WO2020208082A1 - Method for treating cmv related diseases - Google Patents

Abstract

The present invention relates to the treatment of CMV related diseases. In a rat model of CMV infection of the developing brain in utero, the inventors recently detected prominent infection of brain immune cells and early neuroimmune defects at the cellular and molecular levels. Severe postnatal phenotypes reminiscent of the human disease (e.g. epileptic seizures, altered sensorimotor development) the inventors observed in the first postnatal weeks. At the molecular level, they now have investigated the pathophysiological role of the chemokine rl29, encoded by the rat CMV genome (used as a proof of concept) and that showed very early RNA expression in RCMV-infected fetal brains. Co-infection experiments of the developing brain in utero with wild-type (wt) RCMV and with its mutant RCMV counterpart encoding a dominant- negative r129 isoform dramatically rescued the severe postnatal phenotypes caused by wt RCMV alone. Furthermore, sequential infection with the two viruses, starting with in utero injection at E14 of RCMV encoding the dominant-negative r129 isoform, then followed 24h apart by in utero injection at E15 of the wt RCMV, also led to dramatic rescue of the postnatal phenotypes. Importantly, injection of only the RCMV encoding the dominant-negative r129 isoform did not lead to any of the postnatal phenotypes observed with the wt RCMV. Thus, the use of an inhibitor of EIL128 (e.g. the use of a dominant-negative, inhibitory isoform of EIL128), the human CMV (hCMV) analogue of r129, will have the same benefit on CMV related diseases. Thus, the present invention relates to an ETL128 inhibitor for use in the treatment and prevention of CMV related diseases in a subject in need thereof.

Description

METHOD FOR TREATING CMV RELATED DISEASES

FIELD OF THE INVENTION:

The present invention relates to an UL128 inhibitor for use in the treatment of CMV related diseases in a subject in need thereof.

BACKGROUND OF THE INVENTION:

Developmental brain disorders may be acquired through exposure to various environmental factors, including infectious agents such as rubella virus, zika virus, or cytomegalovirus (CMV) - a member of the Herpesviridae family. Generally congenital infections cause morbidity and mortality throughout the world and are of considerable public health impact.

Congenital CMV infections are one leading cause of human neurodevelopmental disorders (1% of all live births worldwide, 0.5% in Western Europe). 15-20% of infected neonates are bom with, or will develop, severe neurological and other defects (e.g. growth retardation, microcephaly, hearing loss, cerebral palsy, epileptic seizures, intellectual disability) (1). In the remaining 80-85% an influence on various brain disorders (e.g. autism, schizophrenia, epilepsy) was postulated, and a possible role for Herpesviridae in Alzheimer's disease was recently highlighted (2).

Despite the incidence and the worldwide medical and socioeconomical burden of congenital CMV, the pathophysiological mechanisms underlying the emergence of neurodevelopmental disorders have long remained elusive (3), and no effective preventive or curative therapies are available. Whereas the pathophysiology of congenital CMV disease is inherently complicated and involves different stages, insights into the early events following CMV infection of the developing brain are particularly needed, before strategies for early interventions can be designed and tested.

CMVs are species-specific; thus, relevant animal models are critical to the understanding of the mechanisms involved in CMV congenital brain disease (4,5). Convergent insights into the alteration of innate and adaptive immune responses have emerged from such models (6-11). Cytokines production by glial cells, the recruitment of peripheral immune cells, and the altered status of microglia (the brain resident immune cells of the brain), are all likely to influence neuropathogenesis. The targeting of the early alterations occurring in the developing brain after CMV infection would help in demonstrating their pathophysiological involvement in the future emergence of postnatal phenotypes, and in improving these phenotypes, hence providing avenues for therapeutic interventions. As a matter of fact, the inventors recently reported on a rat model of CMV infection of the developing brain displaying prominent infection of immune cells (microglia and infiltrating lymphocytes and monocyte-derived macrophages) as well as early altered activity of non-infected microglia (10). In this model, the postnatal neurological manifestations (epileptic seizures, hindlimb paralysis, altered sensorimotor development) and other severe outcomes (decreased weight gain and survival) were prevented by in utero, drug- based strategies targeting fetal microglia (12).

Host and viral chemokines might well have participated to the recruitment of microglia and to the early infiltration by monocytes-derived macrophages and by lymphocytes as detected in their rat CMV (RCMV)-infected brains (10). Indeed, CMV interferes with the host chemokine/receptor system by dysregulating the expression of cellular chemokines, and by encoding endogenous viral CMV chemokines. Cytokines induced during critical stages of fetal development may alter central nervous system function and behavior later in life.

Based on the number and spacing of conserved N-terminal cysteines, chemokines can be classified into one of four different categories (namely C, CC, CXC, or CX3C). CMV chemokines have two major roles: they favor viral dissemination and latency, and they combat against the host immune response. They may not only target diverse immune cell populations but may also act as direct actors of viral cell entry. Hence viral chemokines may provide novel therapeutic targets to inhibit CMV directly at the levels of infection and dissemination, as well as indirectly at the level of antiviral immune response. In addition, viral chemokines could be used directly to combat against inflammatory responses in the contexts of autoimmunity and allotransplantation.

SUMMARY OF THE INVENTION:

In a rat model of CMV infection of the developing brain in utero, the inventors recently detected prominent infection of brain immune cells and early neuroimmune defects at the cellular (alteration of microglia, infiltration by peripheral cells) and molecular (overexpression of chemokines) levels (10). Severe postnatal phenotypes reminiscent of the human disease (e.g. epileptic seizures, altered sensorimotor development) were observed in the first postnatal weeks. At the cellular level, fetal microglia might play pivotal role in the pathophysiology (2). At the molecular level, they now have investigated the pathophysiological role of the chemokine rl29, encoded by RCMV genome (used as a proof of concept) and that showed very early RNA expression in RCMV-infected fetal brains. Co-infection experiments of the developing brain in utero with wild-type (wt) RCMV and with its mutant RCMV counterpart encoding a dominant-negative rl29 isoform dramatically rescued the severe postnatal phenotypes caused by wt RCMV alone. Furthermore, sequential infection with the two viruses, starting with in utero injection at E14 of RCMV encoding the dominant-negative rl29 isoform, then followed 24h apart by in utero injection at E15 of the wt RCMV, also led to dramatic rescue of the postnatal phenotypes. Importantly, injection of only the RCMV encoding the dominant-negative rl29 isoform did not lead to any of the postnatal phenotypes observed with the wt RCMV. Thus, the use of an inhibitor of UL128 (e.g. the use of a dominant-negative, inhibitory isoform of UL128), the human CMV (hCMV) analogue of rl29, will have the same benefit on CMV related diseases.

Thus, the present invention relates to an UL128 inhibitor for use in the treatment and prevention of CMV related diseases in a subject in need thereof. Particularly, the invention is defined by its claims.

DETAILED DESCRIPTION OF THE INVENTION:

A first aspect of the invention relates to an UL128 inhibitor for use in the treatment of CMV related diseases in a subject in need thereof.

In particular, CMV related diseases which could be treated include but are not limited to neurodevelopmental disorders associated with CMV infections or congenital CMV infections, such as microcephaly, retinitis, polymicrogyria, hearing loss, cerebral palsy, epileptic seizures, intellectual disability.

Thus according to the invention, the invention relates to an UL128 inhibitor for use in the treatment of neurodevelopmental disorders associated with CMV infections or congenital CMV infections, such as microcephaly, polymicrogyria, hearing loss, cerebral palsy, epileptic seizures, intellectual disability.

In another embodiment, the UL128 inhibitor according to the invention may be useful to treat a baby infected during the pregnancy of his mother or to prevent the transmission of the virus (particularly the hCMV) to the baby during the pregnancy or to prevent or treat CMV related diseases in a baby during the pregnancy. In this case, the mother will be treated by the UL128 inhibitors according to the invention. In another particular embodiment, the invention relates to an UL128 inhibitor according to the invention for use in the treatment of human CMV infection in a subject in need thereof.

As used herein, the term“subject” denotes a mammal, such as a rodent, a feline, a canine, and a primate. Particularly, the subject according to the invention is a human.

As used herein, the term "treatment" or "treat" refer to both prophylactic or preventive treatment as well as curative or disease modifying treatment, including treatment of subjects at risk of contracting the disease or suspected to have contracted the disease as well as subjects who are ill or have been diagnosed as suffering from a disease or medical condition, and includes suppression of clinical relapse. The treatment may be administered to a subject having a medical disorder or who ultimately may acquire the disorder, in order to prevent, cure, delay the onset of, reduce the severity of, or ameliorate one or more symptoms of a disorder or recurring disorder, or in order to prolong the survival of a subject beyond that expected in the absence of such treatment. By "therapeutic regimen" is meant the pattern of treatment of an illness, e.g., the pattern of dosing used during therapy. A therapeutic regimen may include an induction regimen and a maintenance regimen. The phrase "induction regimen" or "induction period" refers to a therapeutic regimen (or the portion of a therapeutic regimen) that is used for the initial treatment of a disease. The general goal of an induction regimen is to provide a high level of drug to a subject during the initial period of a treatment regimen. An induction regimen may employ (in part or in whole) a "loading regimen", which may include administering a greater dose of the drug than a physician would employ during a maintenance regimen, administering a drug more frequently than a physician would administer the drug during a maintenance regimen, or both. The phrase "maintenance regimen" or "maintenance period" refers to a therapeutic regimen (or the portion of a therapeutic regimen) that is used for the maintenance of a subject during treatment of an illness, e.g., to keep the subject in remission for long periods of time (months or years). A maintenance regimen may employ continuous therapy (e.g., administering a drug at a regular intervals, e.g., weekly, monthly, yearly, etc.) or intermittent therapy (e.g., interrupted treatment, intermittent treatment, treatment at relapse, or treatment upon achievement of a particular predetermined criteria [e.g., disease manifestation, etc.]).

As used herein, the term“UL128” denotes a CC chemokine most highly homologous to human CCL2, with 23.2% amino-acid identity. Very little is known regarding the corresponding receptor(s). UL128 could serve at least two functions; it displays a chemotactic activity and it is at the same time part of the cell entry complex that decorates the hCMV envelope (UL128 forms a pentamer complex along with gH/gL/UL130/UL131A) and is required for full infectivity of non-fibroblastic cells (15). Its protein access number in NCBI is P16837.

Amino acid sequence of UL128 (SEQ ID NO: 1):

MSPKDLTPFL TTLWLLLGHS RVPRVRAEEC CEFINVNHPP ERCYDFKMCN RFTVALRCPD GEVCYSPEKT AEIRGIVTTM THSLTRQVVH NKLTSCNYNP LYLEADGRIR CGKVNDKAQY LLGAAGSVPY RWINLEYDKI TRIVGLDQYL E S VKKHKRLD V CR AKMGYML Q

Nucleic acids coding sequence of UL128 (SEQ ID NO: 2):

ATGAGTCCCAAAGACCTGACGCCGTTCTTGACGACGTTGTGGCTGCTATTG GGTCACAGCCGCGTGCCGCGGGTGCGCGCAGAAGAATGTTGCGAATTCATAAAC GTCAACCACCCGCCGGAACGCTGTTACGATTTCAAAATGTGCAATCGCTTCACCG TCGCGCTGCGGTGTCCGGACGGCGAAGTCTGCTACAGTCCCGAGAAAACGGCTG AGATTCGCGGGATCGTCACCACCATGACCCATTCATTGACACGCCAGGTCGTACA CAACAAACTGACGAGCTGCAACTACAATCCGTTATACCTCGAAGCTGACGGGCG AATACGCTGCGGCAAAGTGAACGACAAGGCGCAGTACCTGCTGGGCGCCGCTGG CAGCGTTCCCTATCGATGGATCAACCTGGAATACGACAAGATAACCCGGATCGTG GGCCTGGATCAGTACCTGGAGAGCGTTAAAAAACACAAACGGCTGGATGTGTGC CGCGCT AAAAT GGGCT AT AT GCTGC AGT GA

As used herein the term“rl29” denotes a CC chemokine that binds to rat chemokine receptors CCR3, CCR4, CCR5 and CCR7 (13); it is encoded by the rat CMV genome and is considered the functional homolog of human CMV chemokine UL128 (13-15). Its protein access number in UniProt is P16837 (https://www.uniprot.org/uniprot/P16837).

Amino acid sequence of rl29 (SEQ ID NO: 3):

MTYGVTFPTP KTTFPFLLLL CHSFTSVARF CCNTYSSGPP ERFIDWEVCG SVIEYVLDDG SQYCLHSSDL RTDIQNLTRH VSRETLMDKI QLSCRESLLY VDVQGEIQCV EDRCSEGKLI REGPKLKLN C TSTGQILYLI DTDPPYFNWM VDEDF GKTFD FNQYVGYTLK TRRPYTYSKI ECDF QMMPMR APSPYCYLDK KLHPDLPMAW VDLTDPFFRK Q

Nucleic acids coding sequence of rl29 (SEQ ID NO: 4)

ATGACGTACGGTGTGACGTTCCCGACGCCTAAGACTACGTTTCCGTTCTTA

CTTCTCCTATGCCATTCGTTCACATCCGTCGCCAGGTTTTGCTGTAATACCTATTC

GTCGGGTCCCCCGGAACGTTTCATAGACTGGGAGGTGTGCGGATCCGTGATTGAA

TACGTTCTCGATGACGGTAGTCAATATTGTCTGCATTCTTCGGACCTCAGAACGG ACATACAGAATCTGACCAGACATGTATCCAGAGAAACTTTGATGGACAAGATCC

AACT ATCCTGC AGAGAGTCCCTGCTCT ATGT GGAT GTT C AAGGGGAAATT C AGT G

TGTGGAAGATAGGTGTTCAGAAGGGAAACTTATCAGAGAAGGTCCCCAACTGAA

ATTGAATTGTACTTCGACGGGACAGATTCTCTATTTGATAGACACGGACCCCCCTT

ATTTTAATTGGATGGTCGATGAGGATTTTGGCAAGACTTTTGACTTCAATCAATAT

GTGGGCTACACACTAAAAACAAGAAGACCCTATACTTATTCAAAAATTGAATGCG

ACTTTCAAATGATGCCTATGAGAGCACCATCTCCCTATTGCTATCTAGACAAAAA

GTTGCACCCGGATTTGCCGATGGCCTGGGTTGACTTAACTGATCCTTTCTTTCGGA

AACAATAA

Thus, the invention also relates to an rl29 inhibitor for use in the treatment of CMV related diseases in a subject in need thereof.

The term“UL128 inhibitor” denotes molecules or compound which can inhibit the activity of the UL128 cytokine (e.g. inhibit the capacity of the cytokine to attract lymphocytes and macrophages, or inhibit its ability to favor viral entry into host cells) or a molecule or compound which destabilizes the cytokine.

The term“UL128 inhibitor” also denotes inhibitors of the expression of the gene coding for the protein.

According to the invention, the UL128 inhibitor can also be a recombinant UL128.

Indeed, interestingly, the inventors showed, as a proof of concept, that mutations in, or deletion of, part of the CC domain of rl29 produces mutant proteins that lose their chemokine properties (13). In particular, the inventors showed that one mutant with a N-Term deletion of the CC domain (DNT-G129) had a dominant-negative effect in vitro (13) and in vivo (see the results) meaning that this mutant protein is able to antagonize and compete with the wild-type rl29. As such, DNT-G129 prevents wild-type rl29-induced attraction of lymphocytes and macrophages in vitro and the emergence of postnatal phenotypes caused by CMV infection of the fetal brain. Thus, mutations or deletion of the CC domain or of a part of the CC domain of UL128 will have the same effect.

Thus, in a particular embodiment the invention relates to a recombinant UL 128 for use in the treatment of CMV related diseases in a subject in need thereof.

As used herein, the term“recombinant UL128” denotes all variant of UL128 with deletion, mutations or addition of amino acids which will have a dominant negative effect against the wild type UL128 protein. As used herein, the term“UL128 dominant negative effect” denotes a variant of the UL128 protein which will inhibit the function of the UL128 protein (e.g. the capacity of the cytokine UL128 to attract lymphocytes and macrophages, or its ability to favor viral entry into host cell).

Thus, the invention also relates to a recombinant UL128 having a mutation, a substitution or a deletion in its CC domain for use in the treatment of CMV related diseases in a subject in need thereof.

According to the invention, for UL128, the CC domains comprise the two cysteine amino acids C30 and C31 of the SEQ ID NO: 1.

Thus, the invention also relates to a recombinant UL128 having a mutation, a substitution or a deletion in at least one cysteine C30 or C31 of the SEQ ID NO: 1.

According to the invention, the recombinant UL128 is the DNT-UL l 28 which comprises or consists of the amino acids sequence SEQ ID NO: 5. The ANT-UL128 corresponds to the UL128 without 10 amino acids arounds the CC domains.

Amino acid sequence of ANT-UL128 (SEQ ID NO: 5):

MSPKDLTPFL TTLWLLLGHS RVPRVRAHPP ERCYDFKMCN RFTVALRCPD GEVCYSPEKT AEIRGIVTTM THSLTRQVVH NKLTSCNYNP LYLEADGRIR

CGKVNDKAQY LLGAAGSVPY RWINLEYDKI TRIVGLDQYL ESVKKHKRLD

V CRAKMGYML Q

Amino acids sequence of DNT-G129 (SEQ ID NO: 6):

MTYGVTFPTP KTTFPFLLLL CHSFTSVAPP ERFIDWEVCG SVIEYVLDDG SQYCLHSSDL RTDIQNLTRH VSRETLMDKI QLSCRESLLY VDVQGEIQCV

EDRCSEGKLI REGPKLKLN C TSTGQILYLI DTDPPYFNWM VDEDF GKTFD FNQYVGYTLK TRRPYTYSKI ECDF QMMPMR APSPYCYLDK KLHPDLPMAW

VDLTDPFFRK Q

In a particular embodiment, the recombinant UL 128 comprises or consist of the amino acids sequence SEQ ID NO: 7, 8, 9, 10, 11, 12, 13 or 14.

SEQ ID NO: 7: MSPKDLTPFL TTLWLLLGHS RVPRVRAEEC EFINVNHPP ERCYDFKMCN RFTVALRCPD GEVCYSPEKT AEIRGIVTTM THSLTRQVVH NKLTSCNYNP LYLEADGRIR CGKVNDKAQY LLGAAGSVPY RWINLEYDKI TRIVGLDQYL ESVKKHKRLD V CRAKMGYML Q

SEQ ID NO: 8: MSPKDLTPFL TTLWLLLGHS RVPRVRAEE EFINVNHPP ERCYDFKMCN RFTVALRCPD GEVCYSPEKT AEIRGIVTTM THSLTRQVVH NKLTSCNYNP LYLEADGRIR CGKVNDKAQY LLGAAGSVPY RWINLEYDKI

TRIVGLDQYL ESVKKHKRLD V CRAKMGYML Q

SEQ ID NO: 9: MSPKDLTPFL TTLWLLLGHS RVPRVRAE EFINVNHPP ERCYDFKMCN RFTVALRCPD GEVCYSPEKT AEIRGIVTTM THSLTRQVVH

NKLTSCNYNP LYLEADGRIR CGKVNDKAQY LLGAAGSVPY RWINLEYDKI

TRIVGLDQYL ESVKKHKRLD V CRAKMGYML Q

SEQ ID NO: 10: MSPKDLTPFL TTLWLLLGHS RVPRVRA EFINVNHPP ERCYDFKMCN RFTVALRCPD GEVCYSPEKT AEIRGIVTTM THSLTRQVVH

NKLTSCNYNP LYLEADGRIR CGKVNDKAQY LLGAAGSVPY RWINLEYDKI

TRIVGLDQYL ESVKKHKRLD V CRAKMGYML Q

SEQ ID NO: 11: MSPKDLTPFL TTLWLLLGHS RVPRVRAEE INVNHPP ERCYDFKMCN RFTVALRCPD GEVCYSPEKT AEIRGIVTTM THSLTRQVVH

NKLTSCNYNP LYLEADGRIR CGKVNDKAQY LLGAAGSVPY RWINLEYDKI

TRIVGLDQYL ESVKKHKRLD V CRAKMGYML Q

SEQ ID NO: 12: MSPKDLTPFL TTLWLLLGHS RVPRVRAEE NVNHPP ERCYDFKMCN RFTVALRCPD GEVCYSPEKT AEIRGIVTTM THSLTRQVVH

NKLTSCNYNP LYLEADGRIR CGKVNDKAQY LLGAAGSVPY RWINLEYDKI

TRIVGLDQYL ESVKKHKRLD V CRAKMGYML Q

SEQ ID NO: 13: MSPKDLTPFL TTLWLLLGHS RVPRVRAEE VNHPP ERCYDFKMCN RFTVALRCPD GEVCYSPEKT AEIRGIVTTM THSLTRQVVH

NKLTSCNYNP LYLEADGRIR CGKVNDKAQY LLGAAGSVPY RWINLEYDKI

TRIVGLDQYL ESVKKHKRLD V CRAKMGYML Q

SEQ ID NO: 14: MSPKDLTPFL TTLWLLLGHS RVPRVRAEE NHPP ERCYDFKMCN RFTVALRCPD GEVCYSPEKT AEIRGIVTTM THSLTRQVVH

NKLTSCNYNP LYLEADGRIR CGKVNDKAQY LLGAAGSVPY RWINLEYDKI

TRIVGLDQYL ESVKKHKRLD V CRAKMGYML Q

In a particular embodiment, the recombinant UL128 comprises or consists of the amino acids sequence SEQ ID NO: 1 with at least one mutation at the cysteine amino acids C30 and C31.

Thus, in a particular embodiment the invention relates to a recombinant UL128 as described above for use in the treatment of CMV related diseases in a subject in need thereof.

In another particular embodiment, the invention relates to a CMV comprising a recombinant UL128 for use in the treatment of CMV related diseases in a subject in need thereof. In this case, the CMV will express a recombinant UL128 which will exert a dominant negative /inhibitor effect on the wild type UL128 expressed by the wild type CMV. Particularly, the CMV is a human CMV.

The invention also relates to the recombinant UL128 (SEQ ID NO: 5 to 14) or to a recombinant UL128 which comprises or consists of the amino acids sequence SEQ ID NO: 1 with at least one mutation at the cysteine amino acids C30 and C31 as such.

In order to test the functionality of a putative or already validated inhibitor of UL128, a test is necessary. For that purpose, human cells infected with clinical strains of hCMV and thus synthesizing wild-type UL128 will be treated or not by the inhibitor. Attraction of lymphocytes and macrophages will be monitored and quantified according to published methods (13). Also, non-fibroblastic human epithelial or endothelial cells will be infected with hCMV in the presence or absence of the inhibitor of UL128, and viral titers will be monitored at various time points after infection (13).

In one embodiment, the inhibitors according to the invention may be a low molecular weight compound, e. g. a small organic molecule (natural or not).

The term "small organic molecule" refers to a molecule (natural or not) of a size comparable to those organic molecules generally used in pharmaceuticals. The term excludes biological macromolecules (e. g., proteins, nucleic acids, etc.). Preferred small organic molecules range in size up to about 10000 Da, more preferably up to 5000 Da, more preferably up to 2000 Da and most preferably up to about 1000 Da.

In one embodiment, the inhibitor according to the invention (inhibitor of UL128) is an antibody. Antibodies directed against UL128 can be raised according to known methods by administering the appropriate antigen or epitope to a host animal selected, e.g., from pigs, cows, horses, rabbits, goats, sheep, and mice, among others. Various adjuvants known in the art can be used to enhance antibody production. Although antibodies useful in practicing the invention can be polyclonal, monoclonal antibodies are preferred. Monoclonal antibodies against UL128 can be prepared and isolated using any technique that provides for the production of antibody molecules by continuous cell lines in culture. Techniques for production and isolation include but are not limited to the hybridoma technique originally described by Kohler and Milstein (1975); the human B-cell hybridoma technique (Cote et ah, 1983); and the EBV-hybridoma technique (Cole et al. 1985). Alternatively, techniques described for the production of single chain antibodies (see e.g., U.S. Pat. No. 4,946,778) can be adapted to produce anti- UL128 single chain antibodies. Compounds useful in practicing the present invention also include anti- UL128 antibody fragments including but not limited to F(ab')2 fragments, which can be generated by pepsin digestion of an intact antibody molecule, and Fab fragments, which can be generated by reducing the disulfide bridges of the F(ab')2 fragments. Alternatively, Fab and/or scFv expression libraries can be constructed to allow rapid identification of fragments having the desired specificity to UL128.

Humanized anti-UL128 antibodies and antibody fragments therefrom can also be prepared according to known techniques. "Humanized antibodies" are forms of non-human (e.g., rodent) chimeric antibodies that contain minimal sequence derived from non-human immunoglobulin. For the most part, humanized antibodies are human immunoglobulins (recipient antibody) in which residues from a hypervariable region (CDRs) of the recipient are replaced by residues from a hypervariable region of a non-human species (donor antibody) such as mouse, rat, rabbit or nonhuman primate having the desired specificity, affinity and capacity. In some instances, framework region (FR) residues of the human immunoglobulin are replaced by corresponding non-human residues. Furthermore, humanized antibodies may comprise residues that are not found in the recipient antibody or in the donor antibody. These modifications are made to further refine antibody performance. In general, the humanized antibody will comprise substantially all of at least one, and typically two, variable domains, in which all or substantially all of the hypervariable loops correspond to those of a non-human immunoglobulin and all or substantially all of the FRs are those of a human immunoglobulin sequence. The humanized antibody optionally also will comprise at least a portion of an immunoglobulin constant region (Fc), typically that of a human immunoglobulin. Methods for making humanized antibodies are described, for example, by Winter (U.S. Pat. No. 5,225,539) and Boss (Celltech, U.S. Pat. No. 4,816,397).

Then, for this invention, neutralizing antibodies of UL128 are selected.

In another embodiment, the antibody according to the invention is a single domain antibody against UL128. The term“single domain antibody” (sdAb) or "VHH" refers to the single heavy chain variable domain of antibodies of the type that can be found in Camelid mammals which are naturally devoid of light chains. Such VHH are also called“nanobody®”. According to the invention, sdAb can particularly be llama sdAb. The term“VHH” refers to the single heavy chain having 3 complementarity determining regions (CDRs): CDR1, CDR2 and CDR3. The term “complementarity determining region” or “CDR” refers to the hypervariable amino acid sequences which define the binding affinity and specificity of the VHH. The VHH according to the invention can readily be prepared by an ordinarily skilled artisan using routine experimentation. The VHH variants and modified form thereof may be produced under any known technique in the art such as in-vitro maturation.

VHHs or sdAbs are usually generated by PCR cloning of the V-domain repertoire from blood, lymph node, or spleen cDNA obtained from immunized animals into a phage display vector, such as pHEN2. Antigen-specific VHHs are commonly selected by panning phage libraries on immobilized antigen, e.g., antigen coated onto the plastic surface of a test tube, biotinylated antigens immobilized on streptavidin beads, or membrane proteins expressed on the surface of cells. However, such VHHs often show lower affinities for their antigen than VHHs derived from animals that have received several immunizations. The high affinity of VHHs from immune libraries is attributed to the natural selection of variant VHHs during clonal expansion of B-cells in the lymphoid organs of immunized animals. The affinity of VHHs from non-immune libraries can often be improved by mimicking this strategy in vitro, i.e., by site directed mutagenesis of the CDR regions and further rounds of panning on immobilized antigen under conditions of increased stringency (higher temperature, high or low salt concentration, high or low pH, and low antigen concentrations). VHHs derived from camelid are readily expressed in and purified from the E. coli periplasm at much higher levels than the corresponding domains of conventional antibodies. VHHs generally display high solubility and stability and can also be readily produced in yeast, plant, and mammalian cells. For example, the“Hamers patents” describe methods and techniques for generating VHH against any desired target (see for example US 5,800,988; US 5,874, 541 and US 6,015,695). The“Hamers patents” more particularly describe production of VHHs in bacterial hosts such as E. coli (see for example US 6,765,087) and in lower eukaryotic hosts such as moulds (for example Aspergillus or Trichoderma) or in yeast (for example Saccharomyces, Kluyveromyces, Hansenula or Pichia) (see for example US 6,838,254).

In one embodiment, the compound according to the invention is an aptamer. Aptamers are a class of molecule that represents an alternative to antibodies in term of molecular recognition. Aptamers are oligonucleotide or oligopeptide sequences with the capacity to recognize virtually any class of target molecules with high affinity and specificity. Such ligands may be isolated through Systematic Evolution of Ligands by Exponential enrichment (SELEX) of a random sequence library, as described in Tuerk C. and Gold L., 1990. The random sequence library is obtainable by combinatorial chemical synthesis of DNA. In this library, each member is a linear oligomer, eventually chemically modified, of a unique sequence. Possible modifications, uses and advantages of this class of molecules have been reviewed in Jayasena S.D., 1999. Peptide aptamers consists of a conformationally constrained antibody variable region displayed by a platform protein, such as E. coli Thioredoxin A that are selected from combinatorial libraries by two hybrid methods (Colas et al., 1996).

Then, for this invention, neutralizing aptamers of UL128 are selected.

In one embodiment, the recombinant UL128 of the invention may be linked to a cell- penetrating peptide” to allow the penetration of the recombinant UL128 in the cell.

The term“cell-penetrating peptides” are well known in the art and refers to cell permeable sequence or membranous penetrating sequence such as penetratin and compounds (Bechara and Sagan, 2013; Jones and Sayers, 2012; Khafagy el and Morishita, 2012; Malhi and Murthy, 2012).

The recombinant UL128 of the invention may be produced by any suitable means, as will be apparent to those of skill in the art. In order to produce sufficient amounts of recombinant UL128 or functional equivalents thereof for use in accordance with the present invention, expression may conveniently be achieved by culturing under appropriate conditions recombinant host cells containing the recombinant UL128 of the invention. Preferably, the recombinant UL128 is produced by recombinant means, by expression from an encoding nucleic acid molecule. Systems for cloning and expression of a recombinant UL128 in a variety of different host cells are well known.

When expressed in recombinant form, the recombinant UL128 is preferably generated by expression from an encoding nucleic acid in a host cell. Any host cell may be used, depending upon the individual requirements of a particular system. Suitable host cells include bacteria mammalian cells, plant cells, yeast and baculovirus systems. Mammalian cell lines available in the art for expression of a heterologous recombinant UL128 include Chinese hamster ovary cells. HeLa cells, baby hamster kidney cells and many others. Bacteria are also preferred hosts for the production of recombinant protein, due to the ease with which bacteria may be manipulated and grown. A common, preferred bacterial host is E coli.

In specific embodiments, it is contemplated that recombinant UL128 used in the therapeutic methods of the present invention may be modified in order to improve their therapeutic efficacy. Such modification of therapeutic compounds may be used to decrease toxicity, increase circulatory time, or modify biodistribution. For example, the toxicity of potentially important therapeutic compounds can be decreased significantly by combination with a variety of drug carrier vehicles that modify biodistribution. In example adding dipeptides can improve the penetration of a circulating agent in the eye through the blood retinal barrier by using endogenous transporters.

A strategy for improving drug viability is the utilization of water-soluble polymers. Various water-soluble polymers have been shown to modify biodistribution, improve the mode of cellular uptake, change the permeability through physiological barriers; and modify the rate of clearance from the body. To achieve either a targeting or sustained-release effect, water- soluble polymers have been synthesized that contain drug moieties as terminal groups, as part of the backbone, or as pendent groups on the polymer chain.

Polyethylene glycol (PEG) has been widely used as a drug carrier, given its high degree of biocompatibility and ease of modification. Attachment to various drugs, proteins, and liposomes has been shown to improve residence time and decrease toxicity. PEG can be coupled to active agents through the hydroxyl groups at the ends of the chain and via other chemical methods; however, PEG itself is limited to at most two active agents per molecule. In a different approach, copolymers of PEG and amino acids were explored as novel biomaterials which would retain the biocompatibility properties of PEG, but which would have the added advantage of numerous attachment points per molecule (providing greater drug loading), and which could be synthetically designed to suit a variety of applications.

Those of skill in the art are aware of PEGylation techniques for the effective modification of drugs. For example, drug delivery polymers that consist of alternating polymers of PEG and tri-functional monomers such as lysine have been used by VectraMed (Plainsboro, N. J.). The PEG chains (typically 2000 daltons or less) are linked to the a- and e-amino groups of lysine through stable urethane linkages. Such copolymers retain the desirable properties of PEG, while providing reactive pendent groups (the carboxylic acid groups of lysine) at strictly controlled and predetermined intervals along the polymer chain. The reactive pendent groups can be used for derivatization, cross-linking, or conjugation with other molecules. These polymers are useful in producing stable, long-circulating pro-drugs by varying the molecular weight of the polymer, the molecular weight of the PEG segments, and the cleavable linkage between the drug and the polymer. The molecular weight of the PEG segments affects the spacing of the drug/linking group complex and the amount of drug per molecular weight of conjugate (smaller PEG segments provides greater drug loading). In general, increasing the overall molecular weight of the block co-polymer conjugate will increase the circulatory half- life of the conjugate. Nevertheless, the conjugate must either be readily degradable or have a molecular weight below the threshold-limiting glomular filtration (e.g., less than 60 kDa). In addition, to the polymer backbone being important in maintaining circulatory half- life, and biodistribution, linkers may be used to maintain the therapeutic agent in a pro-drug form until released from the backbone polymer by a specific trigger, typically enzyme activity in the targeted tissue. For example, this type of tissue activated drug delivery is particularly useful where delivery to a specific site of biodistribution is required and the therapeutic agent is released at or near the site of pathology. Linking group libraries for use in activated drug delivery are known to those of skill in the art and may be based on enzyme kinetics, prevalence of active enzyme, and cleavage specificity of the selected disease-specific enzymes. Such linkers may be used in modifying the protein or fragment of the protein described herein for therapeutic delivery.

In another embodiment, the UL128 inhibitor according to the invention is an inhibitor of UL128 gene expression.

Small inhibitory RNAs (siRNAs) can also function as inhibitors of UL128 expression for use in the present invention. UL128 gene expression can be reduced by contacting a subject or cell with a small double stranded RNA (dsRNA), or a vector or construct causing the production of a small double stranded RNA, such that UL128 gene expression is specifically inhibited (i.e. RNA interference or RNAi). Methods for selecting an appropriate dsRNA or dsRNA-encoding vector are well known in the art for genes whose sequence is known (e.g. see for example Tuschl, T. et al. (1999); Elbashir, S. M. et al. (2001); Hannon, GJ. (2002); McManus, MT. et al. (2002); Brummelkamp, TR. et al. (2002); U.S. Pat. Nos. 6,573,099 and 6,506,559; and International Patent Publication Nos. WO 01/36646, WO 99/32619, and WO 01/68836).

Ribozymes can also function as inhibitors of UL128 gene expression for use in the present invention. Ribozymes are enzymatic RNA molecules capable of catalyzing the specific cleavage of RNA. The mechanism of ribozyme action involves sequence specific hybridization of the ribozyme molecule to complementary target RNA, followed by endonucleolytic cleavage. Engineered hairpin or hammerhead motif ribozyme molecules that specifically and efficiently catalyze endonucleolytic cleavage of UL128 mRNA sequences are thereby useful within the scope of the present invention. Specific ribozyme cleavage sites within any potential RNA target are initially identified by scanning the target molecule for ribozyme cleavage sites, which typically include the following sequences, GUA, GUU, and GUC. Once identified, short RNA sequences of between about 15 and 20 ribonucleotides corresponding to the region of the target gene containing the cleavage site can be evaluated for predicted structural features, such as secondary structure, that can render the oligonucleotide sequence unsuitable. The suitability of candidate targets can also be evaluated by testing their accessibility to hybridization with complementary oligonucleotides, using, e.g., ribonuclease protection assays.

Both antisense oligonucleotides and ribozymes useful as inhibitors of UL128 gene expression can be prepared by known methods. These include techniques for chemical synthesis such as, e.g., by solid phase phosphoramadite chemical synthesis. Alternatively, anti-sense RNA molecules can be generated by in vitro or in vivo transcription of DNA sequences encoding the RNA molecule. Such DNA sequences can be incorporated into a wide variety of vectors that incorporate suitable RNA polymerase promoters such as the T7 or SP6 polymerase promoters. Various modifications to the oligonucleotides of the invention can be introduced as a means of increasing intracellular stability and half-life. Possible modifications include but are not limited to the addition of flanking sequences of ribonucleotides or deoxyribonucleotides to the 5' and/or 3' ends of the molecule, or the use of phosphorothioate or 2'-0-methyl rather than phosphodiesterase linkages within the oligonucleotide backbone.

Antisense oligonucleotides siRNAs and ribozymes of the invention may be delivered in vivo alone or in association with a vector. In its broadest sense, a "vector" is any vehicle capable of facilitating the transfer of the antisense oligonucleotide siRNA or ribozyme nucleic acid to the CMV and preferably CMV expressing UL128. Preferably, the vector transports the nucleic acid to cells with reduced degradation relative to the extent of degradation that would result in the absence of the vector. In general, the vectors useful in the invention include, but are not limited to, plasmids, phagemids, viruses, other vehicles derived from viral or bacterial sources that have been manipulated by the insertion or incorporation of the antisense oligonucleotide siRNA or ribozyme nucleic acid sequences. Viral vectors are a preferred type of vector and include, but are not limited to nucleic acid sequences from the following viruses: retrovirus, such as moloney murine leukemia virus, harvey murine sarcoma virus, murine mammary tumor virus, and rouse sarcoma virus; adenovirus, adeno-associated virus; SV40-type viruses; polyoma viruses; Epstein-Barr viruses; papilloma viruses; herpes virus; vaccinia virus; polio virus; and RNA virus such as a retrovirus. One can readily employ other vectors not named but known to the art.

Preferred viral vectors are based on non-cytopathic eukaryotic viruses in which non- essential genes have been replaced with the gene of interest. Non-cytopathic viruses include retroviruses (e.g., lentivirus), the life cycle of which involves reverse transcription of genomic viral RNA into DNA with subsequent proviral integration into host cellular DNA. Retroviruses have been approved for human gene therapy trials. Most useful are those retroviruses that are replication-deficient (i.e., capable of directing synthesis of the desired proteins, but incapable of manufacturing an infectious particle). Such genetically altered retroviral expression vectors have general utility for the high-efficiency transduction of genes in vivo. Standard protocols for producing replication-deficient retroviruses (including the steps of incorporation of exogenous genetic material into a plasmid, transfection of a packaging cell lined with plasmid, production of recombinant retroviruses by the packaging cell line, collection of viral particles from tissue culture media, and infection of the target cells with viral particles) are provided in Kriegler, 1990 and in Murry, 1991).

Preferred viruses for certain applications are the adeno-viruses and adeno-associated viruses, which are double-stranded DNA viruses that have already been approved for human use in gene therapy. The adeno-associated virus can be engineered to be replication deficient and is capable of infecting a wide range of cell types and species. It further has advantages such as, heat and lipid solvent stability; high transduction frequencies in cells of diverse lineages, including hemopoietic cells; and lack of superinfection inhibition thus allowing multiple series of transductions. Reportedly, the adeno-associated virus can integrate into human cellular DNA in a site-specific manner, thereby minimizing the possibility of insertional mutagenesis and variability of inserted gene expression characteristic of retroviral infection. In addition, wild- type adeno-associated virus infections have been followed in tissue culture for greater than 100 passages in the absence of selective pressure, implying that the adeno-associated virus genomic integration is a relatively stable event. The adeno-associated virus can also function in an extrachromosomal fashion.

Other vectors include plasmid vectors. Plasmid vectors have been extensively described in the art and are well known to those of skill in the art. See e.g. Sambrook et al, 1989. In the last few years, plasmid vectors have been used as DNA vaccines for delivering antigen encoding genes to cells in vivo. They are particularly advantageous for this because they do not have the same safety concerns as with many of the viral vectors. These plasmids, however, having a promoter compatible with the host cell, can express a peptide from a gene operatively encoded within the plasmid. Some commonly used plasmids include pBR322, pUC18, pUC19, pRC/CMV, SV40, and pBlueScript. Other plasmids are well known to those of ordinary skill in the art. Additionally, plasmids may be custom designed using restriction enzymes and ligation reactions to remove and add specific fragments of DNA. Plasmids may be delivered by a variety of parenteral, mucosal and topical routes. For example, the DNA plasmid can be injected by intramuscular, eye, intradermal, subcutaneous, or other routes. It may also be administered by intranasal sprays or drops, rectal suppository and orally. It may also be administered into the epidermis or a mucosal surface using a gene-gun. The plasmids may be given in an aqueous solution, dried onto gold particles or in association with another DNA delivery system including but not limited to liposomes, dendrimers, cochleate and mi croencap sulation .

In a particular embodiment, the antisense oligonucleotide, siRNA, shRNA or ribozyme nucleic acid sequence is under the control of a heterologous regulatory region, e.g., a heterologous promoter. The promoter may be specific for Muller glial cells, microglia cells, endothelial cells, pericyte cells and astrocytes For example, a specific expression in Muller glial cells may be obtained through the promoter of the glutamine synthetase gene is suitable. The promoter can also be, e.g., a viral promoter, such as CMV promoter or any synthetic promoters.

Indeed, as an alternative to more conventional approaches, such as cDNA overexpression or downregulation by RNA interference, new technologies provide the means to manipulate the genome. Indeed, natural and engineered nuclease enzymes have attracted considerable attention in the recent years. The mechanism behind endonuclease-based genome inactivating generally requires a first step of DNA single or double strand break, which can then trigger two distinct cellular mechanisms for DNA repair, which can be exploited for DNA inactivating: the error prone non homologous end-joining (NHEJ) and the high-fidelity homology-directed repair (HDR).

In a particular embodiment, the endonuclease is CRISPR-cas. As used herein, the term “CRISPR-cas” has its general meaning in the art and refers to clustered regularly interspaced short palindromic repeats associated which are the segments of prokaryotic DNA containing short repetitions of base sequences.

In some embodiment, the endonuclease is CRISPR-cas9 which is from Streptococcus pyogenes. The CRISPR/Cas9 system has been described in US 8697359 B1 and US 2014/0068797. Originally an adaptive immune system in prokaryotes (Barrangou and Marraffmi, 2014), CRISPR has been recently engineered into a new powerful tool for genome editing. It has already been successfully used to target important genes in many cell lines and organisms, including human (Mali et al, 2013, Science, Vol. 339 : 823-826), bacteria (Fabre et al, 2014, PLoS Negl. Trop. Dis., Vol. 8:e267T), zebrafish (Hwang et al., 2013, PLoS One, Vol. 8:e68708.), C. elegans (Hai et al, 2014 Cell Res. doi: 10.1038/cr.2014.1 T), bacteria (Fabre et al., 2014, PLoS Negl. Trop. Dis., Vol. 8:e267L), plants (Mali et al., 2013, Science, Vol. 339 : 823-826), Xenopus tropicalis (Guo et al., 2014, Development, Vol. 141 : 707-714.), yeast (DiCarlo et al., 2013, Nucleic Acids Res., Vol. 41 : 4336-4343.), Drosophila (Gratz et al., 2014 Genetics, doi: 10.1534/genetics.113.160713), monkeys (Niu et al, 2014, Cell, Vol. 156 : 836- 843.), rabbits (Yang et al., 2014, J. Mol. Cell Biol., Vol. 6 : 97-99.), pigs (Hai et al., 2014, Cell Res. doi: 10.1038/cr.2014.11.), rats (Ma et al., 2014, Cell Res., Vol. 24 : 122-125.) and mice (Mashiko et al., 2014, Dev. Growth Differ. Vol. 56 : 122-129.). Several groups have now taken advantage of this method to introduce single point mutations (deletions or insertions) in a particular target gene, via a single gRNA. Using a pair of gRNA-directed Cas9 nucleases instead, it is also possible to induce large deletions or genomic rearrangements, such as inversions or translocations. A recent exciting development is the use of the dCas9 version of the CRISPR/Cas9 system to target protein domains for transcriptional regulation, epigenetic modification, and microscopic visualization of specific genome loci.

In some embodiment, the endonuclease is CRISPR-Cpfl which is the more recently characterized CRISPR from Provotella and Francisella 1 (Cpfl) in Zetsche et al. (“Cpfl is a Single RNA-guided Endonuclease of a Class 2 CRISPR-Cas System (2015); Cell; 163, 1-13).

In a particular embodiment, a CRISPR-cas9 can be used to apply the tri-methylation on H3K27 and thus inhibits the expression of UL128. Particularly, the dCas9-EZH2 (which will express the histone methyltransferase Ezh2, the enzyme responsible of the tri-methylation) can be used to apply the tri-methylation on H3K27 and thus inhibits the expression of UL128 (see for example O'Geen H, Ren C, Nicolet CM, Perez AA, Halmai J, Le VM, Mackay JP, Farnham PJ, Segal DJ (2017) dCas9-based epigenome editing suggests acquisition of histone methylation is not sufficient for target gene repression. Nucleic Acids Res 45: 9901-9916).

In another embodiment, the invention relates to a method for treating CMV related diseases comprising administering to a subject in need thereof a therapeutically effective amount of an inhibitor of UL128.

Nucleic acids, vectors, recombinant host cells and uses thereof

Another object of the invention relates to a nucleic acid sequence encoding a recombinant UL128 according to the invention.

Another object of the invention relates to an expression vector comprising a nucleic acid sequence encoding a recombinant UL 128 according to the invention.

According to the invention, expression vectors suitable for use in the invention may comprise at least one expression control element operationally linked to the nucleic acid sequence. The expression control elements are inserted in the vector to control and regulate the expression of the nucleic acid sequence. Examples of expression control elements include, but are not limited to, lac system, operator and promoter regions of phage lambda, yeast promoters and promoters derived from polyoma, adenovirus, retrovirus, lentivirus or SV40. Additional preferred or required operational elements include, but are not limited to, leader sequence, termination codons, polyadenylation signals and any other sequences necessary or preferred for the appropriate transcription and subsequent translation of the nucleic acid sequence in the host system. It will be understood by one skilled in the art that the correct combination of required or preferred expression control elements will depend on the host system chosen. It will further be understood that the expression vector should contain additional elements necessary for the transfer and subsequent replication of the expression vector containing the nucleic acid sequence in the host system. Examples of such elements include, but are not limited to, origins of replication and selectable markers. It will further be understood by one skilled in the art that such vectors are easily constructed using conventional methods or commercially available.

Another object of the invention is a host cell comprising an expression vector as described here above.

According to the invention, examples of host cells that may be used are eukaryote cells, such as animal, plant, insect and yeast cells and prokaryotes cells, such as E. coli. The means by which the vector carrying the gene may be introduced into the cells include, but are not limited to, microinjection, electroporation, transduction, or transfection using DEAE-dextran, lipofection, calcium phosphate or other procedures known to one skilled in the art.

In a preferred embodiment, eukaryotic expression vectors that function in eukaryotic cells are used. Examples of such vectors include, but are not limited to, viral vectors such as retrovirus, adenovirus, adeno-associated virus, herpes virus, vaccinia virus, poxvirus, poliovirus; lentivirus, bacterial expression vectors, plasmids, such as pcDNA3 or the baculovirus transfer vectors. Preferred eukaryotic cell lines include, but are not limited to, COS cells, CHO cells, HeLa cells, NIH/3T3 cells, 293 cells (ATCC# CRL1573), T2 cells, dendritic cells, or monocytes.

Therapeutic composition

Another object of the invention relates to a therapeutic composition comprising an UL128 inhibitor for use in the treatment of CMV related diseases in a subject in need thereof.

In a particularly embodiment, the invention relates to a therapeutic composition comprising an UL128 inhibitor for use in the treatment of neurodevelopmental disorders associated with an CMV infection in a subject in need thereof. In a particular embodiment, the UL128 inhibitor is a recombinant UL128 according to the invention.

In another particular embodiment, the recombinant UL 128 according to the invention is expressed by a human CMV.

Accordingly, the invention also relates to a therapeutic composition comprising an UL128 inhibitor for use in the treatment of CMV related diseases in a subject in need thereof.

Any therapeutic agent of the invention may be combined with pharmaceutically acceptable excipients, and optionally sustained-release matrices, such as biodegradable polymers, to form therapeutic compositions.

"Pharmaceutically" or "pharmaceutically acceptable" refers to molecular entities and compositions that do not produce an adverse, allergic or other untoward reaction when administered to a mammal, especially a human, as appropriate. A pharmaceutically acceptable carrier or excipient refers to a non-toxic solid, semi-solid or liquid filler, diluent, encapsulating material or formulation auxiliary of any type.

The form of the pharmaceutical compositions, the route of administration, the dosage and the regimen naturally depend upon the condition to be treated, the severity of the illness, the age, weight, and sex of the subject, etc.

The pharmaceutical compositions of the invention can be formulated for a topical, oral, intranasal, parenteral, intraocular, intravenous, intramuscular, or subcutaneous administration and the like.

Particularly, the pharmaceutical compositions contain vehicles which are pharmaceutically acceptable for a formulation capable of being injected. These may be in particular isotonic, sterile, saline solutions (monosodium or disodium phosphate, sodium, potassium, calcium or magnesium chloride and the like or mixtures of such salts), or dry, especially freeze-dried compositions which upon addition, depending on the case, of sterilized water or physiological saline, permit the constitution of injectable solutions.

The doses used for the administration can be adapted as a function of various parameters, and in particular as a function of the mode of administration used, of the relevant pathology, or alternatively of the desired duration of treatment.

In addition, other pharmaceutically acceptable forms include, e.g. tablets or other solids for oral administration; time release capsules; and any other form currently can be used.

Pharmaceutical compositions of the present invention may comprise a further therapeutic active agent. The present invention also relates to a kit comprising an activator according to the invention and a further therapeutic active agent. For example, anti-HCMV agents may be added to the pharmaceutical composition as described below.

Anti-HCMV agents may be the polymerase inhibitors Ganciclovir, Valganciclovir, Foscarnet or Cidofovir, or other molecules with anti-HCMV potentiel such as artesunate and its derivatives, leflunomide, everolimus, or new anti-HCMV agents such as letermovir or other anti-terminases, and maribavir or other UL97 kinase inhibitors, or amide derivatives of valproic acid. Or any other anti-HCMV compound further developed.

The invention will be further illustrated by the following figures and examples. However, these examples and figures should not be interpreted in any way as limiting the scope of the present invention.

FIGURES:

Figure 1. Early expression of rat CMV-encoded rl29 after infection of the rat developing brain with recombinant, wild-type (WT) rat CMV (RCMV-WT) encoding green fluorescent protein (GFP) to label infected cells. Rat fetal brains were infected in utero at El 5. RNAs were extracted from whole brains at E16, E17 and PI and analyzed by qRT-PCR. Taken from Cloarec et al. 2016 (10).

Figure 2. Phenotyping results obtained by daily monitoring of rats pups bom after intracerebroventricular injection at E15 of either RCMV expressing wild-type rl29 (RCMV- WT), or a mutant RCMV counterpart expressing dominant-negative rl29 (RCMV-ANT-r l 29), or the vehicle (MEM). Each panel represents one phenotype: A: survival, B: body weight gain, sensorimotor tests (C: righting, D: cliff aversion), E: presence of hindlimb paralysis or not, F: detection of seizures or not. MEM: n=36 ; RCMV: n=54 ; RCMV-ANT-r l 29: n=16 (unpublished data).

Figure 3. Flow cytometry analysis of infected, GFP+ cells at PI in rat brains injected at El 5 with either RCMV-WT (n=6) or RCMV-ANT-r l 29 (n=6) (unpublished data).

Figure 4. Representative distribution of cell phenotypes amongst infected, GFP+ cells obtained by flow cytometry analysis at PI in the brain of rats infected at E15 with either of RCMV-WT (left) or RCMV-ANT-r l 29 (right) (unpublished data).

Figure 5. Phenotyping results obtained by daily monitoring of rats pups bom after intracerebroventricular injection at El 5 of either the vehicle (MEM), or RCMV expressing wild-type rl29 (RCMV-WT), or a combination of RCMV-WT mixed with various doses of dominant-negative RCMV-ANT-r 129 (5 times more than WT in Mixl; equal dose of each in Mix2; 2 times less than WT in Mix3). Each panel represents one phenotype that was monitored: 5 A: survival, 5B: body weight gain, sensorimotor tests (5C: righting, 5D: cliff aversion), 5E: presence of hindlimb paralysis or not, 5F: detection of seizures or not. MEM: n=34; RCMV: n=29; Mixl : n=28; Mix2: n=30; Mix3 : n=30 (unpublished data).

Figure 6. Phenotyping results obtained by daily monitoring of rats pups bom after intracerebroventricular injection at El 5 of either the vehicle (MEM), or RCMV expressing wild-type rl29 (RCMV-WT), or after sequential intracerebroventricular injections with the dominant-negative RCMV-ANT-r 129 at E14 followed 24h later (at E15) by injection with equal dose of RCMV-WT. Each panel represents one phenotype that was monitored: 6A: survival, 6B: body weight gain, sensorimotor tests (6C: righting, 6D: cliff aversion), 6E: presence of hindlimb paralysis or not, 6F: detection of seizures or not. MEM: n=34; RCMV: n=54; Sequential RCMV-ANT-r 129/RCMV-WT injections: n=16 (unpublished data).

EXAMPLE:

Material & Methods and Results

For the studies, the inventors used the rat CMV and the rl29 as a proof of concept that inhibition of this chemokine (and thus that the inhibition of UL128 for the hCMV) could treat/prevent the CMV related diseases. They thus took advantage of the availability of a strain of RCMV that contains the dominant-negative form of rl29. This strain is called RCMV-DNT- rl29.

Early expression of CMV-encoded r!29 gene after infection of the rat developing brain

In the rat model of CMV infection of the developing brain, transcripts analysis had demonstrated early and consistent dysregulation of various pro-inflammatory chemokines (10). In particular, transcripts corresponding to viral chemokine rl29, which was previously shown to attract lymphocytes and macrophages(13), were detected as early as from El 6 (10) (Figure 1)^.

RCMV-ANT-rl29 is not pathogenic

RCMV-ANT-r l 29 was injected in the lateral ventricle of rat pups at E15. After birth, newborns were monitored daily. We observed no apparent behavioral consequences during the first 20 postnatal days. Data are based on the following daily readouts: lethality, body weight gain, sensorimotor tests (righting, cliff aversion), presence of hindlimb paralysis or not, detection of seizures or not (see Figure 2 below).

Injection of RCMV-ANT-rl29 at E15 produces less infected cells at PI : Much fewer infected cells (Figure 3) and infected leukocytes (Figure 4) were detected by flow cytometry analysis in rats infected with RCMV-ANT-r 129, as compared to those infected with wild-type RCMV.

Much fewer infected, GFP+ cells were also detected by histological analysis on brain sections (data not shown).

Co-infection

Co-infection with wild-type RCMV and various amounts of RCMV-ANT-rl29 revealed a dominant-negative effect in vivo on the postnatal consequences of RCMV infection, with the expected titration effect (see Figure 5 below).

Sequential infection

Sequential infection with RCMV-ANT-r 129 at E14 followed 24h apart with wild-type RCMV at El 5 revealed a preventive effect of the dominant-negative chemokine in vivo , as the postnatal consequences of RCMV infection were dramatically abrogated (see Figure 6 below).

REFERENCES:

Throughout this application, various references describe the state of the art to which this invention pertains. The disclosures of these references are hereby incorporated by reference into the present disclosure.

1. Adler & Nigro 2013, in Cytomegaloviruses: From Molecular Pathogenesis to Intervention, Vol. 2, ed M. J. Reddehase (Mainz: Caister Academic Press), 55-73.

2. Readhead et al. Neuron 2018, 99, 64-82.

3. Cheeran et al. Clin Microbiol Rev 2009, 22, 99-126.

4. Britt et al. 2013, in Cytomegaloviruses: From Molecular Pathogenesis to Intervention, Vol. 2, ed M. J. Reddehase (Mainz: Caister Academic Press), 119-41.

5. Cekinovic et al., Methods Mol Biol, 1119, 289-310. 2014.

6. Kosmac et al. PLoS Pathog 2013, 9, el003200.

7. Sakao-Suzuki et al. Ann Clin Transl Neurol 2014, 1, 570-88.

8. Bradford et al. PloS Pathog 2015, 11, el004774.

9. Slavuljica et al. Cell Mol Immunol 2015, 12, 180-91.

10. Cloarec et al. PLoS One 2016, 11, e0160176.

11. Seleme et al. J Virol 2017, 91, e01983-16.

12. Cloarec et al. Front Cell Neurosci 2018, 12, 55.

13. Vomaske et al. J Virol 2012, 86, 11833-44. 14. Kaptein et al. Virus Genes 2004, 29, 43-61.

15. Pontejo & Murphy J Leukocyte Biol 2017, 102, 1199-217.

Claims

CLAIMS:

1. An UL128 inhibitor for use in the treatment of CMV related diseases in a subject in need thereof.

2. An UL128 inhibitor for use according to claim 1 wherein said inhibitor is a recombinant

UL128.

3. An UL128 inhibitor for use according to claim 2 wherein said recombinant UL128 has a mutation, a substitution or a deletion in at least one cysteine C30 or C31 of the SEQ ID NO: 1.

4. An UL128 inhibitor for use according to claim 2 wherein said inhibitor has an amino acids sequences selected in the group of SEQ ID NO: 5, 6, 7, 8, 9, 10, 11, 12, 13 and 14.

5. An UL128 inhibitor for use according to claims 1 to 4 wherein the CMV related diseases include but are not limited to neurodevelopmental disorders associated with CMV infections or congenital CMV infections, such as microcephaly, retinitis, polymicrogyria, hearing loss, cerebral palsy, epileptic seizures, intellectual disability.

6. A CMV comprising a recombinant UL128 according to claims 2 to 4 for use in the treatment of CMV related diseases in a subject in need thereof.

7. A therapeutic composition comprising an UL128 inhibitor of claims 1 to 5 for use in the treatment of CMV related diseases in a subject in need thereof.

8. A method for treating CMV related diseases comprising administering to a subject in need thereof a therapeutically effective amount of an inhibitor of UL128 according to claims 1 to 4.