, for example, adding an enzyme with The active heterologous polypeptide is fused to SpCas12f1 nuclease to form a chimeric SpCas12f1 nuclease. The enzyme activities include but are not limited to methyltransferase activity, deamination activity, dismutase activity, alkylation activity, and demethylation. Enzyme activity, DNA repair activity, transposase activity, recombinase activity, DNA damage activity, depurination activity, oxidation activity, pyrimidine dimer formation activity, etc.).

Preferably, the gene editing is gene deletion or gene cutting; the gene editing can be used to achieve one or more of the following including but not limited to the correction of pathogenic sites, gene function research, enhancement of cell function, cell therapy, etc. .

The SpCas12f1 nuclease of the present invention or the polynucleotide encoding the same, gRNA or the polynucleotide encoding the same, recombinant expression vector, system, composition and kit can be applied in the research field, diagnostic field, industrial field (such as microbial engineering), Drug discovery (such as high-throughput screening), target identification, imaging fields, and therapeutic areas, etc.

In some embodiments, the target gene is target DNA. In some embodiments, the target DNA can be in vitro naked DNA that is not bound to DNA-associated proteins. In some embodiments, the target DNA is chromosomal DNA in cells in vitro. In some embodiments, the target gene is target RNA. In some embodiments, the target DNA is contacted with a targeting complex comprising the SpCas12f1 nuclease and a gRNA, the gRNA providing target specificity to the targeting complex by comprising a nucleotide sequence complementary to the target DNA; SpCas12f1 nucleic acid Enzymes provide site-specific activity. In some embodiments, the targeting complex modifies the target DNA, resulting in, for example, DNA cleavage, DNA methylation, DNA damage, DNA repair, and the like. In some embodiments, the targeting complex modifies a polypeptide associated with the target DNA (e.g., histones, DNA-binding proteins, etc.), resulting in, for example, methylation of the target DNA-associated polypeptide-histone, histone acetylation, histone acetylation, etc. Protein ubiquitination, etc.

In the method of the present invention, SpCas12f1 nuclease or a nucleic acid containing a nucleotide sequence encoding a polypeptide of SpCas12f1 nuclease can be introduced into cells by known methods. Likewise, gRNA or a nucleic acid comprising a nucleotide sequence encoding gRNA can be introduced into a cell by well-known methods. Well-known methods include DEAE-dextran-mediated transfection, liposome-mediated transfection, virus or phage infection, lipofection, transfection, conjugation, protoplast fusion, polyethylenimine-mediated guided transfection, electroporation, calcium phosphate precipitation, gene gun, calcium phosphate precipitation, microinjection, nanoparticle-mediated nucleic acid delivery, etc. Plasmids are delivered, for example, by electroporation, calcium chloride transfection, microinjection, and lipofection. For viral vector delivery, cells are contacted with viral particles comprising nucleic acid encoding gRNA and/or SpCas12f1 nuclease and/or chimeric SpCas12f1 nuclease and/or donor polynucleotide.

In some embodiments, in the methods of the invention, a nuclease cleaves target DNA in a cell to create a double-stranded break, which is then repaired by the cell, typically through non-homologous end joining (NHEJ) and homology-directed of repair.

The present invention also provides a cell, including a host cell that has been genetically modified with the above-mentioned SpCas12f1 nuclease or polynucleotide encoding the same, gRNA or polynucleotide encoding the same, recombinant expression vector, system, and composition.

In the present invention, the effective dosage of gRNA and/or SpCas12f1 nuclease and/or recombinant expression vector and/or donor polynucleotide is routine for those skilled in the art. This may vary depending on the route of administration and the nature of the condition being treated.

In the present invention, the bacteria or prokaryotic bacteria may be Escherichia coli, Klebsiella pneumoniae, Bacteroides ovatus, Campylobacter jejuni, Staphylococcus saprophyticus, Enterococcus faecalis, Bacteroides thetaiotaomicron, Bacteroides vulgaris, Bacteroides monomorpha, Bacteroides, Lactobacillus casei, Bacteroides fragilis, Acinetobacter reuteri, Fusobacterium nucleatum, Bacteroides johnsonii, Bacteroides arabidopsis, Lactobacillus rhamnosus, Bacteroides marseillei, Parabacteroides faecalis, Clostridium death Bacillus and Bifidobacterium breve, etc.

In the present invention, the eukaryotic cells include but are not limited to mammalian cells, fungi and other eukaryotic cells. The fungi include yeast and Aspergillus, such as Saccharomyces cerevisiae, Hansenula polymorpha, Pichia pastoris, Kluyveromyces fragilis, Kluyveromyces lactis, Schizosaccharomyces pombe and Candida albicans. , Candida donovani, Candida glabrata, Candida quaymondo, Candida lactis, Candida krusei, Candida portuguese, Candida mellin, Candida oleophila, Candida parapsilosis Fibromyces, Candida tropicalis and Candida virogens, Aspergillus fumigatus, Aspergillus flavus, Aspergillus niger, Aspergillus clavulatus, Aspergillus griseus, Aspergillus nidulans, Aspergillus oryzae, Aspergillus terreus, Aspergillus pyrophorus and Aspergillus versicolor, etc.

In embodiments of the present invention, a novel genome editing method based on extremely small CRISPR/SpCas12f1 nuclease is disclosed. The invention shows that through the guidance and positioning functions of guide RNA, SpCas12f1 can accurately cut genomic DNA and achieve double-stranded breaks in genomic DNA. Utilizing the host cell's own or exogenous repair mechanisms, this system can efficiently and accurately achieve gene editing in living cells.

The present invention also provides a method for preparing guide RNA as described above, which method includes individually transforming tracrRNA and crRNA of the basic guide RNA and transforming them in combination, and the transformation is selected from truncation or extension of tracrRNA or crRNA, or TracrRNA and crRNA are connected through connecting strands to prepare engineered guide RNA.

Partial sequences described in the present invention are as follows:

Wherein, the complete sequence of the wild-type guide RNA containing the targeting sequence contains the following sequence:

5'-ucgcgaaccccaaguuauaaaaaaggucuuugacaacaaaacaagucauaucgcuuuaaagccugacauaauuuacucuguuucgcgccagggcaguuaggugcccuaaaagagcgaaguggccgaaaggaaaggcuaacgcuucucuaacgcuacggcgaccuuggcgaaaugccaucaauaccacgcggcccga aaggguucgcgcgaaacugaguaauaaaacauugcggaugcggcaauacagaaccgcugucgcaucuugcguaagcgcguggauugaaac acacagaggaccccuaguaa -3' (SEQ ID NO. 39);

The underlined part is the targeting sequence: 5'- acacagaggaccccuaguaa -3' (SEQ ID NO. 168); which is the 20 bp fragment after the preferred PAM sequence.

The SpCas12f1 nuclease described in the present invention is Syntrophomonas palmmitatica Cas12f (SpCas12f1), and its amino acid sequence preferably includes the sequence shown below:

The codon-optimized nucleotide sequence encoding the SpCas12f1 nuclease E. coli includes the following sequence:

5’-ATGGGTGAAAGCGTTAAAGCGATCAAACTGAAAATCCTGGACATGTTCCTGGACCCGGAATGCACCAAACAGGATGATAACTGGCGTAAAGATCTGTCTACCATGAGCCGCTTCTGCGCTGAAGCGGGCAACATGTGCCTGCGTGATCTGTACAACTACTTCAGCATGCCGAAAGAAGATCGTATCAGCAGCAAAGATCTGTACAACGCGATGTACCACAAAACCAAACTGCTGCACCCGGAACTGCCGGGCAAA GTGGCAAACCAGATCGTGAACCACGCGAAAGATGTTTTGGAAACGTAACGCGAAACTGATCTACCGTAACCAGATCTCCATGCCGACCTATAAAATTACCACCGCGCCGATCCGCCTGCAGAACATCTACAAACTGATCAAAAACAAAAACAAATACATCGACGTTCAGCTGTACAGCAAAGAATACAGCAAAGACAGCGGTAAAGGCACCCACCGCTACTTCCTGGTTGCAGTGCGTGACA GCTCTACCCGTATGATCTTCGA TCGTATCATGAGCAAAGATCACATCGATTCCTCCAAAAGCTACACGCAGGGTCAGCTGCAGATCAAAAAAGACCACCAGGGTTAAATGGTACTGTATCATCCCGTACACCTTCCCGACCCACGAAACCGTGCTGGACCCGGACAAAGTTATGGGTGTTGATCTGGGCGTTGCGAAAGCGGTGTACTGGGCGTTCAACTCTTCTTACAAACGCGGCTGCATCGATGGCGGTGAAATCGAACACTTTCGTAAAATGATCCGTGCGCGC CGTGTTTCATTCAGAACCAGATCAAACACAGCGGTGATGCGCGTAAAGGTCACGGTCGTAAACGCGCTCTGAAACCGATCGAAACCCTGTCTGAAAAAGAGAAAAACTTCCGCGATACCATCAACCACCGCTATGCTAACCGTATCGTTGAAGCGGCGATCAAACAGGGCTGCGGCACCATCCAGATCGAAAACCTGGAAGGCATCGCTGACACCACCGGCAGCAAATTCCTGAAAAACTGGCCGTACTATGATCTGCAGACCAAA ATCGTTAACAAAGCGAAAGAACACGGCATCACCGTTGTGGCGATCAACCCGCAGTACACCAGCCAGCGTTGCAGCATGTGTGGCTACATCGAAAAAACCAACCGCAGCTCCCAGGCAGTTTTCGAATGCAAACAGTGTGGTTACGGCAGCCGTACCATCTGCATCAACTGCCGTCACGTTCAGGTTTCCGGTGATGTTTGCGAAGAATGCGGCGGCATTGTTAAAAAAGAAAACGTGAACGCGGACTACAACGCGGCGAAAAAA CATTAGCACCCCGTACATCGATCAGATCATCATGGAAAAATGCCTGGAACTGGGTATCCCGTACCGTAGCATCACCTGCAAAGAATGCGGTCACATCCAGGCGTCCGGTAACACCTGCGAAGTTTGCGGCTCTACCAACATCCTGAAACCGAAAAAGATCCGTAAAGCTAAATAA-3’(SEQ ID NO.41);

Its human codon-optimized nucleotide sequence contains the following sequence:

5’-ATGGGCGAGAGCGTGAAGGCCATCAAGCTGAAGATCCTGGATATGTTTTGGACCCTGAGTGTACCAAGCAGGATGATAACTGGAGAAAGGACCTGAGCACCATGAGCAGATTTTGCGCCGAGGCCGGCAATATGTGCCTGAGGGATCTGTATAATTACTTTAGCATGCCTAAGGAGGATAGGATTAGCAGCAAGGACCTGTACAACGCCATGTACCACAAGACCAAGCTGCTGCACCCTGAGCTGCCCGGCAAGGTG GCCAACCAGATCGTGAACCACGCCAAGGATGTGTGGAAGAGAAACGCCAAGCTGATCTACAGAAACCAGATCAGCATGCCTACATACAAGATTACCACAGCCCCTATCAGGCTGCAGAACATCTACAAGCTGATCAAGAAAAATAAGTACATCATCGACGTGCAGCTGTATTCCAAGGAGTACTCCAAGGACTCTGGCAAGGGCACCCACAGGTACTTCCTGGTGGCCGTGAGAGACAGCAGCACAAGGATGATCTTCGACAGG ATCATGTCTAAGGATCACATCGATTCCAGCAAGTCCTACACCCAGGGCCAGCTGCAGATCAAGAAGGACCACCA GGGCAAGTGGTACTGCATCATCCCATACACCTTCCCAACCCACGAGACAGTGCTGGACCCCGACAAGGTCATGGGCGTGGACCTGGGCGTGGCCAAGGCCGTGTACTGGGCCTTCAACAGCAGCTACAAGCGCGGCTGCATCGACGGCGGCGAGATCGAGCACTTCCGGAAGATGATCAGAGCCAGGAGAGT GAGCATCCAGAACCAGATCAAGCACTCCGGCGACGCAAGGAAGGGCCACGGCAGAAAGCGGGCCCTGAAGCCAATCGAAACCCTGTCTGAGAAGGAGAAGAACTTCCGGGACACCATCAACCGATACGCCAACAGGATCGTGGAGGCCGCCATTAAGCAGGGCTGCGGCACAATCCAGATCGAGAATCTGGAGGGCATCGCCGACACCACCGGCAGCAAGTTCCTGAAGAATTGGCCTTACTACGATCTGCAGAC CAAGATCGTGAATAAGGCCAAGGAGCACGGCATCACCGTGGTGGCCATCAACCCTCAGTACACATCCCAGAGATGTTCCATGTGCGGCTACATCGAAAAGACAAACCGCAGCAGGCCGTGTTCGAGTGCAAGCAGTGCGGCTACGGCAGCAGGACCATCTGCATCAACTGTAGACACGTGCAGGTGAGCGGCGACGTGTGTGAGGAGTGCCGGCGGCATCGTGAAGAAGGAAAACGTGAACGCCGATTACAATGCCGCCAA GAACATCAGCACCCCCTACATCGACCAGATTATCATGGAGAAGTGCCTGGAGCTGGGCATCCCCTACAGAAGCATCACCTGTAAGGAGTGCGGCCACATCCAGGCCAGCGGCAATACCTGCGAGGTGTGCGGCAGCACCAACATCCTGAAGCCTAAGAAGATCAGAAAGGCCAAG-3’(SEQ ID NO.42);

The guide RNA sequences of different versions corresponding to the SpCas12f1 nuclease described in the present invention are as follows, where light gray is the tracrRNA sequence; dark gray is the tracr partner sequence; when there is no connecting chain, the tracrRNA sequence + tracr partner sequence is Backbone; when there is a connecting strand, the tracrRNA sequence + connecting strand + tracr partner sequence is the backbone.

Its schematic diagram is shown in Figure 1; its tracrRNA sequence is shown in SEQ ID NO.111, and its tracr partner sequence is shown in SEQ ID NO.112; the guide RNA backbone sequence is SEQ ID NO.1 except for the gene targeting segment. The sequence is shown in SEQ ID NO.113; the gene targeting segment that hybridizes to the target sequence is shown in SEQ ID NO.168 ( acacagaggaccccuaguaa );

The tracrRNA sequence is shown in SEQ ID NO.114, the tracr partner sequence is shown in SEQ ID NO.115; the guide RNA backbone sequence is the sequence of SEQ ID NO.2 except for the gene targeting segment, such as SEQ ID NO.116 shown;

The tracrRNA sequence is shown in SEQ ID NO.117, the tracr partner sequence is shown in SEQ ID NO.118; the guide RNA backbone sequence is the sequence of SEQ ID NO.3 except the gene targeting segment, such as SEQ ID NO.119 shown;

The tracrRNA sequence is shown in SEQ ID NO.120, the tracr partner sequence is shown in SEQ ID NO.121; the guide RNA backbone sequence is the sequence of SEQ ID NO.4 except the gene targeting segment, such as SEQ ID NO.122 shown;

The tracrRNA sequence is shown in SEQ ID NO.123, the tracr partner sequence is shown in SEQ ID NO.124; the guide RNA backbone sequence is the sequence of SEQ ID NO.5 except the gene targeting segment, such as SEQ ID NO.125 shown;

The tracrRNA sequence is shown in SEQ ID NO.126, the tracr partner sequence is shown in SEQ ID NO.127; the guide RNA backbone sequence is the sequence of SEQ ID NO.6 except for the gene targeting segment, such as SEQ ID NO.128 shown;

The tracrRNA sequence is shown in SEQ ID NO.129, the tracr partner sequence is shown in SEQ ID NO.130; the guide RNA backbone sequence is the sequence of SEQ ID NO.7 except the gene targeting segment, such as SEQ ID NO.131 shown;

The tracrRNA sequence is shown in SEQ ID NO.132, the tracr partner sequence is shown in SEQ ID NO.133; the guide RNA backbone sequence is the sequence of SEQ ID NO.8 except the gene targeting segment, such as SEQ ID NO.134 shown;

The tracrRNA sequence is shown in SEQ ID NO.135, the tracr partner sequence is shown in SEQ ID NO.136; the guide RNA backbone sequence is the sequence of SEQ ID NO.9 except the gene targeting segment, such as SEQ ID NO.137 shown;

The tracrRNA sequence is shown in SEQ ID NO.138, the tracr partner sequence is shown in SEQ ID NO.139; the guide RNA backbone sequence is the sequence of SEQ ID NO.10 except for the gene targeting segment, such as SEQ ID NO.140 shown;

The tracrRNA sequence is shown in SEQ ID NO.141, the tracr partner sequence is shown in SEQ ID NO.142; the guide RNA backbone sequence is the sequence of SEQ ID NO.11 except the gene targeting segment, such as SEQ ID NO.143 shown;

The tracrRNA sequence is shown in SEQ ID NO.144, the tracr partner sequence is shown in SEQ ID NO.145; the guide RNA backbone sequence is the sequence of SEQ ID NO.12 except for the gene targeting segment, such as SEQ ID NO.146 shown;

The tracrRNA sequence is shown in SEQ ID NO.147, the tracr partner sequence is shown in SEQ ID NO.148; the guide RNA backbone sequence is the sequence of SEQ ID NO.13 except the gene targeting segment, such as SEQ ID NO.149 shown;

The tracrRNA sequence is shown in SEQ ID NO.150, the tracr partner sequence is shown in SEQ ID NO.151; the guide RNA backbone sequence is the sequence of SEQ ID NO.14 except for the gene targeting segment, such as SEQ ID NO.152 shown;

The tracrRNA sequence is shown in SEQ ID NO.153, the tracr partner sequence is shown in SEQ ID NO.154; the guide RNA backbone sequence is the sequence of SEQ ID NO.15 except the gene targeting segment, such as SEQ ID NO.155 shown;

The tracrRNA sequence is shown in SEQ ID NO.156, the tracr partner sequence is shown in SEQ ID NO.157; the guide RNA backbone sequence is the sequence of SEQ ID NO.16 except the gene targeting segment, such as SEQ ID NO.158 shown;

The tracrRNA sequence is shown in SEQ ID NO.159, the tracr partner sequence is shown in SEQ ID NO.160; the guide RNA backbone sequence is the sequence of SEQ ID NO.17 except for the gene targeting segment, such as SEQ ID NO.161 shown;

The tracrRNA sequence is shown in SEQ ID NO.162, the tracr partner sequence is shown in SEQ ID NO.163; the guide RNA backbone sequence is the sequence of SEQ ID NO.18 except for the gene targeting segment, such as SEQ ID NO.164 shown;

The tracrRNA sequence is shown in SEQ ID NO.165, the tracr partner sequence is shown in SEQ ID NO.166; the guide RNA backbone sequence is the sequence of SEQ ID NO.19 except for the gene targeting segment, such as SEQ ID NO.167 shown.

The underlined part is the targeting sequence, which is preferably the 20 bp fragment after the PAM sequence, which can be replaced by other qualifying targeting sequences.

The terms "SpCas12f1", "SpCas12f1 nuclease", "SpCas12f1 polypeptide", "SpCas12f1 protein" and "SpCas12f1 protein" are used interchangeably.

The terms "guide RNA", "guide RNA", "gRNA", "single gRNA" and "chimeric gRNA" are used interchangeably.

The term "a" or "an" entity refers to one or more of that entity; thus, the terms "a" (or "an"), "one or more" and "at least one" are used interchangeably herein.

The term "homology" or "identity" or "similarity" refers to the sequence similarity between two peptides or between two nucleic acid molecules. Homology can be determined by comparing corresponding positions in different polypeptides or nucleic acid molecules. When the same position in the sequence of the molecule being compared is occupied by the same base or amino acid in different sequences, then the molecule is at that position. Homogenous. The degree of homology between sequences is determined as a function of the number of matches or homologous positions shared by the sequences. An "unrelated" or "non-homologous" sequence should have less than 20% homology to one of the sequences disclosed herein.

A polynucleotide or polynucleotide region (or polypeptide or polypeptide region) has a certain percentage of sequence homology (e.g., 20%, 30%) with another polynucleotide or polynucleotide region (or polypeptide or polypeptide region). , 40%, 50%, 60%, 70%, 80%, 90%, 95%, 98% or 99%) refers to the percentage of bases (or amino acids) are the same. The alignment and percent homology or sequence identity can be determined using software programs and methods known in the art.

In the present invention, the terms "polynucleotide" and "oligonucleotide" are used interchangeably and they refer to a polymeric form of nucleotides of any length, whether deoxyribonucleotides or ribonucleotides or its analogues. Polynucleotides can have any three-dimensional structure and can perform any function, known or unknown. Examples of polynucleotides include, but are not limited to, the following: genes or gene fragments (including probes, primers, EST or SAGE tags), exons, introns, messenger RNA (mRNA), transfer RNA, ribosomal RNA, Ribozymes, cDNA, dsRNA, siRNA, miRNA, recombinant polynucleotides, branched polynucleotides, plasmids, vectors, isolated DNA of any sequence, isolated RNA of any sequence, nucleic acid probes and primers. Polynucleotides also include modified nucleotides, such as methylated nucleotides and nucleotide analogs. If a modification is present on the polynucleotide, the modification can be imparted before or after the polynucleotide is assembled. Nucleotide sequences can be interrupted by non-nucleotide components. The polynucleotide may be further modified after polymerization, for example by conjugation to be labeled with a labeling component. The term refers to both double-stranded and single-stranded polynucleotide molecules. Unless otherwise stated or required, any embodiment of a polynucleotide disclosed herein includes its double-stranded form and any of the two complementary single-stranded forms known or predicted to constitute the double-stranded form.

When applied to a polynucleotide, the term "encoding" means that the polynucleotide "encodes" a polypeptide, meaning that in its native state or when manipulated by methods well known to those skilled in the art, it can be transcribed and/or Or translated to produce a polypeptide of interest and/or a fragment thereof, or to produce an mRNA capable of encoding the polypeptide of interest and/or a fragment thereof. The antisense strand refers to the sequence that is complementary to the polynucleotide and from which the coding sequence can be deduced.

The term "genomic DNA" refers to the DNA of the genome of an organism, including the DNA of the genome of bacteria, archaea, fungi, protists, viruses, plants or animals.

The term "manipulating" DNA includes binding, nicking one strand, or cleaving both strands of DNA, or includes modifying or editing DNA or polypeptides that bind to DNA. Manipulating DNA can silence, activate or regulate the expression of RNA or polypeptide encoded by the DNA (so that it is not transcribed, or reduces the transcription activity, or makes it not translated, or reduces the level of translation), or prevents or enhances the interaction of the polypeptide with the DNA. combine. Cleavage can be performed by a variety of methods, such as enzymatic or chemical hydrolysis of phosphodiester bonds; cleavage can be single-stranded or double-stranded; DNA cleavage can result in blunt or staggered ends.

The term "hybridizable" or "complementary" or "substantially complementary" means that a nucleic acid (e.g., RNA) contains a nucleotide sequence that enables it to react at appropriate in vitro and/or in vivo temperatures and solution ionic strengths. Non-covalently bind to another nucleic acid under conditions in a sequence-specific, antiparallel manner, i.e., form Watson-Crick base pairs and/or G/U base pairs, "anneal" or "hybridize" ".

It is understood in the art that the sequence of a polynucleotide need not be 100% complementary to the sequence of a target nucleic acid to which it specifically hybridizes. Polynucleotides can hybridize on one or more segments. The polynucleotide may comprise at least 70%, at least 80%, at least 90%, at least 95%, at least 99%, or 100% sequence complementarity to a target region within the target nucleic acid sequence to which it is targeted.

The terms "peptide", "polypeptide" and "protein" are used interchangeably in the present invention and refer to polymeric forms of amino acids of any length, which may include both coded and non-coded amino acids, chemically or biochemically modified or derivatized Amino acids, and polypeptides with modified peptide backbones.

The term "encoding" a DNA sequence for a particular RNA is a DNA nucleic acid sequence that is transcribed into RNA. A DNA polynucleotide may encode an RNA (mRNA) that is translated into a protein, or a DNA polynucleotide may encode an RNA that is not translated into a protein (e.g., tRNA, rRNA, or gRNA; also known as "non-coding" RNA or "ncRNA" "). A "protein coding sequence" or a sequence encoding a specific protein or polypeptide is a nucleic acid sequence that is transcribed into mRNA (in the case of DNA) and translated (in the case of mRNA) into a polypeptide in vivo or in vitro under the control of appropriate regulatory sequences .

The term "vector" or "expression vector" is a replicon, such as a plasmid, phage, virus or cosmid, to which another DNA segment, i.e., an "insert" can be attached so that the attached segment can be expressed in a cell copy in.

The term "expression cassette" encompasses a DNA coding sequence operably linked to a promoter. "Operably connected" means connected in parallel, with the components in a relationship that allows them to function in their intended manner. The terms "recombinant expression vector" or "DNA construct" are used interchangeably in the present invention to refer to a DNA molecule comprising a vector and at least one insert. Recombinant expression vectors are typically produced for the purpose of expressing and/or amplifying inserts or for the construction of other recombinant nucleotide sequences.

When foreign DNA, such as a recombinant expression vector, has been introduced into a cell, the cell has been "genetically modified" or "transformed" or "transfected" by the DNA. The presence of foreign DNA results in permanent or transient genetic changes. The transforming DNA may or may not be integrated into the cell's genome.

The term "target DNA" is a DNA polynucleotide comprising a "target site" or "target sequence". The terms "target site", "target sequence", "target protospacer DNA" or "protospacer-like sequence" are used interchangeably in the present invention to refer to the nucleic acid sequence present in the target DNA if sufficient conditions for binding, then the DNA-targeting segment of the gRNA will bind to it. RNA molecules contain sequences that bind, hybridize, or are complementary to target sequences within target DNA, thereby targeting the bound polypeptide to a specific location within the target DNA (target sequence). "Cleaving" refers to the break of the covalent backbone of the DNA molecule.

The terms "nuclease" and "endonuclease" are used interchangeably to refer to enzymes having endonucleic acid degrading catalytic activity for polynucleotide cleavage. The "cleavage domain" or "active domain" or "nuclease domain" of a nuclease refers to a polypeptide sequence or domain within a nuclease that has catalytic activity for DNA cleavage. The cleavage domain may be contained in a single polypeptide chain, or the cleavage activity may result from the association of two or more polypeptides.

The term "targeting polypeptide" or "RNA-binding site directed polypeptide" refers to a polypeptide that binds RNA and is targeted to a specific DNA sequence.

The term "leader sequence" or DNA-targeting segment (or "DNA-targeting sequence") encompasses a nucleotide sequence complementary to a specific sequence within the target DNA, referred to in the present invention as a "protospacer-like" sequence (Complementary strand of target DNA).

The term "recombination" refers to the process of exchanging genetic information between two polynucleotides. "Homology-directed repair (HDR)" as used herein refers to a specialized form of DNA repair that occurs, for example, during the repair of double-strand breaks in cells. This process requires nucleotide sequence homology, uses a "donor" molecule to provide a template for repair of a "target" molecule (i.e., a molecule that has undergone a double-strand break), and results in the transfer of genetic information from the donor to the target. If the donor polynucleotide is different from the target molecule and part or all of the donor polynucleotide sequence is incorporated into the target DNA, homology-directed repair may result in changes to the target molecule sequence (e.g., insertions, deletions, mutation).

The term "nonhomologous end joining (NHEJ)" refers to the repair of double-stranded breaks in DNA by directly joining the broken ends to each other without the need for homologous templates. NHEJ often results in deletions of nucleotide sequences near the double-strand break site.

The term "treatment" includes preventing the occurrence of a disease or symptom; inhibiting a disease or symptom or alleviating a disease.

The terms "individual", "subject", "host" and "patient" are used interchangeably in the present invention and refer to any mammalian subject, particularly a human, for whom diagnosis, treatment or therapy is desired. .

If specific techniques or conditions are not specified in the examples, the conventional techniques or conditions described in literature in the field or the instructions of the product manufacturer shall be followed.

The primers used in the examples were all synthesized by Shanghai Sangon Bioengineering Co., Ltd. and Suzhou Jinweizhi Biotechnology Co., Ltd. If the manufacturer of the reagents or instruments used is not indicated, they are regarded as conventional products that can be purchased through regular channels.

Example 1 Gene editing of SpCas12f1 and gRNA_MS1 in mammalian cells

In this example, human embryonic kidney cell HEK293T was used as the cell used in the experiment.

1. Construction of pCMV-SpCas12f-gRNA_MS1 plasmid (without gene targeting segment)

Sangon Bioengineering (Shanghai) Co., Ltd. synthesized the following sequence:

Human transient expression plasmid backbone: 5’-ctgtgccttctagttgccagccatctgttgtttgcccctcccccgtgccttccttgaccctggaaggtgccactcccactgtcctttcctaataaaatgaggaaattgcatcgcattgtctgagtaggtgtcattctattctggggggtggggtggggcaggacagcaagggg gaggattgggaagacaatagcaggcatgctggggatgcggtgggctctatggcttctgaggcggaaagaaccagctggggctcgataccgtcgacctctagctagagcttggcgtaatcatggtcatagctgtttcctgcaggtggcacttttcggggaaatgtgcgcggaacccctatttgtttatttttctaaatacattcaa atatgtatccgctcatgagacaataaccctgataaatgcttcaataatattgaaaaaggaagagtatgagtattcaacatttccgtgtcgcccttattcccttttttgcggcattttgccttcctgtttttgctcacccagaaacgctggtgaaagtaaaagatgctgaagatcagttgggtgcacgagtgggtta catcgaactggatctcaacagcggtaagatccttgagagttttcgccccgaagaacgttttccaatgatgagcacttttaaagttctgctatgtggcgcggtattatcccgtattgacgccgggcaagagcaactcggtcgccgcatacactattctcagaatgacttggttgagtactcaccagtcacagaaaagcatcttacggat ggcatgacagtaagagaattatgcagtgctgccataaccatgagtgataacactgcggccaacttacttctgacaacgatcggaggaccgaaggagctaaccgcttttttgcacaacatgggggatcatgtaactcgccttgatcgttgggaaccggagctgaatgaagccataccaaacgacgagcgtgacaccacgatgcctgtagca atggcaacaacgttgcgcaaactattaactggcgaactacttactctagcttcccggcaacaattaatagactggatggaggcggataaagttgcaggacccacttctgcgctcggcccttccggctggctggttattgctgataaatctggagccggtgagcgtgggtcccgcggtatcattgcagcactggggccagatggtaagccctccc gtatcgtagttatctacacgacggggagtcaggcaactatggatgaacgaaatagacagatcgctgagataggtgcctcactgattaagcattggtaactgtcagaccaagtttactcatatatactttagattgatttaaaacttcatttttaatttaaa aggatctaggtgaagatcctttttgataatctcatgaccaaaatcccttaacgtgagt tttcgttccactgagcgtcagaccccgtagaaaagatcaaaggatcttcttgagatcctttttttctgcgcgtaatctgctgcttgcaaacaaaaaaaccaccgctaccagcggtggtttgtttgccggatcaagagctaccaactctttttccgaaggtaactggcttcagcagagcgcagat accaaatactgtccttctagtgtagccgtagttaggcacccacttcaagaactctgtagcaccgcctacatacctcgctctgctaatcctgttaccagtggctgctgccagtggcgataagtcgtgtcttaccgggttggactcaagacgatagttaccccggataaggcgcagcggtcgggctgaacggggggttcgtgcacacagcccagct tggagcgaacgacctacaccgaactgagatacctacagcgtgagcattgagaaagcgccacgcttcccgaagggagaaaggcggacaggtatccggtaagcggcagggtcggaacaggagagcgcacgagggagcttccagggggaaacgcctggtatctttatagtcctgtcgggtttcgccacctctgacttgagcgt cgatttttgtgatgctcgtcaggggggcggagcctatggaaaaacgccagcaacgcggcctttttacggttcctggccttttgctggcctttgctcacatgttctttcctgcgttatcccctgattctgtggataaccgtattaccgcctttgagtgagctgataccgctcgccgcagccgaacga ccgagcgcagcgagtcagtgagcgaggaagcggaagagcgctgccggcacctgtcctacgagttgcatgataaagaagacagtcataagtgcggcgacgatagtcatgccccgcgcccaccggaaggagctgactgggttgaaggctctcaagggcatcggtcgacggatccttatcgattttaccacatttgtagaggttt tacttgctttaaaaaacctcccacacctcccctgaacctgaaacataaaatgaatgcaattgttgttgttaacttgtttattgcagcttataatggttacaaataaagcaatagcatcacaaatttcacaaataaagcatttttttcactgcattctagttgtggtttgtccaaactcatcaatgtatctttatcatgtctgctc gaagcggccggccgccccgactctagaaagtggctaagatctacagctgccttgtaagtcattggtcttaaaggtaccgatgcatggggtcgtgcgctcctttcggtcgggcgctgcgggtcgtggggcgggcg-3’(SEQ ID NO.43);

Puromycin resistance gene expression cassette: 5’-ggggttggggttgcgccttttccaaggcagccctgggtttgcgcagggacgcggctgctctgggcgtggttccgggaaacgcagcggcgccgaccctgggactcgcacattcttcacgtccgttcgcagcgtcacccggatcttcgccgctacccttg tgggccccccggcgacgcttcctgctccgcccctaagtcgggaaggttccttgcggttcgcggcgtgccggacgtgacaaacggaagccgcacgtctcactagtaccctcgcagacggacagcgccagggagcaatggcagcgcgccgaccgcgatgggctgtggccaatagcggctgctcagcagggc gcgccgagagcagcggccggggaaggggcggtgcgggaggcggggtgtggggcggtagtgtgggccctgttcctgcccgcgcggtgttccgcattctgcaagcctccggagcgcacgtcggcagtcggctccctcgttgaccgaatcaccgacctctctccccagggggatccaccggagcttaccatgaccgag tacaagcccacggtgcgcctcgccacccgcgacgacgtccccagggccgtacgcaccctcgccgccgcgttcgccgactaccccgccacgcgccacaccgtcgatccggaccgccacatcgagcgggtcaccgagctgcaagaactcttcctcacgcgcgtcgggctcgacatcggcaaggtgtg ggtcgcggacgacggcgccgcggtggcggtctggaccacgccggagagcgtcgaagcgggggcggtgttcgccgagatcggcccgcgcatggccgagttgagcggttcccggctggccgcgcagcaacagatggaaggcctcctggcgccgcaccggcccaaggagcccgcgtggttcctggccac cgtcggcgtctcgcccgaccaccagggcaagggtctgggcagcgccgtcgtgctccccggagtggaggcggccgagcgcgccggggtgcccgccttcctggaaacctccgcgccccgcaacctcccctctacgagcggctcggcttcaccgtcaccgccgacgtcgaggtgcccgaaggaccgc gcacctggtgcatgacccgcaagcccggtgcctga-3’(SEQ ID NO.44);

Human codon-optimized SpCas12f1 encoding gene expression cassette: 5’-gacattgattattgactagttattaatagtaatcaattacggggtcattagttcatagcccatatatggagttccgcgttacataacttacggtaaatggcccgcctggctgaccgcccaacgacccccgcccattgacgtcaataatgacgtatgttcccatagtaacgccaatagggactttccatt gacgtcaatgggtggagtatttacggtaaactgcccacttggcagtacatcaagtgtatcatatgccaagtacgccccctattgacgtcaatgacggtaaatggcccgcctggcattatgcccagtacatgaccttatgggactttcctacttggcagtacatctacgtattagtcatcgctattaccatggtgatgcggttttggcagta catcaatgggcgtggatagcggtttgactcacggggatttccaagtctccaccccattgacgtcaatgggagtttgtttggcaccaaaatcaacgggactttccaaaatgtcgtaacaactccgccccattgacgcaaatgggcggtaggcgtgtacggtgggaggtctatataagcagagctggtttagtgaacc gtcagatccgctagagatccgcggccgctaatacgactcactataggggagagccgccaccatgcccaagaagaagaggaaagtcATGGGCGAGAGCGTGAAGGCCATCAAGCTGAAGATCCTGGATATGTTTCTGGACCCTGAGTGTACCAAGCAGGATGATAACTGGAGAAAGGACCTGAGCACCATGAGCAGATTTTGCGCCGAGGCCGGCAATATGTGCCTGAGGGATCTGTATAATTACTTTAG CATGCCTAAGGAGGATAGGATTAGCAGCAAGGACCTGTACAACGCCATGTACCACAAGACCAAGCTGCTGCACCCTGAGCTGCCCGGCAAGGTGGCCAACCAGATCGTC CAAGGAGTACTCCAAGGACTCTGGCAAGGGCACCCACAGGTACTTCCTGGTGGCCGTGAGAGACAGCAGCACAAGGATGATCTTCGACAGGATCATGTCTAAGGATCACATCGATTCCAGCAAGTCCTACACCCAGGGCCAGCTGCAGATCAAGAAGGACCACCAGGGCAAGTGGTACTGCATCATCCCATACACCTTCCCAACCCACGAGACAGTGCTGGACCCCGACAAGGTCATGGGCGTGGACCTGGGCGTGGCCAAGGCCGTGTACT GGGCCTTCAACAGCAGCTACAAGCGCGGCTGCATCGACGGCGGCGAGATCGAGCACTTCCGGAAGATGATCAGAGCCAGGAGAGTGAGCATCCAGAACCAGATCAAGCACTCCGGCGACGCAAGGAAGGGCCACGGCAGAAAGCGGGCCCTGAAGCCAATCGAAACCCTGTCTGAGAAGGAGAAGAACTTCCGGGACACCATCAACCACAGATACGCCAACAGGATCGTGGAGGCCGCCATTAAGCAGGGCTGCGGCA CAATCCAGATCGAATCTGGAGGGCATCGCCGACACCACCGGCAGCAAGTTCCTGAAGAATTGGCCTTACTACGATCTGCAGACCAAGATCGTGAATAAGGCCAAGGAGCACGGCATCACCGTGGTGGCCATCAACCCTCAGTACACATCCCAGAGATGTTCCATGTGCGGCTACATCGAAAAGACAAACCGCAGCAGCCAGGCCGTGTTCGAGTGCAAGCAGTGCGGCTACGGCAGC AGGACCATCTGCATCAACTGTAG ACACGTGCAGGTGAGCGGCGACGTGTGTGAGGAGTGCGGCGGCATCGTGAAGAAGGAAAACGTGAACGCCGATTACAATGCCGCCAAGAACATCAGCACCCCCTACATCGACCAGATTATCATGGAGAAGTGCCTGGAGCTGGGCATCCCCTACAGAAGCATCACCTGTAAGGAGTGCGGCCACATCCAGGCCAGCGGCAATACCTGCGAGGTGTGCGGCAGCACCAACATCCTGAAGCCTAAGAAGATCAGAAAGGCCAA Gtctggtggttctcccaagaagaagaggaaagtctaaccggtcatcatcaccatcaccat-3’(SEQ ID NO.45);

The corresponding guide gRNA_MS1 expression cassette for SpCas12f1 in human cells: 5’-gagggcctatttcccatgattccttcatatttgcatatacgatacaaggctgttagagagataattggaattaatttgactgtaaacacaaagatattagtacaaaatacgtgacgtagaaagtaataatttcttgggtagtttgcagttttaaaattatgttttaaaaatggact atcatatgcttaccgtaacttgaaagtatttcgatttcttggctttatatatcttgtggaaaggacgaaacaccGttatactctgtttcgcgcgccagggcagttaggtgccctaaaagagcgaagtggccgaaaggaaaggctaacgcttctctaacgctacggctacggcgaccttggcgaaatgccatcaataccaCGCGgc ccgaaagggttcgcgcgaaactgagtagaaccgctgtcgcatcttgcgtaagcgcgtggattgaaaccgagaccattggtctcatttttttgaattctcgacctcgagacaaatggcagtattcatccacaattttaaaagaaaaggggggattggggggtacagtgcaggggaaagaatagtagacataatagcaacagacatacaaacta aagaattacaaaaacaaattacaaaaattcaaaattttcgggtttattacagggacagcagagatccactttggccgcggctcgag-3’ (SEQ ID NO. 46).

These four fragments were assembled into pCMV-SpCas12f1 plasmid using Gibson assembly technology. The pCMV-SpCas12f1 plasmid was transformed into Escherichia coli DH5α cells, and single clones were picked for sequencing to obtain the pCMV-SpCas12f1 plasmid.

2. Construction of pCMV-SpCas12f1-gRNA_MS1-G series plasmids containing targeting sequences

2.1 Target sequence DNA preparation

In this example, 9 genes including VEGFA, AAVS1, EMX1, FANCF, ATP1A1F, TP53, HEXA, PRNP and PDCD1 in the HEK293T cell genome were selected as target sequences, and 32 20 bp targets were selected on these target sequences. Sequence DNA. It was synthesized into the following sequence by Sangon Bioengineering (Shanghai) Co., Ltd.:

Guide1-F: 5’-aaacacacagaggacccctagtaa-3’(SEQ ID NO.47);

Guide1-R: 5’-aaaattactaggggtcctctgtgt-3’ (SEQ ID NO.48);

Guide2-F: 5’-AAACaatgcctggcacagcatggt-3’(SEQ ID NO.49);

Guide2-R: 5’-AAAAaccatgctgtgccaggcatt-3’ (SEQ ID NO.50);

Guide3-F: 5’-AAACctcttggggaaatgattctt-3’(SEQ ID NO.51);

Guide3-R: 5’-AAAAaagaatcatttccccaagag-3’ (SEQ ID NO.52);

Guide4-F: 5’-AAACtcttgaaggggacaggctac-3’(SEQ ID NO.53);

Guide4-R: 5’-AAAAgtagcctgtccccttcaaga-3’(SEQ ID NO.54);

Guide5-F: 5’-AAACtcttgggcttggcaggcatg-3’(SEQ ID NO.55);

Guide5-R：5’-AAAAcatgcctgccaagcccaaga-3(SEQ ID NO.56);’

Guide6-F: 5’-AAACtctccccagcctgtcaaagc-3’(SEQ ID NO.57);

Guide6-R: 5’-AAAAgctttgacaggctggggaga-3’ (SEQ ID NO.58);

Guide7-F: 5’-AAACcgtgccagctcccaaggtag-3’(SEQ ID NO.59);

Guide7-R: 5’-AAAActaccttgggagctggcacg-3’ (SEQ ID NO.60);

Guide8-F: 5’-AAACtgtcgcagttgcaaatgaag-3’(SEQ ID NO.61);

Guide8-R: 5’-AAAActtcatttgcaactgcgaca-3’(SEQ ID NO.62);

Guide9-F: 5’-aaacAGTGCCGACGCCGCGAGCCCC-3’ (SEQ ID NO.63);

Guide9-R: 5’-aaaaGGGGCTCGCGGCGTCGCACT-3’(SEQ ID NO.64);

Guide10-F: 5’-aaacCCTCTTTAGCCAGAGCCGGG-3’(SEQ ID NO.65);

Guide10-R: 5’-aaaaCCCGGCTCTGGCTAAAGAGG-3’ (SEQ ID NO.66);

Guide11-F: 5’-AAACCTGGCTCTGCTCTTCAGACT-3’(SEQ ID NO.67);

Guide11-R: 5’-AAAAAGTCTGAAGAGCAGAGCCAG-3’(SEQ ID NO.68);

Guide12-F: 5’-AAACACCAGGTCGTGGCCGCCTCT-3’(SEQ ID NO.69);

Guide12-R: 5’-AAAAAGAGGCGGCCACGACCTGGT-3’(SEQ ID NO.70);

Guide13-F: 5’-AAACCTCCGTGCGTCAGTTTTACC-3’(SEQ ID NO.71);

Guide13-R: 5’-AAAAGGTAAAACTGACGCACGGAG-3’(SEQ ID NO.72);

Guide14-F: 5’-AAAACTAACTTTGGCTCTTCACCTT-3’(SEQ ID NO.73);

Guide14-R: 5’-AAAAAAGGTGAAGAGCCAAAGTTA-3’(SEQ ID NO.74);

Guide15-F: 5’-AAACTGGGAGAGGGTAGCGCAGGG-3’(SEQ ID NO.75);

Guide15-R: 5’-AAAACCCTGCGCTACCCTCTCCCA-3’(SEQ ID NO.76);

Guide16-F: 5’-AAACTCAGTGGCCACCCTGCGCTA-3’(SEQ ID NO.77);

Guide16-R: 5’-AAAATAGCGCAGGGGTGGCCACTGA-3’(SEQ ID NO.78);

Guide17-F: 5’-AAACTGGCAAGGAGAGAGATGGCT-3’(SEQ ID NO.79);

Guide17-R: 5’-AAAAAGCCATCTCTCTCCTTGCCA-3’(SEQ ID NO.80);

Guide18-F: 5’-AAACTGGGTACTTTTATCTGTCCC-3’(SEQ ID NO.81);

Guide18-R: 5’-AAAAGGGACAGATAAAAGTACCCA-3’(SEQ ID NO.82);

Guide19-F: 5’-AAAACTCCTGTGGATTCGGGTCACC-3’(SEQ ID NO.83);

Guide19-R: 5’-AAAAGGTGACCCGAATCCACAGGA-3’(SEQ ID NO.84);

Guide20-F: 5’-AAACctgacccaataatgggtttt-3’(SEQ ID NO.85);

Guide20-R: 5’-AAAAaaaacccattattgggtcag-3’ (SEQ ID NO.86);

Guide21-F: 5’-AAACctgtttcaagctgtggcatt-3’(SEQ ID NO.87);

Guide21-R: 5’-AAAAaatgccacagcttgaaacag-3’ (SEQ ID NO.88);

Guide22-F: 5’-AAACaaccttgtccttgttgtaac-3’(SEQ ID NO.89);

Guide22-R: 5’-AAAAgttacaacaaggacaaggtt-3’(SEQ ID NO.90);

Guide23-F: 5’-AAACtaaggccatgtccctcttgt-3’(SEQ ID NO.91);

Guide23-R: 5’-AAAAacaagagggacatggcctta-3’(SEQ ID NO.92);

Guide24-F: 5’-AAACgccataatgactgctctgca-3’(SEQ ID NO.93);

Guide24-R: 5’-AAAAtgcagagcagtcattatggc-3’(SEQ ID NO.94);

Guide25-F: 5’-AAACcatcctccaggcttcgggcg-3’(SEQ ID NO.95);

Guide25-R: 5’-AAAAcgcccgaagcctggaggatg-3’(SEQ ID NO.96);

Guide26-F：5’-AAACagtttgaaagagagttaatt-3’(SEQ ID NO.97);

Guide26-R: 5’-AAAAaattaactctctttcaaact-3’ (SEQ ID NO.98);

Guide27-F: 5’-AAACcccaggctcaaacctcccct-3’(SEQ ID NO.99);

Guide27-R: 5’-AAAAaggggaggtttgagcctggg-3’ (SEQ ID NO.100);

Guide28-F: 5’-AAACcatggctcagtaccagcaag-3’(SEQ ID NO.101);

Guide28-R: 5’-AAAActtgctggtactgagccatg-3’ (SEQ ID NO.102);

Guide29-F: 5’-aaacCCTCACTCCTGCTCGGTGAA-3’(SEQ ID NO.103);

Guide29-R: 5’-aaaaTTCACCGAGCAGGAGTGAGG-3’ (SEQ ID NO.104);

Guide30-F：5’-AAACtgtaattcagcatatggatt-3’(SEQ ID NO.105);

Guide30-R: 5’-AAAAaatccatatgctgaattaca-3’ (SEQ ID NO.106);

Guide31-F：5’-AAACtgaagttagttagctacaac-3’(SEQ ID NO.107);

Guide31-R: 5’-AAAAgttgtagctaactaacttca-3’ (SEQ ID NO.108);

Guide32-F: 5’-AAACctacacacaaaacaaatatt-3’(SEQ ID NO.109);

Guide32-R: 5’-AAAAaatatttgttttgtgtgtag-3’ (SEQ ID NO.110);

Phosphorylation and annealing of target sequence DNA: Prepare the annealing system according to Table 1.

Table 1

组分 Components		体积volume
10×T4 DNA ligase Buffer(NEB)10×T4 DNA ligase Buffer(NEB)	1μl1μl
Guide-FGuide-F	2μl2μl
Guide-RGuide-R	2μl2μl
T4 PNK(NEB)T4 PNK(NEB)	0.5μl0.5μl
无菌无酶水Sterile enzyme-free water	4.5μl4.5μl

The phosphorylation procedure is: react at 37°C for 30 minutes. Then add a final concentration of 50mM NaCl to the 10μl reaction system and anneal slowly to obtain the annealed target sequence DNA.

2.2 Targeting sequence DNA insertion

Then, the target sequence DNA was inserted into the pCMV-SpCas12f1-gRNA_MS1 plasmid through the Golden gate assembly to construct the pCMV-SpCas12f1-gRNA_MS1-G series plasmids (including pCMV-SpCas12f1-gRNA_MS1-G1 to pCMV-SpCas12f1-gRNA_MS1-G32 plasmids). A total of 32 plasmids). The Golden gate assembly system is shown in Table 2 below.

Table 2

组分Components	含量content
10×T4 DNA ligase Buffer(NEB)10×T4 DNA ligase Buffer(NEB)	1μl1μl
pCMV-SpCas12f1-gRNA_MS1pCMV-SpCas12f1-gRNA_MS1	50ng50ng
靶向序列DNATargeting sequence DNA	0.5μl0.5μl
T4 DNA ligase(NEB)T4 DNA ligase(NEB)	0.5μl0.5μl
BsaI(NEB)BsaI(NEB)	0.5μl0.5μl
无菌无酶水Sterile enzyme-free water	至10μlto 10μl

Connection procedure: 37℃ for 2min, 16℃ for 3min, repeat this step for a total of 25 cycles, finally 50℃ for 10min, 80℃ for 10min.

The ligation product was transformed into E. coli DH5α cells, and single clones were selected for sequencing to obtain pCMV-SpCas12f1-gRNA_MS1-G series plasmids (transient expression plasmids) containing the targeting sequence.

3. Human cell gene editing mediated by pCMV-SpCas12f1-gRNA_MS1-G series plasmids

Culture the activated HEK293T cells in DMEM medium containing 10% FBS by volume. When the cell growth density reaches about 90%, they are passaged into a 24-well plate. The number of cells in each well is about 1.0×10 ⁵ . 16-18 hours later, 1000ng of pCMV-SpCas12f1-gRNA_MS1-G plasmid editing different genes was transfected into the cells using 1.5 μL lipofectamine3000 (Invitrogen) in each well. After 24 hours, fresh medium containing puromycin at a final concentration of 2 μg/ml was added for selection. After continuing to culture for 48 hours, the adherent cells were digested and genomic DNA was extracted.

PCR amplifies the target gene fragment of the target sequence, and the PCR product after gel recovery is annealed with NEBuffer2 (NEB). Then add T7 endonuclease 1 (NEB) to the PCR reaction system, digest at 37°C for 15 minutes, and then add 6×Gel Loading Dye (NEB) to terminate the reaction. The reaction products were separated by 6% TBE-PAGE and stained and imaged by 4S Red dye (Sangon Bioengineering (Shanghai) Co., Ltd.).

4. Results Figure 2 shows the gene editing results of mammalian cells mediated by the CRISPR/SpCas12f1 editing system (pCMV-SpCas12f1-gRNA_MS1 series plasmids). As shown in the figure, the CRISPR/SpCas12f1 editing system successfully achieved gene editing of multiple genes on the mammalian cell genome.

Example 2 Engineering of guide RNA corresponding to SpCas12f1 nuclease

In this example, on the basis of gRNA_MS1, the tracrRNA and crRNA of the guide RNA corresponding to the SpCas12f1 nuclease were individually transformed and combined. The specific transformation sites and corresponding base lengths are shown in Figure 3. The specific engineering methods and The modified base length is as shown in the following sequence:

Coding nucleotides of gRNA_MS1: 5'-ttatctctgtttcgcgcgccagggcagttaggtgccctaaaagagcgaagtggccgaaaggaaaggctaacgcttctctaacgctacggcgaccttggcgaaatgccatcaataccacgcggcccgaaagggttcgcgcgaaactgagtagaaccgctgtcgcatcttgc gtaagcgcgtggattgaaac acacagaggacccctagtaa -3' (SEQ ID NO. 20);

The coding nucleotide of gRNA_MS2, truncating the 7nt base at the 5' end of tracrRNA: 5'-gtttcgcgcgccagggcagttaggtgccctaaaagagcgaagtggccgaaaggaaaggctaacgcttctctaacgctacggcgaccttggcgaaatgccatcaataccacgcggcccgaaagggttcgcgcgaaactgagtagaacc gctgtcgcatcttgcgtaagcgcgtggattgaaac acacagaggacccctagtaa -3' (SEQ ID NO. 21);

The coding nucleotide of gRNA_MS3, truncated 16nt base at the 5' end of tracrRNA: 5'-gccagggcagttaggtgccctaaaagagcgaagtggccgaaaggaaaggctaacgcttctctaacgctacggcgaccttggcgaaatgccatcaataccacgcggcccgaaagggttcgcgcgaaactgagtagaaccgctgtcgcatct tgcgtaagcgcgtggattgaaacacacagaggacccctagtaa -3' (SEQ ID NO. 22);

The coding nucleotide of gRNA_MS4, truncated 6nt bases at the 3' end of tracrRNA: 5'-ttactctgtttcgcgcgccagggcagttaggtgccctaaaagagcgaagtggccgaaaggaaaggctaacgcttctctaacgctacggcgaccttggcgaaatgccatcaataccacgcggcccgaaagggttcgcgcgaaacgaacc gctgtcgcatcttgcgtaagcgcgtggattgaaac acacagaggacccctagtaa –3’ (SEQ ID NO. 23);

The coding nucleotide of gRNA_MS5, truncated 15nt base at the 3' end of tracrRNA: 5'-ttactctgtttcgcgcgccagggcagttaggtgccctaaaagagcgaagtggccgaaaggaaaggctaacgcttctctaacgctacggcgaccttggcgaaatgccatcaataccacgcggcccgaaagggttcgaaccgctgtcg catcttgcgtaagcgcgtggattgaaac acacagaggacccctagtaa –3’ (SEQ ID NO. 24);

The coding nucleotide of gRNA_MS6, truncated 28nt bases at the 3' end of tracrRNA: 5'-ttactctgtttcgcgcgccagggcagttaggtgccctaaaagagcgaagtggccgaaaggaaaggctaacgcttctctaacgctacggcgaccttggcgaaatgccatcaataccacgcgggaaccgctgtcgcatcttgcgtaagc gcgtggattgaaac acacagaggacccctagtaa –3’ (SEQ ID NO. 25);

The coding nucleotide of gRNA_MS7, truncated 8nt base at the 5' end of crRNA: 5'-ttactctgtttcgcgcgccagggcagttaggtgccctaaaagagcgaagtggccgaaaggaaaggctaacgcttctctaacgctacggcgaccttggcgaaatgccatcaataccacgcggcccgaaagggttcgcgcgaaactgagtag tcgcatcttgcgtaagcgcgtggattgaaac acacagaggacccctagtaa –3’ (SEQ ID NO. 26);

The coding nucleotide of gRNA_MS8, truncated 21nt bases at the 5' end of crRNA: 5'-ttactctgtttcgcgcgccagggcagttaggtgccctaaaagagcgaagtggccgaaaggaaaggctaacgcttctctaacgctacggcgaccttggcgaaatgccatcaataccacgcggcccgaaagggttcgcgcgaaactgag tataagcgcgtggattgaaacacacagaggacccctagtaa -3' (SEQ ID NO. 27);

The coding nucleotide of gRNA_MS9 truncates 4nt bases at the 5' end of tracrRNA and truncates 3nt bases at the 3' end of tracrRNA: 5'-tctgtttcgcgcgccagggcagttaggtgccctaaaagagcgaagtggccgaaaggaaaggctaacgcttctctaacgctacggcgaccttggcgaaatgccatcaataccacgcggcccgaa agggttcgcgcgaaactgagaaccgctgtcgcatcttgcgtaagcgcgtggattgaaac acacagaggacccctagtaa –3’ (SEQ ID NO. 28);

The coding nucleotide of gRNA_MS10 truncates 7nt bases at the 5' end of tracrRNA and truncates 6nt bases at the 3' end of tracrRNA: 5'- gtttcgcgcgccagggcagttaggtgccctaaaagagcgaagtggccgaaaggaaaggctaacgcttctctaacgctacggcgaccttggcgaaatgccatcaataccacgcggcccgaaag ggttcgcgcgaaacgaaccgctgtcgcatcttgcgtaagcgcgtggattgaaac acacagaggacccctagtaa –3’ (SEQ ID NO. 29);

The coding nucleotide of gRNA_MS11 truncates 10nt bases at the 5' end of tracrRNA and truncates 9nt bases at the 3' end of tracrRNA: 5'-tcgcgcgccagggcagttaggtgccctaaaagagcgaagtggccgaaaggaaaggctaacgcttctctaacgctacggcgaccttggcgaaatgccatcaataccacgcggcccgaaagggt tcgcgcgagaaccgctgtcgcatcttgcgtaagcgcgtggattgaaac acacagaggacccctagtaa –3’ (SEQ ID NO. 30);

The coding nucleotide of gRNA_MS12 truncates 7nt bases at the 5' end of tracrRNA, truncates 6nt bases at the 3' end of tracrRNA, and truncates 8nt bases at the 5' end of crRNA, and adds AAGG four bases between tracrRNA and crRNA Base for ligation: 5'-gtttcgcgcgccagggcagttaggtgccctaaaagagcgaagtggccgaaaggaaaggctaacgcttctctaacgctacggcgaccttggcgaaatgccatcaataccacgcggcccgaaagggttcgcgcgaaacAAGGgtcgcatcttgcgtaagcgcgtggattgaaac a cacagaggacccctagtaa -3' (SEQ ID NO. 31);

The coding nucleotide of gRNA_MS13 truncates 7nt bases at the 5' end of tracrRNA, truncates 6nt bases at the 3' end of tracrRNA, and truncates 21nt bases at the 5' end of crRNA, and adds AAGG four bases between tracrRNA and crRNA Base for ligation: 5'-gtttcgcgcgccagggcagttaggtgccctaaaagagcgaagtggccgaaaggaaaggctaacgcttctctaacgctacggcgaccttggcgaaatgccatcaataccacgcggcccgaaagggttcgcgcgaaacAAGGtaagcgcgtggattgaaac acacagaggacccctagtaa -3'(SEQ ID NO.32);

Coding nucleotide of gRNA_MS14, cut off stem loop 1, 16nt base: 5'-ttactctgtttcgcgcgccataaaagagcgaagtggccgaaaggaaaggctaacgcttctctaacgctacggcgaccttggcgaaatgccatcaataccacgcggcccgaaagggttcgcgcgaaactgagtagaaccgctgtcgcatct tgcgtaagcgcgtggattgaaacacacagaggacccctagtaa -3' (SEQ ID NO. 33);

Coding nucleotide of gRNA_MS15, cut off the upper half of stem loop 2, 16nt base: 5'-ttactctgtttcgcgcgccagggcagttaggtgccctaaaagagcgaagtaacgcttctctaacgctacggcgaccttggcgaaatgccatcaataccacgcggcccgaaagggttcgcgcgaaactgagtagaaccgctgtc gcatcttgcgtaagcgcgtggattgaaac acacagaggacccctagtaa –3’ (SEQ ID NO.34);

The coding nucleotide of gRNA_MS16, cut off the entire stem loop 2, 32nt bases: 5'-ttactctgtttcgcgcgccagggcagttaggtgccctaaaagtctctaacgctacggcgaccttggcgaaatgccatcaataccacgcggcccgaaagggttcgcgcgaaactgagtagaaccgctgtcgcatcttgcgtaagcg cgtggattgaaac aca cagaggacccctagtaa –3’ (SEQ ID NO. 35);

The coding nucleotide of gRNA_MS17, cut off the stem loop 3, 8nt base: 5'-ttactctgtttcgcgcgccagggcagttaggtgccctaaaagagcgaagtggccgaaaggaaaggctaacgcttctctaacgaccttggcgaaatgccatcaataccacgcggcccgaaagggttcgcgcgaaactgagtagaaccgctgt cgcatcttgcgtaagcgcgtggattgaaac acacagaggacccctagtaa –3’ (SEQ ID NO. 36);

Coding nucleotide of gRNA_MS18, cut off stem loop 4, 11nt base: 5'-ttactctgtttcgcgcgccagggcagttaggtgccctaaaagagcgaagtggccgaaaggaaaggctaacgcttctctaacgctacggcgaccttatcaataccacgcggcccgaaagggttcgcgcgaaactgagtagaaccgctgtcg catcttgcgtaagcgcgtggattgaaac acacagaggacccctagtaa –3’ (SEQ ID NO.37);

The coding nucleotide of gRNA_MS19, add UUUUAUUUUUU (SEQ ID NO.169) 11nt base at the 3' end of crRNA: 5'-ttactctgtttcgcgcgccagggcagttaggtgccctaaaagagcgaagtggccgaaaggaaaggctaacgcttctctaacgctacggcgaccttggcgaaatgccatcaataccacg cggcccgaaagggttcgcgcgaaactgagtagaaccgctgtcgcatcttgcgtaagcgcgtggattgaaac acacagaggacccctagtaa ttttatttttt–3′ (SEQ ID NO. 38).

Correspondingly, the nucleotide sequence of the guide RNA is shown in SEQ ID NO.1 to SEQ ID NO.19.

The underlined part is the targeting sequence, which is preferably the 20 bp fragment after the PAM sequence.

1. Construction of pCMV-SpCas12f1-gRNA_MS2-MS19-G1 series plasmids

The plasmid construction steps are the same as the first point in Example 1, except that the guide gRNA_MS1 expression cassette corresponding to SpCas12f1 in human cells is replaced with the guide gRNA_MS2-gRNA_MS19 expression cassette, which is pCMV-SpCas12f1-gRNA_MS2, pCMV-SpCas12f1-gRNA_MS3, pCMV- SpCas12f1-gRNA_MS4, pCMV-SpCas12f1-gRNA_MS5, pCMV-SpCas12f1-gRNA_MS6, pCMV-SpCas12f1-gRNA_MS7, pCMV-SpCas12f1-gRNA_MS8, pCMV-SpCas12f1-gRNA_MS9, pCMV-SpCas12f1-gRNA_MS10, pCMV-SpCas 12f1-gRNA_MS11, pCMV-SpCas12f1- gRNA_MS12, pCMV-SpCas12f1-gRNA_MS13, pCMV-SpCas12f1-gRNA_MS14, pCMV-SpCas12f1-gRNA_MS15, pCMV-SpCas12f1-gRNA_MS16, pCMV-SpCas12f1-gRNA_MS17, pCMV-SpCas12f1-gRNA_MS18, pCMV-SpCas1 2f1-gRNA_MS19.

Insert the same targeting sequence Guide 1 into the above plasmid according to point 2 of Example 1 to obtain a plasmid containing the targeting sequence.

2. Human cell gene editing mediated by pCMV-SpCas12f1-gRNA_MS1-MS19-G1 series plasmids

The operation steps are the same as point 3 in Example 1, except that the pCMV-SpCas12f1-gRNA_MS1-G series plasmids are replaced with pCMV-SpCas12f1-gRNA_MS1-MS19-G1 series plasmids.

3. Result

The gene editing results of engineered SpCas12f1 gRNA_MS1 to gRNA_MS19 in mammalian cells are shown in Figure 4. As shown in the figure, the engineered gRNA_MS2, gRNA_MS4, gRNA_MS7, gRNA_MS10, gRNA_MS12, and gRNA_MS13 of SpCas12f1 can improve the gene editing efficiency of SpCas12f1 in mammalian cells, among which gRNA_MS13 is the most efficient; gRNA_MS19 has little effect on cell editing; Removing any one of the four stem-loops on the gRNA will have a great impact on the activity, so all four stem-loops cannot be removed.

Example 3 Gene editing of engineered SpCas12f1 nuclease gRNA in mammalian cells

Further limitations on the SpCas12f1 nuclease in this example are as described in Example 1.

The preferred SpCas12f1 engineered guide RNA gene sequence described in this example is gRNA_MS13: 5'-guuucgcgcgccagggcaguuaggugcccuaaaagagcgaaguggccgaaaggaaaggcuaacgcuucucuaacgcuacggcgaccuuggcgaaaugccaucaauaccacgcggcccgaaaggguucgcgcgaaacAAGGuaagcg cguggauugaaac acacagaggaccccuaguaa –3'

1. Construction of pCMV-SpCas12f1-gRNA_MS13-G series plasmids

The plasmid construction steps are the same as the first point in Example 1, except that the guide gRNA_MS1 expression cassette corresponding to SpCas12f1 in human cells is replaced with the guide gRNA_MS13 expression cassette. According to point 2 of Example 1, different targeting sequences were inserted into the above plasmids to obtain pCMV-SpCas12f1-gRNA_MS13-G series plasmids containing targeting sequences.

2. Human cell gene editing mediated by pCMV-SpCas12f1-gRNA_MS13-G series plasmids

The operation steps are the same as point 3 in Example 1, except that the pCMV-SpCas12f1-gRNA_MS1-G series plasmids are replaced with pCMV-SpCas12f1-gRNA_MS13-G series plasmids.

3. Result

Comparison of the editing efficiency of gRNA_MS1 and gRNA_MS13 in HEK293T cells is shown in Figure 5. It can be seen from the figure that the engineered gRNA_MS13 can be used to achieve efficient editing in mammalian cells. The editing efficiency of the same site can be increased by up to about 9 times compared with gRNA_MS1. For example, the editing efficiency of the Guide3 site can be increased from 2.58% to 21.95%. , greatly improving the activity and versatility of SpCas12f1 in mammalian cell gene editing.

Finally, it should be noted that although the specific embodiments of the present invention have been described in detail above, those skilled in the art should understand that these are only examples, and the present invention can be modified without departing from the principle and essence of the present invention. The implementation is modified or equivalently replaced. Accordingly, the scope of the present invention is defined by the appended claims.

Claims

A guide RNA, characterized in that it includes a tracr RNA sequence and a crRNA sequence; the crRNA sequence includes a gene targeting segment capable of hybridizing with a target sequence and a tracr partner sequence; the tracr RNA sequence and a tracr partner sequence The backbone sequence that makes up the guide RNA;

Wherein, the tracrRNA includes the nucleotide sequence shown in SEQ ID NO. 111 or a variant sequence having at least 50% identity with it;

The tracr partner sequence includes the nucleotide sequence shown in SEQ ID NO. 112 or a variant sequence having at least 50% identity with it.
The guide RNA of claim 1, comprising at least any one of the following:

1) The gene targeting segment is located at the 3’ end of the crRNA sequence;

2) The guide RNA includes tracrRNA obtained by exchanging one or more positions of complementary paired base pairs in the tracrRNA;

3) The guide RNA includes the tracrRNA and the tracr partner sequence obtained after one or more exchange positions of the base pairs of the tracrRNA and the tracr partner sequence.

4) The gene targeting segment recognizes the PAM sequence on the targeting sequence; preferably the PAM sequence is at least either 5'-NTTC and 5'-GTTT, where N is A, T, C, G; further preferably The PAM sequence is at least one of 5'-GTTC, 5'-TTTC and 5'-ATTC;

5) The gene targeting segment is a nucleic acid fragment with a length of 12 to 40 bp after targeting the PAM sequence; the preferred length is 20 bp;

6) The guide RNA has two strands, one strand contains the tracrRNA sequence, and the other strand contains the crRNA sequence;

7) The guide RNA is a chain, containing the tracr RNA sequence and crRNA sequence in sequence from the 5' end to the 3' end.
The guide RNA of claim 2, wherein when the guide RNA is a strand, the 3' end of the tracr RNA sequence is directly connected to the 5' end of the crRNA sequence or connected through a connecting strand; preferably , connected through a connecting chain, and the connecting chain is selected from oligonucleotides; preferably, the number of oligonucleotides in the connecting chain is 3 to 18 nt; further preferably, the connecting chain is AAGG.
The guide RNA of claim 1, comprising at least any one of the following:

1) The variant sequence of tracrRNA refers to a sequence obtained by adding, reducing or replacing some nucleotides at the 5' end and/or 3' end of the nucleotide sequence shown in SEQ ID NO. 111; Preferably, the variant sequence of tracrRNA refers to a sequence obtained by reducing nucleotides at the 5' end and/or 3' end of the nucleotide sequence shown in SEQ ID NO. 111;

2) The variant sequence of the tracr partner sequence is obtained by adding, reducing or replacing some nucleotides at the 5' end and/or 3' end of the nucleotide sequence shown in SEQ ID NO. 112 Sequence; Preferably, the variant sequence of the tracr partner sequence refers to one obtained by reducing nucleotides at the 5' end and/or 3' end of the nucleotide sequence shown in SEQ ID NO. 112 sequence.
The guide RNA of claim 4, comprising at least any one of the following:

1) The variant sequence of tracrRNA refers to a sequence obtained by reducing 1 to 30 nt nucleotides from the 5' end and/or 3' end of the nucleotide sequence shown in SEQ ID NO. 111; preferably , reduce 4 to 16 nt nucleotides at the 5' end, and/or reduce 3 to 28 nt nucleotides at the 3' end;

2) The variant sequence of the tracr partner sequence refers to a sequence obtained by reducing 3 to 28 nt nucleotides at the 5' end of the nucleotide sequence shown in SEQ ID NO. 112; preferably, reducing 8 nt ~21nt nucleotide.
The guide RNA of claim 5, comprising at least any one of the following:

1) The variant sequence of tracrRNA refers to the sequence obtained by reducing 7nt nucleotides at the 5' end of the nucleotide sequence shown in SEQ ID NO. 111; preferably, the variant sequence of tracrRNA is as follows Shown in SEQ ID NO.114;

2) The variant sequence of tracrRNA refers to a sequence obtained by reducing 6 nt nucleotides from the 3' end of the nucleotide sequence shown in SEQ ID NO. 111; preferably, the variant sequence of tracrRNA is as follows Shown in SEQ ID NO.120;

3) The variant sequence of the tracr partner sequence refers to a sequence obtained by reducing 8nt nucleotides at the 5' end of the nucleotide sequence shown in SEQ ID NO. 112; preferably, the tracr partner sequence The variant sequence of the sequence is shown in SEQ ID NO.130;

4) The variant sequence of tracrRNA refers to a sequence obtained by reducing 7nt nucleotides at the 5' end of the nucleotide sequence shown in SEQ ID NO. 111 and reducing 6nt nucleotides at the 3' end; preferably Land, the variant sequence of tracrRNA is shown in SEQ ID NO. 138;

5) The variant sequence of tracrRNA refers to a sequence obtained by reducing 7nt nucleotides at the 5' end of the nucleotide sequence shown in SEQ ID NO. 111 and reducing 6nt nucleotides at the 3' end; preferably Land, the variant sequence of tracrRNA is shown in SEQ ID NO. 144;

6) The variant sequence of the tracr partner sequence refers to a sequence obtained by reducing 21nt nucleotides at the 3' end of the nucleotide sequence shown in SEQ ID NO. 112; preferably, the tracr partner sequence The variant sequence of the sequence is shown in SEQ ID NO. 148.
The guide RNA of claim 6, comprising at least any one of the following:

1) The nucleotide sequence of the backbone sequence of the guide RNA is shown in SEQ ID NO. 116;

2) The nucleotide sequence of the backbone sequence of the guide RNA is shown in SEQ ID NO. 122;

3) The nucleotide sequence of the backbone sequence of the guide RNA is shown in SEQ ID NO. 131;

4) The nucleotide sequence of the backbone sequence of the guide RNA is shown in SEQ ID NO. 140;

5) The variant sequence of the tracrRNA is shown in SEQ ID NO.144, and the variant sequence of the tracr partner sequence is shown in SEQ ID NO.145; preferably, the tracrRNA and the tracr partner sequence are connected by Chain connection; Further preferably, the nucleotide sequence of the backbone sequence of the guide RNA is shown in SEQ ID NO. 146;

6) The variant sequence of the tracrRNA is shown in SEQ ID NO.147, and the variant sequence of the tracr partner sequence is shown in SEQ ID NO.148; preferably, the tracrRNA and the tracr partner sequence are connected by Chain connection; further preferably, the nucleotide sequence of the backbone sequence of the guide RNA is shown in SEQ ID NO. 149;

7) The guide RNA is as shown in at least any one of SEQ ID NO. 1 to 19; preferably, it is as shown in at least any one of SEQ ID NO. 2, 4, 7, 10, 12, and 13.
An isolated polynucleotide, characterized in that it encodes the guide RNA according to any one of claims 1 to 7.
A construct, characterized in that the construct contains the isolated polynucleotide of claim 8.
An expression system, characterized in that the expression system contains the construct according to claim 9 or an exogenous polynucleotide according to claim 8 integrated into the genome.
The expression system of claim 10, wherein the host cell of the expression system is selected from eukaryotic cells or prokaryotic cells; preferably, the host cell is selected from mouse cells and human cells.
A gene editing system, characterized in that it includes the guide RNA or its encoding polynucleotide as described in any one of claims 1 to 7.
The base editing system of claim 12, wherein the base editing system further includes a nuclease or a polynucleotide encoding it.
The base editing system of claim 13, comprising at least any one of the following:

1) The base editing system comprises one or more vectors; the one or more vectors comprise (i) a first regulatory element operably connected to the encoding polynucleoside of the nuclease an acid; and (ii) a second regulatory element operably linked to a polynucleotide encoding the guide RNA nucleotide sequence;

Said (i) and (ii) are located on the same or different carriers;

2) The base editing system includes (i) a nuclease, and (ii) a vector containing a polynucleotide encoding the guide RNA.
The gene editing system of claim 13, wherein the nuclease is a CRISPR nuclease; preferably, the nuclease is selected from Cas9, Cas12, Cas13 protein family and mutants thereof; further preferably, the Cas nuclease Selected from nSpCas9 and its mutants, SaCas9 and its mutants, Cas12a and its mutants, or Cas12f and its mutants; more preferably, it is SpCas12f1 nuclease and its mutants.
The gene editing system of claim 15, wherein the SpCas12f1 nuclease and its mutants include:

(1) Wild-type SpCas12f1 nuclease or a fragment thereof, which has RNA-guided nucleic acid binding activity; the SpCas12f1 nuclease is derived from Syntrophomonaspalmitatica Cas12f1, and the amino acid sequence is as shown in SEQ ID NO.40; Preferably, the SpCas12f1 nuclease The humanized codon-optimized nucleic acid sequence is shown in SEQ ID NO.42;

(II) A variant having at least 50% sequence homology with the amino acid sequence of (I) and having RNA-guided nucleic acid binding activity;

(III) according to (I) or (II), which further includes a nuclear localization signal fragment;

(IV) Subject to (I) or (II) or (III), which further includes:

(a) One or more modifications or mutations that produce an endonuclease activity that is significantly reduced compared to before the modification or mutation, or that results in a loss of endonuclease activity; and/or

(b) Polypeptides or domains with other functional activities;

(V) According to (I) or (II) or (III), the SpCas12f1 nuclease has endonuclease activity.
The gene editing system according to any one of claims 12-16, characterized in that it includes at least any one of the following:

1) The gene editing system recognizes the PAM sequence on the target sequence; preferably the PAM sequence is at least one of 5'-NTTC and 5'-GTTT, where N is A, T, C, G; further preferably the PAM sequence Be at least any one of 5'-GTTC, 5'-TTTC and 5'-ATTC;

2) The gene editing system targets nucleic acid fragments with a length of 12 to 40 bp after the PAM sequence, and the preferred length is 20 bp;

3) The gene editing system targets at least one target sequence in the cell genome.
A pharmaceutical composition, characterized in that it contains the gene editing system according to any one of claims 12 to 17, and a pharmaceutically acceptable carrier.
A gene editing method, characterized by contacting a target gene with the gene editing system described in any one of claims 12-17 to achieve editing of the target gene.
The gene editing method of claim 19, comprising the following steps:

i) introducing the SpCas12f1 nuclease or its encoding polynucleotide and the guide RNA or its encoding polynucleotide into a cell;

ii) Produce one or more nicks in a target gene mediated by the SpCas12f1 nuclease, or target, edit, modify or manipulate the target gene.
The gene editing method according to claim 19 or 20, characterized in that it includes at least any one of the following:

1) The SpCas12f1 nuclease is guided to the target gene through processed or unprocessed guide RNA;

2) The SpCas12f1 nuclease and guide RNA form a complex to recognize the PAM sequence on the target gene;

3) The target sequence of the gene editing system is a nucleic acid fragment with a length of 12 to 40 bp after the PAM sequence, preferably a nucleic acid fragment with a length of 20 bp after the PAM sequence;

4) The method further includes the step of introducing a donor template comprising a heterologous polynucleotide sequence into the cell.
The guide RNA according to any one of claims 1 to 7, the isolated polynucleotide according to claim 8, the construct according to claim 9, or the expression system according to claims 10 or 11 Or the gene editing system according to any one of claims 12-17 or the pharmaceutical composition according to claim 18 or the method according to any one of claims 19-21 in vivo, ex vivo cells or cell-free environment Application in gene editing of target genes and/or related polypeptides.
The application according to claim 22, characterized in that it includes at least any one of the following:

1) The gene editing is selected from the group consisting of: gene cutting, gene deletion, gene insertion, point mutation, transcription inhibition, transcription activation, base editing and guided editing; preferably, the gene editing is gene deletion and/or or gene cutting;

2) The in vitro cells are selected from at least one of bacterial cells, archaeal cells, fungal cells, protist cells, viral cells, plant cells and animal cells;

3) The gene editing is used to achieve at least any of the correction of disease-causing sites, research on gene functions, enhancement of cell functions, and cell therapy.
A genetically modified cell, which is gene edited by the gene editing system as described in any one of claims 12-17 or the pharmaceutical composition as claimed in claim 18 or the method as described in any one of claims 19-21 get.
A guide RNA preparation method according to any one of claims 1 to 7, characterized in that the method includes the steps of individually transforming and combining the tracrRNA and crRNA of the basic guide RNA, and the transformation is selected from the group consisting of TracrRNA or crRNA is truncated or extended, or tracrRNA and crRNA are connected through a connecting strand.