KR20210075889A - Immunodeficient Animal Model Mutated IL2Rg Gene by EeCpf1 and Method for Producing the same - Google Patents

Abstract

The present invention relates to an immunodeficient animal model with an IL2Rg gene mutated by EeCpf1 and a manufacturing method thereof. Since it is possible to manufacture the immunodeficient animal model by IL2Rg gene knockout with high efficiency, an animal model that can be effectively used for research on diseases such as immune-related diseases, for example, cancer can be manufactured.

Description

Immunodeficient Animal Model Mutated IL2Rg Gene by EeCpf1 and Method for Producing the same}

The present invention relates to an immunocompromised animal model in which the IL2Rg gene is mutated by EeCpf1 and a method for preparing the same.

Rodent animal models are useful tools for studying gene function, disease mechanisms, and novel therapeutics in vivo. However, the interpretation of these studies is limited due to species differences between rodents and humans. Non-human primates can be used as the best alternative model of human disease, but their use is limited due to their very high cost and ethical concerns. Recently, humanized mice have been developed to replace primates.

IL2 (interleukin 2), also known as T cell growth factor, is known to play a wide range of functional roles in the growth and activity of B cells, NK cells and macrophages. The action of IL-2 is mediated through the IL2 receptor (IL2R) with α, β, and γ chains. The γ chain is expressed in almost all cell populations, among which the IL-2 receptor γ (IL2Rg) chain is known as the most important component of the general cytokine receptor γ chain and receptors for IL2, IL4, IL7, IL9 and IL15. Patients without IL2 have normal numbers of T cells. However, patients without IL2Rg lack T cells because the γ chain is shared among multiple cytokine receptors. Thus, as mutations in IL2Rg in mice can lead to impairment of T, B, and NK cell development and function, immunodeficient mice with a NOD/Scid genetic background have improved carcinogenesis, cancer treatment, and imaging of tumor growth and tumor metastasis. This is especially important for analysis.

Cpf1 is an RNA-guided endonuclease that can be programmed to cut target DNA. Cpf1 is classified as type 5 and, like Cas9, belongs to a class 2 system consisting of one effector protein. Cpf1 has a target recognition mechanism similar to that of the Cas9 system, but differs in some characteristics. Cas9-RNA complex contains two RNA molecules, but Cpf1 is induced by one crRNA (~41nt). The PAM site of Cas9 is located 3' of the target DNA, whereas the PAM site of Cpf1 is located 5' of the target DNA. Cas9 typically recognizes guanine-rich PAMs such as NGG, whereas Cpf1 recognizes thymidine-rich PAMs such as TTTN. In the cleavage form, Cas9 produces a blunt end at a position adjacent to the PAM, whereas Cpf1 has a staggered cut of about 5 base pairs (bp) at a distance of about 17 nt towards the downstream of the PAM. ) is created. Cpf1 contains a short crRNA, generates a staggered cleavage pattern, and has a low off target rate, so it is expected to be more useful than Cas9 as a gene editing tool.

Gene editable Cpf1 Deletion log (ortholog) to find out confirming the discovery of a variety of Cpf1 protein and 52 non-redundant (nonredundant) CRISPR-Cpf1 locus through the PSI-Blast program results, and of the seven kinds Cpf1 coli, Francisella novicida U112 (FnCpf1), Acidaminococcus sp. BV36L (AsCpf1), Lachnospiraceae bacterium ND2006 (LbCpf1) Thiomicrospira sp. XS5 (TsCpf1), Moraxella bovoculi AAX08_00205 (Mb2Cpf1), Moraxella bovoculi AAX11_00205 (Mb3Cpf1) and Butyrivibrio sp. NC3005 (BsCpf1) was confirmed to have a DNA cleavage function in vivo, and among them, FnCpf1, AsCpf1 and LbCpf1 Cpf1 mutants were most intensively studied and used as a gene editing tool. However, the sequence homology of EeCpf1 of Eubacterium eligens has been confirmed, but in vivo DNA cleavage activity has not been reported.

Accordingly, the present inventors completed the present invention by conducting a study to develop an effective animal model of immunosuppression using EeCpf1.

Republic of Korea Publication No. 10-2017-0068400

One object of the present invention is a nucleotide sequence encoding a gRNA that hybridizes to a DNA encoding an IL2Rg (interleukin 2 receptor gamma) gene; a nucleotide sequence encoding a EeCpf1 ( Eubacterium eligens Cpf1) protein; And to provide a recombinant expression vector comprising a promoter operably linked to the nucleotide sequence.

Another object of the present invention is to provide a transformed cell line for preparing an immunocompromised animal model into which the recombinant expression vector is introduced.

Another object of the present invention is to provide a method for preparing an animal model of immunosuppression, comprising the step of transplanting the transformed cell line into the fallopian tube of a surrogate mother, an animal other than a human.

Another object of the present invention is to provide an IL2Rg (interleukin 2 receptor gamma) gene mutant immune dysfunction animal model prepared by the above method.

One aspect of the present invention is a nucleotide sequence encoding a gRNA that hybridizes to a DNA encoding an IL2Rg (interleukin 2 receptor gamma) gene; a nucleotide sequence encoding a EeCpf1 ( Eubacterium eligens Cpf1) protein; And it provides a recombinant expression vector comprising a promoter operably linked to the nucleotide sequence.

In the present specification, a method for producing a transgenic animal exhibiting a phenotype of immune dysfunction by mutating the IL2Rg gene in a mouse fertilized egg using IL2Rg-specific gene scissors using the CRISPR/Cpf1 system is provided.

As used herein, the term "expression" refers to the process by which a polynucleotide is transcribed from a DNA template (eg, into mRNA or other RNA transcript) and/or subsequent translation of the transcribed mRNA into a peptide, polypeptide or protein. refers to the process. If the polynucleotide is derived from genomic DNA, expression may include splicing of mRNA in eukaryotic cells.

As used herein, the term “cleavage” refers to breakage of a covalent backbone of a nucleotide molecule.

As used herein, the term "Cpf1 protein" is an essential protein element in the CRISPR/Cpf1 system, forms a complex with CRISPR RNA (crRNA), and may act as an active endonuclease or nickase. The Cpf1 protein of the present invention is derived from the genus Eubacterium eligens , and the in vivo DNA cleavage activity of Cpf1 obtained from E. eligens was first confirmed in the present invention.

As used herein, the term "guide RNA (gRNA)" refers to RNA specific for a target DNA, and the guide RNA can form a complex with a Cpf1 protein, and can bring the Cpf1 protein to the target DNA.

In the present invention, the guide RNA used together with the Cpf1 protein does not require tracrRNA, unlike the guide RNA used with the Cas protein. In other words, since Cpf1 protein operates as a single crRNA, there is no need to use crRNA and trans-activating crRNA (tracrRNA) at the same time as in Cas9 or to artificially create a single guide RNA (sgRNA) that combines tracrRNA and crRNA.

When a cell is transformed using the recombinant expression vector of the present invention, the guide RNA fragment can be delivered into the cell, and the delivered guide RNA fragment can recognize the IL2Rg gene. Therefore, when a cell is transformed using a recombinant expression vector, the guide RNA can be delivered into the cell, and a structure that can be recognized by the EeCpf1 protein can be formed.

IL2 (interleukin 2), also known as T cell growth factor, is known to play a wide range of functional roles in the growth and activity of B cells, NK cells and macrophages. Therefore, induction of IL2Rg mutation in mice can induce the development and function deletion of T, B, and NK cells. Thus, an immunodeficient animal model in which IL2Rg is mutated can be used for carcinogenesis, cancer treatment, tumor growth and It can be usefully used for experiments related to tumor metastasis.

According to one embodiment of the present invention, the gRNA may consist of any one of SEQ ID NO: 1, SEQ ID NO: 2, and SEQ ID NO: 5.

By using the gRNA consisting of any one of SEQ ID NO: 1, SEQ ID NO: 2, and SEQ ID NO: 5, knockout of DNA encoding IL2Rg can be efficiently induced.

As used herein, the term "recombinant expression vector" refers to a recombinant DNA molecule comprising a desired coding sequence and an appropriate nucleic acid sequence essential for expressing a coding sequence operably linked in a specific host organism. Promoters, enhancers, termination signals and polyadenylation signals available in eukaryotes are known.

As used herein, the term "operably linked" refers to a functional linkage between a gene expression control sequence and another nucleotide sequence. The gene expression control sequence may be at least one selected from the group consisting of an origin of replication, a promoter, and a terminator. The transcription termination sequence may be a polyadenylation sequence (pA), and the origin of replication may be, but is not limited to, an f1 origin of replication, an SV40 origin of replication, a pMB1 origin of replication, an adeno origin of replication, an AAV origin of replication, or a BBV origin of replication. .

As used herein, the term "promoter" refers to a region upstream of DNA from a structural gene, and refers to a DNA molecule to which RNA polymerase binds to initiate transcription.

The promoter according to one embodiment of the present invention is one of the transcription control sequences that regulate the initiation of transcription of a specific gene, and may be a polynucleotide fragment of about 100 bp to about 2500 bp in length. A promoter can be used without limitation as long as it can regulate transcription initiation in a cell, for example, a eukaryotic cell (eg, a plant cell, or an animal cell (eg, a mammalian cell such as a human, a mouse, etc.), etc.). For example, the promoter may be a CMV promoter (cytomegalovirus promoter (eg, human or mouse CMV immediate-early promoter), U6 promoter, elongation factor 1-a (EF1-alpha) promoter, EF1-alpha short (EFS) promoter, SV40 promoter, adenovirus promoter (major late promoter), pL λ promoter, trp promoter, lac promoter, tac promoter, T7 promoter, vaccinia virus 7.5K promoter, HSV tk promoter, SV40E1 promoter, respiratory syncytial virus; RSV promoter, metallotionin promoter, β-actin promoter, ubiquitin C promoter, human interleukin-2 (IL-2) gene promoter, human lymphotoxin gene promoter, and human GM -CSF (human granulocyte-macrophage colony stimulating factor) may be selected from the group consisting of gene promoters, but is not limited thereto.

The recombinant expression vector according to an embodiment of the present invention may be selected from the group consisting of viral vectors such as plasmid vectors, cosmid vectors and bacteriophage vectors, adenoviral vectors, retroviral vectors and adeno-associated viral vectors. Vectors that can be used as recombinant expression vectors include plasmids used in the art (eg, pcDNA series, pSC101, pGV1106, pACYC177, ColE1, pKT230, pME290, pBR322, pUC8/9, pUC6, pBD9, pHC79, pIJ61, pLAFR1). , pHV14, pGEX series, pET series, pUC19, etc.), phage (e.g., λgt4λB, λ-Charon, λΔz1, M13, etc.) or viral vectors (e.g., adeno-associated virus (AAV) vectors, etc.) It may be manufactured based on, but is not limited thereto.

The recombinant expression vector of the present invention may further include one or more selectable markers. The marker is a nucleic acid sequence having a characteristic that can be selected by a conventional chemical method, and includes all genes capable of distinguishing a transfected cell from a non-transfected cell. For example, herbicide resistance genes such as glyphosate, glufosinate ammonium or phosphinothricin, ampicillin, kanamycin, G418, Bleomycin , hygromycin (hygromycin), may be an antibiotic resistance gene such as chloramphenicol (chloramphenicol), but is not limited thereto.

The production of the recombinant expression vector of the present invention can be prepared using a genetic recombination technique well known in the art, and site-specific DNA cleavage and ligation can be performed using enzymes generally known in the art. have.

Another aspect of the present invention provides a transformed cell line for preparing an immunocompromised animal model into which the recombinant expression vector is introduced.

As used herein, the term "immune failure" refers to a state in which an effective immune response ability is lacking, and specifically, it may be caused by a deletion of the development and function of T, B and NK cells.

In order to prepare a transformed cell line into which the recombinant expression vector according to an embodiment of the present invention is introduced, a method known in the art for introducing a nucleic acid molecule into an organism, cell, tissue or organ may be used, and is known in the art. As described above, it can be carried out by selecting an appropriate standard technique according to the host cell. Such methods include, for example, electroporation, calcium phosphate (CaPO4) precipitation, calcium chloride (CaCl2) precipitation, microinjection, polyethylene glycol (PEG) method, DEAE-dextran method, cationic liposome method , and lithium acetate-DMSO method, and the like, but are not limited thereto.

The type of cell to be used as the transformed cell line may be an animal cell or an animal cell-derived cell, preferably a mammalian, most preferably a mouse-derived fertilized single-cell stage embryo.

Another aspect of the present invention provides a method for producing an animal model of immunosuppression comprising the step of transplanting the transformed cell line into the fallopian tube of a surrogate mother, an animal other than a human.

According to one embodiment of the present invention, the animal may be a mouse.

Mice have already been used in research for pathological mechanisms and treatment of various diseases, and in particular, as they have been valued as economic animals for a long time, ethical problems can be avoided than when using other animals as disease models, and a stable breeding system is It has the advantage of being easy to maintain and manage when developing experimental animal models.

According to one embodiment of the present invention, the immunosuppression may be due to knock-out of the IL2Rg gene.

As used herein, the term “knockout” refers to modifying or removing a specific gene in a nucleotide sequence so that it cannot be expressed.

Substitution of some of the bases constituting the IL2Rg gene, deletion, or insertion of some bases, preferably deletion of some of the bases constituting the IL2Rg gene, most preferably exons 3 or 8 of the IL2Rg gene By knockout of IL2Rg by mutation of the base, it is possible to prepare an animal model of immunocompromised.

According to one embodiment of the present invention, the knockout may be generated by mutation of a nucleotide sequence corresponding to any one of SEQ ID NO: 5 or SEQ ID NO: 6 and SEQ ID NO: 9 of exon 8 of exon 3 of the IL2Rg gene.

Another aspect of the present invention provides an IL2Rg (interleukin 2 receptor gamma) gene mutant immunodeficiency animal model prepared by the above manufacturing method.

As used herein, the term "animal model" refers to an animal having a disease that is very similar to a human disease. The significance of disease model animals in the study of human diseases is due to the physiological or genetic similarity between humans and animals. In disease research, biomedical disease model animals can provide research materials for various causes, onset processes, and diagnosis of diseases. It can be understood, and basic data for judging the possibility of practical use can be obtained through actual efficacy and toxicity tests of the developed new drug candidates.

In the immunodeficiency animal model of the present invention, the parts overlapping with the above description may be used with the same meaning as the above description.

As used herein, the term "mutation" refers to a state in which genetic information is changed due to a change in the nucleotide sequence constituting a gene and the genetic trait is changed, and such mutations include point mutations, deletion mutations, insertion mutations, missense mutations and nonsense mutations. may be included. The present invention provides an animal model of immunodeficiency in which the expression of the IL2Rg gene is reduced or deleted due to mutation of the IL2Rg gene by the CRISPR/Cpf1 system.

According to one embodiment of the present invention, the animal model may be one in which the IL2Rg gene is knocked out.

According to one embodiment of the present invention, the knockout may be generated by mutation of a nucleotide sequence corresponding to any one of SEQ ID NO: 5 or SEQ ID NO: 6 and SEQ ID NO: 9 of exon 8 of exon 3 of the IL2Rg gene.

According to one embodiment of the present invention, the animal may be a mouse.

According to the immunodeficiency animal model in which the IL2Rg gene is mutated by EeCpf1 and the manufacturing method thereof, it is possible to produce an immunocompromised animal model by IL2Rg gene knockout with high efficiency, so immune-related diseases, for example, diseases such as cancer It is possible to manufacture animal models that can be effectively used for research on

1 is a result of identifying the type 5 (Type V)-CRISPR locus in the genome of E. eligen. White arrows indicate ORFs in the E. eligens genome and blue arrows indicate the Type V cpf1 gene.
2 is a result of predicting the secondary structure of crRNA of EeCpr1.
3 is a result of multiple sequencing of EeCpf1 and other Cpf1 proteins of the present invention. Red highlights indicate that the catalyst residues are each conserved.
4 is a schematic diagram of EeCpf1-crRNA bound to pUC19. Red letters in pUC19 are PAM motifs in EeCpf1.
5 shows the target DNA cleavage activity of EeCpf1.
6 shows the metal-dependent DNase activity of EeCpf1.
7 is a comparison of the DNase activity of EeCpf1 wild-type and D880A mutant EedCpf1.
8 is a diagram confirming the in vitro nuclease activity of EeCpf1 against the IL2Rg gene. Arrows indicate cleavage sites.
9 is a diagram showing the result of analyzing the target gene cut by EeCpf1 with the Sanger nucleotide sequence.
10 is an IL2Rg PCR photograph showing the results of verifying the EeCpf1 efficiency in the mouse blastocyst.
11 is a sequencing analysis diagram using a PCR product showing the results of verifying the EeCpf1 efficiency in the mouse blastocyst.
12 is a T7E1 analysis result showing the result of verifying EeCpf1 efficiency in a mouse embryo. Arrows indicate cleavage sites.
13 is a sequencing analysis diagram using a PCR product showing the results of verifying EeCpf1 efficiency in a mouse embryo.
14 is a diagram showing the results of genetic analysis of the prepared G0 mice (#1, #3, #20 and #24).
15 is a diagram showing the results of genetic analysis of the prepared G2 mouse.
16 is a graph showing the results of confirming the expression level of IL2Rg mRNA in the thymus of NOD/SCID mice and eNIG mice.
17 and 18 are graphs showing the results of checking the body weight and organ weight of NOD/SCID mice and prepared eNIG mice.
19 is a graph showing the levels of AST, ALT, total cholesterol (CHO), triglyceride (TG), ALP and creatinine in the serum of NOD/SCID mice and prepared eNIG mice.
20 to 22 are diagrams showing the results of tumor size and weight changes in NOD/SCID mice and eNIG mice implanted with tumor cells (HepG2, A549).
23 and 24 are graphs showing the results of flow cytometry analysis of B cells, T cells and NK cells of C57BL/6 mice, NOD/SCID mice and eNIG mice.

Hereinafter, one or more specific embodiments will be described in more detail through examples. However, these examples are for illustrative purposes of one or more embodiments, and the scope of the present invention is not limited to these examples.

Example 1. In vitro ( in vitro ) Confirmation of cleavage activity of EeCpf1 in

1-1. Cloning, Expression, and Purification of EeCpf1 and Mutant Cpf1 (EedCpf1)

<1-1-1> Expression and purification of wild-type Cpf1

The gene encoding Cpf1 (WP_012739647.1) was amplified by PCR from the genomic DNA of Eubacterium eligens (ATCC 27750). The amplified Cpf1 gene was ligated to a modified pET-22b(+) plasmid, and the C-terminus of the produced protein had a 6xHis-tag (6xHis-tag) and a CPD tag. E. coli strain BL21-Codon Plus(DE3)-RIL (Agilent Technologies) was transformed with the recombinant pET22b_EeCpf1-CPD plasmid.

E. coli transformed to produce EeCpf1-CPD was cultured in LB medium containing ampicillin until OD600 was 0.6, and then 1 mM IPTG was added thereto, followed by 16 hours at a temperature of 18 ° C. During incubation, EeCpf1-CPD protein expression was induced.

Cells were collected by centrifugation (6000 g, 30 min), resuspended in 300 ml of lysis buffer (30 mM Tris-HCl pH7.5, 150 mM NaCl, 5 mM beta-mercaptoethanol, 10% glycerol), and ice It was disrupted by sonication in a water bath (ice bath, VC-600 sonicator; Sonics & Materials).

The supernatant was purified by centrifugation (10000 g, 30 min, 4°C), HisTrap HP, Heparin 22HP, and Superdex 200pg columns (GE Healthcare) equipped with an AKTA FPLC system (GE Healthcare) and elution buffer (30 mM Tris) -HCl, pH7.5, 150mM NaCl, 5mM beta-mercaptoethanol, 10% glycerol) was used to purify the EeCpf1-CPD protein. The C-terminal 6xHis-tag and CPD tag of the EeCpf1-CPD protein were cleaved by treatment with 200 μM of phytic acid.

<1-1-2> Expression and purification of D880A mutant EedCpf1

EedCpf1 mutant containing the D880A substitution (pET22b-EedCpf1-CPD) was generated with a site-directed mutagenesis kit (Enzynomics), and expressed in the same manner as in Example 1-1-1. Purified.

1-2. crRNA preparation by in vitro transcription

The target sequence of EeCpf1 and EedCpf1 consists of about 24 nucleotides, followed by the PAM sequence consisting of TTTN.

For in vitro transcription, the template DNA was amplified by overlap PCR. The amplified template DNA was purified with a commercial gel extraction kit (Bioneer). In vitro transcription was performed with the purified DNA template using the MEGAshortscript T7 transcription kit (Invitrogen) according to the manufacturer's instructions. The synthesized crRNA was purified by ethanol precipitation.

1-3. Methods for Assaying Nuclease Activity in Vitro

<1-3-1> Nuclease activity assay targeting pUC19 plasmid

The nuclease activity was assayed in vitro by targeting the pUC19 plasmid (in vitro nuclease activity assays). Purified EeCpf1 or EedCpf1 (160 nM), and crRNA (7.6 μM) were incubated at 37° C. for 5 minutes in a reaction buffer (30 mM Tris-HCl pH 7.5, 100 mM NaCl) containing 5 mM _{MnCl 2 .} The reaction was initiated by addition of pUC19 plasmid (200 ng), followed by incubation at 37° C. for 20 minutes. Finally, the reaction was stopped by adding proteinase K (Enzynomics), incubated at 37° C. for 20 minutes, and all samples were analyzed on a 1% agarose gel.

<1-3-2> Analysis of nuclease activity targeting IL2Rg

For in vitro activity analysis on IL2Rg sequences, regions containing four target sequences on the IL2Rg gene were amplified by PCR. The amplification product was purified using a gel extraction kit and used as a substrate for IL2Rg sequence targeting assay. Nuclease activity was analyzed in the same manner as in Example 1-3-1, except that the amplified IL2Rg substrate was used instead of the plasmid.

1-4. Confirmation of nuclease activity of EeCpf1

In order to confirm the nuclease activity of EeCpf1, Example 1-1 was performed, and EeCpf1 protein was expressed and purified from E. coli, and then Cpf1 ribonucleoprotein (Cpf1 ribonucleoprotein ( Ribonucleoproteins, RNPs) were reconstituted. Based on the analysis of the T-rich PAM at the 5' end of the protospacer sequence in EeCpf1, a double-stranded plasmid (pUC19) with 5'-TTTN PAM as a DNA substrate was used, and corresponding to the target in the plasmid was used. After synthesizing crRNA, Examples 1-3 were performed to analyze nuclease activity in vitro.

As a result, it was confirmed that EeCpf1 produced linear DNA by cleaving the target DNA of the pUC19 plasmid in a crRNA-dependent manner. On the other hand, in the absence of crRNA, EeCpf1 is Nt. Bands were generated by migrating in a pattern corresponding to the pUC19 plasmid nicking by BspQI. That is, it was confirmed that EeCpf1 exhibits nick activity of dsDNA in the absence of crRNA.

On the other hand, as a result of confirming the metal ion dependence of the DNA cleavage activity of EeCpf1, it is dependent on Mn ²⁺ , Mg ²⁺ , Ni ²⁺ and Ca ²⁺ , and Cu ²⁺ , Zn ²⁺ are low related to the activity. Confirmed. In addition, as a result of generating an active site mutation of the RuvC domain including D880A substitution and analyzing its effect on DNA cleavage activity, both nick and double-stranded DNA cleavage activity are lost by EeCpf1 (D880A) mutation. was confirmed to be

Through these results, it was confirmed that EeCpf1 exhibits crRNA-mediated DNA cleavage activity (nuclease activity).

Example 2. In vivo ( in vivo ) Confirmation of cleavage activity of EeCpf1 in

2-1. Cytoplasm microinjection

Female C57BL6 mice (4 to 5 weeks old) were intraperitoneal injection of 5 IU of serum gonadotropin (PMSG, Seoil livestock medicine) to superovulate, and after 46 hours, 5 IU of human Human chorionic gonadotropin (hCG) was injected. Mice were sacrificed 14 hours after hCG administration and oviducts were collected. The oocyte cumulus complex was separated from the fallopian tubes, and the embryos were transferred to a microinjection dish containing M2 medium (Sigma) under mineral oil.

A CRISPR/Cpf1 reagent mixture was prepared by diluting 0.6 μM Cpf1 protein and 6.1 μM IL2Rg crRNA concentrate with distilled water, and then microinjected into the embryo cytoplasm. Embryos injected with the reagent mixture were cultured up to the blastocyst stage in M16 medium (Sigma) under mineral oil.

2-2. Genome Sequencing

For PCR amplification, embryos were treated with blastocyst lysis buffer (100 mM Tris-HCl (pH 8.3), 100 mM KCl, 0.02% gelatin, 0.45% Tween 20, 10 mg/μl yeast tRNA, and 20 mg/ml proteinase K). dissolved in 10 μL.

The lysed sample was incubated at 56 ° C. for 10 minutes and at 95 ° C. for 10 minutes, then stored at -4 ° C. Using 4 μl of the crude sample, the IL2Rg gene was amplified by PCR. The PCR amplification product of the IL2Rg gene was analyzed by Sanger sequencing analysis, Bioneer, Korea to confirm the change in the genome sequence of the blastocyst.

2-3. Confirmation of mammalian gene editing in mouse cells by EeCpf1

It was confirmed that the EeCpf1 protein can cleave endogenous genomic loci in mammalian cells. Human codon-optimized EeCpf1 protein was expressed and purified from E. coli. To enable nuclear compartmentalization of EeCpf1 in mammalian cells, nuclear localization signals (NLS) were attached to each of the N-terminus and C-terminus.

The target gene was interleukin 2 receptor gamma (IL2Rg). The IL2Rg gene encodes an enzyme essential for lymphocyte development and is an essential gene for preparing an immunodeficient mouse model. By injecting multitargeting crRNA and EeCpf1 for the IL2Rg gene into mouse embryos, and investigating whether IL2Rg knockout mice occur, EeCpf1 can be used as a gene-editing tool in vivo. Check whether there is.

To avoid off-target mutagenesis, four sites with low sequence homology with other sequences within the IL2Rg gene (two sites from exon 3, one site from exon 4 and one site from exon 5) were removed. Four crRNAs corresponding to the selection were designed (hereinafter referred to as crRNA1, crRNA2, crRNA3, and crRNA4). In order to increase the gene editing efficiency of EeCpf1, each crRNA was designed to have a U-rich sequence (U-rich tail, U4AU6) at the 3' end of the RNA.

As a result, it was confirmed that all four target regions of the IL2Rg gene amplified by PCR were specifically cleaved by the preassembled EeCpf1 RNP ( FIG. 8 ).

In order to confirm whether it exhibits nuclease activity in vivo, according to Example 2-1, a recombinant EeCpf1 protein and four crRNA mixtures were microinjected into a one-cell-stage embryo and a mouse embryo was cultured. Thus, a blastocyst was obtained. Thereafter, as a result of T7EI analysis and Sanger sequencing of blastocysts according to Example 2-2, it was confirmed that 5 (15%) blastocysts out of 34 blastocysts had EeCpf1-mediated mutations in the IL2Rg gene. In exon 3, it was confirmed that the corresponding 20bp sequence between the targets of crRNA1 and crRNA2 was deleted with an efficiency of 6% (FIG. 9). In exon 4, mutations caused by crRNA3 did not appear, but in exon 5, one nucleotide deletion was shown by crRNA4 with an efficiency of 10%. In addition, according to the DNA sequence chart, it was confirmed that mutation of the IL2Rg gene was induced by EeCpf1, which caused two types of insertion and deletion mutations in the remaining three target sites except for exon 4. Through these results, it was confirmed that EeCpf1 can be used for powerful multiplex genome editing in mammalian cells.

Example 3. IL2Rg gene knockout mouse construction using EeCpf1

3-1. Cpf1 guide RNA design

Cpf1 guide RNA (guide RNA, gRNA, crRNA) was designed as shown in Table 1 in exons 3 to 5 of the IL2Rg gene.

name gRNA nucleotide sequence (5'→3') SEQ ID NO: IL2Rg sgRNA-1 UUGUCCAGCUCCAGGACCCCCAGA SEQ ID NO: 1 IL2Rg sgRNA-2 GCUUCUGUACAGCUCGCCUCUGGG SEQ ID NO: 2 IL2Rg sgRNA-3 AUAUGUCUGCUUUUCCAUCUCAGC SEQ ID NO: 3 IL2Rg sgRNA-4 GGGUUCGGAGCCGCUAUAACCCAA SEQ ID NO: 4

3-2. Off-target analysis of gRNA

A recent study ( analysis of off-target effects of CRISPR/Cas-derived RNA-guided endonucleases and nickases, Genome Res. 2014 Jan; 24(1): 132-141 ) found that two or more nucleotide mismatches with other sequences ( It has been reported that mismatching gRNAs do not represent off-targets. Therefore, the off-target of the sgRNA of Table 1 in IL2Rg was analyzed using the NCBI blast system.

As a result, as shown in Table 2, it was confirmed that each gRNA did not represent an off-target.

sgRNA gRNA target sequence exons Strand off target Base sequence (5'→3') SEQ ID NO: 0 One 2 3 One TCTGGGGGTCCTGGAGCTGGACAA SEQ ID NO: 5 3 + 0 0 0 One 2 CCCAGAGGCGAGCTGTACAGAAGC SEQ ID NO: 6 3 - 0 0 0 0 3 GCTGAGATGGAAAAGCAGACATAT SEQ ID NO: 7 4 - 0 0 0 0 4 TTGGGTTATAGCGGCTCCGAACCC SEQ ID NO: 8 5 + 0 0 0 0

3-3. Verification of EeCpf1 efficiency in blastocysts

The EeCpf1 protein of Example 1-1-1 and the four guide RNAs of Table 1 were microinjected into 50 fertilized eggs by the method of Example 2-1, and a total of 38 blastocysts developed were obtained in Example 2 The genotype was analyzed according to the method of -2.

As a result, it was confirmed that the efficiency of more than 10% was shown in gRNAs 1 and 2 of exon 3 ( FIGS. 10 and 11 ), and gRNAs 1 and 2 were used to produce IL2Rg gene-deficient mice. .

3-4. Validation of EeCpf1 Efficiency in Mouse Embryos

A total of 125 mouse fertilized eggs were microinjected with the EeCpf1 protein of Example 1-1-1 and the guide RNA whose efficiency was verified in Example 3-3 according to the method of Example 2-1, and the developed cells were transferred to 4 surrogate mothers. Nine live offspring were obtained by transplantation (Table 3). Thereafter, the IL2Rg genotype was analyzed by performing T7E1 assay (T7endonuclease1, ToolGen, Daejeon, Korea) and sequencing (Bioneer, Daejeon, Korea).

Date system number of fertilized eggs number of fetuses collection microinjection survival surrogate mother living 5.29 B6/J 157 125 76 (71%) 4 G0 # 1~9
(2019.06.18)

As a result, it was confirmed that the band was cut in mouse 9 (Fig. 12).

In addition, as a result of performing sequencing analysis using the PCR product according to Example 2-2, a deletion of the IL2Rg gene appeared in mouse 9 (FIG. 13), and it was confirmed that the result was consistent with the result, 　 confirmed in Example 3-3 Efficiency similar to the EeCpf1 　 efficiency (13%) was also confirmed in G0 　 mice (11%). On the other hand, since mutant mice were born and analyzed, it was confirmed that there was no problem in the safety of EeCpf1.

Example 4. Confirmation of Immunodeficiency in IL2Rg Gene Knockout Mice Using EeCpf1

4-1. IL2Rg crRNA synthesis

Guide RNA (guide RNA, gRNA, crRNA) targeting exon 8 of the IL2Rg gene was designed in a similar manner to Example 1-2 (Table 4).

4-2. Cytoplasm microinjection

Female NOD/SCID mice (4-5 weeks old) were intraperitoneal injection of 5 IU of serum gonadotropin (pregnant mare serum gonadotropin, PMSG, Seoil livestock medicine) to superovulate, and after 46 hours, 5 IU of human chorionic gonadotropin (hCG) was injected. Mice were sacrificed 14 hours after hCG administration and oviducts were collected. The oocyte cumulus complex was isolated from the fallopian tubes and placed in pre-equilibrated fertilization drops composed of HTF culture solution. Divine sperm were isolated from the transdermal and vas deferens of male NOD/SCID mice (5 months old) and transferred to HTF medium. The sperm were fertilized by transferring the oocyte complex to the sperm in HTF medium, and incubated for _{8 hours (37°C, 5% CO 2 ).} After incubation, the oocytes were washed with HTF to remove excess sperm and incubated in M16 medium (37°C, 5% CO ₂ ) for 7 hours. And microinjection was performed in M2 medium under mineral oil.

The eeCpf1 reagent mixture was prepared by mixing and diluting distilled water to a concentration of 0.3 μM eeCpf1 protein (Scientific Reports (2019) 9:13911) and 80 ng/μl IL2Rg guide RNA. The prepared reagent was microinjected into the cytoplasm of the embryo, and the surviving embryo was surgically transplanted into the fallopian tube of a female of childbearing age. And mice with genetic mutations confirmed among the born mice (G0 mice: #1, #3, #20 and #24) were obtained (see Table 5).

4-3. IL2Rg gene analysis

The genotype of the born pups was analyzed using a PCR fragment in which IL2Rg exon 8 was amplified by applying T7E1 analysis (T7 endonuclease1, ToolGen, Seoul, Korea) (primers used: FR 5'-TACCATCAGGATGTGGCTGA -3', RP 5' - ATTGGATCCAGATTGCCAAG -3').

As a result, it was confirmed that the prepared mice (G0 mice: #1, #3, #20 and #24) were heterogeneous. In the case of the wild-type gene, only one band was identified at 502bp, whereas in the heterozygote, three bands were identified: 200bp, 300bp, and 502bp. As a result of confirming the mutation of the IL2Rg gene, mice confirmed 12bp, 14bp, 18bp deletion and 7bp insertion at the crRNA target position (FIG. 14).

4-4. Confirmation of germline transmission of IL2Rg gene deletion

The mice prepared in 4-2. above (G0 mice: #1, #3, #20 and #24) were crossed with NOD/SCID mice, respectively, and only G0 #3 mice gave birth to G1 mice. Then, G1 mice were crossed again to obtain G2 mice.

As a result of analyzing the G2 mouse gene by PCR, it was confirmed that it had a homo mutation (FIG. 15).

The homo mutant G2 mice were classified as eNIG (or e-NSIG), and RNA analysis was performed to confirm the inactivation of IL2Rg.

Total RNA was secreted from mouse tail tissue using TRIzol (Molecular Research Center, Cincinnati, OH, USA) dmf, and cDNA was synthesized from total RNA sample using a first-strand cDNA synthesis kit (Fermentas, Burlington, Ontario, Canada). did. Real-time qRT-PCR analysis was performed according to the Exicycler™ 96 Real-Time Quantitative Thermal Block (Bioneer, Daejeon, Korea) and SYBR Premix Ex Taq (Takara, Otsu, Japan) protocols. The primer sequences used were as follows: IL2Rg, FP 5'-TGCCTAGTGTGGATGAGCTG-3', RP 5'-CAGGCTGGCTCCATTTACTC-3'; GAPDH, FP 5'-AGAACATCATCCCTGCATGG-3', RP 5'-CACATTGGGGGTAGGAACAC-3'

As a result, in the case of eNIG mice, IL2Rg mRNA was not confirmed in the thymus tissue ( FIG. 16 ), and it was confirmed that the IL2Rg characteristic deficient in NOD/SCID mice was reproductively transmitted.

Thereafter, the 14bp deletion in the IL2Rg gene of eNIG mice was maintained by crossing a mutant male mouse with a mutant female mouse.

4-5. Characterization of eNIG mice

The body weight and organ weight of the prepared eNIG mice were measured and compared with NOD/SCID mice.

As a result, the weights of the thymus and spleen of eNIG mice were significantly reduced compared to NOD/SCID mice ( FIGS. 17 and 18 ). It is considered that the weight loss occurred due to the defect of T, B, and NK cells.

For serum analysis in the peripheral blood of the prepared eNIG mice, the mice were fasted for 4 hours after feeding and anesthetized using isourane. Blood was centrifuged for 10 minutes at 1500 g in a cooled centrifuge for serum, and the supernatant was collected and stored at -70°C for use. Serum AST, ALT, total cholesterol (CHO), triglyceride (TG), ALP and creatinine levels were analyzed using an auto analyzer (AU480 Chemistry System, Beckman Coulter, USA).

As a result, no significant difference was found between NOD/SCID mice and eNIG mice ( FIG. 19 ).

Example 5 Confirmation of feasibility of use as an animal model for immunosuppression

5-1. cancer cell transplant

The tumorigenic potential of the eNIG mouse of the present invention was confirmed using human hepatocarcinoma cell line (HepG2) and adenocarcinomic human alveolar basal epithelial cells (A549) cells. ^{Specifically, 1x10 6} cells suspended in 100 μl of matrigel were subcutaneously injected into 12-week-old NOD/SCID and eNIG male mice (n=4, respectively) and confirmed 6 days after transplantation. At this time, the size (mm ³ ) of the solid cancer formed was derived from the caliper and L Х W2 Х ð/6 formula, where L is the length and W is the width of the tumor.

As a result, it was confirmed that a tumor was formed in the eNIG mouse, and no significant difference was observed between the NOD/SCID mouse and the eNIG mouse in the size and weight of the tumor except for the 27th day after transplantation ( FIGS. 20 to 22 ). (Data presented as mean±SD; *p<0.05).

5-2. Isolation of splenocytes

To isolate splenocytes, harvested spleens were placed in a cell strainer and placed in a 4-well plate. Filtered medium (7 ml) was added and the spleen was disrupted. The crushed cells were centrifuged at 1200 rpm for 5 minutes, and the supernatant was removed. Red blood cells were removed by adding RBC lysis buffer (1ml) to the pellet and placed at room temperature for 10 minutes. The suspended cells were mixed with FACS buffer (7ml), centrifuged at 1200rpm for 5 minutes, and the supernatant was removed. The procedure was repeated a total of two times, and the final pellet was resuspended in 1 ml FACS buffer.

5-3. Identification of T, B and NK cells

To measure T, B and NK cell numbers, splenocytes were treated with APC-conjugated anti-CD45, APC-cy7-conjugated anti-CD3, PerCP-Cy5.5-conjugated anti-NK1.1 and fluorescein isothiocyanate (FITC)-- It was stained with conjugated anti-B220 at 4°C for 20 minutes. Thereafter, the stained cells were washed by adding FACS buffer and centrifuging at 1200 rpm for 5 minutes. The cells were resuspended in Fix buffer and analyzed by flow cytometry using a Gallios flow cytometer (Beckman Coulter, USA).

As a result, compared to C57BL/6 mice, NOD/SCID mice could confirm the deletion of T and B cells, but it was confirmed that the NK cells were at a reduced level. The eNIG mouse of the present invention was confirmed to have T, B and NK cell defects ( FIGS. 23 and 24 ).

Based on the above results, it was confirmed that the eNIG mouse of the present invention is an immunocompromised animal model with more deficient NK cells compared to the conventional NOD/SCID mouse, and that tumors can grow when the tumor cells are transplanted.

So far, the present invention has been looked at with respect to the embodiments. Those of ordinary skill in the art to which the present invention pertains will understand that the present invention can be implemented in modified forms without departing from the essential characteristics of the present invention. Therefore, the disclosed embodiments are to be considered in an illustrative rather than a restrictive sense. The scope of the present invention is indicated by the claims rather than the foregoing description, and all differences within the scope equivalent thereto should be construed as being included in the present invention.

<110> KOREA RESEARCH INSTITUTE OF BIOSCIENCE AND BIOTECHNOLOGY <120> Immunodeficient Animal Model Mutated IL2Rg Gene by EeCpf1 and Method for Producing the same <130> PN190225-P1 <150> KR 10-2019-0166426 <151> 2019-12-13 <160> 14 <170> KoPatentIn 3.0 <210> 1 <211> 24 <212> RNA <213> Artificial Sequence <220> <223> IL2Rg sgRNA-1 <400> 1 uuguccagcu ccaggacccc caga 24 <210> 2 <211> 24 <212> RNA <213> Artificial Sequence <220> <223> IL2Rg sgRNA-2 <400> 2 gcuucuguac agcucgccuc uggg 24 <210> 3 <211> 24 <212> RNA <213> Artificial Sequence <220> <223> IL2Rg sgRNA-3 <400> 3 aauugucugc uuuuccaucu cagc 24 <210> 4 <211> 24 <212> RNA <213> Artificial Sequence <220> <223> IL2Rg sgRNA-4 <400> 4 ggguucggag ccgcuauaac ccaa 24 <210> 5 <211> 19 <212> RNA <213> Artificial Sequence <220> <223> IL2Rg sgRNA-5 <400> 5 uaauuucuac uuuguagau 19 <210> 6 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> IL2Rg sgRNA-1 target sequence (Exon3) <400> 6 tctgggggtc ctggagctgg acaa 24 <210> 7 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> IL2Rg sgRNA-2 target sequence (Exon3) <400> 7 cccagaggcg agctgtacag aagc 24 <210> 8 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> IL2Rg sgRNA-3 target sequence (Exon4) <400> 8 gctgagatgg aaaagcagac atat 24 <210> 9 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> IL2Rg sgRNA-4 target sequence (Exon5) <400> 9 ttgggttata gcggctccga accc 24 <210> 10 <211> 23 <212> RNA <213> Artificial Sequence <220> <223> IL2Rg sgRNA-5 target sequence (Exon8) <400> 10 ugccacguca gcgagauucc ccc 23 <210> 11 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> IL2Rg, FP <400> 11 tgcctagtgt ggatgagctg 20 <210> 12 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> IL2Rg, RP <400> 12 caggctggct ccatttactc 20 <210> 13 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> GAPDH, FP <400> 13 gaacatcatc cctgcatgg 19 <210> 14 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> GAPDH, RP <400> 14 cacatgggg gtaggaacac 20

Claims (11)

a nucleotide sequence encoding a gRNA that hybridizes to a DNA encoding an interleukin 2 receptor gamma (IL2Rg) gene;
a nucleotide sequence encoding a EeCpf1 ( Eubacterium eligens Cpf1) protein; and
a promoter operably linked to the nucleotide sequence
A recombinant expression vector comprising a.
The recombinant expression vector according to claim 1, wherein the gRNA consists of any one nucleotide sequence of SEQ ID NO: 1, SEQ ID NO: 2, and SEQ ID NO: 5.
A transformed cell line for preparing an immunocompromised animal model into which the recombinant expression vector of claim 1 is introduced.
Transplanting the transformed cell line of claim 3 into the fallopian tube of a surrogate mother, an animal other than a human
A method for producing an animal model of immunodeficiency comprising
The method according to claim 4, wherein the animal is a mouse.
[Claim 5] The method of claim 4, wherein the immunodeficiency is caused by knock-out of the IL2Rg gene.
According to claim 6, wherein the knockout is IL2Rg gene exon 3 SEQ ID NO: 5 or SEQ ID NO: 6, and the nucleotide sequence corresponding to any one of SEQ ID NO: 9 of exon 8 is generated by mutation of an animal model of immunodeficiency Way.
An animal model of IL2Rg (interleukin 2 receptor gamma) gene mutation immune dysfunction prepared by the method of claim 4 .
[Claim 9] The animal model of claim 8, wherein the IL2Rg gene is knocked out.
The IL2Rg gene mutant immunocompromised animal according to claim 8, wherein the knockout is generated by mutation of a nucleotide sequence corresponding to any one of SEQ ID NO: 5 or SEQ ID NO: 6 and SEQ ID NO: 9 of exon 8 of exon 3 of the IL2Rg gene. Model.
The animal model of claim 8, wherein the animal is a mouse with IL2Rg gene mutant immunodeficiency.

Images