KR101896847B1 - Composition for Inhibiting Gene Expression comprising Nuclease-Deactivated Cpf1 and Uses Thereof - Google Patents

Abstract

The present invention relates to a composition for inhibiting gene expression, and specifically, to a composition for inhibiting gene expression comprising dCpf1. Since the composition for inhibiting gene expression according to the present invention can effectively suppress the expression of single or multiple genes, the composition can be used as a genetic tool in biotechnology, medical field and the like.

Description

[0001] The present invention relates to a composition for suppressing gene expression, which comprises Cpf1 in which DNA cleavage activity is inactivated, and a use thereof. [0002] Composition for Inhibiting Gene Expression [

TECHNICAL FIELD The present invention relates to a composition for inhibiting gene expression, and more particularly, to a composition for suppressing gene expression comprising Cpf1 in which DNA-cleaving activity is removed.

Clustered regularly interspaced short palindromic repeats (CRISPR) and CRISPR-associated (Cas) proteins are involved in the adaptive immune system in Eubacteria and Archaea. The CRISPR-Cas system has been developed and used as a target gene editing tool in human and other organisms.

CRISPR interference (CRISPR interference) technology using Cas9 protein with the DNA cleavage activity removed has been developed to use the CRISPR-Cas system for gene expression regulation instead of target gene editing, And is used as an efficient tool for sequence-specific regulation.

Cas9 (SpdCas9), the DNA cleavage activity of Streptococcus pyogenes derived from the Type II CRISPR system, is the most widely studied and widely used protein in CRISPRi. The CRISPRi system works with SpdCas9 protein, CRISPR RNA (crRNA) and trans-activating RNA (tracrRNA). The SpCas9-crRNA-tracrRNA complex binds to the nontemplate strand of the target DNA and inhibits transcription by RNA polymerase. In addition, a multimeric CRISPRi system derived from the Type I CRISPR system, which requires deletion of the Cas3 protein involved in cleavage and degradation of the target DNA, has also been reported. The CRISPRi system derived from the Type I and II CRISPR systems can efficiently, reversibly, and multiplexly inhibit gene transcription, but it requires application of tracrRNA in addition to specific protospacer adjacent motif (PAM) sequences and crRNA There is a limit.

Recently, the Type VA CRISPR system has been identified as a target genome editing tool for human cells. It consists of a single Cpf1 (CRISPR from Prevotella and Francisella 1) protein and its cognate crRNA, which also works without additional tracrRNA. In contrast to Cas9, which recognizes a guanidine-rich PAM sequence downstream of the target DNA, Cpf1 recognizes a thymidine-rich PAM sequence upstream of the target DNA do. In addition, Cpf1 cleaves the target DNA to generate a staggered end, while Cas9 makes a blunt end, so it can be used in areas where Cas protein-based systems are difficult to apply.

Type VA CRISPR-Cpf1 is an attractive alternative to Cas9 based genome editing tools, which are currently the DNA cleavage activity to remove Cpf1 Francisella novicida The PAM sequence and DNA binding activity of U112 (FndCpf1) has been reported. However, recently, the diversity of Cpf1 family proteins was studied by searching the open sequence database, but only the PAM sequence of a few Cpf1 family proteins was identified and could not be developed as CRISPRi. Korean Patent Laid-Open No. 10-2015-0107739 relates to the expression modification of a gene product using the CRISPR system, but since it uses the Cas9 protein, it has disadvantages of the Cas-based system described above.

Therefore, the present inventor has made extensive efforts to develop a novel gene regulating method and found that Eubacterium The present invention has been completed by developing a method for efficiently controlling gene expression using Cpf1 (EedCpf1) and designed crRNA from which DNA-cleaving activity derived from eligens has been eliminated.

Korean Patent Publication No. 10-2015-0107739

One object of the present invention is to provide a nuclease-deactivated Cpf1 protein (dCpf1); And a second fragment comprising a first fragment comprising palindrome sequences and a spacer comprising a spacer that is a polynucleotide that hybridizes with the target DNA.

Another object of the present invention is to provide a DNA sequence encoding a nucleotide sequence encoding a nuclease-deactivated Cpf1 protein (dCpf1); A nucleotide sequence encoding a crRNA comprising a first fragment comprising palindrome sequences and a second fragment comprising a spacer that is a polynucleotide that hybridizes to the target DNA; And a recombinant expression vector comprising a promoter operably linked to the nucleotide sequence.

One aspect of the present invention is a DNA-cleaving (nuclease-deactivated) Cpf1 protein (dCpf1); And a second fragment comprising a first fragment comprising palindrome sequences and a spacer that is a polynucleotide that hybridizes with the target DNA.

In this specification, a technique using the Type VA CRISPR system protein Cpf1 (CRISPR from Prevotella and Francisella 1) is provided as one of the methods for overcoming the disadvantages of gene expression inhibition using the Type II CRISPR-Cas9 system.

As used herein, the term " palindrome sequence " means a structure in which the left and right directions are read in the same direction by repeating the base sequence in the reverse direction, and a hairpin structure can be achieved.

As used herein, the term " polynucleotide " refers to a polymer of nucleotides in which a nucleotide monomer is linked in a long chain by covalent bonds. Thus, the term encompasses single-, double- or multi-stranded DNA or RNA, genomic DNA, cDNA, DNA-RNA hybrids, or purine and pyrimidine bases or other naturally occurring, chemically or biochemically modified non- But are not limited to, a polymer comprising a nucleotide derived from the nucleotide sequence of SEQ ID NO.

As used herein, the term " spacer " refers to a nucleotide sequence present at the terminal end of palindrom sequence 3, which hybridizes to the target DNA.

As used herein, the term " hybridization " refers to a reaction in which one or more polynucleotides react to form a complex, which complex is stabilized through hydrogen bonding between bases of the nucleotide residue.

As used herein, the term " expression " refers to the process by which a polynucleotide is transcribed from a DNA template (e. G., Into mRNA or other RNA transcripts) and / or after the transcribed mRNA is translated into a peptide, Process. If the polynucleotide is derived from genomic DNA, expression may involve splicing of mRNA in eukaryotic cells.

As used herein, the term "truncation" refers to the breakage of the covalent backbone of a nucleotide molecule.

The composition for inhibiting gene expression of the present invention may be introduced into cells or organisms in the form of a recombinant vector comprising a recombinant vector comprising a DNA encoding Cpf1 and a DNA encoding a crRNA, or a mixture comprising a Cpf1 protein and a crRNA, Can be introduced into cells or organisms in the form of ribonucleic acid proteins which form the complex.

The crRNA may be hybridized with the target DNA.

As used herein, the term " guide RNA " is RNA specific to target DNA. The guide RNA may form a complex with Cas protein or Cpf1 protein, and Cas protein or Cpf1 protein may be brought into target DNA.

In the present invention, the guide RNA used in conjunction with the Cas protein may consist of two RNAs, i.e., CRISPR RNA (crRNA) and transactivating crRNA (tracrRNA), or fusion of essential parts of crRNA and tracrRNA , And the guide RNA may be a dual RNA including a crRNA and a tracrRNA. On the other hand, the guide RNA used with the Cpf1 protein does not require tracrRNA, unlike the guide RNA used with the Cas protein. In other words, since Cpf1 protein acts as a single crRNA, it is not necessary to construct a single guide RNA (sgRNA) that combines both crRNA and trans-activating crRNA (tracrRNA) or artificially combines tracrRNA and crRNA as in Cas9.

The specific sequence of the guide RNA can be appropriately selected according to the type of Cas9 protein or Cpf1 protein (derived microorganism).

Endonuclease such as Cas9 protein and Cpf1 protein may be isolated from microorganisms or non-naturally occurring by recombinant or synthetic methods. The endonuclease may be an N-terminal nucleoside, such as a nuclear localization signal (NLS) (e.g., PKKKRKV, KRPAATKKAGQAKKKK, or a nucleic acid molecule encoding the same) End, or at the C-terminus (or at the 5 ' end or the 3 ' end of the nucleic acid molecule encoding it). The endonuclease protein can be used in the form of a purified protein, or can be used in the form of a DNA encoding it, or a recombinant vector containing the DNA.

The composition for suppressing gene expression of the present invention can be applied to eukaryotic organisms. Such eukaryotic organisms include eukaryotic cells such as fungi such as yeast, eukaryotic and / or eukaryotic plant derived cells such as embryonic cells, stem cells, somatic cells, germ cells, etc., eukaryotic animals such as vertebrates or invertebrates Animal, more specifically mammals including primates such as humans and monkeys, dogs, pigs, cows, sheep, goats, mice and rats) and eucaryotic plants (for example birds such as green algae, corn, soybean, wheat , A terminal leaf such as rice or a twin leaf plant, etc.).

According to one embodiment of the present invention, the crRNA may further include a third fragment located downstream of the spacer and including a polynucleotide capable of binding to an RNA-binding protein.

As used herein, the term " chimeric crRNA " means a crRNA comprising a nucleotide sequence derived from a different coding region, and includes a nucleotide capable of binding an RNA-binding protein at the 3 ' Lt; RTI ID = 0.0 > artificially fused < / RTI >

According to one embodiment of the present invention, the Cpf1 protein is selected from the group consisting of Eubacterium It can be derived from eligens .

According to one embodiment of the present invention, a protospacer adjacent motif (PAM) composed of TTTV or TTV (V is A, G or C) may be further upstream of the target DNA.

Since the Cpf1 system is different from Cas9 in that PAM is present at the 5 'position of the target sequence and the length of the guide RNA that determines the target is shorter than that of Cas9, the production of the guide RNA, crRNA, .

As used herein, the term " upstream " means a sequence located in the 5 'direction on the basis of a specific position of a nucleotide sequence, and " downstream " 3 ' direction.

According to one embodiment of the present invention, the dCpf1 protein may be substituted with alanine in the aspartic acid at the 880th amino acid constituting the Cpf1 protein. The 880 amino acid is located in the RuvC-like endo-nuclease domain among the domains constituting the Cpf1 protein. By the substitution of the above amino acid, the DNA cleavage activity of Cpf1 can be completely lost.

According to one embodiment of the present invention, the crRNA is a sequence in which two or more first and second fragments are sequentially repeated, and includes different palindromic sequences and spacers, and can simultaneously suppress multiple gene expression.

A second fragment comprising a first fragment comprising palindrome sequences and a spacer being a polynucleotide that hybridizes to the target DNA is repeatedly ligated and each palindrome sequence and / By modifying it to suit the gene, it is possible to produce a crRNA that suppresses multiple genes.

Another aspect of the present invention is a DNA sequence encoding a nucleotide sequence encoding a nuclease-deactivated Cpf1 protein (dCpf1); A nucleotide sequence encoding a crRNA comprising a first fragment comprising palindrome sequences and a second fragment comprising a spacer that is a polynucleotide that hybridizes to the target DNA; And a recombinant expression vector comprising a promoter operably linked to the nucleotide sequence.

In the recombinant expression vector of the present invention, the parts overlapping with those described above in the composition for inhibiting gene expression may be used with the same meaning as described above.

As used herein, the term " promoter " is a DNA regulatory region that is associated with a polymerase and is capable of initiating transcription of a downstream (3 'direction) coding or non-coding sequence.

As used herein, the term " operably linked " refers to a functional association (cis) between a gene expression control sequence and another nucleotide sequence. The gene expression control sequence may be at least one selected from the group consisting of a replication origin, a promoter, and a transcription termination terminator.

The vector may comprise a crRNA expression cassette comprising a transcriptional control sequence such as DNA encoding crRNA and / or a promoter operably linked thereto.

As used herein, the term " expression cassette " means a DNA coding sequence operably linked to a promoter.

The delivery of the recombinant expression vector of the present invention to a cell (e. G., Eukaryotic cell) or an organism (e. G., A eukaryotic organism) can be accomplished using a topical injection (e. G., Direct injection of a lesion or target site), microinjection, electroporation ), Lipofection (e.g., using lipofectamine), and the like. When the target cell is a plant cell, the plant cell may be mixed with a surfactant such as polyethylene glycol (PEG) and then delivered.

The promoter of the present invention is one of the transcription regulatory sequences that regulate the transcription initiation of a specific gene, and may be a polynucleotide fragment, usually about 100 bp to about 2500 bp in length.

The promoter can be used without limitation as long as the promoter can regulate transcription initiation in a cell such as a eukaryotic cell (e.g., a plant cell, or an animal cell (for example, a mammalian cell such as a human, a mouse, etc.)). For example, the promoter may be a CMV promoter (e.g., a human or mouse CMV immediate-early promoter), a U6 promoter, an EF1-alpha (elongation factor 1-a) promoter, an EF1-alpha short (EFS) promoter, an SV40 promoter Promoter, tac promoter, tac promoter, T7 promoter, vaccinia virus 7.5K promoter, HSV tk promoter, SV40E1 promoter, respiratory syncytial virus (HPV) promoter, trp promoter, lac promoter, (Human interleukin-2) gene promoter, human lymphotoxin gene promoter, human GM-CSF (human IL-2) gene promoter, (human granulocyte-macrophage colony stimulating factor) gene promoter, and the like, but is limited thereto The promoter may be selected from the group consisting of CMV immediate-early promoter, U6 promoter, EF1-alpha (elongation factor 1-a) promoter, EF1-alpha short (EFS) promoter, and the like. The transcription termination sequence may be a polyadenylation sequence (pA), etc. The replication origin may be f1 replication origin, SV40 replication origin, pMB1 replication origin, adeno replication origin, AAV replication origin, BBV replication origin, and the like.

The vector of the present invention may be selected from the group consisting of a plasmid vector, a cosmid vector, and a viral vector such as a bacteriophage vector, an adenovirus vector, a retrovirus vector, and an adeno-associated viral vector. The vector that can be used as the recombinant vector may be a plasmid (for example, pcDNA series, pSC101, pGV1106, pACYC177, ColE1, pKT230, pME290, pBR322, pUC8 / 9, pUC6, pBD9, pHC79, pIJ61, pLAFR1 (eg, λgt4λB, λ-Charon, λΔz1, M13, etc.) or viral vectors (eg, adeno-associated virus (AAV) vectors, etc.) But it is not limited thereto.

According to one embodiment of the present invention, the promoter may be an L-rhamnose-inducible promoter. By the above-mentioned L-laminose-inducible promoter, it is possible to control the degree of gene expression inhibition by controlling the L-rhamnose concentration.

The composition for inhibiting gene expression according to the present invention can effectively suppress the expression of single or multiple genes, and thus can be usefully utilized as a genetic tool in biotechnology and medical fields.

1 is a diagram schematically illustrating the operation of SpdCas9 and EedCpf1.
Figure 2 is a schematic representation of a CRISPRi plasmid containing EedCpf1.
Figure 3 is a schematic representation of crRNAR (T1) and crRNA (T1).
Figure 4 depicts the Eubacterium Figure 9 shows the alignment of nine crRNAs of the eligens ATCC 27750 genome.
FIG. 5 shows that the DNA cleaving activity of EedCpf1 in which 880 amino acids constituting the Cpf1 protein located in the RuvC-like endonuclease domain was replaced with alanine in aspartic acid was inactivated.
Figure 6 is a schematic representation of a CRISPRi plasmid containing SpdCas9.
Figure 7 is a schematic representation of a reporter plasmid having a binding site for targeting non-template strands.
8 is a graph showing the gene expression inhibition efficiency of EedCpf1-CRISPRi and SpdCas9-CRISPRi.
Figure 9 is a schematic representation of a reporter plasmid having binding sites for targeting template strands.
10 is a graph showing the gene expression inhibition efficiency of CRISPRi targeting a template (blue stick) or non-mold (red stick) strand.
11 is a graph showing the gene expression inhibition efficiency according to the length of the spacer for CRISPR-EedCpf1.
Figure 12 schematically illustrates the insertion of a spacer sequence into the pSECRVi plasmid in which the Sap I site is truncated.
FIG. 13 is a figure showing a crRNA (T1) binding site inserted after methionine 1 (M1), alanine 206 (A206) or asparagine 372 (N372) in the sequence encoding the MBP-GFP fusion protein on the template strand.
FIG. 14 is a view showing a crRNA (T1) binding site inserted after methionine 1 (M1), alanine 206 (A206) or asparagine 372 (N372) in a sequence encoding MBP-GFP fusion protein on a non-template strand.
15 is a graph showing the gene expression inhibition efficiency of CRISPRi of EedCpf1.
16 is a graph showing the gene expression inhibition efficiency of CRISPRi of SpdCas9.
17 is a graph showing the gene expression inhibition efficiency of EedCpf1 according to the number of thymidine constituting the PAM sequence of pREGFP (T1).
18 is a graph showing the gene expression inhibition efficiency of EedCpf1 against the 5'-CNTTC-3 'PAM sequence of pREGFP (T1).
19 is a graph showing the gene expression suppression efficiency of EedCpf1 against the 5'-NTTTC-3 'PAM sequence of pREGFP (T1).
20 is a graph showing the gene expression inhibition efficiency of EedCpf1 against the 5'-CTTTN-3 'PAM sequence of pREGFP (T1).
Figure 21 is a diagram showing the promoter (P1 and P2), 5'-UTR (T1) and CDS (C1, C2, C3, C4, C5, C6, C7 and C8) regions on the pREGFP3 (P2T1) plasmid.
22 is a graph showing gene expression inhibition efficiency using a reporter plasmid.
23 is a graph showing fluorescence measurement of EedCpf1 gene expression control in E. coli cells using various concentrations of L-rhamnose as an inducing agent.
24 is a graph showing the growth of E. coli cells using L-rhamnose as an inducing agent.
FIG. 25 is a graph showing inhibition of gene expression by EedCpf1 (right side) and single-cell flow cytometry fluorescence assays (left side) targeting eight binding sites. FIG.
26 is a diagram showing a crRNA (C4C5) targeting the C4 and / or C5 region in the reporter gene ( gfp ).
Figure 27 shows the inhibition of gene expression (right) and single-cell flow cytometry fluorescence assays by crRNA (C4C5) targeting C4 and / or C5 regions in the chromosomal reporter gene ( gfp ) (Left side).
Figure 28 shows the effect of the endogenous lacZ Lt; RTI ID = 0.0 > gfp < / RTI > gene.

Hereinafter, one or more embodiments will be described in more detail by way of examples. However, these embodiments are intended to illustrate one or more embodiments, and the scope of the present invention is not limited to these embodiments.

Example  1. Preparation of a gene expression inhibiting composition and gene expression analysis method

<1-1> Strain, medium and reagent

E. coli DH5α was used for cloning and plasmid maintenance.

LB medium (10 g / L of tryptone, 5 g / L of yeast extract and 5 g / L of sodium chloride) was used for the culture of the strain. SOC medium (20 g / L of tryptone, 5 g / L of yeast extract, 0.5 g / L of sodium chloride, 2.4 g / L of magnesium sulfate, 186 mg / L of potassium chloride and 4 g / L of glucose) as recovery medium after transformation Respectively.

L-Rhamnose and antibiotics were purchased from Sigma-Aldrich (St. Louis, MO). Ampicillin, kanamycin and chloramphenicol were used at final concentrations of 100 μg / ml, 25 μg / ml and 10 μg / ml, respectively. High-fidelity KOD-Plus-Neo polymerase (Toyobo, Osaka, Japan) was used according to standard protocols for polymerase chain reaction (PCR). All restriction enzymes and modification enzymes were purchased from New England BioLabs (NEB, Ipswich, Mass.).

<1-2> primer , Plasmids and crRNA

The primers (Table 1 and Table 2), plasmids (Table 3 and Table 4) and crRNA (Table 5) used in the present invention are shown in the following table, respectively. The portion indicated in bold in Table 5 corresponds to the PAM sequence.

CRISPRi plasmid primer The primer sequence (5 'to 3') Remarks SEQ ID NO: CRI (T1) -F actagtattatacctaggac pSECRi (T1) plasmid construction One CRI (T1) -R caccagaatcggcacaacgcgttttagagctagaaatagc 2 dCpf1-VF ttccattcatatggtgatcctgctgaattt pSECRi-EedCpf1 plasmid construction 3 dCpf1-VR gtatgaataactcgagtaaggatctccagg 4 dCpf1-IF cttactcgagttattcataccttttattct 5 dCpf1-IR ggatcaccatatgaatggaaatcgtagcat 6 crRNA-F caaagtagaaattactagtattatacctaggac pG-crRNA plasmid construction 7 crRNA-R tagattgaagagcgacccggggccggccgcctcg 8 crRNA (T1) -F caaagtagaaattactagtattatacctaggac pG-crRNA (T1) plasmid construction 9 The crRNA (T1) -R tagatcaccagaatcggcacaacgctgaagagcgacccggggcggccgcctcg 10 crRNAR (T1) -F aatttctactttgtagattgaagagcgacccggggcgg pG-crRNAR (T1) plasmid construction 11 crRNAR (T1) -R atttaaggttattcaaacgcgttgtgccgattctggtg 12 ST-F tattccgcttcctcggcgaccggttaaagatctttgacag pSECRVi, pSECRVi (T1), pSECRVRi (T1) plasmid construction 13 ST-R ggcccaagcttcctcgaggc 14 crRNA (T1) -16-R ggcggccgccccgggtcgctcttcatgtgccgattctggtgatctacaaagtagaaattactagtatta pSECRVi (T1 _16bp) plasmid construction 15 crRNA (T1) -18-R ggcggccgccccgggtcgctcttcagttgtgccgattctggtgatctacaaagtagaaattactagtatta pSECRVi (T1 _{18 bp} ) plasmid construction 16 crRNA (T1) -22-R ggcggccgccccgggtcgctcttcacggcgttgtgccgattctggtgatctacaaagtagaaattactagtatta pSECRVi (T1 _22bp) plasmid construction 17 crRNA (T1) -24-R ggcggccgccccgggtcgctcttcaaccggcgttgtgccgattctggtgatctacaaagtagaaattactagtatta pSECRVi (T1 _24bp) plasmid construction 18 The crRNA (T1) -25-R ggcggccgccccgggtcgctcttcataccggcgttgtgccgattctggtgatctacaaagtagaaattactagtatta pSECRVi (T1 ₂₅ bp) plasmid construction 19 crRNA (P1) -R ggcggccgccccgggtcgctcttcacctaggactgagctagccgtatctacaaagtagaaattactagtatta pSECRVi (Pl) plasmid construction 20 crRNA (P2) -R ggcggccgccccgggtcgctcttcaagtcctaggtacagtgctagatctacaaagtagaaattactagtatta pSECRVi (P2) plasmid construction 21 crRNA (C1) -R ggcggccgccccgggtcgctcttcatcatatgtatatctccttctatctacaaagtagaaattactagtatta pSECRVi (C1) plasmid construction 22 crRNA (C2) -R ggcggccgccccgggtcgctcttcagaaggagatatacatatgagatctacaaagtagaaattactagtatta pSECRVi (C2) plasmid construction 23 crRNA (C3) -R ggcggccgccccgggtcgctcttcacaggtagttttccagtagtgatctacaaagtagaaattactagtatta pSECRVi (C3) plasmid construction 24 crRNA (C4) -R ggcggccgccccgggtcgctcttcattgtagttcccgtcatctttatctacaaagtagaaattactagtatta pSECRVi (C4) plasmid construction 25 crRNA (C5) -R ggcggccgccccgggtcgctcttcagcttttcgttgggatctttcatctacaaagtagaaattactagtatta pSECRVi (C5) plasmid construction 26 crRNA (C6) -R ggcggccgccccgggtcgctcttcataaatttatttgcactactgatctacaaagtagaaattactagtatta pSECRVi (C6) plasmid construction 27 crRNA (C7) -R ggcggccgccccgggtcgctcttcacaggaacgcactatatctttatctacaaagtagaaattactagtatta pSECRVi (C7) plasmid construction 28 crRNA (C8) -R ggcggccgccccgggtcgctcttcaccctttcgaaagatcccaacatctacaaagtagaaattactagtatta pSECRVi (C8) plasmid construction 29 The crRNA (lacZ) ggcggccgccccgggtcgctcttcattttcccagtcacgacgttgatctacaaagtagaaattactagtatta pSECRVi (lacZ) plasmid construction 30 Multi (C5) -F ggcggccgccccgggtcgctcttcagcttttcgttgggatctttcatctacaaagtagaaattatttaag pSECRVi (C4C5) plasmid construction 31 Multi (C5) -R ttgtagataaagatgacgggaactacaagtttgaataaccttaaataatttctacttttgtagatgaaag 32 Multi (lacZ) -F ggcggccgccccgggtcgctcttcattttcccagtcacgacgttgatctacaaagtagaaattatttaag pSECRVi (C1lacZ) plasmid construction 33 Multi (lacZ) -R ttgtagatagaaggagatatacatatgagtttgaataaccttaaataatttctactttgtagatcaacg 34

Other plasmid primers The primer sequence (5 'to 3') Remarks SEQ ID NO: pR1-F gcgttgtgccgattctggtggaaaataattttgtttaacttta pREGFP3 (T1) plasmid construction 35 pR1-R cggtctagagggaaaccgttgtg 36 pR2-F cggcacaacgccggtatattttgtttaactttaag pREGFP3 (NT1) plasmid construction 37 pR2-R attctggtggaaaatctagagggaaaccgttgtg 38 pR3-F cggcacaacgccggtatattttgtttaactttaag Mutation to contain 5'-CTTTC PAM sequence in a pREGFP3 (T1) plasmid 39 pR3-R attctggtggaaagtctagagggaaaccgttgtg 40 pR4-F cggcacaacgccggtatattttgtttaactttaag Mutation to contain 5'-CCTTC PAM sequence in a pREGFP3 (T1) plasmid 41 pR4-R attctggtggaaggtctagagggaaaccgttgtg 42 pR5-F cggcacaacgccggtatattttgtttaactttaag Mutation to contain 5'-CCCTC PAM sequence in a pREGFP3 (T1) plasmid 43 pR5-R attctggtggagggtctagagggaaaccgttgtg 44 pR6-F cggcacaacgccggtatattttgtttaactttaag Mutation to contain 5'-ATTTC PAM sequence in a pREGFP3 (T1) plasmid 45 pR6-R attctggtggaaattctagagggaaaccgttgtg 46 pR7-F cggcacaacgccggtatattttgtttaactttaag Mutation to contain 5'-GTTTC PAM sequence in a pREGFP3 (T1) plasmid 47 pR7-R attctggtggaaactctagagggaaaccgttgtg 48 pR8-F cggcacaacgccggtatattttgtttaactttaag Mutation to contain 5'-CATTC PAM sequence in a pREGFP3 (T1) plasmid 49 pR8-R attctggtggaatgtctagagggaaaccgttgtg 50 pR9-F cggcacaacgccggtatattttgtttaactttaag Mutation to contain 5'-CGTTC PAM sequence in a pREGFP3 (T1) plasmid 51 pR9-R attctggtggaacgtctagagggaaaccgttgtg 52 pR10-F cggcacaacgccggtatattttgtttaactttaag Mutation to contain 5'-CTTTA PAM sequence in a pREGFP3 (T1) plasmid 53 pR10-R attctggtgtaaagtctagagggaaaccgttgtg 54 pR11-F cggcacaacgccggtatattttgtttaactttaag Mutation to contain 5'-CTTTT PAM sequence in a pREGFP3 (T1) plasmid 55 pR11-R attctggtgaaaagtctagagggaaaccgttgtg 56 pR12-F cggcacaacgccggtatattttgtttaactttaag Mutation to contain 5'-CTTTG PAM sequence in a pREGFP3 (T1) plasmid 57 pR12-R attctggtgcaaagtctagagggaaaccgttgtg 58 Pt-F aaccacaacggtttccctctagattttcca Mutation to contain crRNA (P2) binding site in a pREGFP3 (T1) plasmid 59 Pt-R tgctagcactgtacctaggactgagct 60 Cm-F aataataaggtaccatggtaggtccatatgaatatcctcc pREGFP3C (P2T1) plasmid construction 61 Cm-R tagtctagagagaggcctaggaatacggttagccatttg 62 Int-F actatttcctgtaagaattgactcatctggagcctatgattcaccgtcatcaccgaaac GFP expression cassette integration into bgla locus 63 Int-R gcaacaagtattgcatccggtacttcatcgacttaaagctggaatacggttagccatttg 64 pM1-F attctggtggaaaataaaactgaagaaggtaaact pMEGFP (NT1) plasmid construction 65 pM1-R cggcacaacgccggtcataatctatggtccttgtt 66 pM2-F cggcacaacgccggtaaaactgaagaaggtaaact pMEGFP (T1) plasmid construction 67 pM2-R attctggtggaaaatcataatctatggtccttgtt 68 pM3-F attctggtggaaaatgacaccgattactccatcgc pMEGFP (NT2) plasmid construction 69 pM3-R cggcacaacgccggttgcattcatgtgtttgtttt 70 pM4-F cggcacaacgccggtgacaccgattactccatcgc pMEGFP (T2) plasmid construction 71 pM4-R attctggtggaaaattgcattcatgtgtttgtttt 72 pM5-F attctggtggaaaataacaacaacaataacaa pMEGFP (NT3) plasmid construction 73 pM5-R cggcacaacgccggtgttcgagctcgaattagtct 74 pM6-F cggcacaacgccggtaacaacaacaataacaa pMEGFP (T3) plasmid construction 75 pM6-R attctggtggaaaatgttcgagctcgaattagtct 76

CRISPRi plasmid Explanation pSEVA221 3.8 kb, RK2 ori, Km ^r pSECRi L-rhamnose inducible dCas9 and constitutive sgRNA expression in pSEVA221 pET-22b (+) 5.5 kb, pBR322 ori, Ap ^r pET22b-EeCpf1 P _T7 -EeCpf1: 6x His tag in pET-22b (+) pET22b-EedCpf1 P _T7 -EedCpf1 (D880A mutation): 6x His tag in pET-22b (+) pG-sgRNA P _J23119- sgRNA in pGEM-B1 pSECRi (T1) pSECRi expressing sgRNA (T1) pSECRi-EedCpf1 L-rhamnose inducible EedCpf1 in pSEVA221 pG-crRNA P _J23119- cRNA in pGEM-B1 pG-crRNA (T1) P _J23119- cRNA (T1) in pGEM-B1 pG-crRNAR (T1) P _J23119 -cRNA (T1) with 3 'repeat sequences in pGEM-B1 pSECRVi L-rhamnose inducible EedCpf1 and constitutive crRNA expression in pSEVA221 pSECRVi (T1) pSECRVi expressing crRNA (T1) pSECRVi (T1 _16bp) pSECRVi expressing crRNA (T1 _16bp) pSECRVi (T1 _{18 bp} ) pSECRVi expressing crRNA (T1 _{18 bp} ) pSECRVi (T1 _22bp) pSECRVi expressing crRNA (T1 _22bp) pSECRVi (T1 _24bp) pSECRVi expressing crRNA (T1 _24bp) pSECRVi (T1 _25bp ) pSECRVi expressing crRNA (T1 ₂₅ bp) pSECRVRi (T1) pSECRVi expressing crRNA (T1) with 3 'repeat sequences pSECRVi (P1) pSECRVi expressing crRNA (P1) pSECRVi (P2) pSECRVi expressing crRNA (P2) pSECRVi (C1) pSECRVi expressing crRNA (C1) pSECRVi (C2) pSECRVi expressing crRNA (C2) pSECRVi (C3) pSECRVi expressing crRNA (C3) pSECRVi (C4) pSECRVi expressing crRNA (C4) pSECRVi (C5) pSECRVi expressing crRNA (C5) pSECRVi (C6) pSECRVi expressing crRNA (C6) pSECRVi (C7) pSECRVi expressing crRNA (C7) pSECRVi (C8) pSECRVi expressing crRNA (C8) pSECRVi (1acZ) pSECRVi expressing crRNA (lacZ) pSECRVi (C4C5) pSECRVi expressing crRNA (C4) and crRNA (C5) pSECRVi (C1lacZ) pSECRVi expressing crRNA (C1) and crRNA (lacZ)

Other Plasmids Explanation pREGFP3 P _J23100 - gfp in pMW7, Ap ^r pMEGFP P _tac- MBP: EGFP in pMAL-c2X, Ap ^r pKD3 / I- Sce I pKD3, I- SceI endonuclease recognition site introduced at the side of the chloramphenicol resistance gene, Cm ^r pREGFP3 (NT1) pREGFP3 containing non-template strand binding site of sgRNA (T1), crRNA (T1) in 5'-UTR of GFP pREGFP3 (T1) pREGFP3 containing template strand binding site of sgRNA (T1), crRNA (T1) in 5'-UTR of GFP pREGFP3 (P2T1) pRGFP3 (T1) containing non-template strand binding site of crRNA (P2) in promoter of GFP pREGFP3C (P2T1) pREGFP3 (P2T1) containing chloramphenicol resistance gene behind GFP gene pMEGFP (NT1) pMEGFP containing non-template strand binding site of sgRNA (T1), crRNA (T1) behind methionine 1 residue of MBP-EGFP fusion protein pMEGFP (T1) pMEGFP containing template strand binding site of sgRNA (T1), crRNA (T1) behind methionine 1 residue of MBP-EGFP fusion protein pMEGFP (NT2) pMEGFP containing non-template strand binding site of sgRNA (T1), behind region of crRNA (T1) 206 residue of MBP-EGFP fusion protein pMEGFP (T2) pMEGFP containing template strand binding site of sgRNA (T1), behind region of crRNA (T1) 206 residue of MBP-EGFP fusion protein pMEGFP (NT3) pMEGFP containing non-template strand binding site of sgRNA (T1), crRNA (T1) behind asparagine 372 residue of MBP-EGFP fusion protein pMEGFP (T3) pMEGFP containing template strand binding site of sgRNA (T1), crRNA (T1) behind asparagine 372 residue of MBP-EGFP fusion protein

sgRNA / crRNA name Target site The spacer 5 'to 3' PAM sequence (5 '- &gt; 3') SEQ ID NO: sgRNA (T1) 5'-UTR of GFP caccagaatcggcacaacgc CGG 77 The crRNA (T1) 5'-UTR of GFP caccagaatcggcacaacgc T TTTN 78 The crRNA (T1 _16bp ) 5'-UTR of GFP caccagaatcggcaca T TTTN 79 The crRNA (T1 _18bp ) 5'-UTR of GFP caccagaatcggcacaac T TTTC 80 crRNA (T1 _22bp) 5'-UTR of GFP caccagaatcggcacaacgccg T TTTC 81 crRNA (T1 _24bp) 5'-UTR of GFP caccagaatcggcacaacgccggt T TTTC 82 The crRNA (T1 ₂₅ bp) 5'-UTR of GFP caccagaatcggcacaacgccggta T TTTC 83 The crRNA (P1) Promoter of GFP acggctagctcagtcctagg A TTTG 84 The crRNA (P2) Promoter of GFP ctagcactgtacctaggact G TTTG 85 The crRNA (C1) RBS, CDS of GFP agaaggagatatacatatga C TTTA 86 The crRNA (C2) RBS, CDS of GFP ctcatatgtatatctccttc C TTTA 87 crRNA (C3) CDS of GFP cactactggaaaactacctg A TTTG 88 The crRNA (C4) CDS of GFP aaagatgacgggaactacaa C TTTC 89 crRNA (C5) CDS of GFP gaaagatcccaacgaaaagc C TTTC 90 crRNA (C6) CDS of GFP cagtagtgcaaataaattta T TTTC 91 The crRNA (C7) CDS of GFP aaagatatagtgcgttcctg C TTTG 92 The crRNA (C8) CDS of GFP gttggatctttcgaaaggg T TTTC 93 The crRNA (lacZ) CDS of LacZ caacgtcgtgactgggaaaa T TTTA 94

<1-3> Production of plasmid

<1-3-1> pSECRi (T1) plasmid production

The pSECRi (T1) plasmid was constructed using the conventional inverse PCR method. Specifically, CRI (T1) -F and CRI (T1) -R primers were used with the pSECRi plasmid template to alter the sgRNA region of the SpdCas9-based CRISPRi system. After PCR amplification and agarose gel electrophoresis, the correct size DNA fragment was purified from the gel using Wizard SV Gel and PCR Clean-Up System (Promega, Madison, WI) Lt; / RTI &gt; PSECRi (T1) plasmid was prepared by ligating the digestion product according to the manufacturer's instructions using T4 DNA ligase and T4 polynucleotide kinase.

<1-3-2> pSECRVi  Plasmid production

The pSECRVi plasmid (FIG. 2) encoding the L-rhamnose-induced EedCpf1 protein and the constitutive BioBrick J23119 promoter-driven crRNA cassette was constructed using the existing pSECRi plasmid used in the SpdCas9-mediated CRISPRi system.

Specifically, the SpdCas9 gene of pSECRi was replaced with the EedCpf1 gene. For this, EedCpf1 was amplified from the pET22b-EedCpf1 plasmid using dCpf1-IF and dCpf1-IR primers. The amplified fragment was isolated from E. eligens (D880A) coding DNA sequence (CDS). The vector backbone was amplified using dCpf1-VF, dCpf1-VR primer and pSECRi. The pSECRi-EedCpf1 plasmid was prepared by assembling the two amplified fragments according to the manufacturer's protocol (NEB) using the Gibson assembly method.

Using the reverse PCR method, a crRNA expression cassette was prepared as shown in Fig.

At this time, in order to design a specific crRNA cassette, a 5'-mature repeat sequence deduced from nine crRNA sequences of E. eligens (FIG. 4), a 20-nt spacer, a 3'- ) (Fig. 3) were prepared. After transcription, the crRNA was further processed by RNase activity of EedCpf1 to produce native crRNA.

Thereafter, the entire region was amplified from the pG-sgRNA plasmid using the crRNA-F and the crRNA-R primer. After amplification and electrophoresis, DNA fragments of the correct size were purified and then treated with DpnI. The digested fragments were ligated using T4 DNA ligase and T4 polynucleotide kinase to prepare pG-crRNA.

<1-3-3> pSECRVi , pSECRVi (T1) and pSECRVRi (T1) plasmid production

The pG-crRNA (T1) plasmid was constructed using the crRNA (T1) -F and the crRNA (T1) -R together with the pG-sgRNA in the method of Example 1-3-2. (T1) -F and crRNAR (T1) -R primers were used to construct pG-crRNAR (T1). Three CRNA cassettes were amplified from pG-crRNA, pG-crRNA (T1) or pG-crRNAR (T1) using ST-F and ST-R primers, and the amplified fragments were amplified using AgeI / PSECRVi (T1) and pSECRVRi (T1) plasmids were assembled with the linear vector fragments generated by digesting pSECRi-EedCpf1.

A single stranded oligonucleotide-mediated assembly method was used to insert various spacers into pSECRVi. pSECRVi was linearized with the Type IIS restriction enzyme Sap I and single strand oligonucleotides containing a 20 bp spacer were ligated to the plasmid in which the Sap I site was digested using NEBuilder HiFi DNA Assembly Master Mix according to the manufacturer's protocol.

<1-3-4> pREGFP3 - Based and pMEGFP - based reporter plasmid production

To construct a pREGFP3-based reporter plasmid and a pMEGFP-based reporter plasmid, the CRISPRi binding site was inserted into pREGFP3 or pMEGFP using reverse PCR.

<1-3-5> pSECRVi ( C4C5 ) Plasmid production

by assembling the pSECRVi (C4) to the pSECRVi (C4) was linearized with the Sap I then raised NEBuilder HiFi DNA Master Mix 2 Assembly of Multi (C5) -F and Multi (C5) -R using the linearized nucleotide pSECRVi ( C4C5) plasmid.

<1-3-6> pSECRVi ( C1LacZ ) Plasmid production

The pSECRVi (C1LacZ) plasmid was constructed by assembling Sap I-linearized pSECRVi (C1) and two Multi (LacZ) -F and Multi (LacZ) -R oligonucleotides using NEBuilder HiFi DNA Assembly Master Mix.

<1-4> Production of reporter strain

To insert the reporter cassette into the E. coli DH5a chromosome, a pREGFP3C (P2T1) plasmid containing the chloramphenicol resistance gene for substrate selection was prepared.

Specifically, the chloramphenicol resistant cassette was amplified from pKD3 / I-SceI plasmids using Cm-F and Cm-R primers. The amplified fragment was inserted into a linear fragment generated by cleavage of Hind III site of pREGFP3 (P2T1) through Gibson assembly. Then, the gfp gene and the chloramphenicol expression cassette were amplified from pREGFP3C (P2T1) using Int-F and Int-R primers and inserted into the bglA genomic site of E. coli DH5α through λ Red-mediated homologous recombination.

<1-5> EeCpf1  And EedCpf1's  refine

The gene encoding Cpf1 (WP_012739647.1) was amplified by PCR from the genomic DNA of E. eligens (ATCC 27750) and ligated to the modified pET-22b (+) plasmid to generate a protein having a 6xHis-tag at the C- &Lt; / RTI &gt; The resulting pET22b-EeCpf1 plasmid was transformed into E. coli BL21-CodonPlus (DE3) -RIL strain (Agilent Technologies). The transformed cells were cultured in LB medium containing ampicillin to an OD _{600 of} 0.6, then 1 mM IPTG was added and cultured at 18 ° C for 20 hours. Cells were collected by centrifugation (8000 g, 30 min), resuspended in 400 mL of lysis buffer (30 mM Tris-HCl pH 7.5, 140 mM NaCl, 5 mM β-mercaptoethanol, 10% glycerol) (VC-600 sonicator, Sonics & Materials, Newtown, Conn.). The supernatant was purified through centrifugation (10,000 g, 30 min, 4 캜) and then purified on an AKTA FPLC system (GE Healthcare Life Sciences, Chicago, IL) using HisTrap HP, Heparin HP and Superdex 200 pg columns (GE Healthcare Life Sciences) ) And elution buffer (30 mM Tris-HCl pH 7.5, 100 mM NaCl, 5 mM? -Mercaptoethanol, 10% glycerol).

<1-6> In vitro DNA cleavage activity assay

37-mer crRNA (UAAUUUCUACUUUGUAGAUAAGUUCUGCUAUGUGGCG, SEQ ID NO: 95) was synthesized (Integrated DNA Technologies). Target dsDNA of pUC19 was purchased from Enzynomics. Purified EeCpf1 or EedCpf1 (160 nM) and the above crRNA (7.6 μM) were left at 37 ° C. for 5 minutes in reaction buffer (1 × PBS) containing 5 mM MgSO ₄ . After the reaction was initiated by the addition of the target dsDNA (10 nM), it was left at 37 ° C for 20 minutes and then quenched by addition of 6x DNA loading die (Fermentas) and analyzed on 1% agarose gel.

<1-7> Fluorescence analysis

A single E. coli colony harboring the reporter plasmid and the CRISPRi plasmid was separately inoculated into LB medium containing the appropriate antibiotic and incubated overnight at 37 ° C and 200 rpm. The culture was then diluted (1:99) with fresh LB medium supplemented with the appropriate antibiotics, followed by 8 hours for the pREGFP3 reporter plasmid, 12 hours for the pMEGFP reporter plasmid and chromosome reporter strain at 37 ° C and 200 rpm Lt; / RTI &gt; For the induction of EedCpf1 or SpdCas9 protein expression, 1 mM L-rhamnose was added to the culture medium unless otherwise specified. After incubation, cells were washed once with phosphate-buffered saline and resuspended in the buffer. Fluorescence and OD ₆₀₀ measurements were performed on a Victor X multilabel plate reader (PerkinElmer, Waltham, Mass.) Using a black-walled 96-well polystyrene plate.

Single cell fluorescence assays were performed using FACSCalibur (BD Bioscience, Franklin Lakes, NJ). For the time course of fluorescence, three single E. coli colonies carrying pREGFP3 (P2T1) and pSECRVi (C1) were inoculated into LB medium containing the appropriate antibiotic and 1 mM L-rhamnose, Lt; / RTI &gt; overnight. The culture was then diluted (1:99) into a black-walled 96-well polystyrene plate with fresh LB medium containing appropriate antibiotics and various concentrations of L-rhamnose. Cell growth and fluorescence were measured using an Infinite 200 PRO microplate reader (Tecan, Mannedorf, Switzerland).

Example  2. Deactivated- EedCpf1 (EedCpf1)  Produce

To study the validity of the dCpf1-based CRISPRi system for gene expression regulation, we first deactivated EedCpf1 (EedCpf1) by introducing a mutation in the core amino acid related to DNase activity in wild-type (WT) EeCpf1 Respectively.

Specifically, the Cpf1 protein has a RuvC-like endonuclease domain similar to Cas9 and contains at least three essential catalytic residues (D917, E1006 and D1255), so that the amino acid sequence of FnCpf1 and EeCpf1 Based on the alignment, one of three essential catalytic residues (D880, E965 and D1233) in EeCpf1 was replaced with alanine at position 880 to generate EedCpf1, generating mutations.

As a result, DNA cleavage activity of EeCpf1 was completely lost by the D880A mutation. WT EeCpf1 was able to cleave the supercoiled target DNA in a crRNA-dependent manner in the presence of Mn ^{2 +} , whereas EedCpf1 did not show a nucleic acid degrading activity such as that the RuvC-like domain of EeCpf1 cleaves two strands of the target DNA (Fig. 5).

That is, through the above results, it was confirmed that, unlike SpCas9, the ability to cleave DNA double strand was lost by inactivation of RuvC or HNH domain.

Example  3. pre- crRNA  Required processing Residue  Confirm

Since FnCpf1 is a function independent of the DNA nucleolytic activity, the pre-crRNA is processed into crRNA and four residues (H843, K852, K869 and F873) are required in the processing of pre-crRNA, so the amino acids of FnCpf1 and EeCpf1 The corresponding residues of EeCpf1 were identified based on sequence alignment.

As a result, it was confirmed that, in the processing of pre-crRNA, essential residues of EeCpf1 correspond to H765, K774, K833 and Y837, respectively (FIG. 5).

Example  4. Genes In suppression , EedCpf1  Effect of 3'-terminal 334-bp sequence

&Lt; 4-1 > of the crRNA (T1)  Comparison of synthesis and inhibition efficiency

In order to investigate the effect of the extra 334-bp sequence at the 3'-terminal of the spacer of crRNAR (T1) on the inhibitory efficiency, a 3'-repeat sequence of crRNAR (T1) ) Were synthesized (Fig. 3).

In addition, the CRISPRi efficiencies of SpdCas9 and EedCpf1 in E. coli DH5α were compared using the pSECRi plasmid (Fig. 6), and the 20-fold mutation of the spacer, on the non-template strand between the constitutive BioBrick J23100 promoter and the gfp gene, (NT1), which is a reporter plasmid in which the nucleotide sequence (5'-GCGTTGTGCCGATTCTGGTG-3 ', SEQ ID NO: 96) and the PAM sequence (5'-CCG-3' for SpdCas9; 5'- GAAAA- 3 'for EedCpf1) (Fig. 7).

<4-2> SpdCas9  And On EedCpf1  Calculation method

Expression of SpdCas9 (derived from pSECRi) and EedCpf1 (derived from pSECRVi) was induced by 1 mM L-rhamnose.

The expression rate was calculated by the following equation (1).

In the above equation, RFU and OD are the relative fluorescence units and optical density at 600 nm, respectively, and the subscript xv represents the tested cell carrying the pSECRi or pSECRVi plasmid (in the presence of L-rhamnose) Vector (empty-vector) control (in the presence of L-rhamnose). The mean expression levels were compared mainly through two-tailed t-tests.

<4-3> Non-mold  On the strand, EedCpf1's  Confirmation of gene expression inhibition effect

The effect of suppressing gene expression of SpdCas9 and EedCpf1 was measured by the method of Example < 4-2 > using pREGFP3 (NT1) in which the binding sequence was arranged on a non-template strand.

As a result, CRISPR-SpdCas9 inhibited the expression of gfp from pREGFP3 (NT1) to about 2.8% of the control (Fig. 8), confirming that this was similar to that of the previously reported SpdCas9-mediated CRISPRi.

On the other hand, CRISPR-EedCpf1 showed no significant inhibitory effect (about 80% of gfp expression).

<4-4> In the mold strand, EedCpf1's  Confirming gene expression inhibitory effect

In order to confirm the effect of suppressing the gene expression of EedCpf1 in the template strand, a reporter plasmid pREGFP3 (T1), in which the CRISPRi binding sequence was relocated to the template strand in pREGFP3 (NT1) (FIG. 9) 4-2>.

As a result, CRISPR-EedCpf1 reduced expression of GFP to 13.3% when targeting the template strand and confirmed that the inhibition efficiency was improved than that observed in non-template targeting (73.4%) (Figure 10) . This inhibition efficiency was similar to that of SpdCas9 (13.8%) which targeted the template strand.

On the other hand, when SpdCas9 targeted non-dominant strands in the 5'-UTR, it showed the highest inhibitory efficiency (2.4%), with similar inhibitory efficiencies in cassette crRNA (T1) and crRNAR (T1) 13.3% and 14% for crRNA (T1) and crRNAR (T1), respectively (FIG. 10).

That is, through the above results, since the 334-bp sequence at the 3'-end of EedCpf1 does not affect the inhibition efficiency, a sequence capable of recycling with other RNA-binding proteins is fused to the 3'- It is possible to produce novel chimeric crRNAs to which a novel function has been imparted.

Example 5 . CRISPR - On EedCpf1  About Spacer  Check valid length

Since the WT spacer for the Cpf1 family protein is 25-nt, the length of the spacer effective for gene suppression through CRISPR-EedCpf1 was investigated.

As a result, the spacers having a length of 20-nt to 25-nt did not exhibit a significant difference in efficiency, but a decrease in efficiency began to appear in spacers shorter than 20-nt (Fig. 11).

That is, the effective length of the spacer for CRISPR-EedCpf1 is similar to the length of the spacer (at least 16-nt to 17-nt) of SpdCas9 and, as a result, CRISPR-EedCpf1 is a very specific tool for gene expression regulation Can be used.

 In addition, in the case of using the oligonucleotide-mediated ligation cloning method using Type IIS restriction enzyme, since the spacer sequence in which the 3'-repeat sequence is deleted is less expensive than the spacer sequence in which the 3'-repeat sequence is cloned, The former method was used (Fig. 12).

Example  6. EedCpf1's  Gene Expression Suppression and Locational Tendency

<6-1> EedCpf1 - crRNA  Confirmation of binding efficiency and positional tendency of composite

Binding efficiency and positional biases of EedCpf1-crRNA complexes for inhibition of gene expression were examined by inserting a crRNA (T1) binding site at various positions of the gene.

Specifically, reporter plasmids containing maltose-binding protein (MBP-EGFP) with C-terminal fused enhanced GFP were used. That is, six additional reporters were added to the different coding regions of MBP-EGFP so that crRNA (T1) was bound to either template (T1) (Figure 13) or non-template (NTl) DNA strand (Figure 14) To prepare a plasmid. Bp (5'-CACCAGAATCGGCACAACGC-3 '), which is a crRNA (T1) binding site, is followed by three different codons of the MBP-EGFP fusion protein (methionine 1 (M1), alanine 206 (A206) and asparagine 372 (N372) , SEQ ID NO: 97) was inserted between the 5'-ATTTTC-3 '(for EedCpf1) and the 5'-CGGT-3' (for SpdCas9).

As a result, inhibition of MBP-EGFP expression by EedCpf1-crRNA was observed in all cases (M1, A206 and N372) in the same manner as in Example <4-4> targeting 5'-UTR Was more effective when targeting template strands than when targeting non-template strands (Figure 15). This is in contrast to the non-dominant tendency of Type II CRISPR dCas9 (Figure 16).

That is, through the above results, the expression of the gene can be inhibited by targeting the 5'-UTR and the coding region, and the consistent tendency of the template strand of EedCpf1 was confirmed.

<6-2> Gene EedCpf1 - crRNA  Confirmation of gene expression inhibition efficiency according to binding site of complex

The effect of inhibiting gene expression by binding sites of EedCpf1-crRNA complex was measured by inserting a crRNA (T1) binding site at various positions of the gene.

As a result, when the binding site further moved away from the transcription start site of MBP-EGFP, the inhibitory efficiency of the EedCpf1-crRNA targeting the template strand was slightly reduced (Fig. 15). Expression of MBP-EGFP encoded by the pMEGFP (NT1) plasmid was extremely low and therefore excluded from the experiment.

That is, through the above results, it was confirmed that Type V-A CRISPR-EedCpf1 could bind to 5'-UTR or CDS to potentially block the transcriptional elongation activity of RNAP.

Example  7. On EedCpf1  Identification of PAM sequence

Confirmation of the PAM sequence, which is preferentially used by EedCpf1, is essential for the design of the spacer to enable various applications of the artificial repressor. The various Cpf1 family proteins recognize a thymidine-rich PAM sequence, but the PAM sequence for EeCpf1 is not yet known.

Therefore, in order to confirm the PAM sequence for EedCpf1, the 5'-TTTTC-3 'PAM sequence located upstream of the prototype spacer of pREGFP3 (T1) was modified to give three kinds of PAM, 5'-CTTTC-3' '-CCTTC-3' and 5'-CCCTC-3 'were designed and synthesized.

As a result, as shown in FIG. 17, 5'-CTTTC-3 '(15.5%) PAM inhibited gfp expression at a level similar to that induced by 5'-TTTTC-3' PAM (11.4% The transcriptional repressor activity of the '-CCTTC-3' (66.1%) and 5'-CCCTC-3 '(88.3%) PAM sequences was low.

That is, it was confirmed from the above results that at least three thymidine nucleotides are necessary for efficient suppression of gene transcription by the EedCpf1-CRISPRi system.

On the other hand, the features of the EedCpf1 PAM sequence were confirmed using the further designed 5'-NTTTC-3 ', 5'-CNTTC-3' and 5'-CTTTN-3 'PAM sequences (N: any nucleotide).

As a result, it was confirmed that the 5'-CNTTC-3 'PAM sequence had a low transcriptional repression inhibitory activity except for 5'-CTTTC-3' and contained 3 nucleotides of the thymidine nucleotide (FIG. 18).

In addition, all of the 5'-NTTTC-3 'PAM sequences showed high inhibition efficiency due to the expression of residual gfp of less than 20% (Figure 19), but 5'-CTTTT-3' (40.9%) (Fig. 20).

That is, it was confirmed from the above results that the 5'-TTTV-3 '(V = A, G or C) PAM sequence was favored by EedCpf1-CRISPRi.

Example  8. Comparison of inhibition efficiency by target site

Since the multimeric CRISPRi system preferentially targets the promoter region, the inhibitory efficiency of EedCpf1-CRISPRi targeting the promoter, 5'-UTR and CDS was compared.

Specifically, in addition to the pre-designed pSECRVi plasmid (Figure 21) targeting 5'-UTR (T1), the BioBrick J23100 promoter (P1 and P2) and gfp CDS (C1, C3, C4, Ten pSECRVi plasmids for targeting C2, C6, C7, and C8 targeting template strands were prepared by the single-stranded DNA oligonucleotide-mediated DNA assembly method (Figure 12).

As a result, all of the constituents of EedCpf1 targeting template strands effectively inhibited gfp expression in pREGFP3 (P2T1) (Fig. 22). The non-haplotype strand targeting the promoter region also exhibited a transcriptional initiation (P2: 7.6%) inhibitory effect equivalent to that of the multimeric CRISPRi system derived from Type I CRISPR.

In addition, EedCpf1, which targets the non-dominant strand of gfp CDS, did not substantially inhibit expression (C2: 98.2%; C6: 96.5%; C7: 98.1%; C8: 92.9%); inhibition of gfp expression (C1, ribosome binding site and ATG initiation codon expression: 9.3% expression; C3, 138bp downstream: 12.2% expression; C4, 295bp downstream from initiation codon: 21.3% Expression; downstream from the C5, 618 bp start codon, 18% expression).

That is, considering that the frequency of 5'-TTTV-3 'PAM sequences in the promoter region is low and it is difficult to identify the promoter, the target sequence of EedCpf1-mediated CRISPRi is located at the center of translation initiation site of CDS It should be designed to target the nearest mold strand.

Example  9. L- on rhamnose  by EedCpf1's  Gene expression regulation

The possibility of controlling the expression of EedCpf1 regulatory gene by L-rhamnose inducer was investigated.

Specifically, E. coli cells harboring reporter plasmids pREGFP3 (P2T1) and pSECRVi (C1) plasmids targeting C1 in gfp CDS were cultured in Luria-Bertani (LB) medium containing 1 mM L-rhamnose to express EedCpf1 , Pre-induced cells were diluted (1: 99) in LB medium containing various concentrations of L-rhamnose (0-1000 μM). An L-rhamnose-inducible promoter was used in conjunction with RhaS and RhaR regulators for orthogonal control of EedCpf1 gene transcription. The L-rhamnose-inducible promoter is capable of homogeneous and rheostatic transcriptional control of the heterologous gene, It is not expressed in the absence of L-rhamnose.

As a result, after 200 minutes of culture, cell fluorescence was inversely proportional to the final L-rhamnose concentration (Fig. 23). At the end of the experiment (after 750 min), the level of gfp expression (the fluorescence pattern produced by E. coli) was 15% (1000 μM L-rhamnose), 37% (250 μM L-rhamnose) % (64 μM L-rhamnose), 91% (16 μM L-rhamnose), and 99% (4 μM L-rhamnose).

This meant that higher concentrations of L-rhamnose resulted in stronger inhibition of gfp expression, and cell growth under these conditions was virtually identical (Figure 24).

That is, the above results confirm that EedCpf1 can be used to regulate a wide range of gene expression so that essential or toxic genes can be targeted to control cell growth or metabolic yield.

Example  10. Identification of the possibility of regulating multiple gene expression

<10-1> Confirmation of chromosome gene expression inhibition efficiency and strand tendency

The EedCpf1-mediated CRISPRi system was evaluated for its ability to regulate the expression of the reporter gene inserted into the chromosome.

Specifically, the reporter cassette was introduced into the reporter cassette pREGFP3 (P2T1) so that the reporter cassette could be selected, and the reporter cassette was introduced into E. coli using λ Red-mediated homologous recombination And inserted into the bglA gene on the chromosome of DH5α.

As a result, targeting of the EedCpf1-crRNA complex to the promoter region of the gfp gene efficiently inhibited the gene regardless of the binding DNA strand, similar to the results obtained using an episomal plasmid reporter (P1: 3.2% , P2: 4.3%) (Fig. 25, right). In addition, when the template strand of gfp CDS was targeted, the C1 binding site exhibited the highest gfp inhibition (2.0% expression) and the distance from the translation initiation site (C3: 6.7%, C4: 16.5%, C5: 23% As a result, the inhibitory efficiency was gradually decreased, confirming that the result was similar to that obtained using the MBP-EGFP fusion protein of Example <6-2>. Gfp CDS-targeted nonspecific strand was hardly inhibited (C2: 93.7%).

Single-cell fluorescence analysis of Example <1-7> also confirmed that gene suppression using EedCpf1-CRISPRi produced a homogeneous single cell population without an all-or-none expression phenotype (Fig. 25, left) .

<10-2> To the crRNA (C4C5)  Confirming the effect of suppressing multiple expression by

Multiple inhibition by the newly designed crRNA (C4C5) (Fig. 26) was tested, taking into account the low inhibition efficiency of C4 and C5 binding sites, and was found to be more effective than single site targeting of C4 or C5 (Fig. 27). That is, through the above results, applicability of EedCpf1 was confirmed in the multiple suppression approach.

<10-3> lacZ And gfp on  About EedCpf1's Identify multiple inhibitory effects

To test the general applicability of EedCpf1-based multiplex suppression, we designed a crRNA to inhibit the different genes lacZ and gfp .

Specifically, crRNA (lacZ) is E. coli K-12 MG1655 intrinsic (endogenous) of the lacZ Gene, and the crRNA (C1lacZ) was designed to inhibit the endogenous lacZ of MG1655 Gene and the exogenous gfp gene of the pREGFP3 (P2T1) plasmid.

As a result, crRNA (C1) and crRNA (C1lacZ) effectively suppressed gfp expression in pREGFP3 (P2T1), while crRNA (lacZ) scarcely suppressed gfp expression (Fig. 28, left). lacZ For inhibition, crRNA (lacZ) and crRNA (C1lacZ) is lacZ (Cr) (C1) was detected in the presence of 0.5 mM isopropyl β-D-1-thiogalactopyranoside (IPTG) and 5-bromo-4-chloro-3-indolyl-β-D-galactopyranoside in ㎍ / ㎖ E. coli K-12 MG1655 grown in LB solid medium containing lacZ (Fig. 28, right).

In other words, through the above results, it was concluded that CRISPR-EedCpf1 can regulate several genes at the same time, since the crRNA (C1lacZ) simultaneously inhibits the gfp derived from the exogenous plasmid and the endogenous lacZ on the chromosome in E. coli K-12 MG1655 Respectively.

The present invention has been described above with reference to preferred embodiments thereof. It will be understood by those skilled in the art that various changes in form and details may be made therein without departing from the spirit and scope of the invention as defined by the appended claims. The disclosed embodiments should, therefore, be considered in an illustrative rather than a restrictive sense. The scope of the present invention is indicated by the appended claims rather than by the foregoing description, and all differences within the scope of equivalents thereof should be construed as being included in the present invention.

<110> Korea Research Institute of Bioscience and Biotechnology <120> Composition for Inhibiting Gene Expression          Nuclease-Deactivated Cpf1 and Uses Thereof <130> PN170156 <160> 97 <170> KoPatentin 3.0 <210> 1 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> CRI (T1) -F <400> 1 actagtatta tacctaggac 20 <210> 2 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> CRI (T1) -R <400> 2 caccagaatc ggcacaacgc gttttagagc tagaaatagc 40 <210> 3 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> dCpf1-VF <400> 3 ttccattcat atggtgatcc tgctgaattt 30 <210> 4 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> dCpf1-VR <400> 4 gtatgaataa ctcgagtaag gatctccagg 30 <210> 5 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> dCpf1-IF <400> 5 cttactcgag ttattcatac cttttattct 30 <210> 6 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> dCpf1-IR <400> 6 ggatcaccat atgaatggaa atcgtagcat 30 <210> 7 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> CrRNA-F <400> 7 caaagtagaa attactagta ttatacctag gac 33 <210> 8 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> cRNA-R <400> 8 tagattgaag agcgacccgg ggcggccgcc tcg 33 <210> 9 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> CrRNA (T1) -F <400> 9 caaagtagaa attactagta ttatacctag gac 33 <210> 10 <211> 53 <212> DNA <213> Artificial Sequence <220> <223> crRNA (T1) -R <400> 10 tagatcacca gaatcggcac aacgctgaag agcgacccgg ggcggccgcc tcg 53 <210> 11 <211> 38 <212> DNA <213> Artificial Sequence <220> &Lt; 223 > CrRNAR (T1) -F <400> 11 aatttctact ttgtagattg aagagcgacc cggggcgg 38 <210> 12 <211> 38 <212> DNA <213> Artificial Sequence <220> <223> crRNAR (T1) -R <400> 12 atttaaggtt attcaaacgc gttgtgccga ttctggtg 38 <210> 13 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> ST-F <400> 13 tattccgctt cctcggcgac cggttaaaga tctttgacag 40 <210> 14 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> ST-R <400> 14 ggcccaagct tcctcgaggc 20 <210> 15 <211> 69 <212> DNA <213> Artificial Sequence <220> <223> CrRNA (T1) -16-R <400> 15 ggcggccgcc ccgggtcgct cttcatgtgc cgattctggt gatctacaaa gtagaaatta 60 ctagtatta 69 <210> 16 <211> 71 <212> DNA <213> Artificial Sequence <220> <223> cRNA (T1) -18-R <400> 16 ggcggccgcc ccgggtcgct cttcagttgt gccgattctg gtgatctaca aagtagaaat 60 tactagtatt a 71 <210> 17 <211> 75 <212> DNA <213> Artificial Sequence <220> <223> cRNA (T1) -22-R <400> 17 ggcggccgcc ccgggtcgct cttcacggcg ttgtgccgat tctggtgatc tacaaagtag 60 aaattactag tatta 75 <210> 18 <211> 77 <212> DNA <213> Artificial Sequence <220> <223> CrRNA (T1) -24-R <400> 18 ggcggccgcc ccgggtcgct cttcaaccgg cgttgtgccg attctggtga tctacaaagt 60 agaaattact agtatta 77 <210> 19 <211> 78 <212> DNA <213> Artificial Sequence <220> <223> CrRNA (T1) -25-R <400> 19 ggcggccgcc ccgggtcgct cttcataccg gcgttgtgcc gattctggtg atctacaaag 60 tagaaattac tagtatta 78 <210> 20 <211> 73 <212> DNA <213> Artificial Sequence <220> <223> crRNA (P1) -R <400> 20 ggcggccgcc ccgggtcgct cttcacctag gactgagcta gccgtatcta caaagtagaa 60 attactagta tta 73 <210> 21 <211> 73 <212> DNA <213> Artificial Sequence <220> <223> crRNA (P2) -R <400> 21 ggcggccgcc ccgggtcgct cttcaagtcc taggtacagt gctagatcta caaagtagaa 60 attactagta tta 73 <210> 22 <211> 73 <212> DNA <213> Artificial Sequence <220> <223> crRNA (C1) -R <400> 22 ggcggccgcc ccgggtcgct cttcatcata tgtatatctc cttctatcta caaagtagaa 60 attactagta tta 73 <210> 23 <211> 73 <212> DNA <213> Artificial Sequence <220> <223> crRNA (C2) -R <400> 23 ggcggccgcc ccgggtcgct cttcagaagg agatatacat atgagatcta caaagtagaa 60 attactagta tta 73 <210> 24 <211> 73 <212> DNA <213> Artificial Sequence <220> <223> crRNA (C3) -R <400> 24 ggcggccgcc ccgggtcgct cttcacaggt agttttccag tagtgatcta caaagtagaa 60 attactagta tta 73 <210> 25 <211> 73 <212> DNA <213> Artificial Sequence <220> <223> crRNA (C4) -R <400> 25 ggcggccgcc ccgggtcgct cttcattgta gttcccgtca tctttatcta caaagtagaa 60 attactagta tta 73 <210> 26 <211> 73 <212> DNA <213> Artificial Sequence <220> <223> crRNA (C5) -R <400> 26 ggcggccgcc ccgggtcgct cttcagcttt tcgttgggat ctttcatcta caaagtagaa 60 attactagta tta 73 <210> 27 <211> 73 <212> DNA <213> Artificial Sequence <220> <223> crRNA (C6) -R <400> 27 ggcggccgcc ccgggtcgct cttcataaat ttatttgcac tactgatcta caaagtagaa 60 attactagta tta 73 <210> 28 <211> 73 <212> DNA <213> Artificial Sequence <220> <223> crRNA (C7) -R <400> 28 ggcggccgcc ccgggtcgct cttcacagga acgcactata tctttatcta caaagtagaa 60 attactagta tta 73 <210> 29 <211> 73 <212> DNA <213> Artificial Sequence <220> <223> crRNA (C8) -R <400> 29 ggcggccgcc ccgggtcgct cttcaccctt tcgaaagatc ccaacatcta caaagtagaa 60 attactagta tta 73 <210> 30 <211> 73 <212> DNA <213> Artificial Sequence <220> <223> CrRNA (lacZ) <400> 30 ggcggccgcc ccgggtcgct cttcattttc ccagtcacga cgttgatcta caaagtagaa 60 attactagta tta 73 <210> 31 <211> 70 <212> DNA <213> Artificial Sequence <220> <223> Multi (C5) -F <400> 31 ggcggccgcc ccgggtcgct cttcagcttt tcgttgggat ctttcatcta caaagtagaa 60 attatttaag 70 <210> 32 <211> 69 <212> DNA <213> Artificial Sequence <220> <223> Multi (C5) -R <400> 32 ttgtagataa agatgacggg aactacaagt ttgaataacc ttaaataatt tctactttgt 60 agatgaaag 69 <210> 33 <211> 70 <212> DNA <213> Artificial Sequence <220> <223> Multi (lacZ) -F <400> 33 ggcggccgcc ccgggtcgct cttcattttc ccagtcacga cgttgatcta caaagtagaa 60 attatttaag 70 <210> 34 <211> 69 <212> DNA <213> Artificial Sequence <220> <223> Multi (lacZ) -R <400> 34 ttgtagatag aaggagatat acatatgagt ttgaataacc ttaaataatt tctactttgt 60 agatcaacg 69 <210> 35 <211> 43 <212> DNA <213> Artificial Sequence <220> <223> pR1-F <400> 35 gcgttgtgcc gattctggtg gaaaataatt ttgtttaact tta 43 <210> 36 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> pR1-R <400> 36 cggtctagag ggaaaccgtt gtg 23 <210> 37 <211> 34 <212> DNA <213> Artificial Sequence <220> <223> pR2-F <400> 37 cggcacaacg ccggtaattt tgtttaactt taag 34 <210> 38 <211> 34 <212> DNA <213> Artificial Sequence <220> <223> pR2-R <400> 38 attctggtgg aaaatctaga gggaaaccgt tgtg 34 <210> 39 <211> 34 <212> DNA <213> Artificial Sequence <220> <223> pR3-F <400> 39 cggcacaacg ccggtaattt tgtttaactt taag 34 <210> 40 <211> 34 <212> DNA <213> Artificial Sequence <220> <223> pR3-R <400> 40 attctggtgg aaagtctaga gggaaaccgt tgtg 34 <210> 41 <211> 34 <212> DNA <213> Artificial Sequence <220> <223> pR4-F <400> 41 cggcacaacg ccggtaattt tgtttaactt taag 34 <210> 42 <211> 34 <212> DNA <213> Artificial Sequence <220> <223> pR4-R <400> 42 attctggtgg aaggtctaga gggaaaccgt tgtg 34 <210> 43 <211> 34 <212> DNA <213> Artificial Sequence <220> <223> pR5-F <400> 43 cggcacaacg ccggtaattt tgtttaactt taag 34 <210> 44 <211> 34 <212> DNA <213> Artificial Sequence <220> <223> pR5-R <400> 44 attctggtgg agggtctaga gggaaaccgt tgtg 34 <210> 45 <211> 34 <212> DNA <213> Artificial Sequence <220> <223> pR6-F <400> 45 cggcacaacg ccggtaattt tgtttaactt taag 34 <210> 46 <211> 34 <212> DNA <213> Artificial Sequence <220> <223> pR6-R <400> 46 attctggtgg aaattctaga gggaaaccgt tgtg 34 <210> 47 <211> 34 <212> DNA <213> Artificial Sequence <220> <223> pR7-F <400> 47 cggcacaacg ccggtaattt tgtttaactt taag 34 <210> 48 <211> 34 <212> DNA <213> Artificial Sequence <220> <223> pR7-R <400> 48 attctggtgg aaactctaga gggaaaccgt tgtg 34 <210> 49 <211> 34 <212> DNA <213> Artificial Sequence <220> <223> pR8-F <400> 49 cggcacaacg ccggtaattt tgtttaactt taag 34 <210> 50 <211> 34 <212> DNA <213> Artificial Sequence <220> <223> pR8-R <400> 50 attctggtgg aatgtctaga gggaaaccgt tgtg 34 <210> 51 <211> 34 <212> DNA <213> Artificial Sequence <220> <223> pR9-F <400> 51 cggcacaacg ccggtaattt tgtttaactt taag 34 <210> 52 <211> 34 <212> DNA <213> Artificial Sequence <220> <223> pR9-R <400> 52 attctggtgg aacgtctaga gggaaaccgt tgtg 34 <210> 53 <211> 34 <212> DNA <213> Artificial Sequence <220> <223> pR10-F <400> 53 cggcacaacg ccggtaattt tgtttaactt taag 34 <210> 54 <211> 34 <212> DNA <213> Artificial Sequence <220> <223> pR10-R <400> 54 attctggtgt aaagtctaga gggaaaccgt tgtg 34 <210> 55 <211> 34 <212> DNA <213> Artificial Sequence <220> <223> pR11-F <400> 55 cggcacaacg ccggtaattt tgtttaactt taag 34 <210> 56 <211> 34 <212> DNA <213> Artificial Sequence <220> <223> pR11-R <400> 56 attctggtga aaagtctaga gggaaaccgt tgtg 34 <210> 57 <211> 34 <212> DNA <213> Artificial Sequence <220> <223> pR12-F <400> 57 cggcacaacg ccggtaattt tgtttaactt taag 34 <210> 58 <211> 34 <212> DNA <213> Artificial Sequence <220> <223> pR12-R <400> 58 attctggtgc aaagtctaga gggaaaccgt tgtg 34 <210> 59 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Pt-F <400> 59 aaccacaacg gtttccctct agattttcca 30 <210> 60 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> Pt-R <400> 60 tgctagcact gtacctagga ctgagct 27 <210> 61 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> Cm-F <400> 61 aataataagg taccatggta ggtccatatg aatatcctcc 40 <210> 62 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> Cm-R <400> 62 tagtctagac tagaggccta ggaatacggt tagccatttg 40 <210> 63 <211> 59 <212> DNA <213> Artificial Sequence <220> <223> Int-F <400> 63 actatttcct gtaagaattg actcatctgg agcctatgat tcaccgtcat caccgaaac 59 <210> 64 <211> 60 <212> DNA <213> Artificial Sequence <220> <223> Int-R <400> 64 gcaacaagta ttgcatccgg tacttcatcg acttaaagct ggaatacggt tagccatttg 60                                                                           60 <210> 65 <211> 35 <212> DNA <213> Artificial Sequence <220> <223> pM1-F <400> 65 attctggtgg aaaataaaac tgaagaaggt aaact 35 <210> 66 <211> 35 <212> DNA <213> Artificial Sequence <220> <223> pM1-R <400> 66 cggcacaacg ccggtcataa tctatggtcc ttgtt 35 <210> 67 <211> 35 <212> DNA <213> Artificial Sequence <220> <223> pM2-F <400> 67 cggcacaacg ccggtaaaac tgaagaaggt aaact 35 <210> 68 <211> 35 <212> DNA <213> Artificial Sequence <220> <223> pM2-R <400> 68 attctggtgg aaaatcataa tctatggtcc ttgtt 35 <210> 69 <211> 35 <212> DNA <213> Artificial Sequence <220> <223> pM3-F <400> 69 attctggtgg aaaatgacac cgattactcc atcgc 35 <210> 70 <211> 35 <212> DNA <213> Artificial Sequence <220> <223> pM3-R <400> 70 cggcacaacg ccggttgcat tcatgtgttt gtttt 35 <210> 71 <211> 35 <212> DNA <213> Artificial Sequence <220> <223> pM4-F <400> 71 cggcacaacg ccggtgacac cgattactcc atcgc 35 <210> 72 <211> 35 <212> DNA <213> Artificial Sequence <220> <223> pM4-R <400> 72 attctggtgg aaaattgcat tcatgtgttt gtttt 35 <210> 73 <211> 35 <212> DNA <213> Artificial Sequence <220> <223> pM5-F <400> 73 attctggtgg aaaataacaa caacaataac aataa 35 <210> 74 <211> 35 <212> DNA <213> Artificial Sequence <220> <223> pM5-R <400> 74 cggcacaacg ccggtgttcg agctcgaatt agtct 35 <210> 75 <211> 35 <212> DNA <213> Artificial Sequence <220> <223> pM6-F <400> 75 cggcacaacg ccggtaacaa caacaataac aataa 35 <210> 76 <211> 35 <212> DNA <213> Artificial Sequence <220> <223> pM6-R <400> 76 attctggtgg aaaatgttcg agctcgaatt agtct 35 <210> 77 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> sgRNA (T1) <400> 77 caccagaatc ggcacaacgc 20 <210> 78 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> CrRNA (T1) <400> 78 caccagaatc ggcacaacgc 20 <210> 79 <211> 16 <212> DNA <213> Artificial Sequence <220> <223> crRNA (T1 16 bp) <400> 79 caccagaatc ggcaca 16 <210> 80 <211> 18 <212> DNA <213> Artificial Sequence <220> &Lt; 223 > CrRNA (T1 18bp) <400> 80 caccagaatc ggcacaac 18 <210> 81 <211> 22 <212> DNA <213> Artificial Sequence <220> The <223> crRNA (T1 22bp) <400> 81 caccagaatc ggcacaacgc cg 22 <210> 82 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> CrRNA (T1 24bp) <400> 82 caccagaatc ggcacaacgc cggt 24 <210> 83 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> CrRNA (T1 25 bp) <400> 83 caccagaatc ggcacaacgc cggta 25 <210> 84 <211> 20 <212> DNA <213> Artificial Sequence <220> &Lt; 223 > CrRNA (P1) <400> 84 acggctagct cagtcctagg 20 <210> 85 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> CrRNA (P2) <400> 85 ctagcactgt acctaggact 20 <210> 86 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> crRNA (Cl) <400> 86 agaaggagat atacatatga 20 <210> 87 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> crRNA (C2) <400> 87 ctcatatgta tatctccttc 20 <210> 88 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> crRNA (C3) <400> 88 cactactgga aaactacctg 20 <210> 89 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> crRNA (C4) <400> 89 aaagatgacg ggaactacaa 20 <210> 90 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> CrRNA (C5) <400> 90 gaaagatccc aacgaaaagc 20 <210> 91 <211> 20 <212> DNA <213> Artificial Sequence <220> &Lt; 223 > CrRNA (C6) <400> 91 cagtagtgca aataaattta 20 <210> 92 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> CrRNA (C7) <400> 92 aaagatatag tgcgttcctg 20 <210> 93 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> CrRNA (C8) <400> 93 gttgggatct ttcgaaaggg 20 <210> 94 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> CrRNA (lacZ) <400> 94 caacgtcgtg actgggaaaa 20 <210> 95 <211> 37 <212> DNA <213> Artificial Sequence <220> &Lt; 223 > 37-mer crRNA <400> 95 uaauuucuac uuuguagaua aguucugcua uguggcg 37 <210> 96 <211> 20 <212> DNA <213> Artificial Sequence <220> &Lt; 223 > 20-nt sequence <400> 96 gcgttgtgcc gattctggtg 20 <210> 97 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 20-bp sequence <400> 97 caccagaatc ggcacaacgc 20

Claims (13)

A nuclease-deactivated Cpf1 protein (EedCpf1) derived from Eubacterium eligens ; And
A first fragment comprising palindrome sequences and a second fragment comprising a spacer that is a polynucleotide that hybridizes to the target DNA.
Wherein the gene expression-suppressing activity of the gene expression-inhibiting composition is at least 10% The composition according to claim 1, wherein the crRNA further comprises a third fragment located downstream of the spacer and comprising a polynucleotide capable of binding to an RNA-binding protein . delete The composition for inhibiting gene expression according to claim 1, further comprising a PAM (protospacer adjacent motif) consisting of TTTV or TTV (V is A, G or C) upstream of the target DNA. The composition for suppressing gene expression according to claim 1, wherein the EedCpf1 protein is an 880th amino acid that constitutes the Cpf1 protein is substituted with alanine in aspartic acid. [Claim 2] The method according to claim 1, wherein the crRNA comprises at least two first and second fragments, wherein the first fragment and the second fragment are sequenced and contain different palindromic sequences and spacers, / RTI &gt; A nucleotide sequence encoding a nuclease-deactivated Cpf1 protein (EedCpf1) derived from Eubacterium eligens ;
A nucleotide sequence encoding a crRNA comprising a first fragment comprising palindrome sequences and a second fragment comprising a spacer that is a polynucleotide that hybridizes to the target DNA; And
A promoter operably linked to the nucleotide sequence
&Lt; / RTI &gt; 8. The method of claim 7, wherein the nucleotide sequence encoding the crRNA further comprises a third fragment located downstream of the spacer and comprising a polynucleotide capable of binding an RNA-binding protein Recombinant expression vector. delete 8. The recombinant expression vector according to claim 7, further comprising a PAM (protospacer adjacent motif) consisting of TTTV or TTV (V is A, G or C) upstream of the target DNA. [Claim 7] The recombinant expression vector according to claim 7, wherein the EedCpf1 protein is an 880th amino acid constituting the Cpf1 protein, which is substituted with alanine in aspartic acid. 8. The recombinant expression vector according to claim 7, wherein the promoter is an L-rhamnose-inducible promoter. [Claim 7] The method according to claim 7, wherein the crRNA is a recombinant expression vector having two or more first fragments and second fragments sequentially and comprising different palindromic sequences and spacers, .

Images