KR102493904B1 - Immunodeficient Animal Model Mutated IL2Rg Gene by EeCpf1 and Method for Producing the same - Google Patents

Abstract

The present invention relates to an immunodeficiency animal model in which the IL2Rg gene is mutated by EeCpf1 and a method for preparing the same, and since it is possible to manufacture an immunodeficiency animal model by IL2Rg gene knockout with high efficiency, immune-related diseases such as, It is possible to manufacture animal models that can be effectively used for research on diseases such as cancer.

Description

Immunodeficient Animal Model Mutated IL2Rg Gene by EeCpf1 and Method for Producing the Same}

The present invention relates to an immunodeficiency animal model in which the IL2Rg gene is mutated by EeCpf1 and a method for preparing the same.

Rodent animal models are useful tools for studying gene function, disease mechanisms, and novel therapeutics in vivo. However, species differences between rodents and humans limit the interpretation of these studies. Non-human primates can be used as the best alternative model for human diseases, but their use is limited due to very high cost and ethical concerns. Recently, humanized mice are being developed to replace primates.

Interleukin 2 (IL2), known as a T cell growth factor, is known to play a wide range of functional roles in the growth and activity of B cells, NK cells and macrophages. The action of IL-2 is mediated through the IL2 receptor (IL2R) having α, β, and γ chains. The γ chain is expressed in almost all cell populations, among which the IL-2 receptor γ (IL2Rg) chain is known as the most important component of the general cytokine receptor γ chain and the receptors for IL2, IL4, IL7, IL9 and IL15. Patients without IL2 have normal numbers of T cells. However, patients without IL2Rg lack T cells because the γ chain is shared between multiple cytokine receptors. Thus, as mutations in IL2Rg in mice can lead to impairment of T, B and NK cell development and function, immunodeficient mice with the NOD/Scid genetic background are suitable for carcinogenesis, cancer treatment, imaging of tumor growth and tumor metastasis. This is particularly important for analysis.

Cpf1 is an RNA-guided endonuclease and can be programmed to cleave target DNA. Cpf1 is classified as type 5 and, like Cas9, belongs to a class 2 system composed of one effector protein. Cpf1 has a target recognition mechanism similar to the Cas9 system, but differs in some characteristics. The Cas9-RNA complex contains two RNA molecules, but Cpf1 is induced by one crRNA (~41 nt). The PAM site of Cas9 is located 3' of the target DNA, whereas the PAM site of Cpf1 is located 5' of the target DNA. Cas9 typically recognizes guanine-rich PAMs such as NGG, whereas Cpf1 recognizes thymidine-rich PAMs such as TTTN. In the truncated form, Cas9 creates a blunt end at a position adjacent to PAM, while Cpf1 has a staggered cut of about 5 base pairs (bp) about 17 nt away toward the downstream of PAM ) to create Cpf1 is expected to be more useful than Cas9 as a gene editing tool because it contains a short crRNA, generates a staggered cleavage pattern, and has a low off-target rate.

In order to find Cpf1 orthologs capable of gene editing, various Cpf1 proteins were searched through the PSI-Blast program and 52 nonredundant CRISPR-Cpf1 loci were identified. Of these, 7 Cpf1 E. coli, Francisella novicida U112 (FnCpf1), Acidaminococcus sp. BV36L (AsCpf1), Lachnospiraceae bacteria ND2006 (LbCpf1) Thiomicrospira sp. XS5 (TsCpf1), Moraxella bovoculi AAX08_00205 (Mb2Cpf1), Moraxella bovoculi AAX11_00205 (Mb3Cpf1) and Butyrivibrio sp. NC3005 (BsCpf1) was confirmed to have DNA cleavage function in vivo, among which FnCpf1, AsCpf1 and LbCpf1 Cpf1 variants were studied most intensively and used as gene editing tools. However, EeCpf1 of Eubacterium eligens has sequence homology confirmed, but in vivo DNA cleavage activity has never been reported.

Accordingly, the present inventors completed the present invention by conducting research to develop an effective immunodeficiency animal model using EeCpf1.

Republic of Korea Publication No. 10-2017-0068400

One object of the present invention is a nucleotide sequence encoding a gRNA that hybridizes to DNA encoding an IL2Rg (interleukin 2 receptor gamma) gene; A nucleotide sequence encoding EeCpf1 ( Eubacterium eligens Cpf1) protein; and a promoter operably linked to the nucleotide sequence.

Another object of the present invention is to provide a transformed cell line for preparing an immunodeficiency animal model into which the recombinant expression vector is introduced.

Another object of the present invention is to provide a method for preparing an immunodeficiency animal model comprising the step of transplanting the transformed cell line into the fallopian tube of a surrogate mother, which is an animal other than human.

Another object of the present invention is to provide an IL2Rg (interleukin 2 receptor gamma) gene mutant immunodeficiency animal model prepared by the above production method.

One aspect of the present invention is a nucleotide sequence encoding a gRNA that hybridizes to DNA encoding an interleukin 2 receptor gamma (IL2Rg) gene; A nucleotide sequence encoding EeCpf1 ( Eubacterium eligens Cpf1) protein; and a promoter operably linked to the nucleotide sequence.

In the present specification, there is provided a method of mutating the IL2Rg gene in a mouse fertilized egg using IL2Rg-specific genetic scissors using the CRISPR/Cpf1 system, and thereby producing a transgenic animal exhibiting an immunodeficiency phenotype.

As used herein, the term "expression" refers to the process by which a polynucleotide is transcribed from a DNA template (e.g., to mRNA or other RNA transcripts) and/or the subsequent translation of the transcribed mRNA into a peptide, polypeptide or protein. refers to the process If the polynucleotide is derived from genomic DNA, expression may include splicing of mRNA in eukaryotic cells.

As used herein, the term "cleavage" means breakage of the covalent backbone of a nucleotide molecule.

As used herein, the term "Cpf1 protein" is an essential protein element in the CRISPR/Cpf1 system, and can act as an active endonuclease or nickase by forming a complex with CRISPR RNA (crRNA). The Cpf1 protein of the present invention is derived from the genus Eubacterium eligens , and in the present invention, the in vivo DNA cleavage activity of Cpf1 obtained from E.eligens was confirmed for the first time.

As used herein, the term "guide RNA (gRNA)" is an RNA specific to a target DNA, and the guide RNA can form a complex with the Cpf1 protein and bring the Cpf1 protein to the target DNA.

In the present invention, the guide RNA used with the Cpf1 protein does not require tracrRNA, unlike the guide RNA used with the Cas protein. That is, since the Cpf1 protein operates as a single crRNA, there is no need to use crRNA and trans-activating crRNA (tracrRNA) at the same time or artificially create a single guide RNA (sgRNA) combining tracrRNA and crRNA, as in the case of Cas9.

When cells are transformed using the recombinant expression vector of the present invention, a guide RNA fragment can be delivered into the cell, and the delivered guide RNA fragment can recognize the IL2Rg gene. Therefore, when cells are transformed using the recombinant expression vector, the guide RNA can be delivered into the cells and a structure that can be recognized by the EeCpf1 protein can be formed.

Interleukin 2 (IL2), known as a T cell growth factor, is known to play a wide range of functional roles in the growth and activity of B cells, NK cells and macrophages. Therefore, when IL2Rg mutation is induced in mice, T, B, and NK cell development and loss of function can be induced. Thus, immunodeficient animal models in which IL2Rg is mutated are suitable for carcinogenesis, cancer treatment, tumor growth, and the like. It can be usefully used for experiments related to tumor metastasis.

According to one embodiment of the present invention, the gRNA may consist of any one of SEQ ID NO: 1, SEQ ID NO: 2, and SEQ ID NO: 5.

By using a gRNA consisting of any one of SEQ ID NO: 1, SEQ ID NO: 2, and SEQ ID NO: 5, knockout of DNA encoding IL2Rg can be efficiently induced.

As used herein, the term "recombinant expression vector" refers to a recombinant DNA molecule containing a desired coding sequence and an appropriate nucleic acid sequence essential for expressing the operably linked coding sequence in a specific host organism. Promoters, enhancers, termination signals and polyadenylation signals available in eukaryotic cells are known.

As used herein, the term "operably linked" means a functional linkage between a gene expression control sequence and another nucleotide sequence. The gene expression control sequence may be one or more selected from the group consisting of a replication origin, a promoter, and a transcription termination sequence. The transcription termination sequence may be a polyadenylation sequence (pA), and the origin of replication may be the f1 origin of replication, the SV40 origin of replication, the pMB1 origin of replication, the adeno origin of replication, the AAV origin of replication, or the BBV origin of replication, but is not limited thereto. .

As used herein, the term "promoter" refers to a region of DNA upstream from a structural gene, and refers to a DNA molecule to which RNA polymerase binds to initiate transcription.

A promoter according to one embodiment of the present invention is one of the transcription control sequences that control the initiation of transcription of a specific gene, and may be a polynucleotide fragment with a length of about 100 bp to about 2500 bp. A promoter can be used without limitation as long as it can regulate transcription initiation in cells, for example, eukaryotic cells (eg, plant cells, or animal cells (eg, mammalian cells such as humans and mice), etc.). For example, the promoter may include a CMV promoter (cytomegalovirus promoter (eg, human or mouse CMV immediate-early promoter), U6 promoter, EF1-alpha (elongation factor 1-a) promoter, EF1-alpha short (EFS) promoter, SV40 promoter, adenovirus promoter (major late promoter), pL λ promoter, trp promoter, lac promoter, tac promoter, T7 promoter, vaccinia virus 7.5K promoter, tk promoter of HSV, SV40E1 promoter, respiratory syncytial virus virus; RSV) promoter, metallothionein promoter, β-actin promoter, ubiquitin C promoter, human interleukin-2 (IL-2) gene promoter, human lymphotoxin gene promoter and human GM -CSF (human granulocyte-macrophage colony stimulating factor) may be selected from the group consisting of gene promoters, but is not limited thereto.

The recombinant expression vector according to one embodiment of the present invention may be selected from the group consisting of plasmid vectors, cosmid vectors and bacteriophage vectors, adenovirus vectors, retrovirus vectors and adeno-associated virus vectors. Vectors that can be used as recombinant expression vectors include plasmids used in the art (eg, pcDNA series, pSC101, pGV1106, pACYC177, ColE1, pKT230, pME290, pBR322, pUC8/9, pUC6, pBD9, pHC79, pIJ61, pLAFR1 , pHV14, pGEX series, pET series, pUC19, etc.), phage (eg, λgt4λB, λ-Charon, λΔz1, M13, etc.) or viral vectors (eg, adeno-associated virus (AAV) vectors, etc.) It may be manufactured based on, but is not limited thereto.

The recombinant expression vector of the present invention may further include one or more selectable markers. The marker is a nucleic acid sequence having characteristics that can be selected by conventional chemical methods, and includes all genes capable of distinguishing transfected cells from non-transfected cells. For example, herbicide resistance genes such as glyphosate, glufosinate ammonium or phosphinothricin, ampicillin, kanamycin, G418, bleomycin , hygromycin (hygromycin), may be an antibiotic resistance gene such as chloramphenicol (chloramphenicol), but is not limited thereto.

The recombinant expression vector of the present invention can be prepared using genetic recombination techniques well known in the art, and site-specific DNA cutting and linking can be performed using enzymes generally known in the art. there is.

Another aspect of the present invention provides a transformed cell line for constructing an immunodeficiency animal model into which the recombinant expression vector is introduced.

As used herein, the term "immunodeficiency" refers to a state in which an effective immune response ability is lacking, and specifically, may be caused by loss of development and function of T, B, and NK cells.

In order to prepare a transformed cell line into which the recombinant expression vector according to one embodiment of the present invention is introduced, a method known in the art for introducing nucleic acid molecules into organisms, cells, tissues or organs can be used, and known in the art. As described above, it can be performed by selecting suitable standard techniques according to the host cell. These methods include, for example, electroporation, calcium phosphate (CaPO4) precipitation, calcium chloride (CaCl2) precipitation, microinjection, polyethylene glycol (PEG) method, DEAE-dextran method, cationic liposome method. , And lithium acetate-DMSO method, etc. may be included, but is not limited thereto.

The type of cell to be used as the transformed cell line may be an animal cell or a cell derived from an animal cell, preferably a fertilized single-cell stage embryo derived from a mammal, most preferably a mouse.

Another aspect of the present invention provides a method for preparing an immunodeficiency animal model comprising transplanting the transformed cell line into the oviduct of a surrogate mother, which is an animal other than human.

According to one embodiment of the present invention, the animal may be a mouse.

Mice have already been used for research on the pathological mechanisms and treatment of various diseases, and have been recognized for their value as economic animals for a long time, avoiding ethical problems compared to using other animals as disease models, and having a stable breeding system. Since it is built, it has the advantage of easy maintenance and management when developing an experimental animal model.

According to one embodiment of the present invention, the immunodeficiency may be caused by knock-out of the IL2Rg gene.

As used herein, the term "knockout" refers to modifying or removing a specific gene from a base sequence so that it cannot be expressed.

Substitution, deletion, or insertion of some of the bases constituting the IL2Rg gene, preferably deletion of some of the bases constituting the IL2Rg gene, most preferably exon 3 or 8 of the IL2Rg gene. By knocking out IL2Rg by base mutation, it is possible to prepare an immunodeficiency animal model.

According to one embodiment of the present invention, the knockout may be generated by mutation of a nucleotide sequence corresponding to any one of SEQ ID NO: 6 or SEQ ID NO: 7 of exon 3 of the IL2Rg gene and SEQ ID NO: 10 of exon 8.

Another aspect of the present invention provides an IL2Rg (interleukin 2 receptor gamma) gene mutant immunodeficiency animal model prepared by the above production method.

As used herein, the term "animal model" refers to an animal having a disease very similar to a human disease. In the study of human disease, disease model animals have meaning due to physiological or genetic similarities between humans and animals. In disease research, biomedical disease model animals can provide materials for research on various causes, pathogenesis, and diagnosis of diseases. It is possible to understand, and basic data can be obtained to determine the possibility of commercialization through the actual efficacy and toxicity test of the developed new drug candidate.

In the immunodeficiency animal model of the present invention, parts overlapping with the above may be used with the same meaning as the above.

As used in the present invention, the term "mutation" refers to a state in which genetic information is changed due to a change in the nucleotide sequence constituting a gene and genetic characteristics are changed, and these mutations include point mutations, deletion mutations, insertion mutations, missense mutations and nonsense mutations. may be included. In the present invention, an immunodeficiency animal model in which the expression of the IL2Rg gene is reduced or deleted according to the mutation of the IL2Rg gene by the CRISPR/Cpf1 system is provided.

According to one embodiment of the present invention, the animal model may be one in which the IL2Rg gene is knocked out.

According to one embodiment of the present invention, the knockout may be generated by mutation of a nucleotide sequence corresponding to any one of SEQ ID NO: 6 or SEQ ID NO: 7 of exon 3 of the IL2Rg gene and SEQ ID NO: 10 of exon 8.

According to one embodiment of the present invention, the animal may be a mouse.

According to the immunodeficiency animal model in which the IL2Rg gene is mutated by EeCpf1 and the manufacturing method thereof, it is possible to manufacture an immunodeficiency animal model by knockout of the IL2Rg gene with high efficiency, so that immune-related diseases, such as cancer It is possible to manufacture animal models that can be effectively used for research on

1 shows the results of identifying the Type V-CRISPR locus in the genome of E.eligen. White arrows indicate ORFs in the E. eligens genome and blue arrows indicate the Type V cpf1 gene.
Figure 2 is the result of predicting the secondary structure of crRNA of EeCpr1.
3 is a result of multiple sequence alignment of EeCpf1 and other Cpf1 proteins of the present invention. Red highlights indicate that the catalytic residues are respectively conserved.
4 is a schematic diagram of EeCpf1-crRNA bound to pUC19. Red letters in pUC19 are PAM motifs in EeCpf1.
Figure 5 shows the target DNA cleavage activity of EeCpf1.
6 shows the metal-dependent DNase activity of EeCpf1.
Figure 7 compares the DNase activity of EeCpf1 wild-type and D880A mutant EedCpf1.
8 is a diagram confirming the in vitro nuclease activity of EeCpf1 for the IL2Rg gene. Arrows indicate cleavage sites.
9 is a diagram showing the results of analyzing target genes cleaved by EeCpf1 by Sanger sequencing.
10 is a photograph of IL2Rg PCR showing the result of verifying the efficiency of EeCpf1 in mouse blastocysts.
11 is a sequencing analysis using PCR products showing the results of verifying the efficiency of EeCpf1 in mouse blastocysts.
12 is a T7E1 analysis result showing the result of verifying the efficiency of EeCpf1 in a mouse fetus. Arrows indicate cleavage sites.
13 is a sequencing analysis using PCR products showing the results of verifying the efficiency of EeCpf1 in mouse embryos.
14 is a diagram showing the results of genetic analysis of prepared G0 mice (#1, #3, #20 and #24).
15 is a diagram showing the results of genetic analysis of the prepared G2 mouse.
16 is a graph showing the results of confirming the expression level of IL2Rg mRNA in the thymus of NOD/SCID mice and eNIG mice.
17 and 18 are graphs showing the results of confirming body weight and organ weight of NOD/SCID mice and prepared eNIG mice.
19 is a graph showing the levels of AST, ALT, total cholesterol (CHO), triglyceride (TG), ALP, and creatinine in serum of NOD/SCID mice and prepared eNIG mice.
20 to 22 are drawings showing the results of tumor size and weight changes in NOD/SCID mice and eNIG mice transplanted with tumor cells (HepG2, A549).
23 and 24 are graphs showing the results of flow cytometry analysis of B cells, T cells, and NK cells of C57BL/6 mice, NOD/SCID mice, and eNIG mice.

Hereinafter, one or more specific examples will be described in more detail through examples. However, these examples are intended to illustrate one or more specific examples, and the scope of the present invention is not limited to these examples.

Example 1. In vitro ( in vitro ) confirmed the cleavage activity of EeCpf1

1-1. Cloning, expression, and purification of EeCpf1 and mutant Cpf1 (EedCpf1)

<1-1-1> Expression and purification of wild-type Cpf1

A gene encoding Cpf1 (WP_012739647.1) was amplified from genomic DNA of Eubacterium eligens (ATCC 27750) by PCR. The amplified Cpf1 gene was ligated into a modified pET-22b(+) plasmid, and the produced protein had a 6xHis-tag and a CPD tag at the C terminus. E. coli strain BL21-Codon Plus (DE3)-RIL (Agilent Technologies) was transformed with the recombinant pET22b_EeCpf1-CPD plasmid.

Escherichia coli transformed to produce EeCpf1-CPD ( E.coli ) was cultured in LB medium containing ampicillin until OD600 was 0.6, and IPTG 1mM was added, followed by 16 hours at a temperature of 18 ° C. During incubation, EeCpf1-CPD protein expression was induced.

Cells were collected by centrifugation (6000 g, 30 min), resuspended in 300 ml of lysis buffer (30 mM Tris-HCl pH7.5, 150 mM NaCl, 5 mM beta-mercaptoethanol, 10% glycerol) and stored on ice. It was disrupted by sonication in a water bath (VC-600 sonicator; Sonics & Materials).

The supernatant was purified by centrifugation (10000 g, 30 min, 4 ° C), and HisTrap HP equipped with an AKTA FPLC system (GE Healthcare), Heparin 22HP, and Superdex 200 pg columns (GE Healthcare) and elution buffer (elution buffer, 30 mM Tris -HCl, pH7.5, 150 mM NaCl, 5 mM beta-mercaptoethanol, 10% glycerol) was used to purify the EeCpf1-CPD protein. The 6xHis-tag and the CPD tag at the C-terminus of the EeCpf1-CPD protein were cleaved by treatment with 200 μM phytic acid.

<1-1-2> D880A mutant EedCpf1 expression and purification

An EedCpf1 mutant containing the D880A substitution (pET22b-EedCpf1-CPD) was generated with a site-directed mutagenesis kit (Enzynomics) and expressed in the same manner as in Example 1-1-1. purified.

1-2. Preparation of crRNA by in vitro transcription

The target sequence of EeCpf1 and EedCpf1 consists of about 24 nucleotides, followed by a PAM sequence consisting of TTTN.

For in vitro transcription, template DNA was amplified by overlap PCR. The amplified template DNA was purified with a commercial gel extraction kit (Bioneer). In vitro transcription was performed with the purified DNA template using the MEGAshortscript T7 transcription kit (Invitrogen) according to the manufacturer's instructions. The synthesized crRNA was purified by ethanol precipitation.

1-3. In vitro nuclease activity assay method

<1-3-1> Analysis of nuclease activity targeting pUC19 plasmid

The pUC19 plasmid was targeted and assayed for nuclease activity in vitro ( in vitro nuclease activity assays). Purified EeCpf1 or EedCpf1 (160 nM) and crRNA (7.6 μM) were incubated at 37° C. for 5 minutes in reaction buffer (30 mM Tris-HCl pH7.5, 100 mM NaCl) supplemented with 5 mM MnCl ₂ . The reaction was initiated by adding pUC19 plasmid (200 ng) and incubated at 37°C for 20 minutes. Finally, the reaction was stopped by adding proteinase K (Enzynomics), incubated at 37° C. for 20 minutes, and all samples were analyzed on a 1% agarose gel.

<1-3-2> Analysis of nuclease activity targeting IL2Rg

For in vitro activity assays on IL2Rg sequences, regions containing four target sequences on the IL2Rg gene were amplified by PCR. The amplification product was purified using a gel extraction kit and used as a substrate for IL2Rg sequence targeting assay. Nuclease activity was analyzed in the same manner as in Example 1-3-1, except that the amplified IL2Rg substrate was used instead of the plasmid.

1-4. Confirmation of nuclease activity of EeCpf1

In order to confirm the nuclease activity of EeCpf1, Example 1-1 was performed to express and purify the EeCpf1 protein from E. coli, and then the crRNA transcribed in vitro according to Example 1-2 was used as Cpf1 ribonucleoprotein ( Ribonucleoproteins, RNPs) were reconstituted. Based on the analysis of T-rich PAM at the 5' end of the protospacer sequence in EeCpf1, a double-stranded plasmid (pUC19) with 5'-TTTN PAM was used as a DNA substrate and After synthesizing crRNA, Examples 1-3 were performed to assay nuclease activity in vitro.

As a result, it was confirmed that EeCpf1 generates linear DNA by cleaving the target DNA of the pUC19 plasmid in a crRNA-dependent manner. On the other hand, when there is no crRNA, EeCpf1 is Nt. A band was generated by migrating in a pattern corresponding to the pUC19 plasmid nicked on one strand by BspQI. That is, it was confirmed that EeCpf1 exhibits dsDNA single-strand nick activity in the absence of crRNA.

On the other hand, as a result of confirming the metal ion dependence for DNA cleavage activity of EeCpf1, it was found to be dependent on Mn ²⁺ , Mg ²⁺ , Ni ²⁺ and Ca ²⁺ , while Cu ²⁺ and Zn ²⁺ were less related to activity. Confirmed. In addition, as a result of generating active site mutations of the RuvC domain, including D880A substitution, and analyzing the effect on DNA cleavage activity, both single-strand nick activity and double-strand DNA cleavage activity were lost due to the EeCpf1 (D880A) mutation. confirmed to be

Through these results, it was confirmed that EeCpf1 exhibits crRNA-mediated DNA cleavage activity (nuclease activity).

Example 2. In vivo ( in vivo ) confirmed the cleavage activity of EeCpf1

2-1. Cytoplasm microinjection

Female C57BL6 mice (4 to 5 weeks old) were superovulated by intraperitoneal injection of 5 IU of pregnant mare serum gonadotropin (PMSG, Seoil livestock medicine), and 46 hours later, 5 IU of human Human chorionic gonadotropin (hCG) was injected. 14 hours after administration of hCG, mice were sacrificed and oviducts were collected. The oocyte cumulus complex was separated from the fallopian tube, and the embryo was transferred to a microinjection dish containing M2 medium (Sigma) under mineral oil.

A CRISPR/Cpf1 reagent mixture was prepared by diluting 0.6 μM Cpf1 protein and 6.1 μM IL2Rg crRNA concentrate with distilled water, and then microinjected into the cytoplasm of embryos. Embryos injected with the reagent mixture were cultured in M16 medium (Sigma) under mineral oil until the blastocyst stage.

2-2. Genome sequencing

For PCR amplification, embryos were lysed in blastocyst lysis buffer (100 mM Tris-HCl (pH8.3), 100 mM KCl, 0.02% gelatin, 0.45% Tween 20, 10 mg/μl yeast tRNA, and 20 mg/ml proteinase K). dissolved in 10 μL.

The lysed sample was incubated at 56°C for 10 minutes and 95°C for 10 minutes, then stored at -4°C, and the IL2Rg gene was amplified by PCR using 4 µl of the crude sample. Changes in the genome sequence of the blastocyst were confirmed by Sanger sequencing analysis (Bioneer, Korea) of the PCR amplification product of the IL2Rg gene.

2-3. Confirmation of Mammalian Gene Editing in Mouse Cells by EeCpf1

It was confirmed whether the EeCpf1 protein could cleave endogenous genomic loci in mammalian cells. Human codon-optimized EeCpf1 protein was expressed and purified from E. coli . To enable nuclear compartmentalization of EeCpf1 in mammalian cells, nuclear localization signals (NLS) were attached to each of the N- and C-termini.

The target gene was interleukin 2 receptor gamma (IL2Rg). The IL2Rg gene encodes an essential enzyme for lymphocyte development and is an essential gene for preparing an immunodeficient mouse model. EeCpf1 can be used as a gene-editing tool in vivo by injecting multitargeting crRNA and EeCpf1 for the IL2Rg gene into mouse embryos and examining whether IL2Rg knockout mice are generated. It was checked whether there is

In order to avoid off-target mutagenesis, four sites with low sequence homology to other sequences within the IL2Rg gene (two sites in exon 3, one site in exon 4, and one site in exon 5) were selected. selected and designed four corresponding crRNAs (hereinafter referred to as crRNA1, crRNA2, crRNA3, and crRNA4). To increase the gene editing efficiency of EeCpf1, each crRNA was designed to have a U-rich sequence (U-rich tail, U4AU6) at the 3' end of the RNA.

As a result, it was confirmed that all four target sites of the IL2Rg gene amplified by PCR were specifically cleaved by the preassembled EeCpf1 RNP (FIG. 8).

In order to confirm whether nuclease activity is exhibited in vivo, the recombinant EeCpf1 protein and 4 crRNA mixtures were microinjected into one-cell-stage embryos according to Example 2-1 and the mouse embryos were cultured. to obtain a blastocyst. Then, as a result of T7EI analysis and Sanger sequencing of the blastocysts according to Example 2-2, it was confirmed that 5 (15%) of 34 blastocysts had an EeCpf1-mediated mutation in the IL2Rg gene. In exon 3, the corresponding 20bp sequence between the targets of crRNA1 and crRNA2 was confirmed to be deleted with an efficiency of 6% (FIG. 9). In exon 4, no mutation was caused by crRNA3, but in exon 5, one nucleotide deletion was caused by crRNA4 with 10% efficiency. In addition, according to the DNA sequence chart, it was confirmed that IL2Rg gene was mutated by EeCpf1 by causing two types of insertion and deletion mutations in the remaining three target sites except for exon 4. Through these results, it was confirmed that EeCpf1 can be used for powerful multiplex genome editing in mammalian cells.

Example 3. Construction of IL2Rg Gene Knockout Mice Using EeCpf1

3-1. Design of Cpf1 guide RNA

As shown in Table 1, Cpf1 guide RNAs (guide RNA, gRNA, crRNA) were designed in exons 3 to 5 of the IL2Rg gene.

name gRNA nucleotide sequence (5'→3') sequence number IL2Rg sgRNA-1 UUGUCCAGCUCCAGGACCCCCAGA SEQ ID NO: 1 IL2Rg sgRNA-2 GCUUCUGUACAGCUCGCCUCUGGG SEQ ID NO: 2 IL2Rg sgRNA-3 AUAUGUCUGCUUUUCCAUCUCAGC SEQ ID NO: 3 IL2Rg sgRNA-4 GGGUUCGGAGCCGCUAUAACCCAA SEQ ID NO: 4

3-2. Off-target analysis of gRNAs

According to a recent study ( analysis of off-target effects of CRISPR/Cas-derived RNA-guided endonucleases and nickases, Genome Res. 2014 Jan; 24(1): 132-141 ), mismatches of 2 or more nucleotides with other sequences ( gRNAs that mismatch) have been reported not to represent off-targets. Therefore, the off-targets of the sgRNAs in Table 1 were analyzed in IL2Rg using the NCBI blast system.

As a result, as shown in Table 2, it was confirmed that each gRNA did not represent an off-target.

sgRNAs gRNA target sequence exon Strand off target Base sequence (5'→3') sequence number 0 One 2 3 One TCTGGGGGTCCTGGAGCTGGACAA SEQ ID NO: 6 3 + 0 0 0 One 2 CCCAGAGGCGAGCTGTACAGAAGC SEQ ID NO: 7 3 - 0 0 0 0 3 GCTGAGATGGAAAAGCAGACATAT SEQ ID NO: 8 4 - 0 0 0 0 4 TTGGGTTATAGCGGCTCCGAACCC SEQ ID NO: 9 5 + 0 0 0 0

3-3. Verification of EeCpf1 efficiency in blastocysts

The EeCpf1 protein of Example 1-1-1 and the four guide RNAs of Table 1 were microinjected into 50 fertilized eggs by the method of Example 2-1, and a total of 38 developed blastocysts were obtained to obtain Example 2 Genotypes were analyzed according to the method of -2.

As a result, it was confirmed that gRNA 1 and gRNA 2 in exon 3 showed an efficiency of 10% or more (FIGS. 10 and 11), and gRNA 1 and gRNA 2 were used to produce IL2Rg gene-deficient mice. .

3-4. Verification of EeCpf1 efficiency in mouse embryos

A total of 125 mouse fertilized eggs were microinjected with the EeCpf1 protein of Example 1-1-1 and the guide RNA whose efficiency was verified in Example 3-3 by the method of Example 2-1, and the developed cells were transferred to four surrogate mothers. Nine offspring were obtained by transplantation (Table 3). Then, the IL2Rg genotype was analyzed by performing T7E1 assay (T7endonuclease1, ToolGen, Daejeon, Korea) and sequencing (Bioneer, Daejeon, Korea).

Date system number of fertilized eggs number of fetuses collection microinjection survival surrogate mother birth child 5.29 B6/J 157 125 76 (71%) 4 G0 # 1 to 9
(2019.06.18)

As a result, cutting of the band was confirmed in mouse No. 9 (FIG. 12).

In addition, as a result of sequencing analysis using the PCR product according to Example 2-2, a deletion of the IL2Rg gene was found in mouse No. 9 (FIG. 13), which was confirmed to be consistent with the result, confirmed in Example 3-3 EeCpf1　 efficiency (13%) and similar efficiency was also confirmed in G0　 mice (11%). On the other hand, since the mutant mouse was born and analyzed, it was confirmed that there is no problem with the safety of EeCpf1.

Example 4. Confirmation of Immunodeficiency in IL2Rg Gene Knockout Mice Using EeCpf1

4-1. IL2Rg crRNA synthesis

Guide RNAs (guide RNA, gRNA, crRNA) targeting exon 8 of the IL2Rg gene were designed in a manner similar to Example 1-2 above (Table 4).

4-2. Cytoplasm microinjection

Female NOD/SCID mice (4 to 5 weeks old) were superovulated by intraperitoneal injection of 5 IU of pregnant mare serum gonadotropin (PMSG, Seoil livestock medicine), and 46 hours later, 5 IU of human chorionic gonadotropin (hCG) was injected. 14 hours after administration of hCG, mice were sacrificed and oviducts were collected. The oocyte cumulus complex was isolated from the fallopian tube and placed in pre-equilibrated fertilization drops composed of HTF culture medium. Sacred sperm were isolated from the epidermis and vas deferens of male NOD/SCID mice (5 months old) and transferred to HTF medium. In HTF medium, the sperm was fertilized by transferring the egg ovule complex, and incubated for 8 hours (37°C, 5% CO ₂ ). After incubation, the oocytes were washed with HTF to remove excess sperm and cultured in M16 medium for 7 hours (37°C, 5% CO ₂ ). And microinjection was performed in M2 medium under mineral oil.

The eeCpf1 reagent mixture was prepared by mixing and diluting with distilled water to match the concentration of 0.3 μM eeCpf1 protein (Scientific Reports (2019) 9:13911) and 80 ng/μl IL2Rg guide RNA. The prepared reagent was microinjected into the cytoplasm of embryos, and the surviving embryos were surgically transplanted into the fallopian tubes of females of childbearing age. And among the mice born, mice with confirmed genetic mutations (G0 mice: #1, #3, #20, and #24) were obtained (see Table 5).

4-3. IL2Rg gene analysis

The genotype of the offspring was analyzed using a PCR fragment amplifying IL2Rg exon 8 by applying the T7E1 assay (T7 endonuclease1, ToolGen, Seoul, Korea) (primers used: FR 5'- TACCATCAGGATGTGGCTGA -3', RP 5' -ATTGGATCCAGATTGCCAAG-3').

As a result, it was confirmed that the prepared mice (G0 mice: #1, #3, #20 and #24) were hetero. In addition, in the case of the wild type gene, only one band was identified at 502 bp, whereas three bands of 200 bp, 300 bp and 502 bp were identified in the heterozygous gene. As a result of confirming the mutation of the IL2Rg gene, 12bp, 14bp, and 18bp deletion and 7bp insertion were confirmed in the mice at the target crRNA site (FIG. 14).

4-4. Confirmation of germline transmission of IL2Rg gene deletion

The mice prepared in 4-2. (G0 mice: #1, #3, #20 and #24) were crossed with NOD/SCID mice, respectively, and only the G0 #3 mice gave birth to G1 mice. Then, G1 mice were crossed again to obtain G2 mice.

As a result of analyzing the gene of the G2 mouse by PCR, it was confirmed that it had a homo mutation (FIG. 15).

The homo mutant G2 mice were classified as eNIG (or e-NSIG), and RNA analysis was performed to confirm IL2Rg inactivation.

Total RNA was secreted from mouse tail tissue using TRIzol (Molecular Research Center, Cincinnati, OH, USA), and cDNA was synthesized from total RNA samples using first-strand cDNA synthesis kit (Fermentas, Burlington, Ontario, Canada). did Real-time qRT-PCR analysis was performed according to the Exicycler™ 96 Real-Time Quantitative Thermal Block (Bioneer, Daejeon, Korea) and SYBR Premix Ex Taq (Takara, Otsu, Japan) protocols. Primer sequences used were as follows: IL2Rg, FP 5'-TGCCTAGTGTGGATGAGCTG-3', RP 5'-CAGGCTGGCTCCATTTACTC-3'; GAPDH, FP 5′-AGAACATCATCCCTGCATGG-3′, RP 5′-CACATTGGGGGTAGGAACAC-3′

As a result, in the case of eNIG mice, IL2Rg mRNA was not confirmed in the thymus tissue (FIG. 16), and through this, it was confirmed that the characteristics of IL2Rg, which were deleted in NOD/SCID mice, were transmitted to reproduction.

Thereafter, the 14 bp deletion in the IL2Rg gene of eNIG mice was maintained by mating mutant male mice with mutant female mice.

4-5. Characterization of eNIG mice

The body weight and organ weight of the prepared eNIG mice were measured and compared with NOD/SCID mice.

As a result, compared to NOD/SCID mice, the weight of the thymus and spleen of eNIG mice was significantly reduced (FIGS. 17 and 18). It is believed that the weight loss occurred due to T, B, and NK cell defects.

For serum analysis in the peripheral blood of prepared eNIG mice, the mice were fasted for 4 hours after feeding and anesthetized using isourane. Serum was centrifuged for 10 minutes at 1500 g in a cooled centrifuge, and the supernatant was collected and stored at -70 ° C before use. Serum AST, ALT, total cholesterol (CHO), triglyceride (TG), ALP, and creatinine levels were analyzed using an auto analyzer (AU480 Chemistry System, Beckman Coulter, USA).

As a result, no significant difference between NOD/SCID mice and eNIG mice was confirmed (FIG. 19).

Example 5 Confirmation of the possibility of use as an immunodeficiency animal model

5-1. cancer cell transplant

The tumorigenic potential of the eNIG mouse of the present invention was confirmed using human hepatocarcinoma cell line (HepG2) and adenocarcinomic human alveolar basal epithelial cells (A549) cells. Specifically, 1x10 ⁶ cells suspended in 100 μl of matrigel were subcutaneously injected into 12-week-old NOD/SCID and eNIG male mice (n=4 each), and confirmed 6 days after transplantation. The size (mm ³ ) of the solid tumor formed at this time was derived using a caliper and the L Х W2 Х ð/6 formula, where L represents the length and W represents the width of the tumor.

As a result, it was confirmed that the tumor was formed in the eNIG mouse, and no significant difference between the NOD/SCID mouse and the eNIG mouse was confirmed in the size and weight of the tumor except 27 days after transplantation (FIGS. 20 to 22). (Data are expressed as mean±SD; *p<0.05).

5-2. Isolation of splenocytes

To isolate splenocytes, the harvested spleen was placed in a cell strainer and placed in a 4-well plate. Filtered medium (7 ml) was added and the spleen was ground. The pulverized cells were centrifuged at 1200 rpm for 5 minutes, and the supernatant was removed. Red blood cells were removed by adding RBC lysis buffer (1ml) to the pellet and placed at room temperature for 10 minutes. The suspended cells were mixed with FACS buffer (7ml), centrifuged at 1200 rpm for 5 minutes, and the supernatant was removed. This procedure was repeated a total of 2 times and the final pellet was resuspended in 1ml FACS buffer.

5-3. Identification of T, B and NK cells

To measure T, B and NK cell numbers, splenocytes were stained with APC-conjugated anti-CD45, APC-cy7-conjugated anti-CD3, PerCP-Cy5.5-conjugated anti-NK1.1 and fluorescein isothiocyanate (FITC)-- It was stained with conjugated anti-B220 at 4°C for 20 minutes. Then, the stained cells were washed by adding FACS buffer and centrifuging at 1200 rpm for 5 minutes. The cells were resuspended in Fix buffer and analyzed by flow cytometry using a Gallios flow cytometer (Beckman Coulter, USA).

As a result, compared to C57BL/6 mice, it was confirmed that NOD/SCID mice had T and B cell defects, but NK cells were at a reduced level. Defects in T, B and NK cells were confirmed in the eNIG mice of the present invention (FIGS. 23 and 24).

Through the above results, it was confirmed that the eNIG mouse of the present invention is an immunodeficiency animal model in which NK cells are more deficient than the conventional NOD/SCID mouse, and tumors can grow when transplanted with tumor cells.

So far, the present invention has been examined focusing on the embodiments. Those skilled in the art to which the present invention pertains will be able to understand that the present invention can be implemented in a modified form without departing from the essential characteristics of the present invention. Therefore, the disclosed embodiments should be considered from an illustrative rather than a limiting point of view. The scope of the present invention is shown in the claims rather than the foregoing description, and all differences within the equivalent range should be construed as being included in the present invention.

<110> KOREA RESEARCH INSTITUTE OF BIOSCIENCE AND BIOTECHNOLOGY <120> Immunodeficient Animal Model Mutated IL2Rg Gene by EeCpf1 and Method for producing the same <130> PN190225-P1 <150> KR 10-2019-0166426 <151> 2019-12-13 <160> 14 <170> KoPatentIn 3.0 <210> 1 <211> 24 <212> RNA <213> artificial sequence <220> <223> IL2Rg sgRNA-1 <400> 1 uuguccagcu ccaggacccc caga 24 <210> 2 <211> 24 <212> RNA <213> artificial sequence <220> <223> IL2Rg sgRNA-2 <400> 2 gcuucuguac agcucgccuc uggg 24 <210> 3 <211> 24 <212> RNA <213> artificial sequence <220> <223> IL2Rg sgRNA-3 <400> 3 auaugucugc uuuuccaucu cagc 24 <210> 4 <211> 24 <212> RNA <213> artificial sequence <220> <223> IL2Rg sgRNA-4 <400> 4 ggguucggag ccgcuauaac ccaa 24 <210> 5 <211> 19 <212> RNA <213> artificial sequence <220> <223> IL2Rg sgRNA-5 <400> 5 uaauuucuac uuuguagau 19 <210> 6 <211> 24 <212> DNA <213> artificial sequence <220> <223> IL2Rg sgRNA-1 target sequence (Exon3) <400> 6 tctgggggtc ctggagctgg acaa 24 <210> 7 <211> 24 <212> DNA <213> artificial sequence <220> <223> IL2Rg sgRNA-2 target sequence (Exon3) <400> 7 cccagaggcg agctgtacag aagc 24 <210> 8 <211> 24 <212> DNA <213> artificial sequence <220> <223> IL2Rg sgRNA-3 target sequence (Exon4) <400> 8 gctgagatgg aaaagcagac atat 24 <210> 9 <211> 24 <212> DNA <213> artificial sequence <220> <223> IL2Rg sgRNA-4 target sequence (Exon5) <400> 9 ttggttata gcggctccga accc 24 <210> 10 <211> 23 <212> RNA <213> artificial sequence <220> <223> IL2Rg sgRNA-5 target sequence (Exon8) <400> 10 ugccacguca gcgagauucc ccc 23 <210> 11 <211> 20 <212> DNA <213> artificial sequence <220> <223> IL2Rg, FP <400> 11 tgcctagtgt ggatgagctg 20 <210> 12 <211> 20 <212> DNA <213> artificial sequence <220> <223> IL2Rg, RP <400> 12 caggctggct ccatttactc 20 <210> 13 <211> 19 <212> DNA <213> artificial sequence <220> <223> GAPDH, FP <400> 13 gaacacatc cctgcatgg 19 <210> 14 <211> 20 <212> DNA <213> artificial sequence <220> <223> GAPDH, RP <400> 14 cacattgggg gtaggaacac 20

Claims (11)

a nucleotide sequence encoding a gRNA that hybridizes to DNA encoding an interleukin 2 receptor gamma (IL2Rg) gene;
A nucleotide sequence encoding EeCpf1 ( Eubacterium eligens Cpf1) protein; and
A promoter operably linked to said nucleotide sequence
As a recombinant expression vector containing,
The gRNA is composed of the nucleotide sequence of SEQ ID NO: 1 or SEQ ID NO: 2,
The recombinant expression vector is for preparing an immunodeficiency animal model by knock-out of the IL2Rg gene, and the knock-out is caused by mutation of the nucleotide sequence corresponding to SEQ ID NO: 6 or SEQ ID NO: 7 of exon 3 of the IL2Rg gene That is, a recombinant expression vector.
delete A transformed cell line for preparing an immunodeficiency animal model into which the recombinant expression vector of claim 1 is introduced.
Transplanting the transformed cell line of claim 3 into the fallopian tube of a surrogate mother other than human
Method for producing an immunodeficiency animal model comprising a.
The method of claim 4, wherein the animal is a mouse.
delete delete An IL2Rg (interleukin 2 receptor gamma) gene mutant immunodeficiency animal model prepared by the method of claim 4.
delete delete The IL2Rg gene mutation immunodeficiency animal model according to claim 8, wherein the animal is a mouse.

Images