US20150203872A1 - Crispr-cas systems and methods for altering expression of gene products - Google Patents
Crispr-cas systems and methods for altering expression of gene products Download PDFInfo
- Publication number
- US20150203872A1 US20150203872A1 US14/681,382 US201514681382A US2015203872A1 US 20150203872 A1 US20150203872 A1 US 20150203872A1 US 201514681382 A US201514681382 A US 201514681382A US 2015203872 A1 US2015203872 A1 US 2015203872A1
- Authority
- US
- United States
- Prior art keywords
- sequence
- crispr
- composition according
- cell
- target
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Abandoned
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/87—Introduction of foreign genetic material using processes not otherwise provided for, e.g. co-transformation
- C12N15/90—Stable introduction of foreign DNA into chromosome
- C12N15/902—Stable introduction of foreign DNA into chromosome using homologous recombination
- C12N15/907—Stable introduction of foreign DNA into chromosome using homologous recombination in mammalian cells
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/10—Processes for the isolation, preparation or purification of DNA or RNA
- C12N15/102—Mutagenizing nucleic acids
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/111—General methods applicable to biologically active non-coding nucleic acids
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/87—Introduction of foreign genetic material using processes not otherwise provided for, e.g. co-transformation
- C12N15/90—Stable introduction of foreign DNA into chromosome
- C12N15/902—Stable introduction of foreign DNA into chromosome using homologous recombination
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/14—Hydrolases (3)
- C12N9/16—Hydrolases (3) acting on ester bonds (3.1)
- C12N9/22—Ribonucleases RNAses, DNAses
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/96—Stabilising an enzyme by forming an adduct or a composition; Forming enzyme conjugates
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
- A61K38/16—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- A61K38/43—Enzymes; Proenzymes; Derivatives thereof
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
- A61K38/16—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- A61K38/43—Enzymes; Proenzymes; Derivatives thereof
- A61K38/46—Hydrolases (3)
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
- A61K38/16—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- A61K38/43—Enzymes; Proenzymes; Derivatives thereof
- A61K38/46—Hydrolases (3)
- A61K38/47—Hydrolases (3) acting on glycosyl compounds (3.2), e.g. cellulases, lactases
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/10—Processes for the isolation, preparation or purification of DNA or RNA
- C12N15/1034—Isolating an individual clone by screening libraries
- C12N15/1082—Preparation or screening gene libraries by chromosomal integration of polynucleotide sequences, HR-, site-specific-recombination, transposons, viral vectors
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
- C12N2310/20—Type of nucleic acid involving clustered regularly interspaced short palindromic repeats [CRISPRs]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2800/00—Nucleic acids vectors
- C12N2800/30—Vector systems comprising sequences for excision in presence of a recombinase, e.g. loxP or FRT
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2800/00—Nucleic acids vectors
- C12N2800/80—Vectors containing sites for inducing double-stranded breaks, e.g. meganuclease restriction sites
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2800/00—Nucleic acids vectors
- C12N2800/90—Vectors containing a transposable element
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/14—Hydrolases (3)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/14—Hydrolases (3)
- C12N9/48—Hydrolases (3) acting on peptide bonds (3.4)
- C12N9/50—Proteinases, e.g. Endopeptidases (3.4.21-3.4.25)
- C12N9/52—Proteinases, e.g. Endopeptidases (3.4.21-3.4.25) derived from bacteria or Archaea
Definitions
- the present invention generally relates to systems, methods and compositions used for the control of gene expression involving sequence targeting, such as genome perturbation or gene-editing, that may use vector systems related to Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR) and components thereof.
- sequence targeting such as genome perturbation or gene-editing
- CRISPR Clustered Regularly Interspaced Short Palindromic Repeats
- the CRISPR/Cas or the CRISPR-Cas system does not require the generation of customized proteins to target specific sequences but rather a single Cas enzyme can be programmed by a short RNA molecule to recognize a specific DNA target, in other words the Cas enzyme can be recruited to a specific DNA target using said short RNA molecule.
- Adding the CRISPR-Cas system to the repertoire of genome sequencing techniques and analysis methods may significantly simplify the methodology and accelerate the ability to catalog and map genetic factors associated with a diverse range of biological functions and diseases.
- the invention provides a method of altering or modifying expression of one or more gene products that may comprise introducing into a cell containing and expressing DNA molecules encoding the one or more gene products an engineered, non-naturally occurring CRISPR-Cas system that may comprise a Cas protein and one or more guide RNAs that target the DNA molecules, whereby the one or more guide RNAs target the genomic loci of the DNA molecules encoding the one or more gene products and the Cas protein cleaves the genomic loci of the DNA molecules encoding the one or more gene products, whereby expression of the one or more gene products is altered or modified; and, wherein the Cas protein and the guide RNA do not naturally occur together.
- an engineered, non-naturally occurring CRISPR-Cas system that may comprise a Cas protein and one or more guide RNAs that target the DNA molecules, whereby the one or more guide RNAs target the genomic loci of the DNA molecules encoding the one or more gene products and the Cas protein cleaves the genomic loci of the
- the invention comprehends that the expression of two or more gene products may be altered or modified.
- the guide RNA comprises a guide sequence fused to a tracr sequence.
- the cell is a eukaryotic cell, in a more preferred embodiment the cell is a mammalian cell and in a yet more preferred embodiment the mammalian cell is a human cell.
- the Cas protein may comprise one or more nuclear localization signal(s) (NLS(s)).
- the Cas protein is a type II CRISPR system enzyme.
- the Cas protein is a Cas9 protein.
- the Cas9 protein is S. pneumoniae, S. pyogenes , or S.
- thermophilus Cas9 and may include mutated Cas9 derived from these organisms.
- the protein may be a Cas9 homolog or ortholog.
- the Cas protein is codon-optimized for expression in a eukaryotic cell.
- the Cas protein directs cleavage of one or two strands at the location of the target sequence.
- the expression of the gene product is decreased and the gene product is a protein.
- the invention comprehends that the introducing into the cell is by a delivery system that may comprise viral particles, liposomes, electroporation, microinjection or conjugation.
- the invention provides a method of altering or modifying expression of one or more gene products comprising introducing into a cell containing and expressing DNA molecules encoding the one or more gene products an engineered, non-naturally occurring vector system that may comprise one or more vectors comprising: a) a first regulatory element operably linked to one or more CRISPR-Cas system guide RNAs that hybridize with target sequences in genomic loci of the DNA molecules encoding the one or more gene products, b) a second regulatory element operably linked to a Cas protein, wherein components (a) and (b) are located on same or different vectors of the system, whereby the guide RNAs target the genomic loci of the DNA molecules encoding the one or more gene products and the Cas protein cleaves the genomic loci of the DNA molecules encoding the one or more gene products, whereby expression of the one or more gene products is altered or modified; and, wherein the Cas protein and the guide RNAs do not naturally occur together.
- the invention comprehends that the expression of two or more gene products may be altered or modified.
- the guide RNA comprises a guide sequence fused to a tracr sequence.
- the cell is a eukaryotic cell, in a more preferred embodiment the cell is a mammalian cell and in a yet more preferred embodiment the mammalian cell is a human cell.
- the vectors of the system may further comprise one or more NLS(s).
- the Cas protein is a type II CRISPR system enzyme.
- the Cas protein is a Cas9 protein.
- the Cas9 protein is S. pneumoniae, S. pyogenes , or S.
- thermophilus Cas9 and may include mutated Cas9 derived from these organisms.
- the protein may be a Cas9 homolog or ortholog.
- the Cas protein is codon-optimized for expression in a eukaryotic cell.
- the Cas protein directs cleavage of one or two strands at the location of the target sequence.
- the expression of the gene product is decreased and the gene product is a protein.
- the invention comprehends that the introducing into the cell is by a delivery system that may comprise viral particles, liposomes, electroporation, microinjection or conjugation.
- the invention also provides an engineered, non-naturally occurring vector system that may comprise one or more vectors comprising: a) a first regulatory element operably linked to one or more CRISPR-Cas system guide RNAs that hybridize with target sequences in genomic loci of DNA molecules encoding one or more gene products, b) a second regulatory element operably linked to a Cas protein, wherein components (a) and (b) are located on same or different vectors of the system, whereby the guide RNAs target the genomic loci of the DNA molecules encoding the one or more gene products in a cell and the Cas protein cleaves the genomic loci of the DNA molecules encoding the one or more gene products, whereby expression of the one or more gene products is altered or modified; and, wherein the Cas protein and the guide RNAs do not naturally occur together.
- the invention comprehends that the expression of two or more gene products may be altered or modified.
- the guide RNA comprises a guide sequence fused to a tracr sequence.
- the cell is a eukaryotic cell, in a more preferred embodiment the cell is a mammalian cell and in a yet more preferred embodiment the mammalian cell is a human cell.
- the vectors of the system may further comprise one or more NLS(s).
- the Cas protein is a type II CRISPR system enzyme.
- the Cas protein is a Cas9 protein.
- the Cas9 protein is S. pneumoniae, S. pyogenes , or S.
- thermophilus Cas9 and may include mutated Cas9 derived from these organisms.
- the protein may be a Cas9 homolog or ortholog.
- the Cas protein is codon-optimized for expression in a eukaryotic cell.
- the Cas protein directs cleavage of one or two strands at the location of the target sequence.
- the expression of the gene product is decreased and the gene product is a protein.
- the invention comprehends that the introducing into the cell is by a delivery system that may comprise viral particles, liposomes, electroporation, microinjection or conjugation.
- the invention provides an engineered, programmable, non-naturally occurring CRISPR-Cas system that may comprise a Cas protein and one or more guide RNAs that target the genomic loci of DNA molecules encoding one or more gene products in a cell and the Cas protein cleaves the genomic loci of the DNA molecules encoding the one or more gene products, whereby expression of the one or more gene products is altered or modified; and, wherein the Cas protein and the guide RNAs do not naturally occur together.
- the invention comprehends that the expression of two or more gene products may be altered or modified.
- the guide RNA comprises a guide sequence fused to a tracr sequence.
- the cell is a eukaryotic cell, in a more preferred embodiment the cell is a mammalian cell and in a yet more preferred embodiment the mammalian cell is a human cell.
- the CRISPR-Cas system may further comprise one or more NLS(s).
- the Cas protein is a type II CRISPR system enzyme.
- the Cas protein is a Cas9 protein.
- the Cas9 protein is S. pneumoniae, S. pyogenes , or S. thermophilus Cas9, and may include mutated Cas9 derived from these organisms.
- the protein may be a Cas9 homolog or ortholog.
- the Cas protein is codon-optimized for expression in a eukaryotic cell.
- the Cas protein directs cleavage of one or two strands at the location of the target sequence.
- the expression of the gene product is decreased and the gene product is a protein.
- the invention comprehends that the introducing into the cell is by a delivery system that may comprise viral particles, liposomes, electroporation, microinjection or conjugation.
- the invention provides a vector system comprising one or more vectors.
- the system comprises: (a) a first regulatory element operably linked to a tracr mate sequence and one or more insertion sites for inserting one or more guide sequences upstream of the tracr mate sequence, wherein when expressed, the guide sequence directs sequence-specific binding of a CRISPR complex to a target sequence in a eukaryotic cell, wherein the CRISPR complex comprises a CRISPR enzyme complexed with (1) the guide sequence that is hybridized to the target sequence, and (2) the tracr mate sequence that is hybridized to the tracr sequence; and (b) a second regulatory element operably linked to an enzyme-coding sequence encoding said CRISPR enzyme comprising a nuclear localization sequence; wherein components (a) and (b) are located on the same or different vectors of the system.
- component (a) further comprises the tracr sequence downstream of the tracr mate sequence under the control of the first regulatory element.
- component (a) further comprises two or more guide sequences operably linked to the first regulatory element, wherein when expressed, each of the two or more guide sequences direct sequence specific binding of a CRISPR complex to a different target sequence in a eukaryotic cell.
- the system comprises the tracr sequence under the control of a third regulatory element, such as a polymerase III promoter.
- the tracr sequence exhibits at least 50%, 60%, 70%, 80%, 90%, 95%, or 99% of sequence complementarity along the length of the tracr mate sequence when optimally aligned.
- the CRISPR complex comprises one or more nuclear localization sequences of sufficient strength to drive accumulation of said CRISPR complex in a detectable amount in the nucleus of a eukaryotic cell.
- a nuclear localization sequence is not necessary for CRISPR complex activity in eukaryotes, but that including such sequences enhances activity of the system, especially as to targeting nucleic acid molecules in the nucleus.
- the CRISPR enzyme is a type II CRISPR system enzyme. In some embodiments, the CRISPR enzyme is a Cas9 enzyme. In some embodiments, the Cas9 enzyme is S. pneumoniae, S. pyogenes , or S. thermophilus Cas9, and may include mutated Cas9 derived from these organisms. The enzyme may be a Cas9 homolog or ortholog. In some embodiments, the CRISPR enzyme is codon-optimized for expression in a eukaryotic cell. In some embodiments, the CRISPR enzyme directs cleavage of one or two strands at the location of the target sequence. In some embodiments, the first regulatory element is a polymerase III promoter.
- the second regulatory element is a polymerase II promoter.
- the guide sequence is at least 15, 16, 17, 18, 19, 20, 25 nucleotides, or between 10-30, or between 15-25, or between 15-20 nucleotides in length.
- vector refers to a nucleic acid molecule capable of transporting another nucleic acid to which it has been linked. Vectors include, but are not limited to, nucleic acid molecules that are single-stranded, double-stranded, or partially double-stranded; nucleic acid molecules that comprise one or more free ends, no free ends (e.g.
- vectors refers to a circular double stranded DNA loop into which additional DNA segments can be inserted, such as by standard molecular cloning techniques.
- viral vector wherein virally-derived DNA or RNA sequences are present in the vector for packaging into a virus (e.g. retroviruses, replication defective retroviruses, adenoviruses, replication defective adenoviruses, and adeno-associated viruses).
- Viral vectors also include polynucleotides carried by a virus for transfection into a host cell.
- vectors are capable of autonomous replication in a host cell into which they are introduced (e.g. bacterial vectors having a bacterial origin of replication and episomal mammalian vectors). Other vectors (e.g., non-episomal mammalian vectors) are integrated into the genome of a host cell upon introduction into the host cell, and thereby are replicated along with the host genome. Moreover, certain vectors are capable of directing the expression of genes to which they are operatively-linked. Such vectors are referred to herein as “expression vectors.” Common expression vectors of utility in recombinant DNA techniques are often in the form of plasmids.
- Recombinant expression vectors can comprise a nucleic acid of the invention in a form suitable for expression of the nucleic acid in a host cell, which means that the recombinant expression vectors include one or more regulatory elements, which may be selected on the basis of the host cells to be used for expression, that is operatively-linked to the nucleic acid sequence to be expressed.
- “operably linked” is intended to mean that the nucleotide sequence of interest is linked to the regulatory element(s) in a manner that allows for expression of the nucleotide sequence (e.g. in an in vitro transcription/translation system or in a host cell when the vector is introduced into the host cell).
- regulatory element is intended to include promoters, enhancers, internal ribosomal entry sites (IRES), and other expression control elements (e.g. transcription termination signals, such as polyadenylation signals and poly-U sequences).
- promoters e.g. promoters, enhancers, internal ribosomal entry sites (IRES), and other expression control elements (e.g. transcription termination signals, such as polyadenylation signals and poly-U sequences).
- IRES internal ribosomal entry sites
- regulatory elements e.g. transcription termination signals, such as polyadenylation signals and poly-U sequences.
- Regulatory elements include those that direct constitutive expression of a nucleotide sequence in many types of host cell and those that direct expression of the nucleotide sequence only in certain host cells (e.g., tissue-specific regulatory sequences).
- a tissue-specific promoter may direct expression primarily in a desired tissue of interest, such as muscle, neuron, bone, skin, blood, specific organs (e.g. liver, pancreas), or particular cell types (e.g. lymphocytes). Regulatory elements may also direct expression in a temporal-dependent manner, such as in a cell-cycle dependent or developmental stage-dependent manner, which may or may not also be tissue or cell-type specific.
- a vector comprises one or more pol III promoter (e.g. 1, 2, 3, 4, 5, or more pol III promoters), one or more pol II promoters (e.g. 1, 2, 3, 4, 5, or more pol II promoters), one or more pol I promoters (e.g.
- pol III promoters include, but are not limited to, U6 and H1 promoters.
- pol II promoters include, but are not limited to, the retroviral Rous sarcoma virus (RSV) LTR promoter (optionally with the RSV enhancer), the cytomegalovirus (CMV) promoter (optionally with the CMV enhancer) [see, e.g., Boshart et al, Cell, 41:521-530 (1985)], the SV40 promoter, the dihydrofolate reductase promoter, the ⁇ -actin promoter, the phosphoglycerol kinase (PGK) promoter, and the EF1 ⁇ promoter.
- RSV Rous sarcoma virus
- CMV cytomegalovirus
- PGK phosphoglycerol kinase
- enhancer elements such as WPRE; CMV enhancers; the R-U5′ segment in LTR of HTLV-I (Mol. Cell. Biol., Vol. 8(1), p. 466-472, 1988); SV40 enhancer; and the intron sequence between exons 2 and 3 of rabbit ⁇ -globin (Proc. Natl. Acad. Sci. USA., Vol. 78(3), p. 1527-31, 1981).
- WPRE WPRE
- CMV enhancers the R-U5′ segment in LTR of HTLV-I
- SV40 enhancer SV40 enhancer
- the intron sequence between exons 2 and 3 of rabbit ⁇ -globin Proc. Natl. Acad. Sci. USA., Vol. 78(3), p. 1527-31, 1981.
- a vector can be introduced into host cells to thereby produce transcripts, proteins, or peptides, including fusion proteins or peptides, encoded by nucleic acids as described herein (e.g., clustered regularly interspersed short palindromic repeats (CRISPR) transcripts, proteins, enzymes, mutant forms thereof, fusion proteins thereof, etc.).
- CRISPR clustered regularly interspersed short palindromic repeats
- Advantageous vectors include lentiviruses and adeno-associated viruses, and types of such vectors can also be selected for targeting particular types of cells.
- the invention provides a eukaryotic host cell comprising (a) a first regulatory element operably linked to a tracr mate sequence and one or more insertion sites for inserting one or more guide sequences upstream of the tracr mate sequence, wherein when expressed, the guide sequence directs sequence-specific binding of a CRISPR complex to a target sequence in a eukaryotic cell, wherein the CRISPR complex comprises a CRISPR enzyme complexed with (1) the guide sequence that is hybridized to the target sequence, and (2) the tracr mate sequence that is hybridized to the tracr sequence; and/or (b) a second regulatory element operably linked to an enzyme-coding sequence encoding said CRISPR enzyme comprising a nuclear localization sequence.
- the host cell comprises components (a) and (b).
- component (a), component (b), or components (a) and (b) are stably integrated into a genome of the host eukaryotic cell.
- component (a) further comprises the tracr sequence downstream of the tracr mate sequence under the control of the first regulatory element.
- component (a) further comprises two or more guide sequences operably linked to the first regulatory element, wherein when expressed, each of the two or more guide sequences direct sequence specific binding of a CRISPR complex to a different target sequence in a eukaryotic cell.
- the eukaryotic host cell further comprises a third regulatory element, such as a polymerase III promoter, operably linked to said tracr sequence.
- the tracr sequence exhibits at least 50%. 60%, 70%, 80%, 90%, 95%, or 99% of sequence complementarity along the length of the tracr mate sequence when optimally aligned.
- the enzyme may be a Cas9 homolog or ortholog.
- the CRISPR enzyme is codon-optimized for expression in a eukaryotic cell.
- the CRISPR enzyme directs cleavage of one or two strands at the location of the target sequence.
- the CRISPR enzyme lacks DNA strand cleavage activity.
- the first regulatory element is a polymerase III promoter.
- the second regulatory element is a polymerase II promoter.
- the guide sequence is at least 15, 16, 17, 18, 19, 20, 25 nucleotides, or between 10-30, or between 15-25, or between 15-20 nucleotides in length.
- the invention provides a non-human eukaryotic organism; preferably a multicellular eukaryotic organism, comprising a eukaryotic host cell according to any of the described embodiments.
- the invention provides a eukaryotic organism; preferably a multicellular eukaryotic organism, comprising a eukaryotic host cell according to any of the described embodiments.
- the organism in some embodiments of these aspects may be an animal; for example a mammal. Also, the organism may be an arthropod such as an insect. The organism also may be a plant. Further, the organism may be a fungus.
- the invention provides a kit comprising one or more of the components described herein.
- the kit comprises a vector system and instructions for using the kit.
- the vector system comprises (a) a first regulatory element operably linked to a tracr mate sequence and one or more insertion sites for inserting one or more guide sequences upstream of the tracr mate sequence, wherein when expressed, the guide sequence directs sequence-specific binding of a CRISPR complex to a target sequence in a eukaryotic cell, wherein the CRISPR complex comprises a CRISPR enzyme complexed with (1) the guide sequence that is hybridized to the target sequence, and (2) the tracr mate sequence that is hybridized to the tracr sequence; and/or (b) a second regulatory element operably linked to an enzyme-coding sequence encoding said CRISPR enzyme comprising a nuclear localization sequence.
- the kit comprises components (a) and (b) located on the same or different vectors of the system.
- component (a) further comprises the tracr sequence downstream of the tracr mate sequence under the control of the first regulatory element.
- component (a) further comprises two or more guide sequences operably linked to the first regulatory element, wherein when expressed, each of the two or more guide sequences direct sequence specific binding of a CRISPR complex to a different target sequence in a eukaryotic cell.
- the system further comprises a third regulatory element, such as a polymerase III promoter, operably linked to said tracr sequence.
- the tracr sequence exhibits at least 50%, 60%, 70%, 80%, 90%, 95%, or 99% of sequence complementarity along the length of the tracr mate sequence when optimally aligned.
- the CRISPR enzyme comprises one or more nuclear localization sequences of sufficient strength to drive accumulation of said CRISPR enzyme in a detectable amount in the nucleus of a eukaryotic cell.
- the CRISPR enzyme is a type II CRISPR system enzyme.
- the CRISPR enzyme is a Cas9 enzyme.
- the Cas9 enzyme is S. pneumoniae, S. pyogenes or S.
- thermophilus Cas9 and may include mutated Cas9 derived from these organisms.
- the enzyme may be a Cas9 homolog or ortholog.
- the CRISPR enzyme is codon-optimized for expression in a eukaryotic cell.
- the CRISPR enzyme directs cleavage of one or two strands at the location of the target sequence.
- the CRISPR enzyme lacks DNA strand cleavage activity.
- the first regulatory element is a polymerase III promoter.
- the second regulatory element is a polymerase II promoter.
- the guide sequence is at least 15, 16, 17, 18, 19, 20, 25 nucleotides, or between 10-30, or between 15-25, or between 15-20 nucleotides in length.
- the invention provides a method of modifying a target polynucleotide in a eukaryotic cell.
- the method comprises allowing a CRISPR complex to bind to the target polynucleotide to effect cleavage of said target polynucleotide thereby modifying the target polynucleotide, wherein the CRISPR complex comprises a CRISPR enzyme complexed with a guide sequence hybridized to a target sequence within said target polynucleotide, wherein said guide sequence is linked to a tracr mate sequence which in turn hybridizes to a tracr sequence.
- said cleavage comprises cleaving one or two strands at the location of the target sequence by said CRISPR enzyme. In some embodiments, said cleavage results in decreased transcription of a target gene. In some embodiments, the method further comprises repairing said cleaved target polynucleotide by homologous recombination with an exogenous template polynucleotide, wherein said repair results in a mutation comprising an insertion, deletion, or substitution of one or more nucleotides of said target polynucleotide. In some embodiments, said mutation results in one or more amino acid changes in a protein expressed from a gene comprising the target sequence.
- the method further comprises delivering one or more vectors to said eukaryotic cell, wherein the one or more vectors drive expression of one or more of: the CRISPR enzyme, the guide sequence linked to the tracr mate sequence, and the tracr sequence.
- said vectors are delivered to the eukaryotic cell in a subject.
- said modifying takes place in said eukaryotic cell in a cell culture.
- the method further comprises isolating said eukaryotic cell from a subject prior to said modifying.
- the method further comprises returning said eukaryotic cell and/or cells derived therefrom to said subject.
- the invention provides a method of modifying expression of a polynucleotide in a eukaryotic cell.
- the method comprises allowing a CRISPR complex to bind to the polynucleotide such that said binding results in increased or decreased expression of said polynucleotide; wherein the CRISPR complex comprises a CRISPR enzyme complexed with a guide sequence hybridized to a target sequence within said polynucleotide, wherein said guide sequence is linked to a tracr mate sequence which in turn hybridizes to a tracr sequence.
- the method further comprises delivering one or more vectors to said eukaryotic cells, wherein the one or more vectors drive expression of one or more of: the CRISPR enzyme, the guide sequence linked to the tracr mate sequence, and the tracr sequence.
- the invention provides a method of generating a model eukaryotic cell comprising a mutated disease gene.
- a disease gene is any gene associated an increase in the risk of having or developing a disease.
- the method comprises (a) introducing one or more vectors into a eukaryotic cell, wherein the one or more vectors drive expression of one or more of: a CRISPR enzyme, a guide sequence linked to a tracr mate sequence, and a tracr sequence; and (b) allowing a CRISPR complex to bind to a target polynucleotide to effect cleavage of the target polynucleotide within said disease gene, wherein the CRISPR complex comprises the CRISPR enzyme complexed with (1) the guide sequence that is hybridized to the target sequence within the target polynucleotide, and (2) the tracr mate sequence that is hybridized to the tracr sequence, thereby generating a model eukaryotic cell comprising
- said cleavage comprises cleaving one or two strands at the location of the target sequence by said CRISPR enzyme. In some embodiments, said cleavage results in decreased transcription of a target gene. In some embodiments, the method further comprises repairing said cleaved target polynucleotide by homologous recombination with an exogenous template polynucleotide, wherein said repair results in a mutation comprising an insertion, deletion, or substitution of one or more nucleotides of said target polynucleotide. In some embodiments, said mutation results in one or more amino acid changes in a protein expression from a gene comprising the target sequence.
- the invention provides a method for developing a biologically active agent that modulates a cell signaling event associated with a disease gene.
- a disease gene is any gene associated an increase in the risk of having or developing a disease.
- the method comprises (a) contacting a test compound with a model cell of any one of the described embodiments; and (b) detecting a change in a readout that is indicative of a reduction or an augmentation of a cell signaling event associated with said mutation in said disease gene, thereby developing said biologically active agent that modulates said cell signaling event associated with said disease gene.
- the invention provides a recombinant polynucleotide comprising a guide sequence upstream of a tracr mate sequence, wherein the guide sequence when expressed directs sequence-specific binding of a CRISPR complex to a corresponding target sequence present in a eukaryotic cell.
- the target sequence is a viral sequence present in a eukaryotic cell.
- the target sequence is a proto-oncogene or an oncogene.
- the invention provides for a method of selecting one or more cell(s) by introducing one or more mutations in a gene in the one or more cell (s), the method comprising: introducing one or more vectors into the cell (s), wherein the one or more vectors drive expression of one or more of: a CRISPR enzyme, a guide sequence linked to a tracr mate sequence, a tracr sequence, and an editing template; wherein the editing template comprises the one or more mutations that abolish CRISPR enzyme cleavage; allowing homologous recombination of the editing template with the target polynucleotide in the cell(s) to be selected; allowing a CRISPR complex to bind to a target polynucleotide to effect cleavage of the target polynucleotide within said gene, wherein the CRISPR complex comprises the CRISPR enzyme complexed with (1) the guide sequence that is hybridized to the target sequence within the target polynucleotide, and (2) the tracr mate
- the CRISPR enzyme is a type II CRISPR system enzyme.
- the CRISPR enzyme is a Cas9 protein.
- the Cas9 protein is S. pneumoniae, S. pyogenes , or S. thermophilus Cas9, and may include mutated Cas9 derived from these organisms.
- the enzyme may be a Cas9 homolog or ortholog.
- the enzyme is codon-optimized for expression in a eukaryotic cell.
- the enzyme directs cleavage of one or two strands at the location of the target sequence.
- the CRISPR enzyme is Cas9.
- the cell to be selected may be a eukaryotic cell. Aspects of the invention allow for selection of specific cells without requiring a selection marker or a two-step process that may include a counter-selection system.
- aspects of the invention comprehend site-specific gene knockout in the endogenous genome:
- the present invention is advantageous over using site-specific nuclease technologies based on zinc finger and TAL effectors as it does not require elaborate design and may be used to simultaneously knockout multiple genes within the same genome.
- the invention comprehends site-specific genome editing.
- the present invention is advantageous over using natural or artificial site-specific nucleases or recombinases as it may be able to introduce site-specific double strand breaks to facilitate homologous recombination at the targeted genome loci.
- the invention comprehends DNA sequence-specific interference.
- the invention may be used to inactivate the genome of deleterious DNA-based organisms, such as microbes, viruses, or even cancerous cells, by directly introducing breaks at specific sites in the genome of these organisms.
- the invention provides methods and compositions for multiplexed genome engineering as the CRISPR-Cas system of the invention can be easily targeted to multiple sites in the genome through the use of multiple sequence-specific CRISPR spacer elements or guide sequences.
- FIG. 1 shows a schematic model of the CRISPR system.
- the Cas9 nuclease from Streptococcus pyogenes (yellow) is targeted to genomic DNA by a synthetic guide RNA (sgRNA) consisting of a 20-nt guide sequence (blue) and a scaffold (red).
- the guide sequence base-pairs with the DNA target (blue), directly upstream of a requisite 5′-NGG protospacer adjacent motif (PAM; magenta), and Cas9 mediates a double-stranded break (DSB) ⁇ 3 bp upstream of the PAM (red triangle).
- PAM magenta
- FIG. 2A-F shows an exemplary CRISPR system, a possible mechanism of action, an example adaptation for expression in eukaryotic cells, and results of tests assessing nuclear localization and CRISPR activity.
- FIG. 2C discloses SEQ ID NOS 23-24, respectively, in order of appearance.
- FIG. 2E discloses SEQ ID NOS 25-27, respectively, in order of appearance.
- FIG. 2F discloses SEQ ID NOS 28-32, respectively, in order of appearance.
- FIG. 3A-D shows results of an evaluation of SpCas9 specificity for an example target.
- FIG. 3A discloses SEQ ID NOS 33, 26 and 34-44, respectively, in order of appearance.
- FIG. 3C discloses SEQ ID NO: 33.
- FIG. 4A-G shows an exemplary vector system and results for its use in directing homologous recombination in eukaryotic cells.
- FIG. 4E discloses SEQ ID NO: 45.
- FIG. 4F discloses SEQ ID NOS 46-47, respectively, in order of appearance.
- FIG. 4G discloses SEQ ID NOS 48-52, respectively, in order of appearance.
- FIG. 5 provides a table of protospacer sequences (SEQ ID NOS 16, 15, 14, 53-58, 18, 17 and 59-63, respectively, in order of appearance) and summarizes modification efficiency results for protospacer targets designed based on exemplary S. pyogenes and S. thermophilus CRISPR systems with corresponding PAMs against loci in human and mouse genomes.
- FIG. 6A-C shows a comparison of different tracrRNA transcripts for Cas9-mediated gene targeting.
- FIG. 6A discloses SEQ ID NOS 64-65, respectively, in order of appearance.
- FIG. 7 shows a schematic of a surveyor nuclease assay for detection of double strand break-induced micro-insertions and -deletions.
- FIG. 8A-B shows exemplary bicistronic expression vectors for expression of CRISPR system elements in eukaryotic cells.
- FIG. 8A discloses SEQ ID NOS 66-68, respectively, in order of appearance.
- FIG. 8B discloses SEQ ID NOS 69-71, respectively, in order of appearance.
- FIG. 9A-C shows histograms of distances between adjacent S. pyogenes SF370 locus 1 PAM (NGG) ( FIG. 9A ) and S. thermophilus LMD9 locus 2 PAM (NNAGAAW) ( FIG. 9B ) in the human genome; and distances for each PAM by chromosome (Chr) ( FIG. 9C ).
- FIG. 10A-D shows an exemplary CRISPR system, an example adaptation for expression in eukaryotic cells, and results of tests assessing CRISPR activity.
- FIG. 10B discloses SEQ ID NOS 72-73, respectively, in order of appearance.
- FIG. 10C discloses SEQ ID NO: 74.
- FIG. 11A-C shows exemplary manipulations of a CRISPR system for targeting of genomic loci in mammalian cells.
- FIG. 11A discloses SEQ ID NO: 75.
- FIG. 11B discloses SEQ ID NOS 76-78, respectively, in order of appearance.
- FIG. 12A-B shows the results of a Northern blot analysis of crRNA processing in mammalian cells.
- FIG. 12A discloses SEQ ID NO: 79.
- FIG. 13A-B shows an exemplary selection of protospacers in the human PVALB and mouse Th loci.
- FIG. 13A discloses SEQ ID NO: 80.
- FIG. 13B discloses SEQ ID NO: 81.
- FIG. 14 shows example protospacer and corresponding PAM sequence targets of the S. thermophilus CRISPR system in the human EMX1 locus.
- FIG. 14 discloses SEQ ID NO: 74.
- FIG. 15 provides a table of sequences (SEQ ID NOS 82-93, respectively, in order of appearance) for primers and probes used for Surveyor, RFLP, genomic sequencing, and Northern blot assays.
- FIG. 16A-C shows exemplary manipulation of a CRISPR system with chimeric RNAs and results of SURVEYOR assays for system activity in eukaryotic cells.
- FIG. 16A discloses SEQ ID NO: 94.
- FIG. 17A-B shows a graphical representation of the results of SURVEYOR assays for CRISPR system activity in eukaryotic cells.
- FIG. 18 shows an exemplary visualization of some S. pyogenes Cas9 target sites in the human genome using the UCSC genome browser.
- FIG. 18 discloses SEQ ID NOS 95-173, respectively, in order of appearance.
- FIG. 19A-D shows a circular depiction of the phylogenetic analysis revealing five families of Cas9s, including three groups of large Cas9s ( ⁇ 1400 amino acids) and two of small Cas9s ( ⁇ 1100 amino acids).
- FIG. 20A-F shows the linear depiction of the phylogenetic analysis revealing five families of Cas9s, including three groups of large Cas9s ( ⁇ 1400 amino acids) and two of small Cas9s ( ⁇ 1100 amino acids).
- FIG. 21A-D shows genome editing via homologous recombination.
- FIG. 21C discloses SEQ ID NOS 174-176, 174, 177 and 176, respectively, in order of appearance.
- FIG. 22A-B shows single vector designs for SpCas9.
- FIG. 22A discloses SEQ ID NOS 178-180, respectively, in order of appearance.
- FIG. 22B discloses SEQ ID NO: 181.
- polynucleotide refers to a polymeric form of nucleotides of any length, either deoxyribonucleotides or ribonucleotides, or analogs thereof.
- Polynucleotides may have any three dimensional structure, and may perform any function, known or unknown.
- polynucleotides coding or non-coding regions of a gene or gene fragment, loci (locus) defined from linkage analysis, exons, introns, messenger RNA (mRNA), transfer RNA, ribosomal RNA, short interfering RNA (siRNA), short-hairpin RNA (shRNA), micro-RNA (miRNA), ribozymes, cDNA, recombinant polynucleotides, branched polynucleotides, plasmids, vectors, isolated DNA of any sequence, isolated RNA of any sequence, nucleic acid probes, and primers.
- loci locus defined from linkage analysis, exons, introns, messenger RNA (mRNA), transfer RNA, ribosomal RNA, short interfering RNA (siRNA), short-hairpin RNA (shRNA), micro-RNA (miRNA), ribozymes, cDNA, recombinant polynucleotides, branched poly
- a polynucleotide may comprise one or more modified nucleotides, such as methylated nucleotides and nucleotide analogs. If present, modifications to the nucleotide structure may be imparted before or after assembly of the polymer. The sequence of nucleotides may be interrupted by non nucleotide components. A polynucleotide may be further modified after polymerization, such as by conjugation with a labeling component.
- chimeric RNA refers to the polynucleotide sequence comprising the guide sequence, the tracr sequence and the tracr mate sequence.
- guide sequence refers to the about 20 bp sequence within the guide RNA that specifies the target site and may be used interchangeably with the terms “guide” or “spacer”.
- tracr mate sequence may also be used interchangeably with the term “direct repeat(s)”.
- FIG. 1 An exemplary CRISPR-Cas system is illustrated in FIG. 1 .
- wild type is a term of the art understood by skilled persons and means the typical form of an organism, strain, gene or characteristic as it occurs in nature as distinguished from mutant or variant forms.
- variable should be taken to mean the exhibition of qualities that have a pattern that deviates from what occurs in nature.
- nucleic acid molecules or polypeptides mean that the nucleic acid molecule or the polypeptide is at least substantially free from at least one other component with which they are naturally associated in nature and as found in nature.
- “Complementarity” refers to the ability of a nucleic acid to form hydrogen bond(s) with another nucleic acid sequence by either traditional Watson-Crick or other non-traditional types.
- a percent complementarity indicates the percentage of residues in a nucleic acid molecule which can form hydrogen bonds (e.g., Watson-Crick base pairing) with a second nucleic acid sequence (e.g., 5, 6, 7, 8, 9, 10 out of 10 being 50%, 60%, 70%, 80%, 90%, and 100% complementary).
- Perfectly complementary means that all the contiguous residues of a nucleic acid sequence will hydrogen bond with the same number of contiguous residues in a second nucleic acid sequence.
- “Substantially complementary” as used herein refers to a degree of complementarity that is at least 60%. 65%, 70%, 75%, 80%, 85%, 90%, 95%, 97%, 98%, 99%, or 100% over a region of 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 30, 35, 40, 45, 50, or more nucleotides, or refers to two nucleic acids that hybridize under stringent conditions.
- stringent conditions for hybridization refer to conditions under which a nucleic acid having complementarity to a target sequence predominantly hybridizes with the target sequence, and substantially does not hybridize to non-target sequences. Stringent conditions are generally sequence-dependent, and vary depending on a number of factors. In general, the longer the sequence, the higher the temperature at which the sequence specifically hybridizes to its target sequence. Non-limiting examples of stringent conditions are described in detail in Tijssen (1993), Laboratory Techniques In Biochemistry And Molecular Biology-Hybridization With Nucleic Acid Probes Part I, Second Chapter “Overview of principles of hybridization and the strategy of nucleic acid probe assay”, Elsevier, N.Y.
- Hybridization refers to a reaction in which one or more polynucleotides react to form a complex that is stabilized via hydrogen bonding between the bases of the nucleotide residues.
- the hydrogen bonding may occur by Watson Crick base pairing, Hoogstein binding, or in any other sequence specific manner.
- the complex may comprise two strands forming a duplex structure, three or more strands forming a multi stranded complex, a single self hybridizing strand, or any combination of these.
- a hybridization reaction may constitute a step in a more extensive process, such as the initiation of PCR, or the cleavage of a polynucleotide by an enzyme.
- a sequence capable of hybridizing with a given sequence is referred to as the “complement” of the given sequence.
- expression refers to the process by which a polynucleotide is transcribed from a DNA template (such as into and mRNA or other RNA transcript) and/or the process by which a transcribed mRNA is subsequently translated into peptides, polypeptides, or proteins.
- Transcripts and encoded polypeptides may be collectively referred to as “gene product.” If the polynucleotide is derived from genomic DNA, expression may include splicing of the mRNA in a eukaryotic cell.
- polypeptide refers to polymers of amino acids of any length.
- the polymer may be linear or branched, it may comprise modified amino acids, and it may be interrupted by non amino acids.
- the terms also encompass an amino acid polymer that has been modified; for example, disulfide bond formation, glycosylation, lipidation, acetylation, phosphorylation, or any other manipulation, such as conjugation with a labeling component.
- amino acid includes natural and/or unnatural or synthetic amino acids, including glycine and both the D or L optical isomers, and amino acid analogs and peptidomimetics.
- subject refers to a vertebrate, preferably a mammal, more preferably a human.
- Mammals include, but are not limited to, murines, simians, humans, farm animals, sport animals, and pets. Tissues, cells and their progeny of a biological entity obtained in vivo or cultured in vitro are also encompassed.
- therapeutic agent refers to a molecule or compound that confers some beneficial effect upon administration to a subject.
- the beneficial effect includes enablement of diagnostic determinations; amelioration of a disease, symptom, disorder, or pathological condition; reducing or preventing the onset of a disease, symptom, disorder or condition; and generally counteracting a disease, symptom, disorder or pathological condition.
- treatment or “treating,” or “palliating” or “ameliorating” are used interchangeably. These terms refer to an approach for obtaining beneficial or desired results including but not limited to a therapeutic benefit and/or a prophylactic benefit.
- therapeutic benefit is meant any therapeutically relevant improvement in or effect on one or more diseases, conditions, or symptoms under treatment.
- the compositions may be administered to a subject at risk of developing a particular disease, condition, or symptom, or to a subject reporting one or more of the physiological symptoms of a disease, even though the disease, condition, or symptom may not have yet been manifested.
- an effective amount refers to the amount of an agent that is sufficient to effect beneficial or desired results.
- the therapeutically effective amount may vary depending upon one or more of: the subject and disease condition being treated, the weight and age of the subject, the severity of the disease condition, the manner of administration and the like, which can readily be determined by one of ordinary skill in the art.
- the term also applies to a dose that will provide an image for detection by any one of the imaging methods described herein.
- the specific dose may vary depending on one or more of: the particular agent chosen, the dosing regimen to be followed, whether it is administered in combination with other compounds, timing of administration, the tissue to be imaged, and the physical delivery system in which it is carried.
- Vectors can be designed for expression of CRISPR transcripts (e.g. nucleic acid transcripts, proteins, or enzymes) in prokaryotic or eukaryotic cells.
- CRISPR transcripts e.g. nucleic acid transcripts, proteins, or enzymes
- CRISPR transcripts can be expressed in bacterial cells such as Escherichia coli , insect cells (using baculovirus expression vectors), yeast cells, or mammalian cells. Suitable host cells are discussed further in Goeddel, GENE EXPRESSION TECHNOLOGY: METHODS IN ENZYMOLOGY 185, Academic Press, San Diego, Calif. (1990).
- the recombinant expression vector can be transcribed and translated in vitro, for example using T7 promoter regulatory sequences and T7 polymerase.
- Vectors may be introduced and propagated in a prokaryote.
- a prokaryote is used to amplify copies of a vector to be introduced into a eukaryotic cell or as an intermediate vector in the production of a vector to be introduced into a eukaryotic cell (e.g. amplifying a plasmid as part of a viral vector packaging system).
- a prokaryote is used to amplify copies of a vector and express one or more nucleic acids, such as to provide a source of one or more proteins for delivery to a host cell or host organism.
- Fusion vectors add a number of amino acids to a protein encoded therein, such as to the amino terminus of the recombinant protein.
- Such fusion vectors may serve one or more purposes, such as: (i) to increase expression of recombinant protein; (ii) to increase the solubility of the recombinant protein; and (iii) to aid in the purification of the recombinant protein by acting as a ligand in affinity purification.
- a proteolytic cleavage site is introduced at the junction of the fusion moiety and the recombinant protein to enable separation of the recombinant protein from the fusion moiety subsequent to purification of the fusion protein.
- enzymes, and their cognate recognition sequences include Factor Xa, thrombin and enterokinase.
- Example fusion expression vectors include pGEX (Pharmacia Biotech Inc; Smith and Johnson, 1988 .
- GST glutathione S-transferase
- E. coli expression vectors examples include pTrc (Amrann et al., (1988) Gene 69:301-315) and pET 11d (Studier et al., GENE EXPRESSION TECHNOLOGY: METHODS IN ENZYMOLOGY 185, Academic Press, San Diego, Calif. (1990) 60-89).
- a vector is a yeast expression vector.
- yeast Saccharomyces cerivisae examples include pYepSec1 (Baldari, et al., 1987 . EMBO J. 6: 229-234), pMFa (Kuijan and Herskowitz, 1982. Cell 30: 933-943), pJRY88 (Schultz et al., 1987 . Gene 54: 113-123), pYES2 (Invitrogen Corporation, San Diego, Calif.), and picZ (InVitrogen Corp, San Diego, Calif.).
- a vector drives protein expression in insect cells using baculovirus expression vectors.
- Baculovirus vectors available for expression of proteins in cultured insect cells include the pAc series (Smith, et al., 1983 . Mol. Cell. Biol. 3: 2156-2165) and the pVL series (Lucklow and Summers, 1989 . Virology 170: 31-39).
- a vector is capable of driving expression of one or more sequences in mammalian cells using a mammalian expression vector.
- mammalian expression vectors include pCDM8 (Seed, 1987 . Nature 329: 840) and pMT2PC (Kaufman, et al., 1987 . EMBO J. 6: 187-195).
- the expression vector's control functions are typically provided by one or more regulatory elements.
- commonly used promoters are derived from polyoma, adenovirus 2, cytomegalovirus, simian virus 40, and others disclosed herein and known in the art.
- the recombinant mammalian expression vector is capable of directing expression of the nucleic acid preferentially in a particular cell type (e.g., tissue-specific regulatory elements are used to express the nucleic acid).
- tissue-specific regulatory elements are known in the art.
- suitable tissue-specific promoters include the albumin promoter (liver-specific; Pinkert, et al., 1987 . Genes Dev. 1: 268-277), lymphoid-specific promoters (Calame and Eaton, 1988 . Adv. Immunol. 43: 235-275), in particular promoters of T cell receptors (Winoto and Baltimore, 1989 . EMBO J.
- promoters are also encompassed, e.g., the murine hox promoters (Kessel and Gruss, 1990 . Science 249: 374-379) and the ⁇ -fetoprotein promoter (Campes and Tilghman, 1989 . Genes Dev. 3: 537-546).
- a regulatory element is operably linked to one or more elements of a CRISPR system so as to drive expression of the one or more elements of the CRISPR system.
- CRISPRs Clustered Regularly Interspaced Short Palindromic Repeats
- SPIDRs Sacer Interspersed Direct Repeats
- the CRISPR locus comprises a distinct class of interspersed short sequence repeats (SSRs) that were recognized in E. coli (Ishino et al., J. Bacteriol., 169:5429-5433 [1987]; and Nakata et al., J.
- the CRISPR loci typically differ from other SSRs by the structure of the repeats, which have been termed short regularly spaced repeats (SRSRs) (Janssen et al., OMICS J. Integ. Biol., 6:23-33 [2002]; and Mojica et al., Mol. Microbiol., 36:244-246 [2000]).
- SRSRs short regularly spaced repeats
- the repeats are short elements that occur in clusters that are regularly spaced by unique intervening sequences with a substantially constant length (Mojica et al., [2000], supra).
- the repeat sequences are highly conserved between strains, the number of interspersed repeats and the sequences of the spacer regions typically differ from strain to strain (van Embden et al., J.
- CRISPR loci have been identified in more than 40 prokaryotes (See e.g., Jansen et al., Mol. Microbiol., 43:1565-1575 [2002]; and Mojica et al., [2005]) including, but not limited to Aeropyruinm, Pvrobaculum, Sulfolobus, Archaeoglobus, Halocarcula, Methanobacterium, Methanococcus, Methanosarcina, Methanopyrus, Pvrococcus, Picrophilus, Thermoplasma, Corynebacterium, Mycobacterium, Streptoinyces, Aquifex, Porphyroimonas, Chlorobium, Thermnus, Bacillus, Listeria, Staphylococcus, Clostridium, Thermoanaerobacter, Mycoplasma, Fusobacterium, Azarcus, Chromobacterium
- CRISPR system refers collectively to transcripts and other elements involved in the expression of or directing the activity of CRISPR-associated (“Cas”) genes, including sequences encoding a Cas gene, a tracr (trans-activating CRISPR) sequence (e.g. tracrRNA or an active partial tracrRNA), a tracr-mate sequence (encompassing a “direct repeat” and a tracrRNA-processed partial direct repeat in the context of an endogenous CRISPR system), a guide sequence (also referred to as a “spacer” in the context of an endogenous CRISPR system), or other sequences and transcripts from a CRISPR locus.
- a tracr trans-activating CRISPR
- tracr-mate sequence encompassing a “direct repeat” and a tracrRNA-processed partial direct repeat in the context of an endogenous CRISPR system
- guide sequence also referred to as a “spacer” in the context of an endogenous CRISPR system
- one or more elements of a CRISPR system is derived from a type 1, type II, or type III CRISPR system. In some embodiments, one or more elements of a CRISPR system is derived from a particular organism comprising an endogenous CRISPR system, such as Streptococcus pyogenes . In general, a CRISPR system is characterized by elements that promote the formation of a CRISPR complex at the site of a target sequence (also referred to as a protospacer in the context of an endogenous CRISPR system).
- target sequence refers to a sequence to which a guide sequence is designed to have complementarity, where hybridization between a target sequence and a guide sequence promotes the formation of a CRISPR complex. Full complementarity is not necessarily required, provided there is sufficient complementarity to cause hybridization and promote formation of a CRISPR complex.
- a target sequence may comprise any polynucleotide, such as DNA or RNA polynucleotides.
- a target sequence is located in the nucleus or cytoplasm of a cell.
- the target sequence may be within an organelle of a eukaryotic cell, for example, mitochondrion or chloroplast.
- a sequence or template that may be used for recombination into the targeted locus comprising the target sequences is referred to as an “editing template” or “editing polynucleotide” or “editing sequence”.
- an exogenous template polynucleotide may be referred to as an editing template.
- the recombination is homologous recombination.
- a CRISPR complex comprising a guide sequence hybridized to a target sequence and complexed with one or more Cas proteins
- formation of a CRISPR complex results in cleavage of one or both strands in or near (e.g. within 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 50, or more base pairs from) the target sequence.
- the tracr sequence which may comprise or consist of all or a portion of a wild-type tracr sequence (e.g.
- a wild-type tracr sequence may also form part of a CRISPR complex, such as by hybridization along at least a portion of the tracr sequence to all or a portion of a tracr mate sequence that is operably linked to the guide sequence.
- the tracr sequence has sufficient complementarity to a tracr mate sequence to hybridize and participate in formation of a CRISPR complex. As with the target sequence, it is believed that complete complementarity is not needed, provided there is sufficient to be functional.
- the tracr sequence has at least 50%, 60%, 70%, 80%, 90%, 95% or 99% of sequence complementarity along the length of the tracr mate sequence when optimally aligned.
- one or more vectors driving expression of one or more elements of a CRISPR system are introduced into a host cell such that expression of the elements of the CRISPR system direct formation of a CRISPR complex at one or more target sites.
- a Cas enzyme, a guide sequence linked to a tracr-mate sequence, and a tracr sequence could each be operably linked to separate regulatory elements on separate vectors.
- two or more of the elements expressed from the same or different regulatory elements may be combined in a single vector, with one or more additional vectors providing any components of the CRISPR system not included in the first vector.
- CRISPR system elements that are combined in a single vector may be arranged in any suitable orientation, such as one element located 5′ with respect to (“upstream” of) or 3′ with respect to (“downstream” of) a second element.
- the coding sequence of one element may be located on the same or opposite strand of the coding sequence of a second element, and oriented in the same or opposite direction.
- a single promoter drives expression of a transcript encoding a CRISPR enzyme and one or more of the guide sequence, tracr mate sequence (optionally operably linked to the guide sequence), and a tracr sequence embedded within one or more intron sequences (e.g. each in a different intron, two or more in at least one intron, or all in a single intron).
- the CRISPR enzyme, guide sequence, tracr mate sequence, and tracr sequence are operably linked to and expressed from the same promoter.
- Single vector constructs for SpCas9 are illustrated in FIG. 22 .
- a vector comprises one or more insertion sites, such as a restriction endonuclease recognition sequence (also referred to as a “cloning site”).
- one or more insertion sites e.g. about or more than about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more insertion sites are located upstream and/or downstream of one or more sequence elements of one or more vectors.
- a vector comprises an insertion site upstream of a tracr mate sequence, and optionally downstream of a regulatory element operably linked to the tracr mate sequence, such that following insertion of a guide sequence into the insertion site and upon expression the guide sequence directs sequence-specific binding of a CRISPR complex to a target sequence in a eukaryotic cell.
- a vector comprises two or more insertion sites, each insertion site being located between two tracr mate sequences so as to allow insertion of a guide sequence at each site.
- the two or more guide sequences may comprise two or more copies of a single guide sequence, two or more different guide sequences, or combinations of these.
- a single expression construct may be used to target CRISPR activity to multiple different, corresponding target sequences within a cell.
- a single vector may comprise about or more than about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, or more guide sequences. In some embodiments, about or more than about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more such guide-sequence-containing vectors may be provided, and optionally delivered to a cell.
- a vector comprises a regulatory element operably linked to an enzyme-coding sequence encoding a CRISPR enzyme, such as a Cas protein.
- Cas proteins include Cas1, Cas1B, Cas2, Cas3, Cas4. Cas5, Cas6, Cas7, Cas8. Cas9 (also known as Csn1 and Csx12), Cas10, Csy1, Csy2, Csy3, Cse1, Cse2, Csc1, Csc2, Csa5, Csn2, Csm2, Csm3, Csm4, Csm5.
- These enzymes are known; for example, the amino acid sequence of S. pyogenes Cas9 protein may be found in the SwissProt database under accession number Q99ZW2.
- the unmodified CRISPR enzyme has DNA cleavage activity, such as Cas9.
- the CRISPR enzyme is Cas9, and may be Cas9 from S. pyogenes or S. pneumoniae .
- the CRISPR enzyme directs cleavage of one or both strands at the location of a target sequence, such as within the target sequence and/or within the complement of the target sequence. In some embodiments, the CRISPR enzyme directs cleavage of one or both strands within about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 50, 100, 200, 500, or more base pairs from the first or last nucleotide of a target sequence.
- a vector encodes a CRISPR enzyme that is mutated to with respect to a corresponding wild-type enzyme such that the mutated CRISPR enzyme lacks the ability to cleave one or both strands of a target polynucleotide containing a target sequence.
- an aspartate-to-alanine substitution (D10A) in the RuvC I catalytic domain of Cas9 from S. pyogenes converts Cas9 from a nuclease that cleaves both strands to a nickase (cleaves a single strand).
- FIG. 21 shows genome editing via homologous recombination.
- FIG. 21 ( a ) shows the schematic of SpCas9 nickase, with D10A mutation in the RuvC I catalytic domain.
- (b) Schematic representing homologous recombination (HR) at the human EMX1 locus using either sense or antisense single stranded oligonucleotides as repair templates.
- a Cas9 nickase may be used in combination with guide sequence(s), e.g., two guide sequences, which target respectively sense and antisense strands of the DNA target. This combination allows both strands to be nicked and used to induce NHEJ.
- guide sequence(s) e.g., two guide sequences, which target respectively sense and antisense strands of the DNA target.
- This combination allows both strands to be nicked and used to induce NHEJ.
- Applicants have demonstrated (data not shown) the efficacy of two nickase targets (i.e., sgRNAs targeted at the same location but to different strands of DNA) in inducing mutagenic NHEJ.
- a single nickase (Cas9-D10A with a single sgRNA) is unable to induce NHEJ and create indels but Applicants have shown that double nickase (Cas9-D10A and two sgRNAs targeted to different strands at the same location) can do so in human embryonic stem cells (hESCs).
- the efficiency is about 50% of nuclease (i.e., regular Cas9 without D10 mutation) in hESCs.
- two or more catalytic domains of Cas9 may be mutated to produce a mutated Cas9 substantially lacking all DNA cleavage activity.
- a D10A mutation is combined with one or more of H840A, N854A, or N863A mutations to produce a Cas9 enzyme substantially lacking all DNA cleavage activity.
- a CRISPR enzyme is considered to substantially lack all DNA cleavage activity when the DNA cleavage activity of the mutated enzyme is less than about 25%, 10%, 5%, 1%, 0.1%, 0.01%, or lower with respect to its non-mutated form.
- Other mutations may be useful; where the Cas9 or other CRISPR enzyme is from a species other than S. pyogenes , mutations in corresponding amino acids may be made to achieve similar effects.
- an enzyme coding sequence encoding a CRISPR enzyme is codon optimized for expression in particular cells, such as eukaryotic cells.
- the eukaryotic cells may be those of or derived from a particular organism, such as a mammal, including but not limited to human, mouse, rat, rabbit, dog, or non-human primate.
- codon optimization refers to a process of modifying a nucleic acid sequence for enhanced expression in the host cells of interest by replacing at least one codon (e.g. about or more than about 1, 2, 3, 4, 5, 10, 15, 20, 25, 50, or more codons) of the native sequence with codons that are more frequently or most frequently used in the genes of that host cell while maintaining the native amino acid sequence.
- Codon bias differs in codon usage between organisms
- mRNA messenger RNA
- tRNA transfer RNA
- the predominance of selected tRNAs in a cell is generally a reflection of the codons used most frequently in peptide synthesis. Accordingly, genes can be tailored for optimal gene expression in a given organism based on codon optimization. Codon usage tables are readily available, for example, at the “Codon Usage Database”, and these tables can be adapted in a number of ways.
- codon optimizing a particular sequence for expression in a particular host cell are also available, such as Gene Forge (Aptagen; Jacobus, Pa.), are also available.
- one or more codons e.g. 1, 2, 3, 4, 5, 10, 15, 20, 25, 50, or more, or all codons
- one or more codons in a sequence encoding a CRISPR enzyme correspond to the most frequently used codon for a particular amino acid.
- a guide sequence is any polynucleotide sequence having sufficient complementarity with a target polynucleotide sequence to hybridize with the target sequence and direct sequence-specific binding of a CRISPR complex to the target sequence.
- the degree of complementarity between a guide sequence and its corresponding target sequence, when optimally aligned using a suitable alignment algorithm is about or more than about 50%, 60%, 75%, 80%, 85%, 90%, 95%, 97.5%, 99%, or more.
- Optimal alignment may be determined with the use of any suitable algorithm for aligning sequences, non-limiting example of which include the Smith-Waterman algorithm, the Needleman-Wunsch algorithm, algorithms based on the Burrows-Wheeler Transform (e.g. the Burrows Wheeler Aligner), ClustalW, Clustal X, BLAT, Novoalign (Novocraft Technologies, ELAND (Illumina, San Diego, Calif.), SOAP (available at soap.genomics.org.cn), and Maq (available at maq.sourceforge.net).
- any suitable algorithm for aligning sequences include the Smith-Waterman algorithm, the Needleman-Wunsch algorithm, algorithms based on the Burrows-Wheeler Transform (e.g. the Burrows Wheeler Aligner), ClustalW, Clustal X, BLAT, Novoalign (Novocraft Technologies, ELAND (Illumina, San Diego, Calif.), SOAP (available at soap.genomics.org.cn), and
- a guide sequence is about or more than about 5, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 35, 40, 45, 50, 75, or more nucleotides in length. In some embodiments, a guide sequence is less than about 75, 50, 45, 40, 35, 30, 25, 20, 15, 12, or fewer nucleotides in length. The ability of a guide sequence to direct sequence-specific binding of a CRISPR complex to a target sequence may be assessed by any suitable assay.
- the components of a CRISPR system sufficient to form a CRISPR complex may be provided to a host cell having the corresponding target sequence, such as by transfection with vectors encoding the components of the CRISPR sequence, followed by an assessment of preferential cleavage within the target sequence, such as by Surveyor assay as described herein.
- cleavage of a target polynucleotide sequence may be evaluated in a test tube by providing the target sequence, components of a CRISPR complex, including the guide sequence to be tested and a control guide sequence different from the test guide sequence, and comparing binding or rate of cleavage at the target sequence between the test and control guide sequence reactions.
- Other assays are possible, and will occur to those skilled in the art.
- a guide sequence may be selected to target any target sequence.
- the target sequence is a sequence within a genome of a cell.
- Exemplary target sequences include those that are unique in the target genome.
- a unique target sequence in a genome may include a Cas9 target site of the form MMMMMMMMNNNNNNNNNNNNXGG where NNNNNNNNNNXGG (N is A, G, T, or C; and X can be anything) has a single occurrence in the genome.
- a unique target sequence in a genome may include an S.
- a unique target sequence in a genome may include a Cas9 target site of the form MMMMMMMMNNNNNNNNNNNNXAGAAW (SEQ ID NO: 1) where NNNNNNNNNNXXAGAAW (SEQ ID NO: 2) (N is A, G, T, or C; X can be anything; and W is A or T) has a single occurrence in the genome.
- a unique target sequence in a genome may include an S.
- a unique target sequence in a genome may include a Cas9 target site of the form MMMMMMMMNNNNNNNNNNNNNNNNNNNNNNNNNNNNXGGXG where NNNNNNNNNNNNXGGXG (N is A, G, T, or C; and X can be anything) has a single occurrence in the genome.
- a unique target sequence in a genome may include an S. pyogenes Cas9 target site of the form MMMMMMMMMNNNNNNNNNNNNNXGGXG where NNNNNNNNNXGGXG (N is A, G, T, or C; and X can be anything) has a single occurrence in the genome.
- N is A, G, T, or C; and X can be anything
- M may be A, G, T, or C, and need not be considered in identifying a sequence as unique.
- a guide sequence is selected to reduce the degree of secondary structure within the guide sequence.
- Secondary structure may be determined by any suitable polynucleotide folding algorithm. Some programs are based on calculating the minimal Gibbs free energy. An example of one such algorithm is mFold, as described by Zuker and Stiegler (Nucleic Acids Res. 9 (1981), 133-148). Another example folding algorithm is the online webserver RNAfold, developed at Institute for Theoretical Chemistry at the University of Vienna, using the centroid structure prediction algorithm (see e.g. A. R. Gruber et al., 2008 , Cell 106(1): 23-24; and P A Carr and G M Church, 2009 . Nature Biotechnology 27(12): 1151-62). Further algorithms may be found in U.S. application Ser. No. 61/836,080 (attorney docket 44790.11.2022; Broad Reference BI-2013/004A); incorporated herein by reference.
- a tracr mate sequence includes any sequence that has sufficient complementarity with a tracr sequence to promote one or more of: (1) excision of a guide sequence flanked by tracr mate sequences in a cell containing the corresponding tracr sequence; and (2) formation of a CRISPR complex at a target sequence, wherein the CRISPR complex comprises the tracr mate sequence hybridized to the tracr sequence.
- degree of complementarity is with reference to the optimal alignment of the tracr mate sequence and tracr sequence, along the length of the shorter of the two sequences.
- Optimal alignment may be determined by any suitable alignment algorithm, and may further account for secondary structures, such as self-complementarity within either the tracr sequence or tracr mate sequence.
- the degree of complementarity between the tracr sequence and tracr mate sequence along the length of the shorter of the two when optimally aligned is about or more than about 25%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 97.5%, 99%, or higher.
- Example illustrations of optimal alignment between a tracr sequence and a tracr mate sequence are provided in FIGS. 10B and 11B .
- the tracr sequence is about or more than about 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 40, 50, or more nucleotides in length.
- the tracr sequence and tracr mate sequence are contained within a single transcript, such that hybridization between the two produces a transcript having a secondary structure, such as a hairpin.
- Preferred loop forming sequences for use in hairpin structures are four nucleotides in length, and most preferably have the sequence GAAA. However, longer or shorter loop sequences may be used, as may alternative sequences.
- the sequences preferably include a nucleotide triplet (for example, AAA), and an additional nucleotide (for example C or G). Examples of loop forming sequences include CAAA and AAAG.
- the transcript or transcribed polynucleotide sequence has at least two or more hairpins.
- the transcript has two, three, four or five hairpins. In a further embodiment of the invention, the transcript has at most five hairpins.
- the single transcript further includes a transcription termination sequence; preferably this is a polyT sequence, for example six T nucleotides. An example illustration of such a hairpin structure is provided in the lower portion of FIG. 11B , where the portion of the sequence 5′ of the final “N” and upstream of the loop corresponds to the tracr mate sequence, and the portion of the sequence 3′ of the loop corresponds to the tracr sequence.
- single polynucleotides comprising a guide sequence, a tracr mate sequence, and a tracr sequence are as follows (listed 5′ to 3′), where “N” represents a base of a guide sequence, the first block of lower case letters represent the tracr mate sequence, and the second block of lower case letters represent the tracr sequence, and the final poly-T sequence represents the transcription terminator:
- sequences (1) to (3) are used in combination with Cas9 from S. thermophilus CRISPR1.
- sequences (4) to (6) are used in combination with Cas9 from S. pyogenes .
- the tracr sequence is a separate transcript from a transcript comprising the tracr mate sequence (such as illustrated in the top portion of FIG. 11B ).
- the CRISPR enzyme is part of a fusion protein comprising one or more heterologous protein domains (e.g. about or more than about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more domains in addition to the CRISPR enzyme).
- a CRISPR enzyme fusion protein may comprise any additional protein sequence, and optionally a linker sequence between any two domains.
- protein domains that may be fused to a CRISPR enzyme include, without limitation, epitope tags, reporter gene sequences, and protein domains having one or more of the following activities: methylase activity, demethylase activity, transcription activation activity, transcription repression activity, transcription release factor activity, histone modification activity, RNA cleavage activity and nucleic acid binding activity.
- epitope tags include histidine (His) tags, V5 tags, FLAG tags, influenza hemagglutinin (HA) tags, Myc tags, VSV-G tags, and thioredoxin (Trx) tags.
- reporter genes include, but are not limited to, glutathione-S-transferase (GST), horseradish peroxidase (HRP), chloramphenicol acetyltransferase (CAT) beta-galactosidase, beta-glucuronidase, luciferase, green fluorescent protein (GFP), HcRed, DsRed, cyan fluorescent protein (CFP), yellow fluorescent protein (YFP), and autofluorescent proteins including blue fluorescent protein (BFP).
- GST glutathione-S-transferase
- HRP horseradish peroxidase
- CAT chloramphenicol acetyltransferase
- beta-galactosidase beta-galactosidase
- beta-glucuronidase beta-galactosidase
- luciferase green fluorescent protein
- GFP green fluorescent protein
- HcRed HcRed
- DsRed cyan fluorescent protein
- a CRISPR enzyme may be fused to a gene sequence encoding a protein or a fragment of a protein that bind DNA molecules or bind other cellular molecules, including but not limited to maltose binding protein (MBP), S-tag, Lex A DNA binding domain (DBD) fusions, GALA DNA binding domain fusions, and herpes simplex virus (HSV) BP16 protein fusions. Additional domains that may form part of a fusion protein comprising a CRISPR enzyme are described in US20110059502, incorporated herein by reference. In some embodiments, a tagged CRISPR enzyme is used to identify the location of a target sequence.
- MBP maltose binding protein
- DBD Lex A DNA binding domain
- HSV herpes simplex virus
- a reporter gene which includes but is not limited to glutathione-S-transferase (GST), horseradish peroxidase (HRP), chloramphenicol acetyltransferase (CAT) beta-galactosidase, beta-glucuronidase, luciferase, green fluorescent protein (GFP), HcRed, DsRed, cyan fluorescent protein (CFP), yellow fluorescent protein (YFP), and autofluorescent proteins including blue fluorescent protein (BFP), may be introduced into a cell to encode a gene product which serves as a marker by which to measure the alteration or modification of expression of the gene product.
- GST glutathione-S-transferase
- HRP horseradish peroxidase
- CAT chloramphenicol acetyltransferase
- beta-galactosidase beta-galactosidase
- beta-glucuronidase beta-galactosidase
- the DNA molecule encoding the gene product may be introduced into the cell via a vector.
- the gene product is luciferase.
- the expression of the gene product is decreased.
- the invention provides methods comprising delivering one or more polynucleotides, such as or one or more vectors as described herein, one or more transcripts thereof, and/or one or proteins transcribed therefrom, to a host cell.
- the invention serves as a basic platform for enabling targeted modification of DNA-based genomes. It can interface with many delivery systems, including but not limited to viral, liposome, electroporation, microinjection and conjugation.
- the invention further provides cells produced by such methods, and organisms (such as animals, plants, or fungi) comprising or produced from such cells.
- a CRISPR enzyme in combination with (and optionally complexed with) a guide sequence is delivered to a cell.
- Non-viral vector delivery systems include DNA plasmids, RNA (e.g. a transcript of a vector described herein), naked nucleic acid, and nucleic acid complexed with a delivery vehicle, such as a liposome.
- Viral vector delivery systems include DNA and RNA viruses, which have either episomal or integrated genomes after delivery to the cell.
- Methods of non-viral delivery of nucleic acids include lipofection, nucleofection, microinjection, biolistics, virosomes, liposomes, immunoliposomes, polycation or lipid:nucleic acid conjugates, naked DNA, artificial virions, and agent-enhanced uptake of DNA.
- Lipofection is described in e.g., U.S. Pat. Nos. 5,049,386, 4,946,787; and 4,897,355) and lipofection reagents are sold commercially (e.g., TransfectamTM and LipofectinTM).
- Cationic and neutral lipids that are suitable for efficient receptor-recognition lipofection of polynucleotides include those of Felgner, WO 91/17424; WO 91/16024. Delivery can be to cells (e.g. in vitro or ex vivo administration) or target tissues (e.g. in vivo administration).
- lipid:nucleic acid complexes including targeted liposomes such as immunolipid complexes
- crystal Science 270:404-410 (1995); Blaese et al., Cancer Gene Ther. 2:291-297 (1995); Behr et al., Bioconjugate Chem. 5:382-389 (1994); Remy et al., Bioconjugate Chem. 5:647-654 (1994); Gao et al., Gene Therapy 2:710-722 (1995); Ahmad et al., Cancer Res. 52:4817-4820 (1992); U.S. Pat. Nos. 4,186,183, 4,217,344, 4,235,871, 4,261,975, 4,485,054, 4,501,728, 4,774,085, 4,837,028, and 4.946,787).
- RNA or DNA viral based systems for the delivery of nucleic acids take advantage of highly evolved processes for targeting a virus to specific cells in the body and trafficking the viral payload to the nucleus.
- Viral vectors can be administered directly to patients (in vivo) or they can be used to treat cells in vitro, and the modified cells may optionally be administered to patients (ex vivo).
- Conventional viral based systems could include retroviral, lentivirus, adenoviral, adeno-associated and herpes simplex virus vectors for gene transfer. Integration in the host genome is possible with the retrovirus, lentivirus, and adeno-associated virus gene transfer methods, often resulting in long term expression of the inserted transgene. Additionally, high transduction efficiencies have been observed in many different cell types and target tissues.
- Lentiviral vectors are retroviral vectors that are able to transduce or infect non-dividing cells and typically produce high viral titers. Selection of a retroviral gene transfer system would therefore depend on the target tissue. Retroviral vectors are comprised of cis-acting long terminal repeats with packaging capacity for up to 6-10 kb of foreign sequence. The minimum cis-acting LTRs are sufficient for replication and packaging of the vectors, which are then used to integrate the therapeutic gene into the target cell to provide permanent transgene expression.
- Widely used retroviral vectors include those based upon murine leukemia virus (MuLV), gibbon ape leukemia virus (GaLV), Simian Immuno deficiency virus (SW), human immuno deficiency virus (HIV), and combinations thereof (see, e.g., Buchscher et al., J. Virol. 66:2731-2739 (1992); Johann et al., J. Virol. 66:1635-1640 (1992); Sommnerfelt et al., Virol. 176:58-59 (1990); Wilson et al., J. Virol. 63:2374-2378 (1989); Miller et al., J. Virol.
- MiLV murine leukemia virus
- GaLV gibbon ape leukemia virus
- SW Simian Immuno deficiency virus
- HAV human immuno deficiency virus
- adenoviral based systems may be used.
- Adenoviral based vectors are capable of very high transduction efficiency in many cell types and do not require cell division. With such vectors, high titer and levels of expression have been obtained. This vector can be produced in large quantities in a relatively simple system.
- Adeno-associated virus (“AAV”) vectors may also be used to transduce cells with target nucleic acids, e.g., in the in vitro production of nucleic acids and peptides, and for in vivo and ex vivo gene therapy procedures (see, e.g., West et al., Virology 160:38-47 (1987); U.S. Pat. No. 4,797,368; WO 93/24641; Kotin, Human Gene Therapy 5:793-801 (1994); Muzyczka, J. Clin. Invest. 94:1351 (1994). Construction of recombinant AAV vectors are described in a number of publications, including U.S. Pat. No.
- Packaging cells are typically used to form virus particles that are capable of infecting a host cell. Such cells include 293 cells, which package adenovirus, and ⁇ 2 cells or PA317 cells, which package retrovirus.
- Viral vectors used in gene therapy are usually generated by producing a cell line that packages a nucleic acid vector into a viral particle. The vectors typically contain the minimal viral sequences required for packaging and subsequent integration into a host, other viral sequences being replaced by an expression cassette for the polynucleotide(s) to be expressed. The missing viral functions are typically supplied in trans by the packaging cell line. For example, AAV vectors used in gene therapy typically only possess ITR sequences from the AAV genome which are required for packaging and integration into the host genome.
- Viral DNA is packaged in a cell line, which contains a helper plasmid encoding the other AAV genes, namely rep and cap, but lacking ITR sequences.
- the cell line may also be infected with adenovirus as a helper.
- the helper virus promotes replication of the AAV vector and expression of AAV genes from the helper plasmid.
- the helper plasmid is not packaged in significant amounts due to a lack of ITR sequences. Contamination with adenovirus can be reduced by, e.g., heat treatment to which adenovirus is more sensitive than AAV. Additional methods for the delivery of nucleic acids to cells are known to those skilled in the art. See, for example, US20030087817, incorporated herein by reference.
- a host cell is transiently or non-transiently transfected with one or more vectors described herein.
- a cell is transfected as it naturally occurs in a subject.
- a cell that is transfected is taken from a subject.
- the cell is derived from cells taken from a subject, such as a cell line. A wide variety of cell lines for tissue culture are known in the art.
- cell lines include, but are not limited to, C8161, CCRF-CEM, MOLT, mIMCD-3, NHDF, HeLa—S3, Huhl, Huh4, Huh7, HUVEC, HASMC, HEKn, HEKa, MiaPaCell, Panel, PC-3, TF1, CTLL-2, CIR, Rat6, CVi, RPTE, A10, T24, J82, A375, ARH-77, Calul, SW480, SW620, SKOV3, SK-UT, CaCo2, P388D1, SEM-K2, WEHI-231, HB56, TIB55, Jurkat, J45.01, LRMB, Bcl-1, BC-3, IC21, DLD2, Raw264.7, NRK, NRK-52E, MRC5, MEF, Hep G2, HeLa B, HeLa T4.
- a cell transfected with one or more vectors described herein is used to establish a new cell line comprising one or more vector-derived sequences.
- a cell transiently transfected with the components of a CRISPR system as described herein (such as by transient transfection of one or more vectors, or transfection with RNA), and modified through the activity of a CRISPR complex, is used to establish a new cell line comprising cells containing the modification but lacking any other exogenous sequence.
- cells transiently or non-transiently transfected with one or more vectors described herein, or cell lines derived from such cells are used in assessing one or more test compounds.
- aspects of the invention relate to the generation of isogenic lines of mammalian cells for the study of genetic variations in disease.
- a further aspect of the invention relates to the generation of genetically-modified animal models, either transgenic or viral-mediated delivery.
- the invention also comprehends genome modification of microbes, cells, plants, animals or synthetic organisms for the generation of biomedically, agriculturally, and industrially useful products.
- the invention comprehends gene therapy.
- the invention may be used as a biological research tool, for understanding the genome, e.g. gene knockout studies.
- the inventions relates to many other methods and compositions that depend on the basic ability of editing and rewriting the DNA content of genomes, as well as targeted inactivation of DNA-based organisms.
- the invention also may be used as therapeutic for targeting specific strains of bacterial infections, viral infection, etc.
- one or more vectors described herein are used to produce a non-human transgenic animal or transgenic plant.
- the transgenic animal is a mammal, such as a mouse, rat, or rabbit.
- the organism or subject is a plant.
- the organism or subject or plant is algae.
- Methods for producing transgenic plants and animals are known in the art, and generally begin with a method of cell transfection, such as described herein.
- Transgenic animals are also provided, as are transgenic plants, especially crops and algae. The transgenic animal or plant may be useful in applications outside of providing a disease model.
- transgenic plants especially pulses and tubers, and animals, especially mammals such as livestock (cows, sheep, goats and pigs), but also poultry and edible insects, are preferred.
- Transgenic algae or other plants such as rape may be particularly useful in the production of vegetable oils or biofuels such as alcohols (especially methanol and ethanol), for instance. These may be engineered to express or overexpress high levels of oil or alcohols for use in the oil or biofuel industries.
- alcohols especially methanol and ethanol
- the invention provides for methods of modifying a target polynucleotide in a eukaryotic cell, which may be in vivo, ex vivo or in vitro.
- the method comprises sampling a cell or population of cells from a human or non-human animal or plant (including micro-algae), and modifying the cell or cells. Culturing may occur at any stage ex vivo. The cell or cells may even be re-introduced into the non-human animal or plant (including micro-algae).
- the invention provides for methods of modifying a target polynucleotide in a eukaryotic cell.
- the method comprises allowing a CRISPR complex to bind to the target polynucleotide to effect cleavage of said target polynucleotide thereby modifying the target polynucleotide, wherein the CRISPR complex comprises a CRISPR enzyme complexed with a guide sequence hybridized to a target sequence within said target polynucleotide, wherein said guide sequence is linked to a tracr mate sequence which in turn hybridizes to a tracr sequence.
- the invention provides a method of modifying expression of a polynucleotide in a eukaryotic cell.
- the method comprises allowing a CRISPR complex to bind to the polynucleotide such that said binding results in increased or decreased expression of said polynucleotide; wherein the CRISPR complex comprises a CRISPR enzyme complexed with a guide sequence hybridized to a target sequence within said polynucleotide, wherein said guide sequence is linked to a tracr mate sequence which in turn hybridizes to a tracr sequence.
- pathogens are often host-specific.
- Fusarium oxysporum f. sp. lycopersici causes tomato wilt but attacks only tomato
- Plants have existing and induced defenses to resist most pathogens. Mutations and recombination events across plant generations lead to genetic variability that gives rise to susceptibility, especially as pathogens reproduce with more frequency than plants. In plants there can be non-host resistance, e.g., the host and pathogen are incompatible.
- Horizontal Resistance e.g., partial resistance against all races of a pathogen, typically controlled by many genes
- Vertical Resistance e.g., complete resistance to some races of a pathogen but not to other races, typically controlled by a few genes.
- Plant and pathogens evolve together, and the genetic changes in one balance changes in other. Accordingly, using Natural Variability, breeders combine most useful genes for Yield, Quality, Uniformity, Hardiness, Resistance.
- the sources of resistance genes include native or foreign Varieties, Heirloom Varieties, Wild Plant Relatives, and Induced Mutations, e.g., treating plant material with mutagenic agents.
- plant breeders are provided with a new tool to induce mutations. Accordingly, one skilled in the art can analyze the genome of sources of resistance genes, and in Varieties having desired characteristics or traits employ the present invention to induce the rise of resistance genes, with more precision than previous mutagenic agents and hence accelerate and improve plant breeding programs.
- the invention provides kits containing any one or more of the elements disclosed in the above methods and compositions.
- the kit comprises a vector system and instructions for using the kit.
- the vector system comprises (a) a first regulatory element operably linked to a tracr mate sequence and one or more insertion sites for inserting a guide sequence upstream of the tracr mate sequence, wherein when expressed, the guide sequence directs sequence-specific binding of a CRISPR complex to a target sequence in a eukaryotic cell, wherein the CRISPR complex comprises a CRISPR enzyme complexed with (1) the guide sequence that is hybridized to the target sequence, and (2) the tracr mate sequence that is hybridized to the tracr sequence; and/or (b) a second regulatory element operably linked to an enzyme-coding sequence encoding said CRISPR enzyme comprising a nuclear localization sequence.
- Elements may be provided individually or in combinations, and may be provided in any suitable container, such as a vial, a bottle, or
- a kit comprises one or more reagents for use in a process utilizing one or more of the elements described herein.
- Reagents may be provided in any suitable container.
- a kit may provide one or more reaction or storage buffers.
- Reagents may be provided in a form that is usable in a particular assay, or in a form that requires addition of one or more other components before use (e.g. in concentrate or lyophilized form).
- a buffer can be any buffer, including but not limited to a sodium carbonate buffer, a sodium bicarbonate buffer, a borate buffer, a Tris buffer, a MOPS buffer, a HEPES buffer, and combinations thereof.
- the buffer is alkaline.
- the buffer has a pH from about 7 to about 10.
- the kit comprises one or more oligonucleotides corresponding to a guide sequence for insertion into a vector so as to operably link the guide sequence and a regulatory element.
- the kit comprises a homologous recombination template polynucleotide.
- the invention provides methods for using one or more elements of a CRISPR system.
- the CRISPR complex of the invention provides an effective means for modifying a target polynucleotide.
- the CRISPR complex of the invention has a wide variety of utility including modifying (e.g., deleting, inserting, translocating, inactivating, activating) a target polynucleotide in a multiplicity of cell types.
- the CRISPR complex of the invention has a broad spectrum of applications in, e.g., gene therapy, drug screening, disease diagnosis, and prognosis.
- An exemplary CRISPR complex comprises a CRISPR enzyme complexed with a guide sequence hybridized to a target sequence within the target polynucleotide.
- the guide sequence is linked to a tracr mate sequence, which in turn hybridizes to a tracr sequence.
- the target polynucleotide of a CRISPR complex can be any polynucleotide endogenous or exogenous to the eukaryotic cell.
- the target polynucleotide can be a polynucleotide residing in the nucleus of the eukaryotic cell.
- the target polynucleotide can be a sequence coding a gene product (e.g., a protein) or a non-coding sequence (e.g., a regulatory polynucleotide or a junk DNA).
- a gene product e.g., a protein
- a non-coding sequence e.g., a regulatory polynucleotide or a junk DNA.
- PAM protospacer adjacent motif
- PAMs are typically 2-5 base pair sequences adjacent the protospacer (that is, the target sequence) Examples of PAM sequences are given in the examples section below, and the skilled person will be able to identify further PAM sequences for use with a given CRISPR enzyme.
- the target polynucleotide of a CRISPR complex may include a number of disease-associated genes and polynucleotides as well as signaling biochemical pathway-associated genes and polynucleotides as listed in US provisional patent applications 61/736,527 and 61/748,427 having Broad reference BI-2011/008/WSGR Docket No. 44063-701.101 and B1-2011/008/WSGR Docket No. 44063-701.102 respectively, both entitled SYSTEMS METHODS AND COMPOSITIONS FOR SEQUENCE MANIPULATION filed on Dec. 12, 2012 and Jan. 2, 2013, respectively, the contents of all of which are herein incorporated by reference in their entirety.
- target polynucleotides include a sequence associated with a signaling biochemical pathway, e.g., a signaling biochemical pathway-associated gene or polynucleotide.
- target polynucleotides include a disease associated gene or polynucleotide.
- a “disease-associated” gene or polynucleotide refers to any gene or polynucleotide which is yielding transcription or translation products at an abnormal level or in an abnormal form in cells derived from a disease-affected tissues compared with tissues or cells of a non disease control.
- a disease-associated gene also refers to a gene possessing mutation(s) or genetic variation that is directly responsible or is in linkage disequilibrium with a gene(s) that is responsible for the etiology of a disease.
- the transcribed or translated products may be known or unknown, and may be at a normal or abnormal level.
- disease-associated genes and polynucleotides are available from McKusick-Nathans Institute of Genetic Medicine, Johns Hopkins University (Baltimore, Md.) and National Center for Biotechnology Information, National Library of Medicine (Bethesda, Md.), available on the World Wide Web.
- Examples of disease-associated genes and polynucleotides are listed in Tables A and B. Disease specific information is available from McKusick-Nathans Institute of Genetic Medicine, Johns Hopkins University (Baltimore, Md.) and National Center for Biotechnology Information, National Library of Medicine (Bethesda, Md.), available on the World Wide Web. Examples of signaling biochemical pathway-associated genes and polynucleotides are listed in Table C.
- genes, diseases and proteins are hereby incorporated by reference from US Provisional applications 61/736,527 filed Dec. 12, 2012 and 61/748,427 filed Jan. 2, 2013.
- genes, proteins and pathways may be the target polynucleotide of a CRISPR complex.
- Neoplasia PTEN A DISEASE/ DISORDERS GENE(S) Neoplasia PTEN; ATM; ATR; EGFR; ERBB2; ERBB3; ERBB4; Notch1; Notch2; Notch3; Notch4; AKT; AKT2; AKT3; HIF; HIF1a; HIF3a; Met; HRG; bcl2; PPAR alpha; PPAR gamma; WT1 (Wilms Tumor); FGF Receptor Family members (5 members: 1, 2, 3, 4, 5); CDKN2a; APC; RB (retinoblastoma); MEN1; VHL; BRCA1; BRCA2; AR (Androgen Receptor); TSG101; IGF; IGF Receptor; Igf1 (4 variants); Igf2 (3 variants); Igf 1 Receptor; Igf 2 Receptor; Bax; Bcl2; caspases family (9 members: 1, 2, 3, 4, 6, 7,
- BCL7A Cell dysregulation B-cell non-Hodgkin lymphoma
- Leukemia TAL1, diseases and TCL5, SCL, TAL2, FLT3, disorders NBS1, NBS, ZNFN1A1, IK1, LYF1, HOXD4, HOX4B, BCR, CML, PHL, ALL, ARNT, KRAS2, RASK2, GMPS, AF10, ARHGEF12, LARG, KIAA0382, CALM
- Inflammation and AIDS Keratinization and AIDS (KIR3DL1, NKAT3, NKB1, AMB11, immune related KIR3DS1, IFNG, CXCL12, SDF1); Autoimmune diseases and lymphoproliferative syndrome (TNFRSF6, APT1, disorders FAS, CD95, ALPS1A); Combined immunodeficiency, (IL2RG, SCIDX1, SCIDX, IMD4); HIV-1 (CCL5, SCYA5, D17S136E, TCP228), HIV susceptibility or infection (IL10, CSIF, CMKBR2, CCR2, CMKBR5, CCCKR5 (CCR5)); Immunodeficiencies (CD3E, CD3G, AICDA, AID, HIGM2, TNFRSF5, CD40, UNG, DGU, HIGM4, TNFSF5, CD40LG, HIGM1, IGM, FOXP3, IPEX, AIID, XPID, PIDX, TNFRSF14B, TACI
- Muscular/Skeletal Becker muscular dystrophy (DMD, BMD, diseases and MYF6), Duchenne Muscular disorders Dystrophy (DMD, BMD); Emery-Dreifuss muscular dystrophy (LMNA, LMN1, EMD2, FPLD, CMD1A, HGPS, LGMD1B, LMNA, LMN1, EMD2, FPLD, CMD1A); Facioscapulohumeral muscular dystrophy (FSHMD1A, FSHD1A); Muscular dystrophy (FKRP, MDC1C, LGMD2I, LAMA2, LAMM, LARGE, KIAA0609, MDC1D, FCMD, TTID, MYOT, CAPN3, CANP3, DYSF, LGMD2B, SGCG, LGMD2C, DMDA1, SCG3, SGCA, ADL, DAG2, LGMD2D, DMDA2, SGCB, LGMD2E, SGCD, SGD, LGMD2F, C
- Neurological and ALS SOD1, ALS2, STEX, FUS, TARDBP, neuronal VEGF (VEGF-a, VEGF-b, VEGF-c); Alzheimer diseases and disease (APP, AAA, CVAP, AD1, APOE, AD2, disorders PSEN2, AD4, STM2, APBB2, FE65L1, NOS3, PLAU, URK, ACE, DCP1, ACE1; MPO, PACIP1, PAXIP1L, PTIP, A2M, BLMH, BMH, PSEN1, AD3); Autism (Meep2, BZRAP1, MDGA2, Sema5A, Neurexin 1, GLO1, MECP2, RTT, PPMX, MRX16, MRX79, NLGN3, NLGN4, KIAA1260, AUTSX2); Fragile X Syndrome (FMR2, FXR1, FXR2, mGLUR5); Huntington's disease and disease like disorders (HD, IT15, PRNP, PRIP, JPH
- Occular Age-related macular degeneration (Abcr, Ccl2, diseases and Cc2, cp (ceruloplasmin), Timp3, cathepsinD, Vldlr, disorders Ccr2); Cataract (CRYAA, CRYA1, CRYBB2, CRYB2, PITX3, BFSP2, CP49, CP47, CRYAA, CRYA1, PAX6, AN2, MGDA, CRYBA1, CRYB1, CRYGC, CRYG3, CCL, LIM2, MP19, CRYGD, CRYG4, BFSP2, CP49, CP47, HSF4, CTM, HSF4, CTM, MIP, AQP0, CRYAB, CRYA2, CTPP2, CRYBB1, CRYGD, CRYG4, CRYBB2, CRYB2, CRYGC, CRYG3, CCL, CRYAA, CRYA1, GJA8, CX50, CAE1, GJA3, CX46, CZP3, CAE3, CCM1, CAM
- Embodiments of the invention also relate to methods and compositions related to knocking out genes, amplifying genes and repairing particular mutations associated with DNA repeat instability and neurological disorders (Robert D. Wells, Tetsuo Ashizawa, Genetic Instabilities and Neurological Diseases, Second Edition, Academic Press, Oct. 13, 2011—Medical). Specific aspects of tandem repeat sequences have been found to be responsible for more than twenty human diseases (New insights into repeat instability: role of RNA•DNA hybrids. McIvor E I, Polak U, Napierala M. RNA Biol. 2010 September-October; 7(5):551-8). The CRISPR-Cas system may be harnessed to correct these defects of genomic instability.
- a further aspect of the invention relates to utilizing the CRISPR-Cas system for correcting defects in the EMP2A and EMP2B genes that have been identified to be associated with Lafora disease.
- Lafora disease is an autosomal recessive condition which is characterized by progressive myoclonus epilepsy which may start as epileptic seizures in adolescence.
- a few cases of the disease may be caused by mutations in genes yet to be identified.
- the disease causes seizures, muscle spasms, difficulty walking, dementia, and eventually death. There is currently no therapy that has proven effective against disease progression.
- the CRISPR-Cas system may be used to correct ocular defects that arise from several genetic mutations further described in Genetic Diseases of the Eye, Second Edition, edited by Elias I. Traboulsi, Oxford University Press, 2012.
- the genetic brain diseases may include but are not limited to Adrenoleukodystrophy, Agenesis of the Corpus Callosum, Aicardi Syndrome, Alpers' Disease, Alzheimer's Disease, Barth Syndrome, Batten Disease, CADASIL, Cerebellar Degeneration, Fabry's Disease, Gerstmann-Straussler-Scheinker Disease, Huntington's Disease and other Triplet Repeat Disorders, Leigh's Disease, Lesch-Nyhan Syndrome, Menkes Disease, Mitochondrial Myopathies and NINDS Colpocephaly. These diseases are further described on the website of the National Institutes of Health under the subsection Genetic Brain Disorders.
- the condition may be neoplasia. In some embodiments, where the condition is neoplasia, the genes to be targeted are any of those listed in Table A (in this case PTEN asn so forth). In some embodiments, the condition may be Age-related Macular Degeneration. In some embodiments, the condition may be a Schizophrenic Disorder. In some embodiments, the condition may be a Trinucleotide Repeat Disorder. In some embodiments, the condition may be Fragile X Syndrome. In some embodiments, the condition may be a Secretase Related Disorder. In some embodiments, the condition may be a Prion-related disorder. In some embodiments, the condition may be ALS. In some embodiments, the condition may be a drug addiction. In some embodiments, the condition may be Autism. In some embodiments, the condition may be Alzheimer's Disease. In some embodiments, the condition may be inflammation. In some embodiments, the condition may be Parkinson's Disease.
- proteins associated with Parkinson's disease include but are not limited to ⁇ -synuclein, DJ-1, LRRK2, PINK1, Parkin, UCHL1, Synphilin-1, and NURR1.
- addiction-related proteins may include ABAT for example.
- inflammation-related proteins may include the monocyte chemoattractant protein-1 (MCP1) encoded by the Ccr2 gene, the C-C chemokine receptor type 5 (CCR5) encoded by the Ccr5 gene, the IgG receptor IIB (FCGR2b, also termed CD32) encoded by the Fcgr2b gene, or the Fc epsilon R1g (FCER1g) protein encoded by the Fcer1g gene, for example.
- MCP1 monocyte chemoattractant protein-1
- CCR5 C-C chemokine receptor type 5
- FCGR2b also termed CD32
- FCER1g Fc epsilon R1g
- cardiovascular diseases associated proteins may include IL1B (interleukin 1, beta), XDH (xanthine dehydrogenase), TP53 (tumor protein p53), PTGIS (prostaglandin I2 (prostacyclin) synthase), MB (myoglobin), IL4 (interleukin 4), ANGPT1 (angiopoietin 1), ABCG8 (ATP-binding cassette, sub-family G (WHITE), member 8), or CTSK (cathepsin K), for example.
- IL1B interleukin 1, beta
- XDH xanthine dehydrogenase
- TP53 tumor protein p53
- PTGIS prostaglandin I2 (prostacyclin) synthase)
- MB myoglobin
- IL4 interleukin 4
- ANGPT1 angiopoietin 1
- ABCG8 ATP-binding cassette, sub-family G (WHITE), member 8
- Examples of Alzheimer's disease associated proteins may include the very low density lipoprotein receptor protein (VLDLR) encoded by the VLDLR gene, the ubiquitin-like modifier activating enzyme 1 (UBA1) encoded by the UBA1 gene, or the NEDD8-activating enzyme E1 catalytic subunit protein (UBE1C) encoded by the UBA3 gene, for example.
- VLDLR very low density lipoprotein receptor protein
- UBA1 ubiquitin-like modifier activating enzyme 1
- UBE1C NEDD8-activating enzyme E1 catalytic subunit protein
- proteins associated Autism Spectrum Disorder may include the benzodiazapine receptor (peripheral) associated protein 1 (BZRAP1) encoded by the BZRAP1 gene, the AF4/FMR2 family member 2 protein (AFF2) encoded by the AFF2 gene (also termed MFR2), the fragile X mental retardation autosomal homolog 1 protein (FXR1) encoded by the FXR1 gene, or the fragile X mental retardation autosomal homolog 2 protein (FXR2) encoded by the FXR2 gene, for example.
- BZRAP1 benzodiazapine receptor (peripheral) associated protein 1
- AFF2 AF4/FMR2 family member 2 protein
- FXR1 fragile X mental retardation autosomal homolog 1 protein
- FXR2 fragile X mental retardation autosomal homolog 2 protein
- proteins associated Macular Degeneration may include the ATP-binding cassette, sub-family A (ABC1) member 4 protein (ABCA4) encoded by the ABCR gene, the apolipoprotein E protein (APOE) encoded by the APOE gene, or the chemokine (C-C motif) Ligand 2 protein (CCL2) encoded by the CCL2 gene, for example.
- ABC1 sub-family A
- APOE apolipoprotein E protein
- CCL2 Ligand 2 protein
- proteins associated Schizophrenia may include NRG1, ErbB4, CPLX1, TPH1, TPH2, NRXN1, GSK3A, BDNF, DISC 1, GSK3B, and combinations thereof.
- proteins involved in tumor suppression may include ATM (ataxia telangiectasia mutated), ATR (ataxia telangiectasia and Rad3 related), EGFR (epidermal growth factor receptor), ERBB2 (v-erb-b2 erythroblastic leukemia viral oncogene homolog 2), ERBB3 (v-erb-b2 erythroblastic leukemia viral oncogene homolog 3), ERBB4 (v-erb-b2 erythroblastic leukemia viral oncogene homolog 4), Notch 1, Notch2, Notch 3, or Notch 4, for example.
- ATM ataxia telangiectasia mutated
- ATR ataxia telangiectasia and Rad3 related
- EGFR epidermatitise
- ERBB2 v-erb-b2 erythroblastic leukemia viral oncogene homolog 2
- ERBB3 v-erb-b2 erythroblastic leukemia viral on
- proteins associated with a secretase disorder may include PSENEN (presenilin enhancer 2 homolog ( C. elegans )), CTSB (cathepsin B), PSEN1 (presenilin 1), APP (amyloid beta (A4) precursor protein), APH1B (anterior pharynx defective 1 homolog B ( C. elegans )), PSEN2 (presenilin 2 (Alzheimer disease 4)), or BACE1 (beta-site APP-cleaving enzyme 1), for example.
- proteins associated with Amyotrophic Lateral Sclerosis may include SOD1 (superoxide dismutase 1), ALS2 (amyotrophic lateral sclerosis 2), FUS (fused in sarcoma), TARDBP (TAR DNA binding protein), VAGFA (vascular endothelial growth factor A), VAGFB (vascular endothelial growth factor B), and VAGFC (vascular endothelial growth factor C), and any combination thereof.
- SOD1 superoxide dismutase 1
- ALS2 amotrophic lateral sclerosis 2
- FUS fused in sarcoma
- TARDBP TAR DNA binding protein
- VAGFA vascular endothelial growth factor A
- VAGFB vascular endothelial growth factor B
- VAGFC vascular endothelial growth factor C
- proteins associated with prion diseases may include SOD1 (superoxide dismutase 1), ALS2 (amyotrophic lateral sclerosis 2), FUS (fused in sarcoma), TARDBP (TAR DNA binding protein), VAGFA (vascular endothelial growth factor A), VAGFB (vascular endothelial growth factor B), and VAGFC (vascular endothelial growth factor C), and any combination thereof.
- proteins related to neurodegenerative conditions in prion disorders may include A2M (Alpha-2-Macroglobulin), AATF (Apoptosis antagonizing transcription factor), ACPP (Acid phosphatase prostate), ACTA2 (Actin alpha 2 smooth muscle aorta), ADAM22 (ADAM metallopeptidase domain), ADORA3 (Adenosine A3 receptor), or ADRA1D (Alpha-1D adrenergic receptor for Alpha-1D adrenoreceptor), for example.
- A2M Alpha-2-Macroglobulin
- AATF Apoptosis antagonizing transcription factor
- ACPP Acid phosphatase prostate
- ACTA2 Actin alpha 2 smooth muscle aorta
- ADAM22 ADAM metallopeptidase domain
- ADORA3 Adosine A3 receptor
- ADRA1D Alpha-1D adrenergic receptor for Alpha-1D adrenoreceptor
- proteins associated with Immunodeficiency may include A2M [alpha-2-macroglobulin]; AANAT [arylalkylamine N-acetyltransferase]; ABCA1 [ATP-binding cassette, sub-family A (ABC1), member 1]; ABCA2 [ATP-binding cassette, sub-family A (ABC1), member 2]; or ABCA3 [ATP-binding cassette, sub-family A (ABC1), member 3]; for example.
- A2M alpha-2-macroglobulin
- AANAT arylalkylamine N-acetyltransferase
- ABCA1 ATP-binding cassette, sub-family A (ABC1), member 1]
- ABCA2 ATP-binding cassette, sub-family A (ABC1), member 2]
- ABCA3 ATP-binding cassette, sub-family A (ABC1), member 3]
- proteins associated with Trinucleotide Repeat Disorders include AR (androgen receptor), FMR1 (fragile X mental retardation 1), HTT (huntingtin), or DMPK (dystrophia myotonica-protein kinase), FXN (frataxin), ATXN2 (ataxin 2), for example.
- proteins associated with Neurotransmission Disorders include SST (somatostatin), NOS1 (nitric oxide synthase 1 (neuronal)), ADRA2A (adrenergic, alpha-2A-, receptor), ADRA2C (adrenergic, alpha-2C-, receptor), TACR1 (tachykinin receptor 1), or HTR2c (5-hydroxytryptamine (serotonin) receptor 2C), for example.
- neurodevelopmental-associated sequences include A2BPI [ataxin 2-binding protein 1], AADAT [aminoadipate aminotransferase], AANAT [arylalkylamine N-acetyltransferase], ABAT [4-aminobutyrate aminotransferase], ABCA1 [ATP-binding cassette, sub-family A (ABC1), member 1], or ABCA13 [ATP-binding cassette, sub-family A (ABC1), member 13], for example.
- A2BPI ataxin 2-binding protein 1
- AADAT aminoadipate aminotransferase
- AANAT arylalkylamine N-acetyltransferase
- ABAT 4-aminobutyrate aminotransferase
- ABCA1 ATP-binding cassette, sub-family A (ABC1), member 1
- ABCA13 ATP-binding cassette, sub-family A (ABC1), member 13
- preferred conditions treatable with the present system include may be selected from: Aicardi-Goutines Syndrome; Alexander Disease; Allan-Herndon-Dudley Syndrome; POLG-Related Disorders; Alpha-Mannosidosis (Type II and III); Alström Syndrome; Angelman; Syndrome; Ataxia-Telangiectasia; Neuronal Ceroid-Lipofuscinoses; Beta-Thalassemia; Bilateral Optic Atrophy and (Infantile) Optic Atrophy Type 1; Retinoblastoma (bilateral); Canavan Disease; Cerebrooculofacioskeletal Syndrome 1 [COFS 1]; Cerebrotendinous Xanthomatosis; Cornelia de Lange Syndrome; MAPT-Related Disorders; Genetic Prion Diseases; Dravet Syndrome; Early-Onset Familial Alzheimer Disease; Friedreich Ataxia [FRDA]; Fryns Syndrome; Fucosidosis; Fukuyama Congenital Muscular Dystrophy; Galactosialidosis; Gau
- the present system can be used to target any polynucleotide sequence of interest.
- Some examples of conditions or diseases that might be usefully treated using the present system are included in the Tables above and examples of genes currently associated with those conditions are also provided there. However, the genes exemplified are not exhaustive.
- An example type II CRISPR system is the type II CRISPR locus from Streptococcus pyogenes SF370, which contains a cluster of four genes Cas9, Cas1, Cas2, and Csn1, as well as two non-coding RNA elements, tracrRNA and a characteristic array of repetitive sequences (direct repeats) interspaced by short stretches of non-repetitive sequences (spacers, about 30 bp each).
- DSB targeted DNA double-strand break
- tracrRNA hybridizes to the direct repeats of pre-crRNA, which is then processed into mature crRNAs containing individual spacer sequences.
- the mature crRNA:tracrRNA complex directs Cas9 to the DNA target consisting of the protospacer and the corresponding PAM via heteroduplex formation between the spacer region of the crRNA and the protospacer DNA.
- Cas9 mediates cleavage of target DNA upstream of PAM to create a DSB within the protospacer ( FIG. 2A ).
- This example describes an example process for adapting this RNA-programmable nuclease system to direct CRISPR complex activity in the nuclei of eukaryotic cells.
- HEK cell line HEK 293FT Human embryonic kidney (HEK) cell line HEK 293FT (Life Technologies) was maintained in Dulbecco's modified Eagle's Medium (DMEM) supplemented with 10% fetal bovine serum (HyClone), 2 mM GlutaMAX (Life Technologies), 100U/mL penicillin, and 100 ⁇ g/mL streptomycin at 37° C. with 5% CO 2 incubation.
- DMEM Dulbecco's modified Eagle's Medium
- HyClone fetal bovine serum
- 2 mM GlutaMAX Human neuro2A (N2A) cell line (ATCC) was maintained with DMEM supplemented with 5% fetal bovine serum (HyClone), 2 mM GlutaMAX (Life Technologies), 100U/mL penicillin, and 100 ⁇ g/mL streptomycin at 37° C. with 5% CO 2 .
- HEK 293FT or N2A cells were seeded into 24-well plates (Corning) one day prior to transfection at a density of 200,000 cells per well. Cells were transfected using Lipofectamine 2000 (Life Technologies) following the manufacturer's recommended protocol. For each well of a 24-well plate a total of 800 ng of plasmids were used.
- HEK 293FT or N2A cells were transfected with plasmid DNA as described above. After transfection, the cells were incubated at 37° C. for 72 hours before genomic DNA extraction. Genomic DNA was extracted using the QuickExtract DNA extraction kit (Epicentre) following the manufacturer's protocol. Briefly, cells were resuspended in QuickExtract solution and incubated at 65° C. for 15 minutes and 98C for 10 minutes. Extracted genomic DNA was immediately processed or stored at ⁇ 20° C.
- the genomic region surrounding a CRISPR target site for each gene was PCR amplified, and products were purified using QiaQuick Spin Column (Qiagen) following manufacturer's protocol.
- a total of 400ng of the purified PCR products were mixed with 2 ⁇ l 10 ⁇ Taq polymerase PCR buffer (Enzymatics) and ultrapure water to a final volume of 20 ⁇ l, and subjected to a re-annealing process to enable heteroduplex formation: 95° C. for 10 min, 95° C. to 85° C. ramping at ⁇ 2° C./s, 85° C. to 25° C. at ⁇ 0.25° C./s, and 25° C. hold for 1 minute.
- HEK 293FT and N2A cells were transfected with plasmid DNA, and incubated at 37° C. for 72 hours before genomic DNA extraction as described above.
- the target genomic region was PCR amplified using primers outside the homology arms of the homologous recombination (HR) template. PCR products were separated on a 1% agarose gel and extracted with MinElute GelExtraction Kit (Qiagen). Purified products were digested with HindIII (Fermentas) and analyzed on a 6% Novex TBE poly-acrylamide gel (Life Technologies).
- RNA secondary structure prediction was performed using the online webserver RNAfold developed at Institute for Theoretical Chemistry at the University of Vienna, using the centroid structure prediction algorithm (see e.g. A. R. Gruber et al., 2008, Cell 106(1): 23-24; and P A Carr and G M Church, 2009, Nature Biotechnology 27(12): 1151-62).
- HEK 293FT cells were maintained and transfected as stated above. Cells were harvested by trypsinization followed by washing in phosphate buffered saline (PBS). Total cell RNA was extracted with TRI reagent (Sigma) following manufacturer's protocol. Extracted total RNA was quantified using Naonodrop (Thermo Scientific) and normalized to same concentration.
- RNAs were mixed with equal volumes of 2 ⁇ loading buffer (Ambion), heated to 95° C. for 5 min, chilled on ice for 1 min, and then loaded onto 8% denaturing polyacrylamide gels (SequaGel, National Diagnostics) after pre-running the gel for at least 30 minutes. The samples were electrophoresed for 1.5 hours at 40 W limit. Afterwards, the RNA was transferred to Hybond N+ membrane (GE Healthcare) at 300 mA in a semi-dry transfer apparatus (Bio-rad) at room temperature for 1.5 hours. The RNA was crosslinked to the membrane using autocrosslink button on Stratagene UV Crosslinker the Stratalinker (Stratagene).
- the membrane was pre-hybridized in ULTRAhyb-Oligo Hybridization Buffer (Ambion) for 30 min with rotation at 42° C., and probes were then added and hybridized overnight. Probes were ordered from IDT and labeled with [gamma- 32 P] ATP (Perkin Elmer) with T4 polynucleotide kinase (New England Biolabs). The membrane was washed once with pre-warmed (42° C.) 2 ⁇ SSC, 0.5% SDS for 1 min followed by two 30 minute washes at 42° C. The membrane was exposed to a phosphor screen for one hour or overnight at room temperature and then scanned with a phosphorimager (Typhoon).
- CRISPR locus elements including tracrRNA, Cas9, and leader were PCR amplified from Streptococcus pyogenes SF370 genomic DNA with flanking homology arms for Gibson Assembly. Two BsaI type IIS sites were introduced in between two direct repeats to facilitate easy insertion of spacers ( FIG. 8 ). PCR products were cloned into EcoRV-digested pACYC 184 downstream of the tet promoter using Gibson Assembly Master Mix (NEB). Other endogenous CRISPR system elements were omitted, with the exception of the last 50 bp of Csn2.
- Oligos (Integrated DNA Technology) encoding spacers with complimentary overhangs were cloned into the BsaI-digested vector pDC000 (NEB) and then ligated with T7 ligase (Enzymatics) to generate pCRISPR plasmids.
- T7 ligase Enzymatics
- FIG. 6C shows results of a Northern blot analysis of total RNA extracted from 293FT cells transfected with U6 expression constructs carrying long or short tracrRNA, as well as SpCas9 and DR-EMX1(1)-DR. Left and right panels are from 293FT cells transfected without or with SpRNase III, respectively.
- U6 indicate loading control blotted with a probe targeting human U6 snRNA. Transfection of the short tracrRNA expression construct led to abundant levels of the processed form of tracrRNA ( ⁇ 75 bp). Very low amounts of long tracrRNA are detected on the Northern blot.
- RNA polymerase III-based U6 promoter was selected to drive the expression of tracrRNA ( FIG. 2C ).
- a U6 promoter-based construct was developed to express a pre-crRNA array consisting of a single spacer flanked by two direct repeats (DRs, also encompassed by the term “tracr-mate sequences”; FIG. 2C ).
- the initial spacer was designed to target a 33-base-pair (bp) target site (30-bp protospacer plus a 3-bp CRISPR motif (PAM) sequence satisfying the NGG recognition motif of Cas9) in the human EMX1 locus ( FIG. 2C ), a key gene in the development of the cerebral cortex.
- bp 33-base-pair
- PAM 3-bp CRISPR motif
- HEK 293FT cells were transfected with combinations of CRISPR components. Since DSBs in mammalian nuclei are partially repaired by the non-homologous end joining (NHEJ) pathway, which leads to the formation of indels, the Surveyor assay was used to detect potential cleavage activity at the target EMX1 locus ( FIG. 7 ) (see e.g. Guschin et al., 2010, Methods Mol Biol 649: 247).
- NHEJ non-homologous end joining
- FIG. 12 provides an additional Northern blot analysis of crRNA processing in mammalian cells.
- FIG. 12A illustrates a schematic showing the expression vector for a single spacer flanked by two direct repeats (DR-EMX1(1)-DR). The 30 bp spacer targeting the human EMX1 locus protospacer 1 (see FIG. 6 ) and the direct repeat sequences are shown in the sequence beneath FIG. 12A . The line indicates the region whose reverse-complement sequence was used to generate Northern blot probes for EMX1(1) crRNA detection.
- FIG. 12B shows a Northern blot analysis of total RNA extracted from 293FT cells transfected with U6 expression constructs carrying DR-EMX1(1)-DR.
- DR-EMX1(1)-DR was processed into mature crRNAs only in the presence of SpCas9 and short tracrRNA and was not dependent on the presence of SpRNase III.
- the mature crRNA detected from transfected 293FT total RNA is ⁇ 33 bp and is shorter than the 39-42 bp mature crRNA from S. pyogenes .
- FIG. 2 illustrates the bacterial CRISPR system described in this example.
- FIG. 2A illustrates a schematic showing the CRISPR locus 1 from Streptococcus pyogenes SF370 and a proposed mechanism of CRISPR-mediated DNA cleavage by this system.
- Mature crRNA processed from the direct repeat-spacer array directs Cas9 to genomic targets consisting of complimentary protospacers and a protospacer-adjacent motif (PAM).
- PAM protospacer-adjacent motif
- FIG. 2B illustrates engineering of S.
- FIG. 2C illustrates mammalian expression of SpCas9 and SpRNase III driven by the constitutive EF1a promoter and tracrRNA and pre-crRNA array (DR-Spacer-DR) driven by the RNA Pol3 promoter U6 to promote precise transcription initiation and termination.
- DR-Spacer-DR pre-crRNA array
- FIG. 2D illustrates surveyor nuclease assay for SpCas9-mediated minor insertions and deletions.
- FIG. 2E illustrates a schematic representation of base pairing between target locus and EMX1-targeting crRNA, as well as an example chromatogram showing a micro deletion adjacent to the SpCas9 cleavage site.
- a chimeric crRNA-tracrRNA hybrid design was adapted, where a mature crRNA (comprising a guide sequence) may be fused to a partial tracrRNA via a stem-loop to mimic the natural crRNA:tracrRNA duplex.
- a bicistronic expression vector was created to drive co-expression of a chimeric RNA and SpCas9 in transfected cells.
- the bicistronic vectors were used to express a pre-crRNA (DR-guide sequence-DR) with SpCas9, to induce processing into crRNA with a separately expressed tracrRNA (compare FIG. 11B top and bottom).
- FIG. 11B top and bottom.
- FIG. 8 provides schematic illustrations of bicistronic expression vectors for pre-crRNA array ( FIG. 8A ) or chimeric crRNA (represented by the short line downstream of the guide sequence insertion site and upstream of the EF1 ⁇ promoter in FIG. 8B ) with hSpCas9, showing location of various elements and the point of guide sequence insertion.
- the expanded sequence around the location of the guide sequence insertion site in FIG. 8B also shows a partial DR sequence (GTTTTAGAGCTA) (SEQ ID NO: 11) and a partial tracrRNA sequence (TAGCAAGTTAAAATAAGGCTAGTCCGTTTTT) (SEQ ID NO: 12).
- Guide sequences can be inserted between BbsI sites using annealed oligonucleotides.
- RNA design for the oligonucleotides are shown below the schematic illustrations in FIG. 8 , with appropriate ligation adapters indicated.
- WPRE represents the Woodchuck hepatitis virus post-transcriptional regulatory element.
- the efficiency of chimeric RNA-mediated cleavage was tested by targeting the same EMX1 locus described above. Using both Surveyor assay and Sanger sequencing of amplicons, Applicants confirmed that the chimeric RNA design facilitates cleavage of human EMX1 locus with approximately a 4.7% modification rate ( FIG. 3 ).
- FIG. 13 illustrates the selection of some additional targeted protospacers in human PVALB ( FIG. 13A ) and mouse Th ( FIG. 13B ) loci. Schematics of the gene loci and the location of three protospacers within the last exon of each are provided.
- the underlined sequences include 30 bp of protospacer sequence and 3 bp at the 3′ end corresponding to the PAM sequences.
- Protospacers on the sense and anti-sense strands are indicated above and below the DNA sequences, respectively.
- a modification rate of 6.3% and 0.75% was achieved for the human PVALB and mouse Th loci respectively, demonstrating the broad applicability of the CRISPR system in modifying different loci across multiple organisms ( FIG. 5 ). While cleavage was only detected with one out of three spacers for each locus using the chimeric constructs, all target sequences were cleaved with efficiency of indel production reaching 27% when using the co-expressed pre-crRNA arrangement ( FIGS. 6 and 13 ).
- FIG. 11 provides a further illustration that SpCas9 can be reprogrammed to target multiple genomic loci in mammalian cells.
- FIG. 11A provides a schematic of the human EMX1 locus showing the location of five protospacers, indicated by the underlined sequences.
- FIG. 11B provides a schematic of the pre-crRNA/trcrRNA complex showing hybridization between the direct repeat region of the pre-crRNA and tracrRNA (top), and a schematic of a chimeric RNA design comprising a 20 bp guide sequence, and tracr mate and tracr sequences consisting of partial direct repeat and tracrRNA sequences hybridized in a hairpin structure (bottom).
- Results of a Surveyor assay comparing the efficacy of Cas9-mediated cleavage at five protospacers in the human EMX1 locus is illustrated in FIG. 11C .
- Each protospacer is targeted using either processed pre-crRNA/tracrRNA complex (crRNA) or chimeric RNA (chiRNA).
- crRNA pre-crRNA/tracrRNA complex
- chiRNA chimeric RNA
- RNA Since the secondary structure of RNA can be crucial for intermolecular interactions, a structure prediction algorithm based on minimum free energy and Boltzmann-weighted structure ensemble was used to compare the putative secondary structure of all guide sequences used in the genome targeting experiment (see e.g. Gruber et al., 2008, Nucleic Acids Research, 36: W70). Analysis revealed that in most cases, the effective guide sequences in the chimeric crRNA context were substantially free of secondary structure motifs, whereas the ineffective guide sequences were more likely to form internal secondary structures that could prevent base pairing with the target protospacer DNA. It is thus possible that variability in the spacer secondary structure might impact the efficiency of CRISPR-mediated interference when using a chimeric crRNA.
- FIG. 22 illustrates single expression vectors incorporating a U6 promoter linked to an insertion site for a guide oligo, and a Cbh promoter linked to SpCas9 coding sequence.
- the vector shown in FIG. 22 b includes a tracrRNA coding sequence linked to an H1 promoter.
- FIG. 3A illustrates results of a Surveyor nuclease assay comparing the cleavage efficiency of Cas9 when paired with different mutant chimeric RNAs.
- Single-base mismatch up to 12-bp 5′ of the PAM substantially abrogated genomic cleavage by SpCas9, whereas spacers with mutations at farther upstream positions retained activity against the original protospacer target ( FIG. 3B ).
- FIG. 3C provides a schematic showing the design of TALENs targeting EMX1
- FIG. 4C provides a schematic illustration of the HR strategy, with relative locations of recombination points and primer annealing sequences (arrows). SpCas9 and SpCas9n indeed catalyzed integration of the HR template into the EMX1 locus.
- FIG. 2A Expression constructs mimicking the natural architecture of CRISPR loci with arrayed spacers ( FIG. 2A ) were constructed to test the possibility of multiplexed sequence targeting.
- FIG. 4F showing both a schematic design of the crRNA array and a Surveyor blot showing efficient mediation of cleavage.
- FIG. 4G shows a 1.6% deletion efficacy (3 out of 182 amplicons; FIG. 4G ) was detected. This demonstrates that the CRISPR system can mediate multiplexed editing within a single genome.
- RNA to program sequence-specific DNA cleavage defines a new class of genome engineering tools for a variety of research and industrial applications.
- CRISPR system can be further improved to increase the efficiency and versatility of CRISPR targeting.
- Optimal Cas9 activity may depend on the availability of free Mg 2+ at levels higher than that present in the mammalian nucleus (see e.g. Jinek et al., 2012, Science, 337:816), and the preference for an NGG motif immediately downstream of the protospacer restricts the ability to target on average every 12-bp in the human genome ( FIG. 9 , evaluating both plus and minus strands of human chromosomal sequences).
- FIG. 10 illustrates adaptation of the Type II CRISPR system from CRISPR 1 of Streptococcus thermophilus LMD-9 for heterologous expression in mammalian cells to achieve CRISPR-mediated genome editing.
- FIG. 10A provides a Schematic illustration of CRISPR 1 from S. thermophilus LMD-9.
- FIG. 10B illustrates the design of an expression system for the S. thermophilus CRISPR system.
- Human codon-optimized hStCas9 is expressed using a constitutive EF1 ⁇ promoter. Mature versions of tracrRNA and crRNA are expressed using the U6 promoter to promote precise transcription initiation. Sequences from the mature crRNA and tracrRNA are illustrated. A single base indicated by the lower case “a” in the crRNA sequence is used to remove the polyU sequence, which serves as a RNA polIII transcriptional terminator.
- FIG. 10C provides a schematic showing guide sequences targeting the human EMX1 locus.
- FIG. 10D shows the results of hStCas9-mediated cleavage in the target locus using the Surveyor assay. RNA guide spacers 1 and 2 induced 14% and 6.4%, respectively.
- FIG. 14 provides a schematic of additional protospacer and corresponding PAM sequence targets of the S. thermophilus CRISPR system in the human EMX1 locus. Two protospacer sequences are highlighted and their corresponding PAM sequences satisfying NNAGAAW motif are indicated by underlining 3′ with respect to the corresponding highlighted sequence. Both protospacers target the anti-sense strand.
- a software program is designed to identify candidate CRISPR target sequences on both strands of an input DNA sequence based on desired guide sequence length and a CRISPR motif sequence (PAM) for a specified CRISPR enzyme.
- PAM CRISPR motif sequence
- target sites for Cas9 from S. pyogenes with PAM sequences NGG, may be identified by searching for 5′-N-NGG-3′ both on the input sequence and on the reverse-complement of the input.
- target sites for Cas9 of S. thermophilus CRISPR1, with PAM sequence NNAGAAW may be identified by searching for 5′-N x -NNAGAAW-3′ both on the input sequence and on the reverse-complement of the input.
- thermophilus CRISPR3, with PAM sequence NGGNG may be identified by searching for 5′-N x -NGGNG-3′ both on the input sequence and on the reverse-complement of the input.
- the value “x” in N x may be fixed by the program or specified by the user, such as 20.
- the program filters out sequences based on the number of times they appear in the relevant reference genome.
- the filtering step may be based on the seed sequence.
- results are filtered based on the number of occurrences of the seed:PAM sequence in the relevant genome.
- the user may be allowed to choose the length of the seed sequence.
- the user may also be allowed to specify the number of occurrences of the seed:PAM sequence in a genome for purposes of passing the filter.
- the default is to screen for unique sequences. Filtration level is altered by changing both the length of the seed sequence and the number of occurrences of the sequence in the genome.
- the program may in addition or alternatively provide the sequence of a guide sequence complementary to the reported target sequence(s) by providing the reverse complement of the identified target sequence(s).
- An example visualization of some target sites in the human genome is provided in FIG. 18 .
- FIG. 16 a illustrates a schematic of a bicistronic expression vector for chimeric RNA and Cas9. Cas9 is driven by the CBh promoter and the chimeric RNA is driven by a U6 promoter.
- the chimeric guide RNA consists of a 20 bp guide sequence (Ns) joined to the tracr sequence (running from the first “U” of the lower strand to the end of the transcript), which is truncated at various positions as indicated.
- the guide and tracr sequences are separated by the tracr-mate sequence GUUUUAGAGCUA (SEQ ID NO: 13) followed by the loop sequence GAAA.
- Results of SURVEYOR assays for Cas9-mediated indels at the human EMX1 and PVALB loci are illustrated in FIGS. 16 b and 16 c , respectively. Arrows indicate the expected SURVEYOR fragments.
- ChiRNAs are indicated by their “+n” designation, and crRNA refers to a hybrid RNA where guide and tracr sequences are expressed as separate transcripts. Quantification of these results, performed in triplicate, are illustrated by histogram in FIGS. 17 a and 17 b , corresponding to FIGS.
- Protospacer IDs and their corresponding genomic target, protospacer sequence, PAM sequence, and strand location are provided in Table D. Guide sequences were designed to be complementary to the entire protospacer sequence in the case of separate transcripts in the hybrid system, or only to the underlined portion in the case of chimeric RNAs.
- chiRNA(+n) indicate that up to the +n nucleotide of wild-type tracrRNA is included in the chimeric RNA construct, with values of 48, 54, 67, and 85 used for n.
- Chimeric RNAs containing longer fragments of wild-type tracrRNA (chiRNA(+67) and chiRNA(+85)) mediated DNA cleavage at all three EMX1 target sites, with chiRNA(+85) in particular demonstrating significantly higher levels of DNA cleavage than the corresponding crRNA/tracrRNA hybrids that expressed guide and tracr sequences in separate transcripts ( FIGS. 16 b and 17 a ).
- Two sites in the PVALB locus that yielded no detectable cleavage using the hybrid system (guide sequence and tracr sequence expressed as separate transcripts) were also targeted using chiRNAs.
- chiRNA(+67) and chiRNA(+85) were able to mediate significant cleavage at the two PVALB protospacers ( FIGS. 16 c and 17 b ).
- the secondary structure formed by the 3′ end of the tracrRNA may play a role in enhancing the rate of CRISPR complex formation.
- the CRISPR-Cas system is an adaptive immune mechanism against invading exogenous DNA employed by diverse species across bacteria and archaea.
- the type II CRISPR-Cas9 system consists of a set of genes encoding proteins responsible for the “acquisition” of foreign DNA into the CRISPR locus, as well as a set of genes encoding the “execution” of the DNA cleavage mechanism; these include the DNA nuclease (Cas9), a non-coding transactivating cr-RNA (tracrRNA), and an array of foreign DNA-derived spacers flanked by direct repeats (crRNAs).
- the tracRNA and crRNA duplex guide the Cas9 nuclease to a target DNA sequence specified by the spacer guide sequences, and mediates double-stranded breaks in the DNA near a short sequence motif in the target DNA that is required for cleavage and specific to each CRISPR-Cas system.
- the type II CRISPR-Cas systems are found throughout the bacterial kingdom and highly diverse in in Cas9 protein sequence and size, tracrRNA and crRNA direct repeat sequence, genome organization of these elements, and the motif requirement for target cleavage.
- One species may have multiple distinct CRISPR-Cas systems.
- Applicants analyzed Cas9 orthologs to identify the relevant PAM sequences and the corresponding chimeric guide RNA. Having an expanded set of PAMs provides broader targeting across the genome and also significantly increases the number of unique target sites and provides potential for identifying novel Cas9s with increased levels of specificity in the genome.
- the specificity of Cas9 orthologs can be evaluated by testing the ability of each Cas9 to tolerate mismatches between the guide RNA and its DNA target.
- the specificity of SpCas9 has been characterized by testing the effect of mutations in the guide RNA on cleavage efficiency. Libraries of guide RNAs were made with single or multiple mismatches between the guide sequence and the target DNA. Based on these findings, target sites for SpCas9 can be selected based on the following guidelines:
- a target site within the locus of interest such that potential ‘off-target’ genomic sequences abide by the following four constraints: First and foremost, they should not be followed by a PAM with either 5′-NGG or NAG sequences. Second, their global sequence similarity to the target sequence should be minimized. Third, a maximal number of mismatches should lie within the PAM-proximal region of the off-target site. Finally, a maximal number of mismatches should be consecutive or spaced less than four bases apart.
- Method 1 Applicants deliver Cas9 and guide RNA using a vector that expresses Cas9 under the control of a constitutive promoter such as Hsp70A-Rbc S2 or Beta2-tubulin.
- a constitutive promoter such as Hsp70A-Rbc S2 or Beta2-tubulin.
- Method 2 Applicants deliver Cas9 and T7 polymerase using vectors that expresses Cas9 and T7 polymerase under the control of a constitutive promoter such as Hsp70A-Rbe S2 or Beta2-tubulin.
- Guide RNA will be delivered using a vector containing T7 promoter driving the guide RNA.
- Method 3 Applicants deliver Cas9 mRNA and in vitro transcribed guide RNA to algae cells.
- RNA can be in vitro transcribed.
- Cas9 mRNA will consist of the coding region for Cas9 as well as 3′UTR from Cop1 to ensure stabilization of the Cas9 mRNA.
- Applicants provide an additional homology directed repair template.
- T7 promoter T7 promoter, Ns represent targeting sequence
- Chlamydomonas reinhardtii strain CC-124 and CC-125 from the Chlamydomonas Resource Center will be used for electroporation. Electroporation protocol follows standard recommended protocol from the GeneArt Chlamydomonas Engineering kit.
- Applicants generate a line of Chlamydomonas reinhardtii that expresses Cas9 constitutively. This can be done by using pChlamyl (linearized using PvuI) and selecting for hygromycin resistant colonies. Sequence for pChlamyl containing Cas9 is below. In this way to achieve gene knockout one simply needs to deliver RNA for the guideRNA. For homologous recombination Applicants deliver guideRNA as well as a linearized homologous recombination template.
- Applicants use PCR, SURVEYOR nuclease assay, and DNA sequencing to verify successful modification.
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Genetics & Genomics (AREA)
- Engineering & Computer Science (AREA)
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Biomedical Technology (AREA)
- Biotechnology (AREA)
- General Engineering & Computer Science (AREA)
- Molecular Biology (AREA)
- General Health & Medical Sciences (AREA)
- Microbiology (AREA)
- Biochemistry (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Plant Pathology (AREA)
- Medicinal Chemistry (AREA)
- Mycology (AREA)
- Crystallography & Structural Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Cell Biology (AREA)
- Immunology (AREA)
- Analytical Chemistry (AREA)
- Bioinformatics & Computational Biology (AREA)
- Virology (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Enzymes And Modification Thereof (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
- Pharmacology & Pharmacy (AREA)
- Epidemiology (AREA)
- Animal Behavior & Ethology (AREA)
- Public Health (AREA)
- Veterinary Medicine (AREA)
- Medicinal Preparation (AREA)
- Gastroenterology & Hepatology (AREA)
Abstract
Description
- This application is a continuation of International Application No. PCT/US2013/074743 filed Dec. 12, 2013 and published as PCT Publication No. WO 2014/093661 on Jun. 19, 2014 and which claims priority to U.S.
provisional patent application 61/842,322 and U.S. patent application Ser. No. 14/054,414, each having Broad reference BI-2011/008A, entitled CRISPR-CAS SYSTEMS AND METHODS FOR ALTERING EXPRESSION OF GENE PRODUCTS filed on Jul. 2, 2013 and Oct. 15, 2013 respectively. Priority is also claimed to USprovisional patent applications 61/736,527, 61/748,427, 61/791,409 and 61/835,931 having Broad reference BI-2011/008/WSGR Docket No. 44063-701.101, BI-2011/008/WSGR Docket No. 44063-701.102, Broad reference BI-2011/008/VP Docket No. 44790.02.2003 and BI-2011/008/VP Docket No. 44790.03.2003 respectively, all entitled SYSTEMS METHODS AND COMPOSITIONS FOR SEQUENCE MANIPULATION filed on Dec. 12, 2012, Jan. 2, 2013, Mar. 15, 2013 and Jun. 17, 2013, respectively. - This invention was made with government support under NIH Pioneer Award DP1MH100706, awarded by the National Institutes of Health. The government has certain rights in the invention.
- Reference is made to US
provisional patent applications 61/758,468; 61/769,046; 61/802,174; 61/806,375; 61/814,263; 61/819,803 and 61/828,130, each entitled ENGINEERING AND OPTIMIZATION OF SYSTEMS, METHODS AND COMPOSITIONS FOR SEQUENCE MANIPULATION, filed on Jan. 30, 2013; Feb. 25, 2013; Mar. 15, 2013; Mar. 28, 2013; Apr. 20, 2013; May 6, 2013 and May 28, 2013 respectively. Reference is also made to USprovisional patent applications 61/835,936, 61/836,127, 61/836,101, 61/836,080 and 61/835,973 each filed Jun. 17, 2013. - The foregoing applications, and all documents cited therein or during their prosecution (“appln cited documents”) and all documents cited or referenced in the appln cited documents, and all documents cited or referenced herein (“herein cited documents”), and all documents cited or referenced in herein cited documents, together with any manufacturer's instructions, descriptions, product specifications, and product sheets for any products mentioned herein or in any document incorporated by reference herein, are hereby incorporated herein by reference, and may be employed in the practice of the invention. More specifically, all referenced documents are incorporated by reference to the same extent as if each individual document was specifically and individually indicated to be incorporated by reference.
- The present invention generally relates to systems, methods and compositions used for the control of gene expression involving sequence targeting, such as genome perturbation or gene-editing, that may use vector systems related to Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR) and components thereof.
- Recent advances in genome sequencing techniques and analysis methods have significantly accelerated the ability to catalog and map genetic factors associated with a diverse range of biological functions and diseases. Precise genome targeting technologies are needed to enable systematic reverse engineering of causal genetic variations by allowing selective perturbation of individual genetic elements, as well as to advance synthetic biology, biotechnological, and medical applications. Although genome-editing techniques such as designer zinc fingers, transcription activator-like effectors (TALEs), or homing meganucleases are available for producing targeted genome perturbations, there remains a need for new genome engineering technologies that are affordable, easy to set up, scalable, and amenable to targeting multiple positions within the eukaryotic genome.
- There exists a pressing need for alternative and robust systems and techniques for sequence targeting with a wide array of applications. This invention addresses this need and provides related advantages. The CRISPR/Cas or the CRISPR-Cas system (both terms are used interchangeably throughout this application) does not require the generation of customized proteins to target specific sequences but rather a single Cas enzyme can be programmed by a short RNA molecule to recognize a specific DNA target, in other words the Cas enzyme can be recruited to a specific DNA target using said short RNA molecule. Adding the CRISPR-Cas system to the repertoire of genome sequencing techniques and analysis methods may significantly simplify the methodology and accelerate the ability to catalog and map genetic factors associated with a diverse range of biological functions and diseases. To utilize the CRISPR-Cas system effectively for genome editing without deleterious effects, it is critical to understand aspects of engineering and optimization of these genome engineering tools, which are aspects of the claimed invention.
- In one aspect, the invention provides a method of altering or modifying expression of one or more gene products that may comprise introducing into a cell containing and expressing DNA molecules encoding the one or more gene products an engineered, non-naturally occurring CRISPR-Cas system that may comprise a Cas protein and one or more guide RNAs that target the DNA molecules, whereby the one or more guide RNAs target the genomic loci of the DNA molecules encoding the one or more gene products and the Cas protein cleaves the genomic loci of the DNA molecules encoding the one or more gene products, whereby expression of the one or more gene products is altered or modified; and, wherein the Cas protein and the guide RNA do not naturally occur together. The invention comprehends that the expression of two or more gene products may be altered or modified. The invention further comprehends that the guide RNA comprises a guide sequence fused to a tracr sequence. In a preferred embodiment the cell is a eukaryotic cell, in a more preferred embodiment the cell is a mammalian cell and in a yet more preferred embodiment the mammalian cell is a human cell. The invention also comprehends that the Cas protein may comprise one or more nuclear localization signal(s) (NLS(s)). In some embodiments, the Cas protein is a type II CRISPR system enzyme. In some embodiments, the Cas protein is a Cas9 protein. In some embodiments, the Cas9 protein is S. pneumoniae, S. pyogenes, or S. thermophilus Cas9, and may include mutated Cas9 derived from these organisms. The protein may be a Cas9 homolog or ortholog. In some embodiments, the Cas protein is codon-optimized for expression in a eukaryotic cell. In some embodiments, the Cas protein directs cleavage of one or two strands at the location of the target sequence. In a further aspect of the invention, the expression of the gene product is decreased and the gene product is a protein. The invention comprehends that the introducing into the cell is by a delivery system that may comprise viral particles, liposomes, electroporation, microinjection or conjugation.
- In another aspect the invention provides a method of altering or modifying expression of one or more gene products comprising introducing into a cell containing and expressing DNA molecules encoding the one or more gene products an engineered, non-naturally occurring vector system that may comprise one or more vectors comprising: a) a first regulatory element operably linked to one or more CRISPR-Cas system guide RNAs that hybridize with target sequences in genomic loci of the DNA molecules encoding the one or more gene products, b) a second regulatory element operably linked to a Cas protein, wherein components (a) and (b) are located on same or different vectors of the system, whereby the guide RNAs target the genomic loci of the DNA molecules encoding the one or more gene products and the Cas protein cleaves the genomic loci of the DNA molecules encoding the one or more gene products, whereby expression of the one or more gene products is altered or modified; and, wherein the Cas protein and the guide RNAs do not naturally occur together. The invention comprehends that the expression of two or more gene products may be altered or modified. The invention further comprehends that the guide RNA comprises a guide sequence fused to a tracr sequence. In a preferred embodiment the cell is a eukaryotic cell, in a more preferred embodiment the cell is a mammalian cell and in a yet more preferred embodiment the mammalian cell is a human cell. The invention also comprehends that the vectors of the system may further comprise one or more NLS(s). In some embodiments, the Cas protein is a type II CRISPR system enzyme. In some embodiments, the Cas protein is a Cas9 protein. In some embodiments, the Cas9 protein is S. pneumoniae, S. pyogenes, or S. thermophilus Cas9, and may include mutated Cas9 derived from these organisms. The protein may be a Cas9 homolog or ortholog. In some embodiments, the Cas protein is codon-optimized for expression in a eukaryotic cell. In some embodiments, the Cas protein directs cleavage of one or two strands at the location of the target sequence. In a further aspect of the invention, the expression of the gene product is decreased and the gene product is a protein. The invention comprehends that the introducing into the cell is by a delivery system that may comprise viral particles, liposomes, electroporation, microinjection or conjugation.
- The invention also provides an engineered, non-naturally occurring vector system that may comprise one or more vectors comprising: a) a first regulatory element operably linked to one or more CRISPR-Cas system guide RNAs that hybridize with target sequences in genomic loci of DNA molecules encoding one or more gene products, b) a second regulatory element operably linked to a Cas protein, wherein components (a) and (b) are located on same or different vectors of the system, whereby the guide RNAs target the genomic loci of the DNA molecules encoding the one or more gene products in a cell and the Cas protein cleaves the genomic loci of the DNA molecules encoding the one or more gene products, whereby expression of the one or more gene products is altered or modified; and, wherein the Cas protein and the guide RNAs do not naturally occur together. The invention comprehends that the expression of two or more gene products may be altered or modified. The invention further comprehends that the guide RNA comprises a guide sequence fused to a tracr sequence. In a preferred embodiment the cell is a eukaryotic cell, in a more preferred embodiment the cell is a mammalian cell and in a yet more preferred embodiment the mammalian cell is a human cell. The invention also comprehends that the vectors of the system may further comprise one or more NLS(s). In some embodiments, the Cas protein is a type II CRISPR system enzyme. In some embodiments, the Cas protein is a Cas9 protein. In some embodiments, the Cas9 protein is S. pneumoniae, S. pyogenes, or S. thermophilus Cas9, and may include mutated Cas9 derived from these organisms. The protein may be a Cas9 homolog or ortholog. In some embodiments, the Cas protein is codon-optimized for expression in a eukaryotic cell. In some embodiments, the Cas protein directs cleavage of one or two strands at the location of the target sequence. In a further aspect of the invention, the expression of the gene product is decreased and the gene product is a protein. The invention comprehends that the introducing into the cell is by a delivery system that may comprise viral particles, liposomes, electroporation, microinjection or conjugation.
- In yet another aspect the invention provides an engineered, programmable, non-naturally occurring CRISPR-Cas system that may comprise a Cas protein and one or more guide RNAs that target the genomic loci of DNA molecules encoding one or more gene products in a cell and the Cas protein cleaves the genomic loci of the DNA molecules encoding the one or more gene products, whereby expression of the one or more gene products is altered or modified; and, wherein the Cas protein and the guide RNAs do not naturally occur together. The invention comprehends that the expression of two or more gene products may be altered or modified. The invention further comprehends that the guide RNA comprises a guide sequence fused to a tracr sequence. In a preferred embodiment the cell is a eukaryotic cell, in a more preferred embodiment the cell is a mammalian cell and in a yet more preferred embodiment the mammalian cell is a human cell. The invention also comprehends that the CRISPR-Cas system may further comprise one or more NLS(s). In some embodiments, the Cas protein is a type II CRISPR system enzyme. In some embodiments, the Cas protein is a Cas9 protein. In some embodiments, the Cas9 protein is S. pneumoniae, S. pyogenes, or S. thermophilus Cas9, and may include mutated Cas9 derived from these organisms. The protein may be a Cas9 homolog or ortholog. In some embodiments, the Cas protein is codon-optimized for expression in a eukaryotic cell. In some embodiments, the Cas protein directs cleavage of one or two strands at the location of the target sequence. In a further aspect of the invention, the expression of the gene product is decreased and the gene product is a protein. The invention comprehends that the introducing into the cell is by a delivery system that may comprise viral particles, liposomes, electroporation, microinjection or conjugation.
- In one aspect, the invention provides a vector system comprising one or more vectors. In some embodiments, the system comprises: (a) a first regulatory element operably linked to a tracr mate sequence and one or more insertion sites for inserting one or more guide sequences upstream of the tracr mate sequence, wherein when expressed, the guide sequence directs sequence-specific binding of a CRISPR complex to a target sequence in a eukaryotic cell, wherein the CRISPR complex comprises a CRISPR enzyme complexed with (1) the guide sequence that is hybridized to the target sequence, and (2) the tracr mate sequence that is hybridized to the tracr sequence; and (b) a second regulatory element operably linked to an enzyme-coding sequence encoding said CRISPR enzyme comprising a nuclear localization sequence; wherein components (a) and (b) are located on the same or different vectors of the system. In some embodiments, component (a) further comprises the tracr sequence downstream of the tracr mate sequence under the control of the first regulatory element. In some embodiments, component (a) further comprises two or more guide sequences operably linked to the first regulatory element, wherein when expressed, each of the two or more guide sequences direct sequence specific binding of a CRISPR complex to a different target sequence in a eukaryotic cell. In some embodiments, the system comprises the tracr sequence under the control of a third regulatory element, such as a polymerase III promoter. In some embodiments, the tracr sequence exhibits at least 50%, 60%, 70%, 80%, 90%, 95%, or 99% of sequence complementarity along the length of the tracr mate sequence when optimally aligned. Determining optimal alignment is within the purview of one of skill in the art. For example, there are publically and commercially available alignment algorithms and programs such as, but not limited to, ClustalW, Smith-Waterman in matlab, Bowtie, Geneious, Biopython and SeqMan. In some embodiments, the CRISPR complex comprises one or more nuclear localization sequences of sufficient strength to drive accumulation of said CRISPR complex in a detectable amount in the nucleus of a eukaryotic cell. Without wishing to be bound by theory, it is believed that a nuclear localization sequence is not necessary for CRISPR complex activity in eukaryotes, but that including such sequences enhances activity of the system, especially as to targeting nucleic acid molecules in the nucleus. In some embodiments, the CRISPR enzyme is a type II CRISPR system enzyme. In some embodiments, the CRISPR enzyme is a Cas9 enzyme. In some embodiments, the Cas9 enzyme is S. pneumoniae, S. pyogenes, or S. thermophilus Cas9, and may include mutated Cas9 derived from these organisms. The enzyme may be a Cas9 homolog or ortholog. In some embodiments, the CRISPR enzyme is codon-optimized for expression in a eukaryotic cell. In some embodiments, the CRISPR enzyme directs cleavage of one or two strands at the location of the target sequence. In some embodiments, the first regulatory element is a polymerase III promoter. In some embodiments, the second regulatory element is a polymerase II promoter. In some embodiments, the guide sequence is at least 15, 16, 17, 18, 19, 20, 25 nucleotides, or between 10-30, or between 15-25, or between 15-20 nucleotides in length. In general, and throughout this specification, the term “vector” refers to a nucleic acid molecule capable of transporting another nucleic acid to which it has been linked. Vectors include, but are not limited to, nucleic acid molecules that are single-stranded, double-stranded, or partially double-stranded; nucleic acid molecules that comprise one or more free ends, no free ends (e.g. circular); nucleic acid molecules that comprise DNA, RNA, or both; and other varieties of polynucleotides known in the art. One type of vector is a “plasmid,” which refers to a circular double stranded DNA loop into which additional DNA segments can be inserted, such as by standard molecular cloning techniques. Another type of vector is a viral vector, wherein virally-derived DNA or RNA sequences are present in the vector for packaging into a virus (e.g. retroviruses, replication defective retroviruses, adenoviruses, replication defective adenoviruses, and adeno-associated viruses). Viral vectors also include polynucleotides carried by a virus for transfection into a host cell. Certain vectors are capable of autonomous replication in a host cell into which they are introduced (e.g. bacterial vectors having a bacterial origin of replication and episomal mammalian vectors). Other vectors (e.g., non-episomal mammalian vectors) are integrated into the genome of a host cell upon introduction into the host cell, and thereby are replicated along with the host genome. Moreover, certain vectors are capable of directing the expression of genes to which they are operatively-linked. Such vectors are referred to herein as “expression vectors.” Common expression vectors of utility in recombinant DNA techniques are often in the form of plasmids.
- Recombinant expression vectors can comprise a nucleic acid of the invention in a form suitable for expression of the nucleic acid in a host cell, which means that the recombinant expression vectors include one or more regulatory elements, which may be selected on the basis of the host cells to be used for expression, that is operatively-linked to the nucleic acid sequence to be expressed. Within a recombinant expression vector, “operably linked” is intended to mean that the nucleotide sequence of interest is linked to the regulatory element(s) in a manner that allows for expression of the nucleotide sequence (e.g. in an in vitro transcription/translation system or in a host cell when the vector is introduced into the host cell).
- The term “regulatory element” is intended to include promoters, enhancers, internal ribosomal entry sites (IRES), and other expression control elements (e.g. transcription termination signals, such as polyadenylation signals and poly-U sequences). Such regulatory elements are described, for example, in Goeddel, GENE EXPRESSION TECHNOLOGY: METHODS IN ENZYMOLOGY 185. Academic Press, San Diego, Calif. (1990). Regulatory elements include those that direct constitutive expression of a nucleotide sequence in many types of host cell and those that direct expression of the nucleotide sequence only in certain host cells (e.g., tissue-specific regulatory sequences). A tissue-specific promoter may direct expression primarily in a desired tissue of interest, such as muscle, neuron, bone, skin, blood, specific organs (e.g. liver, pancreas), or particular cell types (e.g. lymphocytes). Regulatory elements may also direct expression in a temporal-dependent manner, such as in a cell-cycle dependent or developmental stage-dependent manner, which may or may not also be tissue or cell-type specific. In some embodiments, a vector comprises one or more pol III promoter (e.g. 1, 2, 3, 4, 5, or more pol III promoters), one or more pol II promoters (e.g. 1, 2, 3, 4, 5, or more pol II promoters), one or more pol I promoters (e.g. 1, 2, 3, 4, 5, or more pol I promoters), or combinations thereof. Examples of pol III promoters include, but are not limited to, U6 and H1 promoters. Examples of pol II promoters include, but are not limited to, the retroviral Rous sarcoma virus (RSV) LTR promoter (optionally with the RSV enhancer), the cytomegalovirus (CMV) promoter (optionally with the CMV enhancer) [see, e.g., Boshart et al, Cell, 41:521-530 (1985)], the SV40 promoter, the dihydrofolate reductase promoter, the β-actin promoter, the phosphoglycerol kinase (PGK) promoter, and the EF1α promoter. Also encompassed by the term “regulatory element” are enhancer elements, such as WPRE; CMV enhancers; the R-U5′ segment in LTR of HTLV-I (Mol. Cell. Biol., Vol. 8(1), p. 466-472, 1988); SV40 enhancer; and the intron sequence between
exons - Advantageous vectors include lentiviruses and adeno-associated viruses, and types of such vectors can also be selected for targeting particular types of cells.
- In one aspect, the invention provides a eukaryotic host cell comprising (a) a first regulatory element operably linked to a tracr mate sequence and one or more insertion sites for inserting one or more guide sequences upstream of the tracr mate sequence, wherein when expressed, the guide sequence directs sequence-specific binding of a CRISPR complex to a target sequence in a eukaryotic cell, wherein the CRISPR complex comprises a CRISPR enzyme complexed with (1) the guide sequence that is hybridized to the target sequence, and (2) the tracr mate sequence that is hybridized to the tracr sequence; and/or (b) a second regulatory element operably linked to an enzyme-coding sequence encoding said CRISPR enzyme comprising a nuclear localization sequence. In some embodiments, the host cell comprises components (a) and (b). In some embodiments, component (a), component (b), or components (a) and (b) are stably integrated into a genome of the host eukaryotic cell. In some embodiments, component (a) further comprises the tracr sequence downstream of the tracr mate sequence under the control of the first regulatory element. In some embodiments, component (a) further comprises two or more guide sequences operably linked to the first regulatory element, wherein when expressed, each of the two or more guide sequences direct sequence specific binding of a CRISPR complex to a different target sequence in a eukaryotic cell. In some embodiments, the eukaryotic host cell further comprises a third regulatory element, such as a polymerase III promoter, operably linked to said tracr sequence. In some embodiments, the tracr sequence exhibits at least 50%. 60%, 70%, 80%, 90%, 95%, or 99% of sequence complementarity along the length of the tracr mate sequence when optimally aligned. The enzyme may be a Cas9 homolog or ortholog. In some embodiments, the CRISPR enzyme is codon-optimized for expression in a eukaryotic cell. In some embodiments, the CRISPR enzyme directs cleavage of one or two strands at the location of the target sequence. In some embodiments, the CRISPR enzyme lacks DNA strand cleavage activity. In some embodiments, the first regulatory element is a polymerase III promoter. In some embodiments, the second regulatory element is a polymerase II promoter. In some embodiments, the guide sequence is at least 15, 16, 17, 18, 19, 20, 25 nucleotides, or between 10-30, or between 15-25, or between 15-20 nucleotides in length. In an aspect, the invention provides a non-human eukaryotic organism; preferably a multicellular eukaryotic organism, comprising a eukaryotic host cell according to any of the described embodiments. In other aspects, the invention provides a eukaryotic organism; preferably a multicellular eukaryotic organism, comprising a eukaryotic host cell according to any of the described embodiments. The organism in some embodiments of these aspects may be an animal; for example a mammal. Also, the organism may be an arthropod such as an insect. The organism also may be a plant. Further, the organism may be a fungus.
- In one aspect, the invention provides a kit comprising one or more of the components described herein. In some embodiments, the kit comprises a vector system and instructions for using the kit. In some embodiments, the vector system comprises (a) a first regulatory element operably linked to a tracr mate sequence and one or more insertion sites for inserting one or more guide sequences upstream of the tracr mate sequence, wherein when expressed, the guide sequence directs sequence-specific binding of a CRISPR complex to a target sequence in a eukaryotic cell, wherein the CRISPR complex comprises a CRISPR enzyme complexed with (1) the guide sequence that is hybridized to the target sequence, and (2) the tracr mate sequence that is hybridized to the tracr sequence; and/or (b) a second regulatory element operably linked to an enzyme-coding sequence encoding said CRISPR enzyme comprising a nuclear localization sequence. In some embodiments, the kit comprises components (a) and (b) located on the same or different vectors of the system. In some embodiments, component (a) further comprises the tracr sequence downstream of the tracr mate sequence under the control of the first regulatory element. In some embodiments, component (a) further comprises two or more guide sequences operably linked to the first regulatory element, wherein when expressed, each of the two or more guide sequences direct sequence specific binding of a CRISPR complex to a different target sequence in a eukaryotic cell. In some embodiments, the system further comprises a third regulatory element, such as a polymerase III promoter, operably linked to said tracr sequence. In some embodiments, the tracr sequence exhibits at least 50%, 60%, 70%, 80%, 90%, 95%, or 99% of sequence complementarity along the length of the tracr mate sequence when optimally aligned. In some embodiments, the CRISPR enzyme comprises one or more nuclear localization sequences of sufficient strength to drive accumulation of said CRISPR enzyme in a detectable amount in the nucleus of a eukaryotic cell. In some embodiments, the CRISPR enzyme is a type II CRISPR system enzyme. In some embodiments, the CRISPR enzyme is a Cas9 enzyme. In some embodiments, the Cas9 enzyme is S. pneumoniae, S. pyogenes or S. thermophilus Cas9, and may include mutated Cas9 derived from these organisms. The enzyme may be a Cas9 homolog or ortholog. In some embodiments, the CRISPR enzyme is codon-optimized for expression in a eukaryotic cell. In some embodiments, the CRISPR enzyme directs cleavage of one or two strands at the location of the target sequence. In some embodiments, the CRISPR enzyme lacks DNA strand cleavage activity. In some embodiments, the first regulatory element is a polymerase III promoter. In some embodiments, the second regulatory element is a polymerase II promoter. In some embodiments, the guide sequence is at least 15, 16, 17, 18, 19, 20, 25 nucleotides, or between 10-30, or between 15-25, or between 15-20 nucleotides in length.
- In one aspect, the invention provides a method of modifying a target polynucleotide in a eukaryotic cell. In some embodiments, the method comprises allowing a CRISPR complex to bind to the target polynucleotide to effect cleavage of said target polynucleotide thereby modifying the target polynucleotide, wherein the CRISPR complex comprises a CRISPR enzyme complexed with a guide sequence hybridized to a target sequence within said target polynucleotide, wherein said guide sequence is linked to a tracr mate sequence which in turn hybridizes to a tracr sequence. In some embodiments, said cleavage comprises cleaving one or two strands at the location of the target sequence by said CRISPR enzyme. In some embodiments, said cleavage results in decreased transcription of a target gene. In some embodiments, the method further comprises repairing said cleaved target polynucleotide by homologous recombination with an exogenous template polynucleotide, wherein said repair results in a mutation comprising an insertion, deletion, or substitution of one or more nucleotides of said target polynucleotide. In some embodiments, said mutation results in one or more amino acid changes in a protein expressed from a gene comprising the target sequence. In some embodiments, the method further comprises delivering one or more vectors to said eukaryotic cell, wherein the one or more vectors drive expression of one or more of: the CRISPR enzyme, the guide sequence linked to the tracr mate sequence, and the tracr sequence. In some embodiments, said vectors are delivered to the eukaryotic cell in a subject. In some embodiments, said modifying takes place in said eukaryotic cell in a cell culture. In some embodiments, the method further comprises isolating said eukaryotic cell from a subject prior to said modifying. In some embodiments, the method further comprises returning said eukaryotic cell and/or cells derived therefrom to said subject.
- In one aspect, the invention provides a method of modifying expression of a polynucleotide in a eukaryotic cell. In some embodiments, the method comprises allowing a CRISPR complex to bind to the polynucleotide such that said binding results in increased or decreased expression of said polynucleotide; wherein the CRISPR complex comprises a CRISPR enzyme complexed with a guide sequence hybridized to a target sequence within said polynucleotide, wherein said guide sequence is linked to a tracr mate sequence which in turn hybridizes to a tracr sequence. In some embodiments, the method further comprises delivering one or more vectors to said eukaryotic cells, wherein the one or more vectors drive expression of one or more of: the CRISPR enzyme, the guide sequence linked to the tracr mate sequence, and the tracr sequence.
- In one aspect, the invention provides a method of generating a model eukaryotic cell comprising a mutated disease gene. In some embodiments, a disease gene is any gene associated an increase in the risk of having or developing a disease. In some embodiments, the method comprises (a) introducing one or more vectors into a eukaryotic cell, wherein the one or more vectors drive expression of one or more of: a CRISPR enzyme, a guide sequence linked to a tracr mate sequence, and a tracr sequence; and (b) allowing a CRISPR complex to bind to a target polynucleotide to effect cleavage of the target polynucleotide within said disease gene, wherein the CRISPR complex comprises the CRISPR enzyme complexed with (1) the guide sequence that is hybridized to the target sequence within the target polynucleotide, and (2) the tracr mate sequence that is hybridized to the tracr sequence, thereby generating a model eukaryotic cell comprising a mutated disease gene. In some embodiments, said cleavage comprises cleaving one or two strands at the location of the target sequence by said CRISPR enzyme. In some embodiments, said cleavage results in decreased transcription of a target gene. In some embodiments, the method further comprises repairing said cleaved target polynucleotide by homologous recombination with an exogenous template polynucleotide, wherein said repair results in a mutation comprising an insertion, deletion, or substitution of one or more nucleotides of said target polynucleotide. In some embodiments, said mutation results in one or more amino acid changes in a protein expression from a gene comprising the target sequence.
- In one aspect, the invention provides a method for developing a biologically active agent that modulates a cell signaling event associated with a disease gene. In some embodiments, a disease gene is any gene associated an increase in the risk of having or developing a disease. In some embodiments, the method comprises (a) contacting a test compound with a model cell of any one of the described embodiments; and (b) detecting a change in a readout that is indicative of a reduction or an augmentation of a cell signaling event associated with said mutation in said disease gene, thereby developing said biologically active agent that modulates said cell signaling event associated with said disease gene.
- In one aspect, the invention provides a recombinant polynucleotide comprising a guide sequence upstream of a tracr mate sequence, wherein the guide sequence when expressed directs sequence-specific binding of a CRISPR complex to a corresponding target sequence present in a eukaryotic cell. In some embodiments, the target sequence is a viral sequence present in a eukaryotic cell. In some embodiments, the target sequence is a proto-oncogene or an oncogene.
- In one aspect the invention provides for a method of selecting one or more cell(s) by introducing one or more mutations in a gene in the one or more cell (s), the method comprising: introducing one or more vectors into the cell (s), wherein the one or more vectors drive expression of one or more of: a CRISPR enzyme, a guide sequence linked to a tracr mate sequence, a tracr sequence, and an editing template; wherein the editing template comprises the one or more mutations that abolish CRISPR enzyme cleavage; allowing homologous recombination of the editing template with the target polynucleotide in the cell(s) to be selected; allowing a CRISPR complex to bind to a target polynucleotide to effect cleavage of the target polynucleotide within said gene, wherein the CRISPR complex comprises the CRISPR enzyme complexed with (1) the guide sequence that is hybridized to the target sequence within the target polynucleotide, and (2) the tracr mate sequence that is hybridized to the tracr sequence, wherein binding of the CRISPR complex to the target polynucleotide induces cell death, thereby allowing one or more cell(s) in which one or more mutations have been introduced to be selected. In some embodiments, the CRISPR enzyme is a type II CRISPR system enzyme. In some embodiments, the CRISPR enzyme is a Cas9 protein. In some embodiments, the Cas9 protein is S. pneumoniae, S. pyogenes, or S. thermophilus Cas9, and may include mutated Cas9 derived from these organisms. The enzyme may be a Cas9 homolog or ortholog. In some embodiments, the enzyme is codon-optimized for expression in a eukaryotic cell. In some embodiments, the enzyme directs cleavage of one or two strands at the location of the target sequence. In a preferred embodiment, the CRISPR enzyme is Cas9. In another preferred embodiment of the invention the cell to be selected may be a eukaryotic cell. Aspects of the invention allow for selection of specific cells without requiring a selection marker or a two-step process that may include a counter-selection system.
- Aspects of the invention comprehend site-specific gene knockout in the endogenous genome: The present invention is advantageous over using site-specific nuclease technologies based on zinc finger and TAL effectors as it does not require elaborate design and may be used to simultaneously knockout multiple genes within the same genome. In a further aspect, the invention comprehends site-specific genome editing. The present invention is advantageous over using natural or artificial site-specific nucleases or recombinases as it may be able to introduce site-specific double strand breaks to facilitate homologous recombination at the targeted genome loci. In another aspect the invention comprehends DNA sequence-specific interference. The invention may be used to inactivate the genome of deleterious DNA-based organisms, such as microbes, viruses, or even cancerous cells, by directly introducing breaks at specific sites in the genome of these organisms. The invention provides methods and compositions for multiplexed genome engineering as the CRISPR-Cas system of the invention can be easily targeted to multiple sites in the genome through the use of multiple sequence-specific CRISPR spacer elements or guide sequences.
- Accordingly, it is an object of the invention not to encompass within the invention any previously known product, process of making the product, or method of using the product such that Applicants reserve the right and hereby disclose a disclaimer of any previously known product, process, or method. It is further noted that the invention does not intend to encompass within the scope of the invention any product, process, or making of the product or method of using the product, which does not meet the written description and enablement requirements of the USPTO (35 U.S.C. §112, first paragraph) or the EPO (Article 83 of the EPC), such that Applicants reserve the right and hereby disclose a disclaimer of any previously described product, process of making the product, or method of using the product.
- It is noted that in this disclosure and particularly in the claims and/or paragraphs, terms such as “comprises”, “comprised”, “comprising” and the like can have the meaning attributed to it in U.S. patent law; e.g., they can mean “includes”, “included”, “including”, and the like; and that terms such as “consisting essentially of” and “consists essentially of” have the meaning ascribed to them in U.S. patent law, e.g., they allow for elements not explicitly recited, but exclude elements that are found in the prior art or that affect a basic or novel characteristic of the invention. These and other embodiments are disclosed or are obvious from and encompassed by, the following Detailed Description.
- The novel features of the invention are set forth with particularity in the appended claims. A better understanding of the features and advantages of the present invention will be obtained by reference to the following detailed description that sets forth illustrative embodiments, in which the principles of the invention are utilized, and the accompanying drawings of which:
-
FIG. 1 shows a schematic model of the CRISPR system. The Cas9 nuclease from Streptococcus pyogenes (yellow) is targeted to genomic DNA by a synthetic guide RNA (sgRNA) consisting of a 20-nt guide sequence (blue) and a scaffold (red). The guide sequence base-pairs with the DNA target (blue), directly upstream of a requisite 5′-NGG protospacer adjacent motif (PAM; magenta), and Cas9 mediates a double-stranded break (DSB) ˜3 bp upstream of the PAM (red triangle). -
FIG. 2A-F shows an exemplary CRISPR system, a possible mechanism of action, an example adaptation for expression in eukaryotic cells, and results of tests assessing nuclear localization and CRISPR activity.FIG. 2C discloses SEQ ID NOS 23-24, respectively, in order of appearance.FIG. 2E discloses SEQ ID NOS 25-27, respectively, in order of appearance.FIG. 2F discloses SEQ ID NOS 28-32, respectively, in order of appearance. -
FIG. 3A-D shows results of an evaluation of SpCas9 specificity for an example target.FIG. 3A discloses SEQ ID NOS 33, 26 and 34-44, respectively, in order of appearance.FIG. 3C discloses SEQ ID NO: 33. -
FIG. 4A-G shows an exemplary vector system and results for its use in directing homologous recombination in eukaryotic cells.FIG. 4E discloses SEQ ID NO: 45.FIG. 4F discloses SEQ ID NOS 46-47, respectively, in order of appearance.FIG. 4G discloses SEQ ID NOS 48-52, respectively, in order of appearance. -
FIG. 5 provides a table of protospacer sequences (SEQ ID NOS -
FIG. 6A-C shows a comparison of different tracrRNA transcripts for Cas9-mediated gene targeting.FIG. 6A discloses SEQ ID NOS 64-65, respectively, in order of appearance. -
FIG. 7 shows a schematic of a surveyor nuclease assay for detection of double strand break-induced micro-insertions and -deletions. -
FIG. 8A-B shows exemplary bicistronic expression vectors for expression of CRISPR system elements in eukaryotic cells.FIG. 8A discloses SEQ ID NOS 66-68, respectively, in order of appearance.FIG. 8B discloses SEQ ID NOS 69-71, respectively, in order of appearance. -
FIG. 9A-C shows histograms of distances between adjacent S. pyogenesSF370 locus 1 PAM (NGG) (FIG. 9A ) and S.thermophilus LMD9 locus 2 PAM (NNAGAAW) (FIG. 9B ) in the human genome; and distances for each PAM by chromosome (Chr) (FIG. 9C ). -
FIG. 10A-D shows an exemplary CRISPR system, an example adaptation for expression in eukaryotic cells, and results of tests assessing CRISPR activity.FIG. 10B discloses SEQ ID NOS 72-73, respectively, in order of appearance.FIG. 10C discloses SEQ ID NO: 74. -
FIG. 11A-C shows exemplary manipulations of a CRISPR system for targeting of genomic loci in mammalian cells.FIG. 11A discloses SEQ ID NO: 75.FIG. 11B discloses SEQ ID NOS 76-78, respectively, in order of appearance. -
FIG. 12A-B shows the results of a Northern blot analysis of crRNA processing in mammalian cells.FIG. 12A discloses SEQ ID NO: 79. -
FIG. 13A-B shows an exemplary selection of protospacers in the human PVALB and mouse Th loci.FIG. 13A discloses SEQ ID NO: 80.FIG. 13B discloses SEQ ID NO: 81. -
FIG. 14 shows example protospacer and corresponding PAM sequence targets of the S. thermophilus CRISPR system in the human EMX1 locus.FIG. 14 discloses SEQ ID NO: 74. -
FIG. 15 provides a table of sequences (SEQ ID NOS 82-93, respectively, in order of appearance) for primers and probes used for Surveyor, RFLP, genomic sequencing, and Northern blot assays. -
FIG. 16A-C shows exemplary manipulation of a CRISPR system with chimeric RNAs and results of SURVEYOR assays for system activity in eukaryotic cells.FIG. 16A discloses SEQ ID NO: 94. -
FIG. 17A-B shows a graphical representation of the results of SURVEYOR assays for CRISPR system activity in eukaryotic cells. -
FIG. 18 shows an exemplary visualization of some S. pyogenes Cas9 target sites in the human genome using the UCSC genome browser.FIG. 18 discloses SEQ ID NOS 95-173, respectively, in order of appearance. -
FIG. 19A-D shows a circular depiction of the phylogenetic analysis revealing five families of Cas9s, including three groups of large Cas9s (˜1400 amino acids) and two of small Cas9s (˜1100 amino acids). -
FIG. 20A-F shows the linear depiction of the phylogenetic analysis revealing five families of Cas9s, including three groups of large Cas9s (˜1400 amino acids) and two of small Cas9s (˜1100 amino acids). -
FIG. 21A-D shows genome editing via homologous recombination. (a) Schematic of SpCas9 nickase, with D10A mutation in the RuvC I catalytic domain. (b) Schematic representing homologous recombination (HR) at the human EtM1 locus using either sense or antisense single stranded oligonucleotides as repair templates. Red arrow above indicates sgRNA cleavage site; PCR primers for genotyping (Tables J and K) are indicated as arrows in right panel.FIG. 21C discloses SEQ ID NOS 174-176, 174, 177 and 176, respectively, in order of appearance. (c) Sequence of region modified by HR. d, SURVEYOR assay for wildtype (wt) and nickase (D10A) SpCas9-mediated indels at theEMX1 target 1 locus (n=3). Arrows indicate positions of expected fragment sizes. -
FIG. 22A-B shows single vector designs for SpCas9.FIG. 22A discloses SEQ ID NOS 178-180, respectively, in order of appearance.FIG. 22B discloses SEQ ID NO: 181. - The figures herein are for illustrative purposes only and are not necessarily drawn to scale.
- The terms “polynucleotide”, “nucleotide”, “nucleotide sequence”, “nucleic acid” and “oligonucleotide” are used interchangeably. They refer to a polymeric form of nucleotides of any length, either deoxyribonucleotides or ribonucleotides, or analogs thereof. Polynucleotides may have any three dimensional structure, and may perform any function, known or unknown. The following are non limiting examples of polynucleotides: coding or non-coding regions of a gene or gene fragment, loci (locus) defined from linkage analysis, exons, introns, messenger RNA (mRNA), transfer RNA, ribosomal RNA, short interfering RNA (siRNA), short-hairpin RNA (shRNA), micro-RNA (miRNA), ribozymes, cDNA, recombinant polynucleotides, branched polynucleotides, plasmids, vectors, isolated DNA of any sequence, isolated RNA of any sequence, nucleic acid probes, and primers. A polynucleotide may comprise one or more modified nucleotides, such as methylated nucleotides and nucleotide analogs. If present, modifications to the nucleotide structure may be imparted before or after assembly of the polymer. The sequence of nucleotides may be interrupted by non nucleotide components. A polynucleotide may be further modified after polymerization, such as by conjugation with a labeling component.
- In aspects of the invention the terms “chimeric RNA”, “chimeric guide RNA”, “guide RNA”, “single guide RNA” and “synthetic guide RNA” are used interchangeably and refer to the polynucleotide sequence comprising the guide sequence, the tracr sequence and the tracr mate sequence. The term “guide sequence” refers to the about 20 bp sequence within the guide RNA that specifies the target site and may be used interchangeably with the terms “guide” or “spacer”. The term “tracr mate sequence” may also be used interchangeably with the term “direct repeat(s)”. An exemplary CRISPR-Cas system is illustrated in
FIG. 1 . - As used herein the term “wild type” is a term of the art understood by skilled persons and means the typical form of an organism, strain, gene or characteristic as it occurs in nature as distinguished from mutant or variant forms.
- As used herein the term “variant” should be taken to mean the exhibition of qualities that have a pattern that deviates from what occurs in nature.
- The terms “non-naturally occurring” or “engineered” are used interchangeably and indicate the involvement of the hand of man. The terms, when referring to nucleic acid molecules or polypeptides mean that the nucleic acid molecule or the polypeptide is at least substantially free from at least one other component with which they are naturally associated in nature and as found in nature.
- “Complementarity” refers to the ability of a nucleic acid to form hydrogen bond(s) with another nucleic acid sequence by either traditional Watson-Crick or other non-traditional types. A percent complementarity indicates the percentage of residues in a nucleic acid molecule which can form hydrogen bonds (e.g., Watson-Crick base pairing) with a second nucleic acid sequence (e.g., 5, 6, 7, 8, 9, 10 out of 10 being 50%, 60%, 70%, 80%, 90%, and 100% complementary). “Perfectly complementary” means that all the contiguous residues of a nucleic acid sequence will hydrogen bond with the same number of contiguous residues in a second nucleic acid sequence. “Substantially complementary” as used herein refers to a degree of complementarity that is at least 60%. 65%, 70%, 75%, 80%, 85%, 90%, 95%, 97%, 98%, 99%, or 100% over a region of 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 30, 35, 40, 45, 50, or more nucleotides, or refers to two nucleic acids that hybridize under stringent conditions.
- As used herein, “stringent conditions” for hybridization refer to conditions under which a nucleic acid having complementarity to a target sequence predominantly hybridizes with the target sequence, and substantially does not hybridize to non-target sequences. Stringent conditions are generally sequence-dependent, and vary depending on a number of factors. In general, the longer the sequence, the higher the temperature at which the sequence specifically hybridizes to its target sequence. Non-limiting examples of stringent conditions are described in detail in Tijssen (1993), Laboratory Techniques In Biochemistry And Molecular Biology-Hybridization With Nucleic Acid Probes Part I, Second Chapter “Overview of principles of hybridization and the strategy of nucleic acid probe assay”, Elsevier, N.Y.
- “Hybridization” refers to a reaction in which one or more polynucleotides react to form a complex that is stabilized via hydrogen bonding between the bases of the nucleotide residues. The hydrogen bonding may occur by Watson Crick base pairing, Hoogstein binding, or in any other sequence specific manner. The complex may comprise two strands forming a duplex structure, three or more strands forming a multi stranded complex, a single self hybridizing strand, or any combination of these. A hybridization reaction may constitute a step in a more extensive process, such as the initiation of PCR, or the cleavage of a polynucleotide by an enzyme. A sequence capable of hybridizing with a given sequence is referred to as the “complement” of the given sequence.
- As used herein, “expression” refers to the process by which a polynucleotide is transcribed from a DNA template (such as into and mRNA or other RNA transcript) and/or the process by which a transcribed mRNA is subsequently translated into peptides, polypeptides, or proteins. Transcripts and encoded polypeptides may be collectively referred to as “gene product.” If the polynucleotide is derived from genomic DNA, expression may include splicing of the mRNA in a eukaryotic cell.
- The terms “polypeptide”, “peptide” and “protein” are used interchangeably herein to refer to polymers of amino acids of any length. The polymer may be linear or branched, it may comprise modified amino acids, and it may be interrupted by non amino acids. The terms also encompass an amino acid polymer that has been modified; for example, disulfide bond formation, glycosylation, lipidation, acetylation, phosphorylation, or any other manipulation, such as conjugation with a labeling component. As used herein the term “amino acid” includes natural and/or unnatural or synthetic amino acids, including glycine and both the D or L optical isomers, and amino acid analogs and peptidomimetics.
- The terms “subject,” “individual,” and “patient” are used interchangeably herein to refer to a vertebrate, preferably a mammal, more preferably a human. Mammals include, but are not limited to, murines, simians, humans, farm animals, sport animals, and pets. Tissues, cells and their progeny of a biological entity obtained in vivo or cultured in vitro are also encompassed.
- The terms “therapeutic agent”, “therapeutic capable agent” or “treatment agent” are used interchangeably and refer to a molecule or compound that confers some beneficial effect upon administration to a subject. The beneficial effect includes enablement of diagnostic determinations; amelioration of a disease, symptom, disorder, or pathological condition; reducing or preventing the onset of a disease, symptom, disorder or condition; and generally counteracting a disease, symptom, disorder or pathological condition.
- As used herein, “treatment” or “treating,” or “palliating” or “ameliorating” are used interchangeably. These terms refer to an approach for obtaining beneficial or desired results including but not limited to a therapeutic benefit and/or a prophylactic benefit. By therapeutic benefit is meant any therapeutically relevant improvement in or effect on one or more diseases, conditions, or symptoms under treatment. For prophylactic benefit, the compositions may be administered to a subject at risk of developing a particular disease, condition, or symptom, or to a subject reporting one or more of the physiological symptoms of a disease, even though the disease, condition, or symptom may not have yet been manifested.
- The term “effective amount” or “therapeutically effective amount” refers to the amount of an agent that is sufficient to effect beneficial or desired results. The therapeutically effective amount may vary depending upon one or more of: the subject and disease condition being treated, the weight and age of the subject, the severity of the disease condition, the manner of administration and the like, which can readily be determined by one of ordinary skill in the art. The term also applies to a dose that will provide an image for detection by any one of the imaging methods described herein. The specific dose may vary depending on one or more of: the particular agent chosen, the dosing regimen to be followed, whether it is administered in combination with other compounds, timing of administration, the tissue to be imaged, and the physical delivery system in which it is carried.
- The practice of the present invention employs, unless otherwise indicated, conventional techniques of immunology, biochemistry, chemistry, molecular biology, microbiology, cell biology, genomics and recombinant DNA, which are within the skill of the art. See Sambrook, Fritsch and Maniatis, MOLECULAR CLONING: A LABORATORY MANUAL, 2nd edition (1989); CURRENT PROTOCOLS IN MOLECULAR BIOLOGY (F. M. Ausubel, et al. eds., (1987)); the series METHODS IN ENZYMOLOGY (Academic Press, Inc.): PCR 2: A PRACTICAL APPROACH (M. J. MacPherson, B. D. Hames and G. R. Taylor eds. (1995)), Harlow and Lane, eds. (1988) ANTIBODIES, A LABORATORY MANUAL, and ANIMAL CELL CULTURE (R. I. Freshney, ed. (1987)).
- Several aspects of the invention relate to vector systems comprising one or more vectors, or vectors as such. Vectors can be designed for expression of CRISPR transcripts (e.g. nucleic acid transcripts, proteins, or enzymes) in prokaryotic or eukaryotic cells. For example, CRISPR transcripts can be expressed in bacterial cells such as Escherichia coli, insect cells (using baculovirus expression vectors), yeast cells, or mammalian cells. Suitable host cells are discussed further in Goeddel, GENE EXPRESSION TECHNOLOGY: METHODS IN ENZYMOLOGY 185, Academic Press, San Diego, Calif. (1990). Alternatively, the recombinant expression vector can be transcribed and translated in vitro, for example using T7 promoter regulatory sequences and T7 polymerase.
- Vectors may be introduced and propagated in a prokaryote. In some embodiments, a prokaryote is used to amplify copies of a vector to be introduced into a eukaryotic cell or as an intermediate vector in the production of a vector to be introduced into a eukaryotic cell (e.g. amplifying a plasmid as part of a viral vector packaging system). In some embodiments, a prokaryote is used to amplify copies of a vector and express one or more nucleic acids, such as to provide a source of one or more proteins for delivery to a host cell or host organism. Expression of proteins in prokaryotes is most often carried out in Escherichia coli with vectors containing constitutive or inducible promoters directing the expression of either fusion or non-fusion proteins. Fusion vectors add a number of amino acids to a protein encoded therein, such as to the amino terminus of the recombinant protein. Such fusion vectors may serve one or more purposes, such as: (i) to increase expression of recombinant protein; (ii) to increase the solubility of the recombinant protein; and (iii) to aid in the purification of the recombinant protein by acting as a ligand in affinity purification. Often, in fusion expression vectors, a proteolytic cleavage site is introduced at the junction of the fusion moiety and the recombinant protein to enable separation of the recombinant protein from the fusion moiety subsequent to purification of the fusion protein. Such enzymes, and their cognate recognition sequences, include Factor Xa, thrombin and enterokinase. Example fusion expression vectors include pGEX (Pharmacia Biotech Inc; Smith and Johnson, 1988. Gene 67: 31-40), pMAL (New England Biolabs, Beverly, Mass.) and pRIT5 (Pharmacia, Piscataway, N.J.) that fuse glutathione S-transferase (GST), maltose E binding protein, or protein A, respectively, to the target recombinant protein.
- Examples of suitable inducible non-fusion E. coli expression vectors include pTrc (Amrann et al., (1988) Gene 69:301-315) and pET 11d (Studier et al., GENE EXPRESSION TECHNOLOGY: METHODS IN ENZYMOLOGY 185, Academic Press, San Diego, Calif. (1990) 60-89).
- In some embodiments, a vector is a yeast expression vector. Examples of vectors for expression in yeast Saccharomyces cerivisae include pYepSec1 (Baldari, et al., 1987. EMBO J. 6: 229-234), pMFa (Kuijan and Herskowitz, 1982. Cell 30: 933-943), pJRY88 (Schultz et al., 1987. Gene 54: 113-123), pYES2 (Invitrogen Corporation, San Diego, Calif.), and picZ (InVitrogen Corp, San Diego, Calif.).
- In some embodiments, a vector drives protein expression in insect cells using baculovirus expression vectors. Baculovirus vectors available for expression of proteins in cultured insect cells (e.g., SF9 cells) include the pAc series (Smith, et al., 1983. Mol. Cell. Biol. 3: 2156-2165) and the pVL series (Lucklow and Summers, 1989. Virology 170: 31-39).
- In some embodiments, a vector is capable of driving expression of one or more sequences in mammalian cells using a mammalian expression vector. Examples of mammalian expression vectors include pCDM8 (Seed, 1987. Nature 329: 840) and pMT2PC (Kaufman, et al., 1987. EMBO J. 6: 187-195). When used in mammalian cells, the expression vector's control functions are typically provided by one or more regulatory elements. For example, commonly used promoters are derived from polyoma,
adenovirus 2, cytomegalovirus, simian virus 40, and others disclosed herein and known in the art. For other suitable expression systems for both prokaryotic and eukaryotic cells see, e.g.,Chapters - In some embodiments, the recombinant mammalian expression vector is capable of directing expression of the nucleic acid preferentially in a particular cell type (e.g., tissue-specific regulatory elements are used to express the nucleic acid). Tissue-specific regulatory elements are known in the art. Non-limiting examples of suitable tissue-specific promoters include the albumin promoter (liver-specific; Pinkert, et al., 1987. Genes Dev. 1: 268-277), lymphoid-specific promoters (Calame and Eaton, 1988. Adv. Immunol. 43: 235-275), in particular promoters of T cell receptors (Winoto and Baltimore, 1989. EMBO J. 8: 729-733) and immunoglobulins (Baneiji, et al., 1983. Cell 33: 729-740; Queen and Baltimore, 1983. Cell 33: 741-748), neuron-specific promoters (e.g., the neurofilament promoter; Byrne and Ruddle, 1989. Proc. Natl. Acad. Sci. USA. 86: 5473-5477), pancreas-specific promoters (Edlund, et al., 1985. Science 230: 912-916), and mammary gland-specific promoters (e.g., milk whey promoter, U.S. Pat. No. 4,873,316 and European Application Publication No. 264,166). Developmentally-regulated promoters are also encompassed, e.g., the murine hox promoters (Kessel and Gruss, 1990. Science 249: 374-379) and the α-fetoprotein promoter (Campes and Tilghman, 1989. Genes Dev. 3: 537-546).
- In some embodiments, a regulatory element is operably linked to one or more elements of a CRISPR system so as to drive expression of the one or more elements of the CRISPR system. In general, CRISPRs (Clustered Regularly Interspaced Short Palindromic Repeats), also known as SPIDRs (SPacer Interspersed Direct Repeats), constitute a family of DNA loci that are usually specific to a particular bacterial species. The CRISPR locus comprises a distinct class of interspersed short sequence repeats (SSRs) that were recognized in E. coli (Ishino et al., J. Bacteriol., 169:5429-5433 [1987]; and Nakata et al., J. Bacteriol., 171:3553-3556 [1989]), and associated genes. Similar interspersed SSRs have been identified in Haloferax mediterranei, Streptococcus pyogenes, Anabaena, and Mycobacterium tuberculosis (See, Groenen et al., Mol. Microbiol., 10:1057-1065 [1993]; Hoe et al., Emerg. Infect. Dis., 5:254-263 [1999]; Masepohl et al., Biochim. Biophys. Acta 1307:26-30 [1996]; and Mojica et al., Mol. Microbiol., 17:85-93 [1995]). The CRISPR loci typically differ from other SSRs by the structure of the repeats, which have been termed short regularly spaced repeats (SRSRs) (Janssen et al., OMICS J. Integ. Biol., 6:23-33 [2002]; and Mojica et al., Mol. Microbiol., 36:244-246 [2000]). In general, the repeats are short elements that occur in clusters that are regularly spaced by unique intervening sequences with a substantially constant length (Mojica et al., [2000], supra). Although the repeat sequences are highly conserved between strains, the number of interspersed repeats and the sequences of the spacer regions typically differ from strain to strain (van Embden et al., J. Bacteriol., 182:2393-2401 [2000]). CRISPR loci have been identified in more than 40 prokaryotes (See e.g., Jansen et al., Mol. Microbiol., 43:1565-1575 [2002]; and Mojica et al., [2005]) including, but not limited to Aeropyruinm, Pvrobaculum, Sulfolobus, Archaeoglobus, Halocarcula, Methanobacterium, Methanococcus, Methanosarcina, Methanopyrus, Pvrococcus, Picrophilus, Thermoplasma, Corynebacterium, Mycobacterium, Streptoinyces, Aquifex, Porphyroimonas, Chlorobium, Thermnus, Bacillus, Listeria, Staphylococcus, Clostridium, Thermoanaerobacter, Mycoplasma, Fusobacterium, Azarcus, Chromobacterium, Neisseria, Nitrosomonas, Desulfovibrio, Geobacter, Myxococcus, Campylobacter, Wolinella, Acinetobacter, Erwinia, Escherichia, Legionella, Methylococcus, Pasteurella, Photobacterium, Salmonella, Xanthomonas, Yerinia, Treponema, and Thermotoga.
- In general, “CRISPR system” refers collectively to transcripts and other elements involved in the expression of or directing the activity of CRISPR-associated (“Cas”) genes, including sequences encoding a Cas gene, a tracr (trans-activating CRISPR) sequence (e.g. tracrRNA or an active partial tracrRNA), a tracr-mate sequence (encompassing a “direct repeat” and a tracrRNA-processed partial direct repeat in the context of an endogenous CRISPR system), a guide sequence (also referred to as a “spacer” in the context of an endogenous CRISPR system), or other sequences and transcripts from a CRISPR locus. In some embodiments, one or more elements of a CRISPR system is derived from a
type 1, type II, or type III CRISPR system. In some embodiments, one or more elements of a CRISPR system is derived from a particular organism comprising an endogenous CRISPR system, such as Streptococcus pyogenes. In general, a CRISPR system is characterized by elements that promote the formation of a CRISPR complex at the site of a target sequence (also referred to as a protospacer in the context of an endogenous CRISPR system). In the context of formation of a CRISPR complex, “target sequence” refers to a sequence to which a guide sequence is designed to have complementarity, where hybridization between a target sequence and a guide sequence promotes the formation of a CRISPR complex. Full complementarity is not necessarily required, provided there is sufficient complementarity to cause hybridization and promote formation of a CRISPR complex. A target sequence may comprise any polynucleotide, such as DNA or RNA polynucleotides. In some embodiments, a target sequence is located in the nucleus or cytoplasm of a cell. In some embodiments, the target sequence may be within an organelle of a eukaryotic cell, for example, mitochondrion or chloroplast. A sequence or template that may be used for recombination into the targeted locus comprising the target sequences is referred to as an “editing template” or “editing polynucleotide” or “editing sequence”. In aspects of the invention, an exogenous template polynucleotide may be referred to as an editing template. In an aspect of the invention the recombination is homologous recombination. - Typically, in the context of an endogenous CRISPR system, formation of a CRISPR complex (comprising a guide sequence hybridized to a target sequence and complexed with one or more Cas proteins) results in cleavage of one or both strands in or near (e.g. within 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 50, or more base pairs from) the target sequence. Without wishing to be bound by theory, the tracr sequence, which may comprise or consist of all or a portion of a wild-type tracr sequence (e.g. about or more than about 20, 26, 32, 45, 48, 54, 63, 67, 85, or more nucleotides of a wild-type tracr sequence), may also form part of a CRISPR complex, such as by hybridization along at least a portion of the tracr sequence to all or a portion of a tracr mate sequence that is operably linked to the guide sequence. In some embodiments, the tracr sequence has sufficient complementarity to a tracr mate sequence to hybridize and participate in formation of a CRISPR complex. As with the target sequence, it is believed that complete complementarity is not needed, provided there is sufficient to be functional. In some embodiments, the tracr sequence has at least 50%, 60%, 70%, 80%, 90%, 95% or 99% of sequence complementarity along the length of the tracr mate sequence when optimally aligned. In some embodiments, one or more vectors driving expression of one or more elements of a CRISPR system are introduced into a host cell such that expression of the elements of the CRISPR system direct formation of a CRISPR complex at one or more target sites. For example, a Cas enzyme, a guide sequence linked to a tracr-mate sequence, and a tracr sequence could each be operably linked to separate regulatory elements on separate vectors. Alternatively, two or more of the elements expressed from the same or different regulatory elements, may be combined in a single vector, with one or more additional vectors providing any components of the CRISPR system not included in the first vector. CRISPR system elements that are combined in a single vector may be arranged in any suitable orientation, such as one element located 5′ with respect to (“upstream” of) or 3′ with respect to (“downstream” of) a second element. The coding sequence of one element may be located on the same or opposite strand of the coding sequence of a second element, and oriented in the same or opposite direction. In some embodiments, a single promoter drives expression of a transcript encoding a CRISPR enzyme and one or more of the guide sequence, tracr mate sequence (optionally operably linked to the guide sequence), and a tracr sequence embedded within one or more intron sequences (e.g. each in a different intron, two or more in at least one intron, or all in a single intron). In some embodiments, the CRISPR enzyme, guide sequence, tracr mate sequence, and tracr sequence are operably linked to and expressed from the same promoter. Single vector constructs for SpCas9 are illustrated in
FIG. 22 . - In some embodiments, a vector comprises one or more insertion sites, such as a restriction endonuclease recognition sequence (also referred to as a “cloning site”). In some embodiments, one or more insertion sites (e.g. about or more than about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more insertion sites) are located upstream and/or downstream of one or more sequence elements of one or more vectors. In some embodiments, a vector comprises an insertion site upstream of a tracr mate sequence, and optionally downstream of a regulatory element operably linked to the tracr mate sequence, such that following insertion of a guide sequence into the insertion site and upon expression the guide sequence directs sequence-specific binding of a CRISPR complex to a target sequence in a eukaryotic cell. In some embodiments, a vector comprises two or more insertion sites, each insertion site being located between two tracr mate sequences so as to allow insertion of a guide sequence at each site. In such an arrangement, the two or more guide sequences may comprise two or more copies of a single guide sequence, two or more different guide sequences, or combinations of these. When multiple different guide sequences are used, a single expression construct may be used to target CRISPR activity to multiple different, corresponding target sequences within a cell. For example, a single vector may comprise about or more than about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, or more guide sequences. In some embodiments, about or more than about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more such guide-sequence-containing vectors may be provided, and optionally delivered to a cell.
- In some embodiments, a vector comprises a regulatory element operably linked to an enzyme-coding sequence encoding a CRISPR enzyme, such as a Cas protein. Non-limiting examples of Cas proteins include Cas1, Cas1B, Cas2, Cas3, Cas4. Cas5, Cas6, Cas7, Cas8. Cas9 (also known as Csn1 and Csx12), Cas10, Csy1, Csy2, Csy3, Cse1, Cse2, Csc1, Csc2, Csa5, Csn2, Csm2, Csm3, Csm4, Csm5. Csm6, Cmr1, Cmr3, Cmr4, Cmr5, Cmr6, Csb1, Csb2, Csb3, Csx17, Csx14, Csx10, Csx16, CsaX, Csx3, Csx1, Csx15, Csf1, Csf2, Csf3, Csf4, homologs thereof, or modified versions thereof. These enzymes are known; for example, the amino acid sequence of S. pyogenes Cas9 protein may be found in the SwissProt database under accession number Q99ZW2. In some embodiments, the unmodified CRISPR enzyme has DNA cleavage activity, such as Cas9. In some embodiments the CRISPR enzyme is Cas9, and may be Cas9 from S. pyogenes or S. pneumoniae. In some embodiments, the CRISPR enzyme directs cleavage of one or both strands at the location of a target sequence, such as within the target sequence and/or within the complement of the target sequence. In some embodiments, the CRISPR enzyme directs cleavage of one or both strands within about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 50, 100, 200, 500, or more base pairs from the first or last nucleotide of a target sequence. In some embodiments, a vector encodes a CRISPR enzyme that is mutated to with respect to a corresponding wild-type enzyme such that the mutated CRISPR enzyme lacks the ability to cleave one or both strands of a target polynucleotide containing a target sequence. For example, an aspartate-to-alanine substitution (D10A) in the RuvC I catalytic domain of Cas9 from S. pyogenes converts Cas9 from a nuclease that cleaves both strands to a nickase (cleaves a single strand). Other examples of mutations that render Cas9 a nickase include, without limitation, H840A, N854A, and N863A. In aspects of the invention, nickases may be used for genome editing via homologous recombination, For example,
FIG. 21 shows genome editing via homologous recombination.FIG. 21 (a) shows the schematic of SpCas9 nickase, with D10A mutation in the RuvC I catalytic domain. (b) Schematic representing homologous recombination (HR) at the human EMX1 locus using either sense or antisense single stranded oligonucleotides as repair templates. (c) Sequence of region modified by HR. d, SURVEYOR assay for wildtype (wt) and nickase (D10A) SpCas9-mediated indels at theEMX1 target 1 locus (n=3). Arrows indicate positions of expected fragment sizes. - In some embodiments, a Cas9 nickase may be used in combination with guide sequence(s), e.g., two guide sequences, which target respectively sense and antisense strands of the DNA target. This combination allows both strands to be nicked and used to induce NHEJ. Applicants have demonstrated (data not shown) the efficacy of two nickase targets (i.e., sgRNAs targeted at the same location but to different strands of DNA) in inducing mutagenic NHEJ. A single nickase (Cas9-D10A with a single sgRNA) is unable to induce NHEJ and create indels but Applicants have shown that double nickase (Cas9-D10A and two sgRNAs targeted to different strands at the same location) can do so in human embryonic stem cells (hESCs). The efficiency is about 50% of nuclease (i.e., regular Cas9 without D10 mutation) in hESCs.
- As a further example, two or more catalytic domains of Cas9 (RuvC I, RuvC II, and RuvC III) may be mutated to produce a mutated Cas9 substantially lacking all DNA cleavage activity. In some embodiments, a D10A mutation is combined with one or more of H840A, N854A, or N863A mutations to produce a Cas9 enzyme substantially lacking all DNA cleavage activity. In some embodiments, a CRISPR enzyme is considered to substantially lack all DNA cleavage activity when the DNA cleavage activity of the mutated enzyme is less than about 25%, 10%, 5%, 1%, 0.1%, 0.01%, or lower with respect to its non-mutated form. Other mutations may be useful; where the Cas9 or other CRISPR enzyme is from a species other than S. pyogenes, mutations in corresponding amino acids may be made to achieve similar effects.
- In some embodiments, an enzyme coding sequence encoding a CRISPR enzyme is codon optimized for expression in particular cells, such as eukaryotic cells. The eukaryotic cells may be those of or derived from a particular organism, such as a mammal, including but not limited to human, mouse, rat, rabbit, dog, or non-human primate. In general, codon optimization refers to a process of modifying a nucleic acid sequence for enhanced expression in the host cells of interest by replacing at least one codon (e.g. about or more than about 1, 2, 3, 4, 5, 10, 15, 20, 25, 50, or more codons) of the native sequence with codons that are more frequently or most frequently used in the genes of that host cell while maintaining the native amino acid sequence. Various species exhibit particular bias for certain codons of a particular amino acid. Codon bias (differences in codon usage between organisms) often correlates with the efficiency of translation of messenger RNA (mRNA), which is in turn believed to be dependent on, among other things, the properties of the codons being translated and the availability of particular transfer RNA (tRNA) molecules. The predominance of selected tRNAs in a cell is generally a reflection of the codons used most frequently in peptide synthesis. Accordingly, genes can be tailored for optimal gene expression in a given organism based on codon optimization. Codon usage tables are readily available, for example, at the “Codon Usage Database”, and these tables can be adapted in a number of ways. See Nakamura, Y., et al. “Codon usage tabulated from the international DNA sequence databases: status for the year 2000” Nucl. Acids Res. 28:292 (2000). Computer algorithms for codon optimizing a particular sequence for expression in a particular host cell are also available, such as Gene Forge (Aptagen; Jacobus, Pa.), are also available. In some embodiments, one or more codons (e.g. 1, 2, 3, 4, 5, 10, 15, 20, 25, 50, or more, or all codons) in a sequence encoding a CRISPR enzyme correspond to the most frequently used codon for a particular amino acid.
- In general, a guide sequence is any polynucleotide sequence having sufficient complementarity with a target polynucleotide sequence to hybridize with the target sequence and direct sequence-specific binding of a CRISPR complex to the target sequence. In some embodiments, the degree of complementarity between a guide sequence and its corresponding target sequence, when optimally aligned using a suitable alignment algorithm, is about or more than about 50%, 60%, 75%, 80%, 85%, 90%, 95%, 97.5%, 99%, or more. Optimal alignment may be determined with the use of any suitable algorithm for aligning sequences, non-limiting example of which include the Smith-Waterman algorithm, the Needleman-Wunsch algorithm, algorithms based on the Burrows-Wheeler Transform (e.g. the Burrows Wheeler Aligner), ClustalW, Clustal X, BLAT, Novoalign (Novocraft Technologies, ELAND (Illumina, San Diego, Calif.), SOAP (available at soap.genomics.org.cn), and Maq (available at maq.sourceforge.net). In some embodiments, a guide sequence is about or more than about 5, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 35, 40, 45, 50, 75, or more nucleotides in length. In some embodiments, a guide sequence is less than about 75, 50, 45, 40, 35, 30, 25, 20, 15, 12, or fewer nucleotides in length. The ability of a guide sequence to direct sequence-specific binding of a CRISPR complex to a target sequence may be assessed by any suitable assay. For example, the components of a CRISPR system sufficient to form a CRISPR complex, including the guide sequence to be tested, may be provided to a host cell having the corresponding target sequence, such as by transfection with vectors encoding the components of the CRISPR sequence, followed by an assessment of preferential cleavage within the target sequence, such as by Surveyor assay as described herein. Similarly, cleavage of a target polynucleotide sequence may be evaluated in a test tube by providing the target sequence, components of a CRISPR complex, including the guide sequence to be tested and a control guide sequence different from the test guide sequence, and comparing binding or rate of cleavage at the target sequence between the test and control guide sequence reactions. Other assays are possible, and will occur to those skilled in the art.
- A guide sequence may be selected to target any target sequence. In some embodiments, the target sequence is a sequence within a genome of a cell. Exemplary target sequences include those that are unique in the target genome. For example, for the S. pyogenes Cas9, a unique target sequence in a genome may include a Cas9 target site of the form MMMMMMMMNNNNNNNNNNNNXGG where NNNNNNNNNNNNXGG (N is A, G, T, or C; and X can be anything) has a single occurrence in the genome. A unique target sequence in a genome may include an S. pyogenes Cas9 target site of the form MMMMMMMMMNNNNNNNNNNNXGG where NNNNNNNNNNNXGG (N is A, G, T, or C; and X can be anything) has a single occurrence in the genome. For the S. thermophilus CRISPR1 Cas9, a unique target sequence in a genome may include a Cas9 target site of the form MMMMMMMMNNNNNNNNNNNNXXAGAAW (SEQ ID NO: 1) where NNNNNNNNNNNNXXAGAAW (SEQ ID NO: 2) (N is A, G, T, or C; X can be anything; and W is A or T) has a single occurrence in the genome. A unique target sequence in a genome may include an S. thermophilus CRISPR1 Cas9 target site of the form MMMMMMMMMNNNNNNNNNNNXXAGAAW (SEQ ID NO: 3) where NNNNNNNNNNNXXAGAAW (SEQ ID NO: 4) (N is A, G, T, or C; X can be anything; and W is A or T) has a single occurrence in the genome. For the S. pyogenes Cas9, a unique target sequence in a genome may include a Cas9 target site of the form MMMMMMMMNNNNNNNNNNNNXGGXG where NNNNNNNNNNNNXGGXG (N is A, G, T, or C; and X can be anything) has a single occurrence in the genome. A unique target sequence in a genome may include an S. pyogenes Cas9 target site of the form MMMMMMMMMNNNNNNNNNNNXGGXG where NNNNNNNNNNNXGGXG (N is A, G, T, or C; and X can be anything) has a single occurrence in the genome. In each of these sequences “M” may be A, G, T, or C, and need not be considered in identifying a sequence as unique.
- In some embodiments, a guide sequence is selected to reduce the degree of secondary structure within the guide sequence. Secondary structure may be determined by any suitable polynucleotide folding algorithm. Some programs are based on calculating the minimal Gibbs free energy. An example of one such algorithm is mFold, as described by Zuker and Stiegler (Nucleic Acids Res. 9 (1981), 133-148). Another example folding algorithm is the online webserver RNAfold, developed at Institute for Theoretical Chemistry at the University of Vienna, using the centroid structure prediction algorithm (see e.g. A. R. Gruber et al., 2008, Cell 106(1): 23-24; and P A Carr and G M Church, 2009. Nature Biotechnology 27(12): 1151-62). Further algorithms may be found in U.S. application Ser. No. 61/836,080 (attorney docket 44790.11.2022; Broad Reference BI-2013/004A); incorporated herein by reference.
- In general, a tracr mate sequence includes any sequence that has sufficient complementarity with a tracr sequence to promote one or more of: (1) excision of a guide sequence flanked by tracr mate sequences in a cell containing the corresponding tracr sequence; and (2) formation of a CRISPR complex at a target sequence, wherein the CRISPR complex comprises the tracr mate sequence hybridized to the tracr sequence. In general, degree of complementarity is with reference to the optimal alignment of the tracr mate sequence and tracr sequence, along the length of the shorter of the two sequences. Optimal alignment may be determined by any suitable alignment algorithm, and may further account for secondary structures, such as self-complementarity within either the tracr sequence or tracr mate sequence. In some embodiments, the degree of complementarity between the tracr sequence and tracr mate sequence along the length of the shorter of the two when optimally aligned is about or more than about 25%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 97.5%, 99%, or higher. Example illustrations of optimal alignment between a tracr sequence and a tracr mate sequence are provided in
FIGS. 10B and 11B . In some embodiments, the tracr sequence is about or more than about 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 40, 50, or more nucleotides in length. In some embodiments, the tracr sequence and tracr mate sequence are contained within a single transcript, such that hybridization between the two produces a transcript having a secondary structure, such as a hairpin. Preferred loop forming sequences for use in hairpin structures are four nucleotides in length, and most preferably have the sequence GAAA. However, longer or shorter loop sequences may be used, as may alternative sequences. The sequences preferably include a nucleotide triplet (for example, AAA), and an additional nucleotide (for example C or G). Examples of loop forming sequences include CAAA and AAAG. In an embodiment of the invention, the transcript or transcribed polynucleotide sequence has at least two or more hairpins. In preferred embodiments, the transcript has two, three, four or five hairpins. In a further embodiment of the invention, the transcript has at most five hairpins. In some embodiments, the single transcript further includes a transcription termination sequence; preferably this is a polyT sequence, for example six T nucleotides. An example illustration of such a hairpin structure is provided in the lower portion ofFIG. 11B , where the portion of thesequence 5′ of the final “N” and upstream of the loop corresponds to the tracr mate sequence, and the portion of thesequence 3′ of the loop corresponds to the tracr sequence. Further non-limiting examples of single polynucleotides comprising a guide sequence, a tracr mate sequence, and a tracr sequence are as follows (listed 5′ to 3′), where “N” represents a base of a guide sequence, the first block of lower case letters represent the tracr mate sequence, and the second block of lower case letters represent the tracr sequence, and the final poly-T sequence represents the transcription terminator: -
(1) (SEQ ID NO: 5) NNNNNNNNNNNNNNNNNNNNgtttttgtactctcaagatttaGAAAtaaa tcttgcagaagctacaaagataaggcttcatgccgaaatcaacaccctgt cattttatggcagggtgttttcgttatttaaTTTTTT; (2) (SEQ ID NO: 6) NNNNNNNNNNNNNNNNNNNNgtttttgtactctcaGAAAtgcagaagcta caaagataaggcttcatgccgaaatcaacaccctgtcattttatggcagg gtgttttcgttatttaaTTTTTT; (3) (SEQ ID NO: 7) NNNNNNNNNNNNNNNNNNNNgtttttgtactctcaGAAAtgcagaagcta caaagataaggcttcatgccgaaatcaacaccctgtcattttatggcagg gtgtTTTTTT; (4) (SEQ ID NO: 8) NNNNNNNNNNNNNNNNNNNNgttttagagctaGAAAtagcaagttaaaat aaggctagtccgttatcaacttgaaaaagtggcaccgagtcggtgcTTTT TT; (5) (SEQ ID NO: 9) NNNNNNNNNNNNNNNNNNNNgttttagagctaGAAATAGcaagttaaaat aaggctagtccgttatcaacttgaaaaagtgTTTTTTT; and (6) (SEQ ID NO: 10) NNNNNNNNNNNNNNNNNNNNgttttagagctagAAATAGcaagttaaaat aaggctagtccgttatcaTTTTTTTT.
In some embodiments, sequences (1) to (3) are used in combination with Cas9 from S. thermophilus CRISPR1. In some embodiments, sequences (4) to (6) are used in combination with Cas9 from S. pyogenes. In some embodiments, the tracr sequence is a separate transcript from a transcript comprising the tracr mate sequence (such as illustrated in the top portion ofFIG. 11B ). - In some embodiments, the CRISPR enzyme is part of a fusion protein comprising one or more heterologous protein domains (e.g. about or more than about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more domains in addition to the CRISPR enzyme). A CRISPR enzyme fusion protein may comprise any additional protein sequence, and optionally a linker sequence between any two domains. Examples of protein domains that may be fused to a CRISPR enzyme include, without limitation, epitope tags, reporter gene sequences, and protein domains having one or more of the following activities: methylase activity, demethylase activity, transcription activation activity, transcription repression activity, transcription release factor activity, histone modification activity, RNA cleavage activity and nucleic acid binding activity. Non-limiting examples of epitope tags include histidine (His) tags, V5 tags, FLAG tags, influenza hemagglutinin (HA) tags, Myc tags, VSV-G tags, and thioredoxin (Trx) tags. Examples of reporter genes include, but are not limited to, glutathione-S-transferase (GST), horseradish peroxidase (HRP), chloramphenicol acetyltransferase (CAT) beta-galactosidase, beta-glucuronidase, luciferase, green fluorescent protein (GFP), HcRed, DsRed, cyan fluorescent protein (CFP), yellow fluorescent protein (YFP), and autofluorescent proteins including blue fluorescent protein (BFP). A CRISPR enzyme may be fused to a gene sequence encoding a protein or a fragment of a protein that bind DNA molecules or bind other cellular molecules, including but not limited to maltose binding protein (MBP), S-tag, Lex A DNA binding domain (DBD) fusions, GALA DNA binding domain fusions, and herpes simplex virus (HSV) BP16 protein fusions. Additional domains that may form part of a fusion protein comprising a CRISPR enzyme are described in US20110059502, incorporated herein by reference. In some embodiments, a tagged CRISPR enzyme is used to identify the location of a target sequence.
- In an aspect of the invention, a reporter gene which includes but is not limited to glutathione-S-transferase (GST), horseradish peroxidase (HRP), chloramphenicol acetyltransferase (CAT) beta-galactosidase, beta-glucuronidase, luciferase, green fluorescent protein (GFP), HcRed, DsRed, cyan fluorescent protein (CFP), yellow fluorescent protein (YFP), and autofluorescent proteins including blue fluorescent protein (BFP), may be introduced into a cell to encode a gene product which serves as a marker by which to measure the alteration or modification of expression of the gene product. In a further embodiment of the invention, the DNA molecule encoding the gene product may be introduced into the cell via a vector. In a preferred embodiment of the invention the gene product is luciferase. In a further embodiment of the invention the expression of the gene product is decreased.
- In some aspects, the invention provides methods comprising delivering one or more polynucleotides, such as or one or more vectors as described herein, one or more transcripts thereof, and/or one or proteins transcribed therefrom, to a host cell. The invention serves as a basic platform for enabling targeted modification of DNA-based genomes. It can interface with many delivery systems, including but not limited to viral, liposome, electroporation, microinjection and conjugation. In some aspects, the invention further provides cells produced by such methods, and organisms (such as animals, plants, or fungi) comprising or produced from such cells. In some embodiments, a CRISPR enzyme in combination with (and optionally complexed with) a guide sequence is delivered to a cell. Conventional viral and non-viral based gene transfer methods can be used to introduce nucleic acids in mammalian cells or target tissues. Such methods can be used to administer nucleic acids encoding components of a CRISPR system to cells in culture, or in a host organism. Non-viral vector delivery systems include DNA plasmids, RNA (e.g. a transcript of a vector described herein), naked nucleic acid, and nucleic acid complexed with a delivery vehicle, such as a liposome. Viral vector delivery systems include DNA and RNA viruses, which have either episomal or integrated genomes after delivery to the cell. For a review of gene therapy procedures, see Anderson, Science 256:808-813 (1992); Nabel & Felgner, TIBTECH 11:211-217 (1993); Mitani & Caskey, TIBTECH 11:162-166 (1993); Dillon, TIBTECH 11:167-175 (1993); Miller, Nature 357:455-460 (1992); Van Brunt, Biotechnology 6(10):1149-1154 (1988); Vigne, Restorative Neurology and Neuroscience 8:35-36 (1995); Kremer & Perricaudet, British Medical Bulletin 51(1):31-44 (1995); Haddada et al., in Current Topics in Microbiology and Immunology Doerfler and Böhm (eds) (1995); and Yu et al., Gene Therapy 1:13-26 (1994).
- Methods of non-viral delivery of nucleic acids include lipofection, nucleofection, microinjection, biolistics, virosomes, liposomes, immunoliposomes, polycation or lipid:nucleic acid conjugates, naked DNA, artificial virions, and agent-enhanced uptake of DNA. Lipofection is described in e.g., U.S. Pat. Nos. 5,049,386, 4,946,787; and 4,897,355) and lipofection reagents are sold commercially (e.g., Transfectam™ and Lipofectin™). Cationic and neutral lipids that are suitable for efficient receptor-recognition lipofection of polynucleotides include those of Felgner, WO 91/17424; WO 91/16024. Delivery can be to cells (e.g. in vitro or ex vivo administration) or target tissues (e.g. in vivo administration).
- The preparation of lipid:nucleic acid complexes, including targeted liposomes such as immunolipid complexes, is well known to one of skill in the art (see, e.g., Crystal, Science 270:404-410 (1995); Blaese et al., Cancer Gene Ther. 2:291-297 (1995); Behr et al., Bioconjugate Chem. 5:382-389 (1994); Remy et al., Bioconjugate Chem. 5:647-654 (1994); Gao et al., Gene Therapy 2:710-722 (1995); Ahmad et al., Cancer Res. 52:4817-4820 (1992); U.S. Pat. Nos. 4,186,183, 4,217,344, 4,235,871, 4,261,975, 4,485,054, 4,501,728, 4,774,085, 4,837,028, and 4.946,787).
- The use of RNA or DNA viral based systems for the delivery of nucleic acids take advantage of highly evolved processes for targeting a virus to specific cells in the body and trafficking the viral payload to the nucleus. Viral vectors can be administered directly to patients (in vivo) or they can be used to treat cells in vitro, and the modified cells may optionally be administered to patients (ex vivo). Conventional viral based systems could include retroviral, lentivirus, adenoviral, adeno-associated and herpes simplex virus vectors for gene transfer. Integration in the host genome is possible with the retrovirus, lentivirus, and adeno-associated virus gene transfer methods, often resulting in long term expression of the inserted transgene. Additionally, high transduction efficiencies have been observed in many different cell types and target tissues.
- The tropism of a retrovirus can be altered by incorporating foreign envelope proteins, expanding the potential target population of target cells. Lentiviral vectors are retroviral vectors that are able to transduce or infect non-dividing cells and typically produce high viral titers. Selection of a retroviral gene transfer system would therefore depend on the target tissue. Retroviral vectors are comprised of cis-acting long terminal repeats with packaging capacity for up to 6-10 kb of foreign sequence. The minimum cis-acting LTRs are sufficient for replication and packaging of the vectors, which are then used to integrate the therapeutic gene into the target cell to provide permanent transgene expression. Widely used retroviral vectors include those based upon murine leukemia virus (MuLV), gibbon ape leukemia virus (GaLV), Simian Immuno deficiency virus (SW), human immuno deficiency virus (HIV), and combinations thereof (see, e.g., Buchscher et al., J. Virol. 66:2731-2739 (1992); Johann et al., J. Virol. 66:1635-1640 (1992); Sommnerfelt et al., Virol. 176:58-59 (1990); Wilson et al., J. Virol. 63:2374-2378 (1989); Miller et al., J. Virol. 65:2220-2224 (1991); PCT/US94/05700).In applications where transient expression is preferred, adenoviral based systems may be used. Adenoviral based vectors are capable of very high transduction efficiency in many cell types and do not require cell division. With such vectors, high titer and levels of expression have been obtained. This vector can be produced in large quantities in a relatively simple system. Adeno-associated virus (“AAV”) vectors may also be used to transduce cells with target nucleic acids, e.g., in the in vitro production of nucleic acids and peptides, and for in vivo and ex vivo gene therapy procedures (see, e.g., West et al., Virology 160:38-47 (1987); U.S. Pat. No. 4,797,368; WO 93/24641; Kotin, Human Gene Therapy 5:793-801 (1994); Muzyczka, J. Clin. Invest. 94:1351 (1994). Construction of recombinant AAV vectors are described in a number of publications, including U.S. Pat. No. 5,173,414; Tratschin et al., Mol. Cell. Biol. 5:3251-3260 (1985); Tratschin, et al., Mol. Cell. Biol. 4:2072-2081 (1984); Hermonat & Muzyczka, PNAS 81:6466-6470 (1984); and Samulski et al., J. Virol. 63:03822-3828 (1989).
- Packaging cells are typically used to form virus particles that are capable of infecting a host cell. Such cells include 293 cells, which package adenovirus, and ψ2 cells or PA317 cells, which package retrovirus. Viral vectors used in gene therapy are usually generated by producing a cell line that packages a nucleic acid vector into a viral particle. The vectors typically contain the minimal viral sequences required for packaging and subsequent integration into a host, other viral sequences being replaced by an expression cassette for the polynucleotide(s) to be expressed. The missing viral functions are typically supplied in trans by the packaging cell line. For example, AAV vectors used in gene therapy typically only possess ITR sequences from the AAV genome which are required for packaging and integration into the host genome. Viral DNA is packaged in a cell line, which contains a helper plasmid encoding the other AAV genes, namely rep and cap, but lacking ITR sequences. The cell line may also be infected with adenovirus as a helper. The helper virus promotes replication of the AAV vector and expression of AAV genes from the helper plasmid. The helper plasmid is not packaged in significant amounts due to a lack of ITR sequences. Contamination with adenovirus can be reduced by, e.g., heat treatment to which adenovirus is more sensitive than AAV. Additional methods for the delivery of nucleic acids to cells are known to those skilled in the art. See, for example, US20030087817, incorporated herein by reference.
- In some embodiments, a host cell is transiently or non-transiently transfected with one or more vectors described herein. In some embodiments, a cell is transfected as it naturally occurs in a subject. In some embodiments, a cell that is transfected is taken from a subject. In some embodiments, the cell is derived from cells taken from a subject, such as a cell line. A wide variety of cell lines for tissue culture are known in the art. Examples of cell lines include, but are not limited to, C8161, CCRF-CEM, MOLT, mIMCD-3, NHDF, HeLa—S3, Huhl, Huh4, Huh7, HUVEC, HASMC, HEKn, HEKa, MiaPaCell, Panel, PC-3, TF1, CTLL-2, CIR, Rat6, CVi, RPTE, A10, T24, J82, A375, ARH-77, Calul, SW480, SW620, SKOV3, SK-UT, CaCo2, P388D1, SEM-K2, WEHI-231, HB56, TIB55, Jurkat, J45.01, LRMB, Bcl-1, BC-3, IC21, DLD2, Raw264.7, NRK, NRK-52E, MRC5, MEF, Hep G2, HeLa B, HeLa T4. COS, COS-1, COS-6, COS-M6A, BS-C-1 monkey kidney epithelial, BALB/3T3 mouse embryo fibroblast, 3T3 Swiss, 3T3-L1, 132-d5 human fetal fibroblasts; 10.1 mouse fibroblasts, 293-T, 3T3, 721, 9L, A2780, A2780ADR, A2780cis, A172, A20, A253, A431, A-549, ALC, B16, B35, BCP-1 cells, BEAS-2B, bEnd.3, BHK-21, BR 293, BxPC3, C3H-10T1/2, C6/36, Cal-27, CHO, CHO-7, CHO-IR, CHO-K1, CHO-K2, CHO-T, CHO Dhfr −/−, COR-L23, COR-L23/CPR, COR-L235010, COR-L23/R23, COS-7, COV-434, CML T1, CMT, CT26, D17, DH82, DU145, DuCaP, EL4, EM2, EM3, EMT6/AR1, EMT6/AR10.0, FM3, H1299, H69, HB54, HB55, HCA2, HEK-293, HeLa, Hepalclc7, HL-60, HMEC, HT-29, Jurkat, JY cells, K562 cells, Ku812, KCL22, KGI, KYOI, LNCap, Ma-Mel 1-48, MC-38, MCF-7, MCF-10A, MDA-MB-231, MDA-MB-468, MDA-MB-435, MDCK II, MDCK II, MOR/0.2R, MONO-MAC 6, MTD-1A, MyEnd, NCI-H69/CPR, NCI-H69/LX10, NCI-H69/LX20, NCI-H69/LX4, NIH-3T3, NALM-1, NW-145, OPCN/OPCT cell lines, Peer, PNT-1A/PNT 2, RenCa, RIN-5F, RMA/RMAS, Saos-2 cells, Sf-9, SkBr3, T2, T-47D, T84, THP1 cell line, U373, U87, U937, VCaP, Vero cells, WM39, WT-49, X63, YAC-1, YAR, and transgenic varieties thereof. Cell lines are available from a variety of sources known to those with skill in the art (see, e.g., the American Type Culture Collection (ATCC) (Manassas, Va.)). In some embodiments, a cell transfected with one or more vectors described herein is used to establish a new cell line comprising one or more vector-derived sequences. In some embodiments, a cell transiently transfected with the components of a CRISPR system as described herein (such as by transient transfection of one or more vectors, or transfection with RNA), and modified through the activity of a CRISPR complex, is used to establish a new cell line comprising cells containing the modification but lacking any other exogenous sequence. In some embodiments, cells transiently or non-transiently transfected with one or more vectors described herein, or cell lines derived from such cells are used in assessing one or more test compounds.
- Aspects of the invention relate to the generation of isogenic lines of mammalian cells for the study of genetic variations in disease. A further aspect of the invention relates to the generation of genetically-modified animal models, either transgenic or viral-mediated delivery. The invention also comprehends genome modification of microbes, cells, plants, animals or synthetic organisms for the generation of biomedically, agriculturally, and industrially useful products. In yet another aspect, the invention comprehends gene therapy. The invention may be used as a biological research tool, for understanding the genome, e.g. gene knockout studies. The inventions relates to many other methods and compositions that depend on the basic ability of editing and rewriting the DNA content of genomes, as well as targeted inactivation of DNA-based organisms. The invention also may be used as therapeutic for targeting specific strains of bacterial infections, viral infection, etc.
- In some embodiments, one or more vectors described herein are used to produce a non-human transgenic animal or transgenic plant. In some embodiments, the transgenic animal is a mammal, such as a mouse, rat, or rabbit. In certain embodiments, the organism or subject is a plant. In certain embodiments, the organism or subject or plant is algae. Methods for producing transgenic plants and animals are known in the art, and generally begin with a method of cell transfection, such as described herein. Transgenic animals are also provided, as are transgenic plants, especially crops and algae. The transgenic animal or plant may be useful in applications outside of providing a disease model. These may include food or feed production through expression of, for instance, higher protein, carbohydrate, nutrient or vitamins levels than would normally be seen in the wildtype. In this regard, transgenic plants, especially pulses and tubers, and animals, especially mammals such as livestock (cows, sheep, goats and pigs), but also poultry and edible insects, are preferred.
- Transgenic algae or other plants such as rape may be particularly useful in the production of vegetable oils or biofuels such as alcohols (especially methanol and ethanol), for instance. These may be engineered to express or overexpress high levels of oil or alcohols for use in the oil or biofuel industries.
- In one aspect, the invention provides for methods of modifying a target polynucleotide in a eukaryotic cell, which may be in vivo, ex vivo or in vitro. In some embodiments, the method comprises sampling a cell or population of cells from a human or non-human animal or plant (including micro-algae), and modifying the cell or cells. Culturing may occur at any stage ex vivo. The cell or cells may even be re-introduced into the non-human animal or plant (including micro-algae).
- In one aspect, the invention provides for methods of modifying a target polynucleotide in a eukaryotic cell. In some embodiments, the method comprises allowing a CRISPR complex to bind to the target polynucleotide to effect cleavage of said target polynucleotide thereby modifying the target polynucleotide, wherein the CRISPR complex comprises a CRISPR enzyme complexed with a guide sequence hybridized to a target sequence within said target polynucleotide, wherein said guide sequence is linked to a tracr mate sequence which in turn hybridizes to a tracr sequence.
- In one aspect, the invention provides a method of modifying expression of a polynucleotide in a eukaryotic cell. In some embodiments, the method comprises allowing a CRISPR complex to bind to the polynucleotide such that said binding results in increased or decreased expression of said polynucleotide; wherein the CRISPR complex comprises a CRISPR enzyme complexed with a guide sequence hybridized to a target sequence within said polynucleotide, wherein said guide sequence is linked to a tracr mate sequence which in turn hybridizes to a tracr sequence.
- With recent advances in crop genomics, the ability to use CRISPR-Cas systems to perform efficient and cost effective gene editing and manipulation will allow the rapid selection and comparison of single and multiplexed genetic manipulations to transform such genomes for improved production and enhanced traits. In this regard reference is made to US patents and publications: U.S. Pat. No. 6,603,061—Agrobacterium-Mediated Plant Transformation Method; U.S. Pat. No. 7,868,149—Plant Genome Sequences and Uses Thereof and
US 2009/0100536—Transgenic Plants with Enhanced Agronomic Traits, all the contents and disclosure of each of which are herein incorporated by reference in their entirety. In the practice of the invention, the contents and disclosure of Morrell et al “Crop genomics:advances and applications” Nat Rev Genet. 2011 Dec. 29; 13(2):85-96 are also herein incorporated by reference in their entirety. - In plants, pathogens are often host-specific. For example, Fusarium oxysporum f. sp. lycopersici causes tomato wilt but attacks only tomato, and F. oxvsporum f. dianthii Puccinia graminis f. sp. tritici attacks only wheat. Plants have existing and induced defenses to resist most pathogens. Mutations and recombination events across plant generations lead to genetic variability that gives rise to susceptibility, especially as pathogens reproduce with more frequency than plants. In plants there can be non-host resistance, e.g., the host and pathogen are incompatible. There can also be Horizontal Resistance, e.g., partial resistance against all races of a pathogen, typically controlled by many genes and Vertical Resistance, e.g., complete resistance to some races of a pathogen but not to other races, typically controlled by a few genes. In a Gene-for-Gene level, plants and pathogens evolve together, and the genetic changes in one balance changes in other. Accordingly, using Natural Variability, breeders combine most useful genes for Yield, Quality, Uniformity, Hardiness, Resistance. The sources of resistance genes include native or foreign Varieties, Heirloom Varieties, Wild Plant Relatives, and Induced Mutations, e.g., treating plant material with mutagenic agents. Using the present invention, plant breeders are provided with a new tool to induce mutations. Accordingly, one skilled in the art can analyze the genome of sources of resistance genes, and in Varieties having desired characteristics or traits employ the present invention to induce the rise of resistance genes, with more precision than previous mutagenic agents and hence accelerate and improve plant breeding programs.
- In one aspect, the invention provides kits containing any one or more of the elements disclosed in the above methods and compositions. In some embodiments, the kit comprises a vector system and instructions for using the kit. In some embodiments, the vector system comprises (a) a first regulatory element operably linked to a tracr mate sequence and one or more insertion sites for inserting a guide sequence upstream of the tracr mate sequence, wherein when expressed, the guide sequence directs sequence-specific binding of a CRISPR complex to a target sequence in a eukaryotic cell, wherein the CRISPR complex comprises a CRISPR enzyme complexed with (1) the guide sequence that is hybridized to the target sequence, and (2) the tracr mate sequence that is hybridized to the tracr sequence; and/or (b) a second regulatory element operably linked to an enzyme-coding sequence encoding said CRISPR enzyme comprising a nuclear localization sequence. Elements may be provided individually or in combinations, and may be provided in any suitable container, such as a vial, a bottle, or a tube. In some embodiments, the kit includes instructions in one or more languages, for example in more than one language.
- In some embodiments, a kit comprises one or more reagents for use in a process utilizing one or more of the elements described herein. Reagents may be provided in any suitable container. For example, a kit may provide one or more reaction or storage buffers. Reagents may be provided in a form that is usable in a particular assay, or in a form that requires addition of one or more other components before use (e.g. in concentrate or lyophilized form). A buffer can be any buffer, including but not limited to a sodium carbonate buffer, a sodium bicarbonate buffer, a borate buffer, a Tris buffer, a MOPS buffer, a HEPES buffer, and combinations thereof. In some embodiments, the buffer is alkaline. In some embodiments, the buffer has a pH from about 7 to about 10. In some embodiments, the kit comprises one or more oligonucleotides corresponding to a guide sequence for insertion into a vector so as to operably link the guide sequence and a regulatory element. In some embodiments, the kit comprises a homologous recombination template polynucleotide.
- In one aspect, the invention provides methods for using one or more elements of a CRISPR system. The CRISPR complex of the invention provides an effective means for modifying a target polynucleotide. The CRISPR complex of the invention has a wide variety of utility including modifying (e.g., deleting, inserting, translocating, inactivating, activating) a target polynucleotide in a multiplicity of cell types. As such the CRISPR complex of the invention has a broad spectrum of applications in, e.g., gene therapy, drug screening, disease diagnosis, and prognosis. An exemplary CRISPR complex comprises a CRISPR enzyme complexed with a guide sequence hybridized to a target sequence within the target polynucleotide. The guide sequence is linked to a tracr mate sequence, which in turn hybridizes to a tracr sequence.
- The target polynucleotide of a CRISPR complex can be any polynucleotide endogenous or exogenous to the eukaryotic cell. For example, the target polynucleotide can be a polynucleotide residing in the nucleus of the eukaryotic cell. The target polynucleotide can be a sequence coding a gene product (e.g., a protein) or a non-coding sequence (e.g., a regulatory polynucleotide or a junk DNA). Without wishing to be bound by theory, it is believed that the target sequence should be associated with a PAM (protospacer adjacent motif); that is, a short sequence recognized by the CRISPR complex. The precise sequence and length requirements for the PAM differ depending on the CRISPR enzyme used, but PAMs are typically 2-5 base pair sequences adjacent the protospacer (that is, the target sequence) Examples of PAM sequences are given in the examples section below, and the skilled person will be able to identify further PAM sequences for use with a given CRISPR enzyme.
- The target polynucleotide of a CRISPR complex may include a number of disease-associated genes and polynucleotides as well as signaling biochemical pathway-associated genes and polynucleotides as listed in US
provisional patent applications 61/736,527 and 61/748,427 having Broad reference BI-2011/008/WSGR Docket No. 44063-701.101 and B1-2011/008/WSGR Docket No. 44063-701.102 respectively, both entitled SYSTEMS METHODS AND COMPOSITIONS FOR SEQUENCE MANIPULATION filed on Dec. 12, 2012 and Jan. 2, 2013, respectively, the contents of all of which are herein incorporated by reference in their entirety. - Examples of target polynucleotides include a sequence associated with a signaling biochemical pathway, e.g., a signaling biochemical pathway-associated gene or polynucleotide. Examples of target polynucleotides include a disease associated gene or polynucleotide. A “disease-associated” gene or polynucleotide refers to any gene or polynucleotide which is yielding transcription or translation products at an abnormal level or in an abnormal form in cells derived from a disease-affected tissues compared with tissues or cells of a non disease control. It may be a gene that becomes expressed at an abnormally high level; it may be a gene that becomes expressed at an abnormally low level, where the altered expression correlates with the occurrence and/or progression of the disease. A disease-associated gene also refers to a gene possessing mutation(s) or genetic variation that is directly responsible or is in linkage disequilibrium with a gene(s) that is responsible for the etiology of a disease. The transcribed or translated products may be known or unknown, and may be at a normal or abnormal level.
- Examples of disease-associated genes and polynucleotides are available from McKusick-Nathans Institute of Genetic Medicine, Johns Hopkins University (Baltimore, Md.) and National Center for Biotechnology Information, National Library of Medicine (Bethesda, Md.), available on the World Wide Web.
- Examples of disease-associated genes and polynucleotides are listed in Tables A and B. Disease specific information is available from McKusick-Nathans Institute of Genetic Medicine, Johns Hopkins University (Baltimore, Md.) and National Center for Biotechnology Information, National Library of Medicine (Bethesda, Md.), available on the World Wide Web. Examples of signaling biochemical pathway-associated genes and polynucleotides are listed in Table C.
- Mutations in these genes and pathways can result in production of improper proteins or proteins in improper amounts which affect function. Further examples of genes, diseases and proteins are hereby incorporated by reference from
US Provisional applications 61/736,527 filed Dec. 12, 2012 and 61/748,427 filed Jan. 2, 2013. Such genes, proteins and pathways may be the target polynucleotide of a CRISPR complex. -
TABLE A DISEASE/ DISORDERS GENE(S) Neoplasia PTEN; ATM; ATR; EGFR; ERBB2; ERBB3; ERBB4; Notch1; Notch2; Notch3; Notch4; AKT; AKT2; AKT3; HIF; HIF1a; HIF3a; Met; HRG; bcl2; PPAR alpha; PPAR gamma; WT1 (Wilms Tumor); FGF Receptor Family members (5 members: 1, 2, 3, 4, 5); CDKN2a; APC; RB (retinoblastoma); MEN1; VHL; BRCA1; BRCA2; AR (Androgen Receptor); TSG101; IGF; IGF Receptor; Igf1 (4 variants); Igf2 (3 variants); Igf 1 Receptor; Igf 2 Receptor; Bax; Bcl2; caspases family (9 members: 1, 2, 3, 4, 6, 7, 8, 9, 12); Kras; Apc Age-related Abcr; Ccl2; Cc2; cp (ceruloplasmin); Timp3; cathepsinD; Macular Vldlr; Ccr2 Degeneration Schizophrenia Neuregulin1 (Nrg1); Erb4 (receptor for Neuregulin); Complexin1 (Cplx1); Tph1 Tryptophan hydroxylase; Tph2 Tryptophan hydroxylase 2; Neurexin 1; GSK3; GSK3a; GSK3b Disorders 5-HTT (Slc6a4); COMT; DRD (Drd1a); SLC6A3; DAOA; DTNBP1; Dao (Dao1) Trinucleotide HTT (Huntington's Dx); SBMA/SMAX1/AR (Kennedy's Repeat Dx); FXN/X25 (Friedrich's Ataxia); ATX3 (Machado- Disorders Joseph's Dx); ATXN1 and ATXN2 (spinocerebellar ataxias); DMPK (myotonic dystrophy); Atrophin-1 and Atn1(DRPLA Dx); CBP (Creb-BP-global instability); VLDLR (Alzheimer's); Atxn7; Atxn10 Fragile X FMR2; FXR1; FXR2; mGLUR5 Syndrome Secretase APH-1 (alpha and beta); Presenilin (Psen1); nicastrin Related (Ncstn); PEN-2 Disorders Others Nos1, Parp1; Nat1; Nat2 Prion-related Prp disorders ALS SOD1; ALS2; STEX; FUS; TARDBP; VEGF (VEGF-a; VEGF-b; VEGF-c) Drug Prkce (alcohol); Drd2; Drd4; ABAT (alcohol); GRIA2; addiction Grm5; Grin1; Htr1b; Grin2a; Drd3; Pdyn; Gria1 (alcohol) Autism Mecp2; BZRAP1; MDGA2; Sema5A; Neurexin 1; Fragile X (FMR2 (AFF2); FXR1; FXR2; Mglur5) Alzheimer's E1; CHIP; UCH; UBB; Tau; LRP; PICALM; Clusterin; Disease PS1; SORL1; CR1; Vldlr; Uba1; Uba3; CHIP28 (Aqp1, Aquaporin 1); Uchl1; Uchl3; APP Inflammation IL-10; IL-1 (IL-1a; IL-1b); 1L-13; IL-17 (IL-17a (CTLA8); IL-17b; IL-17c; IL-17d; IL-17f); II-23; Cx3cr1; ptpn22; TNFa; NOD2/CARD15 for IBD; IL-6; IL-12 (IL-12a; IL-12b); CTLA4; Cx3cl1 Parkinson's x-Synuclein; DJ-1; LRRK2; Parkin; PINK1 Disease -
TABLE B Blood and Anemia (CDAN1, CDA1, RPS19, DBA, PKLR, coagulation diseases PK1, NT5C3, UMPH1, PSN1, RHAG, RH50A, and disorders NRAMP2, SPTB, ALAS2, ANH1, ASB, ABCB7, ABC7, ASAT); Bare lymphocyte syndrome (TAPBP, TPSN, TAP2, ABCB3, PSF2, RING11, MHC2TA, C2TA, RFX5, RFXAP, RFX5), Bleeding disorders (TBXA2R, P2RX1, P2X1); Factor H and factor H-like 1 (HF1, CFH, HUS); Factor V and factor VIII (MCFD2); Factor VII deficiency (F7); Factor X deficiency (F10); Factor XI deficiency (F11); Factor XII deficiency (F12, HAF); Factor XIIIA deficiency (F13A1, F13A); Factor XIIIB deficiency (F13B); Fanconi anemia (FANCA, FACA, FA1, FA, FAA, FAAP95, FAAP90, FLJ34064, FANCB, FANCC, FACC, BRCA2, FANCD1, FANCD2, FANCD, FACD, FAD, FANCE, FACE, FANCF, XRCC9, FANCG, BRIP1, BACH1, FANCJ, PHF9, FANCL, FANCM, KIAA1596); Hemophagocytic lymphohistiocytosis disorders (PRF1, HPLH2, UNC13D, MUNC13-4, HPLH3, HLH3, FHL3); Hemophilia A (F8, F8C, HEMA); Hemophilia B (F9, HEMB), Hemorrhagic disorders (PI, ATT, F5); Leukocyde deficiencies and disorders (ITGB2, CD18, LCAMB, LAD, EIF2B1, EIF2BA, EIF2B2, EIF2B3, EIF2B5, LVWM, CACH, CLE, EIF2B4); Sickle cell anemia (HBB); Thalassemia (HBA2, HBB, HBD, LCRB, HBA1). Cell dysregulation B-cell non-Hodgkin lymphoma (BCL7A, and oncology BCL7); Leukemia (TAL1, diseases and TCL5, SCL, TAL2, FLT3, disorders NBS1, NBS, ZNFN1A1, IK1, LYF1, HOXD4, HOX4B, BCR, CML, PHL, ALL, ARNT, KRAS2, RASK2, GMPS, AF10, ARHGEF12, LARG, KIAA0382, CALM; CLTH, CEBPA, CEBP, CHIC2, BTL, FLT3, KIT, PBT, LPP, NPM1, NUP214, D9S46E, CAN, CAIN, RUNX1, CBFA2, AML1, WHSC1L1, NSD3, FLT3, AF1Q, NPM1, NUMA1, ZNF145, PLZF, PML, MYL, STAT5B, AF10, CALM, CLTH, ARL11, ARLTS1, P2RX7, P2X7, BCR, CML, PHL, ALL, GRAF, NF1, VRNF, WSS, NFNS, PTPN11, PTP2C, SHP2, NS1, BCL2, CCND1, PRAD1, BCL1, TCRA, GATA1, GF1, ERYF1, NFE1, ABL1, NQO1, DIA4, NMOR1, NUP214, D9S46E, CAN, CAIN). Inflammation and AIDS (KIR3DL1, NKAT3, NKB1, AMB11, immune related KIR3DS1, IFNG, CXCL12, SDF1); Autoimmune diseases and lymphoproliferative syndrome (TNFRSF6, APT1, disorders FAS, CD95, ALPS1A); Combined immunodeficiency, (IL2RG, SCIDX1, SCIDX, IMD4); HIV-1 (CCL5, SCYA5, D17S136E, TCP228), HIV susceptibility or infection (IL10, CSIF, CMKBR2, CCR2, CMKBR5, CCCKR5 (CCR5)); Immunodeficiencies (CD3E, CD3G, AICDA, AID, HIGM2, TNFRSF5, CD40, UNG, DGU, HIGM4, TNFSF5, CD40LG, HIGM1, IGM, FOXP3, IPEX, AIID, XPID, PIDX, TNFRSF14B, TACI); Inflammation (IL-10, IL-1 (IL-1a, IL-1b), IL-13, IL-17 (IL-17a (CTLA8), IL-17b, IL-17c, IL-17d, IL-17f), II-23, Cx3cr1, ptpn22, TNFa, NOD2/CARD15 for IBD, IL-6, IL-12 (IL-12a, IL-12b), CTLA4, Cx3cl1); Severe combined immunodeficiencies (SCIDs)(JAK3, JAKL, DCLRE1C, ARTEMIS, SCIDA, RAG1, RAG2, ADA, PTPRC, CD45, LCA, IL7R, CD3D, T3D, IL2RG, SCIDX1, SCIDX, IMD4). Metabolic, liver, Amyloid neuropathy (TTR, PALB); kidney and protein Amyloidosis (APOA1, APP, AAA, diseases and CVAP, AD1, GSN, FGA, LYZ, TTR, disorders PALB); Cirrhosis (KRT18, KRT8, CIRH1A, NAIC, TEX292, KIAA1988); Cystic fibrosis (CFTR, ABCC7, CF, MRP7); Glycogen storage diseases (SLC2A2, GLUT2, G6PC, G6PT, G6PT1, GAA, LAMP2, LAMPB, AGL, GDE, GBE1, GYS2, PYGL, PFKM); Hepatic adenoma, 142330 (TCF1, HNF1A, MODY3), Hepatic failure, early onset, and neurologic disorder (SCOD1, SCO1), Hepatic lipase deficiency (LIPC), Hepatoblastoma, cancer and carcinomas (CTNNB1, PDGFRL, PDGRL, PRLTS, AXIN1, AXIN, CTNNB1, TP53, P53, LFS1, IGF2R, MPRI, MET, CASP8, MCH5; Medullary cystic kidney disease (UMOD, HNFJ, FJHN, MCKD2, ADMCKD2); Phenylketonuria (PAH, PKU1, QDPR, DHPR, PTS); Polycystic kidney and hepatic disease (FCYT, PKHD1, ARPKD, PKD1, PKD2, PKD4, PKDTS, PRKCSH, G19P1, PCLD, SEC63). Muscular/Skeletal Becker muscular dystrophy (DMD, BMD, diseases and MYF6), Duchenne Muscular disorders Dystrophy (DMD, BMD); Emery-Dreifuss muscular dystrophy (LMNA, LMN1, EMD2, FPLD, CMD1A, HGPS, LGMD1B, LMNA, LMN1, EMD2, FPLD, CMD1A); Facioscapulohumeral muscular dystrophy (FSHMD1A, FSHD1A); Muscular dystrophy (FKRP, MDC1C, LGMD2I, LAMA2, LAMM, LARGE, KIAA0609, MDC1D, FCMD, TTID, MYOT, CAPN3, CANP3, DYSF, LGMD2B, SGCG, LGMD2C, DMDA1, SCG3, SGCA, ADL, DAG2, LGMD2D, DMDA2, SGCB, LGMD2E, SGCD, SGD, LGMD2F, CMD1L, TCAP, LGMD2G, CMD1N, TRIM32, HT2A, LGMD2H, FKRP, MDC1C, LGMD21, TTN, CMD1G, TMD, LGMD2J, POMT1, CAV3, LGMD1C, SEPN1, SELN, RSMD1, PLEC1, PLTN, EBS1); Osteopetrosis (LRP5, BMND1, LRP7, LR3, OPPG, VBCH2, CLCN7, CLC7, OPTA2, OSTM1, GL, TCIRG1, TIRC7, OC116, OPTB1); Muscular atrophy (VAPB, VAPC, ALS8, SMN1, SMA1, SMA2, SMA3, SMA4, BSCL2, SPG17, GARS, SMAD1, CMT2D, HEXB, IGHMBP2, SMUBP2, CATF1, SMARD1). Neurological and ALS (SOD1, ALS2, STEX, FUS, TARDBP, neuronal VEGF (VEGF-a, VEGF-b, VEGF-c); Alzheimer diseases and disease (APP, AAA, CVAP, AD1, APOE, AD2, disorders PSEN2, AD4, STM2, APBB2, FE65L1, NOS3, PLAU, URK, ACE, DCP1, ACE1; MPO, PACIP1, PAXIP1L, PTIP, A2M, BLMH, BMH, PSEN1, AD3); Autism (Meep2, BZRAP1, MDGA2, Sema5A, Neurexin 1, GLO1, MECP2, RTT, PPMX, MRX16, MRX79, NLGN3, NLGN4, KIAA1260, AUTSX2); Fragile X Syndrome (FMR2, FXR1, FXR2, mGLUR5); Huntington's disease and disease like disorders (HD, IT15, PRNP, PRIP, JPH3, JP3, HDL2, TBP, SCA17); Parkinson disease (NR4A2, NURR1, NOT, TINUR, SNCAIP, TBP, SCA17, SNCA, NACP, PARK1, PARK4, DJ1, PARK7, LRRK2, PARK8, PINK1, PARK6, UCHL1, PARK5, SNCA, NACP, PARK1, PARK4, PRKN, PARK2, PDJ, DBH, NDUFV2); Rett syndrome (MECP2, RTT, PPMX, MRX16, MRX79, CDKL5, STK9, MECP2, RTT, PPMX, MRX16, MRX79, x-Synuclein, DJ-1); Schizophrenia (Neuregulin1 (Nrg1), Erb4 (receptor for Neuregulin), Complexin1 (Cplx1), Tph1 Tryptophan hydroxylase, Tph2, Tryptophan hydroxylase 2, Neurexin 1, GSK3, GSK3a, GSK3b, 5-HTT (Slc6a4), COMT, DRD (Drd1a), SLC6A3, DAOA, DTNBP1, Dao (Dao1)); Secretase Related Disorders (APH-1 (alpha and beta), Presenilin (Psen1), nicastrin, (Ncstn), PEN-2, Nos1, Parp1, Nat1, Nat2); Trinucleotide Repeat Disorders (HTT (Huntington's Dx), SBMA/SMAX1/AR (Kennedy's Dx), FXN/X25 (Friedrich's Ataxia), ATX3 (Machado-Joseph's Dx), ATXN1 and ATXN2 (spinocerebellar ataxias), DMPK (myotonic dystrophy), Atrophin-1 and Atn1 (DRPLA Dx), CBP (Creb-BP-global instability), VLDLR (Alzheimer's), Atxn7, Atxn10). Occular Age-related macular degeneration (Abcr, Ccl2, diseases and Cc2, cp (ceruloplasmin), Timp3, cathepsinD, Vldlr, disorders Ccr2); Cataract (CRYAA, CRYA1, CRYBB2, CRYB2, PITX3, BFSP2, CP49, CP47, CRYAA, CRYA1, PAX6, AN2, MGDA, CRYBA1, CRYB1, CRYGC, CRYG3, CCL, LIM2, MP19, CRYGD, CRYG4, BFSP2, CP49, CP47, HSF4, CTM, HSF4, CTM, MIP, AQP0, CRYAB, CRYA2, CTPP2, CRYBB1, CRYGD, CRYG4, CRYBB2, CRYB2, CRYGC, CRYG3, CCL, CRYAA, CRYA1, GJA8, CX50, CAE1, GJA3, CX46, CZP3, CAE3, CCM1, CAM, KRIT1); Corneal clouding and dystrophy (APOA1, TGFBI, CSD2, CDGG1, CSD, BIGH3, CDG2, TACSTD2, TROP2, M1S1, VSX1, RINX, PPCD, PPD, KTCN, COL8A2, FECD, PPCD2, PIP5K3, CFD); Cornea plana congenital (KERA, CNA2); Glaucoma (MYOC, TIGR, GLC1A, JOAG, GPOA, OPTN, GLC1E, FIP2, HYPL, NRP, CYP1B1, GLC3A, OPA1, NTG, NPG, CYP1B1, GLC3A); Leber congenital amaurosis (CRB1, RP12, CRX, CORD2, CRD, RPGRIP1, LCA6, CORD9, RPE65, RP20, AIPL1, LCA4, GUCY2D, GUC2D, LCA1, CORD6, RDH12, LCA3); Macular dystrophy (ELOVL4, ADMD, STGD2, STGD3, RDS, RP7, PRPH2, PRPH, AVMD, AOFMD, VMD2). Epilepsy, myoclonic, EPM2A, MELF, EPM2 Lafora type, 254780 Epilepsy, myoclonic, NHLRC1, EPM2A, EPM2B Lafora type, 254780 Duchenne muscular DMD, BMD dystrophy, 310200 (3) AIDS, delayed/rapid KIR3DL1, NKAT3, NKB1, AMB11, progression to (3) KIR3DS1 AIDS, rapid IFNG progression to, 609423 (3) AIDS, resistance to CXCL12, SDF1 (3) Alpha 1-Antitrypsin SERPINA1 [serpin peptidase inhibitor, clade A Deficiency (alpha-1 antiproteinase, antitrypsin), member 1]; SERPINA2 [serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 2]; SERPINA3 [serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 3]; SERPINA5 [serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 5]; SERPINA6 [serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 6]; SERPINA7 [serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 7];” AND “SERPINA6 (serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 6) -
TABLE C CELLULAR FUNCTION GENES PI3K/AKT PRKCE; ITGAM; ITGA5; IRAK1; Signaling PRKAA2; EIF2AK2; PTEN; EIF4E; PRKCZ; GRK6; MAPK1; TSC1; PLK1; AKT2; IKBKB; PIK3CA; CDK8; CDKN1B; NFKB2; BCL2; PIK3CB; PPP2R1A; MAPK8; BCL2L1; MAPK3; TSC2; ITGA1; KRAS; EIF4EBP1; RELA; PRKCD; NOS3; PRKAA1; MAPK9; CDK2; PPP2CA; PIM1; ITGB7; YWHAZ; ILK; TP53; RAF1; IKBKG; RELB; DYRK1A; CDKN1A; ITGB1; MAP2K2; JAK1; AKT1; JAK2; PIK3R1; CHUK; PDPK1; PPP2R5C; CTNNB1; MAP2K1; NFKB1; PAK3; ITGB3; CCND1; GSK3A; FRAP1; SFN; ITGA2; TTK; CSNK1A1; BRAF; GSK3B; AKT3; FOXO1; SGK; HSP90AA1; RPS6KB1 ERK/MAPK PRKCE; ITGAM; ITGA5; HSPB1; IRAK1; Signaling PRKAA2; EIF2AK2; RAC1; RAP1A; TLN1; EIF4E; ELK1; GRK6; MAPK1; RAC2; PLK1; AKT2; PIK3CA; CDK8; CREB1; PRKCI; PTK2; FOS; RPS6KA4; PIK3CB; PPP2R1A; PIK3C3; MAPK8; MAPK3; ITGA1; ETS1; KRAS; MYCN; EIF4EBP1; PPARG; PRKCD; PRKAA1; MAPK9; SRC; CDK2; PPP2CA; PIM1; PIK3C2A; ITGB7; YWHAZ; PPP1CC; KSR1; PXN; RAF1; FYN; DYRK1A; ITGB1; MAP2K2; PAK4; PIK3R1; STAT3; PPP2R5C; MAP2K1; PAK3; ITGB3; ESR1; ITGA2; MYC; TTK; CSNK1A1; CRKL; BRAF; ATF4; PRKCA; SRF; STAT1; SGK Glucocorticoid RAC1; TAF4B; EP300; SMAD2; TRAF6; Receptor PCAF; ELK1; MAPK1; SMAD3; Signaling AKT2; IKBKB; NCOR2; UBE2I; PIK3CA; CREB1; FOS; HSPA5; NFKB2; BCL2; MAP3K14; STAT5B; PIK3CB; PIK3C3; MAPK8; BCL2L1; MAPK3; TSC22D3; MAPK10; NRIP1; KRAS; MAPK13; RELA; STAT5A; MAPK9; NOS2A; PBX1; NR3C1; PIK3C2A; CDKN1C; TRAF2; SERPINE1; NCOA3; MAPK14; TNF; RAF1; IKBKG; MAP3K7; CREBBP; CDKN1A; MAP2K2; JAK1; IL8; NCOA2; AKT1; JAK2; PIK3R1; CHUK; STAT3; MAP2K1; NFKB1; TGFBR1; ESR1; SMAD4; CEBPB; JUN; AR; AKT3; CCL2; MMP1; STAT1; IL6; HSP90AA1 Axonal PRKCE; ITGAM; ROCK1; ITGA5; Guidance CXCR4; ADAM12; IGF1; RAC1; RAP1A; Signaling EIF4E; PRKCZ; NRP1; NTRK2; ARHGEF7; SMO; ROCK2; MAPK1; PGF; RAC2; PTPN11; GNAS; AKT2; PIK3CA; ERBB2; PRKCI; PTK2; CFL1; GNAQ; PIK3CB; CXCL12; PIK3C3; WINT11; PRKD1; GNB2L1; ABL1; MAPK3; ITGA1; KRAS; RHOA; PRKCD; PIK3C2A; ITGB7; GLI2; PXN; VASP; RAF1; FYN; ITGB1; MAP2K2; PAK4; ADAM17; AKT1; PIK3R1; GLI1; WNT5A; ADAM10; MAP2K1; PAK3; ITGB3; CDC42; VEGFA; ITGA2; EPHA8; CRKL; RND1; GSK3B; AKT3; PRKCA Ephrin PRKCE; ITGAM; ROCK1; ITGA5; Receptor CXCR4; IRAK1; PRKAA2; EIF2AK2; Signaling RAC1; RAP1A; GRK6; ROCK2; MAPK1; PGF; RAC2; PTPN11; GNAS; PLK1; AKT2; DOK1; CDK8; CREB1; PTK2; CFL1; GNAQ; MAP3K14; CXCL12; MAPK8; GNB2L1; ABL1; MAPK3; ITGA1; KRAS; RHOA; PRKCD; PRKAA1; MAPK9; SRC; CDK2; PIM1; ITGB7; PXN; RAF1; FYN; DYRK1A; ITGB1; MAP2K2; PAK4; AKT1; JAK2; STAT3; ADAM10; MAP2K1; PAK3; ITGB3; CDC42; VEGFA; ITGA2; EPHA8; TTK; CSNK1A1; CRKL; BRAF; PTPN13; ATF4; AKT3; SGK Actin ACTN4; PRKCE; ITGAM; ROCK1; Cytoskeleton ITGA5; IRAK1; PRKAA2; EIF2AK2; Signaling RAC1; INS; ARHGEF7; GRK6; ROCK2; MAPK1; RAC2; PLK1; AKT2; PIK3CA; CDK8; PTK2; CFL1; PIK3CB; MYH9; DIAPH1; PIK3C3; MAPK8; F2R; MAPK3; SLC9A1; ITGA1; KRAS; RHOA; PRKCD; PRKAA1; MAPK9; CDK2; PIM1; PIK3C2A; ITGB7; PPP1CC; PXN; VIL2; RAF1; GSN; DYRK1A; ITGB1; MAP2K2; PAK4; PIP5K1A; PIK3R1; MAP2K1; PAK3; ITGB3; CDC42; APC; ITGA2; TTK; CSNK1A1; CRKL; BRAF; VAV3; SGK Huntington's PRKCE; IGF1; EP300; RCOR1; PRKCZ; Disease HDAC4; TGM2; MAPK1; CAPNS1; Signaling AKT2; EGFR; NCOR2; SP1; CAPN2; PIK3CA; HDAC5; CREB1; PRKCI; HSPA5; REST; GNAQ; PIK3CB; PIK3C3; MAPK8; IGF1R; PRKD1; GNB2L1; BCL2L1; CAPN1; MAPK3; CASP8; HDAC2; HDAC7A; PRKCD; HDAC11; MAPK9; HDAC9; PIK3C2A; HDAC3; TP53; CASP9; CREBBP; AKT1; PIK3R1; PDPK1; CASP1; APAF1; FRAP1; CASP2; JUN; BAX; ATF4; AKT3; PRKCA; CLTC; SGK; HDAC6; CASP3 Apoptosis PRKCE; ROCK1; BID; IRAK1; PRKAA2; Signaling EIF2AK2; BAK1; BIRC4; GRK6; MAPK1; CAPNS1; PLK1; AKT2; IKBKB; CAPN2; CDK8; FAS; NFKB2; BCL2; MAP3K14; MAPK8; BCL2L1; CAPN1; MAPK3; CASP8; KRAS; RELA; PRKCD; PRKAA1; MAPK9; CDK2; PIM1; TP53; TNF; RAF1; IKBKG; RELB; CASP9; DYRK1A; MAP2K2; CHUK; APAF1; MAP2K1; NFKB1; PAK3; LMNA; CASP2; BIRC2; TTK; CSNK1A1; BRAF; BAX; PRKCA; SGK; CASP3; BIRC3; PARP1 B Cell RAC1; PTEN; LYN; ELK1; MAPK1; Receptor RAC2; PTPN11; AKT2; IKBKB; PIK3CA; Signaling CREB1; SYK; NFKB2; CAMK2A; MAP3K14; PIK3CB; PIK3C3; MAPK8; BCL2L1; ABL1; MAPK3; ETS1; KRAS; MAPK13; RELA; PTPN6; MAPK9; EGR1; PIK3C2A; BTK; MAPK14; RAF1; IKBKG; RELB; MAP3K7; MAP2K2; AKT1; PIK3R1; CHUK; MAP2K1; NFKB1; CDC42; GSK3A; FRAP1; BCL6; BCL10; JUN; GSK3B; ATF4; AKT3; VAV3; RPS6KB1 Leukocyte ACTN4; CD44; PRKCE; ITGAM; ROCK1; Extravasation CXCR4; CYBA; RAC1; RAP1A; Signaling PRKCZ; ROCK2; RAC2; PTPN11; MMP14; PIK3CA; PRKCI; PTK2; PIK3CB; CXCL12; PIK3C3; MAPK8; PRKD1; ABL1; MAPK10; CYBB; MAPK13; RHOA; PRKCD; MAPK9; SRC; PIK3C2A; BTK; MAPK14; NOX1; PXN; VIL2; VASP; ITGB1; MAP2K2; CTNND1; PIK3R1; CTNNB1; CLDN1; CDC42; F11R; ITK; CRKL; VAV3; CTTN; PRKCA; MMP1; MMP9 Integrin ACTN4; ITGAM; ROCK1; ITGA5; RAC1; Signaling PTEN; RAP1A; TLN1; ARHGEF7; MAPK1; RAC2; CAPNS1; AKT2; CAPN2; PIK3CA; PTK2; PIK3CB; PIK3C3; MAPK8; CAV1; CAPN1; ABL1; MAPK3; ITGA1; KRAS; RHOA; SRC; PIK3C2A; ITGB7; PPP1CC; ILK; PXN; VASP; RAF1; FYN; ITGB1; MAP2K2; PAK4; AKT1; PIK3R1; TNK2; MAP2K1; PAK3; ITGB3; CDC42; RND3; ITGA2; CRKL; BRAF; GSK3B; AKT3 Acute IRAK1; SOD2; MYD88; TRAF6; ELK1; Phase MAPK1; PTPN11; AKT2; IKBKB; Response PIK3CA; FOS; NFKB2; MAP3K14; Signaling PIK3CB; MAPK8; RIPK1; MAPK3; IL6ST; KRAS; MAPK13; IL6R; RELA; SOCS1; MAPK9; FTL; NR3C1; TRAF2; SERPINE1, MAPK14; TNF; RAF1; PDK1; IKBKG; RELB; MAP3K7; MAP2K2; AKT1; JAK2; PIK3R1; CHUK; STAT3; MAP2K1; NFKB1; FRAP1; CEBPB; JUN; AKT3; IL1R1; IL6 PTEN ITGAM; ITGA5; RAC1; PTEN; PRKCZ; Signaling BCL2L11; MAPK1; RAC2; AKT2; EGFR; IKBKB; CBL; PIK3CA; CDKN1B; PTK2; NFKB2; BCL2; PIK3CB; BCL2L1; MAPK3; ITGA1; KRAS; ITGB7; ILK; PDGFRB; INSR; RAF1; IKBKG; CASP9; CDKN1A; ITGB1; MAP2K2; AKT1; PIK3R1, CHUK; PDGFRA; PDPK1; MAP2K1; NFKB1; ITGB3; CDC42; CCND1; GSK3A; ITGA2; GSK3B; AKT3; AKT3; FOXO1; CASP3; RPS6KB1 p53 Signaling PTEN; EP300; BBC3; PCAF; FASN; BRCA1; GADD45A; BIRC5; AKT2; PIK3CA; CHEK1; TP53INP1; BCL2; PIK3CB; PIK3C3; MAPK8; THBS1; ATR; BCL2L1; E2F1; PMAIP1; CHEK2; TNFRSF10B; TP73; RB1; HDAC9; CDK2; PIK3C2A; MAPK14; TP53; LRDD; CDKN1A; HIPK2; AKT1; PIK3R1; RRM2B; APAF1; CTNNB1; SIRT1; CCND1; PRKDC; ATM; SFN; CDKN2A; JUN; SNAI2; GSK3B; BAX; AKT3 Aryl HSPB1; EP300; FASN; TGM2; RXRA; Hydrocarbon MAPK1; NQO1; NCOR2; SP1; Receptor ARNT; CDKN1B; FOS; CHEK1; Signaling SMARCA4; NFKB2; MAPK8; ALDH1A1; ATR; E2F1; MAPK3; NRIP1; CHEK2; RELA; TP73; GSTP1; RB1; SRC; CDK2; AHR; NFE2L2; NCOA3; TP53; TNF; CDKN1A; NCOA2; APAF1; NFKB1; CCND1; ATM; ESR1; CDKN2A; MYC; JUN; ESR2; BAX; IL6; CYP1B1; HSP90AA1 Xenobiotic PRKCE; EP300; PRKCZ; RXRA; Metabolism MAPK1; NQO1; NCOR2; PIK3CA; Signaling ARNT; PRKCI; NFKB2; CAMK2A; PIK3CB; PPP2R1A; PIK3C3; MAPK8; PRKD1; ALDH1A1; MAPK3; NRIP1; KRAS; MAPK13; PRKCD; GSTP1; MAPK9; NOS2A; ABCB1; AHR; PPP2CA; FTL; NFE2L2; PIK3C2A; PPARGC1A; MAPK14; TNF; RAF1; CREBBP; MAP2K2; PIK3R1; PPP2R5C; MAP2K1; NFKB1; KEAP1; PRKCA; EIF2AK3; IL6; CYP1B1 HSP90AA1 SAPK/JNK PRKCE; IRAK1; PRKAA2; EIF2AK2; Signaling RAC1; ELK1; GRK6; MAPK1; GADD45A; RAC2; PLK1; AKT2; PIK3CA; FADD; CDK8; PIK3CB; PIK3C3; MAPK8; RIPK1; GNB2L1; IRS1; MAPK3; MAPK10; DAXX; KRAS; PRKCD; PRKAA1; MAPK9; CDK2; PIM1; PIK3C2A; TRAF2; TP53; LCK; MAP3K7; DYRK1A; MAP2K2; PIK3R1; MAP2K1; PAK3; CDC42; JUN; TTK; CSNK1A1; CRKL; BRAF; SGK PPAr/RXR PRKAA2; EP300; INS; SMAD2; TRAF6; Signaling PPARA; FASN; RXRA; MAPK1; SMAD3; GNAS; IKBKB; NCOR2; ABCA1; GNAQ; NFKB2; MAP3K14; STAT5B; MAPK8; IRS1; MAPK3; KRAS; RELA; PRKAA1; PPARGC1A; NCOA3; MAPK14; INSR; RAF1; IKBKG; RELB; MAP3K7; CREBBP; MAP2K2; JAK2; CHUK; MAP2K1; NFKB1; TGFBR1; SMAD4; JUN; IL1R1; PRKCA; IL6; HSP90AA1; ADIPOQ NF-KB IRAK1; EIF2AK2; EP300; INS; MYD88; Signaling PRKCZ; TRAF6; TBK1; AKT2; EGFR; IKBKB; PIK3CA; BTRC; NFKB2; MAP3K14; PIK3CB; PIK3C3; MAPK8; RIPK1; HDAC2; KRAS; RELA; PIK3C2A; TRAF2; TLR4; PDGFRB; TNF; INSR; LCK; IKBKG; RELB; MAP3K7; CREBBP; AKT1; PIK3R1; CHUK; PDGFRA; NFKB1; TLR2; BCL10; GSK3B; AKT3; TNFAIP3; IL1R1 Neuregulin ERBB4; PRKCE; ITGAM; ITGA5; Signaling PTEN; PRKCZ; ELK1; MAPK1; PTPN11; AKT2; EGFR; ERBB2; PRKCI; CDKN1B; STAT5B; PRKD1; MAPK3; ITGA1; KRAS; PRKCD; STAT5A; SRC; ITGB7; RAF1; ITGB1; MAP2K2; ADAM17; AKT1; PIK3R1; PDPK1; MAP2K1; ITGB3; EREG; FRAP1; PSEN1; ITGA2; MYC; NRG1; CRKL; AKT3; PRKCA; HSP90AA1; RPS6KB1 Wnt & Beta CD44; EP300; LRP6; DVL3; CSNK1E; catenin GJA1; SMO; AKT2; PIN1; CDH1; Signaling BTRC; GNAQ; MARK2; PPP2R1A; WNT11; SRC; DKK1; PPP2CA; SOX6; SFRP2; ILK; LEF1; SOX9; TP53; MAP3K7; CREBBP; TCF7L2; AKT1; PPP2R5C; WNT5A; LRP5; CTNNB1; TGFBR1; CCND1; GSK3A; DVL1; APC; CDKN2A; MYC; CSNK1A1; GSK3B; AKT3; SOX2 Insulin PTEN; INS; EIF4E; PTPN1; PRKCZ; Receptor MAPK1; TSC1; PTPN11; AKT2; CBL; Signaling PIK3CA; PRKCI; PIK3CB; PIK3C3; MAPK8; IRS1; MAPK3; TSC2; KRAS; EIF4EBP1; SLC2A4; PIK3C2A; PPP1CC; INSR; RAF1; FYN; MAP2K2; JAK1; AKT1; JAK2; PIK3R1; PDPK1; MAP2K1; GSK3A; FRAP1; CRKL; GSK3B; AKT3; FOXO1; SGK; RPS6KB1 IL-6 HSPB1; TRAF6; MAPKAPK2; ELK1; Signaling MAPK1; PTPN11; IKBKB; FOS; NFKB2; MAP3K14; MAPK8; MAPK3; MAPK10; IL6ST; KRAS; MAPK13; IL6R; RELA; SOCS1; MAPK9; ABCB1; TRAF2; MAPK14; TNF; RAF1; IKBKG; RELB; MAP3K7; MAP2K2, IL8; JAK2; CHUK; STAT3; MAP2K1; NFKB1; CEBPB; JUN; IL1R1; SRF; IL6 Hepatic PRKCE; IRAK1; INS; MYD88; Cholestasis PRKCZ; TRAF6; PPARA; RXRA; IKBKB; PRKCI; NFKB2; MAP3K14; MAPK8; PRKD1; MAPK10; RELA; PRKCD; MAPK9; ABCB1; TRAF2; TLR4; TNF; INSR; IKBKG; RELB; MAP3K7; IL8; CHUK; NR1H2; TJP2; NFKB1; ESR1; SREBF1; FGFR4; JUN; IL1R1; PRKCA; IL6 IGF-1 IGF1; PRKCZ; ELK1; MAPK1; Signaling PTPN11; NEDD4; AKT2; PIK3CA; PRKCI; PTK2; FOS; PIK3CB; PIK3C3; MAPK8; IGF1R; IRS1; MAPK3; IGFBP7; KRAS; PIK3C2A; YWHAZ; PXN; RAF1; CASP9; MAP2K2; AKT1; PIK3R1; PDPK1; MAP2K1; IGFBP2; SFN; JUN; CYR61; AKT3; FOXO1; SRF; CTGF; RPS6KB1 NRF2-mediated PRKCE; EP300; SOD2; PRKCZ; Oxidative MAPK1; SQSTM1; NQO1; PIK3CA; Stress PRKCI; FOS; PIK3CB; PIK3C3; MAPK8; Response PRKD1; MAPK3; KRAS; PRKCD; GSTP1; MAPK9; FTL; NFE2L2; FIK3C2A; MAPK14; RAF1; MAP3K7; CREBBP; MAP2K2; AKT1; PIK3R1; MAP2K1; PPIB; JUN; KEAP1; GSK3B; ATF4; PRKCA; EIF2AK3; HSP90AA1 Hepatic EDN1; IGF1; KDR; FLT1; SMAD2; Fibrosis/ FGFR1; MET; PGF; SMAD3; EGFR; Hepatic FAS; CSF1; NFKB2; BCL2; MYH9; Stellate Cell IGF1R; IL6R; RELA; TLR4; PDGFRB; Activation TNF; RELB; IL8; PDGFRA; NFKB1; TGFBR1; SMAD4; VEGFA; BAX; IL1R1; CCL2; HGF; MMP1; STAT1; IL6; CTGF; MMP9 PPAR EP300; INS; TRAF6; PPARA; RXRA; Signaling MAPK1; IKBKB; NCOR2; FOS; NFKB2; MAP3K14; STAT5B; MAPK3; NRIP1; KRAS; PPARG; RELA; STAT5A; TRAF2; PPARGC1A; PDGFRB; TNF; INSR; RAF1; IKBKG; RELB; MAP3K7; CREBBP; MAP2K2; CHUK; PDGFRA; MAP2K1; NFKB1; JUN; IL1R1; HSP90AA1 Fc Epsilon PRKCE; RAC1; PRKCZ; LYN; MAPK1; RI Signaling RAC2; PTPN11; AKT2; PIK3CA; SYK; PRKCI; PIK3CB; PIK3C3; MAPK8; PRKD1; MAPK3; MAPK10; KRAS; MAPK13; PRKCD; MAPK9; PIK3C2A; BTK; MAPK14; TNF; RAF1; FYN; MAP2K2; AKT1; PIK3R1; PDPK1; MAP2K1; AKT3; VAV3; PRKCA G-Protein PRKCE; RAP1A; RGS16; MAPK1; Coupled GNAS; AKT2; IKBKB; PIK3CA; CREB1; Receptor GNAQ; NFKB2; CAMK2A; PIK3CB; Signaling PIK3C3; MAPK3; KRAS; RELA; SRC; PIK3C2A; RAF1; IKBKG; RELB; FYN; MAP2K2; AKT1; PIK3R1; CHUK; PDPK1; STAT3; MAP2K1; NFKB1; BRAF; ATF4; AKT3; PRKCA Inositol PRKCE; IRAK1; PRKAA2; EIF2AK2; Phosphate PTEN; GRK6; MAPK1; PLK1; AKT2; Metabolism PIK3CA; CDK8; PIK3CB; PIK3C3; MAPK8; MAPK3; PRKCD; PRKAA1; MAPK9; CDK2; PIM1; PIK3C2A; DYRK1A; MAP2K2; PIP5K1A; PIK3R1; MAP2K1; PAK3; ATM; TTK; CSNK1A1; BRAF; SGK PDGF EIF2AK2; ELK1; ABL2; MAPK1; Signaling PIK3CA; FOS; PIK3CB; PIK3C3; MAPK8; CAV1; ABL1; MAPK3; KRAS; SRC; PIK3C2A; PDGFRB; RAF1; MAP2K2; JAK1; JAK2; PIK3R1; PDGFRA; STAT3; SPHK1; MAP2K1; MYC; JUN; CRKL; PRKCA; SRF; STAT1; SPHK2 VEGF ACTN4; ROCK1; KDR; FLT1; ROCK2; Signaling MAPK1; PGF; AKT2; PIK3CA; ARNT; PTK2; BCL2; PIK3CB; PIK3C3; BCL2L1; MAPK3; KRAS; HIF1A; NOS3; PIK3C2A; PXN; RAF1; MAP2K2; ELAVL1; AKT1; PIK3R1; MAP2K1; SFN; VEGFA; AKT3; FOXO1; PRKCA Natural PRKCE; RAC1; PRKCZ; MAPK1; Killer Cell RAC2; PTPN11; KIR2DL3; AKT2; Signaling PIK3CA; SYK; PRKCI; PIK3CB; PIK3C3; PRKD1; MAPK3; KRAS; PRKCD; PTPN6; PIK3C2A; LCK; RAF1; FYN; MAP2K2; PAK4; AKT1; PIK3R1; MAP2K1; PAK3; AKT3; VAV3; PRKCA Cell Cycle: HDAC4; SMAD3; SUV39H1; HDAC5; G1/S CDKN1B; BTRC; ATR; ABL1; E2F1; Checkpoint HDAC2; HDAC7A; RB1; HDAC11; Regulation HDAC9; CDK2; E2F2; HDAC3; TP53; CDKN1A; CCND1; E2F4; ATM; RBL2; SMAD4; CDKN2A; MYC; NRG1; GSK3B; RBL1; HDAC6 T Cell RAC1; ELK1; MAPK1; IKBKB; Receptor CBL; PIK3CA; FOS; NFKB2; PIK3CB; Signaling PIK3C3; MAPK8; MAPK3; KRAS; RELA; PIK3C2A; BTK; LCK; RAF1; IKBKG; RELB; FYN; MAP2K2; PIK3R1; CHUK; MAP2K1; NFKB1; ITK; BCL10; JUN; VAV3 Death CRADD; HSPB1; BID; BIRC4; TBK1; Receptor IKBKB; FADD; FAS; NFKB2; BCL2; Signaling MAP3K14; MAPK8; RIPK1; CASP8, DAXX; TNFRSF10B; RELA; TRAF2; TNF; IKBKG; RELB; CASP9; CHUK; APAF1; NEKB1; CASP2; BIRC2; CASP3; BIRC3 FGF RAC1; FGFR1; MET; MAPKAPK2; Signaling MAPK1; PTPN11; AKT2; PIK3CA; CREB1; PIK3CB; PIK3C3; MAPK8; MAPK3; MAPK13; PTPN6; PIK3C2A; MAPK14; RAF1; AKT1; PIK3R1; STAT3; MAP2K1; FGFR4; CRKL; ATF4; AKT3; PRKCA; HGF GM-CSF LYN; ELK1; MAPK1; PTPN11; AKT2; Signaling PIK3CA; CAMK2A; STAT5B; PIK3CB; PIK3C3; GNB2L1; BCL2L1; MAPK3; ETS1; KRAS; RUNX1; PIM1; PIK3C2A; RAF1; MAP2K2; AKT1; JAK2; PIK3R1; STAT3, MAP2K1; CCND1; AKT3; STAT1 Amyotrophic BID; IGF1; RAC1; BIRC4; PGF; Lateral CAPNS1; CAPN2; PIK3CA; BCL2; Sclerosis PIK3CB; PIK3C3; BCL2L1; CAPN1; Signaling PIK3C2A; TP53; CASP9; PIK3R1; RAB5A; CASP1; APAF1; VEGFA; BIRC2; BAX; AKT3; CASP3; BIRC3 JAK/Stat PTPN1; MAPK1; PTPN11; AKT2; Signaling PIK3CA; STAT5B; PIK3CB; PIK3C3; MAPK3; KRAS; SOCS1; STAT5A; PTPN6; PIK3C2A; RAF1; CDKN1A; MAP2K2; JAK1; AKT1; JAK2; PIK3R1; STAT3; MAP2K1; FRAP1; AKT3; STAT1 Nicotinate and PRKCE; IRAK1; PRKAA2; EIF2AK2; Nicotinamide GRK6; MAPK1; PLK1; AKT2; CDK8; Metabolism MAPK8; MAPK3; PRKCD; PRKAA1; PBEF1; MAPK9; CDK2; PIM1; DYRK1A; MAP2K2; MAP2K1; PAK3; NT5E; TTK; CSNK1A1; BRAF; SGK Chemokine CXCR4; ROCK2; MAPK1; PTK2; FOS; Signaling CFL1; GNAQ; CAMK2A; CXCL12; MAPK8; MAPK3; KRAS; MAPK13; RHOA; CCR3; SRC; PPP1CC; MAPK14; NOX1; RAF1; MAP2K2; MAP2K1; JUN; CCL2; PRKCA IL-2 ELK1; MAPK1; PTPN11; AKT2; Signaling PIK3CA; SYK; FOS; STAT5B; PIK3CB; PIK3C3; MAPK8; MAPK3; KRAS; SOCS1; STAT5A; PIK3C2A; LCK; RAF1; MAP2K2; JAK1; AKT1; PIK3R1; MAP2K1; JUN; AKT3 Synaptic PRKCE; IGF1; PRKCZ; PRDX6; LYN; Long Term MAPK1; GNAS; PRKCI; GNAQ; Depression PPP2R1A; IGF1R; PRKD1; MAPK3; KRAS; GRN; PRKCD; NOS3; NOS2A; PPP2CA; YWHAZ; RAF1; MAP2K2; PPP2R5C; MAP2K1; PRKCA Estrogen TAF4B; EP300; CARM1; PCAF; Receptor MAPK1; NCOR2; SMARCA4; MAPK3; Signaling NRIP1; KRAS; SRC; NR3C1; HDAC3; PPARGC1A; RBM9; NCOA3; RAF1; CREBBP; MAP2K2; NCOA2; MAP2K1; PRKDC; ESR1; ESR2 Protein TRAF6; SMURF1; BIRC4; BRCA1; Ubiquitination UCHL1; NEDD4; CBL; UBE21; BTRC; Pathway HSPA5; USP7; USP10; FBXW7; USP9X; STUB1; USP22; B2M; BIRC2; PARK2; USP8; USP1; VHL; FISP90AA1; BIRC3 IL-10 TRAF6; CCR1; ELK1; IKBKB; SP1; Signaling FOS; NFKB2; MAP3K14; MAPK8; MAPK13; RELA; MAPK14; TNF; IKBKG; RELB; MAP3K7; JAK1; CHUK; STAT3; NFKB1; JUN; IL1R1; IL6 VDR/RXR PRKCE; EP300; PRKCZ; RXRA; Activation GADD45A; HES1; NCOR2; SP1; PRKCI; CDKN1B; PRKD1; PRKCD; RUNX2; KLF4; YY1; NCOA3; CDKN1A; NCOA2; SPP1; LRP5; CEBPB; FOXO1; PRKCA TGF-beta EP300; SMAD2; SMURF1; MAPK1; Signaling SMAD3; SMAD1; FOS; MAPK8; MAPK3; KRAS; MAPK9; RUNX2; SERPINE1; RAF1; MAP3K7; CREBBP; MAP2K2; MAP2K1; TGFBR1; SMAD4; JUN; SMAD5 Toll-like IRAK1; EIF2AK2; MYD88; TRAF6; Receptor PPARA; ELK1; IKBKB; FOS; NFKB2; Signaling MAP3K14; MAPK8; MAPK13; RELA; TLR4; MAPK14; IKBKG; RELB; MAP3K7; CHUK; NFKB1; TLR2; JUN p38 MAPK HSPB1; IRAK1; TRAF6; MAPKAPK2; Signaling ELK1; FADD; FAS; CREB1; DDIT3; RPS6KA4; DAXX; MAPK13; TRAF2; MAPK14; TNF; MAP3K7; TGFBR1; MYC; ATF4; IL1R1; SRF; STAT1 Neurotrophin/ NTRK2; MAPK1; PTPN11; PIK3CA; TRK CREB1; FOS; PIK3CB; PIK3C3; Signaling MAPK8; MAPK3; KRAS; PIK3C2A; RAF1; MAP2K2; AKT1; PIK3R1; PDPK1; MAP2K1; CDC42; JUN; ATF4 FXR/RXR INS; PPARA; FASN; RXRA; AKT2; Activation SDC1; MAPK8; APOB; MAPK10; PPARG; MTTP; MAPK9; PPARGC1A; TNF; CREBBP; AKT1; SREBF1; FGFR4; AKT3; FOXO1 Synaptic PRKCE; RAP1A; EP300; PRKCZ; Long Term MAPK1; CREB1; PRKCI; GNAQ; Potentiation CAMK2A; PRKD1; MAPK3; KRAS; PRKCD; PPP1CC; RAF1; CREBBP; MAP2K2; MAP2K1; ATF4; PRKCA Calcium RAP1A; EP300; HDAC4; MAPK1; Signaling HDAC5; CREB1; CAMK2A; MYH9; MAPK3; HDAC2; HDAC7A; HDAC11; HDAC9; HDAC3; CREBBP; CALR; CAMKK2; ATF4; HDAC6 EGF Signaling ELK1; MAPK1; EGFR; PIK3CA; FOS; PIK3CB; PIK3C3; MAPK8; MAPK3; PIK3C2A; RAF1; JAK1; PIK3R1; STAT3; MAP2K1; JUN; PRKCA; SRF; STAT1 Hypoxia Signaling EDN1; PTEN; EP300; NQO1; UBE2I; in the CREB1; ARNT; HIF1A; SLC2A4; Cardiovascular NOS3; TP53; LDHA; AKT1; ATM; System VEGFA; JUN; ATF4; VHL; HSP90AA1 LPS/IL-1 IRAK1; MYD88; TRAF6; PPARA; Mediated RXRA; ABCA1; MAPK8; ALDH1A1; Inhibition GSTP1; MAPK9; ABCB1; TRAF2; of RXR TLR4; TNF; MAP3K7; NR1H2; Function SREBF1; JUN; IL1R1 LXR/RXR FASN; RXRA; NCOR2; ABCA1; Activation NFKB2; IRF3; RELA; NOS2A; TLR4; TNF; RELB; LDLR; NR1H2; NFKB1; SREBF1; IL1R1; CCL2; IL6; MMP9 Amyloid PRKCE; CSNK1E; MAPK1; CAPNS1; Processing AKT2; CAPN2; CAPN1; MAPK3; MAPK13; MAPT; MAPK14; AKT1; PSEN1; CSNK1A1; GSK3B; AKT3; APP IL-4 AKT2; PIK3CA; PIK3CB; PIK3C3; Signaling IRS1; KRAS; SOCS1; PTPN6; NR3C1; PIK3C2A; JAK1; AKT1; JAK2; PIK3R1; FRAP1; AKT3; RPS6KB1 Cell Cycle: EP300; PCAF; BRCA1; GADD45A; G2/M DNA PLK1; BTRC; CHEK1; ATR; CHEK2; Damage YWHAZ; TP53; CDKN1A; Checkpoint PRKDC; ATM; SFN; CDKN2A Regulation Nitric Oxide KDR; FLT1; PGF; AKT2; PIK3CA; Signaling in the PIK3CB; PIK3C3; Cardiovascular CAV1; PRKCD; NOS3; System PIK3C2A; AKT1; PIK3R1; VEGFA; AKT3; HSP90AA1 Purine NME2; SMARCA4; MYH9; RRM2; Metabolism ADAR; EIF2AK4; PKM2; ENTPD1; RAD51; RRM2B; TJP2; RAD51C; NT5E; POLD1; NME1 cAMP-mediated RAP1A; MAPK1; GNAS; CREB1; Signaling CAMK2A; MAPK3; SRC; RAF1; MAP2K2; STAT3; MAP2K1; BRAF; ATF4 Mitochondrial SOD2; MAPK8; CASP8; MAPK10; Dysfunction MAPK9; CASP9; PARK7; PSEN1; PARK2; APP; CASP3 Notch Signaling HES1; JAG1; NUMB; NOTCH4; ADAM17; NOTCH2; PSEN1; NOTCH3; NOTCH1; DLL4 Endoplasmic HSPA5; MAPK8; XBP1; TRAF2; Reticulum ATF6; CASP9; ATF4; Stress Pathway EIF2AK3; CASP3 Pyrimidine NME2; AICDA; RRM2; EIF2AK4; Metabolism ENTPD1; RRM2B; NT5E; POLD1; NME1 Parkinson's UCHL1; MAPK8; MAPK13; MAPK14; Signaling CASP9; PARK7; PARK2; CASP3 Cardiac & Beta GNAS; GNAQ; PPP2R1A; GNB2L1; Adrenergic PPP2CA; PPP1CC; PPP2R5C Signaling Glycolysis/ HK2; GCK; GPI; ALDH1A1; PKM2; Gluconeogenesis LDHA; HK1 Interferon Signaling IRF1; SOCS1; JAK1; JAK2; IFITM1; STAT1; IFIT3 Sonic Hedgehog ARRB2; SMO; GLI2; DYRK1A; Signaling GLI1; GSK3B; DYRK1B Glycerophospholipid PLD1; GRN; GPAM; YWHAZ; Metabolism SPHK1; SPHK2 Phospholipid PRDX6; PLD1; GRN; YWHAZ; Degradation SPHK1; SPHK2 Tryptophan SIAH2; PRMT5; NEDD4; ALDH1A1; Metabolism CYP1B1; SIAH1 Lysine Degradation SUV39H1; EHMT2; NSD1; SETD7; PPP2R5C Nucleotide Excision ERCC5; ERCC4; XPA; XPC; ERCC1 Repair Pathway Starch and Sucrose UCHL1; HK2; GCK; GPI; HK1 Metabolism Aminosugars NQO1; HK2; GCK; HK1 Metabolism Arachidonic Acid PRDX6; GRN; YWHAZ; CYP1B1 Metabolism Circadian Rhythm CSNK1E; CREB1; ATF4; NR1D1 Signaling Coagulation BDKRB1; F2R; SERPINE1; F3 System Dopamine PPP2R1A; PPP2CA; PPP1CC; PPP2R5C Receptor Signaling Glutathione IDH2; GSTP1; ANPEP; IDH1 Metabolism Glycerolipid ALDH1A1; GPAM; SPHK1; SPHK2 Metabolism Linoleic Acid PRDX6; GRN; YWHAZ; CYP1B1 Metabolism Methionine DNMT1; DNMT3B; AHCY; DNMT3A Metabolism Pyruvate GLO1; ALDH1A1; PKM2; LDHA Metabolism Arginine ALDH1A1; NOS3; NOS2A and Proline Metabolism Eicosanoid PRDX6; GRN; YWHAZ Signaling Fructose and HK2; GCK; HK1 Mannose Metabolism Galactose HK2; GCK; HK1 Metabolism Stilbene, PRDX6; PRDX1; TYR Coumarine and Lignin Biosynthesis Antigen CALR; B2M Presentation Pathway Biosynthesis NQO1; DHCR7 of Steroids Butanoate ALDH1A1; NLGN1 Metabolism Citrate Cycle IDH2; IDH1 Fatty Acid ALDH1A1; CYP1B1 Metabolism Glycerophospholipid PRDX6; CHKA Metabolism Histidine PRMT5; ALDH1A1 Metabolism Inositol Metabolism ERO1L; APEX1 Metabolism of GSTP1; CYP1B1 Xenobiotics by Cytochrome p450 Methane Metabolism PRDX6; PRDX1 Phenylalanine PRDX6; PRDX1 Metabolism Propanoate ALDH1A1; LDHA Metabolism Selenoamino Acid PRMT5; AHCY Metabolism Sphingolipid SPHK1; SPHK2 Metabolism Aminophosphonate PRMT5 Metabolism Androgen PRMT5 and Estrogen Metabolism Ascorbate ALDH1A1 and Aldarate Metabolism Bile Acid ALDH1A1 Biosynthesis Cysteine Metabolism LDHA Fatty Acid FASN Biosynthesis Glutamate GNB2L1 Receptor Signaling NRF2-mediated PRDX1 Oxidative Stress Response Pentose GPI Phosphate Pathway Pentose and UCHL1 Glucuronate Interconventions Retinol ALDH1A1 Metabolism Riboflavin TYR Metabolism Tyrosine PRMT5, TYR Metabolism Ubiquinone PRMT5 Biosynthesis Valine, ALDH1A1 Leucine and Isoleucine Degradation Glycine, Serine and CHKA Threonine Metabolism Lysine Degradation ALDH1A1 Pain/Taste TRPM5; TRPA1 Pain TRPM7; TRPC5; TRPC6; TRPC1; Cnr1; cnr2; Grk2; Trpa1; Pomc; Cgrp; Crf; Pka; Era; Nr2b; TRPM5; Prkaca; Prkacb; Prkar1a; Prkar2a Mitochondrial AIF; CytC; SMAC (Diablo); Aifm-1; Aifm-2 Function BMP-4; Chordin (Chrd); Noggin (Nog); Developmental WNT (Wnt2; Wnt2b; Wnt3a; Wnt4; Neurology Wnt5a; Wnt6; Wnt7b; Wnt8b; Wnt9a; Wnt9b; Wnt10a; Wnt10b; Wnt16); beta-catenin; Dkk-1; Frizzled related proteins; Otx-2; Gbx2; FGF-8; Reelin; Dab1; unc-86 (Pou4fl or Brn3a); Numb; Reln - Embodiments of the invention also relate to methods and compositions related to knocking out genes, amplifying genes and repairing particular mutations associated with DNA repeat instability and neurological disorders (Robert D. Wells, Tetsuo Ashizawa, Genetic Instabilities and Neurological Diseases, Second Edition, Academic Press, Oct. 13, 2011—Medical). Specific aspects of tandem repeat sequences have been found to be responsible for more than twenty human diseases (New insights into repeat instability: role of RNA•DNA hybrids. McIvor E I, Polak U, Napierala M. RNA Biol. 2010 September-October; 7(5):551-8). The CRISPR-Cas system may be harnessed to correct these defects of genomic instability.
- A further aspect of the invention relates to utilizing the CRISPR-Cas system for correcting defects in the EMP2A and EMP2B genes that have been identified to be associated with Lafora disease. Lafora disease is an autosomal recessive condition which is characterized by progressive myoclonus epilepsy which may start as epileptic seizures in adolescence. A few cases of the disease may be caused by mutations in genes yet to be identified. The disease causes seizures, muscle spasms, difficulty walking, dementia, and eventually death. There is currently no therapy that has proven effective against disease progression. Other genetic abnormalities associated with epilepsy may also be targeted by the CRISPR-Cas system and the underlying genetics is further described in Genetics of Epilepsy and Genetic Epilepsies, edited by Giuliano Avanzini, Jeffrey L. Noebels, Mariani Foundation Paediatric Neurology:20; 2009).
- In yet another aspect of the invention, the CRISPR-Cas system may be used to correct ocular defects that arise from several genetic mutations further described in Genetic Diseases of the Eye, Second Edition, edited by Elias I. Traboulsi, Oxford University Press, 2012.
- Several further aspects of the invention relate to correcting defects associated with a wide range of genetic diseases which are further described on the website of the National Institutes of Health under the topic subsection Genetic Disorders (website at health.nih.gov/topic/GeneticDisorders). The genetic brain diseases may include but are not limited to Adrenoleukodystrophy, Agenesis of the Corpus Callosum, Aicardi Syndrome, Alpers' Disease, Alzheimer's Disease, Barth Syndrome, Batten Disease, CADASIL, Cerebellar Degeneration, Fabry's Disease, Gerstmann-Straussler-Scheinker Disease, Huntington's Disease and other Triplet Repeat Disorders, Leigh's Disease, Lesch-Nyhan Syndrome, Menkes Disease, Mitochondrial Myopathies and NINDS Colpocephaly. These diseases are further described on the website of the National Institutes of Health under the subsection Genetic Brain Disorders.
- In some embodiments, the condition may be neoplasia. In some embodiments, where the condition is neoplasia, the genes to be targeted are any of those listed in Table A (in this case PTEN asn so forth). In some embodiments, the condition may be Age-related Macular Degeneration. In some embodiments, the condition may be a Schizophrenic Disorder. In some embodiments, the condition may be a Trinucleotide Repeat Disorder. In some embodiments, the condition may be Fragile X Syndrome. In some embodiments, the condition may be a Secretase Related Disorder. In some embodiments, the condition may be a Prion-related disorder. In some embodiments, the condition may be ALS. In some embodiments, the condition may be a drug addiction. In some embodiments, the condition may be Autism. In some embodiments, the condition may be Alzheimer's Disease. In some embodiments, the condition may be inflammation. In some embodiments, the condition may be Parkinson's Disease.
- Examples of proteins associated with Parkinson's disease include but are not limited to α-synuclein, DJ-1, LRRK2, PINK1, Parkin, UCHL1, Synphilin-1, and NURR1.
- Examples of addiction-related proteins may include ABAT for example.
- Examples of inflammation-related proteins may include the monocyte chemoattractant protein-1 (MCP1) encoded by the Ccr2 gene, the C-C chemokine receptor type 5 (CCR5) encoded by the Ccr5 gene, the IgG receptor IIB (FCGR2b, also termed CD32) encoded by the Fcgr2b gene, or the Fc epsilon R1g (FCER1g) protein encoded by the Fcer1g gene, for example.
- Examples of cardiovascular diseases associated proteins may include IL1B (
interleukin 1, beta), XDH (xanthine dehydrogenase), TP53 (tumor protein p53), PTGIS (prostaglandin I2 (prostacyclin) synthase), MB (myoglobin), IL4 (interleukin 4), ANGPT1 (angiopoietin 1), ABCG8 (ATP-binding cassette, sub-family G (WHITE), member 8), or CTSK (cathepsin K), for example. - Examples of Alzheimer's disease associated proteins may include the very low density lipoprotein receptor protein (VLDLR) encoded by the VLDLR gene, the ubiquitin-like modifier activating enzyme 1 (UBA1) encoded by the UBA1 gene, or the NEDD8-activating enzyme E1 catalytic subunit protein (UBE1C) encoded by the UBA3 gene, for example.
- Examples of proteins associated Autism Spectrum Disorder may include the benzodiazapine receptor (peripheral) associated protein 1 (BZRAP1) encoded by the BZRAP1 gene, the AF4/
FMR2 family member 2 protein (AFF2) encoded by the AFF2 gene (also termed MFR2), the fragile X mental retardationautosomal homolog 1 protein (FXR1) encoded by the FXR1 gene, or the fragile X mental retardationautosomal homolog 2 protein (FXR2) encoded by the FXR2 gene, for example. - Examples of proteins associated Macular Degeneration may include the ATP-binding cassette, sub-family A (ABC1)
member 4 protein (ABCA4) encoded by the ABCR gene, the apolipoprotein E protein (APOE) encoded by the APOE gene, or the chemokine (C-C motif)Ligand 2 protein (CCL2) encoded by the CCL2 gene, for example. - Examples of proteins associated Schizophrenia may include NRG1, ErbB4, CPLX1, TPH1, TPH2, NRXN1, GSK3A, BDNF,
DISC 1, GSK3B, and combinations thereof. - Examples of proteins involved in tumor suppression may include ATM (ataxia telangiectasia mutated), ATR (ataxia telangiectasia and Rad3 related), EGFR (epidermal growth factor receptor), ERBB2 (v-erb-b2 erythroblastic leukemia viral oncogene homolog 2), ERBB3 (v-erb-b2 erythroblastic leukemia viral oncogene homolog 3), ERBB4 (v-erb-b2 erythroblastic leukemia viral oncogene homolog 4),
Notch 1, Notch2,Notch 3, orNotch 4, for example. - Examples of proteins associated with a secretase disorder may include PSENEN (
presenilin enhancer 2 homolog (C. elegans)), CTSB (cathepsin B), PSEN1 (presenilin 1), APP (amyloid beta (A4) precursor protein), APH1B (anterior pharynx defective 1 homolog B (C. elegans)), PSEN2 (presenilin 2 (Alzheimer disease 4)), or BACE1 (beta-site APP-cleaving enzyme 1), for example. - Examples of proteins associated with Amyotrophic Lateral Sclerosis may include SOD1 (superoxide dismutase 1), ALS2 (amyotrophic lateral sclerosis 2), FUS (fused in sarcoma), TARDBP (TAR DNA binding protein), VAGFA (vascular endothelial growth factor A), VAGFB (vascular endothelial growth factor B), and VAGFC (vascular endothelial growth factor C), and any combination thereof.
- Examples of proteins associated with prion diseases may include SOD1 (superoxide dismutase 1), ALS2 (amyotrophic lateral sclerosis 2), FUS (fused in sarcoma), TARDBP (TAR DNA binding protein), VAGFA (vascular endothelial growth factor A), VAGFB (vascular endothelial growth factor B), and VAGFC (vascular endothelial growth factor C), and any combination thereof.
- Examples of proteins related to neurodegenerative conditions in prion disorders may include A2M (Alpha-2-Macroglobulin), AATF (Apoptosis antagonizing transcription factor), ACPP (Acid phosphatase prostate), ACTA2 (
Actin alpha 2 smooth muscle aorta), ADAM22 (ADAM metallopeptidase domain), ADORA3 (Adenosine A3 receptor), or ADRA1D (Alpha-1D adrenergic receptor for Alpha-1D adrenoreceptor), for example. - Examples of proteins associated with Immunodeficiency may include A2M [alpha-2-macroglobulin]; AANAT [arylalkylamine N-acetyltransferase]; ABCA1 [ATP-binding cassette, sub-family A (ABC1), member 1]; ABCA2 [ATP-binding cassette, sub-family A (ABC1), member 2]; or ABCA3 [ATP-binding cassette, sub-family A (ABC1), member 3]; for example.
- Examples of proteins associated with Trinucleotide Repeat Disorders include AR (androgen receptor), FMR1 (fragile X mental retardation 1), HTT (huntingtin), or DMPK (dystrophia myotonica-protein kinase), FXN (frataxin), ATXN2 (ataxin 2), for example.
- Examples of proteins associated with Neurotransmission Disorders include SST (somatostatin), NOS1 (nitric oxide synthase 1 (neuronal)), ADRA2A (adrenergic, alpha-2A-, receptor), ADRA2C (adrenergic, alpha-2C-, receptor), TACR1 (tachykinin receptor 1), or HTR2c (5-hydroxytryptamine (serotonin) receptor 2C), for example.
- Examples of neurodevelopmental-associated sequences include A2BPI [ataxin 2-binding protein 1], AADAT [aminoadipate aminotransferase], AANAT [arylalkylamine N-acetyltransferase], ABAT [4-aminobutyrate aminotransferase], ABCA1 [ATP-binding cassette, sub-family A (ABC1), member 1], or ABCA13 [ATP-binding cassette, sub-family A (ABC1), member 13], for example.
- Further examples of preferred conditions treatable with the present system include may be selected from: Aicardi-Goutières Syndrome; Alexander Disease; Allan-Herndon-Dudley Syndrome; POLG-Related Disorders; Alpha-Mannosidosis (Type II and III); Alström Syndrome; Angelman; Syndrome; Ataxia-Telangiectasia; Neuronal Ceroid-Lipofuscinoses; Beta-Thalassemia; Bilateral Optic Atrophy and (Infantile) Optic Atrophy Type 1; Retinoblastoma (bilateral); Canavan Disease; Cerebrooculofacioskeletal Syndrome 1 [COFS 1]; Cerebrotendinous Xanthomatosis; Cornelia de Lange Syndrome; MAPT-Related Disorders; Genetic Prion Diseases; Dravet Syndrome; Early-Onset Familial Alzheimer Disease; Friedreich Ataxia [FRDA]; Fryns Syndrome; Fucosidosis; Fukuyama Congenital Muscular Dystrophy; Galactosialidosis; Gaucher Disease; Organic Acidemias; Hemophagocytic Lymphohistiocytosis; Hutchinson-Gilford Progeria Syndrome; Mucolipidosis II; Infantile Free Sialic Acid Storage Disease; PLA2G6-Associated Neurodegeneration; Jervell and Lange-Nielsen Syndrome; Junctional Epidermolysis Bullosa; Huntington Disease; Krabbe Disease (Infantile); Mitochondrial DNA-Associated Leigh Syndrome and NARP; Lesch-Nyhan Syndrome; LIS1-Associated Lissencephaly; Lowe Syndrome; Maple Syrup Urine Disease; MECP2 Duplication Syndrome; ATP7A-Related Copper Transport Disorders; LAMA2-Related Muscular Dystrophy; Arylsulfatase A Deficiency; Mucopolysaccharidosis Types I, II or III; Peroxisome Biogenesis Disorders, Zellweger Syndrome Spectrum; Neurodegeneration with Brain Iron Accumulation Disorders; Acid Sphingomyelinase Deficiency; Niemann-Pick Disease Type C; Glycine Encephalopathy: ARX-Related Disorders; Urea Cycle Disorders: COL1A1/2-Related Osteogenesis Imperfecta; Mitochondrial DNA Deletion Syndromes; PLP1-Related Disorders; Perry Syndrome; Phelan-McDermid Syndrome; Glycogen Storage Disease Type II (Pompe Disease) (Infantile); MAPT-Related Disorders; MECP2-Related Disorders; Rhizomelic Chondrodysplasia Punctata Type 1; Roberts Syndrome; Sandhoff Disease; Schindler Disease-Type 1; Adenosine Deaminase Deficiency; Smith-Lemli-Opitz Syndrome; Spinal Muscular Atrophy; Infantile-Onset Spinocerebellar Ataxia; Hexosaminidase A Deficiency; Thanatophoric Dysplasia Type 1; Collagen Type VI-Related Disorders: Usher Syndrome Type I; Congenital Muscular Dystrophy; Wolf-Hirschhorn Syndrome; Lysosomal Acid Lipase Deficiency; and Xeroderma Pigmentosum.
- As will be apparent, it is envisaged that the present system can be used to target any polynucleotide sequence of interest. Some examples of conditions or diseases that might be usefully treated using the present system are included in the Tables above and examples of genes currently associated with those conditions are also provided there. However, the genes exemplified are not exhaustive.
- The following examples are given for the purpose of illustrating various embodiments of the invention and are not meant to limit the present invention in any fashion. The present examples, along with the methods described herein are presently representative of preferred embodiments, are exemplary, and are not intended as limitations on the scope of the invention. Changes therein and other uses which are encompassed within the spirit of the invention as defined by the scope of the claims will occur to those skilled in the art.
- An example type II CRISPR system is the type II CRISPR locus from Streptococcus pyogenes SF370, which contains a cluster of four genes Cas9, Cas1, Cas2, and Csn1, as well as two non-coding RNA elements, tracrRNA and a characteristic array of repetitive sequences (direct repeats) interspaced by short stretches of non-repetitive sequences (spacers, about 30 bp each). In this system, targeted DNA double-strand break (DSB) is generated in four sequential steps (
FIG. 2A ). First, two non-coding RNAs, the pre-crRNA array and tracrRNA, are transcribed from the CRISPR locus. Second, tracrRNA hybridizes to the direct repeats of pre-crRNA, which is then processed into mature crRNAs containing individual spacer sequences. Third, the mature crRNA:tracrRNA complex directs Cas9 to the DNA target consisting of the protospacer and the corresponding PAM via heteroduplex formation between the spacer region of the crRNA and the protospacer DNA. Finally, Cas9 mediates cleavage of target DNA upstream of PAM to create a DSB within the protospacer (FIG. 2A ). This example describes an example process for adapting this RNA-programmable nuclease system to direct CRISPR complex activity in the nuclei of eukaryotic cells. - Cell Culture and Transfection
- Human embryonic kidney (HEK) cell line HEK 293FT (Life Technologies) was maintained in Dulbecco's modified Eagle's Medium (DMEM) supplemented with 10% fetal bovine serum (HyClone), 2 mM GlutaMAX (Life Technologies), 100U/mL penicillin, and 100 μg/mL streptomycin at 37° C. with 5% CO2 incubation. Mouse neuro2A (N2A) cell line (ATCC) was maintained with DMEM supplemented with 5% fetal bovine serum (HyClone), 2 mM GlutaMAX (Life Technologies), 100U/mL penicillin, and 100 μg/mL streptomycin at 37° C. with 5% CO2.
- HEK 293FT or N2A cells were seeded into 24-well plates (Corning) one day prior to transfection at a density of 200,000 cells per well. Cells were transfected using Lipofectamine 2000 (Life Technologies) following the manufacturer's recommended protocol. For each well of a 24-well plate a total of 800 ng of plasmids were used.
- Surveyor Assay and Sequencing Analysis for Genome Modification
- HEK 293FT or N2A cells were transfected with plasmid DNA as described above. After transfection, the cells were incubated at 37° C. for 72 hours before genomic DNA extraction. Genomic DNA was extracted using the QuickExtract DNA extraction kit (Epicentre) following the manufacturer's protocol. Briefly, cells were resuspended in QuickExtract solution and incubated at 65° C. for 15 minutes and 98C for 10 minutes. Extracted genomic DNA was immediately processed or stored at −20° C.
- The genomic region surrounding a CRISPR target site for each gene was PCR amplified, and products were purified using QiaQuick Spin Column (Qiagen) following manufacturer's protocol. A total of 400ng of the purified PCR products were mixed with 2
μl 10× Taq polymerase PCR buffer (Enzymatics) and ultrapure water to a final volume of 20 μl, and subjected to a re-annealing process to enable heteroduplex formation: 95° C. for 10 min, 95° C. to 85° C. ramping at −2° C./s, 85° C. to 25° C. at −0.25° C./s, and 25° C. hold for 1 minute. After re-annealing, products were treated with Surveyor nuclease and Surveyor enhancer S (Transgenomics) following the manufacturer's recommended protocol, and analyzed on 4-20% Novex TBE poly-acrylamide gels (Life Technologies). Gels were stained with SYBR Gold DNA stain (Life Technologies) for 30 minutes and imaged with a Gel Doc gel imaging system (Bio-rad). Quantification was based on relative band intensities, as a measure of the fraction of cleaved DNA.FIG. 7 provides a schematic illustration of this Surveyor assay. - Restriction fragment length polymorphism assay for detection of homologous recombination.
- HEK 293FT and N2A cells were transfected with plasmid DNA, and incubated at 37° C. for 72 hours before genomic DNA extraction as described above. The target genomic region was PCR amplified using primers outside the homology arms of the homologous recombination (HR) template. PCR products were separated on a 1% agarose gel and extracted with MinElute GelExtraction Kit (Qiagen). Purified products were digested with HindIII (Fermentas) and analyzed on a 6% Novex TBE poly-acrylamide gel (Life Technologies).
- RNA Secondary Structure Prediction and Analysis
- RNA secondary structure prediction was performed using the online webserver RNAfold developed at Institute for Theoretical Chemistry at the University of Vienna, using the centroid structure prediction algorithm (see e.g. A. R. Gruber et al., 2008, Cell 106(1): 23-24; and P A Carr and G M Church, 2009, Nature Biotechnology 27(12): 1151-62).
- RNA Purification
- HEK 293FT cells were maintained and transfected as stated above. Cells were harvested by trypsinization followed by washing in phosphate buffered saline (PBS). Total cell RNA was extracted with TRI reagent (Sigma) following manufacturer's protocol. Extracted total RNA was quantified using Naonodrop (Thermo Scientific) and normalized to same concentration.
- Northern Blot Analysis of crRN4 and tracrRNA Expression in Mammalian Cells
- RNAs were mixed with equal volumes of 2× loading buffer (Ambion), heated to 95° C. for 5 min, chilled on ice for 1 min, and then loaded onto 8% denaturing polyacrylamide gels (SequaGel, National Diagnostics) after pre-running the gel for at least 30 minutes. The samples were electrophoresed for 1.5 hours at 40 W limit. Afterwards, the RNA was transferred to Hybond N+ membrane (GE Healthcare) at 300 mA in a semi-dry transfer apparatus (Bio-rad) at room temperature for 1.5 hours. The RNA was crosslinked to the membrane using autocrosslink button on Stratagene UV Crosslinker the Stratalinker (Stratagene). The membrane was pre-hybridized in ULTRAhyb-Oligo Hybridization Buffer (Ambion) for 30 min with rotation at 42° C., and probes were then added and hybridized overnight. Probes were ordered from IDT and labeled with [gamma-32P] ATP (Perkin Elmer) with T4 polynucleotide kinase (New England Biolabs). The membrane was washed once with pre-warmed (42° C.) 2×SSC, 0.5% SDS for 1 min followed by two 30 minute washes at 42° C. The membrane was exposed to a phosphor screen for one hour or overnight at room temperature and then scanned with a phosphorimager (Typhoon).
- Bacterial CRISPR System Construction and Evaluation
- CRISPR locus elements, including tracrRNA, Cas9, and leader were PCR amplified from Streptococcus pyogenes SF370 genomic DNA with flanking homology arms for Gibson Assembly. Two BsaI type IIS sites were introduced in between two direct repeats to facilitate easy insertion of spacers (
FIG. 8 ). PCR products were cloned into EcoRV-digested pACYC 184 downstream of the tet promoter using Gibson Assembly Master Mix (NEB). Other endogenous CRISPR system elements were omitted, with the exception of the last 50 bp of Csn2. Oligos (Integrated DNA Technology) encoding spacers with complimentary overhangs were cloned into the BsaI-digested vector pDC000 (NEB) and then ligated with T7 ligase (Enzymatics) to generate pCRISPR plasmids. Challenge plasmids containing spacers with PAM - expression in mammalian cells (expression constructs illustrated in
FIG. 6A , with functionality as determined by results of the Surveyor assay shown inFIG. 6B ). Transcription start sites are marked as +1, and transcription terminator and the sequence probed by northern blot are also indicated. Expression of processed tracrRNA was also confirmed by Northern blot.FIG. 6C shows results of a Northern blot analysis of total RNA extracted from 293FT cells transfected with U6 expression constructs carrying long or short tracrRNA, as well as SpCas9 and DR-EMX1(1)-DR. Left and right panels are from 293FT cells transfected without or with SpRNase III, respectively. U6 indicate loading control blotted with a probe targeting human U6 snRNA. Transfection of the short tracrRNA expression construct led to abundant levels of the processed form of tracrRNA (˜75 bp). Very low amounts of long tracrRNA are detected on the Northern blot. - To promote precise transcriptional initiation, the RNA polymerase III-based U6 promoter was selected to drive the expression of tracrRNA (
FIG. 2C ). Similarly, a U6 promoter-based construct was developed to express a pre-crRNA array consisting of a single spacer flanked by two direct repeats (DRs, also encompassed by the term “tracr-mate sequences”;FIG. 2C ). The initial spacer was designed to target a 33-base-pair (bp) target site (30-bp protospacer plus a 3-bp CRISPR motif (PAM) sequence satisfying the NGG recognition motif of Cas9) in the human EMX1 locus (FIG. 2C ), a key gene in the development of the cerebral cortex. - To test whether heterologous expression of the CRISPR system (SpCas9, SpRNase III, tracrRNA, and pre-crRNA) in mammalian cells can achieve targeted cleavage of mammalian chromosomes, HEK 293FT cells were transfected with combinations of CRISPR components. Since DSBs in mammalian nuclei are partially repaired by the non-homologous end joining (NHEJ) pathway, which leads to the formation of indels, the Surveyor assay was used to detect potential cleavage activity at the target EMX1 locus (
FIG. 7 ) (see e.g. Guschin et al., 2010, Methods Mol Biol 649: 247). Co-transfection of all four CRISPR components was able to induce up to 5.0% cleavage in the protospacer (seeFIG. 2D ). Co-transfection of all CRISPR components minus SpRNase III also induced up to 4.7% indel in the protospacer, suggesting that there may be endogenous mammalian RNases that are capable of assisting with crRNA maturation, such as for example the related Dicer and Drosha enzymes. Removing any of the remaining three components abolished the genome cleavage activity of the CRISPR system (FIG. 2D ). Sanger sequencing of amplicons containing the target locus verified the cleavage activity: in 43 sequenced clones, 5 mutated alleles (11.6%) were found. Similar experiments using a variety of guide sequences produced indel percentages as high as 29% (seeFIGS. 3-6 , 10, and 11). These results define a three-component system for efficient CRISPR-mediated genome modification in mammalian cells. To optimize the cleavage efficiency, Applicants also tested whether different isoforms of tracrRNA affected the cleavage efficiency and found that, in this example system, only the short (89-bp) transcript form was able to mediate cleavage of the human EMX1 genomic locus (FIG. 6B ). -
FIG. 12 provides an additional Northern blot analysis of crRNA processing in mammalian cells.FIG. 12A illustrates a schematic showing the expression vector for a single spacer flanked by two direct repeats (DR-EMX1(1)-DR). The 30 bp spacer targeting the human EMX1 locus protospacer 1 (seeFIG. 6 ) and the direct repeat sequences are shown in the sequence beneathFIG. 12A . The line indicates the region whose reverse-complement sequence was used to generate Northern blot probes for EMX1(1) crRNA detection.FIG. 12B shows a Northern blot analysis of total RNA extracted from 293FT cells transfected with U6 expression constructs carrying DR-EMX1(1)-DR. Left and right panels are from 293FT cells transfected without or with SpRNase III respectively. DR-EMX1(1)-DR was processed into mature crRNAs only in the presence of SpCas9 and short tracrRNA and was not dependent on the presence of SpRNase III. The mature crRNA detected from transfected 293FT total RNA is ˜33 bp and is shorter than the 39-42 bp mature crRNA from S. pyogenes. These results demonstrate that a CRISPR system can be transplanted into eukaryotic cells and reprogrammed to facilitate cleavage of endogenous mammalian target polynucleotides. -
FIG. 2 illustrates the bacterial CRISPR system described in this example.FIG. 2A illustrates a schematic showing theCRISPR locus 1 from Streptococcus pyogenes SF370 and a proposed mechanism of CRISPR-mediated DNA cleavage by this system. Mature crRNA processed from the direct repeat-spacer array directs Cas9 to genomic targets consisting of complimentary protospacers and a protospacer-adjacent motif (PAM). Upon target-spacer base pairing, Cas9 mediates a double-strand break in the target DNA.FIG. 2B illustrates engineering of S. pyogenes Cas9 (SpCas9) and RNase III (SpRNase III) with nuclear localization signals (NLSs) to enable import into the mammalian nucleus.FIG. 2C illustrates mammalian expression of SpCas9 and SpRNase III driven by the constitutive EF1a promoter and tracrRNA and pre-crRNA array (DR-Spacer-DR) driven by the RNA Pol3 promoter U6 to promote precise transcription initiation and termination. A protospacer from the human EMX1 locus with a satisfactory PAM sequence is used as the spacer in the pre-crRNA array.FIG. 2D illustrates surveyor nuclease assay for SpCas9-mediated minor insertions and deletions. SpCas9 was expressed with and without SpRNase III, tracrRNA, and a pre-crRNA array carrying the EMX1-target spacer.FIG. 2E illustrates a schematic representation of base pairing between target locus and EMX1-targeting crRNA, as well as an example chromatogram showing a micro deletion adjacent to the SpCas9 cleavage site.FIG. 2F illustrates mutated alleles identified from sequencing analysis of 43 clonal amplicons showing a variety of micro insertions and deletions. Dashes indicate deleted bases, and non-aligned or mismatched bases indicate insertions or mutations. Scale bar=10 μm. - To further simplify the three-component system, a chimeric crRNA-tracrRNA hybrid design was adapted, where a mature crRNA (comprising a guide sequence) may be fused to a partial tracrRNA via a stem-loop to mimic the natural crRNA:tracrRNA duplex. To increase co-delivery efficiency, a bicistronic expression vector was created to drive co-expression of a chimeric RNA and SpCas9 in transfected cells. In parallel, the bicistronic vectors were used to express a pre-crRNA (DR-guide sequence-DR) with SpCas9, to induce processing into crRNA with a separately expressed tracrRNA (compare
FIG. 11B top and bottom).FIG. 8 provides schematic illustrations of bicistronic expression vectors for pre-crRNA array (FIG. 8A ) or chimeric crRNA (represented by the short line downstream of the guide sequence insertion site and upstream of the EF1α promoter inFIG. 8B ) with hSpCas9, showing location of various elements and the point of guide sequence insertion. The expanded sequence around the location of the guide sequence insertion site inFIG. 8B also shows a partial DR sequence (GTTTTAGAGCTA) (SEQ ID NO: 11) and a partial tracrRNA sequence (TAGCAAGTTAAAATAAGGCTAGTCCGTTTTT) (SEQ ID NO: 12). Guide sequences can be inserted between BbsI sites using annealed oligonucleotides. Sequence design for the oligonucleotides are shown below the schematic illustrations inFIG. 8 , with appropriate ligation adapters indicated. WPRE represents the Woodchuck hepatitis virus post-transcriptional regulatory element. The efficiency of chimeric RNA-mediated cleavage was tested by targeting the same EMX1 locus described above. Using both Surveyor assay and Sanger sequencing of amplicons, Applicants confirmed that the chimeric RNA design facilitates cleavage of human EMX1 locus with approximately a 4.7% modification rate (FIG. 3 ). - Generalizability of CRISPR-mediated cleavage in eukaryotic cells was tested by targeting additional genomic loci in both human and mouse cells by designing chimeric RNA targeting multiple sites in the human EMX1 and PVALB, as well as the mouse Th loci.
FIG. 13 illustrates the selection of some additional targeted protospacers in human PVALB (FIG. 13A ) and mouse Th (FIG. 13B ) loci. Schematics of the gene loci and the location of three protospacers within the last exon of each are provided. The underlined sequences include 30 bp of protospacer sequence and 3 bp at the 3′ end corresponding to the PAM sequences. Protospacers on the sense and anti-sense strands are indicated above and below the DNA sequences, respectively. A modification rate of 6.3% and 0.75% was achieved for the human PVALB and mouse Th loci respectively, demonstrating the broad applicability of the CRISPR system in modifying different loci across multiple organisms (FIG. 5 ). While cleavage was only detected with one out of three spacers for each locus using the chimeric constructs, all target sequences were cleaved with efficiency of indel production reaching 27% when using the co-expressed pre-crRNA arrangement (FIGS. 6 and 13 ). -
FIG. 11 provides a further illustration that SpCas9 can be reprogrammed to target multiple genomic loci in mammalian cells.FIG. 11A provides a schematic of the human EMX1 locus showing the location of five protospacers, indicated by the underlined sequences.FIG. 11B provides a schematic of the pre-crRNA/trcrRNA complex showing hybridization between the direct repeat region of the pre-crRNA and tracrRNA (top), and a schematic of a chimeric RNA design comprising a 20 bp guide sequence, and tracr mate and tracr sequences consisting of partial direct repeat and tracrRNA sequences hybridized in a hairpin structure (bottom). Results of a Surveyor assay comparing the efficacy of Cas9-mediated cleavage at five protospacers in the human EMX1 locus is illustrated inFIG. 11C . Each protospacer is targeted using either processed pre-crRNA/tracrRNA complex (crRNA) or chimeric RNA (chiRNA). - Since the secondary structure of RNA can be crucial for intermolecular interactions, a structure prediction algorithm based on minimum free energy and Boltzmann-weighted structure ensemble was used to compare the putative secondary structure of all guide sequences used in the genome targeting experiment (see e.g. Gruber et al., 2008, Nucleic Acids Research, 36: W70). Analysis revealed that in most cases, the effective guide sequences in the chimeric crRNA context were substantially free of secondary structure motifs, whereas the ineffective guide sequences were more likely to form internal secondary structures that could prevent base pairing with the target protospacer DNA. It is thus possible that variability in the spacer secondary structure might impact the efficiency of CRISPR-mediated interference when using a chimeric crRNA.
- Further vector designs for SpCas9 are shown in
FIG. 22 , which illustrates single expression vectors incorporating a U6 promoter linked to an insertion site for a guide oligo, and a Cbh promoter linked to SpCas9 coding sequence. The vector shown inFIG. 22 b includes a tracrRNA coding sequence linked to an H1 promoter. - In the bacterial assay, all spacers facilitated efficient CRISPR interference (
FIG. 3C ). These results suggest that there may be additional factors affecting the efficiency of CRISPR activity in mammalian cells. - To investigate the specificity of CRISPR-mediated cleavage, the effect of single-nucleotide mutations in the guide sequence on protospacer cleavage in the mammalian genome was analyzed using a series of EMX1-targeting chimeric crRNAs with single point mutations (
FIG. 3A ).FIG. 3B illustrates results of a Surveyor nuclease assay comparing the cleavage efficiency of Cas9 when paired with different mutant chimeric RNAs. Single-base mismatch up to 12-bp 5′ of the PAM substantially abrogated genomic cleavage by SpCas9, whereas spacers with mutations at farther upstream positions retained activity against the original protospacer target (FIG. 3B ). In addition to the PAM, SpCas9 has single-base specificity within the last 12-bp of the spacer. Furthermore, CRISPR is able to mediate genomic cleavage as efficiently as a pair of TALE nucleases (TALEN) targeting the same EMX1 protospacer.FIG. 3C provides a schematic showing the design of TALENs targeting EMX1, andFIG. 3D shows a Surveyor gel comparing the efficiency of TALEN and Cas9 (n=3). - Having established a set of components for achieving CRISPR-mediated gene editing in mammalian cells through the error-prone NHEJ mechanism, the ability of CRISPR to stimulate homologous recombination (HR), a high fidelity gene repair pathway for making precise edits in the genome, was tested. The wild type SpCas9 is able to mediate site-specific DSBs, which can be repaired through both NHEJ and HR. In addition, an aspartate-to-alanine substitution (D10A) in the RuvC I catalytic domain of SpCas9 was engineered to convert the nuclease into a nickase (SpCas9n; illustrated in
FIG. 4A ) (see e.g. Sapranausaks et al., 2011, Nucleic Acids Research, 39: 9275; Gasiunas et al., 2012, Proc. Natl. Acad. Sci. USA, 109:E2579), such that nicked genomic DNA undergoes the high-fidelity homology-directed repair (HDR). Surveyor assay confirmed that SpCas9n does not generate indels at the EMX1 protospacer target. As illustrated inFIG. 4B , co-expression of EMX1-targeting chimeric crRNA with SpCas9 produced indels in the target site, whereas co-expression with SpCas9n did not (n=3). Moreover, sequencing of 327 amplicons did not detect any indels induced by SpCas9n. The same locus was selected to test CRISPR-mediated HR by co-transfecting HEK 293FT cells with the chimeric RNA targeting EMX1, hSpCas9 or hSpCas9n, as well as a HR template to introduce a pair of restriction sites (HindIII and NheI) near the protospacer.FIG. 4C provides a schematic illustration of the HR strategy, with relative locations of recombination points and primer annealing sequences (arrows). SpCas9 and SpCas9n indeed catalyzed integration of the HR template into the EMX1 locus. PCR amplification of the target region followed by restriction digest with HindIII revealed cleavage products corresponding to expected fragment sizes (arrows in restriction fragment length polymorphism gel analysis shown inFIG. 4D ), with SpCas9 and SpCas9n mediating similar levels of HR efficiencies. Applicants further verified HR using Sanger sequencing of genomic amplicons (FIG. 4E ). These results demonstrate the utility of CRISPR for facilitating targeted gene insertion in the mammalian genome. Given the 14-bp (12-bp from the spacer and 2-bp from the PAM) target specificity of the wild type SpCas9, the availability of a nickase can significantly reduce the likelihood of off-target modifications, since single strand breaks are not substrates for the error-prone NHEJ pathway. - Expression constructs mimicking the natural architecture of CRISPR loci with arrayed spacers (
FIG. 2A ) were constructed to test the possibility of multiplexed sequence targeting. Using a single CRISPR array encoding a pair of EMX1- and PVALB-targeting spacers, efficient cleavage at both loci was detected (FIG. 4F , showing both a schematic design of the crRNA array and a Surveyor blot showing efficient mediation of cleavage). Targeted deletion of larger genomic regions through concurrent DSBs using spacers against two targets within EMX1 spaced by 119 bp was also tested, and a 1.6% deletion efficacy (3 out of 182 amplicons;FIG. 4G ) was detected. This demonstrates that the CRISPR system can mediate multiplexed editing within a single genome. - The ability to use RNA to program sequence-specific DNA cleavage defines a new class of genome engineering tools for a variety of research and industrial applications. Several aspects of the CRISPR system can be further improved to increase the efficiency and versatility of CRISPR targeting. Optimal Cas9 activity may depend on the availability of free Mg2+ at levels higher than that present in the mammalian nucleus (see e.g. Jinek et al., 2012, Science, 337:816), and the preference for an NGG motif immediately downstream of the protospacer restricts the ability to target on average every 12-bp in the human genome (
FIG. 9 , evaluating both plus and minus strands of human chromosomal sequences). Some of these constraints can be overcome by exploring the diversity of CRISPR loci across the microbial metagenome (see e.g. Makarova et al., 2011, Nat Rev Microbiol, 9:467). Other CRISPR loci may be transplanted into the mammalian cellular milieu by a process similar to that described in Example 1. For example,FIG. 10 illustrates adaptation of the Type II CRISPR system fromCRISPR 1 of Streptococcus thermophilus LMD-9 for heterologous expression in mammalian cells to achieve CRISPR-mediated genome editing.FIG. 10A provides a Schematic illustration ofCRISPR 1 from S. thermophilus LMD-9.FIG. 10B illustrates the design of an expression system for the S. thermophilus CRISPR system. Human codon-optimized hStCas9 is expressed using a constitutive EF1α promoter. Mature versions of tracrRNA and crRNA are expressed using the U6 promoter to promote precise transcription initiation. Sequences from the mature crRNA and tracrRNA are illustrated. A single base indicated by the lower case “a” in the crRNA sequence is used to remove the polyU sequence, which serves as a RNA polIII transcriptional terminator.FIG. 10C provides a schematic showing guide sequences targeting the human EMX1 locus.FIG. 10D shows the results of hStCas9-mediated cleavage in the target locus using the Surveyor assay.RNA guide spacers FIG. 5 .FIG. 14 provides a schematic of additional protospacer and corresponding PAM sequence targets of the S. thermophilus CRISPR system in the human EMX1 locus. Two protospacer sequences are highlighted and their corresponding PAM sequences satisfying NNAGAAW motif are indicated by underlining 3′ with respect to the corresponding highlighted sequence. Both protospacers target the anti-sense strand. - A software program is designed to identify candidate CRISPR target sequences on both strands of an input DNA sequence based on desired guide sequence length and a CRISPR motif sequence (PAM) for a specified CRISPR enzyme. For example, target sites for Cas9 from S. pyogenes, with PAM sequences NGG, may be identified by searching for 5′-N-NGG-3′ both on the input sequence and on the reverse-complement of the input. Likewise, target sites for Cas9 of S. thermophilus CRISPR1, with PAM sequence NNAGAAW, may be identified by searching for 5′-Nx-NNAGAAW-3′ both on the input sequence and on the reverse-complement of the input. Likewise, target sites for Cas9 of S. thermophilus CRISPR3, with PAM sequence NGGNG, may be identified by searching for 5′-Nx-NGGNG-3′ both on the input sequence and on the reverse-complement of the input. The value “x” in Nx may be fixed by the program or specified by the user, such as 20.
- Since multiple occurrences in the genome of the DNA target site may lead to nonspecific genome editing, after identifying all potential sites, the program filters out sequences based on the number of times they appear in the relevant reference genome. For those CRISPR enzymes for which sequence specificity is determined by a ‘seed’ sequence, such as the 11-12
bp 5′ from the PAM sequence, including the PAM sequence itself, the filtering step may be based on the seed sequence. Thus, to avoid editing at additional genomic loci, results are filtered based on the number of occurrences of the seed:PAM sequence in the relevant genome. The user may be allowed to choose the length of the seed sequence. The user may also be allowed to specify the number of occurrences of the seed:PAM sequence in a genome for purposes of passing the filter. The default is to screen for unique sequences. Filtration level is altered by changing both the length of the seed sequence and the number of occurrences of the sequence in the genome. The program may in addition or alternatively provide the sequence of a guide sequence complementary to the reported target sequence(s) by providing the reverse complement of the identified target sequence(s). An example visualization of some target sites in the human genome is provided inFIG. 18 . - Further details of methods and algorithms to optimize sequence selection can be found in U.S. application Ser. No. 61/064,798 (Attorney docket 44790.11.2022; Broad Reference BI-2012/084); incorporated herein by reference.
- This example describes results obtained for chimeric RNAs (chiRNAs; comprising a guide sequence, a tracr mate sequence, and a tracr sequence in a single transcript) having tracr sequences that incorporate different lengths of wild-type tracrRNA sequence.
FIG. 16 a illustrates a schematic of a bicistronic expression vector for chimeric RNA and Cas9. Cas9 is driven by the CBh promoter and the chimeric RNA is driven by a U6 promoter. The chimeric guide RNA consists of a 20 bp guide sequence (Ns) joined to the tracr sequence (running from the first “U” of the lower strand to the end of the transcript), which is truncated at various positions as indicated. The guide and tracr sequences are separated by the tracr-mate sequence GUUUUAGAGCUA (SEQ ID NO: 13) followed by the loop sequence GAAA. Results of SURVEYOR assays for Cas9-mediated indels at the human EMX1 and PVALB loci are illustrated inFIGS. 16 b and 16 c, respectively. Arrows indicate the expected SURVEYOR fragments. ChiRNAs are indicated by their “+n” designation, and crRNA refers to a hybrid RNA where guide and tracr sequences are expressed as separate transcripts. Quantification of these results, performed in triplicate, are illustrated by histogram inFIGS. 17 a and 17 b, corresponding toFIGS. 16 b and 16 c, respectively (“N.D.” indicates no indels detected). Protospacer IDs and their corresponding genomic target, protospacer sequence, PAM sequence, and strand location are provided in Table D. Guide sequences were designed to be complementary to the entire protospacer sequence in the case of separate transcripts in the hybrid system, or only to the underlined portion in the case of chimeric RNAs. -
TABLE D proto- protospacer SEQ spac- genomic sequence ID er ID target (5′ to 3′) PAM NO: strand 1 EMX1 GGACATCGATGTCACCT TGG 14 + CCAATGACTAGGG 2 EMX1 CATTGGAGGTGACATCG TGG 15 − ATGTCCTCCCCAT 3 EXM1 GGAAGGGCCTGAGTCCG GGG 16 + AGCAGAAGAAGAA 4 PVALB GGTGGCGAGAGGGGCCG AGG 17 + AGATTGGGTGTTC 5 PVALB ATGCAGGAGGGTGGCGA TGG 18 + GAGGGGCCGAGAT - Further details to optimize guide sequences can be found in U.S. application Ser. No. 61/836,127 (Attorney docket 44790.08.2022; Broad Reference BI-2013/004G); incorporated herein by reference.
- Initially, three sites within the EMX1 locus in human HEK 293FT cells were targeted. Genome modification efficiency of each chiRNA was assessed using the SURVEYOR nuclease assay, which detects mutations resulting from DNA double-strand breaks (DSBs) and their subsequent repair by the non-homologous end joining (NHEJ) DNA damage repair pathway. Constructs designated chiRNA(+n) indicate that up to the +n nucleotide of wild-type tracrRNA is included in the chimeric RNA construct, with values of 48, 54, 67, and 85 used for n. Chimeric RNAs containing longer fragments of wild-type tracrRNA (chiRNA(+67) and chiRNA(+85)) mediated DNA cleavage at all three EMX1 target sites, with chiRNA(+85) in particular demonstrating significantly higher levels of DNA cleavage than the corresponding crRNA/tracrRNA hybrids that expressed guide and tracr sequences in separate transcripts (
FIGS. 16 b and 17 a). Two sites in the PVALB locus that yielded no detectable cleavage using the hybrid system (guide sequence and tracr sequence expressed as separate transcripts) were also targeted using chiRNAs. chiRNA(+67) and chiRNA(+85) were able to mediate significant cleavage at the two PVALB protospacers (FIGS. 16 c and 17 b). - For all five targets in the EMX1 and PVALB loci, a consistent increase in genome modification efficiency with increasing tracr sequence length was observed. Without wishing to be bound by any theory, the secondary structure formed by the 3′ end of the tracrRNA may play a role in enhancing the rate of CRISPR complex formation.
- The CRISPR-Cas system is an adaptive immune mechanism against invading exogenous DNA employed by diverse species across bacteria and archaea. The type II CRISPR-Cas9 system consists of a set of genes encoding proteins responsible for the “acquisition” of foreign DNA into the CRISPR locus, as well as a set of genes encoding the “execution” of the DNA cleavage mechanism; these include the DNA nuclease (Cas9), a non-coding transactivating cr-RNA (tracrRNA), and an array of foreign DNA-derived spacers flanked by direct repeats (crRNAs). Upon maturation by Cas9, the tracRNA and crRNA duplex guide the Cas9 nuclease to a target DNA sequence specified by the spacer guide sequences, and mediates double-stranded breaks in the DNA near a short sequence motif in the target DNA that is required for cleavage and specific to each CRISPR-Cas system. The type II CRISPR-Cas systems are found throughout the bacterial kingdom and highly diverse in in Cas9 protein sequence and size, tracrRNA and crRNA direct repeat sequence, genome organization of these elements, and the motif requirement for target cleavage. One species may have multiple distinct CRISPR-Cas systems.
- Applicants evaluated 207 putative Cas9s from bacterial species identified based on sequence homology to known Cas9s and structures orthologous to known subdomains, including the HNH endonuclease domain and the RuvC endonuclease domains [information from the Eugene Koonin and Kira Makarova]. Phylogenetic analysis based on the protein sequence conservation of this set revealed five families of Cas9s, including three groups of large Cas9s (˜1400 amino acids) and two of small Cas9s (˜1100 amino acids) (see FIGS. 19 and 20A-F).
- Further details of Cas9s and mutations of the Cas9 enzyme to convert into a nickase or DNA binding protein and use of same with altered functionality can be found in U.S. application Ser. Nos. 61/836,101 and 61/835,936 (Attorney docket 44790.09.2022 and 4790.07.2022 and Broad Reference BI-2013/004E and BI-2013/004F respectively) incorporated herein by reference.
- Applicants analyzed Cas9 orthologs to identify the relevant PAM sequences and the corresponding chimeric guide RNA. Having an expanded set of PAMs provides broader targeting across the genome and also significantly increases the number of unique target sites and provides potential for identifying novel Cas9s with increased levels of specificity in the genome.
- The specificity of Cas9 orthologs can be evaluated by testing the ability of each Cas9 to tolerate mismatches between the guide RNA and its DNA target. For example, the specificity of SpCas9 has been characterized by testing the effect of mutations in the guide RNA on cleavage efficiency. Libraries of guide RNAs were made with single or multiple mismatches between the guide sequence and the target DNA. Based on these findings, target sites for SpCas9 can be selected based on the following guidelines:
- To maximize SpCas9 specificity for editing a particular gene, one should choose a target site within the locus of interest such that potential ‘off-target’ genomic sequences abide by the following four constraints: First and foremost, they should not be followed by a PAM with either 5′-NGG or NAG sequences. Second, their global sequence similarity to the target sequence should be minimized. Third, a maximal number of mismatches should lie within the PAM-proximal region of the off-target site. Finally, a maximal number of mismatches should be consecutive or spaced less than four bases apart.
- Similar methods can be used to evaluate the specificity of other Cas9 orthologs and to establish criteria for the selection of specific target sites within the genomes of target species. As mentioned previously phylogenetic analysis based on the protein sequence conservation of this set revealed five families of Cas9s, including three groups of large Cas9s (˜1400 amino acids) and two of small Cas9s (˜1100 amino acids) (see FIGS. 19 and 20A-F). Further details on Cas orthologs can be found in U.S.
application Serial Nos 61/836,101 and 61/835,936 (Attorney docket 44790.09.2022 and 4790.07.2022 and Broad Reference BI-2013/004E and BI-2013/004F respectively) incorporated herein by reference. - Methods of Delivering Cas9
- Method 1: Applicants deliver Cas9 and guide RNA using a vector that expresses Cas9 under the control of a constitutive promoter such as Hsp70A-Rbc S2 or Beta2-tubulin.
- Method 2: Applicants deliver Cas9 and T7 polymerase using vectors that expresses Cas9 and T7 polymerase under the control of a constitutive promoter such as Hsp70A-Rbe S2 or Beta2-tubulin. Guide RNA will be delivered using a vector containing T7 promoter driving the guide RNA.
- Method 3: Applicants deliver Cas9 mRNA and in vitro transcribed guide RNA to algae cells. RNA can be in vitro transcribed. Cas9 mRNA will consist of the coding region for Cas9 as well as 3′UTR from Cop1 to ensure stabilization of the Cas9 mRNA.
- For Homologous recombination, Applicants provide an additional homology directed repair template.
- Sequence for a cassette driving the expression of Cas9 under the control of beta-2 tubulin promoter, followed by the 3′ UTR of Cop1.
-
(SEQ ID NO: 19) TCTTTCTTGCGCTATGACACTTCCAGCAAAAGGTAGGGCGGGCTGCGAGACGGCTTCCC GGCGCTGCATGCAACACCGATGATGCTTCGACCCCCCGAAGCTCCTTCGGG GCTGCATGGGCGCTCCGATGCCGCTCCAGGGCGAGCGCTGTTTAAATAGCCAG GCCCCCGATTGCAAAGACATTATAGCGAGCTACCAAAGCCATATTCAAACACCTAG ATCACTACCACTTCTACACAGGCCACTCGAGCTTGTGATCGCACTCCGCTAAGGGGG CGCCTCTTCCTCTTCGTTTCAGTCACAACCCGCAAACATGTACCCATACGATGTTCCA GATTACGCTTCGCCGAAGAAAAAGCGCAAGGTCGAAGCGTCCGACAAGAAGTACAG CATCGGCCTGGACATCGGCACCAACTCTGTGGGCTGGGCCGTGATCACCGACGAGT ACAAGGTGCCCAGCAAGAAATTCAAGGTGCTGGGCAACACCGACCGGCACAGCATC AAGAAGAACCTGATCGGAGCCCTGCTGTTCGACAGCGGCGAAACAGCCGAGGCCAC CCGGCTGAAGAGAACCGCCAGAAGAAGATACACCAGACGGAAGAACCGGATCTGC TATCTGCAAGAGATCTTCAGCAACGAGATGGCCAAGGTGGACGACAGCTTCTTCCAC AGACTGGAAGAGTCCTTCCTGGTGGAAGAGGATAAGAAGCACGAGCGGCACCCCAT CTTCGGCAACATCGTGGACGAGGTGGCCTACCACGAGAAGTACCCCACCATCTACC ACCTGAGAAAGAAACTGGTGGACAGCACCGACAAGGCCGACCTGCGGCTGATCTAT CTGGCCCTGGCCCACATGATCAAGTTCCGGGGCCACTTCCTGATCGAGGGCGACCTG AACCCCGACAACAGCGACGTGGACAAGCTGTTCATCCAGCTGGTGCAGACCTACAA CCAGCTGTTCGAGGAAAACCCCATCAACGCCAGCGGCGTGGACGCCAAGGCCATCC TGTCTGCCAGACTGAGCAAGAGCAGACGGCTGGAAAATCTGATCGCCCAGCTGCCC GGCGAGAAGAAGAATGGCCTGTTCGGCAACCTGATTGCCCTGAGCCTGGGCCTGAC CCCCAACTTCAAGAGCAACTTCGACCTGGCCGAGGATGCCAAACTGCAGCTGAGCA AGGACACCTACGACGACGACCTGGACAACCTGCTGGCCCAGATCGGCGACCAGTAC GCCGACCTGTTTCTGGCCGCCAAGAACCTGTCCGACGCCATCCTGCTGAGCGACATC CTGAGAGTGAACACCGAGATCACCAAGGCCCCCCTGAGCGCCTCTATGATCAAGAG ATACGACGAGCACCACCAGGACCTGACCCTGCTGAAAGCTCTCGTGCGGCAGCAGC TGCCTGAGAAGTACAAAGAGATTTTCTTCGACCAGAGCAAGAACGGCTACGCCGGC TACATTGACGGCGGAGCCAGCCAGGAAGAGTTCTACAAGTTCATCAAGCCCATCCT GGAAAAGATGGACGGCACCGAGGAACTGCTCGTGAAGCTGAACAGAGAGGACCTG CTGCGGAAGCAGCGGACCTTCGACAACGGCAGCATCCCCCACCAGATCCACCTGGG AGAGCTGCACGCCATTCTGCGGCGGCAGGAAGATTTTTACCCATTCCTGAAGGACAA CCGGGAAAAGATCGAGAAGATCCTGACCTTCCGCATCCCCTACTACGTGGGCCCTCT GGCCAGGGGAAACAGCAGATTCGCCTGGATGACCAGAAAGAGCGAGGAAACCATC ACCCCCTGGAACTTCGAGGAAGTGGTGGACAAGGGCGCTTCCGCCCAGAGCTTCAT CGAGCGGATGACCAACTTCGATAAGAACCTGCCCAACGAGAAGGTGCTGCCCAAGC ACAGCCTGCTGTACGAGTACTTCACCGTGTATAACGAGCTGACCAAAGTGAAATAC TCGTGGACCTGCTGTTCAAGACCAACCGGAAAGTGACCGTGAAGCAGCTGAAAGAG GACTACTTCAAGAAAATCGAGTGCTTCGACTCCGTGGAAATCTCCGGCGTGGAAGAT CGGTTCAACGCCTCCCTGGGCACATACCACGATCTGCTGAAAATTATCAAGGACAA GGACTTCCTGGACAATGAGGAAAACGAGGACATTCTGGAAGATATCGTGCTGACCC TGACACTGTTTGAGGACAGAGAGATGATCGAGGAACGGCTGAAAACCTATGCCCAC CTGTTCGACGACAAAGTGATGAAGCAGCTGAAGCGGCGGAGATACACCGGCTGGGG CAGGCTGAGCCGGAAGCTGATCAACGGCATCCGGGACAAGCAGTCCGGCAAGACA ATCCTGGATTTCCTGAAGTCCGACGGCTTCGCCAACAGAAACTTCATGCAGCTGATC CACGACGACAGCCTGACCTTTAAAGAGGACATCCAGAAAGCCCAGGTGTCCGGCCA GGGCGATAGCCTGCACGAGCACATTGCCAATCTGGCCGGCAGCCCCGCCATTAAGA AGGGCATCCTGCAGACAGTGAAGGTGGTGGACGAGCTCGTGAAAGTGATGGGCCGG CACAAGCCCGAGAACATCGTGATCGAAATGGCCAGAGAGAACCAGACCACCCAGA AGGGACAGAAGAACAGCCGCGAGAGAATGAAGCGGATCGAAGAGGGCATCAAAGA GCTGGGCAGCCAGATCCTGAAAGAACACCCCGTGGAAAACACCCAGCTGCAGAACG AGAAGCTGTACCTGTACTACCTGCAGAATGGGCGGGATATGTACGTGGACCAGGAA CTGGACATCAACCGGCTGTCCGACTACGATGTGGACCATATCGTGCCTCAGAGCTTT CTGAAGGACGACTCCATCGACAACAAGGTGCTGACCAGAAGCGACAAGAACCGGG GCAAGAGCGACAACGTGCCCTCCGAAGAGGTCGTGAAGAAGATGAAGAACTACTGG CGGCAGCTGCTGAACGCCAAGCTGATTACCCAGAGAAAGTTCGACAATCTGACCAA GGCCGAGAGAGGCGGCCTGAGCGAACTGGATAAGGCCGGCTTCATCAAGAGACAG CTGGTGGAAACCCGGCAGATCACAAAGCACGTGGCACAGATCCTGGACTCCCGGAT GAACACTAAGTACGACGAGAATGACAAGCTGATCCGGGAAGTGAAAGTGATCACCC TGAAGTCCAAGCTGGTGTCCGATTTCCGGAAGGATTTCCAGTTTTACAAAGTGCGCG AGATCAACAACTACCACCACGCCCACGACGCCTACCTGAACGCCGTCGTGGGAACC GCCCTGATCAAAAAGTACCCTAAGCTGGAAAGCGAGTTCGTGTACGGCGACTACAA GGTGTACGACGTGCGGAAGATGATCGCCAAGAGCGAGCAGGAAATCGGCAAGGCT ACCGCCAAGTACTTCTTCTACAGCAACATCATGAACTTTTTCAAGACCGAGATTACC CTGGCCAACGGCGAGATCCGGAAGCGGCCTCTGATCGAGACAAACGGCGAAACCGG GGAGATCGTGTGGGATAAGGGCCGGGATTTTGCCACCGTGCGGAAAGTGCTGAGCA TGCCCCAAGTGAATATCGTGAAAAAGACCGAGGTGCAGACAGGCGGCTTCAGCAAA GAGTCTATCCTGCCCAAGAGGAACAGCGATAAGCTGATCGCCAGAAAGAAGGACTG GGACCCTAAGAAGTACGGCGGCTTCGACAGCCCCACCGTGGCCTATTCTGTGCTGGT GGTGGCCAAAGTGGAAAAGGGCAAGTCCAAGAAACTGAAGAGTGTGAAAGAGCTG CTGGGGATCACCATCATGGAAAGAAGCAGCTTCGAGAAGAATCCCATCGACTTTCT GGAAGCCAAGGGCTACAAAGAAGTGAAAAAGGACCTGATCATCAAGCTGCCTAAGT ACTCCCTGTTCGAGCTGGAAAACGGCCGGAAGAGAATGCTGGCCTCTGCCGGCGAA CTGCAGAAGGGAAACGAACTGGCCCTGCCCTCCAAATATGTGAACTTCCTGTACCTG GCCAGCCACTATGAGAAGCTGAAGGGCTCCCCCGAGGATAATGAGCAGAAACAGCT GTTTGTGGAACAGCACAAGCACTACCTGGACGAGATCATCGAGCAGATCAGCGAGT TCTCCAAGAGAGTGATCCTGGCCGACGCTAATCTGGACAAAGTGCTGTCCGCCTACA ACAAGCACCGGGATAAGCCCATCAGAGAGCAGGCCGAGAATATCATCCACCTGTTT ACCCTGACCAATCTGGGAGCCCCTGCCGCCTTCAAGTACTTTGACACCACCATCGAC CGGAAGACGTACACCAGCACCAAAGAGGTGCTGGACGCCACCCTGATCCACCAGAG CATCACCGGCCTGTACGAGACACGGATCGACCTGTCTCAGCTGGGAGGCGACAGCC CCAAGAAGAAGAGAAAGGTGGAGGCCAGCTAAGGATCCGGCAAGACTGGCCCCGC TTGGCAACGCAACAGTGAGCCCCTCCCTAGTGTGTTTGGGGATGTGACTATGTATTC GTGTGTTGGCCAACGGGTCAACCCGAACAGATTGATACCCGCCTTGGCATTTCCTGT CAGAATGTAACGTCAGTTGATGGTACT - Sequence for a cassette driving the expression of T7 polymerase under the control of beta-2 tubulin promoter, followed by the 3′ UTR of Cop1:
-
(SEQ ID NO: 20) TCTTTCTTGCGCTATGACACTTCCAGCAAAAGGTAGGGCGGGCTGCGAGACGGCTTCCCGGCGCTGCATGCAACACCGATGATGCTTCG ACCCCCCGAAGCTCCTTCGGGGCTGCATGGGCGCTCCGATGCCGCTCCAGGGCGAGCGCTGTTTAAATAGCCAGGCCCCCGATTGCAAA GACATTATAGCGAGCTACCAAAGCCATATTCAAACACCTAGATCACTACCACTTCTACACAGGCCACTCGAGCTTGTGATCGCACTCC GCTAAGGGGGCGCCTCTTCCTCTTCGTTTCAGTCACAACCCGCAAACatgcctaagaagaagaggaaggttaacacgattaacat cgctaagaacgacttctctgacatcgaactggctgctatcccgttcaacactctggctgaccattacggtgagcgtttagctcgcgaa cagttggcccttgagcatgagtcUacgagatgggtgaagcacgcttccgcaagatgtttgagcgtcaacttaaagctggtgaggttgcggat aacgctgccgccaagcctctcatcactaccctactccctaagatgattgcacgcatcaacgactggttgaggaagtgaaagctaagcgcg gcaagcgcccgacagccttccagttcctgcaagaaatcaagccggaagccgtagcgtacatcaccattaagaccactctggcttgcctaac cagtgctgacaatacaaccgttcaggctgtagcaagcgcaatcggtcgggccattgaggacgaggctcgcttcggtcgtatccgtgacctt gaagctaagcacttcaagaaaaacgttgaggaacaactcaacaagcgcgtagggcacgtctacaagaaagcatttatgcaagttgtcgag gctgacatgctctctaagggtctactcggtggcgaggcgtggtcttcgtggcataaggattgactctattcatgtaggagtacgctgcatcgag atgctcattgagtcaaccggaatggtfagcttacaccgccaaaatgctggcgtagtaggtcaagactctgagactatcgaactcgcacctga atacgctgaggctatcgcaacccgtgcaggtgcgctggctggcatctctccgatgttccaaccttgcgtagttcctcctaagccgtggactgg cattactggtggtggctattgggctaacggtcgtcgtcctctggcgctggtgcgtactcacagtaagaaagcactgatgcgctacgaagacg tttacatgcctgaggtgtacaaagcgattaacattgcgcaaaacaccgcatggaaaatcaacaagaaagtcctagcggtcgccaacgtaatc accaagtggaagcattgtccggtcgaggacatccctgcgattgagcgtgaagaactcccgatgaaaccggaagacatcgacatgaatcct gaggctctcaccgcgtggaaacgtgctgccgctgctgtgtaccgcaaggacaaggctcgcaagtctcgccgtatcagccttgagttcatgc ttgagcaagccaataagtttgctaaccataaggccatctggttcccttacaacatggactggcgcggtcgtgtttacgctgtgtcaatgttcaac ccgcaaggtaacgatatgaccaaaggactgcttacgctggcgaaaggtaaaccaatcggtaaggaaggttactactggctgaaaatccac ggtgcaaactgtgcgggtgtcgacaaggttccgttccctgagcgcatcaagttcattgaggaaaaccacgagaacatcatggcttgcgctaa gtctccactggagaacacttggtgggctgagcaagattctccgttctgcttccttgcgttctgctttgagtacgctggggtacagcaccacggc ctgagctataactgctcccttccgctggcgtttgacgggtcttgctctggcatccagcacttctccgcgatgctccgagatgaggtaggtggtc gcgcggttaacttgcttcctagtgaaaccgttcaggacatctacgggattgttgctaagaaagtcaacgagattctacaagcagacgcaatca atgggaccgataacgaagtagttaccgtgaccgatgagaacactggtgaaatctctgagaaagtcaagctgggcactaaggcactggctg gtcaatggctggcttacggtgttactcgcagtgtgactaagcgttcagtcatgacgctggcttacgggtccaaagagttcggcttccgtcaac aagtgctggaagataccattcagccagctattgattccggcaagggtctgatgttcactcagccgaatcaggctgctggatacatggctaag ctgatttgggaatctgtgagcgtgacggtggtagctgcggttgaagcaatgaactggcttaagtctgctgctaagctgctggctgctgaggtc aaagataagaagactggagagattcttcgcaagcgttgcgctgtgcattgggtaactcctgatggtttccctgtgtggcaggaatacaagaa gcctattcagacgcgcttgaacctgatgttcctcggtcagttccgcttacagcctaccattaacaccaacaaagatagcgagattgatgcaca caacaggagtctggtatcgctcctaactttgtacacagccaagacggtagccaccttcgtaagactgtagtgtgggcacacgagaagtac ggaatcgaatcttttgcactgattcacgactccttcggtacgattccggctgacgctgcgaacctgttcaaagcagtgcgcgaaactatggttg acacatatgagtcttgtgatgtactggctgatttctacgaccagttcgctgaccagttgcacgagtctcaattggacaaaaatgccagcacttcc ggctaaaggtaacttgaacctccgtgacatcttagagtcggacttcgcgttcgcgtaaGGATCCGGCAAGACTGGCCCCGCTTGGCAACGCAA CAGTGAGCCCCTCCCTAGTGTGTTTGGGGATGTGACTATGTATTCGTGTGTTGGCCAACGGGTCAACCCGAACAGATTGATACCCGCCTTGGC ATTTCCTGTCAGAATGTAACGTCAGTTGATGGTACT - Sequence of guide RNA driven by the T7 promoter (T7 promoter, Ns represent targeting sequence):
-
(SEQ ID NO: 21) gaaatTAATACGACTCACTATANNNNNNNNNNNNNNNNNNNNgttttagagctaGAAAtagcaa gttaaaataaggctagtccgttatcaacttgaaaaagtggcaccgagtcggtgcttttttt - Gene Delivery:
- Chlamydomonas reinhardtii strain CC-124 and CC-125 from the Chlamydomonas Resource Center will be used for electroporation. Electroporation protocol follows standard recommended protocol from the GeneArt Chlamydomonas Engineering kit.
- Also, Applicants generate a line of Chlamydomonas reinhardtii that expresses Cas9 constitutively. This can be done by using pChlamyl (linearized using PvuI) and selecting for hygromycin resistant colonies. Sequence for pChlamyl containing Cas9 is below. In this way to achieve gene knockout one simply needs to deliver RNA for the guideRNA. For homologous recombination Applicants deliver guideRNA as well as a linearized homologous recombination template.
- pChlamyl-Cas9:
-
GAACCCCTATTTGTTTATTTTTCTAAATACATTCAAATATGTATCCG CTCATGAGATTATCAAAAAGGATCTTCACCTAGATCCTTTTAAATTA AAAATGAAGTTTTAAATCAATCTAAAGTATATATGAGrAAACTTGGT CTGACAGTTACCAATGCTTAATCAGTGAGGCACCTATCTCAGCGATC TGTCTATTTCGTTCATCCATAGTTGCCTGACTCCCCGTCGTGTAGAT AACTACGATACGGGAGGGCTTACCATCTGGCCCCAGTGCTGCAATGA TACCGCGAGACCCACGCTCACCGGCTCCAGATTTATCAGCAATAAAC CAGCCAGCCGGAAGGGCCGAGCGCAGAAGTGGTCCTGCAACTTTATC CGCCTCCATCCAGTCTATTAATTGTTGCCGGGAAGCTAGAGTAAGTA GTTCGCCAGTTAATAGTTTGCGCAACGTTGTTGC - For all modified Chlamydomonas reinhardtii cells, Applicants use PCR, SURVEYOR nuclease assay, and DNA sequencing to verify successful modification.
- While preferred embodiments of the present invention have been shown and described herein, it will be obvious to those skilled in the art that such embodiments are provided by way of example only. Numerous variations, changes, and substitutions will now occur to those skilled in the art without departing from the invention. It should be understood that various alternatives to the embodiments of the invention described herein may be employed in practicing the invention. It is intended that the following claims define the scope of the invention and that methods and structures within the scope of these claims and their equivalents be covered thereby.
-
- 1. Urnov, F. D., Rebar, E. J., Holmes, M. C., Zhang, H. S. & Gregory, P. D. Genome editing with engineered zinc finger nucleases. Nat. Rev. Genet. 11, 636-646 (2010).
- 2. Bogdanove, A. J. & Voytas, D. F. TAL effectors: customizable proteins for DNA targeting. Science 333, 1843-1846 (2011).
- 3. Stoddard, B. L. Homing endonuclease structure and function. Q. Rev. Biophys. 38, 49-95 (2005).
- 4. Bae, T. & Schneewind, O. Allelic replacement in Staphylococcus aureus with inducible counter-selection. Plasmid 55, 58-63 (2006).
- 5. Sung, C. K., Li, H., Claverys, J. P. & Morrison, D. A. An rpsL cassette, janus, for gene replacement through negative selection in Streptococcus pneumoniae. Appl. Environ. Microbiol. 67, 5190-5196 (2001).
- 6. Sharan, S. K., Thomason, L. C., Kuznetsov, S. G. & Court, D. L. Recombineering: a homologous recombination-based method of genetic engineering. Nat. Protoc. 4, 206-223 (2009).
- 7. Jinek, M. et al. A programmable dual-RNA-guided DNA endonuclease in adaptive bacterial immunity. Science 337, 816-821 (2012).
- 8. Deveau, H., Garneau, J. E. & Moineau, S. CRISPR/Cas system and its role in phage-bacteria interactions. Annu. Rev. Microbiol. 64, 475-493 (2010).
- 9. Horvath, P. & Barrangou, R. CRISPR/Cas, the immune system of bacteria and archaea. Science 327, 167-170 (2010).
- 10. Terns, M. P. & Terns, R. M. CRISPR-based adaptive immune systems. Curr. Opin. Microbiol. 14, 321-327 (2011).
- 11. van der Oost, J., Jore, M. M., Westra, E. R., Lundgren, M. & Brouns, S. J. CRISPR-based adaptive and heritable immunity in prokaryotes. Trends. Biochem. Sci. 34, 401-407 (2009).
- 12. Brouns, S. J. et al. Small CRISPR RNAs guide antiviral defense in prokaryotes. Science 321, 960-964 (2008).
- 13. Carte, J., Wang, R., Li, H., Terns, R. M. & Terns, M. P. Cas6 is an endoribonuclease that generates guide RNAs for invader defense in prokaryotes. Genes Dev. 22, 3489-3496 (2008).
- 14. Deltcheva, E. et al. CRISPR RNA maturation by trans-encoded small RNA and host factor RNase III. Nature 471, 602-607 (2011).
- 15. Hatoum-Aslan, A., Maniv, I. & Marraffini, L. A. Mature clustered, regularly interspaced, short palindromic repeats RNA (crRNA) length is measured by a ruler mechanism anchored at the precursor processing site. Proc. Natl. Acad. Sci. U.S.A. 108, 21218-21222 (2011).
- 16. Haurwitz, R. E., Jinek. M., Wiedenheft, B., Zhou, K. & Doudna, J. A. Sequence- and structure-specific RNA processing by a CRISPR endonuclease. Science 329, 1355-1358 (2010).
- 17. Deveau, H. et al. Phage response to CRISPR-encoded resistance in Streptococcus thermophilus. J. Bacteriol. 190, 1390-1400 (2008).
- 18. Gasiunas, G., Barrangou, R., Horvath, P. & Siksnys, V. Cas9-crRNA ribonucleoprotein complex mediates specific DNA cleavage for adaptive immunity in bacteria. Proc. Natl. Acad. Sci. U.S.A. (2012).
- 19. Makarova, K. S., Aravind, L., Wolf, Y. I. & Koonin, E. V. Unification of Cas protein families and a simple scenario for the origin and evolution of CRISPR-Cas systems. Biol. Direct. 6, 38 (2011).
- 20. Barrangou, R. RNA-mediated programmable DNA cleavage. Nat. Biotechnol. 30, 836-838 (2012).
- 21. Brouns, S. J. Molecular biology. A Swiss army knife of immunity. Science 337, 808-809 (2012).
- 22. Carroll, D. A CRISPR Approach to Gene Targeting. Mol. Ther. 20, 1658-1660 (2012).
- 23. Bikard, D., Hatoum-Aslan, A., Mucida, D. & Marraffini, L. A. CRISPR interference can prevent natural transformation and virulence acquisition during in vivo bacterial infection.
Cell Host Microbe 12, 177-186 (2012). - 24. Sapranauskas, R. et al. The Streptococcus thermophilus CRISPR/Cas system provides immunity in Escherichia coli. Nucleic Acids Res. (2011).
- 25. Semenova, E. et al. Interference by clustered regularly interspaced short palindromic repeat (CRISPR) RNA is governed by a seed sequence. Proc. Natl. Acad. Sci. U.S.A. (2011).
- 26. Wiedenheft, B. et al. RNA-guided complex from a bacterial immune system enhances target recognition through seed sequence interactions. Proc. Natl. Acad. Sci. U.S.A. (2011).
- 27. Zahner, D. & Hakenbeck, R. The Streptococcus pneunmoniae beta-galactosidase is a surface protein. J. Bacteriol. 182, 5919-5921 (2000).
- 28. Marraffini, L. A., Dedent, A. C. & Schneewind, O. Sortases and the art of anchoring proteins to the envelopes of gram-positive bacteria. Microbiol. Mol. Biol. Rev. 70, 192-221 (2006).
- 29. Motamedi, M. R., Szigety, S. K. & Rosenberg, S. M. Double-strand-break repair recombination in Escherichia coli: physical evidence for a DNA replication mechanism in vivo. Genes Dev. 13, 2889-2903 (1999).
- 30. Hosaka, T. et al. The novel mutation K87E in ribosomal protein S12 enhances protein synthesis activity during the late growth phase in Escherichia coli. Mol. Genet. Genonics 271, 317-324 (2004).
- 31. Costantino, N. & Court, D. L. Enhanced levels of lambda Red-mediated recombinants in mismatch repair mutants. Proc. Natl. Acad. Sci. U.S.A. 100, 15748-15753 (2003).
- 32. Edgar, R. & Qimron. U. The Escherichia coli CRISPR system protects from lambda lysogenization, lysogens, and prophage induction. J. Bacteriol. 192, 6291-6294 (2010).
- 33. Marraffini, L. A. & Sontheimer, E. J. Self versus non-self discrimination during CRISPR RNA-directed immunity. Nature 463, 568-571 (2010).
- 34. Fischer, S. et al. An archaeal immune system can detect multiple Protospacer Adjacent Motifs (PAMs) to target invader DNA. J. Biol. Chemn. 287, 33351-33363 (2012).
- 35. Gudbergsdottir, S. et al. Dynamic properties of the Sulfolobus CRISPR/Cas and CRISPR/Cmr systems when challenged with vector-borne viral and plasmid genes and protospacers. Mol. Microbiol. 79, 35-49 (2011).
- 36. Wang, H. H. et al. Genome-scale promoter engineering by coselection MAGE. Nat Methods 9, 591-593 (2012).
- 37. Cong, L. et al. Multiplex Genome Engineering Using CRISPR/Cas Systems. Science In press (2013).
- 38. Mali, P. et al. RNA-Guided Human Genome Engineering via Cas9. Science In press (2013).
- 39. Hoskins, J. et al. Genome of the bacterium Streptococcus pneumoniae strain R6. J. Bacteriol. 183, 5709-5717 (2001).
- 40. Havarstein, L. S., Coomaraswamy, G. & Morrison, D. A. An unmodified heptadecapeptide pheromone induces competence for genetic transformation in Streptococcus pneumoniae. Proc. Natl. Acad. Sci. U.S.A. 92, 11140-11144 (1995).
- 41. Horinouchi, S. & Weisblum, B. Nucleotide sequence and functional map of
pC 194, a plasmid that specifies inducible chloramphenicol resistance. J. Bacteriol. 150, 815-825 (1982). - 42. Horton, R. M. In Vitro Recombination and Mutagenesis of DNA: SOEing Together Tailor-Made Genes. Methods Mol. Biol. 15, 251-261 (1993).
- 43. Podbielski, A., Spellerberg, B., Woischnik, M., Pohl, B. & Lutticken, R. Novel series of plasmid vectors for gene inactivation and expression analysis in group A streptococci (GAS). Gene 177, 137-147 (1996).
- 44. Husmann, L. K., Scott, J. R., Lindahl, G. & Stenberg, L. Expression of the Arp protein, a member of the M protein family, is not sufficient to inhibit phagocytosis of Streptococcus pyogenes. Infection and
immunity 63, 345-348 (1995). - 45. Gibson, D. G. et al. Enzymatic assembly of DNA molecules up to several hundred kilobases.
Nat Methods 6, 343-345 (2009). - 46. Garneau J. E. et al. The CRISPR/Cas bacterial immune system cleaves bacteriophage and plasmid DNA. Nature 468,67-71(4 Nov. 2010)
- 47. Barrangou R. et al. CRISPR provides acquired resistance against viruses in prokaryotes. Science. 2007 Mar. 23; 315(5819): 1709-12.
- 48. Ishino Y. et al. Nucleotide sequence of the iap gene, responsible for alkaline phosphatase isozyme conversion in Escherichia coli, and identification of the gene product. J Bacteriol. 1987 December; 169(12):5429-33.
- 49. Mojica F. J. M et al. Biological significance of a family of regularly spaced repeats in the genomes of Archaea, Bacteria and mitochondria. Molecular Microbiology (2000) 36(1), 244-246.
- 50. Jansen R. et al. Identification of genes that are associated with DNA repeats in prokaryotes. Molecular Microbiology (2002) 43(6), 1565-1575.
Claims (30)
Priority Applications (2)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
US14/681,382 US20150203872A1 (en) | 2012-12-12 | 2015-04-08 | Crispr-cas systems and methods for altering expression of gene products |
US15/160,710 US20160281072A1 (en) | 2012-12-12 | 2016-05-20 | Crispr-cas systems and methods for altering expression of gene products |
Applications Claiming Priority (8)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
US201261736527P | 2012-12-12 | 2012-12-12 | |
US201361748427P | 2013-01-02 | 2013-01-02 | |
US201361791409P | 2013-03-15 | 2013-03-15 | |
US201361835931P | 2013-06-17 | 2013-06-17 | |
US201361842322P | 2013-07-02 | 2013-07-02 | |
US14/054,414 US8697359B1 (en) | 2012-12-12 | 2013-10-15 | CRISPR-Cas systems and methods for altering expression of gene products |
PCT/US2013/074743 WO2014093661A2 (en) | 2012-12-12 | 2013-12-12 | Crispr-cas systems and methods for altering expression of gene products |
US14/681,382 US20150203872A1 (en) | 2012-12-12 | 2015-04-08 | Crispr-cas systems and methods for altering expression of gene products |
Related Parent Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
PCT/US2013/074743 Continuation WO2014093661A2 (en) | 2012-12-12 | 2013-12-12 | Crispr-cas systems and methods for altering expression of gene products |
Related Child Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
US15/160,710 Continuation US20160281072A1 (en) | 2012-12-12 | 2016-05-20 | Crispr-cas systems and methods for altering expression of gene products |
Publications (1)
Publication Number | Publication Date |
---|---|
US20150203872A1 true US20150203872A1 (en) | 2015-07-23 |
Family
ID=50441380
Family Applications (8)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
US14/054,414 Active US8697359B1 (en) | 2012-12-12 | 2013-10-15 | CRISPR-Cas systems and methods for altering expression of gene products |
US14/183,429 Active US8771945B1 (en) | 2012-12-12 | 2014-02-18 | CRISPR-Cas systems and methods for altering expression of gene products |
US14/256,912 Active US8945839B2 (en) | 2012-12-12 | 2014-04-18 | CRISPR-Cas systems and methods for altering expression of gene products |
US14/324,960 Abandoned US20150184139A1 (en) | 2012-12-12 | 2014-07-07 | Crispr-cas systems and methods for altering expression of gene products |
US14/681,382 Abandoned US20150203872A1 (en) | 2012-12-12 | 2015-04-08 | Crispr-cas systems and methods for altering expression of gene products |
US15/160,710 Pending US20160281072A1 (en) | 2012-12-12 | 2016-05-20 | Crispr-cas systems and methods for altering expression of gene products |
US15/217,489 Abandoned US20170175142A1 (en) | 2012-12-12 | 2016-07-22 | Crispr-cas systems and methods for altering expression of gene products |
US16/177,403 Pending US20190153476A1 (en) | 2012-12-12 | 2018-10-31 | Crispr-cas systems for altering expression of gene products |
Family Applications Before (4)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
US14/054,414 Active US8697359B1 (en) | 2012-12-12 | 2013-10-15 | CRISPR-Cas systems and methods for altering expression of gene products |
US14/183,429 Active US8771945B1 (en) | 2012-12-12 | 2014-02-18 | CRISPR-Cas systems and methods for altering expression of gene products |
US14/256,912 Active US8945839B2 (en) | 2012-12-12 | 2014-04-18 | CRISPR-Cas systems and methods for altering expression of gene products |
US14/324,960 Abandoned US20150184139A1 (en) | 2012-12-12 | 2014-07-07 | Crispr-cas systems and methods for altering expression of gene products |
Family Applications After (3)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
US15/160,710 Pending US20160281072A1 (en) | 2012-12-12 | 2016-05-20 | Crispr-cas systems and methods for altering expression of gene products |
US15/217,489 Abandoned US20170175142A1 (en) | 2012-12-12 | 2016-07-22 | Crispr-cas systems and methods for altering expression of gene products |
US16/177,403 Pending US20190153476A1 (en) | 2012-12-12 | 2018-10-31 | Crispr-cas systems for altering expression of gene products |
Country Status (15)
Country | Link |
---|---|
US (8) | US8697359B1 (en) |
EP (2) | EP2998400A1 (en) |
JP (5) | JP6545621B2 (en) |
KR (1) | KR20150107739A (en) |
CN (3) | CN106170549B (en) |
AU (4) | AU2013359238B2 (en) |
BR (1) | BR112015013785A2 (en) |
CA (1) | CA2894688A1 (en) |
DK (1) | DK2764103T3 (en) |
ES (1) | ES2552535T3 (en) |
HK (2) | HK1201290A1 (en) |
PL (1) | PL2764103T3 (en) |
PT (1) | PT2764103E (en) |
RU (1) | RU2687451C1 (en) |
WO (1) | WO2014093661A2 (en) |
Cited By (58)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US9260752B1 (en) | 2013-03-14 | 2016-02-16 | Caribou Biosciences, Inc. | Compositions and methods of nucleic acid-targeting nucleic acids |
US9512446B1 (en) | 2015-08-28 | 2016-12-06 | The General Hospital Corporation | Engineered CRISPR-Cas9 nucleases |
US9567604B2 (en) | 2013-03-15 | 2017-02-14 | The General Hospital Corporation | Using truncated guide RNAs (tru-gRNAs) to increase specificity for RNA-guided genome editing |
WO2017040348A1 (en) | 2015-08-28 | 2017-03-09 | The General Hospital Corporation | Engineered crispr-cas9 nucleases |
WO2018005445A1 (en) | 2016-06-27 | 2018-01-04 | The Broad Institute, Inc. | Compositions and methods for detecting and treating diabetes |
US9888673B2 (en) | 2014-12-10 | 2018-02-13 | Regents Of The University Of Minnesota | Genetically modified cells, tissues, and organs for treating disease |
WO2018039145A1 (en) | 2016-08-20 | 2018-03-01 | Avellino Lab Usa, Inc. | Single guide rna, crispr/cas9 systems, and methods of use thereof |
US9926546B2 (en) | 2015-08-28 | 2018-03-27 | The General Hospital Corporation | Engineered CRISPR-Cas9 nucleases |
US9970030B2 (en) | 2014-08-27 | 2018-05-15 | Caribou Biosciences, Inc. | Methods for increasing CAS9-mediated engineering efficiency |
US10000772B2 (en) | 2012-05-25 | 2018-06-19 | The Regents Of The University Of California | Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription |
US10011850B2 (en) | 2013-06-21 | 2018-07-03 | The General Hospital Corporation | Using RNA-guided FokI Nucleases (RFNs) to increase specificity for RNA-Guided Genome Editing |
WO2018195545A2 (en) | 2017-04-21 | 2018-10-25 | The General Hospital Corporation | Variants of cpf1 (cas12a) with altered pam specificity |
WO2018218166A1 (en) | 2017-05-25 | 2018-11-29 | The General Hospital Corporation | Using split deaminases to limit unwanted off-target base editor deamination |
US10166255B2 (en) | 2015-07-31 | 2019-01-01 | Regents Of The University Of Minnesota | Intracellular genomic transplant and methods of therapy |
US10190137B2 (en) | 2013-11-07 | 2019-01-29 | Editas Medicine, Inc. | CRISPR-related methods and compositions with governing gRNAS |
US10428319B2 (en) | 2017-06-09 | 2019-10-01 | Editas Medicine, Inc. | Engineered Cas9 nucleases |
WO2019195738A1 (en) | 2018-04-06 | 2019-10-10 | Children's Medical Center Corporation | Compositions and methods for somatic cell reprogramming and modulating imprinting |
WO2019241315A1 (en) | 2018-06-12 | 2019-12-19 | Obsidian Therapeutics, Inc. | Pde5 derived regulatory constructs and methods of use in immunotherapy |
US10526589B2 (en) | 2013-03-15 | 2020-01-07 | The General Hospital Corporation | Multiplex guide RNAs |
WO2020086742A1 (en) | 2018-10-24 | 2020-04-30 | Obsidian Therapeutics, Inc. | Er tunable protein regulation |
EP3502261A4 (en) * | 2016-08-19 | 2020-07-15 | Toolgen Incorporated | Artificially engineered angiogenesis regulatory system |
US10731181B2 (en) | 2012-12-06 | 2020-08-04 | Sigma, Aldrich Co. LLC | CRISPR-based genome modification and regulation |
WO2020163396A1 (en) | 2019-02-04 | 2020-08-13 | The General Hospital Corporation | Adenine dna base editor variants with reduced off-target rna editing |
WO2020185632A1 (en) | 2019-03-08 | 2020-09-17 | Obsidian Therapeutics, Inc. | Human carbonic anhydrase 2 compositions and methods for tunable regulation |
WO2020225754A1 (en) | 2019-05-06 | 2020-11-12 | Mcmullen Tara | Crispr gene editing for autosomal dominant diseases |
US10851380B2 (en) | 2012-10-23 | 2020-12-01 | Toolgen Incorporated | Methods for cleaving a target DNA using a guide RNA specific for the target DNA and Cas protein-encoding nucleic acid or Cas protein |
US10912797B2 (en) | 2016-10-18 | 2021-02-09 | Intima Bioscience, Inc. | Tumor infiltrating lymphocytes and methods of therapy |
WO2021046451A1 (en) | 2019-09-06 | 2021-03-11 | Obsidian Therapeutics, Inc. | Compositions and methods for dhfr tunable protein regulation |
US11078483B1 (en) | 2016-09-02 | 2021-08-03 | KSQ Therapeutics, Inc. | Methods for measuring and improving CRISPR reagent function |
US11078481B1 (en) | 2016-08-03 | 2021-08-03 | KSQ Therapeutics, Inc. | Methods for screening for cancer targets |
US11098325B2 (en) | 2017-06-30 | 2021-08-24 | Intima Bioscience, Inc. | Adeno-associated viral vectors for gene therapy |
JP2021166514A (en) * | 2015-12-28 | 2021-10-21 | ノバルティス アーゲー | Compositions and methods for treatment of hemoglobinopathies |
WO2021216622A1 (en) | 2020-04-21 | 2021-10-28 | Aspen Neuroscience, Inc. | Gene editing of gba1 in stem cells and method of use of cells differentiated therefrom |
WO2021224633A1 (en) | 2020-05-06 | 2021-11-11 | Orchard Therapeutics (Europe) Limited | Treatment for neurodegenerative diseases |
WO2021248052A1 (en) | 2020-06-05 | 2021-12-09 | The Broad Institute, Inc. | Compositions and methods for treating neoplasia |
US11236313B2 (en) | 2016-04-13 | 2022-02-01 | Editas Medicine, Inc. | Cas9 fusion molecules, gene editing systems, and methods of use thereof |
US11371030B2 (en) | 2017-05-31 | 2022-06-28 | The University Of Tokyo | Modified Cas9 protein and use thereof |
US11390884B2 (en) | 2015-05-11 | 2022-07-19 | Editas Medicine, Inc. | Optimized CRISPR/cas9 systems and methods for gene editing in stem cells |
EP4036228A1 (en) | 2015-11-13 | 2022-08-03 | Avellino Lab USA, Inc. | Methods for the treatment of corneal dystrophies |
US11466271B2 (en) | 2017-02-06 | 2022-10-11 | Novartis Ag | Compositions and methods for the treatment of hemoglobinopathies |
WO2022235929A1 (en) | 2021-05-05 | 2022-11-10 | Radius Pharmaceuticals, Inc. | Animal model having homologous recombination of mouse pth1 receptor |
US11499151B2 (en) | 2017-04-28 | 2022-11-15 | Editas Medicine, Inc. | Methods and systems for analyzing guide RNA molecules |
US11597924B2 (en) | 2016-03-25 | 2023-03-07 | Editas Medicine, Inc. | Genome editing systems comprising repair-modulating enzyme molecules and methods of their use |
US11667911B2 (en) | 2015-09-24 | 2023-06-06 | Editas Medicine, Inc. | Use of exonucleases to improve CRISPR/CAS-mediated genome editing |
US11680268B2 (en) | 2014-11-07 | 2023-06-20 | Editas Medicine, Inc. | Methods for improving CRISPR/Cas-mediated genome-editing |
EP4198124A1 (en) | 2021-12-15 | 2023-06-21 | Versitech Limited | Engineered cas9-nucleases and method of use thereof |
WO2023115039A2 (en) | 2021-12-17 | 2023-06-22 | Sana Biotechnology, Inc. | Modified paramyxoviridae fusion glycoproteins |
WO2023115041A1 (en) | 2021-12-17 | 2023-06-22 | Sana Biotechnology, Inc. | Modified paramyxoviridae attachment glycoproteins |
WO2023133595A2 (en) | 2022-01-10 | 2023-07-13 | Sana Biotechnology, Inc. | Methods of ex vivo dosing and administration of lipid particles or viral vectors and related systems and uses |
WO2023150518A1 (en) | 2022-02-01 | 2023-08-10 | Sana Biotechnology, Inc. | Cd3-targeted lentiviral vectors and uses thereof |
WO2023150647A1 (en) | 2022-02-02 | 2023-08-10 | Sana Biotechnology, Inc. | Methods of repeat dosing and administration of lipid particles or viral vectors and related systems and uses |
US11866726B2 (en) | 2017-07-14 | 2024-01-09 | Editas Medicine, Inc. | Systems and methods for targeted integration and genome editing and detection thereof using integrated priming sites |
US11911415B2 (en) | 2015-06-09 | 2024-02-27 | Editas Medicine, Inc. | CRISPR/Cas-related methods and compositions for improving transplantation |
WO2024044655A1 (en) | 2022-08-24 | 2024-02-29 | Sana Biotechnology, Inc. | Delivery of heterologous proteins |
WO2024064838A1 (en) | 2022-09-21 | 2024-03-28 | Sana Biotechnology, Inc. | Lipid particles comprising variant paramyxovirus attachment glycoproteins and uses thereof |
WO2024081820A1 (en) | 2022-10-13 | 2024-04-18 | Sana Biotechnology, Inc. | Viral particles targeting hematopoietic stem cells |
JP7472121B2 (en) | 2018-10-18 | 2024-04-22 | インテリア セラピューティクス,インコーポレーテッド | Compositions and methods for transgene expression from the albumin locus |
US11999952B2 (en) | 2021-04-21 | 2024-06-04 | Toolgen Incorporated | Artificially-manipulated neovascularization regulatory system |
Families Citing this family (1143)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
EP2449112A1 (en) | 2009-07-01 | 2012-05-09 | Transposagen Biopharmaceuticals, Inc. | Genetically modified rat models for severe combined immunodeficiency (scid) |
MY172702A (en) | 2010-06-11 | 2019-12-10 | Regeneron Pharma | Production of fertile xy female animals from xy es cells |
US11191665B2 (en) | 2011-02-04 | 2021-12-07 | Joseph E. Kovarik | Method and system for reducing the likelihood of a porphyromonas gingivalis infection in a human being |
US10583033B2 (en) | 2011-02-04 | 2020-03-10 | Katherine Rose Kovarik | Method and system for reducing the likelihood of a porphyromonas gingivalis infection in a human being |
US11951139B2 (en) | 2015-11-30 | 2024-04-09 | Seed Health, Inc. | Method and system for reducing the likelihood of osteoporosis |
US11419903B2 (en) | 2015-11-30 | 2022-08-23 | Seed Health, Inc. | Method and system for reducing the likelihood of osteoporosis |
US11273187B2 (en) | 2015-11-30 | 2022-03-15 | Joseph E. Kovarik | Method and system for reducing the likelihood of developing depression in an individual |
US9730967B2 (en) | 2011-02-04 | 2017-08-15 | Katherine Rose Kovarik | Method and system for treating cancer cachexia |
US10512661B2 (en) | 2011-02-04 | 2019-12-24 | Joseph E. Kovarik | Method and system for reducing the likelihood of developing liver cancer in an individual diagnosed with non-alcoholic fatty liver disease |
US10842834B2 (en) | 2016-01-06 | 2020-11-24 | Joseph E. Kovarik | Method and system for reducing the likelihood of developing liver cancer in an individual diagnosed with non-alcoholic fatty liver disease |
US11951140B2 (en) | 2011-02-04 | 2024-04-09 | Seed Health, Inc. | Modulation of an individual's gut microbiome to address osteoporosis and bone disease |
US11844720B2 (en) | 2011-02-04 | 2023-12-19 | Seed Health, Inc. | Method and system to reduce the likelihood of dental caries and halitosis |
US10314865B2 (en) | 2011-02-04 | 2019-06-11 | Katherine Rose Kovarik | Method and system for treating cancer and other age-related diseases by extending the healthspan of a human |
US9528124B2 (en) * | 2013-08-27 | 2016-12-27 | Recombinetics, Inc. | Efficient non-meiotic allele introgression |
US10920242B2 (en) | 2011-02-25 | 2021-02-16 | Recombinetics, Inc. | Non-meiotic allele introgression |
EP3613852A3 (en) | 2011-07-22 | 2020-04-22 | President and Fellows of Harvard College | Evaluation and improvement of nuclease cleavage specificity |
LT2768942T (en) | 2011-10-17 | 2020-04-10 | Massachusetts Institute Of Technology | Intracellular delivery |
IN2014MN00974A (en) | 2011-12-16 | 2015-04-24 | Targetgene Biotechnologies Ltd | |
US11021737B2 (en) | 2011-12-22 | 2021-06-01 | President And Fellows Of Harvard College | Compositions and methods for analyte detection |
GB201122458D0 (en) | 2011-12-30 | 2012-02-08 | Univ Wageningen | Modified cascade ribonucleoproteins and uses thereof |
WO2013138351A1 (en) | 2012-03-13 | 2013-09-19 | Board Of Trustees Of The University Of Arkansas | Separatome-based protein expression and purification platform |
US9637739B2 (en) | 2012-03-20 | 2017-05-02 | Vilnius University | RNA-directed DNA cleavage by the Cas9-crRNA complex |
EP2847335B1 (en) | 2012-04-25 | 2018-06-27 | Regeneron Pharmaceuticals, Inc. | Nuclease-mediated targeting with large targeting vectors |
WO2013163628A2 (en) | 2012-04-27 | 2013-10-31 | Duke University | Genetic correction of mutated genes |
US20150225734A1 (en) * | 2012-06-19 | 2015-08-13 | Regents Of The University Of Minnesota | Gene targeting in plants using dna viruses |
AU2013289206B2 (en) | 2012-07-11 | 2018-08-09 | Sangamo Therapeutics, Inc. | Methods and compositions for the treatment of lysosomal storage diseases |
US10648001B2 (en) | 2012-07-11 | 2020-05-12 | Sangamo Therapeutics, Inc. | Method of treating mucopolysaccharidosis type I or II |
EP3808844A1 (en) * | 2012-07-25 | 2021-04-21 | The Broad Institute, Inc. | Inducible dna binding proteins and genome perturbation tools and applications thereof |
WO2014066830A1 (en) * | 2012-10-25 | 2014-05-01 | Department Of Veterans Affairs | Composition and methods for the prevention and treatment of diet-induced obesity |
US8697359B1 (en) | 2012-12-12 | 2014-04-15 | The Broad Institute, Inc. | CRISPR-Cas systems and methods for altering expression of gene products |
EP2848690B1 (en) | 2012-12-12 | 2020-08-19 | The Broad Institute, Inc. | Crispr-cas component systems, methods and compositions for sequence manipulation |
DK2931898T3 (en) | 2012-12-12 | 2016-06-20 | Massachusetts Inst Technology | CONSTRUCTION AND OPTIMIZATION OF SYSTEMS, PROCEDURES AND COMPOSITIONS FOR SEQUENCE MANIPULATION WITH FUNCTIONAL DOMAINS |
MX2015007550A (en) | 2012-12-12 | 2017-02-02 | Broad Inst Inc | Delivery, engineering and optimization of systems, methods and compositions for sequence manipulation and therapeutic applications. |
ES2553782T3 (en) * | 2012-12-12 | 2015-12-11 | The Broad Institute, Inc. | Systems engineering, methods and guide compositions optimized for sequence manipulation |
ES2786193T3 (en) | 2012-12-12 | 2020-10-09 | Broad Inst Inc | Genetic engineering and optimization of improved enzyme systems, methods, and compositions for sequence manipulation |
EP3434776A1 (en) | 2012-12-12 | 2019-01-30 | The Broad Institute, Inc. | Methods, models, systems, and apparatus for identifying target sequences for cas enzymes or crispr-cas systems for target sequences and conveying results thereof |
EP3252160B1 (en) | 2012-12-12 | 2020-10-28 | The Broad Institute, Inc. | Crispr-cas component systems, methods and compositions for sequence manipulation |
RU2699523C2 (en) | 2012-12-17 | 2019-09-05 | Президент Энд Фэллоуз Оф Харвард Коллидж | Rna-guided engineering of human genome |
AU2014207618A1 (en) | 2013-01-16 | 2015-08-06 | Emory University | Cas9-nucleic acid complexes and uses related thereto |
US11466306B2 (en) * | 2013-02-14 | 2022-10-11 | Osaka University | Method for isolating specific genomic regions with use of molecule capable of specifically binding to endogenous DNA sequence |
ES2904803T3 (en) | 2013-02-20 | 2022-04-06 | Regeneron Pharma | Genetic modification of rats |
EP3578666A1 (en) | 2013-03-12 | 2019-12-11 | President and Fellows of Harvard College | Method of generating a three-dimensional nucleic acid containing matrix |
US20160138027A1 (en) * | 2013-03-14 | 2016-05-19 | The Board Of Trustees Of The Leland Stanford Junior University | Treatment of diseases and conditions associated with dysregulation of mammalian target of rapamycin complex 1 (mtorc1) |
US20140273235A1 (en) * | 2013-03-15 | 2014-09-18 | Regents Of The University Of Minnesota | ENGINEERING PLANT GENOMES USING CRISPR/Cas SYSTEMS |
US9234213B2 (en) | 2013-03-15 | 2016-01-12 | System Biosciences, Llc | Compositions and methods directed to CRISPR/Cas genomic engineering systems |
US20140273230A1 (en) * | 2013-03-15 | 2014-09-18 | Sigma-Aldrich Co., Llc | Crispr-based genome modification and regulation |
US9957515B2 (en) | 2013-03-15 | 2018-05-01 | Cibus Us Llc | Methods and compositions for targeted gene modification |
WO2014165825A2 (en) | 2013-04-04 | 2014-10-09 | President And Fellows Of Harvard College | Therapeutic uses of genome editing with crispr/cas systems |
PT3456831T (en) | 2013-04-16 | 2021-09-10 | Regeneron Pharma | Targeted modification of rat genome |
US20160186208A1 (en) * | 2013-04-16 | 2016-06-30 | Whitehead Institute For Biomedical Research | Methods of Mutating, Modifying or Modulating Nucleic Acid in a Cell or Nonhuman Mammal |
CN116083487A (en) * | 2013-05-15 | 2023-05-09 | 桑格摩生物治疗股份有限公司 | Methods and compositions for treating genetic conditions |
WO2014186686A2 (en) * | 2013-05-17 | 2014-11-20 | Two Blades Foundation | Targeted mutagenesis and genome engineering in plants using rna-guided cas nucleases |
WO2014190181A1 (en) | 2013-05-22 | 2014-11-27 | Northwestern University | Rna-directed dna cleavage and gene editing by cas9 enzyme from neisseria meningitidis |
WO2014194190A1 (en) | 2013-05-30 | 2014-12-04 | The Penn State Research Foundation | Gene targeting and genetic modification of plants via rna-guided genome editing |
US9267135B2 (en) | 2013-06-04 | 2016-02-23 | President And Fellows Of Harvard College | RNA-guided transcriptional regulation |
EP3603679B1 (en) * | 2013-06-04 | 2022-08-10 | President and Fellows of Harvard College | Rna-guided transcriptional regulation |
EP3004370A4 (en) * | 2013-06-05 | 2017-01-11 | Duke University | Rna-guided gene editing and gene regulation |
US9982277B2 (en) | 2013-06-11 | 2018-05-29 | The Regents Of The University Of California | Methods and compositions for target DNA modification |
DK3011031T3 (en) | 2013-06-17 | 2020-12-21 | Broad Inst Inc | PERFORMANCE AND APPLICATION OF CRISPR-CAS SYSTEMS, VECTORS AND COMPOSITIONS FOR LIVER TARGET DIRECTION AND THERAPY |
KR20160034901A (en) | 2013-06-17 | 2016-03-30 | 더 브로드 인스티튜트, 인코퍼레이티드 | Optimized crispr-cas double nickase systems, methods and compositions for sequence manipulation |
EP3011033B1 (en) * | 2013-06-17 | 2020-02-19 | The Broad Institute, Inc. | Functional genomics using crispr-cas systems, compositions methods, screens and applications thereof |
ES2777217T3 (en) | 2013-06-17 | 2020-08-04 | Broad Inst Inc | Supply, modification and optimization of tandem guidance systems, methods and compositions for sequence manipulation |
SG11201510286QA (en) * | 2013-06-17 | 2016-01-28 | Broad Inst Inc | Delivery, use and therapeutic applications of the crispr-cas systems and compositions for targeting disorders and diseases using viral components |
WO2015006498A2 (en) | 2013-07-09 | 2015-01-15 | President And Fellows Of Harvard College | Therapeutic uses of genome editing with crispr/cas systems |
BR112016000571B1 (en) | 2013-07-10 | 2023-12-26 | President And Fellows Of Harvard College | IN VITRO METHODS FOR MODULATING EXPRESSION AND FOR ALTERING ONE OR MORE TARGET NUCLEIC ACIDS IN A CELL SIMULTANEOUSLY WITH REGULATING THE EXPRESSION OF ONE OR MORE TARGET NUCLEIC ACIDS IN A CELL AS WELL AS A YEAST OR BACTERIAL CELL COMPRISING NUCLEIC ACIDS |
US11060083B2 (en) | 2013-07-19 | 2021-07-13 | Larix Bioscience Llc | Methods and compositions for producing double allele knock outs |
US9663782B2 (en) | 2013-07-19 | 2017-05-30 | Larix Bioscience Llc | Methods and compositions for producing double allele knock outs |
US11306328B2 (en) | 2013-07-26 | 2022-04-19 | President And Fellows Of Harvard College | Genome engineering |
US9163284B2 (en) * | 2013-08-09 | 2015-10-20 | President And Fellows Of Harvard College | Methods for identifying a target site of a Cas9 nuclease |
SG11201601927SA (en) | 2013-08-16 | 2016-04-28 | Massachusetts Inst Technology | Selective delivery of material to cells |
LT3036327T (en) | 2013-08-22 | 2019-06-25 | Pioneer Hi-Bred International, Inc. | Genome modification using guide polynucleotide/cas endonuclease systems and methods of use |
US9359599B2 (en) | 2013-08-22 | 2016-06-07 | President And Fellows Of Harvard College | Engineered transcription activator-like effector (TALE) domains and uses thereof |
EP3039136B8 (en) | 2013-08-28 | 2020-12-16 | Sangamo Therapeutics, Inc. | Compositions for linking dna-binding domains and cleavage domains |
US20160251410A1 (en) | 2013-09-03 | 2016-09-01 | Yissum Research Development Company Of The Hebrew University Of Jerusalem Ltd. | Compositions and methods for expressing recombinant polypeptides |
US9737604B2 (en) | 2013-09-06 | 2017-08-22 | President And Fellows Of Harvard College | Use of cationic lipids to deliver CAS9 |
US9340800B2 (en) * | 2013-09-06 | 2016-05-17 | President And Fellows Of Harvard College | Extended DNA-sensing GRNAS |
US9388430B2 (en) | 2013-09-06 | 2016-07-12 | President And Fellows Of Harvard College | Cas9-recombinase fusion proteins and uses thereof |
CA2924650C (en) | 2013-09-17 | 2019-10-22 | Board Of Trustees Of The University Of Arkansas | E. coli separatome-based protein expression and purification platform |
CN105637087A (en) * | 2013-09-18 | 2016-06-01 | 科马布有限公司 | Methods, cells and organisms |
US10822606B2 (en) * | 2013-09-27 | 2020-11-03 | The Regents Of The University Of California | Optimized small guide RNAs and methods of use |
AU2014337248B2 (en) | 2013-10-17 | 2020-09-24 | Sangamo Therapeutics, Inc. | Delivery methods and compositions for nuclease-mediated genome engineering |
WO2015057976A1 (en) | 2013-10-17 | 2015-04-23 | Sangamo Biosciences, Inc. | Delivery methods and compositions for nuclease-mediated genome engineering in hematopoietic stem cells |
US10767156B2 (en) | 2013-10-24 | 2020-09-08 | Yeda Research And Development Co., Ltd. | Polynucleotides encoding BREX system polypeptides and methods of using same |
WO2015065964A1 (en) | 2013-10-28 | 2015-05-07 | The Broad Institute Inc. | Functional genomics using crispr-cas systems, compositions, methods, screens and applications thereof |
WO2015066119A1 (en) * | 2013-10-30 | 2015-05-07 | North Carolina State University | Compositions and methods related to a type-ii crispr-cas system in lactobacillus buchneri |
US11326209B2 (en) * | 2013-11-07 | 2022-05-10 | Massachusetts Institute Of Technology | Cell-based genomic recorded accumulative memory |
US9074199B1 (en) | 2013-11-19 | 2015-07-07 | President And Fellows Of Harvard College | Mutant Cas9 proteins |
US10787684B2 (en) | 2013-11-19 | 2020-09-29 | President And Fellows Of Harvard College | Large gene excision and insertion |
CN105980568B (en) | 2013-12-11 | 2019-12-03 | 瑞泽恩制药公司 | Method and composition for targeting modification genome |
JP6625055B2 (en) | 2013-12-12 | 2020-01-08 | ザ・ブロード・インスティテュート・インコーポレイテッド | Compositions and methods of using the CRISPR-CAS system in nucleotide repeat disorders |
DK3079725T3 (en) | 2013-12-12 | 2020-01-20 | Broad Inst Inc | ADMINISTRATION, USE, AND THERAPEUTICAL APPLICATIONS OF CRISPR CAS SYSTEMS AND COMPOSITIONS FOR RETURNING |
CN111269902A (en) | 2013-12-12 | 2020-06-12 | 布罗德研究所有限公司 | Delivery and use of CRISPR-CAS systems and compositions |
EP4219699A1 (en) | 2013-12-12 | 2023-08-02 | The Broad Institute, Inc. | Engineering of systems, methods and optimized guide compositions with new architectures for sequence manipulation |
KR20160089526A (en) | 2013-12-12 | 2016-07-27 | 더 브로드 인스티튜트, 인코퍼레이티드 | Delivery, use and therapeutic applications of the crispr-cas systems and compositions for targeting disorders and diseases using particle delivery components |
US20150166984A1 (en) | 2013-12-12 | 2015-06-18 | President And Fellows Of Harvard College | Methods for correcting alpha-antitrypsin point mutations |
WO2015089364A1 (en) | 2013-12-12 | 2015-06-18 | The Broad Institute Inc. | Crystal structure of a crispr-cas system, and uses thereof |
AU2014361834B2 (en) | 2013-12-12 | 2020-10-22 | Massachusetts Institute Of Technology | CRISPR-Cas systems and methods for altering expression of gene products, structural information and inducible modular Cas enzymes |
WO2015089486A2 (en) | 2013-12-12 | 2015-06-18 | The Broad Institute Inc. | Systems, methods and compositions for sequence manipulation with optimized functional crispr-cas systems |
US9994831B2 (en) * | 2013-12-12 | 2018-06-12 | The Regents Of The University Of California | Methods and compositions for modifying a single stranded target nucleic acid |
JP2017505756A (en) | 2013-12-13 | 2017-02-23 | ザ ジェネラル ホスピタル コーポレイション | Soluble high molecular weight (HMW) tau species and uses thereof |
RU2714902C2 (en) | 2013-12-19 | 2020-02-20 | Новартис Аг | Chimeric human mesotheliogen antigen receptors and use thereof |
US11839632B2 (en) | 2013-12-20 | 2023-12-12 | Seed Health, Inc. | Topical application of CRISPR-modified bacteria to treat acne vulgaris |
US11980643B2 (en) | 2013-12-20 | 2024-05-14 | Seed Health, Inc. | Method and system to modify an individual's gut-brain axis to provide neurocognitive protection |
US11969445B2 (en) | 2013-12-20 | 2024-04-30 | Seed Health, Inc. | Probiotic composition and method for controlling excess weight, obesity, NAFLD and NASH |
US11833177B2 (en) | 2013-12-20 | 2023-12-05 | Seed Health, Inc. | Probiotic to enhance an individual's skin microbiome |
US11826388B2 (en) | 2013-12-20 | 2023-11-28 | Seed Health, Inc. | Topical application of Lactobacillus crispatus to ameliorate barrier damage and inflammation |
SG10201804439PA (en) | 2013-12-20 | 2018-06-28 | Hutchinson Fred Cancer Res | Tagged chimeric effector molecules and receptors thereof |
WO2015103026A2 (en) | 2014-01-03 | 2015-07-09 | The Regents Of The University Of Michigan | Treatment of neurological disorders |
US9850525B2 (en) * | 2014-01-29 | 2017-12-26 | Agilent Technologies, Inc. | CAS9-based isothermal method of detection of specific DNA sequence |
GB201401707D0 (en) * | 2014-01-31 | 2014-03-19 | Sec Dep For Health The | Adeno-associated viral vectors |
CN111705365A (en) | 2014-02-11 | 2020-09-25 | 科罗拉多州立大学董事会(法人团体) | CRISPR-supported multiplexed genome engineering |
US10287590B2 (en) * | 2014-02-12 | 2019-05-14 | Dna2.0, Inc. | Methods for generating libraries with co-varying regions of polynuleotides for genome modification |
KR20160130392A (en) | 2014-02-18 | 2016-11-11 | 듀크 유니버시티 | Compositions for the inactivation of virus replication and methods of making and using the same |
US11186843B2 (en) | 2014-02-27 | 2021-11-30 | Monsanto Technology Llc | Compositions and methods for site directed genomic modification |
WO2015130968A2 (en) | 2014-02-27 | 2015-09-03 | The Broad Institute Inc. | T cell balance gene expression, compositions of matters and methods of use thereof |
CN111500569A (en) * | 2014-03-05 | 2020-08-07 | 国立大学法人神户大学 | Method for modifying genome sequence of nucleic acid base for specifically converting target DNA sequence, and molecular complex used therefor |
EP3957735A1 (en) | 2014-03-05 | 2022-02-23 | Editas Medicine, Inc. | Crispr/cas-related methods and compositions for treating usher syndrome and retinitis pigmentosa |
US11339437B2 (en) | 2014-03-10 | 2022-05-24 | Editas Medicine, Inc. | Compositions and methods for treating CEP290-associated disease |
DK3116997T3 (en) | 2014-03-10 | 2019-08-19 | Editas Medicine Inc | CRISPR / CAS-RELATED PROCEDURES AND COMPOSITIONS TO TREAT LEVER'S CONGENITAL AMAUROSIS 10 (LCA10) |
US11141493B2 (en) | 2014-03-10 | 2021-10-12 | Editas Medicine, Inc. | Compositions and methods for treating CEP290-associated disease |
EP3116533B1 (en) * | 2014-03-12 | 2020-08-12 | Precision Biosciences, Inc. | Dystrophin gene exon deletion using engineered nucleases |
UA124375C2 (en) | 2014-03-14 | 2021-09-08 | Кібус Юс Ллс | Methods and compositions for increasing efficiency of targeted gene modification using oligonucleotide-mediated gene repair |
EP3593812A3 (en) | 2014-03-15 | 2020-05-27 | Novartis AG | Treatment of cancer using chimeric antigen receptor |
JP2017514513A (en) | 2014-03-20 | 2017-06-08 | ユニベルシテ ラバル | CRISPR-based methods and products for increasing frataxin levels and uses thereof |
EP3122880B1 (en) * | 2014-03-26 | 2021-05-05 | Editas Medicine, Inc. | Crispr/cas-related methods and compositions for treating sickle cell disease |
KR20240042250A (en) | 2014-04-07 | 2024-04-01 | 노파르티스 아게 | Treatment of cancer using anti-cd19 chimeric antigen receptor |
CN106460003A (en) | 2014-04-08 | 2017-02-22 | 北卡罗来纳州立大学 | Methods and compositions for RNA-directed repression of transcription using CRISPR-associated genes |
EP3132030B1 (en) * | 2014-04-18 | 2020-08-26 | Editas Medicine, Inc. | Crispr-cas-related methods, compositions and components for cancer immunotherapy |
EP3134729A1 (en) * | 2014-04-22 | 2017-03-01 | Q-State Biosciences, Inc. | Analysis of compounds for pain and sensory disorders |
WO2015168404A1 (en) * | 2014-04-30 | 2015-11-05 | Massachusetts Institute Of Technology | Toehold-gated guide rna for programmable cas9 circuitry with rna input |
GB201407852D0 (en) | 2014-05-02 | 2014-06-18 | Iontas Ltd | Preparation of libraries od protein variants expressed in eukaryotic cells and use for selecting binding molecules |
WO2015175642A2 (en) | 2014-05-13 | 2015-11-19 | Sangamo Biosciences, Inc. | Methods and compositions for prevention or treatment of a disease |
WO2015184262A1 (en) * | 2014-05-30 | 2015-12-03 | The Board Of Trustees Of The Leland Stanford Junior University | Compositions and methods of delivering treatments for latent viral infections |
US9970001B2 (en) | 2014-06-05 | 2018-05-15 | Sangamo Therapeutics, Inc. | Methods and compositions for nuclease design |
LT3152312T (en) * | 2014-06-06 | 2020-04-27 | Regeneron Pharmaceuticals, Inc. | Methods and compositions for modifying a targeted locus |
WO2015191693A2 (en) | 2014-06-10 | 2015-12-17 | Massachusetts Institute Of Technology | Method for gene editing |
EP3154694A1 (en) | 2014-06-13 | 2017-04-19 | Children's Medical Center Corporation | Products and methods to isolate mitochondria |
ES2788426T3 (en) | 2014-06-16 | 2020-10-21 | Univ Johns Hopkins | Compositions and Methods for the Expression of CRISPR Guide RNAs Using the H1 Promoter |
PT3155099T (en) | 2014-06-23 | 2018-04-20 | Regeneron Pharma | Nuclease-mediated dna assembly |
CN106604994B (en) | 2014-06-23 | 2021-12-14 | 通用医疗公司 | Whole genome unbiased identification of DSBs by sequencing evaluation (GUIDE-Seq) |
RU2771532C2 (en) | 2014-06-26 | 2022-05-05 | Регенерон Фармасьютикалз, Инк. | Methods and compositions for targeted genetic modifications and their application methods |
US20180187172A1 (en) * | 2014-07-01 | 2018-07-05 | Board Of Regents, The University Of Texas System | Regulated gene expression from viral vectors |
WO2016005985A2 (en) | 2014-07-09 | 2016-01-14 | Yissum Research Development Company Of The Hebrew University Of Jerusalem Ltd. | Method for reprogramming cells |
WO2016007347A1 (en) | 2014-07-11 | 2016-01-14 | E. I. Du Pont De Nemours And Company | Compositions and methods for producing plants resistant to glyphosate herbicide |
WO2016011080A2 (en) * | 2014-07-14 | 2016-01-21 | The Regents Of The University Of California | Crispr/cas transcriptional modulation |
CN106572974B (en) | 2014-07-15 | 2021-04-23 | 生命技术公司 | Compositions and methods having lipid aggregates for efficient delivery of molecules to cells |
JP2017528433A (en) | 2014-07-21 | 2017-09-28 | ノバルティス アーゲー | Low immunoenhancing dose of mTOR inhibitor and CAR combination |
MX2017001011A (en) | 2014-07-21 | 2018-05-28 | Novartis Ag | Treatment of cancer using humanized anti-bcma chimeric antigen receptor. |
CN107109419B (en) | 2014-07-21 | 2020-12-22 | 诺华股份有限公司 | Treatment of cancer using CD33 chimeric antigen receptor |
US11542488B2 (en) | 2014-07-21 | 2023-01-03 | Novartis Ag | Sortase synthesized chimeric antigen receptors |
WO2016014794A1 (en) | 2014-07-25 | 2016-01-28 | Sangamo Biosciences, Inc. | Methods and compositions for modulating nuclease-mediated genome engineering in hematopoietic stem cells |
US9757420B2 (en) | 2014-07-25 | 2017-09-12 | Sangamo Therapeutics, Inc. | Gene editing for HIV gene therapy |
WO2016022363A2 (en) | 2014-07-30 | 2016-02-11 | President And Fellows Of Harvard College | Cas9 proteins including ligand-dependent inteins |
WO2016019144A2 (en) | 2014-07-30 | 2016-02-04 | Sangamo Biosciences, Inc. | Gene correction of scid-related genes in hematopoietic stem and progenitor cells |
US20170209492A1 (en) | 2014-07-31 | 2017-07-27 | Novartis Ag | Subset-optimized chimeric antigen receptor-containing t-cells |
WO2016022866A1 (en) * | 2014-08-07 | 2016-02-11 | Agilent Technologies, Inc. | Cis-blocked guide rna |
WO2016022931A1 (en) * | 2014-08-07 | 2016-02-11 | The Rockefeller University | Compositions and methods for transcription-based crispr-cas dna editing |
US10513711B2 (en) | 2014-08-13 | 2019-12-24 | Dupont Us Holding, Llc | Genetic targeting in non-conventional yeast using an RNA-guided endonuclease |
WO2016025759A1 (en) | 2014-08-14 | 2016-02-18 | Shen Yuelei | Dna knock-in system |
WO2016025880A1 (en) | 2014-08-14 | 2016-02-18 | Novartis Ag | Treatment of cancer using gfr alpha-4 chimeric antigen receptor |
EP3686279B1 (en) | 2014-08-17 | 2023-01-04 | The Broad Institute, Inc. | Genome editing using cas9 nickases |
EP3183358B1 (en) | 2014-08-19 | 2020-10-07 | President and Fellows of Harvard College | Rna-guided systems for probing and mapping of nucleic acids |
SG11201700770PA (en) | 2014-08-19 | 2017-03-30 | Novartis Ag | Anti-cd123 chimeric antigen receptor (car) for use in cancer treatment |
US10435685B2 (en) | 2014-08-19 | 2019-10-08 | Pacific Biosciences Of California, Inc. | Compositions and methods for enrichment of nucleic acids |
EP3633032A3 (en) | 2014-08-28 | 2020-07-29 | North Carolina State University | Novel cas9 proteins and guiding features for dna targeting and genome editing |
WO2016036754A1 (en) | 2014-09-02 | 2016-03-10 | The Regents Of The University Of California | Methods and compositions for rna-directed target dna modification |
EP3191578B1 (en) | 2014-09-12 | 2020-11-04 | Whitehead Institute for Biomedical Research | Cells expressing apolipoprotein e and uses thereof |
EP3191595B1 (en) | 2014-09-12 | 2019-12-25 | E. I. du Pont de Nemours and Company | Generation of site-specific-integration sites for complex trait loci in corn and soybean, and methods of use |
IL234638A0 (en) | 2014-09-14 | 2014-12-02 | Yeda Res & Dev | Nmda receptor antagonists for treating gaucher disease |
SG11201702134RA (en) | 2014-09-16 | 2017-04-27 | Sangamo Therapeutics Inc | Methods and compositions for nuclease-mediated genome engineering and correction in hematopoietic stem cells |
US10577417B2 (en) | 2014-09-17 | 2020-03-03 | Novartis Ag | Targeting cytotoxic cells with chimeric receptors for adoptive immunotherapy |
WO2016049163A2 (en) | 2014-09-24 | 2016-03-31 | The Broad Institute Inc. | Use and production of chd8+/- transgenic animals with behavioral phenotypes characteristic of autism spectrum disorder |
WO2016049251A1 (en) | 2014-09-24 | 2016-03-31 | The Broad Institute Inc. | Delivery, use and therapeutic applications of the crispr-cas systems and compositions for modeling mutations in leukocytes |
WO2016049024A2 (en) | 2014-09-24 | 2016-03-31 | The Broad Institute Inc. | Delivery, use and therapeutic applications of the crispr-cas systems and compositions for modeling competition of multiple cancer mutations in vivo |
US10040048B1 (en) | 2014-09-25 | 2018-08-07 | Synthego Corporation | Automated modular system and method for production of biopolymers |
WO2016049258A2 (en) | 2014-09-25 | 2016-03-31 | The Broad Institute Inc. | Functional screening with optimized functional crispr-cas systems |
EP3197269A1 (en) | 2014-09-26 | 2017-08-02 | Purecircle Usa Inc. | Single nucleotide polymorphism (snp) markers for stevia |
JP2017534295A (en) | 2014-09-29 | 2017-11-24 | ザ ジャクソン ラボラトリー | High-efficiency, high-throughput generation of genetically modified mammals by electroporation |
KR102630014B1 (en) | 2014-10-01 | 2024-01-25 | 더 제너럴 하스피탈 코포레이션 | Methods for increasing efficiency of nuclease-induced homology-directed repair |
SG11201702309RA (en) | 2014-10-15 | 2017-04-27 | Regeneron Pharma | Methods and compositions for generating or maintaining pluripotent cells |
WO2016061523A1 (en) | 2014-10-17 | 2016-04-21 | Howard Hughes Medical Institute | Genomic probes |
JP6779217B2 (en) | 2014-10-24 | 2020-11-04 | アヴェクタス リミテッド | Delivery method across the cell plasma membrane |
WO2016069591A2 (en) | 2014-10-27 | 2016-05-06 | The Broad Institute Inc. | Compositions, methods and use of synthetic lethal screening |
EP3215168B1 (en) * | 2014-10-31 | 2023-08-02 | The Trustees of the University of Pennsylvania | Altering gene expression in modified t cells and uses thereof |
SG11201703044PA (en) | 2014-10-31 | 2017-05-30 | Massachusetts Inst Technology | Delivery of biomolecules to immune cells |
DK3212789T3 (en) | 2014-10-31 | 2020-07-27 | Massachusetts Inst Technology | MASSIVE PARALLEL COMBINATORY GENETICS FOR CRISPR |
CN107406838A (en) | 2014-11-06 | 2017-11-28 | 纳幕尔杜邦公司 | Peptide-mediated delivering of the endonuclease of RNA guiding into cell |
CA2974716A1 (en) | 2014-11-12 | 2016-05-19 | Nmc, Inc. | Transgenic plants with engineered redox sensitive modulation of photosynthetic antenna complex pigments and methods for making the same |
WO2016080097A1 (en) * | 2014-11-17 | 2016-05-26 | 国立大学法人東京医科歯科大学 | Method for easily and highly efficiently creating genetically modified nonhuman mammal |
KR20230070319A (en) | 2014-11-21 | 2023-05-22 | 리제너론 파마슈티칼스 인코포레이티드 | METHODS AND COMPOSITIONS FOR TARGETED GENETIC MODIFICATION USING PAIRED GUIDE RNAs |
WO2016086197A1 (en) | 2014-11-25 | 2016-06-02 | The Brigham And Women's Hospital, Inc. | Method of identifying and treating a person having a predisposition to or afflicted with a cardiometabolic disease |
KR101833433B1 (en) | 2014-11-25 | 2018-02-28 | 한국생명공학연구원 | Production of cell line for porcine T-cell and B-cell immunodeficiency and a method of manufacturing |
EP3224362A4 (en) | 2014-11-26 | 2018-06-06 | The Regents of The University of California | Therapeutic compositions comprising transcription factors and methods of making and using the same |
GB201421096D0 (en) | 2014-11-27 | 2015-01-14 | Imp Innovations Ltd | Genome editing methods |
CA2969619A1 (en) | 2014-12-03 | 2016-06-09 | Agilent Technologies, Inc. | Guide rna with chemical modifications |
WO2016094867A1 (en) | 2014-12-12 | 2016-06-16 | The Broad Institute Inc. | Protected guide rnas (pgrnas) |
EP3230452A1 (en) | 2014-12-12 | 2017-10-18 | The Broad Institute Inc. | Dead guides for crispr transcription factors |
WO2016094874A1 (en) | 2014-12-12 | 2016-06-16 | The Broad Institute Inc. | Escorted and functionalized guides for crispr-cas systems |
WO2016094880A1 (en) | 2014-12-12 | 2016-06-16 | The Broad Institute Inc. | Delivery, use and therapeutic applications of crispr systems and compositions for genome editing as to hematopoietic stem cells (hscs) |
US10889834B2 (en) | 2014-12-15 | 2021-01-12 | Sangamo Therapeutics, Inc. | Methods and compositions for enhancing targeted transgene integration |
WO2016100333A1 (en) | 2014-12-15 | 2016-06-23 | Syngenta Participations Ag | Pesticidal microrna carriers and use thereof |
EP3234150A1 (en) | 2014-12-16 | 2017-10-25 | Danisco US Inc. | Fungal genome modification systems and methods of use |
CN107223157B (en) | 2014-12-16 | 2021-01-08 | 丹尼斯科美国公司 | Compositions and methods for helper-strain-mediated modification of fungal genomes |
EA038595B1 (en) | 2014-12-16 | 2021-09-21 | Си3Джей ТЕРАПЬЮТИКС, ИНК. | Compositions and methods for in vitro viral genome engineering |
EP3234133B1 (en) * | 2014-12-18 | 2020-11-11 | Integrated DNA Technologies, Inc. | Crispr-based compositions and methods of use |
WO2016100974A1 (en) | 2014-12-19 | 2016-06-23 | The Broad Institute Inc. | Unbiased identification of double-strand breaks and genomic rearrangement by genome-wide insert capture sequencing |
WO2016100857A1 (en) | 2014-12-19 | 2016-06-23 | Regeneron Pharmaceuticals, Inc. | Stem cells for modeling type 2 diabetes |
US20190054117A1 (en) | 2014-12-19 | 2019-02-21 | Novartis Ag | Dimerization switches and uses thereof |
BR112017013104A2 (en) | 2014-12-19 | 2018-05-15 | Regeneron Pharma | methods for modifying a target genomic locus in a cell, for enhancing homologous recombination at a target genomic locus in a cell, and for producing an f0 generation from a nonhuman animal. |
ES2785329T3 (en) | 2014-12-23 | 2020-10-06 | Syngenta Participations Ag | Methods and Compositions for Identifying and Enriching Cells Comprising Site-Specific Genomic Modifications |
WO2016106236A1 (en) | 2014-12-23 | 2016-06-30 | The Broad Institute Inc. | Rna-targeting system |
CA2970370A1 (en) | 2014-12-24 | 2016-06-30 | Massachusetts Institute Of Technology | Crispr having or associated with destabilization domains |
WO2016108926A1 (en) | 2014-12-30 | 2016-07-07 | The Broad Institute Inc. | Crispr mediated in vivo modeling and genetic screening of tumor growth and metastasis |
JP2018500037A (en) * | 2014-12-31 | 2018-01-11 | シンセティック ジェノミクス インコーポレーテッド | Compositions and methods for highly efficient in vivo genome editing |
CN107250373A (en) * | 2015-01-12 | 2017-10-13 | 麻省理工学院 | The gene editing realized is delivered by microfluid |
WO2016114972A1 (en) | 2015-01-12 | 2016-07-21 | The Regents Of The University Of California | Heterodimeric cas9 and methods of use thereof |
WO2016112963A1 (en) | 2015-01-13 | 2016-07-21 | Riboxx Gmbh | Delivery of biomolecules into cells |
JP7239266B2 (en) * | 2015-01-19 | 2023-03-14 | スージョウ チー バイオデザイン バイオテクノロジー カンパニー リミテッド | Methods for precisely modifying plants by transient gene expression |
EP3247366A4 (en) | 2015-01-21 | 2018-10-31 | Sangamo Therapeutics, Inc. | Methods and compositions for identification of highly specific nucleases |
US11421241B2 (en) | 2015-01-27 | 2022-08-23 | Institute Of Genetics And Developmental Biology, Chinese Academy Of Sciences | Method for conducting site-specific modification on entire plant via gene transient expression |
BR112017016080B1 (en) | 2015-01-28 | 2024-02-20 | Caribou Biosciences, Inc | UNIQUE CLASS 2 CRISPR POLYNUCLEOTIDE, CLASS 2 CRISPR SYSTEM AND IN VITRO METHOD OF MODIFYING A TARGET NUCLEIC ACID MOLECULE IN A NON-HUMAN ORGANISM, OR IN A CELL |
US11180792B2 (en) | 2015-01-28 | 2021-11-23 | The Regents Of The University Of California | Methods and compositions for labeling a single-stranded target nucleic acid |
ES2894882T3 (en) | 2015-01-29 | 2022-02-16 | Meiogenix | Procedure for inducing directed meiotic recombinations |
WO2016124918A1 (en) | 2015-02-03 | 2016-08-11 | The Institute Of Genetics And Developmental Biology | Plants with increased seed size |
WO2016124920A1 (en) | 2015-02-03 | 2016-08-11 | The Institute Of Genetics And Developmental Biology | Rice plants with altered seed phenotype and quality |
CN115029362A (en) | 2015-02-06 | 2022-09-09 | 新加坡国立大学 | Nucleic acids, engineered immune cells comprising the same, methods of production and uses thereof |
EP3262193A2 (en) | 2015-02-26 | 2018-01-03 | The Broad Institute Inc. | T cell balance gene expression, compositions of matters and methods of use thereof |
TW201702380A (en) * | 2015-02-27 | 2017-01-16 | 再生元醫藥公司 | Host cell protein modification |
WO2016138574A1 (en) | 2015-03-02 | 2016-09-09 | Sinai Health System | Homologous recombination factors |
HUE051749T2 (en) * | 2015-03-02 | 2021-03-29 | Conagen Inc | Regulatory elements from labyrinthulomycetes microorganisms |
CN107532161A (en) | 2015-03-03 | 2018-01-02 | 通用医疗公司 | The specific engineering CRISPR Cas9 nucleases of PAM with change |
WO2016142427A1 (en) | 2015-03-10 | 2016-09-15 | INSERM (Institut National de la Santé et de la Recherche Médicale) | Method ank kit for reprogramming somatic cells |
US10410118B2 (en) | 2015-03-13 | 2019-09-10 | Deep Genomics Incorporated | System and method for training neural networks |
EP3929291A1 (en) | 2015-03-17 | 2021-12-29 | Bio-Rad Laboratories, Inc. | Detection of genome editing |
EP4218771A1 (en) | 2015-03-27 | 2023-08-02 | Yeda Research and Development Co. Ltd | Methods of treating motor neuron diseases |
US10450576B2 (en) | 2015-03-27 | 2019-10-22 | E I Du Pont De Nemours And Company | Soybean U6 small nuclear RNA gene promoters and their use in constitutive expression of small RNA genes in plants |
KR20180029953A (en) | 2015-03-31 | 2018-03-21 | 엑셀리겐 사이언티픽, 인코포레이티드 | The Cas 9 retrovirus integrase system and the Cas 9 recombinant enzyme system for targeting incorporation of DNA sequences into the genome of cells or organisms |
EP3280803B1 (en) | 2015-04-06 | 2021-05-26 | The Board of Trustees of the Leland Stanford Junior University | Chemically modified guide rnas for crispr/cas-mediated gene regulation |
WO2016164797A1 (en) | 2015-04-08 | 2016-10-13 | University Of Pittsburgh - Of The Commonwealth System Of Higher Education | Activatable crispr/cas9 for spatial and temporal control of genome editing |
GB201506509D0 (en) | 2015-04-16 | 2015-06-03 | Univ Wageningen | Nuclease-mediated genome editing |
EP3286211A1 (en) | 2015-04-23 | 2018-02-28 | Novartis AG | Treatment of cancer using chimeric antigen receptor and protein kinase a blocker |
JP2018522249A (en) | 2015-04-24 | 2018-08-09 | エディタス・メディシン、インコーポレイテッド | Evaluation of CAS 9 molecule / guide RNA molecule complex |
EP3288570A4 (en) | 2015-04-29 | 2018-11-21 | Fred Hutchinson Cancer Research Center | Modified stem cells and uses thereof |
US20160346359A1 (en) * | 2015-05-01 | 2016-12-01 | Spark Therapeutics, Inc. | Adeno-associated Virus-Mediated CRISPR-Cas9 Treatment of Ocular Disease |
EP3461337A1 (en) | 2015-05-06 | 2019-04-03 | Snipr Technologies Limited | Altering microbial populations & modifying microbiota |
US10179918B2 (en) | 2015-05-07 | 2019-01-15 | Sangamo Therapeutics, Inc. | Methods and compositions for increasing transgene activity |
WO2016182893A1 (en) | 2015-05-08 | 2016-11-17 | Teh Broad Institute Inc. | Functional genomics using crispr-cas systems for saturating mutagenesis of non-coding elements, compositions, methods, libraries and applications thereof |
ES2962885T3 (en) | 2015-05-15 | 2024-03-21 | Massachusetts Gen Hospital | Tumor necrosis factor receptor superfamily antagonist antibodies |
IL296365A (en) | 2015-05-16 | 2022-11-01 | Genzyme Corp | Gene editing of deep intronic mutations |
EP3466967A1 (en) | 2015-05-18 | 2019-04-10 | TCR2 Therapeutics Inc. | Compositions and methods for tcr reprogramming using fusion proteins |
DE102015014252A1 (en) | 2015-11-05 | 2017-05-11 | Kws Saat Se | Methods and constructs for targeted nucleic acid editing in plants |
DE102015006335A1 (en) | 2015-05-19 | 2016-11-24 | Kws Saat Se | Methods and constructs for targeted nucleic acid editing in plants |
EP3095870A1 (en) | 2015-05-19 | 2016-11-23 | Kws Saat Se | Methods for the in planta transformation of plants and manufacturing processes and products based and obtainable therefrom |
KR102562733B1 (en) | 2015-05-22 | 2023-08-03 | 주식회사 에스티큐브앤컴퍼니 | Screening methods for targets for cancer treatment |
US10117911B2 (en) | 2015-05-29 | 2018-11-06 | Agenovir Corporation | Compositions and methods to treat herpes simplex virus infections |
EP3302048B1 (en) | 2015-05-29 | 2020-02-19 | Regeneron Pharmaceuticals, Inc. | Non-human animals having a disruption in a c9orf72 locus |
CN108368502B (en) | 2015-06-03 | 2022-03-18 | 内布拉斯加大学董事委员会 | DNA editing using single-stranded DNA |
US10392607B2 (en) | 2015-06-03 | 2019-08-27 | The Regents Of The University Of California | Cas9 variants and methods of use thereof |
WO2016193945A2 (en) | 2015-06-05 | 2016-12-08 | Novartis Ag | Methods and compositions for diagnosing, treating, and monitoring treatment of shank3 deficiency associated disorders |
US10185803B2 (en) | 2015-06-15 | 2019-01-22 | Deep Genomics Incorporated | Systems and methods for classifying, prioritizing and interpreting genetic variants and therapies using a deep neural network |
CN108026545A (en) | 2015-06-17 | 2018-05-11 | Uab研究基金会 | For the CRISPR/CAS9 compounds introducing functional polypeptide in blood cell lineages cell |
EP3310932B1 (en) | 2015-06-17 | 2023-08-30 | The UAB Research Foundation | Crispr/cas9 complex for genomic editing |
WO2016205728A1 (en) | 2015-06-17 | 2016-12-22 | Massachusetts Institute Of Technology | Crispr mediated recording of cellular events |
WO2016205613A1 (en) | 2015-06-18 | 2016-12-22 | The Broad Institute Inc. | Crispr enzyme mutations reducing off-target effects |
WO2016205745A2 (en) | 2015-06-18 | 2016-12-22 | The Broad Institute Inc. | Cell sorting |
WO2016205749A1 (en) | 2015-06-18 | 2016-12-22 | The Broad Institute Inc. | Novel crispr enzymes and systems |
US9790490B2 (en) * | 2015-06-18 | 2017-10-17 | The Broad Institute Inc. | CRISPR enzymes and systems |
WO2016205759A1 (en) | 2015-06-18 | 2016-12-22 | The Broad Institute Inc. | Engineering and optimization of systems, methods, enzymes and guide scaffolds of cas9 orthologs and variants for sequence manipulation |
FI3430134T3 (en) | 2015-06-18 | 2023-01-13 | Novel crispr enzymes and systems | |
US9957501B2 (en) | 2015-06-18 | 2018-05-01 | Sangamo Therapeutics, Inc. | Nuclease-mediated regulation of gene expression |
US10648020B2 (en) | 2015-06-18 | 2020-05-12 | The Broad Institute, Inc. | CRISPR enzymes and systems |
WO2016210292A1 (en) | 2015-06-25 | 2016-12-29 | Children's Medical Center Corporation | Methods and compositions relating to hematopoietic stem cell expansion, enrichment, and maintenance |
AU2016285724A1 (en) | 2015-06-29 | 2017-11-16 | Ionis Pharmaceuticals, Inc. | Modified CRISPR RNA and modified single CRISPR RNA and uses thereof |
CA2988996A1 (en) | 2015-07-09 | 2017-01-12 | Massachusetts Institute Of Technology | Delivery of materials to anucleate cells |
US10450585B2 (en) | 2015-07-13 | 2019-10-22 | Sangamo Therapeutics, Inc. | Delivery methods and compositions for nuclease-mediated genome engineering |
CA2992580C (en) | 2015-07-15 | 2022-09-20 | Rutgers, The State University Of New Jersey | Nuclease-independent targeted gene editing platform and uses thereof |
EP3943098A3 (en) | 2015-07-16 | 2022-05-11 | Biokine Therapeutics Ltd. | Compositions and methods for treating cancer |
AU2016295291A1 (en) | 2015-07-17 | 2018-02-08 | Institute Of Genetics And Developmental Biology Chinese Academy Of Sciences | Wheat plants resistant to powdery mildew |
WO2017015101A1 (en) * | 2015-07-17 | 2017-01-26 | University Of Washington | Methods for maximizing the efficiency of targeted gene correction |
DK3329001T3 (en) | 2015-07-28 | 2021-12-20 | Danisco Us Inc | RE-EDITING SYSTEMS AND APPLICATION PROCEDURES |
CA2995036A1 (en) | 2015-08-06 | 2017-02-09 | Dana-Farber Cancer Institute, Inc. | Tunable endogenous protein degradation |
WO2017024317A2 (en) | 2015-08-06 | 2017-02-09 | Dana-Farber Cancer Institute, Inc. | Methods to induce targeted protein degradation through bifunctional molecules |
US9580727B1 (en) | 2015-08-07 | 2017-02-28 | Caribou Biosciences, Inc. | Compositions and methods of engineered CRISPR-Cas9 systems using split-nexus Cas9-associated polynucleotides |
US11667691B2 (en) | 2015-08-07 | 2023-06-06 | Novartis Ag | Treatment of cancer using chimeric CD3 receptor proteins |
CA3033617A1 (en) | 2015-08-11 | 2017-02-16 | Anie Philip | Peptidic tgf-beta antagonists |
JP2018529759A (en) | 2015-08-14 | 2018-10-11 | ザ ユニバーシティー オブ シドニー | Therapeutic connexin 45 inhibitor |
KR102127418B1 (en) | 2015-08-14 | 2020-06-26 | 인스티튜트 오브 제네틱스 앤드 디벨롭멘털 바이오롤지, 차이니즈 아카데미 오브 사이언시스 | Method for obtaining glyphosate-resistant rice through site-specific nucleotide substitution |
EP3337908A4 (en) | 2015-08-18 | 2019-01-23 | The Broad Institute, Inc. | Methods and compositions for altering function and structure of chromatin loops and/or domains |
CA2995582A1 (en) | 2015-08-19 | 2017-02-23 | Children's Research Institute, Children's National Medical Center | Compositions and methods for treating graft versus host disease |
JP6905755B2 (en) | 2015-08-25 | 2021-07-21 | デューク ユニバーシティ | Compositions and Methods to Improve Specificity in Genomic Engineering Using RNA-Guided Endonucleases |
WO2017041051A1 (en) | 2015-09-04 | 2017-03-09 | Sqz Biotechnologies Company | Intracellular delivery of biomolecules to cells comprising a cell wall |
CN108271384B (en) | 2015-09-09 | 2022-04-15 | 国立大学法人神户大学 | Method for converting gram-positive bacterium genome sequence for specifically converting nucleobase targeting DNA sequence, and molecular complex used therefor |
IL241462A0 (en) | 2015-09-10 | 2015-11-30 | Yeda Res & Dev | Heterologous engineering of betalain pigments in plants |
JP2018530536A (en) | 2015-09-11 | 2018-10-18 | ザ ジェネラル ホスピタル コーポレイション | Full verification and sequencing of nuclease DSB (FIND-seq) |
CN105132427B (en) * | 2015-09-21 | 2019-01-08 | 新疆畜牧科学院生物技术研究所 | A kind of dual-gene method for obtaining gene editing sheep of specific knockdown mediated with RNA and its dedicated sgRNA |
US9850484B2 (en) | 2015-09-30 | 2017-12-26 | The General Hospital Corporation | Comprehensive in vitro reporting of cleavage events by sequencing (Circle-seq) |
EP3356520B1 (en) | 2015-10-02 | 2022-03-23 | The U.S.A. as represented by the Secretary, Department of Health and Human Services | Lentiviral protein delivery system for rna-guided genome editing |
JP6929837B2 (en) | 2015-10-05 | 2021-09-15 | プレシジョン バイオサイエンシズ,インク. | A meganuclease engineered on a recognition sequence found in the human T cell receptor alpha constant region gene |
CN108601821B (en) | 2015-10-05 | 2023-09-19 | 精密生物科学公司 | Genetically modified cells comprising modified human T cell receptor alpha constant region genes |
US20190255107A1 (en) | 2015-10-09 | 2019-08-22 | The Brigham And Women's Hospital, Inc. | Modulation of novel immune checkpoint targets |
DK3362560T3 (en) | 2015-10-12 | 2022-11-07 | Dupont Us Holding Llc | PROTECTED DNA TEMPLATES FOR GENE MODIFICATION AND ENHANCED HOMOLOGOUS RECOMBINATION IN CELLS AND METHODS THEREOF |
EP4089175A1 (en) | 2015-10-13 | 2022-11-16 | Duke University | Genome engineering with type i crispr systems in eukaryotic cells |
US11207393B2 (en) | 2015-10-16 | 2021-12-28 | President And Fellows Of Harvard College | Regulatory T cell PD-1 modulation for regulating T cell effector immune responses |
CN108290939B (en) | 2015-10-16 | 2023-01-13 | 纽约市哥伦比亚大学理事会 | Compositions and methods for inhibiting lineage specific antigens |
WO2017070056A1 (en) * | 2015-10-20 | 2017-04-27 | 10X Genomics, Inc. | Methods and systems for high throughput single cell genetic manipulation |
CN109153980B (en) | 2015-10-22 | 2023-04-14 | 布罗德研究所有限公司 | CRISPR enzymes and systems of type VI-B |
WO2017068120A1 (en) * | 2015-10-22 | 2017-04-27 | Institut National De La Sante Et De La Recherche Medicale (Inserm) | Endonuclease-barcoding |
EP3159407A1 (en) | 2015-10-23 | 2017-04-26 | Silence Therapeutics (London) Ltd | Guide rnas, methods and uses |
US9677090B2 (en) | 2015-10-23 | 2017-06-13 | Caribou Biosciences, Inc. | Engineered nucleic-acid targeting nucleic acids |
IL258821B (en) | 2015-10-23 | 2022-07-01 | Harvard College | Nucleobase editors and uses thereof |
US11492670B2 (en) * | 2015-10-27 | 2022-11-08 | The Broad Institute Inc. | Compositions and methods for targeting cancer-specific sequence variations |
US11092607B2 (en) | 2015-10-28 | 2021-08-17 | The Board Institute, Inc. | Multiplex analysis of single cell constituents |
WO2017075478A2 (en) | 2015-10-28 | 2017-05-04 | The Broad Institute Inc. | Compositions and methods for evaluating and modulating immune responses by use of immune cell gene signatures |
WO2017075465A1 (en) | 2015-10-28 | 2017-05-04 | The Broad Institute Inc. | Compositions and methods for evaluating and modulating immune responses by detecting and targeting gata3 |
WO2017075294A1 (en) | 2015-10-28 | 2017-05-04 | The Board Institute Inc. | Assays for massively combinatorial perturbation profiling and cellular circuit reconstruction |
WO2017075451A1 (en) | 2015-10-28 | 2017-05-04 | The Broad Institute Inc. | Compositions and methods for evaluating and modulating immune responses by detecting and targeting pou2af1 |
WO2017075329A2 (en) | 2015-10-29 | 2017-05-04 | Dana-Farber Cancer Institute, Inc. | Methods for identification, assessment, prevention, and treatment of metabolic disorders using pm20d1 and n-lipidated amino acids |
WO2017079406A1 (en) | 2015-11-03 | 2017-05-11 | President And Fellows Of Harvard College | Method and apparatus for volumetric imaging of a three-dimensional nucleic acid containing matrix |
US10669320B2 (en) | 2015-11-18 | 2020-06-02 | The Regents Of The University Of Michigan | Mps1 and KNL1 phosphorylation system |
CA3000018A1 (en) | 2015-11-18 | 2017-05-26 | Timothy Joseph KELLIHER | Haploid induction compositions and methods for use therefor |
WO2017087708A1 (en) | 2015-11-19 | 2017-05-26 | The Brigham And Women's Hospital, Inc. | Lymphocyte antigen cd5-like (cd5l)-interleukin 12b (p40) heterodimers in immunity |
WO2017091630A1 (en) * | 2015-11-23 | 2017-06-01 | The Regents Of The University Of California | Tracking and manipulating cellular rna via nuclear delivery of crispr/cas9 |
EP3380622A4 (en) | 2015-11-23 | 2019-08-07 | Sangamo Therapeutics, Inc. | Methods and compositions for engineering immunity |
US11220693B2 (en) | 2015-11-27 | 2022-01-11 | National University Corporation Kobe University | Method for converting monocot plant genome sequence in which nucleic acid base in targeted DNA sequence is specifically converted, and molecular complex used therein |
US11903974B2 (en) | 2015-11-30 | 2024-02-20 | Flagship Pioneering Innovations V, Inc. | Methods and compositions relating to chondrisomes from cultured cells |
CN105296518A (en) * | 2015-12-01 | 2016-02-03 | 中国农业大学 | Homologous arm vector construction method used for CRISPR/Cas 9 technology |
KR102093570B1 (en) | 2015-12-04 | 2020-03-25 | 카리부 바이오사이언시스 인코포레이티드 | Engineered nucleic acid targeting nucleic acid |
US11208649B2 (en) | 2015-12-07 | 2021-12-28 | Zymergen Inc. | HTP genomic engineering platform |
US9988624B2 (en) | 2015-12-07 | 2018-06-05 | Zymergen Inc. | Microbial strain improvement by a HTP genomic engineering platform |
KR20180084756A (en) | 2015-12-07 | 2018-07-25 | 지머젠 인코포레이티드 | Promoter from Corynebacterium glutamicum |
US11345931B2 (en) | 2015-12-14 | 2022-05-31 | President And Fellows Of Harvard College | Cas discrimination using tuned guide RNA |
EP3390624A4 (en) * | 2015-12-18 | 2019-07-10 | The Regents of The University of California | Modified site-directed modifying polypeptides and methods of use thereof |
WO2017106528A2 (en) | 2015-12-18 | 2017-06-22 | Sangamo Biosciences, Inc. | Targeted disruption of the t cell receptor |
IL297018A (en) | 2015-12-18 | 2022-12-01 | Sangamo Therapeutics Inc | Targeted disruption of the mhc cell receptor |
WO2017112620A1 (en) | 2015-12-22 | 2017-06-29 | North Carolina State University | Methods and compositions for delivery of crispr based antimicrobials |
US11026969B2 (en) | 2015-12-23 | 2021-06-08 | Fred Hutchinson Cancer Research Center | High affinity T cell receptors and uses thereof |
ES2944597T3 (en) | 2015-12-30 | 2023-06-22 | Novartis Ag | Enhanced Efficacy Immune Effector Cell Therapies |
JP7449646B2 (en) | 2015-12-30 | 2024-03-14 | アヴェクタス リミテッド | Vector-free delivery of gene editing proteins and compositions to cells and tissues |
WO2017120147A1 (en) | 2016-01-04 | 2017-07-13 | The Board Of Trustees Of The Leland Stanford Junior University | Gene therapy for recessive dystrophic epidermolysis bullosa using genetically corrected autologous keratinocytes |
JP2019505511A (en) | 2016-01-06 | 2019-02-28 | イェダ リサーチ アンド ディベロップメント カンパニー リミテッドYeda Research And Development Co.Ltd. | Compositions and methods for treating malignant diseases, autoimmune diseases and inflammatory diseases |
IL260532B2 (en) | 2016-01-11 | 2023-12-01 | Univ Leland Stanford Junior | Chimeric proteins- containing systems and uses thereof in regulating gene expression |
SG10202112024PA (en) | 2016-01-11 | 2021-12-30 | Univ Leland Stanford Junior | Chimeric proteins and methods of immunotherapy |
WO2017124086A1 (en) | 2016-01-15 | 2017-07-20 | The Jackson Laboratory | Genetically modified non-human mammals by multi-cycle electroporation of cas9 protein |
CN109068605B (en) | 2016-01-21 | 2022-11-11 | 以色列国家农业和农村发展农业研究组织沃尔坎尼中心 | Parthenocarpic plants and methods of producing the same |
US11261433B2 (en) | 2016-01-31 | 2022-03-01 | Hadasit Medical Research Services And Development Ltd. | Autosomal-identical pluripotent stem cell populations having non-identical sex chromosomal composition and uses thereof |
KR20180101442A (en) | 2016-02-02 | 2018-09-12 | 상가모 테라퓨틱스, 인코포레이티드 | Compositions for linking DNA-binding domains and cleavage domains |
KR20180116769A (en) | 2016-02-09 | 2018-10-25 | 시버스 유에스 엘엘씨 | Methods and compositions for increasing the efficiency of targeted gene modification using oligonucleotide-mediated gene repair |
US10876129B2 (en) | 2016-02-12 | 2020-12-29 | Ceres, Inc. | Methods and materials for high throughput testing of mutagenized allele combinations |
US20190046497A1 (en) | 2016-02-14 | 2019-02-14 | Yeda Research And Development Co., Ltd. | Methods of modulating protein exocytosis and uses of same in therapy |
EP3417061B1 (en) | 2016-02-18 | 2022-10-26 | The Regents of the University of California | Methods and compositions for gene editing in stem cells |
CN116763942A (en) | 2016-02-18 | 2023-09-19 | 宾州研究基金会 | Intra-brain generation of GABAergic neurons |
WO2017147196A1 (en) | 2016-02-22 | 2017-08-31 | Massachusetts Institute Of Technology | Methods for identifying and modulating immune phenotypes |
US11530253B2 (en) | 2016-02-25 | 2022-12-20 | The Children's Medical Center Corporation | Customized class switch of immunoglobulin genes in lymphoma and hybridoma by CRISPR/CAS9 technology |
SG11201807025SA (en) | 2016-02-26 | 2018-09-27 | Lanzatech New Zealand Ltd | Crispr/cas systems for c-1 fixing bacteria |
US20190216891A1 (en) | 2016-03-06 | 2019-07-18 | Yeda Research And Development Co., Ltd. | Method for modulating myelination |
AU2017235461B2 (en) | 2016-03-15 | 2023-02-23 | Children's Medical Center Corporation | Methods and compositions relating to hematopoietic stem cell expansion |
CA3017225A1 (en) | 2016-03-16 | 2017-09-21 | Synthetic Genomics, Inc. | Production of proteins in labyrinthulomycetes |
JP2019515654A (en) | 2016-03-16 | 2019-06-13 | ザ ジェイ. デヴィッド グラッドストーン インスティテューツ | Methods and compositions for treating obesity and / or diabetes, and methods and compositions for identifying candidate treatment agents |
US11427861B2 (en) | 2016-03-17 | 2022-08-30 | Massachusetts Institute Of Technology | Methods for identifying and modulating co-occurant cellular phenotypes |
EP3219799A1 (en) | 2016-03-17 | 2017-09-20 | IMBA-Institut für Molekulare Biotechnologie GmbH | Conditional crispr sgrna expression |
CA3018332A1 (en) | 2016-03-21 | 2017-09-28 | Dana-Farber Cancer Institute, Inc. | T-cell exhaustion state-specific gene expression regulators and uses thereof |
US11512311B2 (en) | 2016-03-25 | 2022-11-29 | Editas Medicine, Inc. | Systems and methods for treating alpha 1-antitrypsin (A1AT) deficiency |
JP7058223B2 (en) | 2016-04-15 | 2022-04-21 | メモリアル スローン ケタリング キャンサー センター | Transgenic T cells and chimeric antigen receptor T cell compositions and related methods |
SG11201809041TA (en) | 2016-04-15 | 2018-11-29 | Novartis Ag | Compositions and methods for selective protein expression |
CA3026112A1 (en) | 2016-04-19 | 2017-10-26 | The Broad Institute, Inc. | Cpf1 complexes with reduced indel activity |
KR101896243B1 (en) * | 2016-04-22 | 2018-09-11 | 한양대학교 산학협력단 | Chlamydomonas mutants produced usingrgen rnp and method for preparing pigment using the same |
CA3210120C (en) | 2016-04-25 | 2024-04-09 | President And Fellows Of Harvard College | Hybridization chain reaction methods for in situ molecular detection |
EP3448996A1 (en) | 2016-04-26 | 2019-03-06 | Massachusetts Institute of Technology | Extensible recombinase cascades |
WO2017192573A1 (en) | 2016-05-02 | 2017-11-09 | Massachusetts Institute Of Technology | Nanoparticle conjugates of highly potent toxins and intraperitoneal administration of nanoparticles for treating or imaging cancer |
JP2019519501A (en) * | 2016-05-12 | 2019-07-11 | ブライアン ピー. ハンリーBrian P. HANLEY | Safe delivery of CRISPR and other gene therapeutics to the majority of somatic cells in humans and animals |
WO2017201476A1 (en) | 2016-05-20 | 2017-11-23 | Regeneron Pharmaceuticals, Inc. | Methods for breaking immunological tolerance using multiple guide rnas |
WO2017205503A1 (en) | 2016-05-24 | 2017-11-30 | Indiana University Research And Technology Corporation | Ku inhibitors and their use |
CN109689089A (en) | 2016-05-25 | 2019-04-26 | 国家医疗保健研究所 | The method and composition for the treatment of cancer |
AU2017274145B2 (en) | 2016-06-02 | 2020-07-23 | Sigma-Aldrich Co Llc | Using programmable DNA binding proteins to enhance targeted genome modification |
GB201609811D0 (en) | 2016-06-05 | 2016-07-20 | Snipr Technologies Ltd | Methods, cells, systems, arrays, RNA and kits |
US10767175B2 (en) | 2016-06-08 | 2020-09-08 | Agilent Technologies, Inc. | High specificity genome editing using chemically modified guide RNAs |
CA3028074A1 (en) | 2016-06-16 | 2018-12-20 | Oslo Universitetssykehus Hf | Improved gene editing |
US11788083B2 (en) | 2016-06-17 | 2023-10-17 | The Broad Institute, Inc. | Type VI CRISPR orthologs and systems |
US11293021B1 (en) | 2016-06-23 | 2022-04-05 | Inscripta, Inc. | Automated cell processing methods, modules, instruments, and systems |
EP3474669B1 (en) | 2016-06-24 | 2022-04-06 | The Regents of The University of Colorado, A Body Corporate | Methods for generating barcoded combinatorial libraries |
EP3478845A4 (en) | 2016-06-30 | 2019-07-31 | Zymergen, Inc. | Methods for generating a glucose permease library and uses thereof |
JP2019519242A (en) | 2016-06-30 | 2019-07-11 | ザイマージェン インコーポレイテッド | Method for generating a bacterial hemoglobin library and its use |
EP4219462A1 (en) | 2016-07-13 | 2023-08-02 | Vertex Pharmaceuticals Incorporated | Methods, compositions and kits for increasing genome editing efficiency |
EP3484455A2 (en) | 2016-07-15 | 2019-05-22 | Novartis AG | Treatment and prevention of cytokine release syndrome using a chimeric antigen receptor in combination with a kinase inhibitor |
CN106191061B (en) * | 2016-07-18 | 2019-06-18 | 暨南大学 | A kind of sgRNA targeting sequencing of special target people ABCG2 gene and its application |
JP7004651B2 (en) * | 2016-07-19 | 2022-02-04 | 株式会社バイオダイナミクス研究所 | How to prepare long single-stranded DNA |
WO2018023014A1 (en) | 2016-07-29 | 2018-02-01 | Regeneron Pharmaceuticals, Inc. | Mice comprising mutations resulting in expression of c-truncated fibrillin-1 |
EP3494220A1 (en) | 2016-08-02 | 2019-06-12 | Editas Medicine, Inc. | Compositions and methods for treating cep290 associated disease |
CN109715668A (en) | 2016-08-02 | 2019-05-03 | T细胞受体治疗公司 | For using fusion protein to carry out the composition and method of TCR reprogramming |
SG11201900907YA (en) | 2016-08-03 | 2019-02-27 | Harvard College | Adenosine nucleobase editors and uses thereof |
US11661590B2 (en) | 2016-08-09 | 2023-05-30 | President And Fellows Of Harvard College | Programmable CAS9-recombinase fusion proteins and uses thereof |
KR101710026B1 (en) | 2016-08-10 | 2017-02-27 | 주식회사 무진메디 | Composition comprising delivery carrier of nano-liposome having Cas9 protein and guide RNA |
WO2018030457A1 (en) | 2016-08-10 | 2018-02-15 | 武田薬品工業株式会社 | Method for modifying target site in genome of eukaryotic cell, and method for detecting presence or absence of nucleic acid sequence to be detected at target site |
US20190284581A1 (en) | 2016-08-12 | 2019-09-19 | Nexuspiral Inc. | Genome editing method |
US11352647B2 (en) | 2016-08-17 | 2022-06-07 | The Broad Institute, Inc. | Crispr enzymes and systems |
WO2018035250A1 (en) | 2016-08-17 | 2018-02-22 | The Broad Institute, Inc. | Methods for identifying class 2 crispr-cas systems |
WO2018035364A1 (en) | 2016-08-17 | 2018-02-22 | The Broad Institute Inc. | Product and methods useful for modulating and evaluating immune responses |
IL247368A0 (en) | 2016-08-18 | 2016-11-30 | Yeda Res & Dev | Diagnostic and therapeutic uses of exosomes |
US11542509B2 (en) | 2016-08-24 | 2023-01-03 | President And Fellows Of Harvard College | Incorporation of unnatural amino acids into proteins using base editing |
SG11201901364VA (en) | 2016-08-24 | 2019-03-28 | Sangamo Therapeutics Inc | Engineered target specific nucleases |
US20190262399A1 (en) | 2016-09-07 | 2019-08-29 | The Broad Institute, Inc. | Compositions and methods for evaluating and modulating immune responses |
AU2017324462B2 (en) | 2016-09-07 | 2024-03-21 | Sangamo Therapeutics, Inc. | Modulation of liver genes |
EP3510407A1 (en) | 2016-09-08 | 2019-07-17 | INSERM (Institut National de la Santé et de la Recherche Médicale) | Methods for diagnosing and treating nephrotic syndrome |
IL247752A0 (en) | 2016-09-11 | 2016-11-30 | Yeda Res & Dev | Compositions and methods for regulating gene expression for targeted mutagenesis |
EP3512952B1 (en) | 2016-09-15 | 2024-05-15 | Labcyte Inc. | High-efficiency transfection of biological cells using sonoporation |
EP3515559A4 (en) | 2016-09-20 | 2020-07-15 | Dana-Farber Cancer Institute, Inc. | Compositions and methods for identification, assessment, prevention, and treatment of aml using usp10 biomarkers and modulators |
US20190225974A1 (en) | 2016-09-23 | 2019-07-25 | BASF Agricultural Solutions Seed US LLC | Targeted genome optimization in plants |
JP6866475B2 (en) | 2016-09-23 | 2021-04-28 | フレッド ハッチンソン キャンサー リサーチ センター | Minor histocompatibility (H) TCR specific for antigen HA-1 and its use |
CN109844126A (en) | 2016-09-28 | 2019-06-04 | 诺华股份有限公司 | Macromolecular delivery system based on perforated membrane |
AU2017336094A1 (en) | 2016-09-29 | 2019-04-18 | Immunitybio, Inc. | HLA class I-deficient NK-92 cells with decreased immunogenicity |
SG10202102997UA (en) * | 2016-09-30 | 2021-04-29 | Regeneron Pharma | Non-human animals having a hexanucleotide repeat expansion in a c9orf72 locus |
AU2017335890B2 (en) | 2016-09-30 | 2024-05-09 | The Regents Of The University Of California | RNA-guided nucleic acid modifying enzymes and methods of use thereof |
CA3039014A1 (en) | 2016-10-04 | 2018-04-12 | Precision Biosciences, Inc. | Co-stimulatory domains for use in genetically-modified cells |
US10669539B2 (en) | 2016-10-06 | 2020-06-02 | Pioneer Biolabs, Llc | Methods and compositions for generating CRISPR guide RNA libraries |
PT3445787T (en) | 2016-10-07 | 2021-03-15 | Tcr2 Therapeutics Inc | Compositions and methods for t-cell receptors reprogramming using fusion proteins |
KR102606680B1 (en) | 2016-10-07 | 2023-11-27 | 인티그레이티드 디엔에이 테크놀로지스 아이엔씨. | S. Pyogenes ACS9 mutant gene and polypeptide encoded thereby |
US11242542B2 (en) | 2016-10-07 | 2022-02-08 | Integrated Dna Technologies, Inc. | S. pyogenes Cas9 mutant genes and polypeptides encoded by same |
US20200016202A1 (en) | 2016-10-07 | 2020-01-16 | The Brigham And Women's Hospital, Inc. | Modulation of novel immune checkpoint targets |
WO2018069232A1 (en) | 2016-10-10 | 2018-04-19 | INSERM (Institut National de la Santé et de la Recherche Médicale) | Methods for predicting the risk of having cardiac hypertrophy |
GB2573062A (en) | 2016-10-14 | 2019-10-23 | Harvard College | AAV delivery of nucleobase editors |
AU2017341926B2 (en) | 2016-10-14 | 2022-06-30 | The General Hospital Corporation | Epigenetically regulated site-specific nucleases |
GB201617559D0 (en) | 2016-10-17 | 2016-11-30 | University Court Of The University Of Edinburgh The | Swine comprising modified cd163 and associated methods |
EP3528852A4 (en) | 2016-10-20 | 2020-06-03 | Sangamo Therapeutics, Inc. | Methods and compositions for the treatment of fabry disease |
CN106637421B (en) * | 2016-10-28 | 2019-12-27 | 博雅缉因(北京)生物科技有限公司 | Construction of double sgRNA library and method for applying double sgRNA library to high-throughput functional screening research |
WO2018081531A2 (en) | 2016-10-28 | 2018-05-03 | Ariad Pharmaceuticals, Inc. | Methods for human t-cell activation |
WO2018081775A1 (en) | 2016-10-31 | 2018-05-03 | Sangamo Therapeutics, Inc. | Gene correction of scid-related genes in hematopoietic stem and progenitor cells |
WO2018076335A1 (en) | 2016-10-31 | 2018-05-03 | Institute Of Genetics And Developmental Biology, Chinese Academy Of Sciences | Compositions and methods for enhancing abiotic stress tolerance |
US10633454B2 (en) | 2016-11-01 | 2020-04-28 | Conagen Inc. | Expression of modified glycoproteins and glycopeptides |
WO2018083606A1 (en) | 2016-11-01 | 2018-05-11 | Novartis Ag | Methods and compositions for enhancing gene editing |
WO2018144097A1 (en) | 2016-11-04 | 2018-08-09 | Akeagen Llc | Genetically modified non-human animals and methods for producing heavy chain-only antibodies |
AU2017355507B2 (en) | 2016-11-04 | 2023-09-21 | Flagship Pioneering Innovations V. Inc. | Novel plant cells, plants, and seeds |
WO2018087391A1 (en) | 2016-11-14 | 2018-05-17 | INSERM (Institut National de la Santé et de la Recherche Médicale) | Methods and pharmaceutical compositions for modulating stem cells proliferation or differentiation |
WO2018093797A1 (en) | 2016-11-15 | 2018-05-24 | The Schepens Eye Research Institute, Inc. | Compositions and methods for the treatment of aberrant angiogenesis |
EP4321617A3 (en) | 2016-11-22 | 2024-04-24 | Integrated DNA Technologies Inc. | Crispr/cpf1 systems and methods |
KR20190085528A (en) | 2016-11-22 | 2019-07-18 | 싱가포르국립대학교 | Blocking chimeric antigen receptors and CD7 expression for immunotherapy of T-cell malignancies |
CN110177803A (en) | 2016-11-22 | 2019-08-27 | T细胞受体治疗公司 | For using fusion protein to carry out the composition and method that TCR is reprogramed |
WO2018096547A1 (en) | 2016-11-28 | 2018-05-31 | Yeda Research And Development Co. Ltd. | Isolated polynucleotides and polypeptides and methods of using same for expressing an expression product of interest |
EP3548894B1 (en) | 2016-12-02 | 2021-10-20 | INSERM (Institut National de la Santé et de la Recherche Médicale) | Methods and compositions for diagnosing renal cell carcinoma |
US9816093B1 (en) | 2016-12-06 | 2017-11-14 | Caribou Biosciences, Inc. | Engineered nucleic acid-targeting nucleic acids |
CN110249051A (en) | 2016-12-08 | 2019-09-17 | 凯斯西储大学 | Enhance the method and composition that functional myelin generates |
US11293022B2 (en) | 2016-12-12 | 2022-04-05 | Integrated Dna Technologies, Inc. | Genome editing enhancement |
CN110582302A (en) | 2016-12-14 | 2019-12-17 | 利甘达尔股份有限公司 | Compositions and methods for nucleic acid and/or protein payload delivery |
JP2020513754A (en) | 2016-12-21 | 2020-05-21 | ティーシーアール2 セラピューティクス インク. | T cells engineered for cancer treatment |
CN110494549A (en) | 2016-12-22 | 2019-11-22 | 阿维塔斯有限公司 | By invertibity infiltration to the carrier-free Intracellular delivery of non-adherent cell |
WO2018119359A1 (en) | 2016-12-23 | 2018-06-28 | President And Fellows Of Harvard College | Editing of ccr5 receptor gene to protect against hiv infection |
US20200124615A1 (en) | 2016-12-29 | 2020-04-23 | Ukko Inc. | Methods for identifying and de-epitoping allergenic polypeptides |
WO2018126087A1 (en) | 2016-12-29 | 2018-07-05 | Applied Stemcell, Inc. | Gene editing method using virus |
US11859219B1 (en) | 2016-12-30 | 2024-01-02 | Flagship Pioneering Innovations V, Inc. | Methods of altering a target nucleotide sequence with an RNA-guided nuclease and a single guide RNA |
WO2018129346A1 (en) | 2017-01-06 | 2018-07-12 | Nantkwest, Inc. | Genetically modified nk-92 cells with decreased cd96/tigit expression |
EP3346001A1 (en) | 2017-01-06 | 2018-07-11 | TXCell | Monospecific regulatory t cell population with cytotoxicity for b cells |
WO2018127585A1 (en) | 2017-01-06 | 2018-07-12 | Txcell | Monospecific regulatory t cell population with cytotoxicity for b cells |
ES2949801T3 (en) | 2017-01-09 | 2023-10-03 | Whitehead Inst Biomedical Res | Methods to alter gene expression by perturbation of transcription factor multimers that structure regulatory loops |
WO2018129440A1 (en) | 2017-01-09 | 2018-07-12 | University Of Massachusetts | Complexes for gene deletion and editing |
CN106636204B (en) * | 2017-01-09 | 2019-08-23 | 华中农业大学 | A kind of albefaction Misgurnus auguillicaudatus breeding method that can stablize heredity |
GB201700380D0 (en) | 2017-01-10 | 2017-02-22 | Plant Bioscience Ltd | Methods of increasing seed yield |
EP3569708A4 (en) | 2017-01-13 | 2020-09-09 | Jichi Medical University | Aav vector for disrupting clotting-related factor gene on liver genome |
WO2018136702A1 (en) | 2017-01-23 | 2018-07-26 | Regeneron Pharmaceuticals, Inc. | Hydroxysteroid 17-beta dehydrogenase 13 (hsd17b13) variants and uses thereof |
US11535662B2 (en) | 2017-01-26 | 2022-12-27 | Novartis Ag | CD28 compositions and methods for chimeric antigen receptor therapy |
WO2018140899A1 (en) | 2017-01-28 | 2018-08-02 | Inari Agriculture, Inc. | Novel plant cells, plants, and seeds |
US20190375815A1 (en) | 2017-01-31 | 2019-12-12 | Novartis Ag | Treatment of cancer using chimeric t cell receptor proteins having multiple specificities |
IL250479A0 (en) | 2017-02-06 | 2017-03-30 | Sorek Rotem | Isolated cells genetically modified to express a disarm system having an anti-phage activity and methods of producing same |
WO2018148246A1 (en) | 2017-02-07 | 2018-08-16 | Massachusetts Institute Of Technology | Methods and compositions for rna-guided genetic circuits |
CA3053006C (en) | 2017-02-08 | 2023-09-05 | Dana-Farber Cancer Institute, Inc. | Regulating chimeric antigen receptors |
CN110573623A (en) | 2017-02-09 | 2019-12-13 | 福建农林大学 | Expression of phosphate transporters for increasing plant yield |
KR20190116282A (en) | 2017-02-10 | 2019-10-14 | 지머젠 인코포레이티드 | Modular, Universal Plasmid Design Strategy for Assembling and Editing Multiple DNA Constructs for Multiple Hosts |
US11471538B2 (en) | 2017-02-10 | 2022-10-18 | INSERM (Institut National de la Santéet de la Recherche Medicale) | Methods and pharmaceutical compositions for the treatment of cancers associated with activation of the MAPK pathway |
JP2020510418A (en) | 2017-02-17 | 2020-04-09 | デナリ セラピューティクス インコーポレイテッドDenali Therapeutics Inc. | Transferrin receptor transgenic model |
US20200040061A1 (en) * | 2017-02-22 | 2020-02-06 | Crispr Therapeutics Ag | Materials and methods for treatment of early onset parkinson's disease (park1) and other synuclein, alpha (snca) gene related conditions or disorders |
EP3589647A1 (en) | 2017-02-28 | 2020-01-08 | Novartis AG | Shp inhibitor compositions and uses for chimeric antigen receptor therapy |
EP3592853A1 (en) | 2017-03-09 | 2020-01-15 | President and Fellows of Harvard College | Suppression of pain by gene editing |
WO2018165629A1 (en) | 2017-03-10 | 2018-09-13 | President And Fellows Of Harvard College | Cytosine to guanine base editor |
WO2018170184A1 (en) | 2017-03-14 | 2018-09-20 | Editas Medicine, Inc. | Systems and methods for the treatment of hemoglobinopathies |
EA201992131A1 (en) | 2017-03-15 | 2020-02-06 | Фред Хатчинсон Кэнсер Рисерч Сентер | HIGH-AFFINE SPECIFIC TO MAGE-A1 TCR AND THEIR APPLICATION |
US20200087403A1 (en) | 2017-03-15 | 2020-03-19 | INSERM (Institut National de la Santé et de la Recherche Médicale) | Pharmaceutical compositions for the treatment of thrombosis in patients suffering from a myeloproliferative neoplasm |
US11739308B2 (en) | 2017-03-15 | 2023-08-29 | The Broad Institute, Inc. | Cas13b orthologues CRISPR enzymes and systems |
WO2018170515A1 (en) | 2017-03-17 | 2018-09-20 | The Broad Institute, Inc. | Methods for identifying and modulating co-occurant cellular phenotypes |
EP3596117A4 (en) | 2017-03-17 | 2021-01-13 | The Johns Hopkins University | Targeted epigenetic therapy against distal regulatory element of tgfb2 expression |
CA3057192A1 (en) | 2017-03-23 | 2018-09-27 | President And Fellows Of Harvard College | Nucleobase editors comprising nucleic acid programmable dna binding proteins |
BR112019019977A2 (en) | 2017-03-24 | 2020-04-28 | Inst Genetics & Developmental Biology Cas | methods to increase grain yield |
US10980779B2 (en) | 2017-03-24 | 2021-04-20 | Inserm (Institut National De La Sante Et De La Recherche Medicale) | GFI1 inhibitors for the treatment of hyperglycemia |
WO2018172508A1 (en) | 2017-03-24 | 2018-09-27 | INSERM (Institut National de la Santé et de la Recherche Médicale) | Methods and compositions for treating melanoma |
WO2018183580A1 (en) * | 2017-03-29 | 2018-10-04 | The Broad Institute, Inc | Compositions and methods for treatment of peroxisome proliferator-activated receptor gamma (pparg) activated cancer |
CN110476214A (en) | 2017-03-30 | 2019-11-19 | 孟山都技术有限公司 | System and method for identifying the Aggregate effect of the genome editor of multiple genome editors and prediction identification |
WO2018178237A1 (en) | 2017-03-30 | 2018-10-04 | INSERM (Institut National de la Santé et de la Recherche Médicale) | Methods for the treatment of mitochondrial genetic diseases |
WO2018183908A1 (en) | 2017-03-31 | 2018-10-04 | Dana-Farber Cancer Institute, Inc. | Compositions and methods for treating ovarian tumors |
WO2018183921A1 (en) | 2017-04-01 | 2018-10-04 | The Broad Institute, Inc. | Methods and compositions for detecting and modulating an immunotherapy resistance gene signature in cancer |
EP3607071A1 (en) * | 2017-04-06 | 2020-02-12 | DSM IP Assets B.V. | Self-guiding integration construct (sgic) |
KR20200006054A (en) | 2017-04-12 | 2020-01-17 | 더 브로드 인스티튜트, 인코퍼레이티드 | New Type VI CRISPR Orthologs and Systems |
WO2018191553A1 (en) | 2017-04-12 | 2018-10-18 | Massachusetts Eye And Ear Infirmary | Tumor signature for metastasis, compositions of matter methods of use thereof |
WO2018191520A1 (en) | 2017-04-12 | 2018-10-18 | The Broad Institute, Inc. | Respiratory and sweat gland ionocytes |
US10457683B2 (en) | 2017-04-12 | 2019-10-29 | Magenta Therapeutics Inc. | Aryl hydrocarbon receptor antagonists and uses thereof |
WO2018191750A2 (en) | 2017-04-14 | 2018-10-18 | The Broad Institute Inc. | Novel delivery of large payloads |
WO2018195129A1 (en) | 2017-04-17 | 2018-10-25 | University Of Maryland, College Park | Embryonic cell cultures and methods of using the same |
MX2019012398A (en) | 2017-04-18 | 2020-09-25 | Broad Inst Inc | Compositions for detecting secretion and methods of use. |
US11834670B2 (en) * | 2017-04-19 | 2023-12-05 | Global Life Sciences Solutions Usa Llc | Site-specific DNA modification using a donor DNA repair template having tandem repeat sequences |
WO2018195486A1 (en) | 2017-04-21 | 2018-10-25 | The Broad Institute, Inc. | Targeted delivery to beta cells |
DK3612174T3 (en) | 2017-04-21 | 2023-05-08 | Inst Nat Sante Rech Med | METHODS AND PHARMACEUTICAL COMPOSITIONS FOR THE TREATMENT OF DISEASES ASSOCIATED WITH REDUCED CFTR FUNCTION |
AU2018256877B2 (en) | 2017-04-28 | 2022-06-02 | Acuitas Therapeutics, Inc. | Novel carbonyl lipids and lipid nanoparticle formulations for delivery of nucleic acids |
EP3615055A1 (en) | 2017-04-28 | 2020-03-04 | Novartis AG | Cells expressing a bcma-targeting chimeric antigen receptor, and combination therapy with a gamma secretase inhibitor |
WO2018201051A1 (en) | 2017-04-28 | 2018-11-01 | Novartis Ag | Bcma-targeting agent, and combination therapy with a gamma secretase inhibitor |
CA3059793A1 (en) | 2017-05-03 | 2018-11-08 | Sangamo Therapeutics, Inc. | Methods and compositions for modification of a cystic fibrosis transmembrane conductance regulator (cftr) gene |
US11591601B2 (en) | 2017-05-05 | 2023-02-28 | The Broad Institute, Inc. | Methods for identification and modification of lncRNA associated with target genotypes and phenotypes |
IL252151A0 (en) | 2017-05-07 | 2017-07-31 | Fainzilber Michael | Methods of treating psychiatric stress disorders |
CA3062698A1 (en) | 2017-05-08 | 2018-11-15 | Precision Biosciences, Inc. | Nucleic acid molecules encoding an engineered antigen receptor and an inhibitory nucleic acid molecule and methods of use thereof |
WO2018208998A1 (en) | 2017-05-10 | 2018-11-15 | The Regents Of The University Of California | Directed editing of cellular rna via nuclear delivery of crispr/cas9 |
WO2018209158A2 (en) | 2017-05-10 | 2018-11-15 | Editas Medicine, Inc. | Crispr/rna-guided nuclease systems and methods |
US11560566B2 (en) | 2017-05-12 | 2023-01-24 | President And Fellows Of Harvard College | Aptazyme-embedded guide RNAs for use with CRISPR-Cas9 in genome editing and transcriptional activation |
US20200171022A1 (en) | 2017-05-17 | 2020-06-04 | Inserm (Institut National De La Santé Et Da La Recherche Médicale) | Flt3 inhibitors for improving pain treatments by opioids |
WO2018213708A1 (en) | 2017-05-18 | 2018-11-22 | The Broad Institute, Inc. | Systems, methods, and compositions for targeted nucleic acid editing |
CA3064000A1 (en) | 2017-05-24 | 2018-11-29 | Effector Therapeutics, Inc. | Methods and compositions for cellular immunotherapy |
US11725214B2 (en) | 2017-05-25 | 2023-08-15 | Institute Of Genetics And Developmental Biology Chinese Academy Of Sciences | Methods for increasing grain productivity |
EP3409104A1 (en) | 2017-05-31 | 2018-12-05 | Vilmorin et Cie | Tomato plant resistant to tomato yellow leaf curl virus, powdery mildew, and nematodes |
WO2020249996A1 (en) | 2019-06-14 | 2020-12-17 | Vilmorin & Cie | Resistance in plants of solanum lycopersicum to the tobamovirus tomato brown rugose fruit virus |
EP3409106A1 (en) | 2017-06-01 | 2018-12-05 | Vilmorin et Cie | Tolerance in plants of solanum lycopersicum to the tobamovirus tomato brown rugose fruit virus (tbrfv) |
WO2018224508A1 (en) | 2017-06-05 | 2018-12-13 | Consejo Superior De Investigaciones Científicas (Csic) -Delegación Andalucía | Targeting of gluten by genome editing |
CA3102054A1 (en) | 2017-06-05 | 2018-12-13 | Fred Hutchinson Cancer Research Center | Genomic safe harbors for genetic therapies in human stem cells and engineered nanoparticles to provide targeted genetic therapies |
JP2020524490A (en) | 2017-06-06 | 2020-08-20 | ザイマージェン インコーポレイテッド | HTP genome manipulation platform to improve Escherichia coli |
EP3634496A4 (en) | 2017-06-06 | 2021-09-08 | Dana-Farber Cancer Institute, Inc. | Methods for sensitizing cancer cells to t cell-mediated killing by modulating molecular pathways |
WO2018226900A2 (en) | 2017-06-06 | 2018-12-13 | Zymergen Inc. | A htp genomic engineering platform for improving fungal strains |
EP3634582A1 (en) | 2017-06-08 | 2020-04-15 | INSERM (Institut National de la Santé et de la Recherche Médicale) | Methods and compositions for treating hyperpigmentation disorders |
WO2018226972A2 (en) | 2017-06-09 | 2018-12-13 | Vilmorin & Cie | Compositions and methods for genome editing |
AU2018285860A1 (en) | 2017-06-13 | 2020-01-02 | Flagship Pioneering Innovations V, Inc. | Compositions comprising curons and uses thereof |
EP3638218A4 (en) | 2017-06-14 | 2021-06-09 | The Broad Institute, Inc. | Compositions and methods targeting complement component 3 for inhibiting tumor growth |
CA3066047A1 (en) | 2017-06-14 | 2018-12-20 | Technische Universitat Dresden | Methods and means for genetic alteration of genomes utilizing designer dna recombining enzymes |
JP7275054B2 (en) | 2017-06-15 | 2023-05-17 | ザ リージェンツ オブ ザ ユニバーシティ オブ カリフォルニア | Targeted non-viral DNA insertion |
US11512287B2 (en) | 2017-06-16 | 2022-11-29 | Sangamo Therapeutics, Inc. | Targeted disruption of T cell and/or HLA receptors |
DK3538645T3 (en) | 2017-06-20 | 2021-04-19 | Inst Curie | IMMUNE CELLS MISSING SUV39H1 |
US10011849B1 (en) | 2017-06-23 | 2018-07-03 | Inscripta, Inc. | Nucleic acid-guided nucleases |
US9982279B1 (en) | 2017-06-23 | 2018-05-29 | Inscripta, Inc. | Nucleic acid-guided nucleases |
EP3916086A1 (en) | 2017-06-23 | 2021-12-01 | Inscripta, Inc. | Nucleic acid-guided nucleases |
WO2019005884A1 (en) | 2017-06-26 | 2019-01-03 | The Broad Institute, Inc. | Crispr/cas-adenine deaminase based compositions, systems, and methods for targeted nucleic acid editing |
HRP20220615T1 (en) | 2017-06-30 | 2022-06-24 | Inscripta, Inc. | Automated cell processing methods, modules, instruments, and systems |
US20200140896A1 (en) | 2017-06-30 | 2020-05-07 | Novartis Ag | Methods for the treatment of disease with gene editing systems |
WO2019005957A1 (en) | 2017-06-30 | 2019-01-03 | Precision Biosciences, Inc. | Genetically-modified t cells comprising a modified intron in the t cell receptor alpha gene |
AU2018301393A1 (en) | 2017-07-11 | 2020-02-06 | Compass Therapeutics Llc | Agonist antibodies that bind human CD137 and uses thereof |
WO2019014664A1 (en) * | 2017-07-14 | 2019-01-17 | Dana-Farber Cancer Institute, Inc. | Modulating biomarkers to increase tumor immunity and improve the efficacy of cancer immunotherapy |
WO2019011118A1 (en) | 2017-07-14 | 2019-01-17 | 苏州克睿基因生物科技有限公司 | Gene editing system and gene editing method |
US20190316101A1 (en) | 2017-07-18 | 2019-10-17 | Howard Hughes Medical Institute | Methods and compositions for genetically manipulating genes and cells |
WO2019016310A1 (en) | 2017-07-20 | 2019-01-24 | INSERM (Institut National de la Santé et de la Recherche Médicale) | Methods and compositions for treating cancers |
IL253642A0 (en) | 2017-07-24 | 2017-09-28 | Seger Rony | Combination therapy for the treatment of cancer |
WO2019023291A2 (en) | 2017-07-25 | 2019-01-31 | Dana-Farber Cancer Institute, Inc. | Compositions and methods for making and decoding paired-guide rna libraries and uses thereof |
US11926664B2 (en) | 2017-07-25 | 2024-03-12 | INSERM (Institut National de la Santé et de la Recherche Médicale) | Methods and pharmaceutical compositions for modulating monocytopoiesis |
JP2020534795A (en) | 2017-07-28 | 2020-12-03 | プレジデント アンド フェローズ オブ ハーバード カレッジ | Methods and Compositions for Evolving Base Editing Factors Using Phage-Supported Continuous Evolution (PACE) |
AU2018309708A1 (en) | 2017-07-31 | 2020-02-06 | Regeneron Pharmaceuticals, Inc. | CRISPR reporter non-human animals and uses thereof |
AU2018311504A1 (en) | 2017-07-31 | 2020-03-12 | Reflection Biotechnologies Limited | Cellular models of and therapies for ocular diseases |
WO2019028032A1 (en) | 2017-07-31 | 2019-02-07 | Regeneron Pharmaceuticals, Inc. | Cas-transgenic mouse embryonic stem cells and mice and uses thereof |
CA3065579A1 (en) | 2017-07-31 | 2019-02-07 | Regeneron Pharmaceuticals, Inc. | Assessment of crispr/cas-induced recombination with an exogenous donor nucleic acid in vivo |
EP3663310A4 (en) | 2017-08-04 | 2021-08-11 | Peking University | Tale rvd specifically recognizing dna base modified by methylation and application thereof |
US11624077B2 (en) | 2017-08-08 | 2023-04-11 | Peking University | Gene knockout method |
CN111263810A (en) * | 2017-08-22 | 2020-06-09 | 纳匹基因公司 | Organelle genome modification using polynucleotide directed endonucleases |
WO2019038771A1 (en) | 2017-08-23 | 2019-02-28 | Technion Research & Development Foundation Limited | Compositions and methods for improving alcohol tolerance in yeast |
WO2019040650A1 (en) | 2017-08-23 | 2019-02-28 | The General Hospital Corporation | Engineered crispr-cas9 nucleases with altered pam specificity |
CN111655861A (en) | 2017-08-24 | 2020-09-11 | 内布拉斯加大学董事委员会 | Methods and compositions for in situ germline genome engineering |
WO2019038417A1 (en) | 2017-08-25 | 2019-02-28 | Institute Of Genetics And Developmental Biology, Chinese Academy Of Sciences | Methods for increasing grain yield |
US10738327B2 (en) | 2017-08-28 | 2020-08-11 | Inscripta, Inc. | Electroporation cuvettes for automation |
US11319532B2 (en) | 2017-08-30 | 2022-05-03 | President And Fellows Of Harvard College | High efficiency base editors comprising Gam |
US11273148B2 (en) | 2017-09-01 | 2022-03-15 | The Johns Hopkins University | Targeted epigenetic therapy for inherited aortic aneurysm condition |
CN107446859B (en) * | 2017-09-02 | 2020-12-18 | 河南省农业科学院畜牧兽医研究所 | Mycoplasma gallisepticum and application thereof |
CN111201317B (en) | 2017-09-05 | 2024-04-05 | 国立大学法人东京大学 | Modified Cas9 proteins and uses thereof |
CN111051349A (en) | 2017-09-06 | 2020-04-21 | 弗雷德哈钦森癌症研究中心 | STREP-TAG specific chimeric receptor and application thereof |
JP2020533289A (en) | 2017-09-06 | 2020-11-19 | フレッド ハッチンソン キャンサー リサーチ センター | Ways to improve adoptive cell therapy |
MA50280A (en) | 2017-09-11 | 2020-07-22 | Insideoutbio Inc | METHODS AND COMPOSITIONS FOR IMPROVING TUMOR IMMUNOGENICITY [ |
WO2019055862A1 (en) | 2017-09-14 | 2019-03-21 | Fred Hutchinson Cancer Research Center | High affinity t cell receptors and uses thereof |
US20200216805A1 (en) | 2017-09-18 | 2020-07-09 | Edigene Inc. | Gene editing t cell and use thereof |
BR112020004268A2 (en) | 2017-09-18 | 2020-09-29 | Futuragene Israel Ltd. | construct, host cell, plant tissue, method for producing a plant, transgenic plant, method for engineering a plant, plant, and plant cell |
WO2019057649A1 (en) | 2017-09-19 | 2019-03-28 | INSERM (Institut National de la Santé et de la Recherche Médicale) | Methods and pharmaceutical compositions for the treatment of acute myeloid leukemia |
CN111655340A (en) | 2017-09-20 | 2020-09-11 | 国家医疗保健研究所 | Methods and pharmaceutical compositions for modulating autophagy |
CA3076547A1 (en) | 2017-09-20 | 2019-03-28 | The University Of British Columbia | Novel anti-hla-a2 antibodies and uses thereof |
CN111511388A (en) | 2017-09-21 | 2020-08-07 | 博德研究所 | Systems, methods, and compositions for targeted nucleic acid editing |
CA3076249A1 (en) | 2017-09-21 | 2019-03-28 | Dana-Farber Cancer Institute, Inc. | Isolation, preservation, compositions and uses of extracts from justicia plants |
KR101896847B1 (en) | 2017-09-22 | 2018-09-07 | 한국생명공학연구원 | Composition for Inhibiting Gene Expression comprising Nuclease-Deactivated Cpf1 and Uses Thereof |
US11603536B2 (en) * | 2017-09-29 | 2023-03-14 | Inari Agriculture Technology, Inc. | Methods for efficient maize genome editing |
CN111163633B (en) | 2017-09-29 | 2022-09-09 | 瑞泽恩制药公司 | Non-human animals comprising humanized TTR loci and methods of use thereof |
CA3074927A1 (en) | 2017-09-30 | 2019-04-04 | Inscripta, Inc. | Flow through electroporation instrumentation |
EP4269560A3 (en) | 2017-10-03 | 2024-01-17 | Precision Biosciences, Inc. | Modified epidermal growth factor receptor peptides for use in genetically-modified cells |
WO2019071054A1 (en) | 2017-10-04 | 2019-04-11 | The Broad Institute, Inc. | Methods and compositions for altering function and structure of chromatin loops and/or domains |
CA3076740A1 (en) * | 2017-10-06 | 2019-04-11 | Oregon Health & Science University | Compositions and methods for editing rna |
US11725228B2 (en) | 2017-10-11 | 2023-08-15 | The General Hospital Corporation | Methods for detecting site-specific and spurious genomic deamination induced by base editing technologies |
US10709085B2 (en) | 2017-10-13 | 2020-07-14 | Bejo Zaden Bv | Lettuce variety ‘80020-0911-007’ |
US11795443B2 (en) | 2017-10-16 | 2023-10-24 | The Broad Institute, Inc. | Uses of adenosine base editors |
US11680296B2 (en) | 2017-10-16 | 2023-06-20 | Massachusetts Institute Of Technology | Mycobacterium tuberculosis host-pathogen interaction |
JP7383607B2 (en) | 2017-10-20 | 2023-11-20 | フレッド ハッチンソン キャンサー センター | Systems and methods for producing genetically modified B cells to express selected antibodies |
EP3697435A1 (en) | 2017-10-20 | 2020-08-26 | Fred Hutchinson Cancer Research Center | Compositions and methods of immunotherapy targeting tigit and/or cd112r or comprising cd226 overexpression |
US11690856B2 (en) | 2017-10-23 | 2023-07-04 | Inserm (Institut National De La Sante Et De La Recherche Medicale) | Compounds for treating CMV related diseases |
KR102503130B1 (en) | 2017-10-27 | 2023-02-24 | 더 리전트 오브 더 유니버시티 오브 캘리포니아 | Targeted replacement of endogenous T cell receptors |
CN109722414A (en) | 2017-10-27 | 2019-05-07 | 博雅辑因(北京)生物科技有限公司 | It is a kind of efficiently to prepare the method for mature erythrocyte and be used to prepare the culture medium of mature erythrocyte |
US20210179709A1 (en) | 2017-10-31 | 2021-06-17 | Novartis Ag | Anti-car compositions and methods |
US20190343885A1 (en) | 2017-10-31 | 2019-11-14 | Magenta Therapeutics Inc. | Compositions and methods for hematopoietic stem and progenitor cell transplant therapy |
US11547614B2 (en) | 2017-10-31 | 2023-01-10 | The Broad Institute, Inc. | Methods and compositions for studying cell evolution |
WO2019089753A2 (en) | 2017-10-31 | 2019-05-09 | Compass Therapeutics Llc | Cd137 antibodies and pd-1 antagonists and uses thereof |
EP3704232A1 (en) | 2017-10-31 | 2020-09-09 | Magenta Therapeutics, Inc. | Compositions and methods for the expansion of hematopoietic stem and progenitor cells |
US20210180053A1 (en) | 2017-11-01 | 2021-06-17 | Novartis Ag | Synthetic rnas and methods of use |
US20200299658A1 (en) | 2017-11-01 | 2020-09-24 | Precision Biosciences, Inc. | Engineered nucleases that target human and canine factor viii genes as a treatment for hemophilia a |
SG11202004003YA (en) | 2017-11-09 | 2020-05-28 | Sangamo Therapeutics Inc | Genetic modification of cytokine inducible sh2-containing protein (cish) gene |
WO2019094983A1 (en) | 2017-11-13 | 2019-05-16 | The Broad Institute, Inc. | Methods and compositions for treating cancer by targeting the clec2d-klrb1 pathway |
IL255664A0 (en) | 2017-11-14 | 2017-12-31 | Shachar Idit | Hematopoietic stem cells with improved properties |
CA3082643A1 (en) | 2017-11-14 | 2019-05-23 | The Schepens Eye Research Institute, Inc. | Runx1 inhibition for treatment of proliferative vitreoretinopathy and conditions associated with epithelial to mesenchymal transition |
CN111601883A (en) | 2017-11-17 | 2020-08-28 | 艾欧凡斯生物治疗公司 | TIL amplification from Fine needle aspirates and Small biopsies |
WO2019099823A1 (en) * | 2017-11-17 | 2019-05-23 | Stc.Unm | Therapy for myotonic dystrophy type 1 via genome editing of the dmpk gene |
US11851497B2 (en) | 2017-11-20 | 2023-12-26 | Compass Therapeutics Llc | CD137 antibodies and tumor antigen-targeting antibodies and uses thereof |
JP2021503885A (en) | 2017-11-22 | 2021-02-15 | アイオバンス バイオセラピューティクス,インコーポレイテッド | Expanded culture of peripheral blood lymphocytes (PBL) from peripheral blood |
US11679148B2 (en) | 2017-11-24 | 2023-06-20 | Institut National De La Santé Et De La Recherche Médicale (Inserm) | Methods and compositions for treating cancers |
WO2019101995A1 (en) | 2017-11-27 | 2019-05-31 | INSERM (Institut National de la Santé et de la Recherche Médicale) | Methods and pharmaceutical compositions for cardiac regeneration |
KR20200096262A (en) | 2017-11-28 | 2020-08-11 | 미리머스, 인코포레이티드 | Genetic interference development and application method of RNAi model |
WO2019109047A1 (en) | 2017-12-01 | 2019-06-06 | Fred Hutchinson Cancer Research Center | Binding proteins specific for 5t4 and uses thereof |
BR112020011186A2 (en) | 2017-12-06 | 2020-11-17 | Magenta Therapeutics, Inc. | dosing regimens for stem cell mobilization and hematopoietic progenitors |
GB201720351D0 (en) | 2017-12-06 | 2018-01-17 | Iontas Ltd | Selecting for developability in drug discovery |
US11332736B2 (en) | 2017-12-07 | 2022-05-17 | The Broad Institute, Inc. | Methods and compositions for multiplexing single cell and single nuclei sequencing |
AU2018378833A1 (en) | 2017-12-08 | 2020-07-09 | Synthetic Genomics, Inc. | Improving algal lipid productivity via genetic modification of a TPR domain containing protein |
KR20200098578A (en) | 2017-12-15 | 2020-08-20 | 다니스코 유에스 인크. | CAS9 variants and how to use them |
CN107868123B (en) | 2017-12-25 | 2020-05-12 | 中国农业科学院作物科学研究所 | Gene capable of simultaneously improving plant yield and resistance and application thereof |
WO2019133881A1 (en) | 2017-12-29 | 2019-07-04 | Rubius Therapeutics, Inc. | Gene editing and targeted transcriptional modulation for enginerering erythroid cells |
WO2019136159A1 (en) | 2018-01-03 | 2019-07-11 | Magenta Therapeutics Inc. | Compositions and methods for the expansion of hematopoietic stem and progenitor cells and treatment of inherited metabolic disorders |
US11994512B2 (en) | 2018-01-04 | 2024-05-28 | Massachusetts Institute Of Technology | Single-cell genomic methods to generate ex vivo cell systems that recapitulate in vivo biology with improved fidelity |
US20210072244A1 (en) | 2018-01-04 | 2021-03-11 | INSERM (Institut National de la Santé et de la Recherche Médicale) | Methods and compositions for treating melanoma resistant |
US11359208B2 (en) | 2018-01-09 | 2022-06-14 | Cibus Us Llc | Shatterproof genes and mutations |
WO2019140278A1 (en) | 2018-01-11 | 2019-07-18 | Fred Hutchinson Cancer Research Center | Immunotherapy targeting core binding factor antigens |
CN111566121A (en) | 2018-01-12 | 2020-08-21 | 巴斯夫欧洲公司 | Gene for determining number of spikelets per ear QTL on wheat 7a chromosome |
CA3088788A1 (en) | 2018-01-17 | 2019-07-25 | Vertex Pharmaceuticals Incorporated | Dna-pk inhibitors |
AU2019209292B2 (en) | 2018-01-17 | 2023-10-05 | Vertex Pharmaceuticals Incorporated | Quinoxalinone compounds, compositions, methods, and kits for increasing genome editing efficiency |
CN111757876B (en) | 2018-01-17 | 2024-03-22 | 沃泰克斯药物股份有限公司 | DNA-PK inhibitors |
US20210054064A1 (en) | 2018-01-24 | 2021-02-25 | INSERM (Institut National de la Santé et de la Recherche Médicale | Antagonists of il-33 for use in methods for preventing ischemia reperfusion injusry in an organ |
WO2019147743A1 (en) | 2018-01-26 | 2019-08-01 | Massachusetts Institute Of Technology | Structure-guided chemical modification of guide rna and its applications |
IL257225A (en) | 2018-01-29 | 2018-04-09 | Yeda Res & Dev | Treatment of sarcoma |
US11220694B1 (en) | 2018-01-29 | 2022-01-11 | Inari Agriculture, Inc. | Rice cells and rice plants |
US11802288B1 (en) * | 2018-01-29 | 2023-10-31 | Inari Agriculture Technology, Inc. | Methods for efficient soybean genome editing |
US11926835B1 (en) * | 2018-01-29 | 2024-03-12 | Inari Agriculture Technology, Inc. | Methods for efficient tomato genome editing |
WO2019153067A1 (en) * | 2018-02-06 | 2019-08-15 | Valorbec, Société en commandite | Microfluidic devices, systems, infrastructures, uses thereof and methods for genetic engineering using same |
KR20200119239A (en) | 2018-02-08 | 2020-10-19 | 지머젠 인코포레이티드 | Genome editing using CRISPR in Corynebacterium |
EP3751990A1 (en) | 2018-02-14 | 2020-12-23 | Institute Of Genetics And Developmental Biology Chinese Academy of Sciences | Methods of increasing nutrient use efficiency |
JP7384811B2 (en) | 2018-02-16 | 2023-11-21 | アンスティチュ ナショナル ドゥ ラ サンテ エ ドゥ ラ ルシェルシュ メディカル | Methods and compositions for treating vitiligo |
US20210079061A1 (en) | 2018-02-26 | 2021-03-18 | Fred Hutchinson Cancer Research Center | Compositions and methods for cellular immunotherapy |
US20190284553A1 (en) | 2018-03-15 | 2019-09-19 | KSQ Therapeutics, Inc. | Gene-regulating compositions and methods for improved immunotherapy |
WO2019183123A1 (en) | 2018-03-19 | 2019-09-26 | Regeneron Pharmaceuticals, Inc. | Transcription modulation in animals using crispr/cas systems |
US10760075B2 (en) | 2018-04-30 | 2020-09-01 | Snipr Biome Aps | Treating and preventing microbial infections |
AU2019241967A1 (en) | 2018-03-29 | 2020-11-19 | Inscripta, Inc. | Automated control of cell growth rates for induction and transformation |
WO2019193375A1 (en) | 2018-04-04 | 2019-10-10 | INSERM (Institut National de la Santé et de la Recherche Médicale) | Use of fzd7 inhibitors for the treatment of retinal neovascularization |
IT201800004253A1 (en) | 2018-04-05 | 2019-10-05 | Compositions and methods for the treatment of hereditary dominant catecholaminergic polymorphic ventricular tachycardia. | |
JP7304888B2 (en) | 2018-04-12 | 2023-07-07 | プレシジョン バイオサイエンシズ,インク. | Optimized engineered nucleases with specificity for the human T-cell receptor alpha constant region gene |
US10376889B1 (en) | 2018-04-13 | 2019-08-13 | Inscripta, Inc. | Automated cell processing instruments comprising reagent cartridges |
AU2019250692A1 (en) | 2018-04-13 | 2020-11-05 | Sangamo Therapeutics France | Chimeric antigen receptor specific for Interleukin-23 receptor |
AU2019256287A1 (en) | 2018-04-17 | 2020-11-12 | The General Hospital Corporation | Sensitive in vitro assays for substrate preferences and sites of nucleic acid binding, modifying, and cleaving agents |
WO2019204585A1 (en) | 2018-04-19 | 2019-10-24 | Massachusetts Institute Of Technology | Single-stranded break detection in double-stranded dna |
JP2021521788A (en) | 2018-04-19 | 2021-08-30 | ザ・リージエンツ・オブ・ザ・ユニバーシテイー・オブ・カリフオルニア | Compositions and methods for genome editing |
EP3560330B1 (en) | 2018-04-24 | 2022-06-15 | KWS SAAT SE & Co. KGaA | Plants with improved digestibility and marker haplotypes |
WO2019209926A1 (en) | 2018-04-24 | 2019-10-31 | Inscripta, Inc. | Automated instrumentation for production of peptide libraries |
US10858761B2 (en) | 2018-04-24 | 2020-12-08 | Inscripta, Inc. | Nucleic acid-guided editing of exogenous polynucleotides in heterologous cells |
US10557216B2 (en) | 2018-04-24 | 2020-02-11 | Inscripta, Inc. | Automated instrumentation for production of T-cell receptor peptide libraries |
CN108707621B (en) | 2018-04-26 | 2021-02-12 | 中国农业科学院作物科学研究所 | CRISPR/Cpf1 system-mediated homologous recombination method taking RNA transcript as repair template |
US11957695B2 (en) | 2018-04-26 | 2024-04-16 | The Broad Institute, Inc. | Methods and compositions targeting glucocorticoid signaling for modulating immune responses |
EP3788094A2 (en) | 2018-04-27 | 2021-03-10 | Genedit Inc. | Cationic polymer and use for biomolecule delivery |
CA3098303A1 (en) | 2018-04-27 | 2019-10-31 | Iovance Biotherapeutics, Inc. | Closed process for expansion and gene editing of tumor infiltrating lymphocytes and uses of same in immunotherapy |
US20210047405A1 (en) | 2018-04-27 | 2021-02-18 | Novartis Ag | Car t cell therapies with enhanced efficacy |
WO2019210268A2 (en) | 2018-04-27 | 2019-10-31 | The Broad Institute, Inc. | Sequencing-based proteomics |
CN110184301B (en) * | 2018-04-28 | 2023-02-24 | 辉大(上海)生物科技有限公司 | Efficient and accurate targeted integration through Tild-CRISPR |
US20210386829A1 (en) | 2018-05-04 | 2021-12-16 | The Broad Institute, Inc. | Compositions and methods for modulating cgrp signaling to regulate innate lymphoid cell inflammatory responses |
CN112218945A (en) | 2018-05-08 | 2021-01-12 | 国立大学法人大阪大学 | Method for producing homozygous cells |
EP4252759A3 (en) | 2018-05-11 | 2023-11-08 | Memorial Sloan Kettering Cancer Center | T cell receptors targeting pik3ca mutations and uses thereof |
JP2021523745A (en) | 2018-05-16 | 2021-09-09 | シンテゴ コーポレイション | Methods and systems for guide RNA design and use |
US11690921B2 (en) | 2018-05-18 | 2023-07-04 | Sangamo Therapeutics, Inc. | Delivery of target specific nucleases |
GB201808424D0 (en) | 2018-05-23 | 2018-07-11 | Lucite Int Uk Ltd | Methods for producing BMA and MMA using genetically modified microorganisms |
WO2019232542A2 (en) | 2018-06-01 | 2019-12-05 | Massachusetts Institute Of Technology | Methods and compositions for detecting and modulating microenvironment gene signatures from the csf of metastasis patients |
WO2019229722A1 (en) | 2018-06-01 | 2019-12-05 | Avectas Limited | Cell engineering platform |
US11866719B1 (en) | 2018-06-04 | 2024-01-09 | Inari Agriculture Technology, Inc. | Heterologous integration of regulatory elements to alter gene expression in wheat cells and wheat plants |
US20210222125A1 (en) | 2018-06-07 | 2021-07-22 | The Brigham And Women`S Hospital, Inc. | Methods for generating hematopoietic stem cells |
CN112203725A (en) | 2018-06-13 | 2021-01-08 | 诺华股份有限公司 | BCMA chimeric antigen receptors and uses thereof |
WO2019237386A1 (en) * | 2018-06-16 | 2019-12-19 | 深圳市博奥康生物科技有限公司 | Method for knocking out human ct1.1 gene |
CA3101066A1 (en) | 2018-06-26 | 2020-01-02 | The Broad Institute, Inc. | Crispr/cas and transposase based amplification compositions, systems and methods |
MX2020013836A (en) | 2018-06-26 | 2021-05-27 | Massachusetts Inst Technology | Crispr effector system based amplification methods, systems, and diagnostics. |
EP3814369A1 (en) | 2018-06-29 | 2021-05-05 | Stichting Het Nederlands Kanker Instituut- Antoni van Leeuwenhoek Ziekenhuis | Tweak-receptor agonists for use in combination with immunotherapy of a cancer |
EP3813871A4 (en) | 2018-06-29 | 2022-10-12 | Icahn School of Medicine at Mount Sinai | Anc80 encoding sphingolipid-metabolizing proteins |
WO2020005383A1 (en) | 2018-06-30 | 2020-01-02 | Inscripta, Inc. | Instruments, modules, and methods for improved detection of edited sequences in live cells |
EP3818075A1 (en) | 2018-07-04 | 2021-05-12 | Ukko Inc. | Methods of de-epitoping wheat proteins and use of same for the treatment of celiac disease |
EP3820995A1 (en) * | 2018-07-10 | 2021-05-19 | Alia Therapeutics S.R.L. | Vesicles for traceless delivery of guide rna molecules and/or guide rna molecule/rna-guided nuclease complex(es) and a production method thereof |
EP3821012A4 (en) | 2018-07-13 | 2022-04-20 | The Regents of The University of California | Retrotransposon-based delivery vehicle and methods of use thereof |
WO2020018964A1 (en) | 2018-07-20 | 2020-01-23 | Fred Hutchinson Cancer Research Center | Compositions and methods for controlled expression of antigen-specific receptors |
CN113348245A (en) | 2018-07-31 | 2021-09-03 | 博德研究所 | Novel CRISPR enzymes and systems |
WO2020028686A1 (en) * | 2018-08-01 | 2020-02-06 | New York University | Targeting piezo1 for treatment of cancer and infectious diseases |
EP3833383A1 (en) | 2018-08-06 | 2021-06-16 | INSERM (Institut National de la Santé et de la Recherche Médicale) | Methods and compositions for treating cancers |
EP3833761A1 (en) | 2018-08-07 | 2021-06-16 | The Broad Institute, Inc. | Novel cas12b enzymes and systems |
EP3607819A1 (en) | 2018-08-10 | 2020-02-12 | Vilmorin et Cie | Resistance to xanthomonas campestris pv. campestris (xcc) in cauliflower |
US20210292389A1 (en) | 2018-08-10 | 2021-09-23 | Sangamo Therapeutics France | New car constructs comprising tnfr2 domains |
US11142740B2 (en) | 2018-08-14 | 2021-10-12 | Inscripta, Inc. | Detection of nuclease edited sequences in automated modules and instruments |
US10532324B1 (en) | 2018-08-14 | 2020-01-14 | Inscripta, Inc. | Instruments, modules, and methods for improved detection of edited sequences in live cells |
US10752874B2 (en) | 2018-08-14 | 2020-08-25 | Inscripta, Inc. | Instruments, modules, and methods for improved detection of edited sequences in live cells |
WO2020086144A2 (en) | 2018-08-15 | 2020-04-30 | Zymergen Inc. | APPLICATIONS OF CRISPRi IN HIGH THROUGHPUT METABOLIC ENGINEERING |
US20210324357A1 (en) | 2018-08-20 | 2021-10-21 | The Brigham And Women's Hospital, Inc. | Degradation domain modifications for spatio-temporal control of rna-guided nucleases |
US20210317429A1 (en) | 2018-08-20 | 2021-10-14 | The Broad Institute, Inc. | Methods and compositions for optochemical control of crispr-cas9 |
US20210355522A1 (en) | 2018-08-20 | 2021-11-18 | The Broad Institute, Inc. | Inhibitors of rna-guided nuclease activity and uses thereof |
JP2021534752A (en) | 2018-08-22 | 2021-12-16 | フレッド ハッチンソン キャンサー リサーチ センター | Immunotherapy targeting KRAS or HER2 antigens |
IL280951B1 (en) | 2018-08-23 | 2024-04-01 | Sangamo Therapeutics Inc | Engineered target specific base editors |
CN112930393A (en) | 2018-08-28 | 2021-06-08 | 福瑞德哈金森癌症研究中心 | Methods and compositions for adoptive T cell therapy in conjunction with induced Notch signaling |
KR20220036908A (en) | 2018-08-28 | 2022-03-23 | 보르 바이오파마 인크. | Genetically engineered hematopoietic stem cells and uses thereof |
AU2019363487A1 (en) | 2018-08-30 | 2021-04-15 | Inscripta, Inc. | Improved detection of nuclease edited sequences in automated modules and instruments |
US11479762B1 (en) | 2018-08-31 | 2022-10-25 | Inari Agriculture Technology, Inc. | Compositions, systems, and methods for genome editing |
WO2020048942A1 (en) | 2018-09-04 | 2020-03-12 | INSERM (Institut National de la Santé et de la Recherche Médicale) | Methods and pharmaceutical compositions for enhancing cytotoxic t lymphocyte-dependent immune responses |
SG11202102208WA (en) | 2018-09-04 | 2021-04-29 | Magenta Therapeutics Inc | Aryl hydrocarbon receptor antagonists and methods of use |
WO2020051283A1 (en) * | 2018-09-05 | 2020-03-12 | The Regents Of The University Of California | Generation of heritably gene-edited plants without tissue culture |
EP3846909A1 (en) | 2018-09-05 | 2021-07-14 | Institut National de la Santé et de la Recherche Médicale (INSERM) | Methods and compositions for treating asthma and allergic diseases |
WO2020051507A1 (en) | 2018-09-06 | 2020-03-12 | The Broad Institute, Inc. | Nucleic acid assemblies for use in targeted delivery |
WO2020051452A2 (en) * | 2018-09-07 | 2020-03-12 | The J. David Gladstone Institutes, A Testamentary Trust Established Under The Will Of J. David Gladstone | Hiv or hcv detection with crispr-cas13a |
US20220047567A1 (en) | 2018-09-10 | 2022-02-17 | INSERM (Institut National de la Santé et de la Recherche Médicale) | Methods for the treatment of neurofibromatosis |
EP4268831A3 (en) | 2018-09-12 | 2024-05-22 | Fred Hutchinson Cancer Center | Reducing cd33 expression to selectively protect therapeutic cells |
CN113164623A (en) | 2018-09-18 | 2021-07-23 | 维恩维纽克公司 | ARC-based capsids and uses thereof |
WO2020061161A1 (en) | 2018-09-18 | 2020-03-26 | Sangamo Therapeutics, Inc. | Programmed cell death 1 (pd1) specific nucleases |
WO2020061391A1 (en) * | 2018-09-20 | 2020-03-26 | The Trustees Of Columbia University In The City Of New York | Methods for inhibiting tumor cells using inhibitors of foxo3a antagonists |
JP2022501374A (en) | 2018-09-21 | 2022-01-06 | プレジデント アンド フェローズ オブ ハーバード カレッジ | Methods and Compositions for Treating Diabetes, as well as Methods for Concentrating mRNA Encoding Secretory Proteins |
WO2020068702A1 (en) | 2018-09-24 | 2020-04-02 | Fred Hutchinson Cancer Research Center | Chimeric receptor proteins and uses thereof |
EP3856772A1 (en) | 2018-09-25 | 2021-08-04 | Institut National de la Santé et de la Recherche Médicale (INSERM) | Use of antagonists of th17 cytokines for the treatment of bronchial remodeling in patients suffering from allergic asthma |
GB201815672D0 (en) | 2018-09-26 | 2018-11-07 | Innes John Centre | Methods for altering starch granule size profile |
WO2020070062A1 (en) | 2018-10-01 | 2020-04-09 | INSERM (Institut National de la Santé et de la Recherche Médicale) | Use of tim-3 inhibitors for the treatment of exacerbations in patients suffering from severe asthma |
WO2020072248A1 (en) | 2018-10-01 | 2020-04-09 | North Carolina State University | Recombinant type i crispr-cas system |
JP7288915B2 (en) | 2018-10-04 | 2023-06-08 | 株式会社カネカ | DNA constructs used for plant genome editing |
US20210347898A1 (en) | 2018-10-09 | 2021-11-11 | INSERM (Institut National de la Santé et de la Recherche Médicale) | Use of alpha-v-integrin (cd51) inhibitors for the treatment of cardiac fibrosis |
US20220411783A1 (en) | 2018-10-12 | 2022-12-29 | The Broad Institute, Inc. | Method for extracting nuclei or whole cells from formalin-fixed paraffin-embedded tissues |
US11851663B2 (en) | 2018-10-14 | 2023-12-26 | Snipr Biome Aps | Single-vector type I vectors |
US20210379057A1 (en) | 2018-10-16 | 2021-12-09 | Massachusetts Institute Of Technology | Nutlin-3a for use in treating a mycobacterium tuberculosis infection |
WO2020079162A1 (en) | 2018-10-18 | 2020-04-23 | INSERM (Institut National de la Santé et de la Recherche Médicale) | Methods for inducing full ablation of hematopoiesis |
US11214781B2 (en) | 2018-10-22 | 2022-01-04 | Inscripta, Inc. | Engineered enzyme |
CN113227368B (en) | 2018-10-22 | 2023-07-07 | 因思科瑞普特公司 | Engineered enzymes |
EP3870628B1 (en) | 2018-10-24 | 2024-04-03 | Genedit Inc. | Cationic polymer with alkyl side chains and use for biomolecule delivery |
US11407995B1 (en) | 2018-10-26 | 2022-08-09 | Inari Agriculture Technology, Inc. | RNA-guided nucleases and DNA binding proteins |
IL262658A (en) | 2018-10-28 | 2020-04-30 | Memorial Sloan Kettering Cancer Center | Prevention of age related clonal hematopoiesis and diseases associated therewith |
CA3117805A1 (en) | 2018-10-31 | 2020-05-07 | Zymergen Inc. | Multiplexed deterministic assembly of dna libraries |
US11970733B2 (en) * | 2018-11-01 | 2024-04-30 | Synthego Corporation | Methods for analyzing nucleic acid sequences |
US20210403519A1 (en) | 2018-11-02 | 2021-12-30 | Insideoutbio, Inc. | Methods and compositions to induce or suppress immune responses through the use of membrane bound complement split products |
US11434477B1 (en) | 2018-11-02 | 2022-09-06 | Inari Agriculture Technology, Inc. | RNA-guided nucleases and DNA binding proteins |
AU2019370485A1 (en) | 2018-11-02 | 2021-05-13 | Annexon, Inc. | Compositions and methods for treating brain injury |
KR20210091213A (en) | 2018-11-05 | 2021-07-21 | 이오반스 바이오테라퓨틱스, 인크. | Methods for generating tumor-infiltrating lymphocytes and their use in immunotherapy |
EP3877511A1 (en) | 2018-11-05 | 2021-09-15 | Iovance Biotherapeutics, Inc. | Expansion of tils utilizing akt pathway inhibitors |
EP3876957A1 (en) | 2018-11-05 | 2021-09-15 | Iovance Biotherapeutics, Inc. | Treatment of nsclc patients refractory for anti-pd-1 antibody |
MX2021004953A (en) | 2018-11-05 | 2021-08-11 | Iovance Biotherapeutics Inc | Selection of improved tumor reactive t-cells. |
EP3877552B1 (en) | 2018-11-08 | 2023-02-22 | Sutro Biopharma, Inc. | E coli strains having an oxidative cytoplasm |
CA3119188A1 (en) | 2018-11-09 | 2020-05-14 | Fred Hutchinson Cancer Research Center | T cell receptors specific for mesothelin and their use in immunotherapy |
CN113166269A (en) | 2018-11-13 | 2021-07-23 | 指南针制药有限责任公司 | Multispecific binding constructs against checkpoint molecules and uses thereof |
EP3653708A1 (en) | 2018-11-14 | 2020-05-20 | Evonik Operations GmbH | Isomaltulose production |
US20220282275A1 (en) | 2018-11-15 | 2022-09-08 | The Broad Institute, Inc. | G-to-t base editors and uses thereof |
MX2021006210A (en) | 2018-11-26 | 2021-08-19 | Asociacion Centro De Investig Cooperativa En Biociencias Cic Biogune | Methods for diagnosing and/or treating acute or chronic liver, kidney or lung disease. |
RU2712497C1 (en) * | 2018-11-26 | 2020-01-29 | Автономная некоммерческая образовательная организация высшего образования Сколковский институт науки и технологий | DNA POLYMER BASED ON Cas9 PROTEIN FROM BIOTECHNOLOGICALLY SIGNIFICANT BACTERIUM CLOSTRIDIUM CELLULOLYTICUM |
RU2712492C1 (en) * | 2018-11-26 | 2020-01-29 | Автономная некоммерческая образовательная организация высшего образования Сколковский институт науки и технологий | DNA PROTEASE CUTTING AGENT BASED ON Cas9 PROTEIN FROM DEFLUVIIMONAS SP. |
CN113423823A (en) | 2018-12-12 | 2021-09-21 | 国立大学法人九州大学 | Method for producing genome-edited cell |
US11166996B2 (en) | 2018-12-12 | 2021-11-09 | Flagship Pioneering Innovations V, Inc. | Anellovirus compositions and methods of use |
WO2020123502A1 (en) | 2018-12-13 | 2020-06-18 | Versiti Blood Research Institute Foundation, Inc. | Method of treating autoimmune and inflammatory diseases using b cells |
US20220073890A1 (en) | 2018-12-14 | 2022-03-10 | Pioneer Hi-Bred International, Inc. | Novel crispr-cas systems for genome editing |
US20220062394A1 (en) | 2018-12-17 | 2022-03-03 | The Broad Institute, Inc. | Methods for identifying neoantigens |
EP3898958A1 (en) | 2018-12-17 | 2021-10-27 | The Broad Institute, Inc. | Crispr-associated transposase systems and methods of use thereof |
CA3123392A1 (en) | 2018-12-19 | 2020-06-25 | Iovance Biotherapeutics, Inc. | Methods of expanding tumor infiltrating lymphocytes using engineered cytokine receptor pairs and uses thereof |
JP2022515211A (en) | 2018-12-20 | 2022-02-17 | アールネイティブズ・インコーポレイテッド | Synthetic microRNA mimic |
JP7449291B2 (en) | 2018-12-20 | 2024-03-13 | リジェネロン・ファーマシューティカルズ・インコーポレイテッド | Nuclease-mediated repeat expansion |
EP3898661A1 (en) | 2018-12-21 | 2021-10-27 | Precision BioSciences, Inc. | Genetic modification of the hydroxyacid oxidase 1 gene for treatment of primary hyperoxaluria |
WO2020136216A1 (en) | 2018-12-27 | 2020-07-02 | INSERM (Institut National de la Santé et de la Recherche Médicale) | Methods of identifying subjects having or at risk of having a coagulation related disorder |
AU2020205150A1 (en) | 2019-01-03 | 2021-07-22 | Assistance Publique-Hôpitaux De Paris (Aphp) | Methods and pharmaceutical compositions for enhancing CD8+ T cell-dependent immune responses in subjects suffering from cancer |
US11739156B2 (en) | 2019-01-06 | 2023-08-29 | The Broad Institute, Inc. Massachusetts Institute of Technology | Methods and compositions for overcoming immunosuppression |
WO2020146805A1 (en) | 2019-01-11 | 2020-07-16 | Acuitas Therapeutics, Inc. | Lipids for lipid nanoparticle delivery of active agents |
CA3145881A1 (en) | 2019-01-15 | 2020-07-23 | Seminis Vegetable Seeds, Inc. | Green bean plants with improved resistance to sclerotinia sclerotiorum and genetic markers therefor |
US20220119516A1 (en) | 2019-01-16 | 2022-04-21 | INSERM (Institut National de la Santé et de la Recherche Médicale) | Variants of erythroferrone and their use |
EP3911369A4 (en) | 2019-01-18 | 2022-11-16 | Orthobio Therapeutics, Inc. | Gene editing to improve joint function |
EP3921031A1 (en) | 2019-02-04 | 2021-12-15 | Institut National de la Santé et de la Recherche Médicale (INSERM) | Methods and compositions for modulating blood-brain barrier |
EP3826664A4 (en) | 2019-02-06 | 2022-10-26 | Sangamo Therapeutics, Inc. | Method for the treatment of mucopolysaccharidosis type i |
US20220145330A1 (en) | 2019-02-10 | 2022-05-12 | The J. David Gladstone Institutes, a testamentary trust established under the Will of J. David Glads | Modified mitochondrion and methods of use thereof |
WO2020168315A1 (en) | 2019-02-15 | 2020-08-20 | Just-Evotec Biologics, Inc. | Automated biomanufacturing systems, facilities, and processes |
WO2020169472A2 (en) | 2019-02-18 | 2020-08-27 | INSERM (Institut National de la Santé et de la Recherche Médicale) | Methods of inducing phenotypic changes in macrophages |
JP2022521513A (en) | 2019-02-20 | 2022-04-08 | フレッド ハッチンソン キャンサー リサーチ センター | RAS neoantigen-specific binding proteins and their use |
EP3931310A1 (en) | 2019-03-01 | 2022-01-05 | Iovance Biotherapeutics, Inc. | Expansion of tumor infiltrating lymphocytes from liquid tumors and therapeutic uses thereof |
CA3128360A1 (en) | 2019-03-05 | 2020-09-10 | Yuval CINNAMON | Genome-edited birds |
AU2020231380A1 (en) | 2019-03-07 | 2021-09-23 | The Regents Of The University Of California | CRISPR-Cas effector polypeptides and methods of use thereof |
US10947534B2 (en) | 2019-03-07 | 2021-03-16 | The Trustees Of Columbia University In The City Of New York | RNA-guided DNA integration using Tn7-like transposons |
CA3129871A1 (en) | 2019-03-08 | 2020-09-17 | Zymergen Inc. | Iterative genome editing in microbes |
US11053515B2 (en) | 2019-03-08 | 2021-07-06 | Zymergen Inc. | Pooled genome editing in microbes |
AU2020237043A1 (en) | 2019-03-11 | 2021-09-30 | Fred Hutchinson Cancer Center | High avidity WT1 T cell receptors and uses thereof |
CN113825834A (en) | 2019-03-11 | 2021-12-21 | 索伦托药业有限公司 | Improved process for DNA construct integration using RNA-guided endonuclease |
US11781131B2 (en) | 2019-03-18 | 2023-10-10 | Regeneron Pharmaceuticals, Inc. | CRISPR/Cas dropout screening platform to reveal genetic vulnerabilities associated with tau aggregation |
CN113631700A (en) | 2019-03-18 | 2021-11-09 | 瑞泽恩制药公司 | CRISPR/Cas screening platform for identifying genetic modification factors for tau vaccination or aggregation |
US20220177863A1 (en) | 2019-03-18 | 2022-06-09 | The Broad Institute, Inc. | Type vii crispr proteins and systems |
WO2020191153A2 (en) | 2019-03-19 | 2020-09-24 | The Broad Institute, Inc. | Methods and compositions for editing nucleotide sequences |
CN113631713A (en) | 2019-03-25 | 2021-11-09 | 因思科瑞普特公司 | Simultaneous multiplex genome editing in yeast |
US11001831B2 (en) | 2019-03-25 | 2021-05-11 | Inscripta, Inc. | Simultaneous multiplex genome editing in yeast |
WO2020193740A1 (en) | 2019-03-28 | 2020-10-01 | INSERM (Institut National de la Santé et de la Recherche Médicale) | New strategy for treating pancreatic cancer |
US20220249511A1 (en) | 2019-03-29 | 2022-08-11 | INSERM (Institut National de la Santé et de la Recherche Médicale) | Methods for the treatment of keloid, hypertrophic scars and/or hyperpigmentation disorders |
US20220162649A1 (en) | 2019-04-01 | 2022-05-26 | The Broad Institute, Inc. | Novel nucleic acid modifiers |
US20220175848A1 (en) | 2019-04-01 | 2022-06-09 | The Broad Institute, Inc. | Methods and compositions for cell therapy |
WO2020201362A2 (en) | 2019-04-02 | 2020-10-08 | INSERM (Institut National de la Santé et de la Recherche Médicale) | Methods of predicting and preventing cancer in patients having premalignant lesions |
KR20210146986A (en) | 2019-04-02 | 2021-12-06 | 상가모 테라퓨틱스, 인코포레이티드 | Methods of treating beta-thalassemia |
EP4332115A3 (en) | 2019-04-03 | 2024-05-29 | Precision Biosciences, Inc. | Genetically-modified immune cells comprising a microrna-adapted shrna (shrnamir) |
MX2021011956A (en) | 2019-04-03 | 2021-12-15 | Regeneron Pharma | Methods and compositions for insertion of antibody coding sequences into a safe harbor locus. |
KR102487901B1 (en) | 2019-04-04 | 2023-01-12 | 리제너론 파마슈티칼스 인코포레이티드 | Methods for seamless introduction of targeted modifications into targeting vectors |
WO2020206139A1 (en) | 2019-04-04 | 2020-10-08 | Regeneron Pharmaceuticals, Inc. | Non-human animals comprising a humanized coagulation factor 12 locus |
EP3947662A1 (en) | 2019-04-05 | 2022-02-09 | Danisco US Inc. | Methods for integrating a donor dna sequence into the genome of bacillus using linear recombinant dna constructs and compositions thereof |
US20220162621A1 (en) | 2019-04-05 | 2022-05-26 | Danisco Us Inc | Methods For Polynucleotide Integration Into The Genome Of Bacillus Using Dual Circular Recombinant DNA Constructs And Compositions Thereof |
CA3136265A1 (en) | 2019-04-05 | 2020-10-08 | Precision Biosciences, Inc. | Methods of preparing populations of genetically-modified immune cells |
WO2020208082A1 (en) | 2019-04-09 | 2020-10-15 | INSERM (Institut National de la Santé et de la Recherche Médicale) | Method for treating cmv related diseases |
US20220340711A1 (en) | 2019-04-23 | 2022-10-27 | GenEdit, Inc. | Cationic polymer with alkyl side chains |
WO2020219742A1 (en) | 2019-04-24 | 2020-10-29 | Novartis Ag | Compositions and methods for selective protein degradation |
US20220220565A1 (en) | 2019-04-30 | 2022-07-14 | INSERM (Institut National de la Santé et de la Recherche Médicale) | Methods and compositions for treating melanoma |
US20220193142A1 (en) | 2019-04-30 | 2022-06-23 | Edigene Inc. | Method for predicting effectiveness of treatment of hemoglobinopathy |
UY38693A (en) | 2019-05-13 | 2020-12-31 | Kws Saat Se & Co Kgaa | DROUGHT TOLERANCE IN CORN |
US20220249559A1 (en) | 2019-05-13 | 2022-08-11 | Iovance Biotherapeutics, Inc. | Methods and compositions for selecting tumor infiltrating lymphocytes and uses of the same in immunotherapy |
US20220220169A1 (en) | 2019-05-15 | 2022-07-14 | Insideoutbio, Inc. | Modular Therapeutics for the Treatment of Inflammatory Diseases and Cancer |
US20220220468A1 (en) * | 2019-05-17 | 2022-07-14 | Beth Israel Deaconess Medical Center, Inc. | Compositions and methods for homology directed repair |
US20220220469A1 (en) | 2019-05-20 | 2022-07-14 | The Broad Institute, Inc. | Non-class i multi-component nucleic acid targeting systems |
WO2020236967A1 (en) | 2019-05-20 | 2020-11-26 | The Broad Institute, Inc. | Random crispr-cas deletion mutant |
CN113924367A (en) | 2019-05-23 | 2022-01-11 | 南京农业大学 | Method for improving rice grain yield |
WO2020239623A1 (en) | 2019-05-24 | 2020-12-03 | INSERM (Institut National de la Santé et de la Recherche Médicale) | Use of ngal inhibitors for the treating chronic wound |
AR118995A1 (en) | 2019-05-25 | 2021-11-17 | Kws Saat Se & Co Kgaa | HAPLOID INDUCTION ENHANCER |
EP3976015A1 (en) | 2019-05-28 | 2022-04-06 | Genedit Inc. | Polymer comprising multiple functionalized sidechains for biomolecule delivery |
US20220243178A1 (en) | 2019-05-31 | 2022-08-04 | The Broad Institute, Inc. | Methods for treating metabolic disorders by targeting adcy5 |
JP2022534867A (en) | 2019-06-04 | 2022-08-04 | リジェネロン・ファーマシューティカルズ・インコーポレイテッド | Non-human animals containing humanized TTR loci with beta slip mutations and methods of use |
WO2020245208A1 (en) | 2019-06-04 | 2020-12-10 | INSERM (Institut National de la Santé et de la Recherche Médicale) | Use of cd9 as a biomarker and as a biotarget in glomerulonephritis or glomerulosclerosis |
EP3980012A1 (en) | 2019-06-04 | 2022-04-13 | Institut National de la Santé et de la Recherche Médicale (INSERM) | A neuropilin antagonist in combination with a p38alpha-kinase inhibitor for the treatment of cancer |
WO2020244759A1 (en) | 2019-06-05 | 2020-12-10 | Klemm & Sohn Gmbh & Co. Kg | New plants having a white foliage phenotype |
CA3139122C (en) | 2019-06-06 | 2023-04-25 | Inscripta, Inc. | Curing for recursive nucleic acid-guided cell editing |
BR112021022722A2 (en) | 2019-06-07 | 2022-01-04 | Regeneron Pharma | Non-human animal, non-human animal cell, non-human animal genome, humanized non-human animal albumin gene, targeting vector, method of evaluating the activity of a reagent, and, method of optimizing the activity of a reagent |
RU2722933C1 (en) * | 2019-06-11 | 2020-06-05 | Автономная некоммерческая образовательная организация высшего образования Сколковский институт науки и технологий | Dna protease cutting agent based on cas9 protein from demequina sediminicola bacteria |
WO2020249769A1 (en) | 2019-06-14 | 2020-12-17 | INSERM (Institut National de la Santé et de la Recherche Médicale) | Methods and compositions for treating ocular diseases related to mitochondrial dna maintenance |
EP3813522A1 (en) | 2019-06-14 | 2021-05-05 | Regeneron Pharmaceuticals, Inc. | Models of tauopathy |
US10907125B2 (en) | 2019-06-20 | 2021-02-02 | Inscripta, Inc. | Flow through electroporation modules and instrumentation |
WO2020254850A1 (en) | 2019-06-21 | 2020-12-24 | Vilmorin & Cie | Improvement of quality and permanence of green color of peppers at maturity and over-maturity |
US10920189B2 (en) | 2019-06-21 | 2021-02-16 | Inscripta, Inc. | Genome-wide rationally-designed mutations leading to enhanced lysine production in E. coli |
WO2020263825A1 (en) | 2019-06-24 | 2020-12-30 | Promega Corporation | Modified polyamine polymers for delivery of biomolecules into cells |
US10927385B2 (en) | 2019-06-25 | 2021-02-23 | Inscripta, Inc. | Increased nucleic-acid guided cell editing in yeast |
SG11202112092TA (en) | 2019-06-25 | 2021-11-29 | Inari Agriculture Technology Inc | Improved homology dependent repair genome editing |
US20220354863A1 (en) | 2019-07-02 | 2022-11-10 | Inserm (Institut National De La Santè Et De La Recherch Médicale) | Methods for the prophylactic treatment of cancer in patients suffering from pancreatitis |
CA3138188A1 (en) | 2019-07-02 | 2021-01-07 | Fred Hutchinson Cancer Research Center | Recombinant ad35 vectors and related gene therapy improvements |
WO2021001431A1 (en) | 2019-07-02 | 2021-01-07 | INSERM (Institut National de la Santé et de la Recherche Médicale) | Use of pi3ka-selective inhibitors for treating metastatic disease in patients suffering from pancreatic cancer |
US20220251148A1 (en) | 2019-07-04 | 2022-08-11 | Ukko Inc. | De-epitoped alpha gliadin and use of same for the management of celiac disease and gluten sensitivity |
US10557149B1 (en) | 2019-07-15 | 2020-02-11 | Vigene Biosciences, Inc. | Recombinantly-modified adeno-associated virus helper vectors and their use to improve the packaging efficiency of recombinantly-modified adeno-associated virus |
US10653731B1 (en) | 2019-07-15 | 2020-05-19 | Vigene Biosciences Inc. | Recombinantly-modified adeno-associated virus (rAAV) having improved packaging efficiency |
US10801042B1 (en) | 2019-07-15 | 2020-10-13 | Vigene Biosciences, Inc. | Use of ion concentrations to increase the packaging efficiency of recombinant adeno-associated virus |
IL268111A (en) | 2019-07-16 | 2021-01-31 | Fainzilber Michael | Methods of treating pain |
WO2021009299A1 (en) | 2019-07-17 | 2021-01-21 | INSERM (Institut National de la Santé et de la Recherche Médicale) | Bcl-xl:fkbp12 fusion proteins suitable for screening agents capable of slowing down the aging process |
CA3146895A1 (en) | 2019-07-23 | 2021-01-28 | Mnemo Therapeutics | Immune cells defective for suv39h1 |
EP4003325A1 (en) | 2019-07-24 | 2022-06-01 | INSERM (Institut National de la Santé et de la Recherche Médicale) | Inhibitors of the sting pathway for the treatment of hidradenitis suppurativa |
WO2021016608A1 (en) | 2019-07-25 | 2021-01-28 | Precision Biosciences, Inc. | Compositions and methods for sequential stacking of nucleic acid sequences into a genomic locus |
WO2021019272A1 (en) | 2019-07-31 | 2021-02-04 | Vilmorin & Cie | Tolerance to tolcndv in cucumber |
WO2021023644A1 (en) | 2019-08-02 | 2021-02-11 | INSERM (Institut National de la Santé et de la Recherche Médicale) | Neutralizing granzyme b for providing cardioprotection in a subject who experienced a myocardial infarction |
EP3772542A1 (en) | 2019-08-07 | 2021-02-10 | KWS SAAT SE & Co. KGaA | Modifying genetic variation in crops by modulating the pachytene checkpoint protein 2 |
WO2021028359A1 (en) | 2019-08-09 | 2021-02-18 | Sangamo Therapeutics France | Controlled expression of chimeric antigen receptors in t cells |
EP4017872A1 (en) | 2019-08-20 | 2022-06-29 | Fred Hutchinson Cancer Center | T-cell immunotherapy specific for wt-1 |
US20220273720A1 (en) | 2019-08-20 | 2022-09-01 | Precision Biosciences, Inc. | Lymphodepletion dosing regimens for cellular immunotherapies |
WO2021035170A1 (en) | 2019-08-21 | 2021-02-25 | Precision Biosciences, Inc. | Compositions and methods for tcr reprogramming using fusion proteins |
US20220298501A1 (en) | 2019-08-30 | 2022-09-22 | The Broad Institute, Inc. | Crispr-associated mu transposase systems |
JP2022547105A (en) | 2019-09-04 | 2022-11-10 | 博雅▲輯▼因(北京)生物科技有限公司 | Evaluation method of gene editing therapy based on off-target evaluation |
WO2021044012A1 (en) | 2019-09-05 | 2021-03-11 | INSERM (Institut National de la Santé et de la Recherche Médicale) | Method of treatment and pronostic of acute myeloid leukemia |
MX2022002722A (en) | 2019-09-05 | 2022-06-09 | Inst Genetics & Developmental Biology Cas | Methods of improving seed size and quality. |
GB201913060D0 (en) | 2019-09-10 | 2019-10-23 | Innes John Centre | Methods of increasing biotic stress resistance in plants |
WO2021047775A1 (en) | 2019-09-12 | 2021-03-18 | INSERM (Institut National de la Santé et de la Recherche Médicale) | Use of inhibitors of tgfb/activinb signaling pathway for the treatment of patients suffering from medulloblastoma group 3 |
CN114616002A (en) | 2019-09-13 | 2022-06-10 | 瑞泽恩制药公司 | Transcriptional regulation in animals using CRISPR/CAS systems delivered by lipid nanoparticles |
US20230025039A1 (en) | 2019-09-20 | 2023-01-26 | The Broad Institute, Inc. | Novel type vi crispr enzymes and systems |
JP2022548399A (en) | 2019-09-23 | 2022-11-18 | オメガ セラピューティクス, インコーポレイテッド | Compositions and methods for modulating hepatocyte nuclear factor 4-alpha (HNF4α) gene expression |
EP4048807A1 (en) | 2019-09-23 | 2022-08-31 | Omega Therapeutics, Inc. | Compositions and methods for modulating apolipoprotein b (apob) gene expression |
US11542513B2 (en) | 2019-09-26 | 2023-01-03 | Seminis Vegetable Seeds, Inc. | Lettuce plants having resistance to Nasonovia ribisnigri biotype Nr:1 |
WO2021063968A1 (en) | 2019-09-30 | 2021-04-08 | INSERM (Institut National de la Santé et de la Recherche Médicale) | Method and composition for diagnosing chronic obstructive pulmonary disease |
GB201914137D0 (en) | 2019-10-01 | 2019-11-13 | Univ Leeds Innovations Ltd | Modified Plants |
US20220354811A1 (en) | 2019-10-03 | 2022-11-10 | INSERM (Institut National de la Santé et de la Recherche Médicale) | Methods and compositions for modulating macrophages polarization |
US11981922B2 (en) | 2019-10-03 | 2024-05-14 | Dana-Farber Cancer Institute, Inc. | Methods and compositions for the modulation of cell interactions and signaling in the tumor microenvironment |
WO2021067788A1 (en) | 2019-10-03 | 2021-04-08 | Artisan Development Labs, Inc. | Crispr systems with engineered dual guide nucleic acids |
WO2021072031A1 (en) | 2019-10-11 | 2021-04-15 | Insideoutbio, Inc. | Methods and compositions for the manufacture and use of circular dna encoded therapeutics for genetic disorders and other diseases |
WO2021072244A1 (en) | 2019-10-11 | 2021-04-15 | Beth Israel Deaconess Medical Center, Inc. | Anti-tn antibodies and uses thereof |
EP3808766A1 (en) | 2019-10-15 | 2021-04-21 | Sangamo Therapeutics France | Chimeric antigen receptor specific for interleukin-23 receptor |
US20230357788A1 (en) | 2019-10-17 | 2023-11-09 | KWS SAAT SE & Co. KGaA | Enhanced disease resistance of crops by downregulation of repressor genes |
WO2021078359A1 (en) | 2019-10-21 | 2021-04-29 | INSERM (Institut National de la Santé et de la Recherche Médicale) | Use of inhibitors of cubilin for the treatment of chronic kidney diseases |
US20220411790A1 (en) * | 2019-10-25 | 2022-12-29 | The Johns Hopkins University | A crispr-cas9 platform with an intrinsic off-switch and enhanced specificity |
CA3155727A1 (en) | 2019-10-25 | 2021-04-29 | Cecile Chartier-Courtaud | Gene editing of tumor infiltrating lymphocytes and uses of same in immunotherapy |
US20240122938A1 (en) | 2019-10-29 | 2024-04-18 | INSERM (Institut National de la Santé et de la Recherche Médicale) | Methods and compositions for treating uveal melanoma |
US20220411479A1 (en) | 2019-10-30 | 2022-12-29 | Precision Biosciences, Inc. | Cd20 chimeric antigen receptors and methods of use for immunotherapy |
IL270306A (en) | 2019-10-30 | 2021-05-31 | Yeda Res & Dev | Prevention and treatment of pre-myeloid and myeloid malignancies |
US20220401481A1 (en) | 2019-11-01 | 2022-12-22 | Magenta Therapeutics, Inc. | Dosing regimens for the mobilization of hematopoietic stem and progenitor cells |
GB201916020D0 (en) | 2019-11-04 | 2019-12-18 | Univ Of Essex Enterprise Limited | Crispr-mediated identification of biotinylated proteins and chromatin regions |
EP4054651A1 (en) | 2019-11-08 | 2022-09-14 | Regeneron Pharmaceuticals, Inc. | Crispr and aav strategies for x-linked juvenile retinoschisis therapy |
KR20220097985A (en) * | 2019-11-13 | 2022-07-08 | 크리스퍼 테라퓨틱스 아게 | Method of making CAR-T cells |
CN114929862A (en) * | 2019-11-13 | 2022-08-19 | 克里斯珀医疗股份公司 | Production method for producing T cell expressing chimeric antigen receptor |
EP4057802A1 (en) | 2019-11-14 | 2022-09-21 | Vilmorin & Cie | Resistance to acidovorax valerianellae in corn salad |
US11203762B2 (en) | 2019-11-19 | 2021-12-21 | Inscripta, Inc. | Methods for increasing observed editing in bacteria |
EP4061944A1 (en) | 2019-11-22 | 2022-09-28 | INSERM (Institut National de la Santé et de la Recherche Médicale) | Inhibitors of adrenomedullin for the treatment of acute myeloid leukemia by eradicating leukemic stem cells |
WO2021102084A1 (en) | 2019-11-22 | 2021-05-27 | President And Fellows Of Harvard College | Ionic liquids for drug delivery |
WO2021108363A1 (en) | 2019-11-25 | 2021-06-03 | Regeneron Pharmaceuticals, Inc. | Crispr/cas-mediated upregulation of humanized ttr allele |
EP4065224A1 (en) | 2019-11-27 | 2022-10-05 | Institut National de la Santé et de la Recherche Médicale (INSERM) | Use of neuropilin antagonists for the treatment of endometriosis |
CA3158729A1 (en) | 2019-11-27 | 2021-06-03 | Virginia Kincaid | Multipartite luciferase peptides and polypeptides |
CN115335521A (en) | 2019-11-27 | 2022-11-11 | 克里斯珀医疗股份公司 | Method for synthesizing RNA molecules |
EP4069285A1 (en) | 2019-12-06 | 2022-10-12 | Precision BioSciences, Inc. | Methods for cancer immunotherapy, using lymphodepletion regimens and cd19, cd20 or bcma allogeneic car t cells |
US10883095B1 (en) | 2019-12-10 | 2021-01-05 | Inscripta, Inc. | Mad nucleases |
EP4073236A1 (en) | 2019-12-11 | 2022-10-19 | Iovance Biotherapeutics, Inc. | Processes for the production of tumor infiltrating lymphocytes (tils) and methods of using the same |
CN114787362A (en) | 2019-12-13 | 2022-07-22 | 中外制药株式会社 | System for detecting extracellular purine receptor ligand and non-human animal introduced with the system |
WO2021118927A1 (en) | 2019-12-13 | 2021-06-17 | Insideoutbio, Inc. | Methods and compositions for targeted delivery of nucleic acid therapeutics |
US10704033B1 (en) | 2019-12-13 | 2020-07-07 | Inscripta, Inc. | Nucleic acid-guided nucleases |
JP2023507566A (en) | 2019-12-18 | 2023-02-24 | インスクリプタ, インコーポレイテッド | Cascade/dCas3 complementation assay for in vivo detection of nucleic acid-guided nuclease-edited cells |
GB201918902D0 (en) | 2019-12-19 | 2020-02-05 | Genome Res Ltd | Cell differentiation |
IL271656A (en) | 2019-12-22 | 2021-06-30 | Yeda Res & Dev | Systems and methods for identifying cells that have undergone genome editing |
US11060141B1 (en) | 2019-12-23 | 2021-07-13 | Stilla Technologies | Multiplex drop-off digital polymerase chain reaction methods |
US20230059884A1 (en) | 2019-12-30 | 2023-02-23 | Edigene Biotechnology Inc. | Universal car-t targeting t-cell lymphoma cell and preparation method therefor and use thereof |
US20230054266A1 (en) | 2019-12-30 | 2023-02-23 | Edigene Biotechnology Inc. | Method for purifying ucart cell and use thereof |
US11859172B2 (en) | 2020-01-02 | 2024-01-02 | The Trustees Of Columbia University In The City Of New York | Programmable and portable CRISPR-Cas transcriptional activation in bacteria |
US10689669B1 (en) | 2020-01-11 | 2020-06-23 | Inscripta, Inc. | Automated multi-module cell processing methods, instruments, and systems |
CN116234906A (en) | 2020-01-13 | 2023-06-06 | 萨那生物技术股份有限公司 | Modification of blood group antigens |
US20230076415A1 (en) | 2020-01-17 | 2023-03-09 | INSERM (Institut National de la Santé et de la Recherche Médicale) | Methods and compositions for treating melanoma |
WO2021148447A1 (en) | 2020-01-21 | 2021-07-29 | Limagrain Europe | Wheat haploid inducer plant and uses |
IL294715A (en) | 2020-01-23 | 2022-09-01 | Childrens Medical Ct Corp | Stroma-free t cell differentiation from human pluripotent stem cells |
WO2021154706A1 (en) | 2020-01-27 | 2021-08-05 | Inscripta, Inc. | Electroporation modules and instrumentation |
EP4096647A1 (en) | 2020-01-30 | 2022-12-07 | Yeda Research and Development Co. Ltd | Treating acute liver disease with tlr-mik inhibitors |
CN115135142A (en) | 2020-02-07 | 2022-09-30 | 中国科学院遗传与发育生物学研究所 | Method for controlling grain size and grain weight |
US20230357784A1 (en) | 2020-02-21 | 2023-11-09 | Limagrain Europe | Prime editing technology for plant genome engineering |
EP3872190A1 (en) | 2020-02-26 | 2021-09-01 | Antibodies-Online GmbH | A method of using cut&run or cut&tag to validate crispr-cas targeting |
CN115485300A (en) | 2020-02-26 | 2022-12-16 | 索伦托药业有限公司 | Activatable antigen binding proteins with universal masking moieties |
WO2021178556A1 (en) | 2020-03-04 | 2021-09-10 | Regeneron Pharmaceuticals, Inc. | Methods and compositions for sensitization of tumor cells to immune therapy |
WO2021183720A1 (en) | 2020-03-11 | 2021-09-16 | Omega Therapeutics, Inc. | Compositions and methods for modulating forkhead box p3 (foxp3) gene expression |
AU2021237790A1 (en) | 2020-03-20 | 2022-10-13 | INSERM (Institut National de la Santé et de la Recherche Médicale) | Chimeric antigen receptor specific for human CD45RC and uses thereof |
US20210290757A1 (en) | 2020-03-23 | 2021-09-23 | Avectas Limited | Engineering of dendritic cells for generation of vaccines against sars-cov-2 |
EP4125348A1 (en) | 2020-03-23 | 2023-02-08 | Regeneron Pharmaceuticals, Inc. | Non-human animals comprising a humanized ttr locus comprising a v30m mutation and methods of use |
US20240099210A1 (en) | 2020-03-26 | 2024-03-28 | National Agriculture And Food Research Organization | Method for producing temperature-sensitive male sterile plant |
CN115697044A (en) | 2020-03-31 | 2023-02-03 | 艾洛生物系统有限公司 | Regulation of endogenous mogroside pathway genes in watermelon and other cucurbitaceae |
US20210319851A1 (en) | 2020-04-03 | 2021-10-14 | Creyon Bio, Inc. | Oligonucleotide-based machine learning |
CA3179410A1 (en) | 2020-04-06 | 2021-10-14 | LogoMix, Inc. | Genome alteration method and genome alteration kit |
US20230340538A1 (en) | 2020-04-08 | 2023-10-26 | Astrazeneca Ab | Compositions and methods for improved site-specific modification |
EP4132954A1 (en) | 2020-04-08 | 2023-02-15 | Institut National de la Santé et de la Recherche Médicale (INSERM) | Use of cdon inhibitors for the treatment of endothelial dysfunction |
EP4135511A1 (en) | 2020-04-14 | 2023-02-22 | Academisch Ziekenhuis Leiden (h.o.d.n. LUMC) | Methods for induction of endogenous tandem duplication events |
NL2025344B1 (en) | 2020-04-14 | 2021-10-26 | Academisch Ziekenhuis Leiden | Methods for induction of endogenous tandem duplication events |
US20230165909A1 (en) | 2020-04-21 | 2023-06-01 | Aspen Neuroscience, Inc. | Gene editing of lrrk2 in stem cells and method of use of cells differentiated therefrom |
EP4138805A1 (en) | 2020-04-23 | 2023-03-01 | Genedit Inc. | Polymer with cationic and hydrophobic side chains |
US20210332388A1 (en) | 2020-04-24 | 2021-10-28 | Inscripta, Inc. | Compositions, methods, modules and instruments for automated nucleic acid-guided nuclease editing in mammalian cells |
WO2021217083A1 (en) | 2020-04-24 | 2021-10-28 | Sorrento Therapeutics, Inc. | Memory dimeric antigen receptors |
MX2022013493A (en) | 2020-04-27 | 2023-02-22 | Magenta Therapeutics Inc | METHODS AND COMPOSITIONS FOR TRANSDUCING HEMATOPOIETIC STEM AND PROGENITOR CELLS <i>IN VIVO. |
US20210340586A1 (en) | 2020-04-30 | 2021-11-04 | Sutro Biopharma, Inc. | Methods of Producing Full-Length Antibodies Using E. coli |
GB202006463D0 (en) | 2020-05-01 | 2020-06-17 | Innes John Centre | Metabolic engineering of plants enriched in L-DOPA |
JP2023523855A (en) | 2020-05-04 | 2023-06-07 | アイオバンス バイオセラピューティクス,インコーポレイテッド | Method for producing tumor-infiltrating lymphocytes and their use in immunotherapy |
WO2021224401A1 (en) | 2020-05-07 | 2021-11-11 | INSERM (Institut National de la Santé et de la Recherche Médicale) | Methods and compositions for determining a reference range of β-galactose exposure platelet |
KR20230019843A (en) | 2020-05-08 | 2023-02-09 | 더 브로드 인스티튜트, 인코퍼레이티드 | Methods and compositions for simultaneous editing of both strands of a target double-stranded nucleotide sequence |
WO2021231259A1 (en) | 2020-05-11 | 2021-11-18 | Precision Biosciences, Inc. | Self-limiting viral vectors encoding nucleases |
US11787841B2 (en) | 2020-05-19 | 2023-10-17 | Inscripta, Inc. | Rationally-designed mutations to the thrA gene for enhanced lysine production in E. coli |
GB202007943D0 (en) | 2020-05-27 | 2020-07-08 | Snipr Biome Aps | Products & methods |
PE20230080A1 (en) | 2020-05-29 | 2023-01-11 | Kws Saat Se And Co Kgaa | INDUCTION OF HAPLOIDS IN PLANTS |
WO2021245435A1 (en) | 2020-06-03 | 2021-12-09 | Vilmorin & Cie | Melon plants resistant to scab disease, aphids and powdery mildew |
AU2021285983A1 (en) * | 2020-06-04 | 2023-02-02 | Emendobio Inc. | Novel OMNI-59, 61, 67, 76, 79, 80, 81, and 82 CRISPR nucleases |
CA3186284A1 (en) | 2020-06-05 | 2021-12-09 | Vilmorin & Cie | Resistance in plants of solanum lycopersicum to the tobrfv |
US20230235326A1 (en) | 2020-06-05 | 2023-07-27 | INSERM (Institut National de la Santé et de la Recherche Médicale) | Methods and pharmaceutical compositions for treating ocular diseases |
CA3185455A1 (en) | 2020-06-11 | 2021-12-16 | Novartis Ag | Zbtb32 inhibitors and uses thereof |
WO2021255204A1 (en) | 2020-06-18 | 2021-12-23 | INSERM (Institut National de la Santé et de la Recherche Médicale) | New strategy for treating pancreatic cancer |
WO2022008597A1 (en) | 2020-07-08 | 2022-01-13 | INSERM (Institut National de la Santé et de la Recherche Médicale) | Methods and pharmaceutical composition for the treatment of infectious diseases |
AU2021204717A1 (en) | 2020-07-15 | 2022-02-03 | Seminis Vegetable Seeds, Inc. | Green Bean Plants with Improved Disease Resistance |
EP4182297A1 (en) | 2020-07-16 | 2023-05-24 | Acuitas Therapeutics, Inc. | Cationic lipids for use in lipid nanoparticles |
CN116096864A (en) | 2020-07-30 | 2023-05-09 | 居里研究所 | SOCS1 deficient immune cells |
US20230323299A1 (en) | 2020-08-03 | 2023-10-12 | Inserm (Institut National De La Santé Et De La Recherch Médicale) | Population of treg cells functionally committed to exert a regulatory activity and their use for adoptive therapy |
WO2022034474A1 (en) | 2020-08-10 | 2022-02-17 | Novartis Ag | Treatments for retinal degenerative diseases |
EP4192875A1 (en) | 2020-08-10 | 2023-06-14 | Precision BioSciences, Inc. | Antibodies and fragments specific for b-cell maturation antigen and uses thereof |
WO2022034374A2 (en) | 2020-08-11 | 2022-02-17 | University Of Oslo | Improved gene editing |
AU2021329371A1 (en) | 2020-08-20 | 2023-04-20 | A2 Biotherapeutics, Inc. | Compositions and methods for treating mesothelin positive cancers |
CA3189510A1 (en) | 2020-08-20 | 2022-02-24 | Julyun OH | Compositions and methods for treating egfr positive cancers |
AU2021329375A1 (en) | 2020-08-20 | 2023-04-20 | A2 Biotherapeutics, Inc. | Compositions and methods for treating ceacam positive cancers |
WO2022046760A2 (en) | 2020-08-25 | 2022-03-03 | Kite Pharma, Inc. | T cells with improved functionality |
AU2021339805A1 (en) | 2020-09-11 | 2023-05-25 | LifeEDIT Therapeutics, Inc. | Dna modifying enzymes and active fragments and variants thereof and methods of use |
US11299731B1 (en) | 2020-09-15 | 2022-04-12 | Inscripta, Inc. | CRISPR editing to embed nucleic acid landing pads into genomes of live cells |
EP4214311A2 (en) | 2020-09-18 | 2023-07-26 | Artisan Development Labs, Inc. | Constructs and uses thereof for efficient and specific genome editing |
WO2022066973A1 (en) | 2020-09-24 | 2022-03-31 | Fred Hutchinson Cancer Research Center | Immunotherapy targeting pbk or oip5 antigens |
EP4217387A2 (en) | 2020-09-24 | 2023-08-02 | Fred Hutchinson Cancer Center | Immunotherapy targeting sox2 antigens |
US20230363337A1 (en) | 2020-10-02 | 2023-11-16 | Vilmorin & Cie | Melon with extended shelf life |
JP2023545403A (en) | 2020-10-02 | 2023-10-30 | リマグレン、ヨーロッパ | Directed codon rewriting via CRISPR |
US20230375571A1 (en) | 2020-10-05 | 2023-11-23 | INSERM (Institut National de la Santé et de la Recherche Médicale) | Gdf3 as biomarker and biotarget in post-ischemic cardiac remodeling |
JP2023545999A (en) | 2020-10-05 | 2023-11-01 | プロタリクス リミテッド | DICER-like knockout plant cells |
WO2022076606A1 (en) | 2020-10-06 | 2022-04-14 | Iovance Biotherapeutics, Inc. | Treatment of nsclc patients with tumor infiltrating lymphocyte therapies |
EP4225330A1 (en) | 2020-10-06 | 2023-08-16 | Iovance Biotherapeutics, Inc. | Treatment of nsclc patients with tumor infiltrating lymphocyte therapies |
WO2022076353A1 (en) | 2020-10-06 | 2022-04-14 | Fred Hutchinson Cancer Research Center | Compositions and methods for treating mage-a1-expressing disease |
US20230365995A1 (en) | 2020-10-07 | 2023-11-16 | Precision Biosciences, Inc. | Lipid nanoparticle compositions |
EP4228637A1 (en) | 2020-10-15 | 2023-08-23 | Yeda Research and Development Co. Ltd | Method of treating myeloid malignancies |
KR20230088833A (en) | 2020-10-23 | 2023-06-20 | 루트패스 제노믹스, 인크. | Compositions and methods for T-cell receptor identification |
WO2022084531A1 (en) | 2020-10-23 | 2022-04-28 | INSERM (Institut National de la Santé et de la Recherche Médicale) | Methods and compositions for treating glioma |
MX2023004761A (en) | 2020-10-23 | 2023-07-17 | Elo Life Systems Inc | Methods for producing vanilla plants with improved flavor and agronomic production. |
RU2762831C1 (en) * | 2020-10-26 | 2021-12-23 | Федеральное государственное бюджетное научное учреждение "Всероссийский научно-исследовательский институт сельскохозяйственной биотехнологии" (ФГБНУ ВНИИСБ) | Rna-conductor molecule for genomic editing of promoter region of vrn-a1 gene of monocotyledonous cereals using crispr/cas9 system |
US11332744B1 (en) | 2020-10-26 | 2022-05-17 | Arsenal Biosciences, Inc. | Safe harbor loci |
RU2749307C1 (en) * | 2020-10-30 | 2021-06-08 | Федеральное государственное бюджетное научное учреждение "Всероссийский научно-исследовательский институт сельскохозяйственной биотехнологии" (ФГБНУ ВНИИСБ) | New compact type ii cas9 nuclease from anoxybacillus flavithermus |
US11512297B2 (en) | 2020-11-09 | 2022-11-29 | Inscripta, Inc. | Affinity tag for recombination protein recruitment |
WO2022104061A1 (en) | 2020-11-13 | 2022-05-19 | Novartis Ag | Combination therapies with chimeric antigen receptor (car)-expressing cells |
WO2022101481A1 (en) | 2020-11-16 | 2022-05-19 | INSERM (Institut National de la Santé et de la Recherche Médicale) | Methods and compositions for predicting and treating uveal melanoma |
EP4001429A1 (en) | 2020-11-16 | 2022-05-25 | Antibodies-Online GmbH | Analysis of crispr-cas binding and cleavage sites followed by high-throughput sequencing (abc-seq) |
EP4251641A1 (en) | 2020-11-26 | 2023-10-04 | Ukko Inc. | Modified high molecular weight glutenin subunit and uses thereof |
WO2022120022A1 (en) | 2020-12-02 | 2022-06-09 | Regeneron Pharmaceuticals, Inc. | Crispr sam biosensor cell lines and methods of use thereof |
EP4255172A1 (en) | 2020-12-03 | 2023-10-11 | Vilmorin & Cie | Tomato plants resistant to tobrfv, tmv, tomv and tommv and corresponding resistance genes |
EP4259651A2 (en) | 2020-12-14 | 2023-10-18 | Fred Hutchinson Cancer Center | Compositions and methods for cellular immunotherapy |
JP2024500403A (en) | 2020-12-17 | 2024-01-09 | アイオバンス バイオセラピューティクス,インコーポレイテッド | Treatment of cancer with tumor-infiltrating lymphocytes |
EP4262811A1 (en) | 2020-12-17 | 2023-10-25 | Iovance Biotherapeutics, Inc. | Treatment with tumor infiltrating lymphocyte therapies in combination with ctla-4 and pd-1 inhibitors |
IL279559A (en) | 2020-12-17 | 2022-07-01 | Yeda Res & Dev | Controlling ubiquitination of mlkl for treatment of disease |
CA3202599A1 (en) | 2020-12-18 | 2022-06-23 | Johnathan Andrew Napier | Increasing the accumulation of epa and dha in recombinant camelina |
CA3202382A1 (en) | 2020-12-18 | 2022-06-23 | Yeda Research And Development Co. Ltd. | Compositions for use in the treatment of chd2 haploinsufficiency and methods of identifying same |
CA3206361A1 (en) | 2020-12-23 | 2022-06-30 | Flagship Pioneering Innovations V, Inc. | In vitro assembly of anellovirus capsids enclosing rna |
WO2022136658A1 (en) | 2020-12-23 | 2022-06-30 | Institute Of Genetics And Developmental Biology Chinese Academy Of Sciences | Methods of controlling grain size |
EP4269580A1 (en) | 2020-12-25 | 2023-11-01 | Logomix, Inc. | Method for causing large-scale deletions in genomic dna and method for analyzing genomic dna |
AU2021415461A1 (en) | 2021-01-04 | 2023-08-17 | Inscripta, Inc. | Mad nucleases |
US11332742B1 (en) | 2021-01-07 | 2022-05-17 | Inscripta, Inc. | Mad nucleases |
EP4284823A1 (en) | 2021-01-28 | 2023-12-06 | Precision BioSciences, Inc. | Modulation of tgf beta signaling in genetically-modified eukaryotic cells |
JP2024506557A (en) | 2021-01-29 | 2024-02-14 | アイオバンス バイオセラピューティクス,インコーポレイテッド | Methods of producing modified tumor-infiltrating lymphocytes and their use in adoptive cell therapy |
US20220251205A1 (en) | 2021-01-29 | 2022-08-11 | Merck Sharp & Dohme Corp. | Compositions of programmed death receptor 1 (pd-1) antibodies and methods of obtaining the compositions thereof |
AU2022213019A1 (en) | 2021-02-01 | 2023-08-10 | Avectas Limited | Delivery platform |
MX2023009581A (en) | 2021-02-16 | 2023-08-23 | A2 Biotherapeutics Inc | Compositions and methods for treating her2 positive cancers. |
US11884924B2 (en) | 2021-02-16 | 2024-01-30 | Inscripta, Inc. | Dual strand nucleic acid-guided nickase editing |
WO2022187278A1 (en) * | 2021-03-01 | 2022-09-09 | The Johns Hopkins University | Nucleic acid detection and analysis systems |
JP6944226B1 (en) | 2021-03-03 | 2021-10-06 | 株式会社Logomix | How to modify and detect genomic DNA |
DE112022001365T5 (en) | 2021-03-05 | 2024-02-15 | The Board Of Trustees Of The Leland Stanford Junior University | IN VIVO DNA ASSEMBLY AND ANALYSIS |
WO2022197776A1 (en) | 2021-03-16 | 2022-09-22 | Magenta Therapeutics, Inc. | Dosing regimens for hematopoietic stem cell mobilization for stem cell transplants in multiple myeloma patients |
WO2022194908A1 (en) | 2021-03-17 | 2022-09-22 | INSERM (Institut National de la Santé et de la Recherche Médicale) | Methods and compositions for treating melanoma |
WO2022198141A1 (en) | 2021-03-19 | 2022-09-22 | Iovance Biotherapeutics, Inc. | Methods for tumor infiltrating lymphocyte (til) expansion related to cd39/cd69 selection and gene knockout in tils |
JP2024511131A (en) | 2021-03-22 | 2024-03-12 | ライフエディット セラピューティクス,インコーポレイティド | DNA modifying enzymes and their active fragments and variants and methods of use |
JP2024519601A (en) | 2021-03-31 | 2024-05-20 | エントラーダ セラピューティクス,インコーポレイティド | Cyclic cell-penetrating peptides |
WO2022208489A1 (en) | 2021-04-02 | 2022-10-06 | Vilmorin & Cie | Semi-determinate or determinate growth habit trait in cucurbita |
EP4320234A2 (en) | 2021-04-07 | 2024-02-14 | Astrazeneca AB | Compositions and methods for site-specific modification |
WO2022214681A1 (en) | 2021-04-09 | 2022-10-13 | INSERM (Institut National de la Santé et de la Recherche Médicale) | Methods for the treatment of anaplastic large cell lymphoma |
WO2022221699A1 (en) | 2021-04-16 | 2022-10-20 | Beam Therapeutics, Inc. | Genetic modification of hepatocytes |
BR112023021665A2 (en) | 2021-04-19 | 2023-12-19 | Iovance Biotherapeutics Inc | METHOD FOR TREATING A CANCER, AND, COMPOSITION |
WO2022225978A1 (en) | 2021-04-21 | 2022-10-27 | The Regents Of The University Of California | Use of a split dcas fusion protein system for epigenetic editing |
US20240141311A1 (en) | 2021-04-22 | 2024-05-02 | North Carolina State University | Compositions and methods for generating male sterile plants |
WO2022223791A1 (en) | 2021-04-23 | 2022-10-27 | INSERM (Institut National de la Santé et de la Recherche Médicale) | Methods and compositions for treating cell senescence accumulation related disease |
US20220356264A1 (en) * | 2021-05-06 | 2022-11-10 | New York University | Inhibition of atf7ip and setdb1 for cancer treatment |
JP2024518068A (en) | 2021-05-10 | 2024-04-24 | エントラーダ セラピューティクス,インコーポレイティド | Compositions and methods for intracellular therapy |
WO2022240721A1 (en) | 2021-05-10 | 2022-11-17 | Entrada Therapeutics, Inc. | Compositions and methods for modulating interferon regulatory factor-5 (irf-5) activity |
WO2022240760A2 (en) | 2021-05-10 | 2022-11-17 | Entrada Therapeutics, Inc. | COMPOSITIONS AND METHODS FOR MODULATING mRNA SPLICING |
BR112023023486A2 (en) | 2021-05-10 | 2024-01-30 | Yissum Res Dev Co Of Hebrew Univ Jerusalem Ltd | PHARMACEUTICAL COMPOSITION, AND, METHOD OF TREATMENT OF A DISEASE OR CONDITION IN WHICH A BENEFICIAL CLINICAL EFFECT IS OBTAINED BY THE REDUCTION IN NEURONAL NITRIC OXIDE SYNTHASE ACTIVITY |
EP4337770A1 (en) | 2021-05-13 | 2024-03-20 | The United States of America, as represented by the Secretary, Department of Health and Human Services | Compositions and methods for treating sickle cell diseases |
CA3219148A1 (en) | 2021-05-17 | 2022-11-24 | Frederick G. Vogt | Pd-1 gene-edited tumor infiltrating lymphocytes and uses of same in immunotherapy |
WO2022256448A2 (en) | 2021-06-01 | 2022-12-08 | Artisan Development Labs, Inc. | Compositions and methods for targeting, editing, or modifying genes |
CA3222341A1 (en) | 2021-06-11 | 2022-12-15 | Kunwoo Lee | Biodegradable polymer comprising side chains with polyamine and polyalkylene oxide groups |
CN117836402A (en) | 2021-06-13 | 2024-04-05 | 耶路撒冷希伯来大学伊森姆研究发展有限公司 | Method for reprogramming human cells |
WO2022266287A1 (en) * | 2021-06-16 | 2022-12-22 | The Regents Of The University Of Michigan | Compositions and methods to transfect, test, and treat skin cells |
EP4370676A2 (en) | 2021-06-18 | 2024-05-22 | Artisan Development Labs, Inc. | Compositions and methods for targeting, editing or modifying human genes |
AU2022298774A1 (en) | 2021-06-23 | 2023-12-14 | Entrada Therapeutics, Inc. | Antisense compounds and methods for targeting cug repeats |
FR3124522A1 (en) | 2021-06-25 | 2022-12-30 | François CHERBONNEAU | Composition and method allowing genome editing |
EP4367242A2 (en) | 2021-07-07 | 2024-05-15 | Omega Therapeutics, Inc. | Compositions and methods for modulating secreted frizzled receptor protein 1 (sfrp1) gene expression |
EP4370647A1 (en) | 2021-07-15 | 2024-05-22 | Just-Evotec Biologics, Inc. | Bidirectional tangential flow filtration (tff) perfusion system |
TW202317602A (en) | 2021-07-15 | 2023-05-01 | 福瑞德哈金森腫瘤中心 | Chimeric polypeptides |
WO2023004074A2 (en) | 2021-07-22 | 2023-01-26 | Iovance Biotherapeutics, Inc. | Method for cryopreservation of solid tumor fragments |
TW202327631A (en) | 2021-07-28 | 2023-07-16 | 美商艾歐凡斯生物治療公司 | Treatment of cancer patients with tumor infiltrating lymphocyte therapies in combination with kras inhibitors |
WO2023010133A2 (en) | 2021-07-30 | 2023-02-02 | Tune Therapeutics, Inc. | Compositions and methods for modulating expression of frataxin (fxn) |
AU2022318664A1 (en) | 2021-07-30 | 2024-02-29 | Tune Therapeutics, Inc. | Compositions and methods for modulating expression of methyl-cpg binding protein 2 (mecp2) |
CA3221517A1 (en) | 2021-07-30 | 2023-02-02 | Monika KLOIBER-MAITZ | Plants with improved digestibility and marker haplotypes |
EP4130028A1 (en) | 2021-08-03 | 2023-02-08 | Rhazes Therapeutics Ltd | Engineered tcr complex and methods of using same |
CA3226947A1 (en) | 2021-08-03 | 2023-02-09 | Muhammad YASSIN | Engineered tcr complex and methods of using same |
WO2023012342A1 (en) | 2021-08-06 | 2023-02-09 | Kws Vegetables B.V. | Durable downy mildew resistance in spinach |
WO2023012325A1 (en) | 2021-08-06 | 2023-02-09 | Vilmorin & Cie | Resistance to leveillula taurica in pepper |
WO2023031885A1 (en) | 2021-09-02 | 2023-03-09 | SESVanderHave NV | Methods and compositions for ppo herbicide tolerance |
JP7125727B1 (en) | 2021-09-07 | 2022-08-25 | 国立大学法人千葉大学 | Compositions for modifying nucleic acid sequences and methods for modifying target sites in nucleic acid sequences |
US11884915B2 (en) | 2021-09-10 | 2024-01-30 | Agilent Technologies, Inc. | Guide RNAs with chemical modification for prime editing |
GB202113075D0 (en) | 2021-09-14 | 2021-10-27 | Innes John Centre | Methods of improving vitamin d levels in plants |
GB202113933D0 (en) | 2021-09-29 | 2021-11-10 | Genome Res Ltd | Methods for gene editing |
WO2023052508A2 (en) | 2021-09-30 | 2023-04-06 | Astrazeneca Ab | Use of inhibitors to increase efficiency of crispr/cas insertions |
WO2023060186A1 (en) | 2021-10-07 | 2023-04-13 | Hepatx Corporation | Methods of tracking donor cells in a recipient |
WO2023059846A1 (en) | 2021-10-08 | 2023-04-13 | President And Fellows Of Harvard College | Ionic liquids for drug delivery |
CA3234612A1 (en) | 2021-10-14 | 2023-04-20 | Weedout Ltd. | Methods of weed control |
WO2023064872A1 (en) | 2021-10-14 | 2023-04-20 | Precision Biosciences, Inc. | Combinations of anti-bcma car t cells and gamma secretase inhibitors |
AU2022371430A1 (en) | 2021-10-19 | 2024-05-30 | Precision Biosciences, Inc. | Gene editing methods for treating alpha-1 antitrypsin (aat) deficiency |
AR127482A1 (en) | 2021-10-27 | 2024-01-31 | Iovance Biotherapeutics Inc | SYSTEMS AND METHODS TO COORDINATE THE MANUFACTURE OF CELLS FOR PATIENT-SPECIFIC IMMUNOTHERAPY |
WO2023077053A2 (en) | 2021-10-28 | 2023-05-04 | Regeneron Pharmaceuticals, Inc. | Crispr/cas-related methods and compositions for knocking out c5 |
WO2023077148A1 (en) | 2021-11-01 | 2023-05-04 | Tome Biosciences, Inc. | Single construct platform for simultaneous delivery of gene editing machinery and nucleic acid cargo |
CA3237482A1 (en) | 2021-11-03 | 2023-05-11 | The J. David Gladstone Institutes, A Testamentary Trust Established Under The Will Of J. David Gladstone | Precise genome editing using retrons |
WO2023078900A1 (en) | 2021-11-03 | 2023-05-11 | INSERM (Institut National de la Santé et de la Recherche Médicale) | Methods and compositions for treating triple negative breast cancer (tnbc) |
WO2023086803A1 (en) | 2021-11-10 | 2023-05-19 | Iovance Biotherapeutics, Inc. | Methods of expansion treatment utilizing cd8 tumor infiltrating lymphocytes |
US11753677B2 (en) | 2021-11-10 | 2023-09-12 | Encodia, Inc. | Methods for barcoding macromolecules in individual cells |
WO2023091910A1 (en) | 2021-11-16 | 2023-05-25 | Precision Biosciences, Inc. | Methods for cancer immunotherapy |
WO2023093862A1 (en) | 2021-11-26 | 2023-06-01 | Epigenic Therapeutics Inc. | Method of modulating pcsk9 and uses thereof |
CA3238939A1 (en) | 2021-12-08 | 2023-06-15 | Gaurang Patel | Mutant myocilin disease model and uses thereof |
US20230193310A1 (en) | 2021-12-10 | 2023-06-22 | Seminis Vegetabe Seeds, Inc. | Lettuce plants having resistance to downy mildew |
GB202118058D0 (en) | 2021-12-14 | 2022-01-26 | Univ Warwick | Methods to increase yields in crops |
WO2023111173A1 (en) | 2021-12-16 | 2023-06-22 | INSERM (Institut National de la Santé et de la Recherche Médicale) | An ezh2 degrader or inhibitor for use in the treatment of resistant acute myeloid leukemia |
BE1030047B1 (en) | 2021-12-17 | 2023-07-17 | Anheuser Busch Inbev Sa | METHODS FOR PREVENTING INHIBITION OF FLAVOR PRODUCTION IN YEAST |
WO2023122805A1 (en) | 2021-12-20 | 2023-06-29 | Vestaron Corporation | Sorbitol driven selection pressure method |
WO2023118165A1 (en) | 2021-12-21 | 2023-06-29 | INSERM (Institut National de la Santé et de la Recherche Médicale) | Methods and compositions for treating melanoma |
WO2023122764A1 (en) | 2021-12-22 | 2023-06-29 | Tome Biosciences, Inc. | Co-delivery of a gene editor construct and a donor template |
WO2023122800A1 (en) | 2021-12-23 | 2023-06-29 | University Of Massachusetts | Therapeutic treatment for fragile x-associated disorder |
WO2023126458A1 (en) | 2021-12-28 | 2023-07-06 | Mnemo Therapeutics | Immune cells with inactivated suv39h1 and modified tcr |
WO2023137471A1 (en) | 2022-01-14 | 2023-07-20 | Tune Therapeutics, Inc. | Compositions, systems, and methods for programming t cell phenotypes through targeted gene activation |
WO2023137472A2 (en) | 2022-01-14 | 2023-07-20 | Tune Therapeutics, Inc. | Compositions, systems, and methods for programming t cell phenotypes through targeted gene repression |
WO2023141602A2 (en) | 2022-01-21 | 2023-07-27 | Renagade Therapeutics Management Inc. | Engineered retrons and methods of use |
WO2023144235A1 (en) | 2022-01-27 | 2023-08-03 | INSERM (Institut National de la Santé et de la Recherche Médicale) | Methods for monitoring and treating warburg effect in patients with pi3k-related disorders |
WO2023147488A1 (en) | 2022-01-28 | 2023-08-03 | Iovance Biotherapeutics, Inc. | Cytokine associated tumor infiltrating lymphocytes compositions and methods |
WO2023150623A2 (en) | 2022-02-02 | 2023-08-10 | Regeneron Pharmaceuticals, Inc. | Anti-tfr:gaa and anti-cd63:gaa insertion for treatment of pompe disease |
WO2023152164A1 (en) | 2022-02-08 | 2023-08-17 | University Of Glasgow | Modified ion channels |
WO2023156906A1 (en) | 2022-02-15 | 2023-08-24 | Futuragene Israel Ltd | A bacillus thuringiensis pesticidal protein (bt pp) combination useful for plant protection |
WO2023158732A1 (en) | 2022-02-16 | 2023-08-24 | Dana-Farber Cancer Institute, Inc. | Methods for decreasing pathologic alpha-synuclein using agents that modulate fndc5 or biologically active fragments thereof |
WO2023156587A1 (en) | 2022-02-18 | 2023-08-24 | INSERM (Institut National de la Santé et de la Recherche Médicale) | Use of tcr-deficient car-tregs in combination with anti-tcr complex monoclonal antibodies for inducing durable tolerance |
WO2023167882A1 (en) | 2022-03-01 | 2023-09-07 | Artisan Development Labs, Inc. | Composition and methods for transgene insertion |
WO2023196877A1 (en) | 2022-04-06 | 2023-10-12 | Iovance Biotherapeutics, Inc. | Treatment of nsclc patients with tumor infiltrating lymphocyte therapies |
EP4256950A1 (en) | 2022-04-06 | 2023-10-11 | Vilmorin et Cie | Tolerance to cgmmv in cucumber |
WO2023201369A1 (en) | 2022-04-15 | 2023-10-19 | Iovance Biotherapeutics, Inc. | Til expansion processes using specific cytokine combinations and/or akti treatment |
WO2023205744A1 (en) | 2022-04-20 | 2023-10-26 | Tome Biosciences, Inc. | Programmable gene insertion compositions |
WO2023212677A2 (en) | 2022-04-29 | 2023-11-02 | Regeneron Pharmaceuticals, Inc. | Identification of tissue-specific extragenic safe harbors for gene therapy approaches |
WO2023215725A1 (en) | 2022-05-02 | 2023-11-09 | Fred Hutchinson Cancer Center | Compositions and methods for cellular immunotherapy |
WO2023215831A1 (en) | 2022-05-04 | 2023-11-09 | Tome Biosciences, Inc. | Guide rna compositions for programmable gene insertion |
WO2023215498A2 (en) | 2022-05-05 | 2023-11-09 | Modernatx, Inc. | Compositions and methods for cd28 antagonism |
WO2023219933A1 (en) | 2022-05-09 | 2023-11-16 | Entrada Therapeutics, Inc. | Compositions and methods for delivery of nucleic acid therapeutics |
WO2023220040A1 (en) | 2022-05-09 | 2023-11-16 | Synteny Therapeutics, Inc. | Erythroparvovirus with a modified capsid for gene therapy |
WO2023220603A1 (en) | 2022-05-09 | 2023-11-16 | Regeneron Pharmaceuticals, Inc. | Vectors and methods for in vivo antibody production |
WO2023220035A1 (en) | 2022-05-09 | 2023-11-16 | Synteny Therapeutics, Inc. | Erythroparvovirus compositions and methods for gene therapy |
WO2023220043A1 (en) | 2022-05-09 | 2023-11-16 | Synteny Therapeutics, Inc. | Erythroparvovirus with a modified genome for gene therapy |
WO2023220608A1 (en) | 2022-05-10 | 2023-11-16 | Iovance Biotherapeutics, Inc. | Treatment of cancer patients with tumor infiltrating lymphocyte therapies in combination with an il-15r agonist |
WO2023225410A2 (en) | 2022-05-20 | 2023-11-23 | Artisan Development Labs, Inc. | Systems and methods for assessing risk of genome editing events |
WO2023225670A2 (en) | 2022-05-20 | 2023-11-23 | Tome Biosciences, Inc. | Ex vivo programmable gene insertion |
EP4279085A1 (en) | 2022-05-20 | 2023-11-22 | Mnemo Therapeutics | Compositions and methods for treating a refractory or relapsed cancer or a chronic infectious disease |
WO2023230578A2 (en) | 2022-05-25 | 2023-11-30 | Flagship Pioneering Innovations Vii, Llc | Compositions and methods for modulating circulating factors |
WO2023230570A2 (en) | 2022-05-25 | 2023-11-30 | Flagship Pioneering Innovations Vii, Llc | Compositions and methods for modulating genetic drivers |
WO2023230549A2 (en) | 2022-05-25 | 2023-11-30 | Flagship Pioneering Innovations Vii, Llc | Compositions and methods for modulation of tumor suppressors and oncogenes |
WO2023230566A2 (en) | 2022-05-25 | 2023-11-30 | Flagship Pioneering Innovations Vii, Llc | Compositions and methods for modulating cytokines |
WO2023230573A2 (en) | 2022-05-25 | 2023-11-30 | Flagship Pioneering Innovations Vii, Llc | Compositions and methods for modulation of immune responses |
WO2023235725A2 (en) | 2022-05-31 | 2023-12-07 | Regeneron Pharmaceuticals, Inc. | Crispr-based therapeutics for c9orf72 repeat expansion disease |
WO2023235726A2 (en) | 2022-05-31 | 2023-12-07 | Regeneron Pharmaceuticals, Inc. | Crispr interference therapeutics for c9orf72 repeat expansion disease |
WO2023240282A1 (en) | 2022-06-10 | 2023-12-14 | Umoja Biopharma, Inc. | Engineered stem cells and uses thereof |
US20230404003A1 (en) | 2022-06-21 | 2023-12-21 | Seminis Vegetable Seeds, Inc. | Novel qtls conferring resistance to cucumber mosaic virus |
WO2023250511A2 (en) | 2022-06-24 | 2023-12-28 | Tune Therapeutics, Inc. | Compositions, systems, and methods for reducing low-density lipoprotein through targeted gene repression |
EP4299739A1 (en) | 2022-06-30 | 2024-01-03 | Inari Agriculture Technology, Inc. | Compositions, systems, and methods for genome editing |
WO2024005863A1 (en) | 2022-06-30 | 2024-01-04 | Inari Agriculture Technology, Inc. | Compositions, systems, and methods for genome editing |
GB2621813A (en) | 2022-06-30 | 2024-02-28 | Univ Newcastle | Preventing disease recurrence in Mitochondrial replacement therapy |
WO2024005864A1 (en) | 2022-06-30 | 2024-01-04 | Inari Agriculture Technology, Inc. | Compositions, systems, and methods for genome editing |
EP4299733A1 (en) | 2022-06-30 | 2024-01-03 | Inari Agriculture Technology, Inc. | Compositions, systems, and methods for genome editing |
WO2024008752A1 (en) | 2022-07-05 | 2024-01-11 | John Innes Centre | Methods to increase iron content in plants |
WO2024008799A1 (en) | 2022-07-06 | 2024-01-11 | Institut National de la Santé et de la Recherche Médicale | Methods for the treatment of proliferative glomerulonephritis |
WO2024015881A2 (en) | 2022-07-12 | 2024-01-18 | Tune Therapeutics, Inc. | Compositions, systems, and methods for targeted transcriptional activation |
WO2024020346A2 (en) | 2022-07-18 | 2024-01-25 | Renagade Therapeutics Management Inc. | Gene editing components, systems, and methods of use |
WO2024020587A2 (en) | 2022-07-22 | 2024-01-25 | Tome Biosciences, Inc. | Pleiopluripotent stem cell programmable gene insertion |
WO2024026406A2 (en) | 2022-07-29 | 2024-02-01 | Vestaron Corporation | Next Generation ACTX Peptides |
WO2024026474A1 (en) | 2022-07-29 | 2024-02-01 | Regeneron Pharmaceuticals, Inc. | Compositions and methods for transferrin receptor (tfr)-mediated delivery to the brain and muscle |
LU502613B1 (en) | 2022-08-01 | 2024-02-01 | Plant Bioscience Ltd | Methods of altering the starch granule profile in plants |
WO2024028433A1 (en) | 2022-08-04 | 2024-02-08 | Institut National de la Santé et de la Recherche Médicale | Methods for the treatment of lymphoproliferative disorders |
US20240067969A1 (en) | 2022-08-19 | 2024-02-29 | Tune Therapeutics, Inc. | Compositions, systems, and methods for regulation of hepatitis b virus through targeted gene repression |
WO2024040222A1 (en) | 2022-08-19 | 2024-02-22 | Generation Bio Co. | Cleavable closed-ended dna (cedna) and methods of use thereof |
WO2024044723A1 (en) | 2022-08-25 | 2024-02-29 | Renagade Therapeutics Management Inc. | Engineered retrons and methods of use |
WO2024042489A1 (en) | 2022-08-25 | 2024-02-29 | LifeEDIT Therapeutics, Inc. | Chemical modification of guide rnas with locked nucleic acid for rna guided nuclease-mediated gene editing |
WO2024042199A1 (en) | 2022-08-26 | 2024-02-29 | KWS SAAT SE & Co. KGaA | Use of paired genes in hybrid breeding |
WO2024047110A1 (en) | 2022-08-31 | 2024-03-07 | Institut National de la Santé et de la Recherche Médicale | Method to generate more efficient car-t cells |
WO2024050544A2 (en) | 2022-09-01 | 2024-03-07 | J.R. Simplot Company | Enhanced targeted knock-in frequency in host genomes through crispr exonuclease processing |
WO2024047605A1 (en) | 2022-09-01 | 2024-03-07 | SESVanderHave NV | Methods and compositions for ppo herbicide tolerance |
WO2024052318A1 (en) | 2022-09-06 | 2024-03-14 | Institut National de la Santé et de la Recherche Médicale | Novel dual split car-t cells for the treatment of cd38-positive hematological malignancies |
WO2024059618A2 (en) | 2022-09-13 | 2024-03-21 | Arsenal Biosciences, Inc. | Immune cells having co-expressed tgfbr shrnas |
WO2024056659A1 (en) | 2022-09-13 | 2024-03-21 | Institut National de la Santé et de la Recherche Médicale | Method for treating prostate cancer and other epithelial cancers |
WO2024059824A2 (en) | 2022-09-16 | 2024-03-21 | Arsenal Biosciences, Inc. | Immune cells with combination gene perturbations |
WO2024056902A2 (en) | 2022-09-16 | 2024-03-21 | Christopher Shaw | Compositions and methods for treating neurological diseases |
WO2024064642A2 (en) | 2022-09-19 | 2024-03-28 | Tune Therapeutics, Inc. | Compositions, systems, and methods for modulating t cell function |
WO2024062138A1 (en) | 2022-09-23 | 2024-03-28 | Mnemo Therapeutics | Immune cells comprising a modified suv39h1 gene |
WO2024073606A1 (en) | 2022-09-28 | 2024-04-04 | Regeneron Pharmaceuticals, Inc. | Antibody resistant modified receptors to enhance cell-based therapies |
GB202214410D0 (en) | 2022-09-30 | 2022-11-16 | Ivy Farm Tech Limited | genetically modified cells |
WO2024084034A1 (en) | 2022-10-21 | 2024-04-25 | Institut National de la Santé et de la Recherche Médicale | Methods and pharmaceutical compositions for the treatment of osteoarthritis |
WO2024097639A1 (en) | 2022-10-31 | 2024-05-10 | Modernatx, Inc. | Hsa-binding antibodies and binding proteins and uses thereof |
WO2024095245A2 (en) | 2022-11-04 | 2024-05-10 | LifeEDIT Therapeutics, Inc. | Evolved adenine deaminases and rna-guided nuclease fusion proteins with internal insertion sites and methods of use |
WO2024098027A1 (en) | 2022-11-04 | 2024-05-10 | Iovance Biotherapeutics, Inc. | Methods for tumor infiltrating lymphocyte (til) expansion related to cd39/cd103 selection |
WO2024098002A1 (en) | 2022-11-04 | 2024-05-10 | Regeneron Pharmaceuticals, Inc. | Calcium voltage-gated channel auxiliary subunit gamma 1 (cacng1) binding proteins and cacng1-mediated delivery to skeletal muscle |
WO2024098024A1 (en) | 2022-11-04 | 2024-05-10 | Iovance Biotherapeutics, Inc. | Expansion of tumor infiltrating lymphocytes from liquid tumors and therapeutic uses thereof |
WO2024102434A1 (en) | 2022-11-10 | 2024-05-16 | Senda Biosciences, Inc. | Rna compositions comprising lipid nanoparticles or lipid reconstructed natural messenger packs |
WO2024107765A2 (en) | 2022-11-14 | 2024-05-23 | Regeneron Pharmaceuticals, Inc. | Compositions and methods for fibroblast growth factor receptor 3-mediated delivery to astrocytes |
WO2024107670A1 (en) | 2022-11-16 | 2024-05-23 | Regeneron Pharmaceuticals, Inc. | Chimeric proteins comprising membrane bound il-12 with protease cleavable linkers |
WO2024105633A1 (en) | 2022-11-18 | 2024-05-23 | Kyoto Prefectural Public University Corporation | Compositions for mitophagy induction and uses thereof |
Family Cites Families (57)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US4217344A (en) | 1976-06-23 | 1980-08-12 | L'oreal | Compositions containing aqueous dispersions of lipid spheres |
US4235871A (en) | 1978-02-24 | 1980-11-25 | Papahadjopoulos Demetrios P | Method of encapsulating biologically active materials in lipid vesicles |
US4186183A (en) | 1978-03-29 | 1980-01-29 | The United States Of America As Represented By The Secretary Of The Army | Liposome carriers in chemotherapy of leishmaniasis |
US4261975A (en) | 1979-09-19 | 1981-04-14 | Merck & Co., Inc. | Viral liposome particle |
US4485054A (en) | 1982-10-04 | 1984-11-27 | Lipoderm Pharmaceuticals Limited | Method of encapsulating biologically active materials in multilamellar lipid vesicles (MLV) |
US4501728A (en) | 1983-01-06 | 1985-02-26 | Technology Unlimited, Inc. | Masking of liposomes from RES recognition |
US5049386A (en) | 1985-01-07 | 1991-09-17 | Syntex (U.S.A.) Inc. | N-ω,(ω-1)-dialkyloxy)- and N-(ω,(ω-1)-dialkenyloxy)Alk-1-YL-N,N,N-tetrasubstituted ammonium lipids and uses therefor |
US4946787A (en) | 1985-01-07 | 1990-08-07 | Syntex (U.S.A.) Inc. | N-(ω,(ω-1)-dialkyloxy)- and N-(ω,(ω-1)-dialkenyloxy)-alk-1-yl-N,N,N-tetrasubstituted ammonium lipids and uses therefor |
US4897355A (en) | 1985-01-07 | 1990-01-30 | Syntex (U.S.A.) Inc. | N[ω,(ω-1)-dialkyloxy]- and N-[ω,(ω-1)-dialkenyloxy]-alk-1-yl-N,N,N-tetrasubstituted ammonium lipids and uses therefor |
US4797368A (en) | 1985-03-15 | 1989-01-10 | The United States Of America As Represented By The Department Of Health And Human Services | Adeno-associated virus as eukaryotic expression vector |
US4774085A (en) | 1985-07-09 | 1988-09-27 | 501 Board of Regents, Univ. of Texas | Pharmaceutical administration systems containing a mixture of immunomodulators |
DE122007000007I1 (en) | 1986-04-09 | 2007-05-16 | Genzyme Corp | Genetically transformed animals secreting a desired protein in milk |
US4837028A (en) | 1986-12-24 | 1989-06-06 | Liposome Technology, Inc. | Liposomes with enhanced circulation time |
US4873316A (en) | 1987-06-23 | 1989-10-10 | Biogen, Inc. | Isolation of exogenous recombinant proteins from the milk of transgenic mammals |
US5264618A (en) | 1990-04-19 | 1993-11-23 | Vical, Inc. | Cationic lipids for intracellular delivery of biologically active molecules |
AU7979491A (en) | 1990-05-03 | 1991-11-27 | Vical, Inc. | Intracellular delivery of biologically active substances by means of self-assembling lipid complexes |
US5173414A (en) | 1990-10-30 | 1992-12-22 | Applied Immune Sciences, Inc. | Production of recombinant adeno-associated virus vectors |
US5587308A (en) | 1992-06-02 | 1996-12-24 | The United States Of America As Represented By The Department Of Health & Human Services | Modified adeno-associated virus vector capable of expression from a novel promoter |
US6534261B1 (en) | 1999-01-12 | 2003-03-18 | Sangamo Biosciences, Inc. | Regulation of endogenous gene expression in cells using zinc finger proteins |
US7868149B2 (en) | 1999-07-20 | 2011-01-11 | Monsanto Technology Llc | Plant genome sequence and uses thereof |
US6479808B1 (en) | 1999-07-07 | 2002-11-12 | The United States Of America As Represented By The Administrator Of The National Aeronautics And Space Administration | Method and systems for collecting data from multiple fields of view |
US6603061B1 (en) | 1999-07-29 | 2003-08-05 | Monsanto Company | Agrobacterium-mediated plant transformation method |
JP3454818B1 (en) * | 2001-03-16 | 2003-10-06 | 直哉 小林 | Liver cell proliferation method, liver cell obtained by the method, and use thereof |
US20090100536A1 (en) | 2001-12-04 | 2009-04-16 | Monsanto Company | Transgenic plants with enhanced agronomic traits |
US20050220796A1 (en) | 2004-03-31 | 2005-10-06 | Dynan William S | Compositions and methods for modulating DNA repair |
EP1913149A4 (en) * | 2005-07-26 | 2009-08-05 | Sangamo Biosciences Inc | Targeted integration and expression of exogenous nucleic acid sequences |
TR201905633T4 (en) | 2007-03-02 | 2019-05-21 | Dupont Nutrition Biosci Aps | Cultures with improved phage resistance. |
WO2010011961A2 (en) | 2008-07-25 | 2010-01-28 | University Of Georgia Research Foundation, Inc. | Prokaryotic rnai-like system and methods of use |
US20100076057A1 (en) | 2008-09-23 | 2010-03-25 | Northwestern University | TARGET DNA INTERFERENCE WITH crRNA |
US9404098B2 (en) | 2008-11-06 | 2016-08-02 | University Of Georgia Research Foundation, Inc. | Method for cleaving a target RNA using a Cas6 polypeptide |
WO2010065123A1 (en) * | 2008-12-04 | 2010-06-10 | Sangamo Biosciences, Inc. | Genome editing in rats using zinc-finger nucleases |
US8889394B2 (en) | 2009-09-07 | 2014-11-18 | Empire Technology Development Llc | Multiple domain proteins |
US10087431B2 (en) | 2010-03-10 | 2018-10-02 | The Regents Of The University Of California | Methods of generating nucleic acid fragments |
EP3078753B1 (en) | 2010-05-10 | 2018-04-18 | The Regents of The University of California | Methods using endoribonuclease compositions |
CA2798988C (en) | 2010-05-17 | 2020-03-10 | Sangamo Biosciences, Inc. | Tal-effector (tale) dna-binding polypeptides and uses thereof |
US9405700B2 (en) | 2010-11-04 | 2016-08-02 | Sonics, Inc. | Methods and apparatus for virtualization in an integrated circuit |
AU2011369769B2 (en) | 2011-05-30 | 2015-09-03 | The University Of Tokyo | High-strength polypropylene fiber and method for producing same |
US20140113376A1 (en) | 2011-06-01 | 2014-04-24 | Rotem Sorek | Compositions and methods for downregulating prokaryotic genes |
GB201122458D0 (en) | 2011-12-30 | 2012-02-08 | Univ Wageningen | Modified cascade ribonucleoproteins and uses thereof |
US9637739B2 (en) * | 2012-03-20 | 2017-05-02 | Vilnius University | RNA-directed DNA cleavage by the Cas9-crRNA complex |
WO2013141680A1 (en) | 2012-03-20 | 2013-09-26 | Vilnius University | RNA-DIRECTED DNA CLEAVAGE BY THE Cas9-crRNA COMPLEX |
PE20150336A1 (en) * | 2012-05-25 | 2015-03-25 | Univ California | METHODS AND COMPOSITIONS FOR RNA-DIRECTED MODIFICATION OF TARGET DNA AND FOR RNA-DIRECTED MODULATION OF TRANSCRIPTION |
CN116064533A (en) * | 2012-10-23 | 2023-05-05 | 基因工具股份有限公司 | Composition for cleaving target DNA and use thereof |
KR101844123B1 (en) * | 2012-12-06 | 2018-04-02 | 시그마-알드리치 컴퍼니., 엘엘씨 | Crispr-based genome modification and regulation |
WO2014093479A1 (en) | 2012-12-11 | 2014-06-19 | Montana State University | Crispr (clustered regularly interspaced short palindromic repeats) rna-guided control of gene regulation |
ES2786193T3 (en) | 2012-12-12 | 2020-10-09 | Broad Inst Inc | Genetic engineering and optimization of improved enzyme systems, methods, and compositions for sequence manipulation |
EP2848690B1 (en) | 2012-12-12 | 2020-08-19 | The Broad Institute, Inc. | Crispr-cas component systems, methods and compositions for sequence manipulation |
EP2931899A1 (en) | 2012-12-12 | 2015-10-21 | The Broad Institute, Inc. | Functional genomics using crispr-cas systems, compositions, methods, knock out libraries and applications thereof |
EP3252160B1 (en) | 2012-12-12 | 2020-10-28 | The Broad Institute, Inc. | Crispr-cas component systems, methods and compositions for sequence manipulation |
EP3434776A1 (en) | 2012-12-12 | 2019-01-30 | The Broad Institute, Inc. | Methods, models, systems, and apparatus for identifying target sequences for cas enzymes or crispr-cas systems for target sequences and conveying results thereof |
MX2015007550A (en) | 2012-12-12 | 2017-02-02 | Broad Inst Inc | Delivery, engineering and optimization of systems, methods and compositions for sequence manipulation and therapeutic applications. |
DK2931898T3 (en) | 2012-12-12 | 2016-06-20 | Massachusetts Inst Technology | CONSTRUCTION AND OPTIMIZATION OF SYSTEMS, PROCEDURES AND COMPOSITIONS FOR SEQUENCE MANIPULATION WITH FUNCTIONAL DOMAINS |
US8697359B1 (en) | 2012-12-12 | 2014-04-15 | The Broad Institute, Inc. | CRISPR-Cas systems and methods for altering expression of gene products |
WO2014093694A1 (en) | 2012-12-12 | 2014-06-19 | The Broad Institute, Inc. | Crispr-cas nickase systems, methods and compositions for sequence manipulation in eukaryotes |
ES2553782T3 (en) | 2012-12-12 | 2015-12-11 | The Broad Institute, Inc. | Systems engineering, methods and guide compositions optimized for sequence manipulation |
RU2699523C2 (en) | 2012-12-17 | 2019-09-05 | Президент Энд Фэллоуз Оф Харвард Коллидж | Rna-guided engineering of human genome |
JP6244391B2 (en) * | 2016-03-17 | 2017-12-06 | 本田技研工業株式会社 | vehicle |
-
2013
- 2013-10-15 US US14/054,414 patent/US8697359B1/en active Active
- 2013-12-12 CN CN201380072715.1A patent/CN106170549B/en active Active
- 2013-12-12 EP EP15176051.9A patent/EP2998400A1/en not_active Withdrawn
- 2013-12-12 KR KR1020157018654A patent/KR20150107739A/en not_active Application Discontinuation
- 2013-12-12 DK DK13824232.6T patent/DK2764103T3/en active
- 2013-12-12 ES ES13824232.6T patent/ES2552535T3/en active Active
- 2013-12-12 CA CA2894688A patent/CA2894688A1/en active Pending
- 2013-12-12 BR BR112015013785A patent/BR112015013785A2/en not_active IP Right Cessation
- 2013-12-12 EP EP13824232.6A patent/EP2764103B1/en active Active
- 2013-12-12 CN CN202010072631.XA patent/CN111187772A/en active Pending
- 2013-12-12 JP JP2015547555A patent/JP6545621B2/en active Active
- 2013-12-12 AU AU2013359238A patent/AU2013359238B2/en active Active
- 2013-12-12 WO PCT/US2013/074743 patent/WO2014093661A2/en active Application Filing
- 2013-12-12 PT PT138242326T patent/PT2764103E/en unknown
- 2013-12-12 CN CN201610902578.5A patent/CN106480080B/en active Active
- 2013-12-12 RU RU2015128100A patent/RU2687451C1/en active
- 2013-12-12 PL PL13824232T patent/PL2764103T3/en unknown
-
2014
- 2014-02-18 US US14/183,429 patent/US8771945B1/en active Active
- 2014-04-18 US US14/256,912 patent/US8945839B2/en active Active
- 2014-07-07 US US14/324,960 patent/US20150184139A1/en not_active Abandoned
-
2015
- 2015-02-11 HK HK15101515.7A patent/HK1201290A1/en unknown
- 2015-04-08 US US14/681,382 patent/US20150203872A1/en not_active Abandoned
-
2016
- 2016-04-13 HK HK16104239.5A patent/HK1216259A1/en unknown
- 2016-05-20 US US15/160,710 patent/US20160281072A1/en active Pending
- 2016-06-29 JP JP2016128599A patent/JP6723094B2/en active Active
- 2016-07-22 US US15/217,489 patent/US20170175142A1/en not_active Abandoned
- 2016-10-12 AU AU2016244244A patent/AU2016244244B2/en active Active
-
2018
- 2018-10-31 US US16/177,403 patent/US20190153476A1/en active Pending
-
2019
- 2019-02-28 JP JP2019035911A patent/JP6870015B2/en active Active
- 2019-03-08 AU AU2019201608A patent/AU2019201608B2/en active Active
-
2021
- 2021-04-14 JP JP2021068300A patent/JP7090775B2/en active Active
-
2022
- 2022-02-17 AU AU2022201052A patent/AU2022201052A1/en active Pending
- 2022-06-14 JP JP2022095742A patent/JP7463436B2/en active Active
Cited By (159)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US10793878B1 (en) | 2012-05-25 | 2020-10-06 | The Regents Of The University Of California | Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription |
US10563227B2 (en) | 2012-05-25 | 2020-02-18 | The Regents Of The University Of California | Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription |
US11970711B2 (en) | 2012-05-25 | 2024-04-30 | The Regents Of The University Of California | Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription |
US11814645B2 (en) | 2012-05-25 | 2023-11-14 | The Regents Of The University Of California | Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription |
US11634730B2 (en) | 2012-05-25 | 2023-04-25 | The Regents Of The University Of California | Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription |
US11549127B2 (en) | 2012-05-25 | 2023-01-10 | The Regents Of The University Of California | Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription |
US11479794B2 (en) | 2012-05-25 | 2022-10-25 | The Regents Of The University Of California | Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription |
US11473108B2 (en) | 2012-05-25 | 2022-10-18 | The Regents Of The University Of California | Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription |
US11332761B2 (en) | 2012-05-25 | 2022-05-17 | The Regenis of Wie University of California | Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription |
US11293034B2 (en) | 2012-05-25 | 2022-04-05 | The Regents Of The University Of California | Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription |
US11274318B2 (en) | 2012-05-25 | 2022-03-15 | The Regents Of The University Of California | Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription |
US11242543B2 (en) | 2012-05-25 | 2022-02-08 | The Regents Of The University Of California | Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription |
US11186849B2 (en) | 2012-05-25 | 2021-11-30 | The Regents Of The University Of California | Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription |
US11028412B2 (en) | 2012-05-25 | 2021-06-08 | The Regents Of The University Of California | Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription |
US11008589B2 (en) | 2012-05-25 | 2021-05-18 | The Regents Of The University Of California | Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription |
US11008590B2 (en) | 2012-05-25 | 2021-05-18 | The Regents Of The University Of California | Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription |
US10000772B2 (en) | 2012-05-25 | 2018-06-19 | The Regents Of The University Of California | Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription |
US11001863B2 (en) | 2012-05-25 | 2021-05-11 | The Regents Of The University Of California | Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription |
US10988780B2 (en) | 2012-05-25 | 2021-04-27 | The Regents Of The University Of California | Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription |
US10988782B2 (en) | 2012-05-25 | 2021-04-27 | The Regents Of The University Of California | Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription |
US10113167B2 (en) | 2012-05-25 | 2018-10-30 | The Regents Of The University Of California | Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription |
US10982230B2 (en) | 2012-05-25 | 2021-04-20 | The Regents Of The University Of California | Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription |
US10982231B2 (en) | 2012-05-25 | 2021-04-20 | The Regents Of The University Of California | Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription |
US10900054B2 (en) | 2012-05-25 | 2021-01-26 | The Regents Of The University Of California | Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription |
US10513712B2 (en) | 2012-05-25 | 2019-12-24 | The Regents Of The University Of California | Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription |
US10407697B2 (en) | 2012-05-25 | 2019-09-10 | The Regents Of The University Of California | Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription |
US11401532B2 (en) | 2012-05-25 | 2022-08-02 | The Regents Of The University Of California | Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription |
US10227611B2 (en) | 2012-05-25 | 2019-03-12 | The Regents Of The University Of California | Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription |
US10266850B2 (en) | 2012-05-25 | 2019-04-23 | The Regents Of The University Of California | Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription |
US10774344B1 (en) | 2012-05-25 | 2020-09-15 | The Regents Of The University Of California | Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription |
US10301651B2 (en) | 2012-05-25 | 2019-05-28 | The Regents Of The University Of California | Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription |
US10308961B2 (en) | 2012-05-25 | 2019-06-04 | The Regents Of The University Of California | Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription |
US10337029B2 (en) | 2012-05-25 | 2019-07-02 | The Regents Of The University Of California | Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription |
US10351878B2 (en) | 2012-05-25 | 2019-07-16 | The Regents Of The University Of California | Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription |
US10358658B2 (en) | 2012-05-25 | 2019-07-23 | The Regents Of The University Of California | Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription |
US10358659B2 (en) | 2012-05-25 | 2019-07-23 | The Regents Of The University Of California | Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription |
US10752920B2 (en) | 2012-05-25 | 2020-08-25 | The Regents Of The University Of California | Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription |
US10385360B2 (en) | 2012-05-25 | 2019-08-20 | The Regents Of The University Of California | Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription |
US10400253B2 (en) | 2012-05-25 | 2019-09-03 | The Regents Of The University Of California | Methods and compositions or RNA-directed target DNA modification and for RNA-directed modulation of transcription |
US10676759B2 (en) | 2012-05-25 | 2020-06-09 | The Regents Of The University Of California | Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription |
US10415061B2 (en) | 2012-05-25 | 2019-09-17 | The Regents Of The University Of California | Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription |
US10421980B2 (en) | 2012-05-25 | 2019-09-24 | The Regents Of The University Of California | Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription |
US10669560B2 (en) | 2012-05-25 | 2020-06-02 | The Regents Of The University Of California | Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription |
US10428352B2 (en) | 2012-05-25 | 2019-10-01 | The Regents Of The University Of California | Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription |
US10640791B2 (en) | 2012-05-25 | 2020-05-05 | The Regents Of The University Of California | Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription |
US10443076B2 (en) | 2012-05-25 | 2019-10-15 | The Regents Of The University Of California | Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription |
US10487341B2 (en) | 2012-05-25 | 2019-11-26 | The Regents Of The University Of California | Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription |
US10626419B2 (en) | 2012-05-25 | 2020-04-21 | The Regents Of The University Of California | Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription |
US10612045B2 (en) | 2012-05-25 | 2020-04-07 | The Regents Of The University Of California | Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription |
US10519467B2 (en) | 2012-05-25 | 2019-12-31 | The Regents Of The University Of California | Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription |
US10597680B2 (en) | 2012-05-25 | 2020-03-24 | The Regents Of The University Of California | Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription |
US10577631B2 (en) | 2012-05-25 | 2020-03-03 | The Regents Of The University Of California | Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription |
US10526619B2 (en) | 2012-05-25 | 2020-01-07 | The Regents Of The University Of California | Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription |
US10533190B2 (en) | 2012-05-25 | 2020-01-14 | The Regents Of The University Of California | Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription |
US10570419B2 (en) | 2012-05-25 | 2020-02-25 | The Regents Of The University Of California | Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription |
US10550407B2 (en) | 2012-05-25 | 2020-02-04 | The Regents Of The University Of California | Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription |
US10851380B2 (en) | 2012-10-23 | 2020-12-01 | Toolgen Incorporated | Methods for cleaving a target DNA using a guide RNA specific for the target DNA and Cas protein-encoding nucleic acid or Cas protein |
US10745716B2 (en) | 2012-12-06 | 2020-08-18 | Sigma-Aldrich Co. Llc | CRISPR-based genome modification and regulation |
US10731181B2 (en) | 2012-12-06 | 2020-08-04 | Sigma, Aldrich Co. LLC | CRISPR-based genome modification and regulation |
US9260752B1 (en) | 2013-03-14 | 2016-02-16 | Caribou Biosciences, Inc. | Compositions and methods of nucleic acid-targeting nucleic acids |
US9725714B2 (en) | 2013-03-14 | 2017-08-08 | Caribou Biosciences, Inc. | Compositions and methods of nucleic acid-targeting nucleic acids |
US10125361B2 (en) | 2013-03-14 | 2018-11-13 | Caribou Biosciences, Inc. | Compositions and methods of nucleic acid-targeting nucleic acids |
US9909122B2 (en) | 2013-03-14 | 2018-03-06 | Caribou Biosciences, Inc. | Compositions and methods of nucleic acid-targeting nucleic acids |
US9803194B2 (en) | 2013-03-14 | 2017-10-31 | Caribou Biosciences, Inc. | Compositions and methods of nucleic acid-targeting nucleic acids |
US9809814B1 (en) | 2013-03-14 | 2017-11-07 | Caribou Biosciences, Inc. | Compositions and methods of nucleic acid-targeting nucleic acids |
US11312953B2 (en) | 2013-03-14 | 2022-04-26 | Caribou Biosciences, Inc. | Compositions and methods of nucleic acid-targeting nucleic acids |
US9410198B2 (en) | 2013-03-14 | 2016-08-09 | Caribou Biosciences, Inc. | Compostions and methods of nucleic acid-targeting nucleic acids |
US11920152B2 (en) | 2013-03-15 | 2024-03-05 | The General Hospital Corporation | Increasing specificity for RNA-guided genome editing |
US10138476B2 (en) | 2013-03-15 | 2018-11-27 | The General Hospital Corporation | Using RNA-guided FokI nucleases (RFNs) to increase specificity for RNA-guided genome editing |
US10119133B2 (en) | 2013-03-15 | 2018-11-06 | The General Hospital Corporation | Using truncated guide RNAs (tru-gRNAs) to increase specificity for RNA-guided genome editing |
US10415059B2 (en) | 2013-03-15 | 2019-09-17 | The General Hospital Corporation | Using truncated guide RNAs (tru-gRNAs) to increase specificity for RNA-guided genome editing |
US10544433B2 (en) | 2013-03-15 | 2020-01-28 | The General Hospital Corporation | Using RNA-guided FokI nucleases (RFNs) to increase specificity for RNA-guided genome editing |
US11168338B2 (en) | 2013-03-15 | 2021-11-09 | The General Hospital Corporation | RNA-guided targeting of genetic and epigenomic regulatory proteins to specific genomic loci |
US11098326B2 (en) | 2013-03-15 | 2021-08-24 | The General Hospital Corporation | Using RNA-guided FokI nucleases (RFNs) to increase specificity for RNA-guided genome editing |
US9885033B2 (en) | 2013-03-15 | 2018-02-06 | The General Hospital Corporation | Increasing specificity for RNA-guided genome editing |
US10378027B2 (en) | 2013-03-15 | 2019-08-13 | The General Hospital Corporation | RNA-guided targeting of genetic and epigenomic regulatory proteins to specific genomic loci |
US10760064B2 (en) | 2013-03-15 | 2020-09-01 | The General Hospital Corporation | RNA-guided targeting of genetic and epigenomic regulatory proteins to specific genomic loci |
US9567603B2 (en) | 2013-03-15 | 2017-02-14 | The General Hospital Corporation | Using RNA-guided FokI nucleases (RFNs) to increase specificity for RNA-guided genome editing |
US9567604B2 (en) | 2013-03-15 | 2017-02-14 | The General Hospital Corporation | Using truncated guide RNAs (tru-gRNAs) to increase specificity for RNA-guided genome editing |
US11634731B2 (en) | 2013-03-15 | 2023-04-25 | The General Hospital Corporation | Using truncated guide RNAs (tru-gRNAs) to increase specificity for RNA-guided genome editing |
US10526589B2 (en) | 2013-03-15 | 2020-01-07 | The General Hospital Corporation | Multiplex guide RNAs |
US10844403B2 (en) | 2013-03-15 | 2020-11-24 | The General Hospital Corporation | Increasing specificity for RNA-guided genome editing |
US10011850B2 (en) | 2013-06-21 | 2018-07-03 | The General Hospital Corporation | Using RNA-guided FokI Nucleases (RFNs) to increase specificity for RNA-Guided Genome Editing |
US10190137B2 (en) | 2013-11-07 | 2019-01-29 | Editas Medicine, Inc. | CRISPR-related methods and compositions with governing gRNAS |
US10640788B2 (en) | 2013-11-07 | 2020-05-05 | Editas Medicine, Inc. | CRISPR-related methods and compositions with governing gRNAs |
US11390887B2 (en) | 2013-11-07 | 2022-07-19 | Editas Medicine, Inc. | CRISPR-related methods and compositions with governing gRNAS |
US9970030B2 (en) | 2014-08-27 | 2018-05-15 | Caribou Biosciences, Inc. | Methods for increasing CAS9-mediated engineering efficiency |
US11680268B2 (en) | 2014-11-07 | 2023-06-20 | Editas Medicine, Inc. | Methods for improving CRISPR/Cas-mediated genome-editing |
US10993419B2 (en) | 2014-12-10 | 2021-05-04 | Regents Of The University Of Minnesota | Genetically modified cells, tissues, and organs for treating disease |
US10278372B2 (en) | 2014-12-10 | 2019-05-07 | Regents Of The University Of Minnesota | Genetically modified cells, tissues, and organs for treating disease |
US9888673B2 (en) | 2014-12-10 | 2018-02-13 | Regents Of The University Of Minnesota | Genetically modified cells, tissues, and organs for treating disease |
US11234418B2 (en) | 2014-12-10 | 2022-02-01 | Regents Of The University Of Minnesota | Genetically modified cells, tissues, and organs for treating disease |
US11390884B2 (en) | 2015-05-11 | 2022-07-19 | Editas Medicine, Inc. | Optimized CRISPR/cas9 systems and methods for gene editing in stem cells |
US11911415B2 (en) | 2015-06-09 | 2024-02-27 | Editas Medicine, Inc. | CRISPR/Cas-related methods and compositions for improving transplantation |
US11925664B2 (en) | 2015-07-31 | 2024-03-12 | Intima Bioscience, Inc. | Intracellular genomic transplant and methods of therapy |
US11583556B2 (en) | 2015-07-31 | 2023-02-21 | Regents Of The University Of Minnesota | Modified cells and methods of therapy |
US11642375B2 (en) | 2015-07-31 | 2023-05-09 | Intima Bioscience, Inc. | Intracellular genomic transplant and methods of therapy |
US11266692B2 (en) | 2015-07-31 | 2022-03-08 | Regents Of The University Of Minnesota | Intracellular genomic transplant and methods of therapy |
US10166255B2 (en) | 2015-07-31 | 2019-01-01 | Regents Of The University Of Minnesota | Intracellular genomic transplant and methods of therapy |
US11903966B2 (en) | 2015-07-31 | 2024-02-20 | Regents Of The University Of Minnesota | Intracellular genomic transplant and methods of therapy |
US11642374B2 (en) | 2015-07-31 | 2023-05-09 | Intima Bioscience, Inc. | Intracellular genomic transplant and methods of therapy |
US11147837B2 (en) | 2015-07-31 | 2021-10-19 | Regents Of The University Of Minnesota | Modified cells and methods of therapy |
US10406177B2 (en) | 2015-07-31 | 2019-09-10 | Regents Of The University Of Minnesota | Modified cells and methods of therapy |
US10093910B2 (en) | 2015-08-28 | 2018-10-09 | The General Hospital Corporation | Engineered CRISPR-Cas9 nucleases |
US9512446B1 (en) | 2015-08-28 | 2016-12-06 | The General Hospital Corporation | Engineered CRISPR-Cas9 nucleases |
EP4036236A1 (en) | 2015-08-28 | 2022-08-03 | The General Hospital Corporation | Engineered crispr-cas9 nucleases |
WO2017040348A1 (en) | 2015-08-28 | 2017-03-09 | The General Hospital Corporation | Engineered crispr-cas9 nucleases |
US10526591B2 (en) | 2015-08-28 | 2020-01-07 | The General Hospital Corporation | Engineered CRISPR-Cas9 nucleases |
US9926546B2 (en) | 2015-08-28 | 2018-03-27 | The General Hospital Corporation | Engineered CRISPR-Cas9 nucleases |
US10633642B2 (en) | 2015-08-28 | 2020-04-28 | The General Hospital Corporation | Engineered CRISPR-Cas9 nucleases |
US11060078B2 (en) | 2015-08-28 | 2021-07-13 | The General Hospital Corporation | Engineered CRISPR-Cas9 nucleases |
US11667911B2 (en) | 2015-09-24 | 2023-06-06 | Editas Medicine, Inc. | Use of exonucleases to improve CRISPR/CAS-mediated genome editing |
US11987809B2 (en) | 2015-11-13 | 2024-05-21 | Avellino Lab Usa, Inc. | Methods for the treatment of corneal dystrophies |
EP4036228A1 (en) | 2015-11-13 | 2022-08-03 | Avellino Lab USA, Inc. | Methods for the treatment of corneal dystrophies |
JP2021166514A (en) * | 2015-12-28 | 2021-10-21 | ノバルティス アーゲー | Compositions and methods for treatment of hemoglobinopathies |
US11597924B2 (en) | 2016-03-25 | 2023-03-07 | Editas Medicine, Inc. | Genome editing systems comprising repair-modulating enzyme molecules and methods of their use |
US11236313B2 (en) | 2016-04-13 | 2022-02-01 | Editas Medicine, Inc. | Cas9 fusion molecules, gene editing systems, and methods of use thereof |
WO2018005445A1 (en) | 2016-06-27 | 2018-01-04 | The Broad Institute, Inc. | Compositions and methods for detecting and treating diabetes |
US11912987B2 (en) | 2016-08-03 | 2024-02-27 | KSQ Therapeutics, Inc. | Methods for screening for cancer targets |
US11078481B1 (en) | 2016-08-03 | 2021-08-03 | KSQ Therapeutics, Inc. | Methods for screening for cancer targets |
EP3502261A4 (en) * | 2016-08-19 | 2020-07-15 | Toolgen Incorporated | Artificially engineered angiogenesis regulatory system |
WO2018039145A1 (en) | 2016-08-20 | 2018-03-01 | Avellino Lab Usa, Inc. | Single guide rna, crispr/cas9 systems, and methods of use thereof |
US11078483B1 (en) | 2016-09-02 | 2021-08-03 | KSQ Therapeutics, Inc. | Methods for measuring and improving CRISPR reagent function |
US11946163B2 (en) | 2016-09-02 | 2024-04-02 | KSQ Therapeutics, Inc. | Methods for measuring and improving CRISPR reagent function |
US10912797B2 (en) | 2016-10-18 | 2021-02-09 | Intima Bioscience, Inc. | Tumor infiltrating lymphocytes and methods of therapy |
US11154574B2 (en) | 2016-10-18 | 2021-10-26 | Regents Of The University Of Minnesota | Tumor infiltrating lymphocytes and methods of therapy |
US11466271B2 (en) | 2017-02-06 | 2022-10-11 | Novartis Ag | Compositions and methods for the treatment of hemoglobinopathies |
WO2018195545A2 (en) | 2017-04-21 | 2018-10-25 | The General Hospital Corporation | Variants of cpf1 (cas12a) with altered pam specificity |
US11499151B2 (en) | 2017-04-28 | 2022-11-15 | Editas Medicine, Inc. | Methods and systems for analyzing guide RNA molecules |
WO2018218166A1 (en) | 2017-05-25 | 2018-11-29 | The General Hospital Corporation | Using split deaminases to limit unwanted off-target base editor deamination |
WO2018218206A1 (en) | 2017-05-25 | 2018-11-29 | The General Hospital Corporation | Bipartite base editor (bbe) architectures and type-ii-c-cas9 zinc finger editing |
US11371030B2 (en) | 2017-05-31 | 2022-06-28 | The University Of Tokyo | Modified Cas9 protein and use thereof |
US11702645B2 (en) | 2017-05-31 | 2023-07-18 | The University Of Tokyo | Polynucleotide encoding modified CAS9 protein |
US11098297B2 (en) | 2017-06-09 | 2021-08-24 | Editas Medicine, Inc. | Engineered Cas9 nucleases |
US10428319B2 (en) | 2017-06-09 | 2019-10-01 | Editas Medicine, Inc. | Engineered Cas9 nucleases |
US11098325B2 (en) | 2017-06-30 | 2021-08-24 | Intima Bioscience, Inc. | Adeno-associated viral vectors for gene therapy |
US11866726B2 (en) | 2017-07-14 | 2024-01-09 | Editas Medicine, Inc. | Systems and methods for targeted integration and genome editing and detection thereof using integrated priming sites |
WO2019195738A1 (en) | 2018-04-06 | 2019-10-10 | Children's Medical Center Corporation | Compositions and methods for somatic cell reprogramming and modulating imprinting |
WO2019241315A1 (en) | 2018-06-12 | 2019-12-19 | Obsidian Therapeutics, Inc. | Pde5 derived regulatory constructs and methods of use in immunotherapy |
JP7472121B2 (en) | 2018-10-18 | 2024-04-22 | インテリア セラピューティクス,インコーポレーテッド | Compositions and methods for transgene expression from the albumin locus |
WO2020086742A1 (en) | 2018-10-24 | 2020-04-30 | Obsidian Therapeutics, Inc. | Er tunable protein regulation |
WO2020163396A1 (en) | 2019-02-04 | 2020-08-13 | The General Hospital Corporation | Adenine dna base editor variants with reduced off-target rna editing |
WO2020185632A1 (en) | 2019-03-08 | 2020-09-17 | Obsidian Therapeutics, Inc. | Human carbonic anhydrase 2 compositions and methods for tunable regulation |
WO2020225754A1 (en) | 2019-05-06 | 2020-11-12 | Mcmullen Tara | Crispr gene editing for autosomal dominant diseases |
WO2021046451A1 (en) | 2019-09-06 | 2021-03-11 | Obsidian Therapeutics, Inc. | Compositions and methods for dhfr tunable protein regulation |
WO2021216622A1 (en) | 2020-04-21 | 2021-10-28 | Aspen Neuroscience, Inc. | Gene editing of gba1 in stem cells and method of use of cells differentiated therefrom |
WO2021224633A1 (en) | 2020-05-06 | 2021-11-11 | Orchard Therapeutics (Europe) Limited | Treatment for neurodegenerative diseases |
WO2021248052A1 (en) | 2020-06-05 | 2021-12-09 | The Broad Institute, Inc. | Compositions and methods for treating neoplasia |
US11999952B2 (en) | 2021-04-21 | 2024-06-04 | Toolgen Incorporated | Artificially-manipulated neovascularization regulatory system |
WO2022235929A1 (en) | 2021-05-05 | 2022-11-10 | Radius Pharmaceuticals, Inc. | Animal model having homologous recombination of mouse pth1 receptor |
EP4198124A1 (en) | 2021-12-15 | 2023-06-21 | Versitech Limited | Engineered cas9-nucleases and method of use thereof |
WO2023115041A1 (en) | 2021-12-17 | 2023-06-22 | Sana Biotechnology, Inc. | Modified paramyxoviridae attachment glycoproteins |
WO2023115039A2 (en) | 2021-12-17 | 2023-06-22 | Sana Biotechnology, Inc. | Modified paramyxoviridae fusion glycoproteins |
WO2023133595A2 (en) | 2022-01-10 | 2023-07-13 | Sana Biotechnology, Inc. | Methods of ex vivo dosing and administration of lipid particles or viral vectors and related systems and uses |
WO2023150518A1 (en) | 2022-02-01 | 2023-08-10 | Sana Biotechnology, Inc. | Cd3-targeted lentiviral vectors and uses thereof |
WO2023150647A1 (en) | 2022-02-02 | 2023-08-10 | Sana Biotechnology, Inc. | Methods of repeat dosing and administration of lipid particles or viral vectors and related systems and uses |
WO2024044655A1 (en) | 2022-08-24 | 2024-02-29 | Sana Biotechnology, Inc. | Delivery of heterologous proteins |
WO2024064838A1 (en) | 2022-09-21 | 2024-03-28 | Sana Biotechnology, Inc. | Lipid particles comprising variant paramyxovirus attachment glycoproteins and uses thereof |
WO2024081820A1 (en) | 2022-10-13 | 2024-04-18 | Sana Biotechnology, Inc. | Viral particles targeting hematopoietic stem cells |
Also Published As
Similar Documents
Publication | Publication Date | Title |
---|---|---|
US20230340505A1 (en) | Crispr-cas component systems, methods and compositions for sequence manipulation | |
AU2016244244B2 (en) | CRISPR-Cas systems and methods for altering expression of gene products | |
US8906616B2 (en) | Engineering of systems, methods and optimized guide compositions for sequence manipulation | |
EP2921557B1 (en) | Engineering of systems, methods and optimized guide compositions for sequence manipulation | |
US8932814B2 (en) | CRISPR-Cas nickase systems, methods and compositions for sequence manipulation in eukaryotes | |
US20230416788A1 (en) | Gene editing |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
AS | Assignment |
Owner name: MASSACHUSETTS INSTITUTE OF TECHNOLOGY, MASSACHUSET Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNOR:ZHANG, FENG;REEL/FRAME:035396/0665 Effective date: 20150402 Owner name: THE BROAD INSTITUTE INC., MASSACHUSETTS Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNOR:ZHANG, FENG;REEL/FRAME:035396/0665 Effective date: 20150402 |
|
AS | Assignment |
Owner name: NATIONAL INSTITUTES OF HEALTH (NIH), U.S. DEPT. OF Free format text: CONFIRMATORY LICENSE;ASSIGNOR:BROAD INSTITUTE, INC.;REEL/FRAME:036276/0707 Effective date: 20150803 |
|
STCB | Information on status: application discontinuation |
Free format text: ABANDONED -- FAILURE TO RESPOND TO AN OFFICE ACTION |