US20120052088A1 - Pneumococcal vaccine and uses thereof - Google Patents

Pneumococcal vaccine and uses thereof Download PDF

Info

Publication number
US20120052088A1
US20120052088A1 US13/266,846 US201013266846A US2012052088A1 US 20120052088 A1 US20120052088 A1 US 20120052088A1 US 201013266846 A US201013266846 A US 201013266846A US 2012052088 A1 US2012052088 A1 US 2012052088A1
Authority
US
United States
Prior art keywords
vaccine
conjugated
pneumococcal
serotypes
saccharide
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Abandoned
Application number
US13/266,846
Other languages
English (en)
Inventor
Heather Lynn Davis
Arthur Mertz Krieg
Nicolai Lohse
Lars Ostergaard
Henrik Carl Schonheyder
Ole Schmeltz Sogaard
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Coley Pharmaceutical Group Inc
Original Assignee
Coley Pharmaceutical Group Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Coley Pharmaceutical Group Inc filed Critical Coley Pharmaceutical Group Inc
Priority to US13/266,846 priority Critical patent/US20120052088A1/en
Publication of US20120052088A1 publication Critical patent/US20120052088A1/en
Abandoned legal-status Critical Current

Links

Images

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K39/02—Bacterial antigens
    • A61K39/09—Lactobacillales, e.g. aerococcus, enterococcus, lactobacillus, lactococcus, streptococcus
    • A61K39/092—Streptococcus
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K39/02—Bacterial antigens
    • A61K39/09—Lactobacillales, e.g. aerococcus, enterococcus, lactobacillus, lactococcus, streptococcus
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K39/385—Haptens or antigens, bound to carriers
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K39/39—Medicinal preparations containing antigens or antibodies characterised by the immunostimulating additives, e.g. chemical adjuvants
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P1/00—Drugs for disorders of the alimentary tract or the digestive system
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P1/00—Drugs for disorders of the alimentary tract or the digestive system
    • A61P1/16—Drugs for disorders of the alimentary tract or the digestive system for liver or gallbladder disorders, e.g. hepatoprotective agents, cholagogues, litholytics
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P11/00—Drugs for disorders of the respiratory system
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P11/00—Drugs for disorders of the respiratory system
    • A61P11/06—Antiasthmatics
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P11/00—Drugs for disorders of the respiratory system
    • A61P11/08—Bronchodilators
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P13/00—Drugs for disorders of the urinary system
    • A61P13/12—Drugs for disorders of the urinary system of the kidneys
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00—Drugs for disorders of the nervous system
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00—Drugs for disorders of the nervous system
    • A61P25/30—Drugs for disorders of the nervous system for treating abuse or dependence
    • A61P25/32—Alcohol-abuse
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P3/00—Drugs for disorders of the metabolism
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P3/00—Drugs for disorders of the metabolism
    • A61P3/08—Drugs for disorders of the metabolism for glucose homeostasis
    • A61P3/10—Drugs for disorders of the metabolism for glucose homeostasis for hyperglycaemia, e.g. antidiabetics
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/04—Antibacterial agents
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/12—Antivirals
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/12—Antivirals
    • A61P31/14—Antivirals for RNA viruses
    • A61P31/18—Antivirals for RNA viruses for HIV
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • A61P35/02—Antineoplastic agents specific for leukemia
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P37/00—Drugs for immunological or allergic disorders
    • A61P37/02—Immunomodulators
    • A61P37/04—Immunostimulants
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P43/00—Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P7/00—Drugs for disorders of the blood or the extracellular fluid
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P9/00—Drugs for disorders of the cardiovascular system
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P9/00—Drugs for disorders of the cardiovascular system
    • A61P9/04—Inotropic agents, i.e. stimulants of cardiac contraction; Drugs for heart failure
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K2039/555—Medicinal preparations containing antigens or antibodies characterised by a specific combination antigen/adjuvant
    • A61K2039/55511—Organic adjuvants
    • A61K2039/55561—CpG containing adjuvants; Oligonucleotide containing adjuvants
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K2039/60—Medicinal preparations containing antigens or antibodies characteristics by the carrier linked to the antigen
    • A61K2039/6031—Proteins
    • A61K2039/6037—Bacterial toxins, e.g. diphteria toxoid [DT], tetanus toxoid [TT]

Definitions

  • the present invention relates to new pneumococcal vaccines.
  • the invention also relates to vaccination of subjects, in particular immunocompromised subjects, against pneumococcal infections using said novel pneumococcal vaccines.
  • Pneumococcal diseases are a major public health problem all over the world. Infections caused by pneumococci are a major cause of morbidity and mortality all over the world. Pneumonia, febrile bacteraemia and meningitis are the most common manifestations of invasive pneumococcal disease, whereas bacterial spread within the respiratory tract may result in middle-ear infection, sinusitis or recurrent bronchitis. Compared with invasive disease, the non-invasive manifestations are usually less severe, but considerably more common.
  • pneumococcal pneumonia is the most common community-acquired bacterial pneumonia, estimated to affect approximately 100 per 100 000 adults each year.
  • the etiological agent of pneumococcal diseases Streptococcus pneumoniae (the pneumococcus) a Gram-positive encapsulated coccus, surrounded by a polysaccharide capsule. Differences in the composition of this capsule permit serological differentiation between about 90 capsular types, some of which are frequently associated with pneumococcal disease, others rarely.
  • Invasive pneumococcal infections include pneumonia, meningitis and febrile bacteremia; among the common non-invasive manifestations are otitis media, sinusitis and bronchitis.
  • Pneumococcal resistance to essential antimicrobials such as penicillins, cephalosporins and macrolides is a serious and rapidly increasing problem worldwide.
  • Conditions associated with increased risk of serious pneumococcal disease include age extremes (infants, elderly) and being immunocompromised for any reason, including but not limited to: HIV infection, other chronic viral infections, sickle-cell anaemia, diabetes, cancer and cancer therapy, smoking, chronic organ failures, organ transplant and immune suppressive therapy.
  • Some of the shortcomings of current vaccination include: need for several boosts to achieve protection, delay in rise of protective antibodies, prevalence of vaccine non-responders (this is particularly a problem for immune-compromised individuals), cost of antigen and vaccine production which is a very significant limitation in the development of new conjugated pneumococcal vaccines, poorly protective antibodies with low affinity, falling antibody titres over time.
  • An object of the new pneumococcal vaccine of the invention is to overcome at least partially some of theses shortcomings.
  • the present invention is directed towards new pneumococcal vaccines wherein said vaccine comprises one or more pneumoccal polysaccharide antigens conjugated to a carrier protein as antigen and an agonist for Toll-like receptor 9 (TLR9) as adjuvant.
  • said vaccine comprises one or more pneumoccal polysaccharide antigens conjugated to a carrier protein as antigen and an agonist for Toll-like receptor 9 (TLR9) as adjuvant.
  • TLR9 Toll-like receptor 9
  • the present invention is directed towards the use of a pneumococcal vaccine comprising one or more pneumoccal polysaccharide antigens conjugated to a carrier protein as antigen and a TLR-9 agonist as adjuvant to vaccinate immunocompromised subjects.
  • the invention is directed towards any of the pneumococcal vaccine disclosed herein for use in the vaccination of immunocompromised subjects, preferably any of the immunocompromised subjects disclosed herein.
  • the present invention is directed towards the use of any of the pneumococcal vaccines disclosed herein to vaccinate immunocompromised subjects, preferably any of the immunocompromised subjects disclosed herein.
  • the present invention is directed towards any of the vaccines disclosed herein for the prevention or treatment of diseases caused by S. pneumoniae infection, preferably in an immunocompromised subject.
  • the present invention is directed towards a method of immunizing a subject, preferably any of the immunocompromised subjects disclosed herein, against diseases caused by S. pneumoniae infection comprising administering to said subject an immunoprotective dose of any of the vaccines disclosed herein.
  • the present invention is directed towards the use of any of the vaccines disclosed herein, for the manufacture of a medicament for the prevention or treatment of diseases caused by S. pneumoniae infection, preferably in an immunocompromised subject.
  • the present invention is directed towards any of the pneumococcal vaccines disclosed herein and at least one TLR-9 agonist disclosed herein.
  • the present invention is directed towards any of the pneumococcal vaccines disclosed herein and at least one TLR-9 agonist disclosed herein for use in the vaccination of any of the immunocompromised subjects disclosed herein.
  • TLR-9 Agonist Toll-Like Receptor 9 Agonist (TLR-9 Agonist) of the Invention
  • a TLR-9 agonist for use in the present invention is a CpG Oligonucleotide.
  • a CpG oligonucleotide as used herein refers to an immunostimulatory CpG oligodeoxynucleotide (CpG ODN), and accordingly these terms are used interchangeably unless otherwise indicated.
  • Immunostimulatory CpG oligodeoxynucleotides contain one or more immunostimulatory CpG motifs that are unmethylated cytosine-guanine dinucleotides, optionally within certain preferred base contexts. The methylation status of the CpG immunostimulatory motif generally refers to the cytosine residue in the dinucleotide.
  • An immunostimulatory oligonucleotide containing at least one unmethylated CpG dinucleotide is an oligonucleotide which contains a 5′ unmethylated cytosine linked by a phosphate bond to a 3′ guanine, and which activates the immune system through binding to Toll-like receptor 9 (TLR-9).
  • TLR-9 Toll-like receptor 9
  • the immunostimulatory oligonucleotide may contain one or more methylated CpG dinucleotides, which will activate the immune system through TLR9 but not as strongly as if the CpG motif(s) was/were unmethylated.
  • CpG CpG immunostimulatory oligonucleotides may comprise one or more palindromes that in turn may encompass the CpG dinucleotide.
  • CpG oligonucleotides have been described in a number of issued patents, published patent applications, and other publications, including U.S. Pat. Nos. 6,194,388; 6,207,646; 6,214,806; 6,218,371; 6,239,116; and 6,339,068.
  • CpG immunostimulatory oligonucleotides Different classes of CpG immunostimulatory oligonucleotides have been identified. These are referred to as A, B, C and P class, and are described in greater detail below. Methods of the invention embrace the use of these different classes of CpG immunostimulatory oligonucleotides.
  • An E modification may be a halogen substitution for the 5′ terminal nucleotide; examples of such substitutions include but are not limited to bromo-uridine or iodo-uridine substitutions.
  • An E modification can also include an ethyl-uridine substitution for the 5′ terminal nucleotide.
  • the “A class” CpG immunostimulatory oligonucleotides are characterized functionally by the ability to induce high levels of interferon-alpha (IFN- ⁇ ) from plasmacytoid dendritic cells (pDC) and inducing NK cell activation while having minimal effects on B cell activation. Structurally, this class typically has stabilized poly-G sequences at 5′ and 3′ ends. It also has a palindromic phosphodiester CpG dinucleotide-containing sequence of at least 6 nucleotides, for example but not necessarily, it contains one of the following hexamer palindromes: GACGTC, AGCGCT, or AACGTT described by Yamamoto and colleagues. Yamamoto S et al. J.
  • the “A class” CpG oligonucleotide of the invention has the following nucleic acid sequence: 5′ GGGGACGACGTCGTGGGGGGG 3′ (SEQ ID NO: 1)
  • A-Class oligonucleotides include:
  • the “B class” CpG immunostimulatory oligonucleotides are characterized functionally by the ability to activate B cells and pDC except are relatively weak in inducing IFN- ⁇ and NK cell activation. Structurally, this class typically may be fully stabilized with phosphorothioate linkages, but it may also have one or more phosphodiester linkages, preferably between the cytosine and guanine of the CpG motif(s), in which case the molecule is referred to as semi-soft.
  • the TLR-9 agonist for use in the present invention is a B class CpG oligonucleotide represented by at least the formula: 5′ X 1 X 2 CGX 3 X 4 3′, wherein X1, X2, X3, and X4 are nucleotides.
  • X 2 is adenine, guanine, or thymine.
  • X 3 is cytosine, adenine, or thymine.
  • the TLR-9 agonist for use in the present invention is a B class CpG oligonucleotide represented by at least the formula: 5′ N 1 X 1 X 2 CGX 3 X 4 N 2 3′, wherein X 1 , X 2 , X 3 , and X 4 are nucleotides and N is any nucleotide and N 1 and N 2 are nucleic acid sequences composed of from about 0-25 N's each.
  • X 1 X 2 is a dinucleotide selected from the group consisting of GpT, GpG, GpA, ApA, ApT, ApG, CpT, CpA, CpG, TpA, TpT and TpG; and X 3 X 4 is a dinucleotide selected from the group consisting of TpT, ApT, TpG, ApG, CpG, TpC, ApC, CpC, TpA, ApA and CpA.
  • X 1 X 2 is GpA or GpT and X3X4 is TpT.
  • X 1 or X 2 or both are purines and X 3 or X 4 or both are pyrimidines or X 1 X 2 is GpA and X 3 or X 4 or both are pyrimidines.
  • X 1 X 2 is a dinucleotide selected from the group consisting of TpA, ApA, ApC, ApG and GpG.
  • X 3 X 4 is a dinucleotide selected from the group consisting of TpT, TpA, TpG, ApA, ApG, GpA and CpA.
  • X 1 X 2 in another embodiment, is a dinucleotide selected from the group consisting of TpT, TpG, ApT, GpC, CpC, CpT, TpC, GpT and CpG;
  • X 3 is a nucleotide selected from the group consisting of A and T, and
  • X 4 is a nucleotide, but when X 1 X 2 is TpC, GpT or CpG, X 3 X 4 is not TpC, ApT or ApC.
  • the CpG oligonucleotide has the sequence 5′ TCN 1 TX 1 X 2 CGX 3 X 4 3′.
  • the CpG oligonucleotides of the invention include X 1 X 2 selected from the group consisting of GpT, GpG, GpA and ApA and X3X4 selected from the group consisting of TpT, CpT and TpC.
  • the B class CpG oligonucleotide sequences of the invention are those broadly described above as well as disclosed in published PCT Patent Applications PCT/US95/01570 and PCT/US97/19791, and in U.S. Pat. Nos. 6,194,388, 6,207,646, 6,214,806, 6,218,371, 6,239,116 and 6,339,068. Exemplary sequences include but are not limited to those disclosed in these latter applications and patents.
  • the “B class” CpG oligonucleotide of the invention has the following nucleic acid sequence:
  • all of the linkages may be all phosphorothioate bonds.
  • one or more of the linkages may be phosphodiester, preferably between the “C” and the “G” of the CpG motif making a semi-soft CpG oligonucleotide.
  • an ethyl-uridine or a halogen may substitute for the 5′ T; examples of halogen substitutions include but are not limited to bromo-uridine or iodo-uridine substitutions.
  • B-Class oligonucleotides include:
  • CpG immunostimulatory oligonucleotides is characterized functionally by the ability to activate B cells and NK cells and induce IFN- ⁇ . Structurally, this class typically includes a region with one or more B class-type immunostimulatory CpG motifs, and a GC-rich palindrome or near-palindrome region that allows the molecules to form secondary (e.g., stem-loop) or tertiary (e.g., dimer) type structures.
  • Some of these oligonucleotides have both a traditional “stimulatory” CpG sequence and a “GC-rich” or “B-cell neutralizing” motif.
  • combination motif oligonucleotides have immune stimulating effects that fall somewhere between the effects associated with traditional B class CpG oligonucleotides (i.e., strong induction of B cell activation and dendritic cell (DC) activation), and the effects associated with A class CpG ODN (i.e., strong induction of IFN- ⁇ and NK cell activation but relatively poor induction of B cell and DC activation).
  • B class CpG oligonucleotides i.e., strong induction of B cell activation and dendritic cell (DC) activation
  • a class CpG ODN i.e., strong induction of IFN- ⁇ and NK cell activation but relatively poor induction of B cell and DC activation.
  • the C class of combination motif immune stimulatory oligonucleotides may have either completely stabilized, (e.g., all phosphorothioate), chimeric (phosphodiester central region), or semi-soft (e.g., phosphodiester within CpG motif) backbones. This class has been described in U.S. patent application U.S. Ser. No. 10/224,523 filed on Aug. 19, 2002.
  • One stimulatory domain or motif of the C class CpG oligonucleotide is defined by the formula: 5′ X 1 DCGHX 2 3′.
  • D is a nucleotide other than C.
  • C is cytosine.
  • G is guanine.
  • H is a nucleotide other than G.
  • X 1 and X 2 are any nucleic acid sequence 0 to 10 nucleotides long.
  • X 1 may include a CG, in which case there is preferably a T immediately preceding this CG.
  • DCG is TCG.
  • X 1 is preferably from 0 to 6 nucleotides in length.
  • X 2 does not contain any poly G or poly A motifs.
  • the immunostimulatory oligonucleotide has a poly-T sequence at the 5′ end or at the 3′ end.
  • poly-A or poly-T shall refer to a stretch of four or more consecutive A's or T's respectively, e.g., 5′ AAAA 3′ or 5′ TTTT 3′.
  • poly-G end shall refer to a stretch of four or more consecutive G's, e.g., 5′ GGGG 3′, occurring at the 5′ end or the 3′ end of a nucleic acid.
  • poly-G oligonucleotide shall refer to an oligonucleotide having the formula 5′ X 1 X 2 GGGX 3 X 4 3′ wherein X 2 , X 3 , and X 4 are nucleotides and preferably at least one of X 3 and X 4 is a G.
  • Some preferred designs for the B cell stimulatory domain under this formula comprise TTTTTCG, TCG, TTCG, TTTCG, TTTTCG, TCGT, TTCGT, TTTCGT, TCGTCGT.
  • the second motif of the C class CpG oligonucleotide is referred to as either P or N and is positioned immediately 5′ to X 1 or immediately 3′ to X 2 .
  • N is a B cell neutralizing sequence that begins with a CGG trinucleotide and is at least 10 nucleotides long.
  • a B cell neutralizing motif includes at least one CpG sequence in which the CG is preceded by a C or followed by a G (Krieg A M et al. (1998) Proc Natl Acad Sd USA 95:12631-12636) or is a CG containing DNA sequence in which the C of the CG is methylated.
  • Neutralizing motifs or sequences have some degree of immunostimulatory capability when present in an otherwise non-stimulatory motif, but when present in the context of other immunostimulatory motifs serve to reduce the immunostimulatory potential of the other motifs.
  • P is a GC-rich palindrome containing sequence at least 10 nucleotides long.
  • “palindrome” and equivalently “palindromic sequence” shall refer to an inverted repeat, i.e., a sequence such as ABCDEE′D′C′B′A′ in which A and A′, B and B′, etc., are bases capable of forming the usual Watson-Crick base pairs.
  • GC-rich palindrome shall refer to a palindrome having a base composition of at least two-thirds G's and Cs.
  • the GC-rich domain is preferably 3′ to the “B cell stimulatory domain”.
  • the palindrome thus contains at least 8 G's and Cs.
  • the palindrome also contains at least 8 G's and Cs.
  • at least ten bases of the palindrome are G's and Cs.
  • the GC-rich palindrome is made up exclusively of G's and Cs.
  • the GC-rich palindrome has a base composition of at least 81% G's and Cs. In the case of such a 10-base long GC-rich palindrome, the palindrome thus is made exclusively of G's and Cs. In the case of such a 12-base long GC-rich palindrome, it is preferred that at least ten bases (83%) of the palindrome are G's and Cs. In some preferred embodiments, a 12-base long GC-rich palindrome is made exclusively of G's and Cs. In the case of a 14-mer GC-rich palindrome, at least twelve bases (86%) of the palindrome are G's and Cs. In some preferred embodiments, a 14-base long GC-rich palindrome is made exclusively of G's and Cs. The Cs of a GC-rich palindrome can be unmethylated or they can be methylated.
  • this domain has at least 3 Cs and Gs, more preferably 4 of each, and most preferably 5 or more of each.
  • the number of Cs and Gs in this domain need not be identical. It is preferred that the Cs and Gs are arranged so that they are able to form a self-complementary duplex, or palindrome, such as CCGCGCGG. This may be interrupted by As or Ts, but it is preferred that the self-complementarity is at least partially preserved as for example in the motifs CGACGTTCGTCG or CGGCGCCGTGCCG. When complementarity is not preserved, it is preferred that the non-complementary base pairs be TG.
  • the GC-rich palindrome includes at least one CGG trimer, at least one CCG trimer, or at least one CGCG tetramer. In other embodiments, the GC-rich palindrome is not CCCCCCGGGGGG or GGGGGGCCCCCC, CCCCCGGGGG or GGGGGCCCCC.
  • At least one of the G's of the GC rich region may be substituted with an inosine (I).
  • I inosine
  • P includes more than one I.
  • the immunostimulatory oligonucleotide has one of the following formulas 5′ NX 1 DCGHX 2 3′, 5′ X 1 DCGHX 2 N 3′, 5′ PX 1 DCGHX 2 3′, 5′ X 1 DCGHX 2 P 3′, 5′ X 1 DCGHX 2 PX 3 3′, 5′ X 1 DCGHPX 3 3′, 5′ DCGHX 2 PX 3 3′, 5′ TCGHX 2 PX 3 3′, 5′ DCGHPX 3 3′ or 5′DCGHP 3′.
  • N 1 is any sequence 1 to 6 nucleotides long.
  • Py is a pyrimidine.
  • G is guanine.
  • N 2 is any sequence 0 to 30 nucleotides long.
  • P is a GC-rich palindrome containing a sequence at least 10 nucleotides long.
  • N 1 and N 2 may contain more than 50% pyrimidines, and more preferably more than 50% T.
  • N 1 may include a CG, in which case there is preferably a T immediately preceding this CG.
  • N1PyG is TCG, and most preferably a TCGN 2 , where N 2 is not G.
  • N 1 PyGN 2 P may include one or more inosine (I) nucleotides. Either the C or the G in N 1 may be replaced by inosine, but the Cpl is preferred to the IpG. For inosine substitutions such as IpG, the optimal activity may be achieved with the use of a “semi-soft” or chimeric backbone, where the linkage between the IG or the Cl is phosphodiester. N1 may include at least one Cl, TCl, IG or TIG motif.
  • N 1 PyGN 2 is a sequence selected from the group consisting of TTTTTCG, TCG, TTCG, TTTCG, TTTTCG, TCGT, TTCGT, TTTCGT, and TCGTCGT.
  • the “C class” CpG oligonucleotides of the invention has the following nucleic acid sequence:
  • all of the linkages may be all phosphorothioate bonds.
  • one or more of the linkages may be phosphodiester, preferably between the “C” and the “G” of the CpG motif making a semi-soft CpG oligonucleotide.
  • C-Class oligonucleotides include:
  • an ethyl-uridine or a halogen may substitute for the 5′ T; examples of halogen substitutions include but are not limited to bromo-uridine or iodo-uridine substitutions.
  • P-Class CpG immunostimulatory oligonucleotides have been described in WO2007/095316 and are characterized by the fact that they contain duplex forming regions such as, for example, perfect or imperfect palindromes at or near both the 5′ and 3′ ends, giving them the potential to form higher ordered structures such as concatamers.
  • P-Class oligonucleotides have the ability in some instances to induce much high levels of IFN- ⁇ secretion than the C-Class.
  • the P-Class oligonucleotides have the ability to spontaneously self-assemble into concatamers either in vitro and/or in vivo.
  • the TLR-9 agonist for use in the present invention is a P class CpG oligonucleotide containing a 5 TLR activation domain and at least two palindromic regions, one palindromic region being a 5′ palindromic region of at least 6 nucleotides in length and connected to a 3′ palindromic region of at least 8 nucleotides in length either directly or through a spacer, wherein the oligonucleotide includes at least one YpR dinucleotide.
  • said oligoonucleotide is not T*C_G*T*C_G*A*C_G*T*T*C_G*G*C*G*C_G*C*G*C*G (SEQ ID NO: 27).
  • the a P class CpG oligonucleotide includes at least one unmethylated CpG dinucleotide.
  • the TLR activation domain is TCG, TTCG, TTTCG, TYpR, TTYpR, TTTYpR, UCG, UUCG, UUUCG, TTT, or TTTT. In yet another embodiment the TLR activation domain is within the 5′ palindromic region.
  • the TLR activation domain is immediately 5′ to the 5′ palindromic region.
  • the 5′ palindromic region is at least 8 nucleotides in length.
  • the 3′ palindromic region is at least 10 nucleotides in length.
  • the 5′ palindromic region is at least 10 nucleotides in length.
  • the 3′ palindromic region includes an unmethylated CpG dinucleotide.
  • the 3′ palindromic region includes two unmethylated CpG dinucleotides.
  • the 5′ palindromic region includes an unmethylated CpG dinucleotide.
  • the 5′ palindromic region includes two unmethylated CpG dinucleotides.
  • the 5 and 3′ palindromic regions have a duplex stability value of at least 25.
  • the 5 and 3′ palindromic regions have a duplex stability value of at least 30.
  • the 5 and 3′ palindromic regions have a duplex stability value of at least 35.
  • the 5 and 3′ palindromic regions have a duplex stability value of at least 40.
  • the 5 and 3′ palindromic regions have a duplex stability value of at least 45.
  • the 5 and 3′ palindromic regions have a duplex stability value of at least 50.
  • the 5′ and 3′ palindromic regions have a duplex stability value of at least 55. In another embodiment the 5 and 3′ palindromic regions have a duplex stability value of at least 60. In another embodiment the 5 and 3′ palindromic regions have a duplex stability value of at least 65.
  • the two palindromic regions are connected directly. In another embodiment the two palindromic regions are connected via a 3′-3′ linkage. In another embodiment the two palindromic regions overlap by one nucleotide. In yet another embodiment the two palindromic regions overlap by two nucleotides. In another embodiment the two palindromic regions do not overlap. In another embodiment the two palindromic regions are connected by a spacer. In one embodiment the spacer is a nucleic acid having a length of 1-50 nucleotides. In another embodiment the spacer is a nucleic acid having a length of 1 nucleotide. In another embodiment the spacer is a non-nucleotide spacer.
  • the non-nucleotide spacer is a D-spacer. In another embodiment the non-nucleotide spacer is a linker. In one embodiment the oligonucleotide has the formula 5′ XP 1 SP 2 T 3′, wherein X is the TLR activation domain, P 1 is a palindrome, S is a spacer, P 2 is a palindrome, and T is a 3′ tail of 0-100 nucleotides in length. In one embodiment X is TCG, TTCG, or TTTCG. In another embodiment T is 5-50 nucleotides in length. In yet another embodiment T is 5-10 nucleotides in length.
  • S is a nucleic acid having a length of 1-50 nucleotides. In another embodiment S is a nucleic acid having a length of 1 nucleotide. In another embodiment S is a non-nucleotide spacer. In one embodiment the non-nucleotide spacer is a D-spacer. In another embodiment the non-nucleotide spacer is a linker. In another embodiment the oligonucleotide is not an antisense oligonucleotide or a ribozyme. In one embodiment P 1 is A and T rich. In another embodiment P 1 includes at least 4 Ts. In another embodiment P 2 is a perfect palindrome. In another embodiment P2 is G-C rich. In still another embodiment P 2 is CGGCGCX 1 GCGCCG, where X 1 is T or nothing.
  • the oligonucleotide includes at least one phosphorothioate linkage. In another embodiment all internucleotide linkages of the oligonucleotide are phosphorothioate linkages. In another embodiment the oligonucleotide includes at least one phosphodiester-like linkage. In another embodiment the phosphodiester-like linkage is a phosphodiester linkage. In another embodiment a lipophilic group is conjugated to the oligonucleotide. In one embodiment the lipophilic group is cholesterol.
  • the TLR-9 agonist for use in the present invention is a P class CpG oligonucleotide with a 5′ TLR activation domain and at least two complementarity-containing regions, a 5′ and a 3′ complementarity-containing region, each complementarity-containing region being at least 8 nucleotides in length and connected to one another either directly or through a spacer, wherein the oligonucleotide includes at least one pyrimidine-purine (YpR) dinucleotide, and wherein at least one of the complementarity-containing regions is not a perfect palindrome.
  • the oligonucleotide includes at least one unmethylated CpG dinucleotide.
  • the TLR activation domain is TCG, TTCG, TTTCG, TYpR, TTYpR, TTTYpR, UCG, UUCG, UUUCG, TTT, or TTTT.
  • the TLR activation domain is within the 5′ complementarity-containing region.
  • the TLR activation domain is immediately 5′ to the 5′ complementarity-containing region.
  • the 3′ complementarity-containing region is at least 10 nucleotides in length.
  • the 5′ complementarity-containing region is at least 10 nucleotides in length.
  • the 3′ complementarity-containing region includes an unmethylated CpG dinucleotide.
  • the 3′ complementarity-containing region includes two unmethylated CpG dinucleotides.
  • the 5′ complementarity-containing region includes an unmethylated CpG dinucleotide.
  • the 5′ complementarity-containing region includes two unmethylated CpG dinucleotides.
  • the complementarity-containing regions include at least one nucleotide analog.
  • the complementarity-containing regions form an intramolecular duplex.
  • the intramolecular duplex includes at least one non-Watson Crick base pair.
  • the non-Watson Crick base pair is G-T, G-A, G-G, or C-A.
  • the complementarity-containing regions form intermolecular duplexes.
  • at least one of the intermolecular duplexes includes at least one non-Watson Crick base pair.
  • the non-Watson Crick base pair is G-T, G-A, G-G, or C-A.
  • the complementarity-containing regions contain a mismatch.
  • the complementarity-containing regions contain two mismatches.
  • the complementarity-containing regions contain an intervening nucleotide.
  • the complementarity-containing regions contain two intervening nucleotides.
  • the 5′ and 3′ complementarity-containing regions have a duplex stability value of at least 25. In another embodiment the 5′ and 3′ complementarity-containing regions have a duplex stability value of at least 30. In another embodiment the 5′ and 3′ complementarity-containing regions have a duplex stability value of at least 35. In another embodiment the complementarity-containing regions have a duplex stability value of at least 40. In another embodiment the complementarity-containing regions have a duplex stability value of at least 45. In another embodiment the complementarity-containing regions have a duplex stability value of at least 50. In another embodiment the complementarity-containing regions have a duplex stability value of at least 55. In another embodiment the complementarity-containing regions have a duplex stability value of at least 60. In another embodiment the complementarity-containing regions have a duplex stability value of at least 65.
  • the two complementarity-containing regions are connected directly. In another embodiment the two palindromic regions are connected via a 3′-3′ linkage. In yet another embodiment the two complementarity-containing regions overlap by one nucleotide. In another embodiment the two complementarity-containing regions overlap by two nucleotides. In another embodiment the two complementarity-containing regions do not overlap. In another embodiment the two complementarity-containing regions are connected by a spacer. In another embodiment the spacer is a nucleic acid having a length of 1-50 nucleotides. In another embodiment the spacer is a nucleic acid having a length of 1 nucleotide. In one embodiment the spacer is a non-nucleotide spacer. In another embodiment the non-nucleotide spacer is a D-spacer. In yet another embodiment the non-nucleotide spacer is a linker.
  • the P-class oligonucleotide has the formula 5′ XNSPT 3′, wherein X is the TLR activation domain, N is a non-perfect palindrome, P is a palindrome, S is a spacer, and T is a 3′ tail of 0-100 nucleotides in length.
  • X is TCG, TTCG, or TTTCG.
  • T is 5-50 nucleotides in length.
  • T is 5-10 nucleotides in length.
  • S is a nucleic acid having a length of 1-50 nucleotides.
  • S is a nucleic acid having a length of 1 nucleotide.
  • S is a non-nucleotide spacer.
  • the non-nucleotide spacer is a D-spacer.
  • the non-nucleotide spacer is a linker.
  • the oligonucleotide is not an antisense oligonucleotide or a ribozyme.
  • N is A and T rich.
  • N is includes at least 4 Ts.
  • P is a perfect palindrome.
  • P is G-C rich.
  • P is CGGCGCX 1 GCGCCG, wherein X 1 is T or nothing.
  • the oligonucleotide includes at least one phosphorothioate linkage.
  • all interaucleotide linkages of the oligonucleotide are phosphorothioate linkages.
  • the oligonucleotide includes at least one phosphodiester-like linkage.
  • the phosphodiester-like linkage is a phosphodiester linkage.
  • a lipophilic group is conjugated to the oligonucleotide. In one embodiment the lipophilic group is cholesterol.
  • the “P class” CpG oligonucleotides of the invention has the following nucleic acid sequence: 5′ TCGTCGACGATCGGCGCGCGCCG 3′ (SEQ ID NO: 39).
  • all of the linkages may be all phosphorothioate bonds.
  • one or more of the linkages may be phosphodiester, preferably between the “C” and the “G” of the CpG motif making a semi-soft CpG oligonucleotide.
  • an ethyl-uridine or a halogen may substitute for the 5′ T; examples of halogen substitutions include but are not limited to bromo-uridine or iodo-uridine substitutions.
  • P-Class oligonucleotides include:
  • all the internucleotide linkage of the CpG oligonucleotides disclosed herein are phosphodiester bonds (“soft” oligonucleotides, as described in the PCT application WO2007/026190).
  • CpG oligonucleotides of the invention are rendered resistant to degradation (e.g., are stabilized).
  • a “stabilized oligonucleotide” refers to an oligonucleotide that is relatively resistant to in vivo degradation (e.g. via an exo- or endo-nuclease). Nucleic acid stabilization can be accomplished via backbone modifications. Oligonucleotides having phosphorothioate linkages provide maximal activity and protect the oligonucleotide from degradation by intracellular exo- and endo-nucleases.
  • the immunostimulatory oligonucleotides may have a chimeric backbone, which have combinations of phosphodiester and phosphorothioate linkages.
  • a chimeric backbone refers to a partially stabilized backbone, wherein at least one internucleotide linkage is phosphodiester or phosphodiester-like, and wherein at least one other internucleotide linkage is a stabilized internucleotide linkage, wherein the at least one phosphodiester or phosphodiester-like linkage and the at least one stabilized linkage are different.
  • the phosphodiester linkage is preferentially located within the CpG motif such molecules are called “semi-soft” as described in the PCT application WO2007/026190.
  • modified oligonucleotides include combinations of phosphodiester, phosphorothioate, methylphosphonate, methylphosphorothioate, phosphorodithioate, and/or p-ethoxy linkages. Since boranophosphonate linkages have been reported to be stabilized relative to phosphodiester linkages, for purposes of the chimeric nature of the backbone, boranophosphonate linkages can be classified either as phosphodiester-like or as stabilized, depending on the context. For example, a chimeric backbone according to the instant invention could, in some embodiments, includes at least one phosphodiester (phosphodiester or phosphodiester-like) linkage and at least one boranophosphonate (stabilized) linkage.
  • a chimeric backbone according to the instant invention could include boranophosphonate (phosphodiester or phosphodiester-like) and phosphorothioate (stabilized) linkages.
  • a “stabilized internucleotide linkage” shall mean an internucleotide linkage that is relatively resistant to in vivo degradation (e.g., via an exo- or endo-nuclease), compared to a phosphodiester internucleotide linkage.
  • Preferred stabilized internucleotide linkages include, without limitation, phosphorothioate, phosphorodithioate, methylphosphonate, and methylphosphorothioate.
  • Other stabilized internucleotide linkages include, without limitation, peptide, alkyl, dephospho, and others as described above.
  • Modified backbones such as phosphorothioates may be synthesized using automated techniques employing either phosphoramidate or H-phosphonate chemistries.
  • Aryl- and alkyl-phosphonates can be made, e.g., as described in U.S. Pat. No. 4,469,863; and alkylphosphotriesters (in which the charged oxygen moiety is alkylated as described in U.S. Pat. No. 5,023,243 and European Patent No. 092,574) can be prepared by automated solid phase synthesis using commercially available reagents. Methods for making other DNA backbone modifications and substitutions have been described. Uhlmann E et al.
  • Mixed backbone modified ODN may be synthesized as described in the PCT application WO2007/026190.
  • the oligonucleotides of the invention can also include other modifications. These include nonionic DNA analogs, such as alkyl- and aryl-phosphates (in which the charged phosphonate oxygen is replaced by an alkyl or aryl group), phosphodiester and alkylphosphotriesters, in which the charged oxygen moiety is alkylated. Nucleic acids which contain diol, such as tetraethyleneglycol or hexaethyleneglycol, at either or both termini have also been shown to be substantially resistant to nuclease degradation.
  • the size of the CpG oligonucleotide (i.e., the number of nucleotide residues along the length of the oligonucleotide) also may contribute to the stimulatory activity of the oligonucleotide.
  • CpG oligonucleotide of the invention preferably have a minimum length of 6 nucleotide residues. Oligonucleotides of any size greater than 6 nucleotides (even many kb long) are capable of inducing an immune response if sufficient immunostimulatory motifs are present, because larger oligonucleotides are degraded inside cells.
  • the CpG oligonucleotides are 6 to 100 nucleotides long, preferentially 8 to 30 nucleotides long.
  • nucleic acids and oligonucleotides of the invention are not plasmids or expression vectors.
  • the CpG oligonucleotide disclosed herein comprise substitutions or modifications, such as in the bases and/or sugars as described at paragraph 134 to 147 of WO2007/026190.
  • the CpG oligonucleotide of the present invention is chemically modified.
  • Examples of chemical modifications are known to the skilled person and are described, for example in Uhlmann E. et al. (1990), Chem. Rev. 90:543, S. Agrawal, Ed., Humana Press, Totowa, USA 1993; Crooke, S. T. et al. (1996) Annu. Rev. Pharmacol. Toxicol. 36:107-129; and Hunziker J. et al., (1995), Mod. Synth. Methods 7:331-417.
  • An oligonucleotide according to the invention may have one or more modifications, wherein each modification is located at a particular phosphodiester internucleoside bridge and/or at a particular ⁇ -D-ribose unit and/or at a particular natural nucleoside base position in comparison to an oligonucleotide of the same sequence which is composed of natural DNA or RNA.
  • CpG-containing nucleic acids might be simply mixed with immunogenic carriers according to methods known to those skilled in the art (see, e.g. WO03/024480).
  • any of the vaccine disclosed herein comprises from 2 ⁇ g to 100 mg of CpG oligonucleotide, preferably from 0.1 mg to 50 mg CpG oligonucleotide, preferably from 0.2 mg to 10 mg CpG oligonucleotide, preferably from 0.3 mg to 5 mg CpG oligonucleotide, preferably from 0.3 mg to 5 mg CpG oligonucleotide, even preferably from 0.5 to 2 mg CpG oligonucleotide, even preferably from 0.75 to 1.5 mg CpG oligonucleotide.
  • any of the vaccine disclosed herein comprises approximately 1 mg CpG oligonucleotide.
  • Pneumococcal vaccine of the present invention will typically comprise conjugated capsular saccharide antigens, wherein the saccharides are derived from at least seven serotypes of S. pneumoniae .
  • the number of S. pneumoniae capsular saccharides can range from 7 different serotypes (or “v”, valences) to 23 different serotypes (23 v). In one embodiment there are 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22 or 23 different serotypes. In an embodiment there are 10 or 11 different serotypes. In an embodiment there are 7 or 13 different serotypes.
  • the capsular saccharide antigens are conjugated to a carrier protein as described here below.
  • the vaccine may comprise conjugated S. pneumoniae saccharides and unconjugated S. pneumoniae saccharides.
  • the total number of saccharide serotypes is less than or equal to 23.
  • the vaccine may comprise 7 conjugated serotypes and 16 unconjugated saccharides.
  • the vaccine may comprise 13 conjugated serotypes and 10 unconjugated saccharides.
  • the vaccine may comprise 8, 9, 10, 11, 12, 13, 14, 15 or 16 conjugated saccharides and 15, 14, 13, 12, 11, 10, 9, 8 or 7, respectively, unconjugated saccharides.
  • the vaccine of the invention comprises conjugated S. pneumoniae saccharides from serotypes 4, 6B, 9V, 14, 18C, 19F and. 23F. 2. In another embodiment the vaccine of the invention comprises in addition to point 1 above, conjugated S. pneumoniae saccharides from serotype 1. 3. In another embodiment the vaccine of the invention comprises in addition to point 1 or 2 above, conjugated S. pneumoniae saccharides from serotype 5. 4. In another embodiment the vaccine of the invention comprises in addition to point 1, 2 or 3 above, conjugated S. pneumoniae saccharides from serotype 7F. 5. In another embodiment the vaccine of the invention comprises in addition to point 1, 2, 3 or 4 above, conjugated S. pneumoniae saccharides from serotype 3. 6.
  • the vaccine of the invention comprises in addition to point 1, 2, 3, 4 or 5 above, conjugated S. pneumoniae saccharides from serotype 6A. 7. In another embodiment the vaccine of the invention comprises in addition to point 1, 2, 3, 4, 5 or 6 above, conjugated S. pneumoniae saccharides from serotype 19A. 8. In another embodiment the vaccine of the invention comprises in addition to point 1, 2, 3, 4, 5, 6 or 7 above, conjugated S. pneumoniae saccharides from serotype 22F. 9. In another embodiment the vaccine of the invention comprises in addition to point 1, 2, 3, 4, 5, 6, 7 or 8 above, conjugated S. pneumoniae saccharides from serotype 15. 10. In another embodiment the vaccine of the invention comprises in addition to point 1, 2, 3, 4, 5, 6, 7, 8 or 9 above, conjugated S.
  • the vaccine of the invention comprises in addition to point 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 above, conjugated S. pneumoniae saccharides from serotype 12F. 12. In another embodiment the vaccine of the invention comprises in addition to point 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or 11 above, conjugated S. pneumoniae saccharides from serotype 2. 13. In another embodiment the vaccine of the invention comprises in addition to point 1, 2, 3, 4, 5, 6, 7, 8, 9, 11 or 12 above, conjugated S. pneumoniae saccharides from serotype 9N. 14. In another embodiment the vaccine of the invention comprises in addition to point 1, 2, 3, 4, 5, 6, 7, 8, 9, 11, 12 or 13 above, conjugated S. pneumoniae saccharides from serotype 10A. 15.
  • the vaccine of the invention comprises in addition to point 1, 2, 3, 4, 5, 6, 7, 8, 9, 11, 12, 13 or 14 above, conjugated S. pneumoniae saccharides from serotype 11A. 16. In another embodiment the vaccine of the invention comprises in addition to point 1, 2, 3, 4, 5, 6, 7, 8, 9, 11, 12, 13, 14, or 15 above, conjugated S. pneumoniae saccharides from serotype 11A. 17. In another embodiment the vaccine of the invention comprises in addition to point 1, 2, 3, 4, 5, 6, 7, 8, 9, 11, 12, 13, 14, 15 or 16 above, conjugated S. pneumoniae saccharides from serotype 17F. 18. In another embodiment the vaccine of the invention comprises in addition to point 1, 2, 3, 4, 5, 6, 7, 8, 9, 11, 12, 13, 14, 15, 16 or 17 above, conjugated S. pneumoniae saccharides from serotype 20. 19. In another embodiment the vaccine of the invention comprises in addition to point 1, 2, 3, 4, 5, 6, 7, 8, 9, 11, 12, 13, 14, 15, 16, 17 or 18 above, conjugated S. pneumoniae saccharides from serotype 33F.
  • the vaccine of the invention comprises conjugated S. pneumoniae saccharides from serotypes 4, 6B, 9V, 14, 18C, 19F and. 23F.
  • the vaccine of the invention comprises conjugated S. pneumoniae saccharides from serotypes 1, 3, 4, 5, 6A, 6B, 7F, 9V, 14, 18C, 19A, 19F and. 23F
  • the vaccine of the invention comprises conjugated S. pneumoniae saccharides from serotypes 1, 4, 5, 6B, 7F, 9V, 14, 18C, 19F and. 23F.
  • the vaccine of the invention comprises conjugated S. pneumoniae saccharides from serotypes 1, 3, 4, 5, 6B, 7F, 9V, 14, 18C, 19F and 23F.
  • the capsular saccharide antigens are conjugated to a carrier protein independently selected from the group consisting of TT, DT, CRM197, fragment C of TT, PhtD, PhtDE fusions (particularly those described in WO 01/98334 and WO 03/54007), detoxified pneumolysin and protein D.
  • a carrier protein independently selected from the group consisting of TT, DT, CRM197, fragment C of TT, PhtD, PhtDE fusions (particularly those described in WO 01/98334 and WO 03/54007), detoxified pneumolysin and protein D.
  • the capsular saccharide antigens are conjugated to a carrier proteins which is selected in the group consisting of: DT (Diphtheria toxin), TT (tetanus toxid) or fragment C of TT, CRM197 (a nontoxic but antigenically identical variant of diphtheria toxin) other DT point mutants, such as CRM176, CRM228, CRM 45 (Uchida et al J. Biol. Chem.
  • meningitidis serogroup B EP0372501
  • PorB from N. meningitidis
  • PD Haemophilus influenzae protein D—see, e.g., EP 0 594 610 B), or immunologically functional equivalents thereof, synthetic peptides (EP0378881, EP0427347), heat shock proteins (WO 93/17712, WO 94/03208), pertussis proteins (WO 98/58668, EP0471 177), cytokines, lymphokines, growth factors or hormones (WO 91/01146), artificial proteins comprising multiple human CD4+ T cell epitopes from various pathogen derived antigens (Falugi et al (2001) Eur J Immunol 31; 3816-3824) such as N19 protein (Baraldoi et al (2004) Infect Immun 72; 4884-7) pneumococcal surface protein PspA (WO 02/091998), iron uptake proteins (WO 01/72337), toxin A or B of C.
  • the capsular saccharide antigens are conjugated to DT (Diphtheria toxoid). In another embodiment, the capsular saccharide antigens are conjugated to TT (tetanus toxid).
  • the capsular saccharide antigens are conjugated to fragment C of TT.
  • the capsular saccharide antigens are conjugated to PD ( Haemophilus influenzae protein D—see, e.g., EP 0 594 610 B).
  • the capsular saccharide antigens of the invention are conjugated to CRM197 protein.
  • the CRM197 protein is a nontoxic form of diphtheria toxin but is immunologically indistinguishable from the diphtheria toxin.
  • CRM197 is produced by C. diphtheriae infected by the nontoxigenic phage ⁇ 197 tox- created by nitrosoguanidine mutagenesis of the toxigenic corynephage beta (Uchida, T. et al. 1971, Nature New Biology 233:8-11).
  • the CRM197 protein has the same molecular weight as the diphtheria toxin but differs therefrom by a single base change (guanine to adenine) in the structural gene.
  • CRM197 protein is a safe and effective T-cell dependent carrier for saccharides. Further details about CMR197 and production thereof can be found e.g. in U.S. Pat. No. 5,614,382.
  • the saccharides could be conjugated to the same molecule of the protein carrier (carrier molecules having 2 more different saccharides conjugated to it) [see for instance WO 04/083251].
  • the saccharides may each be individually conjugated to different molecules of the protein carrier (each molecule of protein carrier only having one type of saccharide conjugated to it).
  • the capsular saccharides are said to be individually conjugated to the carrier protein.
  • the capsular saccharide antigens of the present invention are from different S. pneumoniae serotypes and are conjugated to one or more carrier protein.
  • the vaccine of the invention comprises 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22 or 23 different serotypes capsular saccharide conjugates in which CRM197 is the carrier protein.
  • the vaccine of the invention comprises 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22 or 23 different serotypes capsular saccharide conjugates in which protein D is the carrier protein.
  • saccharide from serotype 1, 2, 3, 4, 5, 6B, 7F, 8, 9N, 9V, 10A, 11A, 12F, 14, 15B, 17F, 18C, 19A, 19F, 20, 22F, 23F or 33F is conjugated to protein D.
  • saccharide from serotype 1, 2, 3, 4, 5, 6B, 7F, 8, 9N, 9V, 10A, 11A, 12F, 14, 15B, 17F, 18C, 19A, 19F, 20, 22F, 23F or 33F is conjugated to CRM197.
  • saccharides from at least serotypes 1, 3 and 4; 1, 3 and 5; 1, 3 and 6A; 1, 3 and 6B; 1, 3 and 7F; 1, 3 and 9V; 1, 3 and 14; 3, 4 and 7F; 3, 4 and 5; 3, 4 and 7F; 3, 4 and 9V; 3, 4 and 14; 4, 5 and 7F; 4, 5 and 9V; 4, 5, and 14; 5, 7F and 9V; 5, 7F and 14; 7F, 9V and 14; 1, 3, 4 and 5; 3, 4, 5 and 7F; 4, 5, 7F and 9V; 4, 5, 7F and 14; 4, 5, 9V and 14; 4, 7F, 9V and 14; 5, 7F, 9V and 14; or 4, 5, 7F, 9V and 14 are conjugated to CRM197.
  • saccharides from at least serotypes 1, 3 and 4; 1, 3 and 5; 1, 3 and 6A; 1, 3 and 6B; 1, 3 and 7F; 1, 3 and 9V; 1, 3 and 14; 3, 4 and 7F; 3, 4 and 5; 3, 4 and 7F; 3, 4 and 9V; 3, 4 and 14; 4, 5 and 7F; 4, 5 and 9V; 4, 5, and 14; 5, 7F and 9V; 5, 7F and 14; 7F, 9V and 14; 1, 3, 4 and 5; 3, 4, 5 and 7F; 4, 5, 7F and 9V; 4, 5, 7F and 14; 4, 5, 9V and 14; 4, 7F, 9V and 14; 5, 7F, 9V and 14; or 4, 5, 7F, 9V and 14 are conjugated to protein D.
  • the vaccine of the invention comprises 7 different serotypes capsular saccharide conjugates in which CRM197 is the carrier protein.
  • the vaccine of the invention comprises 7 different serotypes capsular saccharide conjugates in which protein D is the carrier protein.
  • the vaccine of the invention comprises 10 different serotypes capsular saccharide conjugates in which CRM197 is the carrier protein.
  • the vaccine of the invention comprises 10 different serotypes capsular saccharide conjugates in which protein D is the carrier protein.
  • the vaccine of the invention comprises 11 different serotypes capsular saccharide conjugates in which CRM197 is the carrier protein.
  • the vaccine of the invention comprises 11 different serotypes capsular saccharide conjugates in which protein D is the carrier protein.
  • the vaccine of the invention comprises 13 different serotypes capsular saccharide conjugates in which CRM197 is the carrier protein.
  • the vaccine of the invention comprises 13 different serotypes capsular saccharide conjugates in which protein D is the carrier protein.
  • the vaccine of the invention comprises 23 different serotypes capsular saccharide conjugates in which CRM197 is the carrier protein.
  • the vaccine of the invention comprises 23 different serotypes capsular saccharide conjugates in which protein D is the carrier protein.
  • the vaccine of the invention comprises saccharide from serotypes 4, 6B, 9V, 14, 18C, 19F and. 23F conjugated to protein D.
  • the vaccine of the invention comprises saccharide from serotypes 4, 6B, 9V, 14, 18C, 19F and. 23F conjugated to CRM197.
  • the vaccine of the invention comprises saccharide from serotypes 1, 3, 4, 5, 6A, 6B, 7F, 9V, 14, 18C, 19A, 19F and 23F conjugated to protein D.
  • the vaccine of the invention comprises saccharide from serotypes 1, 3, 4, 5, 6A, 6B, 7F, 9V, 14, 18C, 19A, 19F and 23F conjugated to CRM197.
  • the vaccine of the invention comprises saccharide from serotypes 1, 4, 5, 6B, 7F, 9V, 14, 18C, 19F and. 23F conjugated to protein D.
  • the vaccine of the invention comprises saccharide from serotypes 1, 4, 5, 6B, 7F, 9V, 14, 18C, 19F and. 23F conjugated to CRM197.
  • the vaccine of the invention comprises saccharide from serotypes 1, 3, 4, 5, 6B, 7F, 9V, 14, 18C, 19F and 23F conjugated to protein D.
  • the vaccine of the invention comprises saccharide from serotypes 1, 3, 4, 5, 6B, 7F, 9V, 14, 18C, 19F and 23F conjugated to CRM197.
  • the vaccine of the invention comprises saccharide from serotype 1, 2, 3, 4, 5, 6B, 7F, 8, 9N, 9V, 10A, 11A, 12F, 14, 15B, 17F, 18C, 19A, 19F, 20, 22F, 23F and 33F conjugated to protein D.
  • the vaccine of the invention comprises saccharide from serotypes 1, 2, 3, 4, 5, 6B, 7F, 8, 9N, 9V, 10A, 11A, 12F, 14, 15B, 17F, 18C, 19A, 19F, 20, 22F, 23F and 33F conjugated to CRM197.
  • the vaccine of the invention comprises saccharide from serotypes 1, 4, 5, 6B, 7F, 9V, 14, and 23F conjugated to protein D, saccharide from serotype 18C conjugated to tetanus toxoid (TT) and saccharide from serotype 19F conjugated to diphtheria toxoid (DT).
  • the vaccine of the invention comprises saccharide from serotypes 1, 4, 5, 7F, 9V, 19F and 23F conjugated to tetanus toxoid (TT) and saccharide from serotypes 3, 14 18C and 6B conjugated to diphtheria toxoid (DT).
  • TT tetanus toxoid
  • DT diphtheria toxoid
  • the vaccine of the invention comprises saccharide from serotypes 1, 4, 5, 6B, 7F, 9V, 14, and 23F individually conjugated to protein D, saccharide from serotype 18C conjugated to tetanus toxoid (TT) and saccharide from serotype 19F conjugated to diphtheria toxoid (DT).
  • the vaccine of the invention comprises saccharide from serotypes 1, 4, 5, 7F, 9V, 19F and 23F individually conjugated to tetanus toxoid (TT) and saccharide from serotypes 3, 14 18C and 6B conjugated to diphtheria toxoid (DT).
  • TT tetanus toxoid
  • DT diphtheria toxoid
  • saccharide throughout this specification may indicate polysaccharide or oligosaccharide and includes both.
  • Capsular polysaccharides of Streptococcus pneumoniae comprise repeating oligosaccharide units which may contain up to 8 sugar residues.
  • oligosaccharide units for the key Streptococcus pneumoniae serotypes see JONES, Christopher. Vaccines based on the cell surface carbohydrates of pathogenic bacteria. An. Acad. Bras. Cienc, June 2005, vol. 77, no. 2, p. 293-324. Table II ISSN 0001-3765.
  • Capsular saccharide antigens of the invention are prepared by standard techniques known to those skilled in the art. Typically polysaccharides conjugates are prepared by separate processes and formulated into a single dosage formulation. For example, in one embodiment, each pneumococcal polysaccharide serotype is grown in a soy-based medium. The individual polysaccharides are then purified through centrifugation, precipitation, ultra-filtration, and column chromatography. The purified polysaccharides are chemically activated to make the saccharides capable of reacting with the carrier protein. Once activated, each capsular polysaccharide is separately conjugated to a carrier protein to form a glycoconjugate. In one embodiment, each capsular polysaccharide is conjugated to the same carrier protein.
  • the conjugation is effected by reductive amination.
  • the chemical activation of the polysaccharides and subsequent conjugation to the carrier protein are achieved by conventional means. See, for example, U.S. Pat. Nos. 4,673,574 and 4,902,506.
  • the polysaccharide-protein conjugates are purified (enriched with respect to the amount of polysaccharide-protein conjugate) by a variety of techniques. These techniques include concentration/diafiltration operations, precipitation/elution, column chromatography, and depth filtration. See for examples US2007/0184072 or WO2008/079653.
  • the individual glycoconjugates are purified, they are compounded to formulate the vaccine of the present invention.
  • Formulation of the immunogenic composition of the present invention can be accomplished using art-recognized methods.
  • the individual pneumococcal conjugates can be formulated with a physiologically acceptable vehicle to prepare the composition. Examples of such vehicles include, but are not limited to, water, buffered saline, polyols (e.g., glycerol, propylene glycol, liquid polyethylene glycol) and dextrose solutions.
  • each vaccine dose comprises 0.1 to 1000 ⁇ g of each saccharide or saccharide—protein conjugate, preferably 2 to 100 ⁇ g, most preferably 4 to 40 ⁇ g.
  • each dose comprises between 0.1 and 20 ⁇ g, 1 and 10 ⁇ g or 1 and 5 ⁇ g of saccharide.
  • the vaccine of the invention contains each S. pneumoniae capsular saccharide at a dose of between 0.1-20 ⁇ g, 0.5-10 ⁇ g; 0.5-5 ⁇ g or 1-5 ⁇ g of saccharide.
  • capsular saccharides may be present at different dosages, for example some capsular saccharides may be present at a dose of around or exactly 2 ⁇ g or some capsular saccharides may be present at a dose of around or exactly 4 ⁇ g.
  • the vaccine contains saccharide from serotypes 4, 6B, 9V, 14, 18C, 19F and. 23F individually conjugated to CRM197 wherein each S. pneumoniae capsular saccharide is at a dose of 2 ⁇ g except for 6B which is at a dose of 4 ⁇ g.
  • the vaccine contains saccharide from serotypes 4, 6B, 9V, 14, 18C, 19F and. 23F individually conjugated to CRM197 wherein each S. pneumoniae capsular saccharide is at a dose of 4 ⁇ g except for 6B which is at a dose of 8 ⁇ g.
  • the vaccine contains saccharide from serotypes 4, 6B, 9V, 14, 18C, 19F and. 23F individually conjugated to CRM197 wherein each S. pneumoniae capsular saccharide is at a dose of 6 ⁇ g except for 6B which is at a dose of 12 ⁇ g.
  • the vaccine contains saccharide from serotypes 4, 6B, 9V, 14, 18C, 19F and. 23F individually conjugated to CRM197 wherein each S. pneumoniae capsular saccharide is at a dose of 8 ⁇ g except for 6B which is at a dose of 16 ⁇ g.
  • the vaccine contains saccharide from serotypes 1, 3, 4, 5, 6A, 6B, 7F, 9V, 14, 18C, 19A, 19F, and 23F individually conjugated to CRM197 wherein each S. pneumoniae capsular saccharide is at a dose of 2 ⁇ g except for 6B which is at a dose of 4 ⁇ g.
  • the vaccine contains saccharide from serotypes 1, 3, 4, 5, 6A, 6B, 7F, 9V, 14, 18C, 19A, 19F, and 23F individually conjugated to CRM197 wherein each S. pneumoniae capsular saccharide is at a dose of 4 ⁇ g except for 6B which is at a dose of 8 ⁇ g.
  • the vaccine contains saccharide from serotypes 1, 3, 4, 5, 6A, 6B, 7F, 9V, 14, 18C, 19A, 19F, and 23F individually conjugated to CRM197 wherein each S. pneumoniae capsular saccharide is at a dose of 6 ⁇ g except for 6B which is at a dose of 12 ⁇ g.
  • the vaccine contains saccharide from serotypes 1, 3, 4, 5, 6A, 6B, 7F, 9V, 14, 18C, 19A, 19F, and 23F individually conjugated to CRM197 wherein each S. pneumoniae capsular saccharide is at a dose of 8 ⁇ g except for 6B which is at a dose of 16 ⁇ g.
  • the vaccine disclosed herein contain from 5 to 500 ⁇ g, preferably 10 to 200 ⁇ g, even more preferably, 20 to 100 ⁇ g of CRM197 carrier protein.
  • the vaccine disclosed herein contain 20 to 50 ⁇ g, preferably 20 to 40 ⁇ g, even more preferably 25 to 30 ⁇ g, even more preferably approximately 28 or 29 ⁇ g of CRM197 carrier protein.
  • the vaccine disclosed herein contain 40 to 100 ⁇ g, preferably 40 to 80 ⁇ g, even more preferably 50 to 60 ⁇ g, even more preferably approximately 57 or 58 ⁇ g of CRM197 carrier protein.
  • the vaccine disclosed herein contain sodium chloride and/or sodium succinate buffer as excipients.
  • the pneumococcal vaccine to be used herein is the 7-valent conjugated pneumococcal vaccine (Prevenar) or the 13-valent conjugated pneumococcal vaccine disclosed in US2007/0184072-Prevenar 13).
  • 7-valent Prevenar contains saccharide from serotypes 4, 6B, 9V, 14, 18C, 19F and. 23F individually conjugated to CRM197.
  • 13-valent Prevenar contains saccharide from serotypes 1, 3, 4, 5, 6A, 6B, 7F, 9V, 14, 18C, 19A, 19F, and 23F individually conjugated to CRM197.
  • the vaccine of the invention comprises saccharide from serotypes 1, 4, 5, 6B, 7F, 9V, 14, and 23F individually conjugated to protein D, saccharide from serotype 18C conjugated to tetanus toxoid (TT) and saccharide from serotype 19F conjugated to diphtheria toxoid (DT) wherein each S. pneumoniae capsular saccharide is at a dose of 1 ⁇ g except for 4, 18C and 19F which is at a dose of 3 ⁇ g.
  • said vaccine contains from 5 to 500 ⁇ g, preferably 7 to 100 ⁇ g of protein D carrier protein, from 2 to 200 ⁇ g, preferably 4 to 50 ⁇ g of tetanus toxoid (TT) carrier protein and from 1 to 100 ⁇ g, preferably 2 to 25 ⁇ g of diphtheria toxoid (DT) carrier protein.
  • said vaccine contains from 9 to 16 ⁇ g of protein D carrier protein, from 5 to 10 ⁇ g tetanus toxoid (TT) carrier protein and from 3 to 6 ⁇ g diphtheria toxoid (DT) carrier protein.
  • the vaccine of the invention comprises saccharide from serotypes 1, 4, 5, 6B, 7F, 9V, 14, and 23F individually conjugated to protein D, saccharide from serotype 18C conjugated to tetanus toxoid (TT) and saccharide from serotype 19F conjugated to diphtheria toxoid (DT) wherein each S. pneumoniae capsular saccharide is at a dose of 2 ⁇ g except for 4, 18C and 19F which is at a dose of 6 ⁇ g.
  • said vaccine contains from 10 to 1000 ⁇ g, preferably 14 to 200 ⁇ g of protein D carrier protein, from 4 to 400 ⁇ g, preferably 8 to 100 ⁇ g of tetanus toxoid (TT) carrier protein and from 2 to 200 ⁇ g, preferably 4 to 50 ⁇ g of diphtheria toxoid (DT) carrier protein.
  • said vaccine contains from 18 to 32 ⁇ g of protein D carrier protein, from 10 to 20 ⁇ g tetanus toxoid (TT) carrier protein and from 6 to 12 ⁇ g diphtheria toxoid (DT) carrier protein.
  • the vaccine of the invention comprises saccharide from serotypes 1, 4, 5, 6B, 7F, 9V, 14, and 23F individually conjugated to protein D, saccharide from serotype 18C conjugated to tetanus toxoid (TT) and saccharide from serotype 19F conjugated to diphtheria toxoid (DT) wherein each S. pneumoniae capsular saccharide is at a dose of 3 ⁇ g except for 4, 18C and 19F which is at a dose of 9 ⁇ g.
  • said vaccine contains from 15 to 1500 ⁇ g, preferably 21 to 300 ⁇ g of protein D carrier protein, from 6 to 600 ⁇ g, preferably 12 to 150 ⁇ g of tetanus toxoid (TT) carrier protein and from 3 to 300 ⁇ g, preferably 6 to 75 ⁇ g of diphtheria toxoid (DT) carrier protein.
  • said vaccine contains from 27 to 48 ⁇ g of protein D carrier protein, from 15 to 30 ⁇ g tetanus toxoid (TT) carrier protein and from 9 to 18 ⁇ g diphtheria toxoid (DT) carrier protein.
  • the vaccine of the invention comprises saccharide from serotypes 1, 4, 5, 6B, 7F, 9V, 14, and 23F individually conjugated to protein D, saccharide from serotype 18C conjugated to tetanus toxoid (TT) and saccharide from serotype 19F conjugated to diphtheria toxoid (DT) wherein each S. pneumoniae capsular saccharide is at a dose of 4 ⁇ g except for 4, 18C and 19F which is at a dose of 12 ⁇ g.
  • said vaccine contains from 20 to 2000 ⁇ g, preferably 28 to 400 ⁇ g of protein D carrier protein, from 8 to 800 ⁇ g, preferably 16 to 200 ⁇ g of tetanus toxoid (TT) carrier protein and from 4 to 400 ⁇ g, preferably 8 to 100 ⁇ g of diphtheria toxoid (DT) carrier protein.
  • said vaccine contains from 36 to 64 ⁇ g of protein D carrier protein, from 20 to 40 ⁇ g tetanus toxoid (TT) carrier protein and from 12 to 24 ⁇ g diphtheria toxoid (DT) carrier protein.
  • the vaccine disclosed herein contain sodium chloride buffer as excipients.
  • the pneumococcal vaccine to be used herein is the 10-valent conjugated pneumococcal vaccine sold under the commercial name SynflorixTM.
  • the pneumococcal vaccines as disclosed herein comprise at least one, two or three adjuvant in addition to the at least one TLR-9 agonist adjuvant disclosed herein.
  • adjuvant refers to a compound or mixture that enhances the immune response to an antigen. Antigens may act primarily as a delivery system, primarily as an immune modulator or have strong features of both. Suitable adjuvants include those suitable for use in mammals, including humans.
  • alum e.g., aluminum phosphate, aluminum sulfate or aluminum hydroxide
  • calcium phosphate e.g., calcium phosphate
  • liposomes e.g., calcium phosphate, liposomes
  • oil-in-water emulsions such as MF59 (4.3% w/v squalene, 0.5% w/v polysorbate 80 (Tween 80), 0.5% w/v sorbitan trioleate (Span 85)
  • water-in-oil emulsions such as Montanide
  • PLG poly(D,L-lactide-co-glycolide)
  • Suitable immune modulatory type adjuvants that can be used in humans include, but are not limited to saponins extracts from the bark of the Aquilla tree (QS21, Quil A), TLR4 agonists such as MPL (Monophosphoryl Lipid A), 3DMPL (3-O-deacylated MPL) or GLA-AQ, LT/CT mutants, cytokines such as the various interleukins (e.g., IL-2, IL-12) or GM-CSF, and the like.
  • saponins extracts from the bark of the Aquilla tree QS21, Quil A
  • TLR4 agonists such as MPL (Monophosphoryl Lipid A), 3DMPL (3-O-deacylated MPL) or GLA-AQ
  • LT/CT mutants LT/CT mutants
  • cytokines such as the various interleukins (e.g., IL-2, IL-12) or GM-CSF, and the like.
  • ISCOMS see, e.g., Sjölander et al. (1998) J. Leukocyte Biol. 64:713; WO90/03184, WO96/11711, WO 00/48630, WO98/36772, WO00/41720, WO06/134423 and WO07/026,190
  • GLA-EM which is a combination of a TLR4 agonist and an oil-in-water emulsion.
  • CFA Complete Freund's Adjuvant
  • IFA Incomplete Adjuvant
  • Emulsigen N-acetyl-muramyl-L-threonyl-D-isoglutamine
  • thr-MDP N-acetyl-nor-muramyl-L-alanyl-D-isoglutamine
  • nor-MDP N-acetylmuramyl-L-alanyl-D-isoglutaminyl-L-alanine-2-(1′-2′-dipalmitoyl-sn-glycero-3-hydroxyphosphoryloxy)-ethylamine
  • CGP 19835A referred to as MTP-PE
  • RIBI which contains three components extracted from bacteria, monophosphoryl lipid A, trehalose dimycolate and cell wall skeleton (MPL+TDM+CWS) in a 2%
  • adjuvants to enhance effectiveness of the pneumococcal vaccines as disclosed herein include, but are not limited to: (1) oil-in-water emulsion formulations (with or without other specific immunostimulating agents such as muramyl peptides (see below) or bacterial cell wall components), such as for example (a) SAF, containing 10% Squalane, 0.4% Tween 80, 5% pluronic-blocked polymer L121, and thr-MDP either microfluidized into a submicron emulsion or vortexed to generate a larger particle size emulsion, and (b) RIBITM adjuvant system (RAS), (Ribi Immunochem, Hamilton, Mont.) containing 2% Squalene, 0.2% Tween 80, and one or more bacterial cell wall components such as monophosphorylipid A (MPL), trehalose dimycolate (TDM), and cell wall skeleton (CWS), preferably MPL+CWS (DETOXTM); (2) sapon
  • cytokines such as interleukins (e.g. IL-1, IL-2, IL-4, IL-5, IL-6, IL-7, IL-12 (WO99/44636), etc.), interferons (e.g.
  • MPL monophosphoryl lipid A
  • 3dMPL 3-O-deacylated MPL
  • a CpG oligonucleotide (WO00/62800); (10) an immunostimulant and a particle of metal salt (see e.g. WO00/23105); (11) a saponin and an oil-in-water emulsion e.g. WO99/11241; (12) a saponin (e.g. QS21)+3dMPL+IM2 (optionally+a sterol) e.g. WO98/57659; (13) other substances that act as immunostimulating agents to enhance the efficacy of the composition.
  • Muramyl peptides include N-acetyl-muramyl-L-threonyl-D-isoglutamine (thr-MDP), N-25 acetyl-normnuramyl-L-alanyl-D-isoglutamine (nor-MDP), N-acetylmuramyl-L-alanyl-D-isoglutaminyl-L-alanine-2-(1′-2′-dipalmitoyl-sn-glycero-3-hydroxyphosphoryloxy)-ethylamine MTP-PE), etc.
  • thr-MDP N-acetyl-muramyl-L-threonyl-D-isoglutamine
  • nor-MDP N-25 acetyl-normnuramyl-L-alanyl-D-isoglutamine
  • the pneumococcal vaccines as disclosed herein comprise alum, aluminium hydroxide, aluminum phosphate, or aluminum sulphate as additional adjuvant to the at least one TLR-9 agonist adjuvant disclosed herein.
  • the vaccine contains saccharide from serotypes 4, 6B, 9V, 14, 18C, 19F and 23F individually conjugated to CRM197 wherein each S. pneumoniae capsular saccharide is at a dose of 2 ⁇ g except for 6B which is at a dose of 4 ⁇ g, further comprising 0.5 mg aluminum phosphate, and optionally sodium chloride and sodium succinate buffer as excipients.
  • the vaccine contains saccharide from serotypes 4, 6B, 9V, 14, 18C, 19F and 23F individually conjugated to CRM197 wherein each S. pneumoniae capsular saccharide is at a dose of 4 ⁇ g except for 6B which is at a dose of 8 ⁇ g, further comprising 1 mg aluminum phosphate, and optionally sodium chloride and sodium succinate buffer as excipients.
  • the vaccine contains saccharide from serotypes 4, 6B, 9V, 14, 18C, 19F and 23F individually conjugated to CRM197 wherein each S. pneumoniae capsular saccharide is at a dose of 6 ⁇ g except for 6B which is at a dose of 12 ⁇ g, further comprising 1.5 mg aluminum phosphate, and optionally sodium chloride and sodium succinate buffer as excipients.
  • the vaccine contains saccharide from serotypes 4, 6B, 9V, 14, 18C, 19F and 23F individually conjugated to CRM197 wherein each S. pneumoniae capsular saccharide is at a dose of 8 ⁇ g except for 6B which is at a dose of 16 ⁇ g, further comprising 2 mg aluminum phosphate, and optionally sodium chloride and sodium succinate buffer as excipients.
  • the vaccine contains saccharide from serotypes 1, 3, 4, 5, 6A, 6B, 7F, 9V, 14, 18C, 19A, 19F, and 23F individually conjugated to CRM197 wherein each S. pneumoniae capsular saccharide is at a dose of 2 ⁇ g except for 6B which is at a dose of 4 ⁇ g further comprising 0.5 mg aluminum phosphate, and optionally sodium chloride and sodium succinate buffer as excipients.
  • the vaccine contains saccharide from serotypes 1, 3, 4, 5, 6A, 6B, 7F, 9V, 14, 18C, 19A, 19F, and 23F individually conjugated to CRM197 wherein each S. pneumoniae capsular saccharide is at a dose of 4 ⁇ g except for 6B which is at a dose of 8 ⁇ g further comprising 1 mg aluminum phosphate, and optionally sodium chloride and sodium succinate buffer as excipients.
  • the vaccine contains saccharide from serotypes 1, 3, 4, 5, 6A, 6B, 7F, 9V, 14, 18C, 19A, 19F, and 23F individually conjugated to CRM197 wherein each S. pneumoniae capsular saccharide is at a dose of 6 ⁇ g except for 6B which is at a dose of 12 ⁇ g further comprising 1.5 mg aluminum phosphate, and optionally sodium chloride and sodium succinate buffer as excipients.
  • the vaccine contains saccharide from serotypes 1, 3, 4, 5, 6A, 6B, 7F, 9V, 14, 18C, 19A, 19F, and 23F individually conjugated to CRM197 wherein each S. pneumoniae capsular saccharide is at a dose of 8 ⁇ g except for 6B which is at a dose of 16 ⁇ g further comprising 1.5 mg aluminum phosphate, and optionally sodium chloride and sodium succinate buffer as excipients.
  • the pneumococcal vaccine is the 7-valent conjugated pneumococcal vaccine (Prevenar) or the 13-valent conjugated pneumococcal vaccine as disclosed in US2007/0184072 (13vPnC).
  • the subject to be vaccinated with the vaccines of the present invention is an immunocompromised subject.
  • said immunocompromised subject is a mammal, such as a cat, sheep, pig, horse, bovine, dog or a human.
  • said subject is a human.
  • An immunocompromised individual is generally defined as a person who exhibits an attenuated or reduced ability to mount a normal humoral or cellular defense to challenge by infectious agents.
  • the immunocompromised subject to be vaccinated with the pneumococcal vaccine suffers from a disease or condition that impairs the immune system and results in an antibody response that is insufficient to protect against or treat pneumococcal disease.
  • said disease is a primary immunodeficiency disorder.
  • said primary immunodeficiency disorder is selected from the group consisting of: combined T- and B-cell immunodeficiencies, antibody deficiencies, well-defined syndromes, immune dysregulation diseases, phagocyte disorders, innate immunity deficiencies, autoinflammatory disorders, and complement deficiencies.
  • said combined T- and B-cell immunodeficiency is selected from the group consisting of: ⁇ e deficiency, JAK3 deficiency, interleukin 7 receptor chain ⁇ deficiency, CD45 deficiency or CD3 ⁇ /CD3 ⁇ deficiency, RAG 1/2 deficiency, DCLRE1C deficiency, adenosine deaminase (ADA) deficiency, reticular dysgenesis, Omenn syndrome, DNA ligase type IV deficiency, CD40 ligand deficiency, CD40 deficiency, Purine nucleoside phosphorylase (PNP) deficiency, MHC class II deficiency, CD3 ⁇ deficiency, CD8 deficiency, ZAP-70 deficiency, TAP-1/2 deficiency and Winged helix deficiency.
  • PNP Purine nucleoside phosphorylase
  • said antibody deficiencies is selected from the group consisting of: X-linked agammaglobulinemia, btk deficiency, Bruton's agammaglobulinemia, ⁇ -Heavy chain deficiency, I 5 deficiency, Ig ⁇ deficiency, BLNK deficiency, thymoma with immunodeficiency, common variable immunodeficiency (CVID), ICOS deficiency, CD19 deficiency, TACI (TNFRSF13B) deficiency, BAFF receptor deficiency, AID deficiency, UNG deficiency, heavy chain deletions, kappa chain deficiency, isolated IgG subclass deficiency, IgA with IgG subsclass deficiency, selective immunoglobulin A deficiency, specific antibody deficiency to specific antigens with normal B cell and normal Ig concentrations, transient hypogammaglobulinemia of infancy (THI
  • said well-defined syndrome is selected from the group consisting of: Wiskott-Aldrich syndrome, ataxia telangiectasia, ataxia-like syndrome, Nijmegen breakage syndrome, Bloom syndrome, DiGeorge syndrome (when associated with thymic defects), cartilage-hair hypoplasia, Schimke syndrome, Hermansky-Pudlak syndrome type 2, Hyper-IgE syndrome, Chronic mucocutaneous candidiasis,
  • said immune dysregulation disease is selected from the group consisting of: Chediak-Higashi syndrome, Griscelli syndrome type 2, perforin deficiency, MUNC13D deficiency, syntaxin 11 deficiency, X-linked lymphoproliferative syndrome, autoimmune lymphoproliferative syndrome: such as type 1a (CD95 defects), type 1b (Fas ligand defects), type 2a (CASP10 defects), type 2b (CASP8 defects), APECED (autoimmune polyendocrinopathy with candidiasis and ectodermal dystrophy) and IPEX (immunodysregulation polyendocrinopathy enteropathy X-linked syndrome)
  • said phagocyte disorder is selected from the group consisting of: ELA2 deficiency (with myelodysplasia), GFI1 deficiency (with T/B lymphopenia), G-CSFR deficiency (G-CSF-unresponsive), Kostmann syndrome, Cyclic neutropenia, X-linked neutropenia/myelodysplasia, Leukocyte adhesion deficiency types 1, 2 and 3, RAC2 deficiency, Beta-actin deficiency, Localized juvenile periodontitis, Papillon-Lefsky syndrome, Specific granule deficiency, Shwachman-Diamond syndrome, Chronic granulomatous disease: X-linked and autosomal forms, Neutrophil glucose-6-phosphate dehydrogenase deficiency, IL-12 and IL-23 ⁇ 1 chain deficiency, IL-12p40 deficiency, Interferon ⁇ receptor 1 deficiency, Interferon ⁇ receptor 2 defici
  • said innate immunity deficiency is selected from the group consisting of: Hypohidrotic ectodermal dysplasia, NEMO deficiency, IKBA deficiency, IRAK-4 deficiency, WHIM syndrome (warts, hypogammaglobulinaemia, infections, myleokathexis) and Epidermodysplasia verruciform is.
  • said autoinflammatory disorder is selected from the group consisting of: Familial Mediterranean fever, TNF receptor associated periodic syndrome (TRAPS), Hyper-IgD syndrome (HIDS), CIAS1-related diseases, Muckle-Wells syndrome, Familial cold autoinflammatory syndrome, Neonatal onset multisystem inflammatory disease, PAPA syndrome (pyogenic sterile arthritis, pyoderma gangrenosum, acne) and Blau syndrome.
  • TRAPS TNF receptor associated periodic syndrome
  • HIDS Hyper-IgD syndrome
  • CIAS1-related diseases CIAS1-related diseases
  • Muckle-Wells syndrome Familial cold autoinflammatory syndrome
  • Neonatal onset multisystem inflammatory disease PAPA syndrome (pyogenic sterile arthritis, pyoderma gangrenosum, acne) and Blau syndrome.
  • said complement deficiency is selected from the group consisting of: C1q deficiency (lupus-like syndrome, rheumatoid disease, infections), C1r deficiency (idem), C4 deficiency (idem), C2 deficiency (lupus-like syndrome, vasculitis, polymyositis, pyogenic infections), C3 deficiency (recurrent pyogenic infections), C5 deficiency (Neisserial infections, SLE), C6 deficiency (idem), C7 deficiency (idem, vasculitis), C8a and C8b deficiency (idem), C9 deficiency (Neisserial infections), C1-inhibitor deficiency (hereditary angioedema), Factor I deficiency (pyogenic infections), Factor H deficiency (haemolytic-uraemic syndrome, membranoproliferative glomerulonephritis), Factor
  • the immunocompromised subject to be vaccinated suffers from a disease that affects the immune system wherein said disease is an acquired immunodeficiency disorder.
  • Acquired immunodeficiency can be caused by several factors including bacterial or viral infections (such as HIV), cancers (such as leukaemia or myeloma), other chronic disorder but also aging, malnutrition, or various (such as glucocorticoids, chemotherapydrug treatments
  • the immunocompromised subject to be vaccinated suffers from a disease selected from the groups consisting of: HIV-infection, acquired immunodeficiency syndrome (AIDS), cancer, chronic heart or lung disorders, congestive heart failure, diabetes mellitus, chronic liver disease, alcoholism, cirrhosis, spinal fluid leaks, cardiomyopathy, chronic bronchitis, emphysema, Chronic obstructive pulmonary disease (COPD), spleen dysfunction (such as sickle cell disease), lack of spleen function (asplenia), blood malignancy, leukemia, multiple myeloma, Hodgkin's disease, lymphoma, kidney failure, nephrotic syndrome and asthma.
  • AIDS acquired immunodeficiency syndrome
  • the immunocompromised subject to be vaccinated suffers from a disease selected from the groups consisting of: spleen dysfunction (such as sickle cell disease), lack of spleen function (asplenia), leukemia, multiple myeloma, Hodgkin's disease and lymphoma.
  • spleen dysfunction such as sickle cell disease
  • asplenia lack of spleen function
  • leukemia multiple myeloma
  • Hodgkin's disease lymphoma.
  • the immunocompromised subject to be vaccinated suffers from HIV-infection or acquired immunodeficiency syndrome (AIDS).
  • HIV-infection or acquired immunodeficiency syndrome (AIDS) HIV-infection or acquired immunodeficiency syndrome
  • the immunocompromised subject to be vaccinated suffers from HIV-infection or acquired immunodeficiency syndrome (AIDS), and is under therapy, said therapy consisting of taking at least one antiretroviral drug selected from the group consisting of a non-nucleosied reverse transcriptase inhibitor, a protease inhibitor and a nucleoside analog reverse transcriptase inhibitor (e.g. abacavir).
  • said therapy consists of taking at least three drugs belonging to at least two classes of antiretroviral drugs selected from the group consisting of non-nucleoside reverse transcriptase inhibitor, protease inhibitor and nucleoside analog reverse transcriptase inhibitor (e.g. abacavir).
  • said therapy consists of taking at least two nucleoside analogue reverse transcriptase inhibitors plus either a protease inhibitor or a non-nucleoside reverse transcriptase inhibitor.
  • the immunocompromised subject to be vaccinated suffers from HIV-infection or acquired immunodeficiency syndrome (AIDS) and is under highly active antiretroviral therapy (HAART).
  • said HAART consists of a 3 drug regimen which includes a non-nucleoside reverse transcriptase inhibitor, a protease inhibitor and/or a nucleoside analog reverse transcriptase inhibitor (e.g. abacavir) or a 2 drug regimen which includes a combination of a non-nucleoside reverse transcriptase inhibitor and a protease inhibitor.
  • the immunocompromised subject to be vaccinated suffers from HIV-infection or acquired immunodeficiency syndrome (AIDS) and is not under highly active antiretroviral therapy (HAART), or is not under antiretroviral therapy, or said subject has never been exposed to antiretroviral drugs.
  • HIV-infection or acquired immunodeficiency syndrome AIDS
  • HAART highly active antiretroviral therapy
  • the immunocompromised subject to be vaccinated is a non-viremic HIV infected patient. In another embodiment, the immunocompromised subject to be vaccinated is a viremic HIV infected patient.
  • the immunocompromised subject to be vaccinated suffers from tuberculosis or sexually transmitted diseases, e.g., syphilis or hepatitis.
  • the immunocompromised subject to be vaccinated suffers from malnutrition.
  • the immunocompromised subject to be vaccinated suffers from aging.
  • the immunocompromised subject to be vaccinated is a human adult 55 years of age or older, more preferably a human adult 65 years of age or older.
  • the immunocompromised subject to be vaccinated is a human adult 70 years of age or older, 75 years of age or older or 80 years of age or older.
  • the immunocompromised subject to be vaccinated is taking a drug or treatment that lowers the body's resistance to infection.
  • the immunocompromised subject to be vaccinated is taking a drug selected from the group consisting of chemotherapy (e.g. cancer drugs), disease-modifying antirheumatic drugs, immunosuppressive drugs after organ transplants and glucocorticoids.
  • the immunocompromised subject to be vaccinated is taking an oral immunosuppressant drug selected from the group consisting of: tacrolimus (Prograf), mycophenolate mofetil (CellCept), sirolimus (Rapamune), prednisone, cyclosoporine (Neoral, Sandimmune, Gengraf) and azathioprine (Imuran).
  • an oral immunosuppressant drug selected from the group consisting of: tacrolimus (Prograf), mycophenolate mofetil (CellCept), sirolimus (Rapamune), prednisone, cyclosoporine (Neoral, Sandimmune, Gengraf) and azathioprine (Imuran).
  • the immunocompromised subject is taking at least two or three of said oral immunosuppressant drugs.
  • the immunocompromised subject to be vaccinated is taking an immunosuppressant drug selected from the group consisting of: Everolimus, Mycophenolic acid, Corticosteroids (such as Prednisolone or Hydrocortisone), Monoclonal anti-IL-2R ⁇ receptor antibodies (such as Basiliximab or Daclizumab), Anti-thymocyte globulin (ATG) and Anti-lymphocyte globulin (ALG).
  • the immunocompromised subject is taking at least two or three of said immunosuppressant drugs.
  • the immunocompromised subject to be vaccinated has undergone organ transplant, or bone marrow transplant or cochlear implantation.
  • the immunocompromised subject to be vaccinated has undergone radiation therapy.
  • the immunocompromised subject to be vaccinated is a smoker.
  • the immunocompromised subject to be vaccinated suffers from asthma and is treated with oral corticosteroid therapy.
  • the immunocompromised subject to be vaccinated is an Alaskan native or an American Indian.
  • the immunocompromised subject to be vaccinated has a white blood cell count (leukocyte count) below 5 ⁇ 10 9 cells per liter, or below 4 ⁇ 10 9 cells per liter, or below 3 ⁇ 10 9 cells per liter, or below 2 ⁇ 10 9 cells per liter, or below 1 ⁇ 10 9 cells per liter, or below 0.5 ⁇ 10 9 cells per liter, or below 0.3 ⁇ 10 9 cells per liter, or below 0.1 ⁇ 10 9 cells per liter.
  • a white blood cell count leukocyte count
  • White blood cell count The number of white blood cells (WBCs) in the blood.
  • the WBC is usually measured as part of the CBC (complete blood count).
  • White blood cells are the infection-fighting cells in the blood and are distinct from the red (oxygen-carrying) blood cells known as erythrocytes.
  • the normal range for the white blood cell count is usually between 4,300 and 10,800 cells per cubic millimeter of blood. This can also be referred to as the leukocyte count and can be expressed in international units as 4.3 ⁇ 10.8 ⁇ 10 9 cells per liter.
  • the immunocompromised subject to be vaccinated suffers from neutropenia.
  • the immunocompromised subject to be vaccinated has a neutrophil count below 2 ⁇ 10 9 cells per liter, or below 1 ⁇ 10 9 cells per liter, or below 0.5 ⁇ 10 9 cells per liter, or below 0.1 ⁇ 10 9 cells per liter, or below 0.05 ⁇ 10 9 cells per liter.
  • a low white blood cell count or “neutropenia” is a condition characterized by abnormally low levels of neutrophils in the circulating blood. Neutrophils are a specific kind of white blood cell that help prevent and fight infections. The most common reason that cancer patients experience neutropenia is as a side effect of chemotherapy. Chemotherapy-induced neutropenia increases a patient's risk of infection and disrupts cancer treatment.
  • neutrophils are a major component of antibacterial defense mechanisms. As the neutrophil count falls below 1.0, 0.5, and 0.1 ⁇ 10 9 /L, the frequency of life-threatening infection rises steeply from 10% to 19% and 28%, respectively.
  • the immunocompromised subject to be vaccinated has a CD4+ cell count below 500/mm 3 , or CD4+ cell count below 300/mm 3 , or CD4+ cell count below 200/mm3, CD4+ cell count below 100/mm 3 , CD4+ cell count below 75/mm3, or CD4+ cell count below 50/mm3.
  • CD4 cell tests are normally reported as the number of cells in mm3. Normal CD4 counts are between 500 and 1600, and CD8 counts are between 375 and 1100. CD4 counts drop dramatically in people with HIV.
  • any of the immunocompromised subject disclosed herein is a human male or a human female.
  • a second, third or fourth dose may be given.
  • a prime dose is given at day 0 and one or more boosts are given at intervals that range from about 2 to about 24 weeks, preferably with a dosing interval of 4-8 weeks.
  • a prime dose is given at day 0 and a boost is given about 3 months later.
  • the vaccine of the invention may reduce the number of vaccinations required to achieve seroprotection, accelerate seroconversion, possibly permitting post-exposure vaccination, reduce the proportion of non-responders, reduce the amount of antigen required, increase antibody avidity and protective activity and/or lead to a more sustained antibody levels.
  • AEs Adverse events
  • SAEs Serious adverse events
  • Laboratory tests hematology, clinical chemistry i.e. viral load (HIV RNA) and CD4-count
  • Physical examination hematology, clinical chemistry i.e. viral load (HIV RNA) and CD4-count.
  • CpG 7909 (a synthetic Toll-like receptor 9-agonist) formulated in PBS buffer.
  • CPG 7909 is a B-Class CpG ODN of sequence 5′-TCGTCGTTTTGTCGTTTTGTCGTT-3′ (SEQ ID NO: 5) and has been synthesized with a wholly phosphorothioate backbone.
  • TEST DRUG DOSAGE 1 mg CpG 7909 (100 ⁇ l) mixed with each pneumococcal vaccination.
  • CONTROLS 100 ⁇ l of a neutral PBS buffer (identical in colour and viscosity to the test drug) with each pneumococcal vaccine.
  • ROUTE OF ADMINISTRATION Intramuscular injection.
  • BLINDING Double-blinded study.
  • Eligible patients have been randomized in a ratio of 1:1 to receive pneumococcal vaccination with or without CpG 7909.
  • Vaccines were kept in their original container according to manufacturer's description and mixed with the adjuvant (CpG 7909 or Placebo) immediately before immunization. Immunization has been done in the left or right upper deltoid muscle at the preference of the subject.
  • a withdrawal from the investigational product is any subject who does not receive the complete treatment, i.e. when no further planned dose is administered from the date of withdrawal.
  • a subject withdrawal from the investigational product may not necessarily be withdrawn from the study as further study procedures or follow-up may be performed (safety or immunogenicity) if planned in the protocol.
  • Consenting participants that pass the inclusion/exclusion criteria have been enrolled in the study. Blood samples for baseline parameter measurements have been drawn before proceeding to immunization. At randomization, participants has been allocated 1:1 one of two study regimens:
  • the study was powered to detect differences between the experimental group and the control group in Pneumococcal vaccine high responders defined as 2-fold increase and IgG levels ⁇ 1 ⁇ g/mL to at least 5 of 7 pneumococcal serotypes (by quantitative IgG measurements).
  • the study was not powered to detect differences in the incidence of pneumonia or confirmed pneumococcal disease invasive/non-invasive. This would require a substantial number of participants and a longer follow-up period.
  • the most widely used measurement of immune response to pneumococcal vaccination is quantitative detection of serotype specific anticapsular antibodies. Recent data indicate that the specificity of this method can be improved by incorporation a 22F absorption step; thereby removing crossreacting antibodies of low avidity.
  • Quantitative serotype specific IgG measurements were done by Statens Serum Institut (SSI), Copenhagen, Denmark using an ELISA incorporating the 22F absorption step. SSI were blinded in regards to treatment allocation.
  • Measuring the quantitative amount of serotype specific anticapsular antibodies does not give any information the functionality of the antibodies. This can be measured by a flow-cytometric opsonophagocytic assay and gives indirect information on the antibodies ability to opsonize and facilitate killing of invading pneumococci.
  • HL60 cell control wells which receives 20 ⁇ l of OPA buffer.
  • OPA buffer After incubation at 37° C. for 20 min with shaking (200 rpm on an orbital shaker), 30 ⁇ l of washed HL60 polymorphonuclear leukocytes (PMNs) (2.5 ⁇ 104/rd) are added to each well, resulting in an effector-to-target ratio of 1:4 (for each target type).
  • the final well volume is 80 ⁇ l, with the first well of a dilution series containing a 1:8 final dilution.
  • the plate is then incubated for 60 min with shaking at 37° C.
  • An additional 80 ⁇ l of OPA buffer is added to every well to provide sufficient volume for flow cytometric analysis and the well contents transferred to microtiter tubes (Bio-Rad, Hercules, Calif.). Up to 12 serum samples can be assayed per plate, including a quality control sample.
  • Flow analysis were done by Flow Applications, Inc, Ill, USA 51.
  • Pneumococcal vaccination can affect pharyngeal carriage of pneumococci. Pneumococcal pharyngeal colonization may also affect the immune response to pneumococcal vaccination. Therefore it is important to establish carrier status before and after pneumococcal vaccination. Oropharyngeal colonization has been tested in the posterior pharynx using a BBL culture swap (Becton Dickson Microbiology Systems, Cockeysville, Md., USA) thru the oral cavity. Samples were labelled with the individuals study ID number, frozen at ⁇ 20° C. within few hours and later shipped to Statens Serum Institut, where isolation, culturing and serotyping took place. This has taken place at day 0 and again during follow-up at day 270.
  • BBL culture swap Becton Dickson Microbiology Systems, Cockeysville, Md., USA
  • An AE is any untoward medical occurrence in a clinical investigation subject, temporally associated with the use of a medicinal product, whether or not considered related to the medicinal product.
  • An AE can therefore be any unfavorable and unintended sign (including an abnormal laboratory finding), symptom or disease (new or exacerbated) temporally associated with the use of a medicinal product.
  • An adverse event occurring during a clinical trial is any undesirable experience associated with the use of a medical product in a participant.
  • the event is serious and will be reported to the regulatory authority when the participant outcome is:
  • Safety population all patients who received at least one vaccination.
  • Prevalence ratios of high responders at six months after 2nd vaccination with Prevenar has been estimated by Chi-square test.
  • a Poisson regression model adjusted by age, CD4 cell count at baseline and HAART (on HAART vs. no HAART) at baseline is planned.
  • Risk factors for achieving a high vaccination response (classified as a high responder) at six months after 2nd vaccination with Prevenar will be estimated by multivariate Poisson regression.
  • ITT Intention-to-treat
  • Sample size is calculated for the primary endpoint (prevalence ratios of high responders at six months after 2nd vaccination with Prevenar, comparing the two vaccination scheme groups). Setting the probabilities of Type I and Type II error to:
  • the two-sided 95% confidence interval (CI) of the immune response difference has been calculated.
  • Immunogenicity and safety were evaluated at 0, 3, 4, 9, and 10 months.
  • Results As shown in table 1, 96 participants were included. In each group of 48 participants, 38 were on ART.
  • FIGS. 2 and 3 show the difference in relative IgG response for two PCV serotypes (9v and 14) between the CPG and placebo group.
  • FIGS. 4 and 5 show the relative IgG response for two non-PCV serotypes (1 and 7f) in the CPG and placebo group (as expected no increase in IgG was observed in relation to PCV immunization). Following PPV immunization, both groups (+/ ⁇ CpG) show significant responses. However, CpG did not increase the antibody response to non-PCV serotypes (1 and 7f) after PPV immunization.
  • OPA opsonophacytic activity
  • PS pneumococcal serotype
  • GM-ratio geometric mean ratio
  • PCV-7 7-valent pneumococccal conjugate vaccine
  • PPV -23 23-valent pneumococcal polysaccharide vaccine
  • TLR9-Agonist Adjuvant Induces Cellular Memory in Response to Pneumococcal Conjugate Vaccine in HIV-Infected Adults
  • PBMC Periferal blood mononuclear cells
  • the Frozen PBMCs were thawed and tested for viability and transferred to 96-well flat-bottomed tissue culture plates.
  • the cells were incubated overnight at 37° C., and stimulated the following day with purified pneumococcal polysaccharide (serotype (ST) 6B and 14). After 48 hours incubation, the supernatants were harvested and cytokine concentrations measured by Luminex. The relative response was calculated as the ratio between cytokine concentrations post- and pre-immunization, taking pre-existing immunity to Streptococcus pneumoniae into account, as well as eliminating bias from innate recognition.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Public Health (AREA)
  • Medicinal Chemistry (AREA)
  • Veterinary Medicine (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Animal Behavior & Ethology (AREA)
  • General Health & Medical Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Organic Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Immunology (AREA)
  • Epidemiology (AREA)
  • Mycology (AREA)
  • Microbiology (AREA)
  • Diabetes (AREA)
  • Oncology (AREA)
  • Pulmonology (AREA)
  • Hematology (AREA)
  • Virology (AREA)
  • Communicable Diseases (AREA)
  • Cardiology (AREA)
  • Addiction (AREA)
  • Heart & Thoracic Surgery (AREA)
  • Molecular Biology (AREA)
  • Obesity (AREA)
  • Biomedical Technology (AREA)
  • Neurology (AREA)
  • Neurosurgery (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Urology & Nephrology (AREA)
  • Endocrinology (AREA)
  • Emergency Medicine (AREA)
  • AIDS & HIV (AREA)
  • Hospice & Palliative Care (AREA)
  • Tropical Medicine & Parasitology (AREA)
US13/266,846 2009-04-30 2010-03-17 Pneumococcal vaccine and uses thereof Abandoned US20120052088A1 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
US13/266,846 US20120052088A1 (en) 2009-04-30 2010-03-17 Pneumococcal vaccine and uses thereof

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
US17406809P 2009-04-30 2009-04-30
US23831309P 2009-08-31 2009-08-31
PCT/IB2010/051150 WO2010125480A1 (en) 2009-04-30 2010-03-17 Pneumococcal vaccine and uses thereof
US13/266,846 US20120052088A1 (en) 2009-04-30 2010-03-17 Pneumococcal vaccine and uses thereof

Related Parent Applications (1)

Application Number Title Priority Date Filing Date
PCT/IB2010/051150 A-371-Of-International WO2010125480A1 (en) 2009-04-30 2010-03-17 Pneumococcal vaccine and uses thereof

Related Child Applications (1)

Application Number Title Priority Date Filing Date
US14/049,842 Division US9205143B2 (en) 2009-04-30 2013-10-09 Pneumococcal vaccine and uses thereof

Publications (1)

Publication Number Publication Date
US20120052088A1 true US20120052088A1 (en) 2012-03-01

Family

ID=42561160

Family Applications (2)

Application Number Title Priority Date Filing Date
US13/266,846 Abandoned US20120052088A1 (en) 2009-04-30 2010-03-17 Pneumococcal vaccine and uses thereof
US14/049,842 Active US9205143B2 (en) 2009-04-30 2013-10-09 Pneumococcal vaccine and uses thereof

Family Applications After (1)

Application Number Title Priority Date Filing Date
US14/049,842 Active US9205143B2 (en) 2009-04-30 2013-10-09 Pneumococcal vaccine and uses thereof

Country Status (14)

Country Link
US (2) US20120052088A1 (de)
EP (1) EP2424562B1 (de)
JP (1) JP5823670B2 (de)
KR (1) KR101450958B1 (de)
CN (1) CN102413838A (de)
AU (1) AU2010243285B2 (de)
BR (1) BRPI1014494A2 (de)
CA (1) CA2757620C (de)
DK (1) DK2424562T3 (de)
ES (1) ES2552153T3 (de)
IL (1) IL215389A (de)
MX (1) MX340830B (de)
RU (1) RU2536248C2 (de)
WO (1) WO2010125480A1 (de)

Cited By (29)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20100143400A1 (en) * 2008-12-09 2010-06-10 Pfizer Inc. Immunostimulatory Oligonucleotides
US20110033494A1 (en) * 2008-04-01 2011-02-10 Innate Therapeutics Limited Anti-Infective Agents and Uses Thereof
US20140193451A1 (en) * 2012-10-17 2014-07-10 Glaxosmithkline Biologicals Sa Immunogenic composition
US20140341945A1 (en) * 2013-04-24 2014-11-20 Corning Incorporated Delamination resistant pharmaceutical glass containers containing active pharmaceutical ingredients
US20150086610A1 (en) * 2008-12-09 2015-03-26 Coley Pharmaceutical Group, Inc. Immunostimulatory oligonucleotides
US20150202309A1 (en) * 2014-01-21 2015-07-23 Pfizer Inc. Immunogenic Compositions Comprising Conjugated Capsular Saccharide Antigens and Uses Thereof
US20150328328A1 (en) * 2012-12-20 2015-11-19 Pfizer Inc. Glycoconjugation process
US9603775B2 (en) 2013-04-24 2017-03-28 Corning Incorporated Delamination resistant pharmaceutical glass containers containing active pharmaceutical ingredients
US9700486B2 (en) 2013-04-24 2017-07-11 Corning Incorporated Delamination resistant pharmaceutical glass containers containing active pharmaceutical ingredients
US9700485B2 (en) 2013-04-24 2017-07-11 Corning Incorporated Delamination resistant pharmaceutical glass containers containing active pharmaceutical ingredients
US9707155B2 (en) 2013-04-24 2017-07-18 Corning Incorporated Delamination resistant pharmaceutical glass containers containing active pharmaceutical ingredients
US9707154B2 (en) 2013-04-24 2017-07-18 Corning Incorporated Delamination resistant pharmaceutical glass containers containing active pharmaceutical ingredients
US9713572B2 (en) 2013-04-24 2017-07-25 Corning Incorporated Delamination resistant pharmaceutical glass containers containing active pharmaceutical ingredients
US9717649B2 (en) 2013-04-24 2017-08-01 Corning Incorporated Delamination resistant pharmaceutical glass containers containing active pharmaceutical ingredients
US9717648B2 (en) 2013-04-24 2017-08-01 Corning Incorporated Delamination resistant pharmaceutical glass containers containing active pharmaceutical ingredients
US9839579B2 (en) 2013-04-24 2017-12-12 Corning Incorporated Delamination resistant pharmaceutical glass containers containing active pharmaceutical ingredients
US9849066B2 (en) 2013-04-24 2017-12-26 Corning Incorporated Delamination resistant pharmaceutical glass containers containing active pharmaceutical ingredients
US20180099039A1 (en) * 2014-01-21 2018-04-12 Pfizer Inc. Immunogenic Compositions Comprising Conjugated Capsular Saccharide Antigens and Uses Thereof
US9981029B2 (en) 2012-12-11 2018-05-29 Sk Chemical Co., Ltd. Multivalent pneumococcal polysaccharide-protein conjugate composition
US10034949B2 (en) 2012-06-20 2018-07-31 Sk Chemicals Co., Ltd. Polyvalent pneumococcal polysaccharide-protein conjugate composition
CN108367059A (zh) * 2015-12-17 2018-08-03 马普科技促进协会 针对肺炎链球菌血清型2的合成疫苗
US10124050B2 (en) 2015-07-21 2018-11-13 Pfizer Inc. Immunogenic compositions comprising conjugated capsular saccharide antigens, kits comprising the same and uses thereof
WO2019152921A1 (en) * 2018-02-05 2019-08-08 Sanofi Pasteur Inc. Multivalent pneumococcal polysaccharide-protein conjugate composition
US10413483B2 (en) 2011-10-25 2019-09-17 Corning Incorporated Delamination resistant pharmaceutical glass containers containing active pharmaceutical ingredients
US10702596B2 (en) * 2017-07-05 2020-07-07 Inventprise, Llc Polysaccharide purification for vaccine production using lytic enzymes, tangential flow filtration, and multimode chromatography
US11123417B2 (en) 2018-02-05 2021-09-21 Sanofi Pasteur Inc. Multivalent pneumococcal polysaccharide-protein conjugate composition
US11224652B2 (en) 2016-08-05 2022-01-18 Sanofi Pasteur Inc. Multivalent pneumococcal polysaccharide-protein conjugate composition
US11241489B2 (en) 2016-08-05 2022-02-08 Sanofi Pasteur Inc. Multivalent pneumococcal polysaccharide-protein conjugate composition
US11951162B2 (en) 2018-04-18 2024-04-09 Sk Bioscience Co., Ltd. Streptococcus pneumoniae capsular polysaccharides and immunogenic conjugate thereof

Families Citing this family (42)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP2471926A3 (de) * 2010-12-30 2012-07-11 Intervet International BV Immunstimulierende Oligodeoxynukleotide
RU2013144207A (ru) * 2011-03-02 2015-04-10 Новартис Аг Комбинированные вакцины с пониженными дозами антигена и/или адъюванта
CA2834442A1 (en) 2011-05-26 2012-11-29 Intervet International B.V. Immunostimulatory oligodeoxynucleotides
EP2833918B1 (de) * 2012-04-05 2019-05-08 Massachusetts Institute of Technology Immunstimulationszusammensetzungen und verfahren zur verwendung davon
US20140105927A1 (en) * 2012-10-17 2014-04-17 Glaxosmithkline Biologicals S.A. Immunogenic composition
CA2889064A1 (en) * 2012-10-19 2014-04-24 The Council Of The Queensland Institute Of Medical Research Improved human herpesvirus immunotherapy
KR20140075201A (ko) * 2012-12-11 2014-06-19 에스케이케미칼주식회사 다가 폐렴구균 다당류-단백질 접합체 조성물
US9149521B2 (en) 2013-09-25 2015-10-06 Sequoia Sciences, Inc. Compositions of vaccines and adjuvants and methods for the treatment of urinary tract infections
US9504743B2 (en) 2013-09-25 2016-11-29 Sequoia Sciences, Inc Compositions of vaccines and adjuvants and methods for the treatment of urinary tract infections
US9149522B2 (en) 2013-09-25 2015-10-06 Sequoia Sciences, Inc. Compositions of vaccines and adjuvants and methods for the treatment of urinary tract infections
US9017698B2 (en) 2013-09-25 2015-04-28 Sequoia Sciences, Inc. Compositions of vaccines and adjuvants and methods for the treatment of urinary tract infections
PT3096786T (pt) 2014-01-21 2021-08-24 Pfizer Polissacáridos capsulares de streptococcus pneumoniae e conjugados dos mesmos
CN105934251A (zh) 2014-01-21 2016-09-07 辉瑞大药厂 肺炎链球菌荚膜多糖及其缀合物
US9107906B1 (en) 2014-10-28 2015-08-18 Adma Biologics, Inc. Compositions and methods for the treatment of immunodeficiency
PT3244917T (pt) 2015-01-15 2023-05-31 Pfizer Composições imunogénicas para utilização em vacinas pneumocócicas
MX2018000879A (es) * 2015-07-20 2018-05-15 Zoetis Services Llc Composiciones de adyuvante liposomal.
EP3377098A1 (de) 2015-11-20 2018-09-26 Pfizer Inc Immunogene zusammensetzungen zur verwendung in pneumokokkenimpfstoffen
US10300145B2 (en) 2016-07-15 2019-05-28 Massachusetts Institute Of Technology Synthetic nanoparticles for delivery of immunomodulatory compounds
KR102459629B1 (ko) 2017-01-20 2022-10-28 화이자 인코포레이티드 폐렴구균 백신에 사용하기 위한 면역원성 조성물
US10259865B2 (en) 2017-03-15 2019-04-16 Adma Biologics, Inc. Anti-pneumococcal hyperimmune globulin for the treatment and prevention of pneumococcal infection
KR102634811B1 (ko) 2017-06-10 2024-02-06 인벤트프라이즈 인크. 면역원성과 항원항체 결합성이 개선된 2가 또는 다가 접합체 다당류를 가진 다가 접합체 백신
US10729763B2 (en) 2017-06-10 2020-08-04 Inventprise, Llc Mixtures of polysaccharide-protein pegylated compounds
MX2019015769A (es) 2017-06-23 2020-08-03 Verimmune Inc Partículas tipo virus quiméricas y usos de estas como redireccionadores de respuestas inmunitarias específicos para el antígeno.
JP7293201B2 (ja) 2017-09-07 2023-06-19 メルク・シャープ・アンド・ドーム・エルエルシー 肺炎球菌多糖体および免疫原性多糖体－キャリアタンパク質コンジュゲートでのその使用
US11260119B2 (en) 2018-08-24 2022-03-01 Pfizer Inc. Escherichia coli compositions and methods thereof
CA3120922A1 (en) 2018-12-12 2020-06-18 Pfizer Inc. Immunogenic multiple hetero-antigen polysaccharide-protein conjugates and uses thereof
KR20210110321A (ko) * 2018-12-27 2021-09-07 버이뮨 아이엔씨. 접합된 바이러스-유사 입자 및 항-종양 면역 재유도제로서의 이의 용도
CN109771640A (zh) * 2019-02-28 2019-05-21 北京智飞绿竹生物制药有限公司 多价肺炎球菌结合疫苗
CA3136278A1 (en) 2019-04-10 2020-10-15 Pfizer Inc. Immunogenic compositions comprising conjugated capsular saccharide antigens, kits comprising the same and uses thereof
IL292494A (en) 2019-11-01 2022-06-01 Pfizer Preparations of Escherichia coli and their methods
JP2023514697A (ja) 2020-02-23 2023-04-07 ファイザー・インク 大腸菌組成物およびその方法
US11858964B2 (en) 2020-10-19 2024-01-02 Verimmune Inc. Virus-inspired compositions and methods of redirecting preexisting immune responses using the same for treatment of cancer
AU2021368151A1 (en) 2020-10-27 2023-06-01 Pfizer Inc. Escherichia coli compositions and methods thereof
US20240000912A1 (en) 2020-11-04 2024-01-04 Pfizer Inc. Immunogenic compositions for use in pneumococcal vaccines
US20220202923A1 (en) 2020-12-23 2022-06-30 Pfizer Inc. E. coli fimh mutants and uses thereof
WO2022234416A1 (en) 2021-05-03 2022-11-10 Pfizer Inc. Vaccination against pneumoccocal and covid-19 infections
CA3218544A1 (en) 2021-05-03 2022-11-10 Pfizer Inc. Vaccination against bacterial and betacoronavirus infections
EP4346893A2 (de) 2021-05-28 2024-04-10 Pfizer Inc. Immunogene zusammensetzungen mit konjugierten kapselsaccharidantigenen und verwendungen davon
US20220387613A1 (en) 2021-05-28 2022-12-08 Pfizer Inc. Immunogenic compositions comprising conjugated capsular saccharide antigens and uses thereof
WO2023135515A1 (en) 2022-01-13 2023-07-20 Pfizer Inc. Immunogenic compositions comprising conjugated capsular saccharide antigens and uses thereof
WO2023218322A1 (en) 2022-05-11 2023-11-16 Pfizer Inc. Process for producing of vaccine formulations with preservatives
WO2024084397A1 (en) 2022-10-19 2024-04-25 Pfizer Inc. Vaccination against pneumoccocal and covid-19 infections

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2007000342A2 (en) * 2005-06-27 2007-01-04 Glaxosmithkline Biologicals S.A. Immunogenic composition
WO2007071707A2 (en) * 2005-12-22 2007-06-28 Glaxosmithkline Biologicals Sa Pneumococcal polysaccharide conjugate vaccine
US8007807B2 (en) * 2005-09-01 2011-08-30 Novartis Vaccines And Diagnostics Gmbh Multiple vaccination including serogroup C meningococcus
US8241844B2 (en) * 2008-10-03 2012-08-14 Ralph Clark, legal representative Methods and compositions for modulating an immune response with immunogenic oligonucleotides

Family Cites Families (76)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4469863A (en) 1980-11-12 1984-09-04 Ts O Paul O P Nonionic nucleic acid alkyl and aryl phosphonates and processes for manufacture and use thereof
US4902506A (en) 1983-07-05 1990-02-20 The University Of Rochester Immunogenic conjugates
US4673574A (en) 1981-08-31 1987-06-16 Anderson Porter W Immunogenic conjugates
ATE75483T1 (de) 1981-10-23 1992-05-15 Molecular Biosystems Inc Oligonukleotides heilmittel und dessen herstellungsverfahren.
US5023243A (en) 1981-10-23 1991-06-11 Molecular Biosystems, Inc. Oligonucleotide therapeutic agent and method of making same
US4709017A (en) 1985-06-07 1987-11-24 President And Fellows Of Harvard College Modified toxic vaccines
US4950740A (en) 1987-03-17 1990-08-21 Cetus Corporation Recombinant diphtheria vaccines
GB8815795D0 (en) 1988-07-02 1988-08-10 Bkl Extrusions Ltd Glazing bead
NZ230747A (en) 1988-09-30 1992-05-26 Bror Morein Immunomodulating matrix comprising a complex of at least one lipid and at least one saponin; certain glycosylated triterpenoid saponins derived from quillaja saponaria molina
DE3841091A1 (de) 1988-12-07 1990-06-13 Behringwerke Ag Synthetische antigene, verfahren zu ihrer herstellung und ihre verwendung
CA2006700A1 (en) 1989-01-17 1990-07-17 Antonello Pessi Synthetic peptides and their use as universal carriers for the preparation of immunogenic conjugates suitable for the development of synthetic vaccines
AU651949B2 (en) 1989-07-14 1994-08-11 American Cyanamid Company Cytokine and hormone carriers for conjugate vaccines
IT1237764B (it) 1989-11-10 1993-06-17 Eniricerche Spa Peptidi sintetici utili come carriers universali per la preparazione di coniugati immunogenici e loro impiego per lo sviluppo di vaccini sintetici.
SE466259B (sv) 1990-05-31 1992-01-20 Arne Forsgren Protein d - ett igd-bindande protein fraan haemophilus influenzae, samt anvaendning av detta foer analys, vacciner och uppreningsaendamaal
IL98715A0 (en) 1990-08-13 1992-07-15 American Cyanamid Co Filamentous hemaglutinin of bodetella pertussis as a carrier molecule for conjugate vaccines
IT1262896B (it) 1992-03-06 1996-07-22 Composti coniugati formati da proteine heat shock (hsp) e oligo-poli- saccaridi, loro uso per la produzione di vaccini.
DE69324487T2 (de) 1992-05-06 1999-08-12 Harvard College Rezeptorbindende region des diphtherietoxius
PL170980B1 (pl) 1992-06-25 1997-02-28 Smithkline Beecham Biolog Szczepionka PL PL PL PL PL PL PL
IL102687A (en) 1992-07-30 1997-06-10 Yeda Res & Dev Conjugates of poorly immunogenic antigens and synthetic pepide carriers and vaccines comprising them
DE69434079T2 (de) 1993-03-05 2005-02-24 Wyeth Holdings Corp. Plasmid zur Herstellung von CRM-Protein und Diphtherie-Toxin
ES2162139T5 (es) 1993-03-23 2008-05-16 Smithkline Beecham Biologicals S.A. Composiciones de vacuna que contienen monofosforil-lipido a 3-o-desacilado.
GB9326253D0 (en) 1993-12-23 1994-02-23 Smithkline Beecham Biolog Vaccines
US5917017A (en) 1994-06-08 1999-06-29 President And Fellows Of Harvard College Diphtheria toxin vaccines bearing a mutated R domain
US6455673B1 (en) 1994-06-08 2002-09-24 President And Fellows Of Harvard College Multi-mutant diphtheria toxin vaccines
AU713040B2 (en) 1994-07-15 1999-11-18 University Of Iowa Research Foundation, The Immunomodulatory oligonucleotides
US6207646B1 (en) 1994-07-15 2001-03-27 University Of Iowa Research Foundation Immunostimulatory nucleic acid molecules
US6239116B1 (en) 1994-07-15 2001-05-29 University Of Iowa Research Foundation Immunostimulatory nucleic acid molecules
AUPM873294A0 (en) 1994-10-12 1994-11-03 Csl Limited Saponin preparations and use thereof in iscoms
GB9513261D0 (en) 1995-06-29 1995-09-06 Smithkline Beecham Biolog Vaccines
AUPO517897A0 (en) 1997-02-19 1997-04-11 Csl Limited Chelating immunostimulating complexes
WO1998037919A1 (en) 1997-02-28 1998-09-03 University Of Iowa Research Foundation USE OF NUCLEIC ACIDS CONTAINING UNMETHYLATED CpG DINUCLEOTIDE IN THE TREATMENT OF LPS-ASSOCIATED DISORDERS
DE69838294T2 (de) 1997-05-20 2009-08-13 Ottawa Health Research Institute, Ottawa Verfahren zur Herstellung von Nukleinsäurekonstrukten
GB9712347D0 (en) 1997-06-14 1997-08-13 Smithkline Beecham Biolog Vaccine
GB9713156D0 (en) 1997-06-20 1997-08-27 Microbiological Res Authority Vaccines
ES2298316T3 (es) 1997-09-05 2008-05-16 Glaxosmithkline Biologicals S.A. Emulsiones de aceite en agua que contienen saponinas.
GB9727262D0 (en) * 1997-12-24 1998-02-25 Smithkline Beecham Biolog Vaccine
US6303114B1 (en) 1998-03-05 2001-10-16 The Medical College Of Ohio IL-12 enhancement of immune responses to T-independent antigens
ES2284247T3 (es) 1998-04-03 2007-11-01 University Of Iowa Research Foundation Metodos y productos para estimular el sistema inmunitario usando oligonucleotidos y citoquinas inmunoterapeuticos.
WO1999052549A1 (en) 1998-04-09 1999-10-21 Smithkline Beecham Biologicals S.A. Adjuvant compositions
WO2000037105A2 (en) 1998-12-21 2000-06-29 Medimmune, Inc. Streptococcus pneumoniae proteins and immunogenic fragments for vaccines
ES2306528T3 (es) 1998-12-23 2008-11-01 Id Biomedical Corporation Antigenos de streptococcus.
US7128918B1 (en) 1998-12-23 2006-10-31 Id Biomedical Corporation Streptococcus antigens
AUPP807399A0 (en) 1999-01-08 1999-02-04 Csl Limited Improved immunogenic lhrh composition and methods relating thereto
AU783344B2 (en) 1999-02-17 2005-10-20 Csl Limited Immunogenic complexes and methods relating thereto
JP2002541808A (ja) 1999-04-09 2002-12-10 テクラブ， インコーポレイテッド ポリサッカリド結合体ワクチンのための組換えトキシンａタンパク質キャリア
EP1221971A2 (de) 1999-09-24 2002-07-17 SmithKline Beecham Biologics SA Verwendung der kombination von polyoxyethylen sorbitan ester und octoxynol als adjuvans und seine verwendung in impfstoffen
ES2265980T5 (es) 1999-09-27 2010-12-28 Coley Pharmaceutical Group, Inc. Metodos relacionados con interferón inducido por ácidos nucleicos inmunoestimuladores.
GB0007432D0 (en) 2000-03-27 2000-05-17 Microbiological Res Authority Proteins for use as carriers in conjugate vaccines
US7074415B2 (en) 2000-06-20 2006-07-11 Id Biomedical Corporation Streptococcus antigens
CA2413450C (en) 2000-06-20 2014-02-18 Shire Biochem Inc. Streptococcus antigens
US20030035806A1 (en) 2001-05-11 2003-02-20 D'ambra Anello J. Novel meningitis conjugate vaccine
DK1446162T3 (da) 2001-08-17 2008-12-08 Coley Pharm Gmbh Kombinationsmotiv-immunstimulatoriske oligonukleotider med forbedret aktivitet
AU2002347404A1 (en) 2001-09-14 2003-04-01 Cytos Biotechnology Ag In vivo activation of antigen presenting cells for enhancement of immune responses induced by virus like particles
AU2002351623A1 (en) 2001-12-20 2003-07-09 Shire Biochem Inc. Streptococcus antigens
AU2003304107B2 (en) * 2002-11-01 2008-05-15 The Government Of The United States Of America As Represented By The Secretary Of The Department Of Health And Human Services Method of preventing infections from bioterrorism agents with immunostimulatory CpG oligonucleotides
BRPI0408094A (pt) 2003-03-13 2006-02-14 Glaxosmithkline Biolog Sa processo para purificação de uma citolisina bacteriana, citolisina bacteriana, conjugado de polissacarìdeo capsular-pneumolisina bacteriano, composição imunogênica, vacina, processo de produção da vacina, método de tratamento ou prevenção de infecção por streptococcus pneumoniae, e, uso da pneumolisina ou do conjugado de polissacarìdeo-pneumolisina bacteriano
WO2004083251A2 (en) 2003-03-17 2004-09-30 Wyeth Holdings Corporation Mutant cholera holotoxin as an adjuvant and an antigen carrier protein
GB0410220D0 (en) * 2004-05-07 2004-06-09 Kirkham Lea Ann Mutant pneumolysin proteins
AU2005333126A1 (en) 2004-07-18 2006-12-21 Csl Limited Methods and compositions for inducing innate immune responses
JP2008506789A (ja) 2004-07-18 2008-03-06 シーエスエル、リミテッド インターフェロン−ガンマ応答強化を誘発するための免疫刺激複合体及びオリゴヌクレオチド処方物
IL308456A (en) 2005-04-08 2024-01-01 Wyeth Llc A multivalent pneumomuroral protein-polysaccharide conjugate preparation
US7709001B2 (en) 2005-04-08 2010-05-04 Wyeth Llc Multivalent pneumococcal polysaccharide-protein conjugate composition
US20070184072A1 (en) 2005-04-08 2007-08-09 Wyeth Multivalent pneumococcal polysaccharide-protein conjugate composition
TR201820018T4 (tr) 2005-04-08 2019-01-21 Wyeth Llc Streptococcus pneumonıae polisakaridinden bulaşkanların ph manipülasyonuyla ayrılması.
US7955605B2 (en) 2005-04-08 2011-06-07 Wyeth Llc Multivalent pneumococcal polysaccharide-protein conjugate composition
PT1991678E (pt) 2006-02-15 2015-11-25 Adiutide Pharmaceuticals Gmbh Composições e métodos para formulações de oligonucleótidos
TW200806315A (en) 2006-04-26 2008-02-01 Wyeth Corp Novel formulations which stabilize and inhibit precipitation of immunogenic compositions
US8808707B1 (en) * 2006-05-08 2014-08-19 Wyeth Llc Pneumococcal dosing regimen
AU2007307800C1 (en) 2006-10-10 2014-03-13 Wyeth Llc Purification of Streptococcus pneumoniae type 3 polysaccharides
EP2122370A1 (de) 2007-03-14 2009-11-25 Wyeth a Corporation of the State of Delaware Automatisierte colorimetrische polysaccharid-tests
EP2436700B8 (de) 2007-03-23 2018-08-01 Wyeth LLC Verkürztes reinigungsverfahren für die herstellung von streptococcus pneumoniae-kapselpolysacchariden
BRPI0813644B8 (pt) 2007-06-26 2021-05-25 Glaxosmithkline Biologicals Sa composição imunogênica, vacina, processo para fabricar a mesma, e, uso da composição imunogênica ou vacina
PL2385981T3 (pl) 2008-12-18 2020-01-31 Wyeth Llc Sposób kontroli masy cząsteczkowej polisacharydów streptococcus pneumoniae z zastosowaniem węgla
SI2379734T1 (en) 2008-12-18 2018-05-31 Wyeth Llc PROCEDURE FOR THE CONTROL OF THE SEROTYPE 19A STREPTOCOCCUS PNEUMONIAE POLYESAHARIDE MOLECULAR MASS
US9501570B2 (en) 2014-07-14 2016-11-22 Verizon Patent And Licensing Inc. Dynamic routing system
US9719791B2 (en) 2014-12-10 2017-08-01 Mapquest, Inc. Computerized systems and methods for providing travel information and/or content to users

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2007000342A2 (en) * 2005-06-27 2007-01-04 Glaxosmithkline Biologicals S.A. Immunogenic composition
US8007807B2 (en) * 2005-09-01 2011-08-30 Novartis Vaccines And Diagnostics Gmbh Multiple vaccination including serogroup C meningococcus
WO2007071707A2 (en) * 2005-12-22 2007-06-28 Glaxosmithkline Biologicals Sa Pneumococcal polysaccharide conjugate vaccine
US8241844B2 (en) * 2008-10-03 2012-08-14 Ralph Clark, legal representative Methods and compositions for modulating an immune response with immunogenic oligonucleotides

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
Cooper et al Clinical Infectious Diseases, 46('8): 1310-1314. *

Cited By (56)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20110033494A1 (en) * 2008-04-01 2011-02-10 Innate Therapeutics Limited Anti-Infective Agents and Uses Thereof
US8709448B2 (en) * 2008-04-01 2014-04-29 Innate Immunotherapeutics Ltd. Anti-infective agents and uses thereof
US20150086610A1 (en) * 2008-12-09 2015-03-26 Coley Pharmaceutical Group, Inc. Immunostimulatory oligonucleotides
US8552165B2 (en) * 2008-12-09 2013-10-08 Heather Davis Immunostimulatory oligonucleotides
US20100143400A1 (en) * 2008-12-09 2010-06-10 Pfizer Inc. Immunostimulatory Oligonucleotides
US9453059B2 (en) * 2008-12-09 2016-09-27 Coley Pharmaceutical Group, Inc. Immunostimulatory oligonucleotides
US10413483B2 (en) 2011-10-25 2019-09-17 Corning Incorporated Delamination resistant pharmaceutical glass containers containing active pharmaceutical ingredients
US11707409B2 (en) 2011-10-25 2023-07-25 Corning Incorporated Delamination resistant pharmaceutical glass containers containing active pharmaceutical ingredients
US10441505B2 (en) 2011-10-25 2019-10-15 Corning Incorporated Delamination resistant pharmaceutical glass containers containing active pharmaceutical ingredients
US10413481B2 (en) 2011-10-25 2019-09-17 Corning Incorporated Delamination resistant pharmaceutical glass containers containing active pharmaceutical ingredients
US11707408B2 (en) 2011-10-25 2023-07-25 Corning Incorporated Delamination resistant pharmaceutical glass containers containing active pharmaceutical ingredients
US10413482B2 (en) 2011-10-25 2019-09-17 Corning Incorporated Delamination resistant pharmaceutical glass containers containing active pharmaceutical ingredients
US11707410B2 (en) 2011-10-25 2023-07-25 Corning Incorporated Delamination resistant pharmaceutical glass containers containing active pharmaceutical ingredients
US10058607B2 (en) 2012-06-20 2018-08-28 Sk Chemicals Co., Ltd. Polyvalent pneumococcal polysaccharide-protein conjugate composition
US10034949B2 (en) 2012-06-20 2018-07-31 Sk Chemicals Co., Ltd. Polyvalent pneumococcal polysaccharide-protein conjugate composition
US20140193451A1 (en) * 2012-10-17 2014-07-10 Glaxosmithkline Biologicals Sa Immunogenic composition
US9981029B2 (en) 2012-12-11 2018-05-29 Sk Chemical Co., Ltd. Multivalent pneumococcal polysaccharide-protein conjugate composition
US20150328328A1 (en) * 2012-12-20 2015-11-19 Pfizer Inc. Glycoconjugation process
AU2018204421B2 (en) * 2012-12-20 2019-10-31 Pfizer Inc. Glycoconjugation process
US10392420B2 (en) * 2012-12-20 2019-08-27 Pfizer Inc. Glycoconjugation process
US10745438B2 (en) 2012-12-20 2020-08-18 Pfizer Inc. Glycoconjugation process
US11117928B2 (en) 2012-12-20 2021-09-14 Pfizer Inc. Glycoconjugation process
US11603384B2 (en) 2012-12-20 2023-03-14 Pfizer Inc. Glycoconjugation process
US9849066B2 (en) 2013-04-24 2017-12-26 Corning Incorporated Delamination resistant pharmaceutical glass containers containing active pharmaceutical ingredients
US9707154B2 (en) 2013-04-24 2017-07-18 Corning Incorporated Delamination resistant pharmaceutical glass containers containing active pharmaceutical ingredients
US9707153B2 (en) * 2013-04-24 2017-07-18 Corning Incorporated Delamination resistant pharmaceutical glass containers containing active pharmaceutical ingredients
US9839579B2 (en) 2013-04-24 2017-12-12 Corning Incorporated Delamination resistant pharmaceutical glass containers containing active pharmaceutical ingredients
US9707155B2 (en) 2013-04-24 2017-07-18 Corning Incorporated Delamination resistant pharmaceutical glass containers containing active pharmaceutical ingredients
US9713572B2 (en) 2013-04-24 2017-07-25 Corning Incorporated Delamination resistant pharmaceutical glass containers containing active pharmaceutical ingredients
US9700485B2 (en) 2013-04-24 2017-07-11 Corning Incorporated Delamination resistant pharmaceutical glass containers containing active pharmaceutical ingredients
US9717649B2 (en) 2013-04-24 2017-08-01 Corning Incorporated Delamination resistant pharmaceutical glass containers containing active pharmaceutical ingredients
US9717648B2 (en) 2013-04-24 2017-08-01 Corning Incorporated Delamination resistant pharmaceutical glass containers containing active pharmaceutical ingredients
US9700486B2 (en) 2013-04-24 2017-07-11 Corning Incorporated Delamination resistant pharmaceutical glass containers containing active pharmaceutical ingredients
US9603775B2 (en) 2013-04-24 2017-03-28 Corning Incorporated Delamination resistant pharmaceutical glass containers containing active pharmaceutical ingredients
US20140341945A1 (en) * 2013-04-24 2014-11-20 Corning Incorporated Delamination resistant pharmaceutical glass containers containing active pharmaceutical ingredients
AU2017268651B2 (en) * 2014-01-21 2019-08-01 Pfizer Inc. Immunogenic compositions comprising conjugated capsular saccharide antigens and uses thereof
US11160855B2 (en) * 2014-01-21 2021-11-02 Pfizer Inc. Immunogenic compositions comprising conjugated capsular saccharide antigens and uses thereof
CN110787290A (zh) * 2014-01-21 2020-02-14 辉瑞公司 包含缀合荚膜糖抗原的免疫原性组合物及其用途
US11872274B2 (en) 2014-01-21 2024-01-16 Pfizer Inc. Immunogenic compositions comprising conjugated capsular saccharide antigens and uses thereof
US20150202309A1 (en) * 2014-01-21 2015-07-23 Pfizer Inc. Immunogenic Compositions Comprising Conjugated Capsular Saccharide Antigens and Uses Thereof
US9492559B2 (en) * 2014-01-21 2016-11-15 Pfizer Inc. Immunogenic compositions comprising conjugated capsular saccharide antigens and uses thereof
AU2019204623B2 (en) * 2014-01-21 2021-04-29 Pfizer Inc. Immunogenic compositions comprising conjugated capsular saccharide antigens and uses thereof
AU2015208821B2 (en) * 2014-01-21 2017-11-02 Pfizer Inc. Immunogenic compositions comprising conjugated capsular saccharide antigens and uses thereof
US20180099039A1 (en) * 2014-01-21 2018-04-12 Pfizer Inc. Immunogenic Compositions Comprising Conjugated Capsular Saccharide Antigens and Uses Thereof
US11020469B2 (en) 2015-07-21 2021-06-01 Pfizer Inc. Immunogenic compositions comprising conjugated capsular saccharide antigens, kits comprising the same and uses thereof
US10124050B2 (en) 2015-07-21 2018-11-13 Pfizer Inc. Immunogenic compositions comprising conjugated capsular saccharide antigens, kits comprising the same and uses thereof
CN108367059A (zh) * 2015-12-17 2018-08-03 马普科技促进协会 针对肺炎链球菌血清型2的合成疫苗
US11224652B2 (en) 2016-08-05 2022-01-18 Sanofi Pasteur Inc. Multivalent pneumococcal polysaccharide-protein conjugate composition
US11241489B2 (en) 2016-08-05 2022-02-08 Sanofi Pasteur Inc. Multivalent pneumococcal polysaccharide-protein conjugate composition
US10702596B2 (en) * 2017-07-05 2020-07-07 Inventprise, Llc Polysaccharide purification for vaccine production using lytic enzymes, tangential flow filtration, and multimode chromatography
US11123417B2 (en) 2018-02-05 2021-09-21 Sanofi Pasteur Inc. Multivalent pneumococcal polysaccharide-protein conjugate composition
US11147864B2 (en) 2018-02-05 2021-10-19 Sanofi Pasteur Inc. Multivalent pneumococcal polysaccharide-protein conjugate composition
WO2019152921A1 (en) * 2018-02-05 2019-08-08 Sanofi Pasteur Inc. Multivalent pneumococcal polysaccharide-protein conjugate composition
CN111757754A (zh) * 2018-02-05 2020-10-09 赛诺菲巴斯德有限公司 多价肺炎球菌多糖-蛋白质缀合物组合物
US11911452B2 (en) 2018-02-05 2024-02-27 Sanofi Pasteur Inc. Multivalent pneumococcal polysaccharide-protein conjugate composition
US11951162B2 (en) 2018-04-18 2024-04-09 Sk Bioscience Co., Ltd. Streptococcus pneumoniae capsular polysaccharides and immunogenic conjugate thereof

Also Published As

Publication number Publication date
WO2010125480A1 (en) 2010-11-04
KR20120005537A (ko) 2012-01-16
RU2536248C2 (ru) 2014-12-20
DK2424562T3 (en) 2015-12-07
CN102413838A (zh) 2012-04-11
CA2757620A1 (en) 2010-11-04
JP5823670B2 (ja) 2015-11-25
EP2424562B1 (de) 2015-10-07
KR101450958B1 (ko) 2014-10-15
MX2011011505A (es) 2011-11-18
BRPI1014494A2 (pt) 2016-08-02
US9205143B2 (en) 2015-12-08
AU2010243285B2 (en) 2013-06-06
MX340830B (es) 2016-07-26
JP2010260849A (ja) 2010-11-18
EP2424562A1 (de) 2012-03-07
RU2011143398A (ru) 2013-06-10
US20140099337A1 (en) 2014-04-10
IL215389A (en) 2016-06-30
AU2010243285A1 (en) 2011-10-27
CA2757620C (en) 2016-04-26
IL215389A0 (en) 2011-12-29
ES2552153T3 (es) 2015-11-26

Similar Documents

Publication Publication Date Title
US9205143B2 (en) Pneumococcal vaccine and uses thereof
JP7033175B2 (ja) 肺炎球菌ワクチンにおいて用いるための免疫原性組成物
JP6884145B2 (ja) 肺炎連鎖球菌ワクチンにおいて用いるための免疫原性組成物
JP2021105036A (ja) 肺炎連鎖球菌（Ｓｔｒｅｐｔｏｃｏｃｃｕｓ ｐｎｅｕｍｏｎｉａｅ）莢膜多糖体およびそれらのコンジュゲート
KR101538535B1 (ko) 15가 폐렴구균성 폴리사카라이드-단백질 접합체 백신 조성물
KR102459629B1 (ko) 폐렴구균 백신에 사용하기 위한 면역원성 조성물
TW202108167A (zh) 包含經共軛之莢膜糖抗原的致免疫性組成物、包含該致免疫性組成物之套組及彼等之用途
KR20220080201A (ko) 접합된 캡슐 사카라이드 항원을 포함하는 면역원성 조성물 및 그의 용도
US20220184199A1 (en) Immunogenic compositions comprising conjugated capsular saccharide antigens, kits comprising the same and uses thereof
JP2022512345A (ja) 免疫原性多重ヘテロ抗原多糖－タンパク質コンジュゲートおよびその使用
US20220387613A1 (en) Immunogenic compositions comprising conjugated capsular saccharide antigens and uses thereof
US20220387576A1 (en) Immunogenic compositions comprising conjugated capsular saccharide antigens and uses thereof
CN117729933A (zh) 包含缀合的荚膜糖抗原的免疫原性组合物及其用途

Legal Events

Date Code Title Description
STCB Information on status: application discontinuation

Free format text: ABANDONED -- FAILURE TO RESPOND TO AN OFFICE ACTION