US20120034603A1 - Ligation-based detection of genetic variants - Google Patents
Ligation-based detection of genetic variants Download PDFInfo
- Publication number
- US20120034603A1 US20120034603A1 US13/013,732 US201113013732A US2012034603A1 US 20120034603 A1 US20120034603 A1 US 20120034603A1 US 201113013732 A US201113013732 A US 201113013732A US 2012034603 A1 US2012034603 A1 US 2012034603A1
- Authority
- US
- United States
- Prior art keywords
- oligonucleotides
- nucleic acid
- bridging
- fixed sequence
- region
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Abandoned
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6813—Hybridisation assays
- C12Q1/6827—Hybridisation assays for detection of mutation or polymorphism
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6809—Methods for determination or identification of nucleic acids involving differential detection
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6862—Ligase chain reaction [LCR]
Definitions
- This invention relates to multiplexed selection, amplification, and detection of targeted regions from a genetic sample.
- Genetic abnormalities account for a wide number of pathologies, including pathologies caused by chromosomal aneuploidy (e.g., Down's syndrome), germline mutations in specific genes (e.g., sickle cell anemia), and pathologies caused by somatic mutations (e.g., cancer). Diagnostic methods for determining such genetic anomalies have become standard techniques for identifying specific diseases and disorders, as well as providing valuable information on disease source and treatment options.
- pathologies caused by chromosomal aneuploidy e.g., Down's syndrome
- germline mutations in specific genes e.g., sickle cell anemia
- somatic mutations e.g., cancer
- Copy-number variations are alterations of genomic DNA that correspond to relatively large regions of the genome that have been deleted or amplified on certain chromosomes. CNVs can be caused by genomic rearrangements such as deletions, duplications, inversions, and translocations. Copy number variation has been associated with various forms of cancer (Cappuzzo F, Hirsch, et al. (2005) 97 (9): 643-655) neurological disorders (Sebat, J., et al. (2007) Science 316 (5823): 445-9, including autism (Sebat, J., et al. (2007) Science 316 (5823): 445-9), and schizophrenia St Clair D (2008). Schizophr Bull 35 (1): 9-12. Detection of copy number variants of a chromosome of interest or a portion thereof in a specific cell population can be a powerful tool to identify genetic diagnostic or prognostic indicators of a disease or disorder.
- Detection of copy number variation is also useful in detecting chromosomal aneuploidies in fetal DNA.
- Conventional methods of prenatal diagnostic testing currently requires removal of a sample of fetal cells directly from the uterus for genetic analysis, using either chorionic villus sampling (CVS) between 11 and 14 weeks gestation or amniocentesis after 15 weeks.
- CVS chorionic villus sampling
- these invasive procedures carry a risk of miscarriage of around 1% Mujezinovic and Alfirevic, Obstet Gynecol 2007; 110:687-694.
- a reliable and convenient method for non-invasive prenatal diagnosis has long been sought to reduce this risk of miscarriage and allow earlier testing.
- Single nucleotide polymorphisms are single nucleotide differences at specific regions of the genome.
- the average human genome typically has more than three million SNPs when compared to a reference genome.
- SNPs have been associated with various diseases, including cancer, cardiovascular disease, cystic fibrosis, and diabetes. Detection of SNPs can be a powerful tool to identify genetic diagnostic or prognostic indicators of a disease or disorder. It is often desirable to detect many different SNPs in the same sample.
- Re-sequencing is the use of DNA sequence detection, often in a portion of the genome. Re-sequencing can be applied towards the analysis of a genetic sample from any source including mammals, other animal species, plants, bacteria, viruses, and the like. Re-sequencing can be used for many applications including but not limited to clinical applications and environmental applications. One use of re-sequencing for clinical applications is the determination of the DNA sequence in a disease causing gene. Examples of gene re-sequencing for medical diagnostic or prognostic indications include the re-sequencing of BRCA1 and BRCA2 for breast cancer risk. An example of an environmental application would be the detection of a specific pathogen in a water source.
- the present invention provides assays systems and methods for detection of copy number variation, polymorphisms, mutations and re-sequencing.
- the invention employs the technique of selecting genomic regions using fixed sequence oligonucleotides and joining them via ligation and/or extension. In a preferred aspect this is accomplished by tandem ligation, i.e. the ligation of two or more non-adjacent, fixed sequence oligonucleotides and a bridging oligonucleotide that is complementary to a region between and directly adjacent to the portion of the nucleic acid region of interest complementary to the fixed sequence oligonucleotides.
- the invention provides an assay system for detecting a nucleic acid region of interest in a genetic sample, comprising the steps of providing a genetic sample; introducing a first and second fixed sequence oligonucleotide to the genetic sample under conditions that allow the fixed sequence oligonucleotides to specifically hybridize to complementary regions in the nucleic acid of interest; introducing one or more bridging oligonucleotides under conditions that allow the fixed sequence oligonucleotides to specifically hybridize to complementary regions in the nucleic acid of interest, wherein the one or more bridging oligonucleotides are complementary to a region of the nucleic acid between and immediately adjacent to the region complementary to the first and second fixed sequence oligonucleotides; ligating the hybridized oligonucleotides to create a contiguous ligation product complementary to the nucleic acid region of interest; amplifying the contiguous ligation product to create amplification products having the sequence of the nucleic acid
- the invention provides an assay system for detecting a nucleic acid region of interest in a genetic sample, comprising the steps of providing a genetic sample; introducing a first and second fixed sequence oligonucleotide to the genetic sample under conditions that allow the fixed sequence oligonucleotides to specifically hybridize to complementary regions in the nucleic acid of interest; introducing one or more bridging oligonucleotides complementary to a region of the nucleic acid of interest between the regions complementary to the first and second fixed sequence oligonucleotides under conditions that allow the bridging oligonucleotides to specifically hybridize to the nucleic acid of interest, wherein at least one or more bases on either or both ends of the bridging oligonucleotide are not immediately adjacent to the fixed sequence oligonucleotides; extending the one or more bridging oligonucleotides so that the bridging oligonucleotides are immediately adjacent to the fixed sequence oligonu
- the relative frequency of the nucleic acid in the sample can be used to determine not only copy number variation for that particular nucleic acid region, but also in conjunction with and/or in comparison to other nucleic acids, it may be used to determine the copy number variation of larger genomic regions, including chromosomes.
- the fixed sequence oligonucleotides used in the assay system preferably comprise universal primer regions that are used in amplification of the contiguous ligation product.
- the universal primer sequences can be added to the contiguous ligation products following the ligation of the hybridized fixes sequence and bridging oligonucleotides, e.g., through the introduction of adapters comprising such universal primer sequences to the ends of the contiguous ligation product.
- the bridging oligonucleotides are preferably shorter oligonucleotides, preferably between 1-10 nucleotides and more preferably between 3-7 nucleotides, and can be designed to provide degeneracy within the sequence of the bridging oligonucleotides, e.g., the bridging oligonucleotides are provided as full or partial randomers with various sequence variations to ensure detection of the selected nucleic region even if the region contains a polymorphic reside.
- the degeneracy of the bridging oligonucleotide can be determined based on the predicted polymorphisms that may be present in the selected nucleic acid region.
- the pool of bridging oligonucleotides used in a reaction can provide degeneracy for one or more position of the bridging oligonucleotide.
- the pool of bridging oligonucleotides used in a reaction can provide degeneracy for each position of the bridging oligonucleotide.
- the pool of bridging molecules used in a reaction can provide degeneracy for each internal position of the bridging oligonucleotide, with the nucleotides adjacent to the ligation sites remaining constant in the pool of bridging oligonucleotides used within the set.
- the bridging oligo is longer than 10 nucleotides and preferably 18-30 nucleotides.
- a single bridging oligonucleotide complementary to a region of the nucleic acid of interest is hybridized between the region complementary to the first and second fixed sequence oligonucleotides.
- two or more bridging oligonucleotides are hybridized within the region between the fixed sequence oligonucleotides, and preferably the bridging oligonucleotides hybridize to adjacent regions on the nucleic acid of interest.
- ligation occurs between the fixed sequence oligonucleotides and the adjacent bridging oligonucleotides as well as between adjacent bridging oligonucleotides.
- the first and second fixed sequence oligonucleotides are introduced to the genetic sample and specifically hybridized to the complementary portions of the nucleic acids of interest prior to introduction of the bridging oligonucleotides.
- the hybridized regions are optionally isolated following the specific hybridization of the fixed sequence oligonucleotides to remove any excess unbound oligonucleotides in the reaction.
- the bridging oligonucleotides are introduced to the genetic sample at the same time the fixed sequence oligonucleotides are introduced, and all are allowed to hybridize to a contiguous portion of the nucleic acid region of interest.
- the fixed sequence oligonucleotides of the invention comprise one or more indices. These indices may serve as surrogate sequences for the identification of the nucleic acid region of interest, a locus, or a particular allele of a locus. In particular, these indices may serve as surrogate detection sequences for the detection of hybridization of the nucleic acid region of interest to an array. Other indices may be used to correspond an amplification product to a particular sample, or to identify experimental error within the assay methods. In particular assays, the amplification product from the contiguous ligation product is identified and quantified using one or more indices as a surrogate to the actual sequence of the amplification product.
- the first or second fixed sequence oligonucleotides comprise an allele index that associates a specific allele with that complementary fixed sequence oligonucleotide.
- an assay system for detecting a nucleic acid region of interest in a maternal sample comprising both maternal and fetal cell free DNA.
- This assay system comprises the steps of providing a maternal sample comprising cell free DNA from both maternal and fetal sources; introducing a first and second non-adjacent, fixed sequence oligonucleotide to the genetic sample under conditions that allow the fixed sequence oligonucleotides to specifically hybridize to complementary regions in the nucleic acid of interest; introducing one or more bridging oligonucleotides under conditions that allow the bridging oligonucleotides to specifically hybridize to complementary regions in the nucleic acid of interest, wherein one or more bridging oligonucleotides are complementary to a region of the nucleic acid between and immediately adjacent to the region complementary to the first and second fixed sequence oligonucleotides; ligating the hybridized oligonucleotides to create a contiguous ligation product complementary
- the relative frequency of the nucleic acid in the sample can be used to determine not only copy number variation for that particular nucleic acid region, but also in conjunction with and/or in comparison to other nucleic acids, it may be used to determine the copy number variation of larger genomic regions, including chromosomal imbalance between maternal and fetal nucleic acid regions due to aneuploidy in the fetus.
- the invention also provides compositions that are useful in ligation-based nucleic acid detection assays such as those of the present invention. Accordingly, the invention provides sets of oligonucleotides for ligation-based detection of a nucleic acid region of interest, comprising a first oligonucleotide that comprises sequences complementary to the sequences of a first portion of a nucleic acid region, a universal primer sequence, and optionally one or more indices; a second oligonucleotide that comprises sequences complementary to the sequence of a second portion of a nucleic acid region and a universal primer sequence; and one or more bridging oligonucleotides that are complementary to the region immediately adjacent and between the nucleic acid region complementary to the first and second oligonucleotides.
- the set of oligonucleotides comprises two or more bridging oligonucleotides with the ability to identify different polymorphisms within the nucleic acid of interest.
- the bridging molecules provide degeneracy for each position of the bridging oligonucleotide.
- the bridging molecules provide degeneracy for each internal position of the bridging oligonucleotide, with the nucleotides adjacent to the ligation sites remaining constant in the pool of bridging oligonucleotides used within the set.
- FIG. 1 illustrates a first general schematic for a ligation-based assay system of the invention.
- FIG. 2 illustrates a second general schematic for a ligation-based assay system of the invention.
- FIG. 3 illustrates a multiplexed assay system for detection of two or more regions of interest.
- FIG. 4 illustrates a first multiplexed assay system for detection of two or more alleles within a region of interest.
- FIG. 5 illustrates a second multiplexed assay system for detection of two or more alleles within a region of interest.
- FIG. 6 illustrates a third multiplexed assay system for detection of two or more alleles within a region of interest.
- FIG. 7 illustrates a fourth multiplexed assay system for detection of two or more alleles within a region of interest.
- FIG. 8 illustrates a fifth multiplexed assay system for detection of two or more alleles within a region of interest.
- FIG. 9 illustrates a first general schematic for assay system utilizing oligo extension in a ligation-based assay system of the invention.
- FIG. 10 illustrates a second general schematic for assay system utilizing oligo extension in a ligation-based assay system of the invention.
- FIG. 11 illustrates an assay system utilizing a single fixed sequence oligonucleotide.
- FIG. 12 illustrates the genotyping performance that is obtained using one exemplary assay format.
- FIG. 13 is a graph illustrating the ability of the assay system to determine percent fetal DNA in a maternal sample.
- allele index refers generally to a series of nucleotides that corresponds to a specific SNP.
- the allele index may contain additional nucleotides that allow for the detection of deletion, substitution, or insertion of one or more bases.
- the index may be combined with any other index to create one index that provides information for two properties (e.g., sample-identification index, allele-locus index).
- binding pair means any two molecules that specifically bind to one another using covalent and/or non-covalent binding, and which can be used for attachment of genetic material to a substrate. Examples include, but are not limited to, ligands and their protein binding partners, e.g., biotin and avidin, biotin and streptavidin, an antibody and its particular epitope, and the like.
- chromosomal abnormality refers to any genetic variant for all or part of a chromosome.
- the genetic variants may include but not be limited to any copy number variant such as duplications or deletions, translocations, inversions, and mutations.
- Complementary or “complementarity” are used in reference to nucleic acid molecules (i.e., a sequence of nucleotides) that are related by base-pairing rules.
- Complementary nucleotides are, generally, A and T (or A and U), or C and G.
- Two single stranded RNA or DNA molecules are said to be substantially complementary when the nucleotides of one strand, optimally aligned and with appropriate nucleotide insertions or deletions, pair with at least about 90% to about 95% complementarity, and more preferably from about 98% to about 100% complementarity, and even more preferably with 100% complementarity.
- RNA or DNA strand will hybridize under selective hybridization conditions to its complement.
- Selective hybridization conditions include, but are not limited to, stringent hybridization conditions. Stringent hybridization conditions will typically include salt concentrations of less than about 1 M, more usually less than about 500 mM and preferably less than about 200 mM. Hybridization temperatures are generally at least about 2° C. to about 6° C. lower than melting temperatures (T in ).
- correction index refers to an index that may contain additional nucleotides that allow for identification and correction of amplification, sequencing or other experimental errors including the detection of deletion, substitution, or insertion of one or more bases during sequencing as well as nucleotide changes that may occur outside of sequencing such as oligo synthesis, amplification, and any other aspect of the assay.
- diagnostic tool refers to any composition or assay of the invention used in combination as, for example, in a system in order to carry out a diagnostic test or assay on a patient sample.
- genetic sample refers to any sample comprising all or a portion of the genetic information of an organism, including but not limited to virus, bacteria, fungus, plants and animals, and in particular mammals.
- the genetic information that can be interrogated within a genetic sample includes genomic DNA (both coding and non-coding regions), mitochondrial DNA, RNA, and nucleic acid products derived from each of these. Such nucleic acid products include cDNA created from mRNA or products of pre-amplification to increase the material for analysis.
- hybridization generally means the reaction by which the pairing of complementary strands of nucleic acid occurs.
- DNA is usually double-stranded, and when the strands are separated they will re-hybridize under the appropriate conditions.
- Hybrids can form between DNA-DNA, DNA-RNA or RNA-RNA. They can form between a short strand and a long strand containing a region complementary to the short one. Imperfect hybrids can also form, but the more imperfect they are, the less stable they will be (and the less likely to form).
- identification index refers generally to a series of nucleotides that are incorporated into an oligonucleotide during oligonucleotide synthesis for identification purposes. Identification index sequences are preferably 6 or more nucleotides in length. In a preferred aspect, the identification index is long enough to have statistical probability of labeling each molecule with a target sequence uniquely. For example, if there are 3000 copies of a particular target sequence, there are substantially more than 3000 identification indexes such that each copy of a particular target sequence is likely to be labeled with a unique identification index.
- the identification index may contain additional nucleotides that allow for identification and correction of sequencing errors including the detection of deletion, substitution, or insertion of one or more bases during sequencing as well as nucleotide changes that may occur outside of sequencing such as oligo synthesis, amplification, and any other aspect of the assay.
- the index may be combined with any other index to create one index that provides information for two properties (e.g., sample-identification index, allele-locus index).
- identification index refers generally to a series of nucleotides incorporated into a primer region of an amplification process for unique identification of an amplification product of a nucleic acid region. Identification index sequences are preferably 6 or more nucleotides in length. In a preferred aspect, the identification index is long enough to have statistical probability of labeling each molecule with a target sequence uniquely. For example, if there are 3000 copies of a particular target sequence, there are substantially more than 3000 identification indexes such that each copy of a particular target sequence is likely to be labeled with a unique identification index.
- the identification index may contain additional nucleotides that allow for identification and correction of sequencing errors including the detection of deletion, substitution, or insertion of one or more bases during sequencing as well as nucleotide changes that may occur outside of sequencing such as oligo synthesis, amplification, and any other aspect of the assay.
- the index may be combined with any other index to create one index that provides information for two properties (e.g., sample-identification index, locus-identification index).
- ligase refers generally to a class of enzymes, DNA ligases (typically T4 DNA ligase), which can link pieces of DNA together. The pieces must have compatible ends—either with both of them blunt or with mutually-compatible sticky ends—and the reaction requires ATP. “Ligation” is the process of joining two pieces of DNA together.
- locus and “loci” as used herein refer to a nucleic acid regions of known location in a genome.
- locus index refers generally to a series of nucleotides that correspond to a given genomic locus.
- the locus index is long enough to label each target sequence region uniquely. For instance, if the method uses 192 target sequence regions, there are at least 192 unique locus indexes, each uniquely identifying each target region.
- the locus index may contain additional nucleotides that allow for identification and correction of sequencing errors including the detection of deletion, substitution, or insertion of one or more bases during sequencing as well as nucleotide changes that may occur outside of sequencing such as oligo synthesis, amplification, and any other aspect of the assay.
- the index may be combined with any other index to create one index that provides information for two properties (e.g. sample-identification index, allele-locus index).
- maternal sample refers to any sample taken from a pregnant mammal which comprises both fetal and maternal cell free DNA.
- maternal samples for use in the invention are obtained through relatively non-invasive means, e.g., phlebotomy or other standard techniques for extracting peripheral samples from a subject.
- melting temperature or T m is commonly defined as the temperature at which a population of double-stranded nucleic acid molecules becomes half dissociated into single strands.
- T m melting temperature
- T m 81.5+16.6(log10[Na+])0.41(%[G+C]) ⁇ 675/n ⁇ 1.0 m
- the (G+C) content is between 30% and 70%
- n is the number of bases
- m is the % age of base pair mismatches (see, e.g., Sambrook J et al., Molecular Cloning, A Laboratory Manual, 3rd Ed., Cold Spring Harbor Laboratory Press (2001)).
- Other references include more sophisticated computations, which take structural as well as sequence characteristics into account for the calculation of T m .
- “Microarray” or “array” refers to a solid phase support having a surface, preferably but not exclusively a planar or substantially planar surface, which carries an array of sites containing nucleic acids such that each site of the array comprises substantially identical or identical copies of oligonucleotides or polynucleotides and is spatially defined and not overlapping with other member sites of the array; that is, the sites are spatially discrete.
- the array or microarray can also comprise a non-planar interrogatable structure with a surface such as a bead or a well.
- the oligonucleotides or polynucleotides of the array may be covalently bound to the solid support, or may be non-covalently bound.
- array analysis refers to analysis, such as, e.g., sequence analysis, of one or more biological molecules using a microarray.
- oligonucleotides or “oligos” as used herein refers to linear oligomers of natural or modified nucleic acid monomers, including deoxyribonucleotides, ribonucleotides, anomeric forms thereof, peptide nucleic acid monomers (PNAs), locked nucleotide acid monomers (LNA), and the like, or a combination thereof, capable of specifically binding to a single-stranded polynucleotide by way of a regular pattern of monomer-to-monomer interactions, such as Watson-Crick type of base pairing, base stacking, Hoogsteen or reverse Hoogsteen types of base pairing, or the like.
- PNAs peptide nucleic acid monomers
- LNA locked nucleotide acid monomers
- oligonucleotides ranging in size from a few monomeric units, e.g., 8-12, to several tens of monomeric units, e.g., 100-200 or more.
- Suitable nucleic acid molecules may be prepared by the phosphoramidite method described by Beaucage and Carruthers (Tetrahedron Lett., 22:1859-1862 (1981)), or by the triester method according to Matteucci, et al. (J. Am. Chem. Soc., 103:3185 (1981)), both incorporated herein by reference, or by other chemical methods such as using a commercial automated oligonucleotide synthesizer.
- nucleotide refers to a base-sugar-phosphate combination. Nucleotides are monomeric units of a nucleic acid sequence (DNA and RNA).
- the term nucleotide includes ribonucleoside triphosphates ATP, UTP, CTG, GTP and deoxyribonucleoside triphosphates such as dATP, dCTP, dITP, dUTP, dGTP, dTTP, or derivatives thereof.
- Such derivatives include, for example, [ ⁇ S]dATP, 7-deaza-dGTP and 7-deaza-dATP, and nucleotide derivatives that confer nuclease resistance on the nucleic acid molecule containing them.
- nucleotide as used herein also refers to dideoxyribonucleoside triphosphates (ddNTPs) and their derivatives.
- ddNTPs dideoxyribonucleoside triphosphates
- Illustrated examples of dideoxyribonucleoside triphosphates include, but are not limited to, ddATP, ddCTP, ddGTP, ddITP, and ddTTP.
- a “nucleotide” may be unlabeled or detectably labeled by well known techniques. Fluorescent labels and their attachment to oligonucleotides are described in many reviews, including Haugland, Handbook of Fluorescent Probes and Research Chemicals, 9th Ed., Molecular Probes, Inc., Eugene Oreg. (2002); Keller and Manak, DNA Probes, 2nd Ed., Stockton Press, New York (1993); Eckstein, Ed., Oligonucleotides and Analogues: A Practical Approach , IRL Press, Oxford (1991); Wetmur, Critical Reviews in Biochemistry and Molecular Biology, 26:227-259 (1991); and the like.
- Labeling can also be carried out with quantum dots, as disclosed in the following patents and patent publications: U.S. Pat. Nos. 6,322,901; 6,576,291; 6,423,551; 6,251,303; 6,319,426; 6,426,513; 6,444,143; 5,990,479; 6,207,392; 2002/0045045; and 2003/0017264.
- Detectable labels include, for example, radioactive isotopes, fluorescent labels, chemiluminescent labels, bioluminescent labels and enzyme labels.
- Fluorescent labels of nucleotides may include but are not limited fluorescein, 5-carboxyfluorescein (FAM), 2′7′-dimethoxy-4′5-dichloro-6-carboxyfluorescein (JOE), rhodamine, 6-carboxyrhodamine (R6G), N,N,N′,N′-tetramethyl-6-carboxyrhodamine (TAMRA), 6-carboxy-X-rhodamine (ROX), 4-(4′ dimethylaminophenylazo) benzoic acid (DABCYL), Cascade Blue, Oregon Green, Texas Red, Cyanine and 5-(2′-aminoethyl)aminonaphthalene-1-sulfonic acid (EDANS).
- FAM 5-carboxyfluorescein
- JE 2′7′-dimethoxy-4′5-dichloro-6-carboxyfluorescein
- rhodamine 6-carboxyr
- fluorescently labeled nucleotides include [R6G]dUTP, [TAMRA]dUTP, [R110]dCTP, [R6G]dCTP, [TAMRA]dCTP, [JOE]ddATP, [R6G]ddATP, [FAM]ddCTP, [R110]ddCTP, [TAMRA]ddGTP, [ROX]ddTTP, [dR6G]ddATP, [dR110]ddCTP, [dTAMRA]ddGTP, and [dROX]ddTTP available from Perkin Elmer, Foster City, Calif.
- FluoroLinki DeoxyNucleotides, FluoroLink Cy3-dCTP, FluoroLink Cy5-dCTP, FluoroLink Fluor X-dCTP, FluoroLink Cy3-dUTP, and FluoroLink Cy5-dUTP available from Amersham, Arlington Heights, Ill.; Fluorescein-15-dATP, Fluorescein-12-dUTP, Tetramethyl-rodamine-6-dUTP, IR770-9-dATP, Fluorescein-12-ddUTP, Fluorescein-12-UTP, and Fluorescein-15-2′-dATP available from Boehringer Mannheim, Indianapolis, Ind.; and Chromosomee Labeled Nucleotides, BODIPY-FL-14-UTP, BODIPY-FL-4-UTP, BODIPY-TMR-14-UTP, BODIPY-TMR-14-dUTP, BODIPY-TR-14-UTP, BODIPY-TR-14-dUTP, Cas
- polymerase refers to an enzyme that links individual nucleotides together into a long strand, using another strand as a template.
- DNA polymerases which synthesize DNA
- RNA polymerases which synthesize RNA.
- sub-types of polymerases depending on what type of nucleic acid can function as template and what type of nucleic acid is formed.
- polymerase chain reaction refers to a technique for replicating a specific piece of target DNA in vitro, even in the presence of excess non-specific DNA.
- Primers are added to the target DNA, where the primers initiate the copying of the target DNA using nucleotides and, typically, Taq polymerase or the like. By cycling the temperature, the target DNA is repetitively denatured and copied. A single copy of the target DNA, even if mixed in with other, random DNA, can be amplified to obtain billions of replicates.
- the polymerase chain reaction can be used to detect and measure very small amounts of DNA and to create customized pieces of DNA. In some instances, linear amplification methods may be used as an alternative to PCR.
- polymorphism refers to any genetic changes or variants in a loci that may be indicative of that particular loci, including but not limited to single nucleotide polymorphisms (SNPs), methylation differences, short tandem repeats (STRs), and the like.
- SNPs single nucleotide polymorphisms
- STRs short tandem repeats
- a “primer” is an oligonucleotide used to, e.g., prime DNA extension, ligation and/or synthesis, such as in the synthesis step of the polymerase chain reaction or in the primer extension techniques used in certain sequencing reactions.
- a primer may also be used in hybridization techniques as a means to provide complementarity of a nucleic acid region to a capture oligonucleotide for detection of a specific nucleic acid region.
- search tool refers to any composition or assay of the invention used for scientific enquiry, academic or commercial in nature, including the development of pharmaceutical and/or biological therapeutics.
- the research tools of the invention are not intended to be therapeutic or to be subject to regulatory approval; rather, the research tools of the invention are intended to facilitate research and aid in such development activities, including any activities performed with the intention to produce information to support a regulatory submission.
- sequencing refers generally to any and all biochemical methods that may be used to determine the order of nucleotide bases including but not limited to adenine, guanine, cytosine and thymine, in one or more molecules of DNA.
- sequence determination means using any method of sequencing known in the art to determine the sequence nucleotide bases in a nucleic acid.
- sample index refers generally to a series of unique nucleotides (i.e., each sample index is unique), and can be used to allow for multiplexing of samples in a single reaction vessel such that each sample can be identified based on its sample index.
- the sample index may contain additional nucleotides that allow for identification and correction of sequencing errors including the detection of deletion, substitution, or insertion of one or more bases during sequencing as well as nucleotide changes that may occur outside of sequencing such as oligo synthesis, amplification, and any other aspect of the assay.
- the index may be combined with any other index to create one index that provides information for two properties (e.g., sample-identification index, allele-locus index).
- the invention provides assay systems to identify copy number variants of nucleic acid regions (including loci, sets of loci and larger genomic regions, e.g., chromosomes), mutations, and polymorphisms in a genetic sample and/or to select a portion of a genetic sample for re-sequencing in a genetic sample.
- the assay system utilizes methods to selectively identify and/or isolate selected nucleic acid regions from two or more genomic regions of interest (e.g., chromosomes or loci) in a genetic sample, and allows determination of an atypical copy number of a particular genomic region based on the comparison between the numbers of detected nucleic acid regions from the two or more chromosomes in the genetic sample or by comparison to one or more reference chromosomes from the same or a different sample.
- genomic regions of interest e.g., chromosomes or loci
- the assay system utilizes a tandem ligation method comprising the use of a first and second non-adjacent oligonucleotides of fixed sequence complementary to a selected nucleic acid region on a chromosome of interest or a reference chromosome, and one or more short, bridging oligonucleotides (also called “splint” oligos) complementary to the region between and immediately adjacent to the first and second oligonucleotides.
- Hybridization of these three or more oligonucleotides to a selected nucleic acid of interest, followed by ligation of these three or more oligonucleotides provides a contiguous template for further amplification, detection and quantification of this region.
- the amplified regions may be quantified directly from the amplification reactions, or they are optionally isolated and identified to quantify the number of selected nucleic acid regions in a sample.
- the tandem ligation methods use fixed sequence oligonucleotides with a set of two or more contiguous, adjacent bridging oligonucleotides that hybridize to the region of the nucleic acid between the regions complementary to the fixed sequence oligonucleotides. These bridging oligonucleotides hybridize adjacent to one another and to the fixed sequence oligonucleotides.
- the contiguous bridging oligonucleotides are ligated during the ligation reaction with the fixed sequence oligonucleotides and with each other, resulting in a single contiguous template for further amplification and sequence determination.
- the assay system uses a set of oligonucleotides that bind to non-adjacent regions within a nucleic acid region of interest, and primer extension is utilized to created a contiguous set of hybridized oligos prior to the tandem ligation step.
- the assay system utilizes a tandem ligation method comprising the use of first and second non-adjacent oligonucleotides of fixed sequence complementary to a selected nucleic acid region on a chromosome of interest or a reference chromosome, and one or more short, bridging oligonucleotides complementary to the region between the first and second oligonucleotides but not immediately adjacent to one or the other fixed sequence oligonucleotide.
- Hybridization of these three or more oligonucleotides to a selected nucleic acid of interest is followed by an extension reaction using dNTPs and a polymerase to create a set of adjacent hybridized oligonucleotides, and ligation of the adjacent hybridized oligos.
- the combination of extension and ligation provides a contiguous template for further amplification, detection and quantification of this region.
- the amplified regions may be quantified directly from the amplification reactions, or they are optionally isolated and identified to quantify the number of selected nucleic acid regions in a sample.
- the tandem ligation methods use fixed sequence oligonucleotides with a set of two or more sequential but non-adjacent bridging oligonucleotides that hybridize to the region of the nucleic acid between the regions complementary to the fixed sequence oligonucleotides.
- the “gap” regions between the fixed sequence oligonucleotides and the bridging oligos and/or between the sequential bridging oligonucleotides are ligated during the ligation reaction, resulting in a single contiguous template for further amplification and sequence determination.
- the nucleic acids from the genetic sample are associated with a substrate, e.g., using binding pairs to attach the genetic material to a substrate surface.
- a first member of a binding pair e.g., biotin
- a second member of a binding pair e.g., avidin or streptavidin
- This can be particularly useful in removing any unhybridized oligonucleotides following specific binding of the fixed sequence oligonucleotides and/or the bridging oligonucleotides to the nucleic acid of interest.
- the attached nucleic acids can be hybridized to the oligonucleotides, and the surface preferably treated to remove any unhybridized oligonucleotides, e.g., by washing or other removal methods such as degradation of such oligonucleotides as discussed in Willis et al., U.S. Pat. Nos. 7,700,323 and 6,858,412.
- nucleic acids of a genetic sample include random photobiotinylation, end-labeling with biotin, replicating with biotinylated nucleotides, and replicating with a biotin-labeled primer.
- the assay system of the invention employs a multiplexed reaction with a set of three or more such oligonucleotides for each selected nucleic acid region.
- This general aspect is illustrated in FIG. 1 .
- Each set of oligonucleotides preferably contains two oligonucleotides 101 , 103 of fixed sequence and one or more bridging oligonucleotides 113 .
- Each of the fixed sequence oligonucleotides comprises a region complementary to the selected nucleic acid region 105 , 107 , and preferably universal primer sequences 109 , 111 , i.e. oligo regions complementary to universal primers.
- These universal primer sequences 109 , 111 are used to amplify the different selected nucleic acid regions following ligation of the hybridized fixed sequence oligonucleotides and the bridging oligonucleotide.
- the universal primer sequences are located at or near the ends of the fixed sequence oligonucleotides 101 , 103 , and thus preserve the nucleic acid-specific sequences in the products of any universal amplification methods.
- Amplification products can be detected by determination of the sequence of the products, e.g., through sequence determination or hybridization, e.g., to an array or a bead-based detection system such as the LuminexTM bead-based assay (Invitrogen, Carlsbad, Calif.) or the BeadXpressTM assay (Illumina, San Diego, Calif.).
- sequence determination or hybridization e.g., to an array or a bead-based detection system such as the LuminexTM bead-based assay (Invitrogen, Carlsbad, Calif.) or the BeadXpressTM assay (Illumina, San Diego, Calif.).
- the fixed sequence oligonucleotides 101 , 103 are introduced 102 to the genetic sample 100 and allowed to specifically bind to the complementary portions of the nucleic acid region of interest 115 .
- the unhybridized fixed sequence oligonucleotides are preferably separated from the remainder of the genetic sample (not shown).
- the bridging oligonucleotide is then introduced and allowed to bind 104 to the region of the selected nucleic acid region 115 between the first 101 and second 103 fixed sequence oligonucleotides.
- the bridging oligo can be introduced simultaneously to the fixed sequence oligonucleotides.
- the bound oligonucleotides are ligated 106 to create a contiguous nucleic acid spanning and complementary to the nucleic acid region of interest.
- universal primers 117 , 119 are introduced to amplify 108 the ligated template region to create 110 products 121 that comprise the sequence of the nucleic acid region of interest.
- products 121 are optionally isolated, detected, and quantified to provide information on the presence and amount of the selected nucleic acid region in a genetic sample.
- the products are detected and quantified through sequence determination of the product, and in particular sequence determination of the region of the product corresponding to the selected nucleic acid region.
- the number of selected nucleic acid regions analyzed for each chromosome in the assay system of the invention may vary from 2-20,000 or more per chromosome analyzed. In a preferred aspect, the number of targeted regions is between 48 and 480. In another aspect, the number of targeted regions is at least 100. In another aspect, the number of targeted regions is at least 400. In another aspect, the number of targeted regions is at least 1000.
- the bridging oligos can be composed of mixture of oligos with degeneracy in each of the positions, so that the mixture of randomers used will be compatible with all reactions in the multiplexed assay requiring a bridging of the given length.
- the bridging oligos can be of various lengths so that the mixture of oligos will be compatible with particular tandem ligation reactions in the multiplexed assay requiring bridging oligos of the given lengths.
- the bridging oligo can have partial degeneracy and the multiplexed tandem ligation reactions are restricted to those that require the specific sequences provided by the degeneracy of the bridging oligos.
- a set of tandem ligation reactions may require only A and C bases in the bridging oligo, and a mixture of bridging oligos synthesized with only A and C bases would be provided for these particular tandem ligation reactions in a multiplexed assay.
- the bridging oligo sequences are designed such that only those assays that have the given specific sequences in the bridging region would be multiplexed in the assay system.
- the bridging oligo is a randomer, where all combinations of the bridging oligo are synthesized.
- the bridging oligo is specific, synthesized to match the sequences in the gap.
- the number of unique oligos synthesized would be equal to or less than the number of targeted regions. A number less than the number of targeted regions could be achieved if the gap sequence was shared between two or more targeted regions.
- the sequences of the bridging oligos are designed and the nucleic acid regions are selected so that all selected nucleic acid regions share the same base(s) at each end of the bridging oligo. For instance, one might choose selected nucleic acids and their gap location such that all of the gaps shared an “A” base at the first position and a “G” base at the last position of the gap. Any combination of a first and last base could be utilized, based upon factors such as the genome investigated, the likelihood of sequence variation in that area, and the like.
- the frequency of the dinucleotide CG is much lower than expected by the respective mononucleotide frequencies.
- the bridging oligos may be selected to have a 5′ G and a 3′ C. This base selection allows each oligo to have a high frequency in the human genome but makes it a rare event for two bridging oligos to hybridize adjacent to each other. The probability is then reduced that multiple oligos are ligated in locations of the genome that are not targeted in the assay.
- the bridging oligo is preferably added to the reaction after the fixed sequence oligonucleotides have been hybridized, and following the optional removal of all unhybridized fixed sequence oligonucleotides have been washed away.
- the conditions of the hybridization reaction are preferably optimized near the T m of the bridging oligo to prevent erroneous hybridization of oligos that are not fully complementary to the nucleic acid region. If the bridging oligos have a T m significantly lower than the fixed sequence oligonucleotides, the splint oligo is preferably added as a part of the ligase reaction.
- the advantage of using short oligos is that ligation on either end would likely occur only when all bases of the bridging oligo match the gap sequence.
- a further advantage of short bridging oligos is that the number of different oligos necessary could be less than the number of targeted sites, raising the oligos effective concentration to allow perfect matches to happen faster. Fewer oligos also has advantages in cost and quality control.
- the advantages of using fixed first and last bases with random bases in between include the ability to utilize longer bridging oligos for better specificity while reducing the number of total bridging oligos in the reaction.
- nucleic acids of interest are directly detected using the described techniques.
- the nucleic acids of interest are associated with one or more indices that are identifying for a selected nucleic acid region or a particular sample being analyzed.
- the detection of the one or more indices can serve as a surrogate detection mechanism of the selected nucleic acid region, or as confirmation of the presence of a particular selected nucleic acid region if both the index and the sequence of the nucleic acid region itself are determined.
- indices are preferably associated with the selected nucleic acids during an amplification step using primers that comprise both the index and sequence regions that specifically hybridize to the nucleic acid region.
- the primers used for amplification of a selected nucleic acid region are designed to provide a locus index between the selected nucleic acid region primer region and a universal amplification region.
- the locus index is unique for each selected nucleic acid region and representative of a locus on a chromosome of interest or reference chromosome, so that quantification of the locus index in a sample provides quantification data for the locus and the particular chromosome containing the locus.
- the primers used for amplification of the selected nucleic acid regions to be analyzed for a genetic sample are designed to provide a random index between the selected nucleic acid region primer region and a universal amplification region.
- a sufficient number of identification indices are present to uniquely identify each selected nucleic acid region in the sample.
- Each nucleic acid region to be analyzed is associated with a unique identification index, so that the identification index is uniquely associated with the selected nucleic acid region.
- Quantification of the identification index in a sample provides quantification data for the associated selected nucleic acid region and the chromosome corresponding to the selected nucleic acid region.
- the identification locus may also be used to detect any amplification bias that occurs downstream of the initial isolation of the selected nucleic acid regions from a sample.
- only the locus index and/or the identification index (if present) are detected and used to quantify the selected nucleic acid regions in a sample.
- a count of the number of times each locus index occurs with a unique identification index is done to determine the relative frequency of a selected nucleic acid region in a sample.
- the primers are preferably designed so that indices comprising identifying information are coded at the ends of the primer flanking the region complementary to the nucleic acid of interest.
- the indices are non-complementary but unique sequences used within the primer to provide information relevant to the selective nucleic acid region that is isolated and/or amplified using the primer.
- the advantage of this is that information on the presence and quantity of the selected nucleic acid region can be obtained without the need to determine the actual sequence itself, although in certain aspects it may be desirable to do so.
- the ability to identify and quantify a selected nucleic acid region through identification of one or more indices will decrease the length of sequencing required as the loci information is captured at the 3′ or 5′ end of the isolated selected nucleic acid region.
- Use of indices as a surrogate for identification of selected nucleic acid regions may also reduce error since longer sequencing reads are more prone to the introduction or error.
- index-specific indices and identification indices can be introduced to primers to assist in the multiplexing of samples.
- indices which identify sequencing error which allow for highly multiplexed amplification techniques or which allow for hybridization or ligation or attachment to another surface can be added to the primers. The order and placement of these indices, as well as the length of these indices, can vary.
- the primers used for identification and quantification of a selected nucleic acid region may be associated with regions complementary to the 5′ of the selected nucleic acid region, regions complementary to the 5′ of the selected nucleic acid region, or in certain amplification regimes the indices may be present on one or both of a set of amplification primers complementary to the selected nucleic acid region.
- the primers can be used to multiplex the analysis of multiple selected nucleic acid regions to be analyzed within a sample, and can be used either in solution or on a solid substrate, e.g., on a microarray or on a bead. These primers may be used for linear replication or amplification, or they may create circular constructs for further analysis.
- one or both of the fixed sequence oligonucleotides further contain an index region.
- This index region may comprise a number of different sequences that can be used to identify the selected nucleic acid region and/or the sample being analyzed in the assay system.
- the index region corresponds to the selected nucleic acid region, so that identification of the index region can be used as a surrogate for detection of the actual sequence of the selected nucleic acid region.
- the index region may optionally comprise a sample index to correspond the oligo set to a particular genetic sample in a multiplexed assay system.
- FIG. 2 illustrated the use of a single index region 221 on a first fixed sequence oligonucleotide 201 in an oligo set for a selected nucleic acid region.
- the fixed sequence oligonucleotides 201 , 203 are introduced 202 to the genetic sample 200 and allowed to specifically bind to the selected nucleic acid region 215 .
- the unhybridized fixed sequence oligonucleotides are preferably separated from the remainder of the genetic sample (not shown).
- the bridging oligo is then introduced and allowed to hybridize 204 to the region of the selected nucleic acid region 215 between the first 201 and second 203 fixed sequence oligonucleotides.
- the bound oligonucleotides are ligated 206 to create a contiguous nucleic acid spanning and complementary to the nucleic acid region of interest.
- universal primers 217 , 219 are introduced to amplify 208 the ligated template region to create 210 products 223 that comprise the sequence of the nucleic acid region of interest.
- products 223 are optionally isolated, detected, and/or quantified to provide information on the presence and amount of the selected nucleic acid region in a genetic sample.
- the products are detected and quantified through sequence determination of the index, thus obviating the need for determining the actual sequences of the selected nucleic acid region.
- the index permits unique hybridization to a feature on an array, such hybridization leading to the detection and quantification of the sequences.
- FIG. 3 illustrates an example where two different selected nucleic acid regions are detected in a single tandem reaction assay.
- Two sets of fixed sequence oligonucleotides ( 301 and 303 , 323 and 325 ) that specifically hybridize to two different nucleic acid regions 315 , 331 are introduced 302 to a genetic sample and allowed to hybridize 304 to the respective nucleic acid regions.
- Each set comprises an oligonucleotide 301 , 323 having a sequence specific region 305 , 327 , a universal primer region 309 and an index region 321 , 335 .
- the other fixed sequence oligonucleotide of the sets comprises a sequence specific region 307 , 329 and a universal primer region 311 .
- the unhybridized fixed sequence oligonucleotides are preferably separated from the remainder of the genetic sample (not shown).
- the bridging oligos 313 , 333 are introduced to the hybridized fixed sequence oligonucleotide/nucleic acid regions and allowed to hybridize 306 to these regions.
- the same bridging oligo may be suitable for both hybridization events, or they may be two oligos from a pool of degenerate oligos that are used with multiple tandem ligation events.
- the bound oligonucleotides are ligated 308 to create a contiguous nucleic acid spanning and complementary to the nucleic acid region of interest.
- universal primers 317 , 319 are introduced to amplify 310 the ligated template regions to create 312 amplification products 337 , 339 that comprise the sequence of the nucleic acid regions of interest.
- These products 337 , 339 are optionally isolated, detected and/or quantified to provide information on the presence and amount of the selected nucleic acid region in a genetic sample.
- the products are detected and quantified through sequence determination of the different indices, thus obviating the need for determining the actual sequences of the selected nucleic acid region.
- the index may be a sample specific index as well as a region specific index, and thus the index may not only identify the nucleic acid region, but it may also provide information of the nucleic acid region and the genetic sample from which the region was obtained.
- the nucleic acid region of the product may be detected, for example, to provide internal confirmation of the results or where the index provides solely sample information and is not informative of the selected nucleic acid region.
- the assay system of the invention detects one or more regions that comprise a polymorphism.
- This methodology is not primarily designed to identify a particular allele, e.g., as maternal versus fetal, but rather to ensure that different alleles corresponding to a nucleic acid region of interest are included in the quantification methods of the invention.
- the invention is intended to encompass both mechanisms for detection of SNP-containing nucleic acid regions for direct determination of copy number variant through quantification as well as detection of SNP for ensuring overall efficiency of the assay.
- allele-discrimination is provided through the bridging oligo.
- the bridging oligo is located over a SNP.
- the polymorphism is preferably located close enough to one end of a ligation reaction as to provide allele-specificity.
- both complementary allele bridging oligo variants are present in the same reaction mixture and allele detection results from subsequent sequencing through the polymorphism of the ligated products or their amplification products.
- FIG. 4 illustrates this aspect.
- two fixed sequence oligonucleotides 401 , 403 and bridging oligonucleotides corresponding to the two possible SNPs in the nucleic acid regions of interest 415 , 429 are used in detection of the selected nucleic acid region, and preferably to detect the region in a single reaction.
- Each of the fixed sequence oligonucleotides comprises a region complementary to the selected nucleic acid region 405 , 407 , and universal primer sequences 409 , 411 used to amplify the different selected nucleic acid regions following initial selection and/or isolation of the selected nucleic acid regions from the genetic sample.
- the universal primer sequences are located at the proximal ends of the fixed sequence oligonucleotides 401 , 403 , and thus preserve the nucleic acid-specific sequences in the products of any universal amplification methods.
- the fixed sequence oligonucleotides 401 , 403 are introduced 402 to the genetic sample 400 and allowed to specifically bind to the selected nucleic acid region 415 , 429 .
- the unhybridized fixed sequence oligonucleotides are preferably separated from the remainder of the genetic sample (not shown).
- the bridging oligos corresponding to an A/T SNP 413 or a G/C SNP 433 are introduced and allowed to bind 404 to the region of the selected nucleic acid region 415 , 429 between the first 401 and second 403 fixed sequence oligonucleotides.
- the bridging oligos 413 , 433 can be introduced to the sample simultaneously with the fixed sequence oligonucleotides.
- the bound oligonucleotides are ligated 406 to create a contiguous nucleic acid spanning and complementary to the nucleic acid region of interest.
- universal primers 417 , 419 are introduced to amplify 408 the ligated template region to create 410 products 421 , 423 that comprise the sequence of the nucleic acid region of interest representing both SNPs in the selected nucleic acid region.
- products 421 , 423 are detected and quantified through sequence determination of the product, and in particular the region of the product containing the SNP in the selected nucleic acid region.
- the allele detection results from the sequencing of a locus index or an allele index which is provided in one or both of the fixed sequence nucleic acid region oligonucleotides.
- the locus index and/or allele index is embedded in either the first or second fixed sequence oligonucleotide used in the set for a selected nucleic acid region containing a polymorphism, and is used with either a specific fixed sequence oligo or with a particular bridging oligo, either of which may be designed to detect the polymorphism.
- Detection of the locus index and/or the allele index in an amplification product allows detection of the presence, amount or absence of a specific allele present in a genetic sample, as well as the number of counts for the region through addition of the polymorphic regions detected in the sample. Two examples of how this may be performed are described in more detail below.
- two or more separate reactions are carried out using a single locus index and different bridging oligos corresponding to the different polymorphisms in the region complementary to the bridging oligos.
- the reactions are differentiated by the bridging oligo, and the ligation, amplification and detection reactions comprising the different bridging oligos remain separate through the detection step.
- the total counts for a particular nucleic acid region of interest can be determined mathematically using the locus index by adding the detected numbers of the counts for the nucleic acid region from the separate reactions comprising the bridging oligos having different polymorphic sequences.
- This aspect may be useful for, e.g., circumstances in which both information on polymorphic frequency in a sample and information on total loci counts are desirable. Since the reactions are detected separately, only one index may be needed for detection in each of the separate reactions, although separate allele indices may also be used in the separate reactions.
- FIG. 5 illustrates one such aspect of the assay system of the invention.
- Two fixed sequence oligonucleotides 501 , 503 and bridging oligonucleotides corresponding to the two possible SNPs in the selected nucleic acid region 515 , 525 are used in detection of a nucleic acid region of interest.
- Each of the fixed sequence oligonucleotides comprises a region complementary to the selected nucleic acid region.
- the ligation, amplification, and detection steps of the assay system take place in two separate reactions, with a first reaction utilizing a first bridging oligo 513 and the second reaction utilizing a second bridging oligo 533 .
- Both reactions utilize the same fixed sequence oligos 501 , 503 having the same regions complementary to allele-specific regions 505 , 507 .
- a single locus index 521 can be used to detect the amplification products in each reaction so that sequence determination of the actual sequence of the nucleic acids of interest are not necessarily needed, although they may still be determined to identify or provide confirmation of the sequence.
- the universal primer sequences 509 , 511 are located at either end flanking the fixed sequence oligonucleotides 501 , 503 , and thus preserve the nucleic acid-specific sequences and the indices in the products of any universal amplification methods.
- the fixed sequence oligonucleotides 501 , 503 are introduced 502 to the genetic sample 500 and allowed to specifically bind to the selected nucleic acid region 515 , 525 . Following hybridization, the unhybridized fixed sequence oligonucleotides are preferably separated from the remainder of the genetic sample (not shown).
- the bridging oligos corresponding to an A/T SNP 513 or a G/C SNP 533 are introduced to each reaction and allowed to bind 504 to the region of the selected nucleic acid region 515 , 525 between the first 505 and second 507 fixed sequence oligonucleotides.
- the bridging oligos 513 , 533 can be introduced to the sample simultaneously with the fixed sequence oligonucleotides.
- the bound oligonucleotides are ligated 506 to create a contiguous nucleic acid spanning and complementary to the nucleic acid region of interest.
- universal primers 517 , 519 are introduced to amplify 508 the ligated template region to create 510 products 527 , 529 that comprise the sequence of the nucleic acid region of interest representing both SNPs in the selected nucleic acid region.
- products 527 , 529 are detected and quantified through sequence determination of the product, and in particular the locus index combined with the knowledge of which bridging oligo was added to which reaction.
- the counts for the nucleic acid region as a whole can be determined through addition of the detected polymorphic regions in the genetic samples.
- a different specific aspect of the invention utilizes allele indices to identify alleles comprising different polymorphisms as well as to determine counts of the nucleic acid region of interest.
- locus indices may be combined with allele indices.
- two or more separate ligation reactions are carried out using two or more different bridging oligos corresponding to the different polymorphisms in the region complementary to the bridging oligos. The reactions are differentiated by the bridging oligo, and each bridging oligo is used with a fixed sequence oligo comprising an allele index that identifies that particular bridging oligo.
- the reactions can be combined either prior to amplification, since the same universal primers are preferably used, or prior to detection, as the different alleles can be distinguished through identification of the different allele-specific indices.
- the allele may also be distinguished through sequence determination of the allele index or alternatively from hybridizing of the allele index, and total counts for the nucleic acid region can be determined through the addition of the identified allelic regions.
- two fixed sets of sequence oligonucleotides are used which comprise substantially the same sequence-specific regions 605 , 607 but which comprise different indices, 621 , 623 on one of the fixed sequence oligonucleotides of the set.
- the ligation reactions are carried out with material from the same genetic sample 600 , but in separate tubes with the different allele-specific oligo sets.
- the bridging oligonucleotides corresponding to the two possible SNPs in the selected nucleic acid region 613 , 633 are used in detection of the selected nucleic acid region in each ligation reaction.
- Each of the fixed sequence oligonucleotides comprises a region complementary to the selected nucleic acid region 605 , 607 , and universal primer sequences 609 , 611 used to amplify the different selected nucleic acid regions following initial selection and/or isolation of the selected nucleic acid regions from the genetic sample.
- the universal primer sequences are located at the ends of the fixed sequence oligonucleotides 601 , 603 , and 623 flanking the indices and the regions complementary to the nucleic acid of interest, thus preserving the nucleic acid-specific sequences and the allele indices in the products of any universal amplification methods.
- the fixed sequence oligonucleotides 601 , 603 , 623 are introduced 602 to an aliquot of the genetic sample 600 and allowed to specifically bind to the selected nucleic acid regions 615 or 625 . Following hybridization, the unhybridized fixed sequence oligonucleotides are preferably separated from the remainder of the genetic sample (not shown).
- the bridging oligos corresponding to an A/T SNP 613 or a G/C SNP 633 are introduced and allowed to bind 604 to the region of the selected nucleic acid region 615 or 625 between the first 605 and second 607 nucleic acid-complementary regions of the fixed sequence oligonucleotides.
- the bridging oligos 613 , 633 can be introduced to the sample simultaneously with the fixed sequence oligonucleotides.
- the bound oligonucleotides are ligated 606 in the single reaction mixture to create a contiguous nucleic acid spanning and complementary to the nucleic acid region of interest.
- the separate reactions are preferably combined for the universal amplification and detection steps.
- Universal primers 617 , 619 are introduced to the combined reactions to amplify 608 the ligated template regions and create 610 products 627 , 629 that comprise the sequence of the nucleic acid region of interest representing both SNPs in the selected nucleic acid region. These products 627 , 629 are detected and quantified through sequence determination of the product, through the allele index and/or the region of the product containing the SNP in the selected nucleic acid region.
- the products of the FIG. 6 methods are detected and quantified through sequence determination of the allele indices, thus obviating the need for determining the actual sequences of the selected nucleic acid region.
- the indices used with the assay systems of the invention can also be used to identify polymorphisms that are associated with the fixed sequences used for the detection of nucleic acids of interest.
- an allele index is associated with an allele-specific fixed sequence oligonucleotide, and the allele detection results from the sequencing of an allele index or alternatively from hybridizing of an allele index which is provided in the nucleic acid region primer.
- the allele index is embedded in either the allele-specific first or second fixed sequence oligonucleotide used in the set for a selected nucleic acid region containing a polymorphism.
- an allele index is present on both the first and second fixed sequence oligonucleotides to detect two or more polymorphisms within the fixed sequence regions.
- the number of fixed sequence oligonucleotides used in such aspects can corresponds to the number of possible alleles being assessed for a selected nucleic acid region, and sequence determination or hybridization of the allele index can detect presence, amount or absence of a specific allele is a genetic sample.
- FIG. 7 illustrates this aspect of the invention.
- three fixed sequence oligonucleotides 701 , 703 and 723 are used.
- Two of the fixed sequence oligonucleotides 701 , 723 are allele-specific, comprising a region complementary to an allele in a nucleic acid region comprising for example an A/T or G/C SNP, respectively.
- Each fixed allele-specific oligonucleotides 701 , 723 also comprises a corresponding allele index 721 , 731 and a universal primer sequence 709 .
- the second fixed sequence oligonucleotide 703 has another universal primer sequence 711 , and these universal primer sequences are used to amplify the ⁇ nucleic acid regions following initial selection and/or isolation of the nucleic acid regions from the genetic sample.
- the universal primer sequences are located at the ends of the fixed sequence oligonucleotides 701 , 703 , 723 flanking the indices and the nucleic acid regions of interest, and thus preserve the nucleic acid-specific sequences and the indices in the products of any universal amplification methods.
- the fixed sequence oligonucleotides 701 , 703 , 723 are introduced 702 to the DNA sample 700 and allowed to specifically bind to the selected nucleic acid region 715 , 725 . Following hybridization, the unhybridized fixed sequence oligonucleotides are preferably separated from the remainder of the genetic sample (not shown).
- the bridging oligos 713 are introduced and allowed to bind 704 to the nucleic acid 715 complementary to the region between the first allele-specific fixed sequence oligonucleotide region 705 and the other fixed sequence oligonucleotide region 707 or to the nucleic acid 725 complementary to the region between the second allele-specific fixed sequence oligonucleotide region 735 and the other fixed sequence oligonucleotide region 707 .
- the bridging oligos 713 can be introduced to the sample simultaneously with the sets of fixed sequence oligonucleotides.
- the bound oligonucleotides are ligated 706 to create a contiguous nucleic acid spanning and complementary to the nucleic acid region of interest.
- the ligation primarily occurs only when the allele-specific ends match.
- universal primers 717 , 719 are introduced to amplify 708 the ligated template region to create 710 products 727 , 729 that comprise the sequence of the nucleic acid region of interest representing both SNPs in the selected nucleic acid region.
- These products 727 , 729 are detected and quantified through sequence determination of the product, and in particular the region of the product containing the SNP in the selected nucleic acid region.
- the products 727 , 729 are detected and quantified through hybridization of the allele index to different features on an array.
- a fluorescent label is incorporated into the products 727 , 729 during the universal amplification by amplifying with primers 717 or 719 that are fluorescently labeled.
- the ligation 706 is allele-specific.
- the allele specifying nucleotide must be close to the ligated end.
- the allele-specific nucleotide must be within 5 nucleotides of the ligated end.
- the allele-specific nucleotide is the terminal base.
- the allele detection results from the hybridization of a locus index to an array.
- Each allele is detected through an allele-specific labeling step, where each allele is labeled with a spectrally distinct fluorescent label during the universal amplification.
- FIG. 8 illustrates this aspect of the invention.
- three fixed sequence oligonucleotides 801 , 803 and 823 are used.
- Two of the fixed sequence oligonucleotides 801 , 823 are allele-specific comprising a region matching a particular allele in the same selected nucleic acid region, a corresponding locus index 821 and allele-specific universal primer sequences 809 , 839 .
- the matching fixed sequence oligonucleotide 803 has another universal primer sequence 811 .
- the universal primer sequences are used to amplify the different selected nucleic acid regions following initial selection and/or isolation of the selected nucleic acid regions from the genetic sample and incorporate a label into the amplification products that distinguish each allele.
- the universal primer sequences are located at the proximal ends of the fixed sequence oligonucleotides 801 , 803 , 823 and thus preserve the nucleic acid-specific sequences and the indices in the products of any universal amplification methods.
- the fixed sequence oligonucleotides 801 , 803 , 823 are introduced 802 to the DNA sample 800 and allowed to specifically bind to the selected nucleic acid region 815 , 825 . Following hybridization, the unhybridized fixed sequence oligonucleotides are preferably separated from the remainder of the genetic sample (not shown).
- the bridging oligos 813 are introduced and allowed to bind 804 to the region of the selected nucleic acid region 815 , 825 between the first 805 and second 807 fixed sequence oligonucleotides and between the first 835 and second 807 fixed sequence oligonucleotides. Alternatively, the bridging oligos 813 can be introduced to the sample simultaneously with the fixed sequence oligonucleotides.
- the bound oligonucleotides are ligated 806 to create a contiguous nucleic acid spanning and complementary to the nucleic acid region of interest.
- the ligation primarily occurs only when the allele-specific ends match.
- universal primers 817 , 819 , 837 are introduced to amplify 808 the ligated template region to create 810 products 827 , 829 that comprise the sequence of the nucleic acid region of interest representing both SNPs in the selected nucleic acid region.
- the universal primers 817 and 837 have spectrally distinct fluorescent labels such that the allele-specific information is retained through these fluorescent labels.
- the ligation 806 is preferably allele-specific.
- the allele specifying nucleotide must be close to the ligated end.
- the allele-specific nucleotide must be within 5 nucleotides of the ligated end.
- the allele-specific nucleotide is the terminal base.
- an allele index is present on both the first and second fixed sequence oligonucleotides to detect a polymorphism at both ends with a corresponding spectrally distinct fluorescent label for each fixed sequence oligonucleotide for a given allele.
- the number of fixed sequence oligonucleotides corresponds to the number of possible alleles being assessed for a selected nucleic acid region.
- the fixed sequence oligonucleotides are represented as two distinct oligonucleotides.
- the fixed sequence oligonucleotides may be opposite ends of the same oligonucleotide.
- the bridging oligos used hybridize to regions of the nucleic acid of interest that are adjacent to the regions complementary to the fixed sequence oligonucleotides, so that when the fixed sequence and bridging oligo(s) specifically hybridize they are directly adjacent to one another for ligation.
- the bridging oligo hybridizes to a region that is not directly adjacent to the region complementary to one or both of the fixed sequence oligos, and an intermediate step requiring extension of one or more of the oligos is necessary prior to ligation.
- each set of oligonucleotides preferably contains two oligonucleotides 901 , 903 of fixed sequence and one or more bridging oligonucleotides 913 .
- Each of the fixed sequence oligonucleotides comprises a region complementary to the selected nucleic acid region 905 , 907 , and preferably universal primer sequences 909 , 911 , i.e. oligo regions complementary to universal primers.
- the universal primer sequences 909 , 911 are located at or near the ends of the fixed sequence oligonucleotides 901 , 903 , and thus preserve the nucleic acid-specific sequences in the products of any universal amplification methods.
- the fixed sequence oligonucleotides 901 , 903 are introduced 902 to the genetic sample 900 and allowed to specifically bind to the complementary portions of the nucleic acid region of interest 915 .
- the unhybridized fixed sequence oligonucleotides are preferably separated from the remainder of the genetic sample (not shown).
- the bridging oligonucleotide is then introduced and allowed to bind 904 to the region of the selected nucleic acid region 915 between the first 901 and second 903 fixed sequence oligonucleotides.
- the bridging oligo can be introduced simultaneously to the fixed sequence oligonucleotides.
- the bridging oligo hybridizes to a region directly adjacent to the first fixed sequence oligo region 905 , but is separated by one or more nucleotides from the complementary region of the second fixed sequence oligonucleotide 907 .
- the bridging oligo 913 is extended 906 , e.g., using a polymerase and dNTPs, to fill the gap between the bridging oligo 913 and the second fixed sequence oligo 903 .
- the bound oligonucleotides are ligated 908 to create a contiguous nucleic acid spanning and complementary to the nucleic acid region of interest 915 .
- universal primers 917 , 919 are introduced 910 to amplify the ligated template region to create 912 products 923 that comprise the sequence of the nucleic acid region of interest.
- These products 923 are optionally isolated, detected, and quantified to provide information on the presence and amount of the selected nucleic acid region in a genetic sample.
- the products are detected and quantified through sequence determination of an identification index 921 , or, alternatively, sequence determination of the nucleic acid of interest 915 within the amplification product 923 .
- each set of oligonucleotides preferably contains two oligonucleotides 1001 , 1003 of fixed sequence and two or more bridging oligonucleotides 1013 , 1033 that bind to non-adjacent regions on a nucleic acid of interest 1015 .
- Each of the fixed sequence oligonucleotides comprises a region complementary to the selected nucleic acid region 1005 , 1007 , and preferably universal primer sequences 1009 , 1011 , i.e. oligo regions complementary to universal primers.
- the universal primer sequences 1009 , 1011 are located at or near the ends of the fixed sequence oligonucleotides 1001 , 1003 , and thus preserve the nucleic acid-specific sequences in the products of any universal amplification methods.
- the fixed sequence oligonucleotides 1001 , 1003 are introduced 1002 to the genetic sample 1000 and allowed to specifically bind to the complementary portions of the nucleic acid region of interest 1015 . Following hybridization, the unhybridized fixed sequence oligonucleotides are preferably separated from the remainder of the genetic sample (not shown).
- two separate bridging oligonucleotides 1013 , 1033 are introduced and allowed to bind 1004 to the region of the selected nucleic acid region 1015 between but not immediately adjacent to both the first 1001 and second 1003 fixed sequence oligonucleotides.
- the bridging oligo can be introduced simultaneously to the fixed sequence oligonucleotides.
- the first bridging oligo 1033 hybridizes to a region directly adjacent to the first fixed sequence oligo region 1005 , but is separated by one or more nucleotides from the complementary region of the second bridging oligo 1013 .
- the second bridging oligo 1013 is also separated from the second fixed sequence oligonucleotide 1007 by one or more nucleotides.
- both bridging oligos 1013 , 1033 are extended 1006 , e.g., using a polymerase and dNTPs, to fill the gap between the bridging oligos and the gap between the second bridging oligo 1013 and the second fixed sequence oligo 1003 .
- the bound oligonucleotides are ligated 1008 to create a contiguous nucleic acid spanning and complementary to the nucleic acid region of interest 1015 .
- universal primers 1017 , 1019 are introduced 910 to amplify the ligated template region to create 1012 products 1023 that comprise the sequence of the nucleic acid region of interest.
- These products 1023 are optionally isolated, detected, and quantified to provide information on the presence and amount of the selected nucleic acid region in a genetic sample.
- the products are detected and quantified through sequence determination of an identification index 1021 , or, alternatively, sequence determination of the nucleic acid of interest 1015 within the amplification product 1023 .
- the single fixed sequence oligonucleotide 1101 is complementary to the selected nucleic acid region 1115 on both ends.
- this single fixed sequence oligonucleotide 1101 hybridizes to the selected nucleic acid region 1115 , it forms a pre-circle oligonucleotide 1103 where the ends are separated by several nucleotides.
- the bridging oligonucleotide 1113 then binds between the complementary regions 1105 , 1107 of the pre-circle oligonucleotide 1103 to fill this gap.
- oligonucleotide regions 1105 , 1107 of the pre-circle oligonucleotide 1103 bound to the genetic sample 1115 are then ligated together with the bridging oligonucleotide 1113 , forming a complete circle.
- the circular template is then preferably cleaved, and amplified using one or more of the universal primer sites.
- a single universal primer region is used to replicate the template using techniques such as rolling circle replication, as disclosed in Lizardi et al., U.S. Pat. No. 6,558,928.
- this fixed sequence oligonucleotide has two universal priming sites 1109 , 1111 on the circular template and optionally one or more indices 1121 between the ends that are complementary to the selected nucleic acid region.
- a cleavage site 1123 exists between the two universal priming sites.
- a nuclease can be used to remove all or most uncircularized oligonucleotides. After the removal of the uncircularized oligonucleotides, the circularized oligonucleotide is cleaved 1106 , preserving and in some aspects exposing the universal priming sites 1109 , 1111 . Universal primers 1117 , 1119 are added 1108 and a universal amplification occurs 1110 to create 1112 products 1125 that comprise the sequence of the nucleic acid region of interest.
- the products 1125 are detected and quantified through sequence determination of selected nucleic acid region or alternatively the index, which obviates the need for determining the actual sequences of the selected nucleic acid region. In other aspects, however, it is desirable to determine the product comprising sequences of both the index and the selected nucleic acid region, for example, to provide internal confirmation of the results or where the index provides sample information and is not informative of the selected nucleic acid region. As mentioned above, this single fixed sequence oligonucleotide methodology may be applied to any of the examples in FIGS. 1-10 .
- the assay system of the invention can be used to resequence a complex nucleic acid.
- the tandem ligation methods have been found to be exceptionally efficient, and this high efficiency allows the methodology to be expanded to the use of multiple oligos, preferably 2-100 or even more, that bind to nucleic acid regions of interest.
- the bridging oligos would be short, preferably between 1-10, more preferably between 2-7, even more preferably between 3-5 nucleotides in length, and the number of bridging oligos used in a tandem ligation reaction would be approximately 10-50. In a preferred aspect, the bridging oligos would be 5 bases in length and there would be approximately 15-30 ligations.
- the bridging oligos might be selected to provide degeneracy for all possible sequence variants for the particular oligo length, for instance all sequence variations of 5-mers.
- one the ligated oligos can be amplified using the universal amplification techniques described herein, and sequence determination of the amplified products to identify the underlying sequence.
- This multiple ligation assay would provide the ability to target multiple sections of the genome simultaneously through universally amplification of tandem ligation products, and determination of their nucleotide composition.
- universal amplification is used to amplify the ligation products created following hybridization of the fixed sequence oligonucleotides and the bridging oligonucleotides. In a multiplexed assay system, this is preferably done through universal amplification of the various nucleic acid regions to be analyzed using the assay systems of the invention.
- Universal primer sequences are added to the contiguous ligation products so that they may be amplified in a single universal amplification reaction. These universal primer sequences are preferably introduced in the fixed sequence oligonucleotides, although they may also be added to the proximal ends of the contiguous ligation products following ligation. The introduction of universal primer regions to the fixed sequence oligonucleotides allows a subsequent controlled universal amplification of all or a portion of selected nucleic acids prior to or during analysis, e.g. sequence determination.
- Bias and variability can be introduced during DNA amplification, such as that seen during polymerase chain reaction (PCR).
- PCR polymerase chain reaction
- loci will amplify at different rates or efficiency. Part of this may be due to the variety of primers in a multiplex reaction with some having better efficiency (i.e. hybridization) than others, or some working better in specific experimental conditions due to the base composition.
- Each set of primers for a given locus may behave differently based on sequence context of the primer and template DNA, buffer conditions, and other conditions.
- the whole tandem ligation reaction or an aliquot of the tandem ligation reaction may be used for the universal amplification.
- Using an aliquot allows different amplification reactions to be undertaken using the same or different conditions (e.g., polymerase, buffers, and the like), e.g., to ensure that bias is not inadvertently introduced due to experimental conditions.
- variations in primer concentrations may be used to effectively limit the number of sequence specific amplification cycles.
- the universal primer regions of the primers or adapters used in the assay system are designed to be compatible with conventional multiplexed assay methods that utilize general priming mechanisms to analyze large numbers of nucleic acids simultaneously.
- Such “universal” priming methods allow for efficient, high volume analysis of the quantity of nucleic acid regions present in a genetic sample, and allow for comprehensive quantification of the presence of nucleic acid regions within such a genetic sample for the determination of aneuploidy.
- Examples of such assay methods include, but are not limited to, multiplexing methods used to amplify and/or genotype a variety of samples simultaneously, such as those described in Oliphant et al., U.S. Pat. No. 7,582,420.
- Some aspects utilize coupled reactions for multiplex detection of nucleic acid sequences where oligonucleotides from an early phase of each process contain sequences which may be used by oligonucleotides from a later phase of the process.
- Exemplary processes for amplifying and/or detecting nucleic acids in samples can be used, alone or in combination, including but not limited to the methods described below, each of which are incorporated by reference in their entirety.
- the assay system of the invention utilizes one of the following combined selective and universal amplification techniques: (1) LDR coupled to PCR; (2) primary PCR coupled to secondary PCR coupled to LDR; and (3) primary PCR coupled to secondary PCR.
- padlock probes also called “precircle probes” or “multi-inversion probes”
- LDR coupled ligase detection reaction
- PCR polymerase chain reaction
- Ronaghi et al. U.S. Pat. No. 7,622,281 describes amplification techniques for labeling and amplifying a nucleic acid using an adapter comprising a unique primer and a barcode.
- sequence determination is compatible with the assay systems of the inventions.
- methods include “next generation” methods of sequencing.
- Exemplary methods for sequence determination include, but are not limited to, including, but not limited to, hybridization-based methods, such as disclosed in Drmanac, U.S. Pat. Nos. 6,864,052; 6,309,824; and 6,401,267; and Drmanac et al, U.S. patent publication 2005/0191656, which are incorporated by reference, sequencing by synthesis methods, e.g., Nyren et al, U.S. Pat. No. 7,648,824, U.S. Pat. No. 7,459,311 and U.S. Pat. No.
- nucleic acid regions of interest can be selected and/or identified using hybridization techniques.
- Methods for conducting polynucleotide hybridization assays for detection of have been well developed in the art. Hybridization assay procedures and conditions will vary depending on the application and are selected in accordance with the general binding methods known including those referred to in: Maniatis et al. Molecular Cloning: A Laboratory Manual (2 nd Ed. Cold Spring Harbor, N.Y., 1989); Berger and Kimmel Methods in Enzymology, Vol. 152, Guide to Molecular Cloning Techniques (Academic Press, Inc., San Diego, Calif., 1987); Young and Davis, P.N.A.S, 80: 1194 (1983).
- the present invention also contemplates signal detection of hybridization between ligands in certain preferred aspects. See U.S. Pat. Nos. 5,143,854, 5,578,832; 5,631,734; 5,834,758; 5,936,324; 5,981,956; 6,025,601; 6,141,096; 6,185,030; 6,201,639; 6,218,803; and 6,225,625, in U.S. Patent application 60/364,731 and in PCT Application PCT/US99/06097 (published as WO99/47964), each of which also is hereby incorporated by reference in its entirety for all purposes.
- nucleic acids of interest are directly detected using the described techniques, e.g., sequence determination or hybridization.
- the nucleic acids of interest are associated with one or more indices that are identifying for a selected nucleic acid region or a particular sample being analyzed.
- the detection of the one or more indices can serve as a surrogate detection mechanism of the selected nucleic acid region, or as confirmation of the presence of a particular selected nucleic acid region if both the sequence of the index and the sequence of the nucleic acid region itself are determined.
- indices are preferably associated with the selected nucleic acids during an amplification step using primers that comprise both the index and sequence regions that specifically hybridize to the nucleic acid region.
- the primers used for amplification of a selected nucleic acid region are designed to provide a locus index between the selected nucleic acid region primer region and a universal amplification region.
- the locus index is unique for each selected nucleic acid region and representative of a locus on a chromosome of interest or reference chromosome, so that quantification of the locus index in a sample provides quantification data for the locus and the particular chromosome containing the locus.
- the primers used for amplification of a selected nucleic acid region are designed to provide an allele index between the selected nucleic acid region primer region and a universal amplification region.
- the allele index is unique for particular alleles of a selected nucleic acid region and representative of a locus variation present on a chromosome of interest or reference chromosome, so that quantification of the allele index in a sample provides quantification data for the allele and the summation of the allelic indices for a particular locus provides quantification data for both the locus and the particular chromosome containing the locus.
- the primers used for amplification of the selected nucleic acid regions to be analyzed for a genetic sample are designed to provide an identification index between the selected nucleic acid region primer region and a universal amplification region.
- a sufficient number of identification indices are present to uniquely identify each selected nucleic acid region in the sample.
- Each nucleic acid region to be analyzed is associated with a unique identification index, so that the identification index is uniquely associated with the selected nucleic acid region.
- Quantification of the identification index in a sample provides quantification data for the associated selected nucleic acid region and the chromosome corresponding to the selected nucleic acid region.
- the identification locus may also be used to detect any amplification bias that occurs downstream of the initial isolation of the selected nucleic acid regions from a sample.
- only the locus index and/or the identification index (if present) are detected and used to quantify the selected nucleic acid regions in a sample.
- a count of the number of times each locus index occurs with a unique identification index is done to determine the relative frequency of a selected nucleic acid region in a sample.
- indices representative of the sample from which a nucleic acid is isolated are used to identify the source of the nucleic acid in a multiplexed assay system.
- the nucleic acids are uniquely identified with the sample index.
- Those uniquely identified oligonucleotides may then be combined into a single reaction vessel with nucleic acids from other samples prior to sequencing.
- the sequencing data is first segregated by each unique sample index prior to determining the frequency of each target locus for each sample and prior to determining whether there is a chromosomal abnormality for each sample. For detection, the sample indices, the locus indices, and the identification indices (if present), are sequenced.
- the fixed sequence oligonucleotides are preferably designed to comprise the indices.
- the indices and universal amplification sequences can be added to the selectively amplified nucleic acids following initial amplification.
- the indices are encoded upstream of the nucleic acid region-specific sequences but downstream of the universal primers so that they are preserved upon amplification, but also require less sequencing to access when using the universal primers for sequence determination.
- the indices are non-complementary but unique sequences used within the primer to provide information relevant to the selective nucleic acid region that is isolated and/or amplified using the primer.
- the advantage of this is that information on the presence and quantity of the selected nucleic acid region can be obtained without the need to determine the actual sequence itself, although in certain aspects it may be desirable to do so.
- the ability to identify and quantify a selected nucleic acid region through identification of one or more indices will decrease the length of sequencing required as the loci information is captured at the 3′ or 5′ end of the isolated selected nucleic acid region.
- Use of indices identification as a surrogate for identification of selected nucleic acid regions may also reduce error since longer sequencing reads are more prone to the introduction or error.
- locus indices allele indices and identification indices
- additional indices can be introduced to primers to assist in the multiplexing of samples.
- correction indices which identify experimental error e.g., errors introduced during amplification or sequence determination
- the order and placement of these indices, as well as the length of these indices, can vary, and they can be used in various combinations.
- the primers used for identification and quantification of a selected nucleic acid region may be associated with regions complementary to the 5′ of the selected nucleic acid region, regions complementary to the 5′ of the selected nucleic acid region, or in certain amplification regimes the indices may be present on one or both of a set of amplification primers which comprise sequences complementary to the sequences of the selected nucleic acid region.
- the primers can be used to multiplex the analysis of multiple selected nucleic acid regions to be analyzed within a sample, and can be used either in solution or on a solid substrate, e.g., on a microarray or on a bead. These primers may be used for linear replication or amplification, or they may create circular constructs for further analysis.
- nucleic acids could pose a risk to the health of the subject(s) or otherwise impact on clinical decisions about the treatment or prognostic outcome for a subject.
- nucleic acids could include but are not limited to indicators of disease or risk such as maternal alleles, polymorphisms, or somatic mutations known to present a risk for maternal or fetal health.
- Such indicators include, but are not limited to, genes associated with Rh status; mutations or polymorphisms associated with diseases such as diabetes, hyperlipidemia, hypercholesterolemia, blood disorders such as sickle cell anemia, hemophilia or thalassemia, cardiac conditions, etc.; exogenous nucleic acids associated with active or latent infections; somatic mutations or copy number variations associated with autoimmune disorders or malignancies (e.g., breast cancer), or any other health issue that may impact on the subject, and in particular on the clinical options that may be available in the treatment and/or prevention of health risks in a subject based on the outcome of the assay results.
- diseases such as diabetes, hyperlipidemia, hypercholesterolemia, blood disorders such as sickle cell anemia, hemophilia or thalassemia, cardiac conditions, etc.
- exogenous nucleic acids associated with active or latent infections somatic mutations or copy number variations associated with autoimmune disorders or malignancies (e.g., breast cancer), or any other health issue that may impact on the subject,
- the preferred assay systems of the invention are highly multiplexed and able to interrogate hundreds or even thousands of nucleic acids within a mixed sample
- it is desirable to interrogate the sample for nucleic acid markers within the mixed sample e.g., nucleic acids associated with genetic risk or that identify the presence or absence of infectious organisms.
- the assay systems provide detection of such nucleic acids in conjunction with the detection of nucleic acids for copy number determination within a mixed sample.
- the immune suppression of the subject may increase the risk for the disease due to changes in the subject's immune system.
- Detection of exogenous agents in a mixed sample may be indicative of exposure to and infection by an infectious agent, and this finding have an impact on patient care or management of an infectious disease for which a subject tests positively for such infectious agent.
- changes in immunity and physiology during pregnancy may make pregnant women more susceptible to or more severely affected by infectious diseases.
- pregnancy itself may be a risk factor for acquiring certain infectious diseases, such as toxoplasmosis, Hansen disease, and listeriosis.
- certain infectious diseases such as influenza and varicella may have a more severe clinical course, increased complication rate, and higher case-fatality rate. Identification of infectious disease agents may therefore allow better treatment for maternal disease during pregnancy, leading to a better overall outcome for both mother and fetus.
- certain infectious agents can be passed to the fetus via vertical transmission, i.e. spread of infections from mother to baby. These infections may occur while the fetus is still in the uterus, during labor and delivery, or after delivery (such as while breastfeeding).
- the assay system may include detection of exogenous sequences, e.g., sequences from infectious organisms that may have an adverse effect on the health and/or viability of the fetus or infant, in order to protect maternal, fetal, and or infant health.
- exogenous sequences e.g., sequences from infectious organisms that may have an adverse effect on the health and/or viability of the fetus or infant, in order to protect maternal, fetal, and or infant health.
- Exemplary infections which can be spread via vertical transmission, and which can be tested for using the assay methods of the invention include but are not limited to congenital infections, perinatal infections and postnatal infections.
- TORCH is an acronym for several of the more common congenital infections. These are: toxoplasmosis, other infections (e.g., syphilis, hepatitis B, Coxsackie virus, Epstein-Barr virus, varicella-zoster virus (chicken pox), and human parvovirus B19 (fifth disease)), rubella, cytomegalovirus (CMV), and herpes simplex virus.
- toxoplasmosis other infections (e.g., syphilis, hepatitis B, Coxsackie virus, Epstein-Barr virus, varicella-zoster virus (chicken pox), and human parvovirus B19 (fifth disease)), rubella, cytomegalovirus (CMV), and herpes simplex virus.
- Perinatal infections refer to infections that occur as the baby moves through an infected birth canal or through contamination with fecal matter during delivery. These infections can include, but are not limited to, sexually-transmitted diseases (e.g., gonorrhea, chlamydia, herpes simplex virus, human papilloma virus, etc.) CMV, and Group B Streptococci (GBS).
- sexually-transmitted diseases e.g., gonorrhea, chlamydia, herpes simplex virus, human papilloma virus, etc.
- CMV Group B Streptococci
- Infections spread from mother to baby following delivery are known as postnatal infections. These infections can be spread during breastfeeding through infectious microbes found in the mother's breast milk. Some examples of postnatal infections are CMV, Human immunodeficiency virus (HIV), Hepatitis C Virus (HCV), and GBS.
- CMV Human immunodeficiency virus
- HCV Hepatitis C Virus
- GBS GBS
- a number of assay formats were tested to demonstrate the ability to perform selective amplification and detection of independent loci to demonstrate multiplexed, ligation-based detection of a large number (e.g., 96 or more) of nucleic acid regions of interest.
- the first oligo complementary to the 3′ region of a genomic region, comprised the following sequential (5′ to 3′) oligo elements: a universal PCR priming sequence common to all assays: TACACCGGCGTTATGCGTCGAGAC (SEQ ID NO:1); a nine nucleotide degenerate identification code where each specific sequence is intended to be specific to a single oligonucleotide molecule and its progeny; a 9 base locus- or locus/allele-specific sequence that acts as a locus code in SNP-independent assay formats and a locus/allele code in SNP-specific assay formats; an optional hybridization breaking nucleotide which is different from the corresponding base in the genomic locus; and a 20-24 bp sequence complementary to the selected genomic locus.
- the allele-specific interrogation set consisted of two first fixed sequence tandem ligation primers, each with a different locus/allele code and a different allele-specific base at the SNP position. These first oligos were designed for each selected nucleic acid to provide a predicted uniform T m with a two degree variation across all interrogations in the assay set.
- the second fixed sequence oligo complementary to the 5′ region of the genomic loci, comprised the following sequential (5′ to 3′) elements: a 20-24 b sequence complimentary to the 5′ region in the genomic locus; a hybridization breaking nucleotide different from the corresponding base in the genomic locus; and a universal PCR priming sequence which was common to all third oligos in the assay set: ATTGCGGGGACCGATGATCGCGTC (SEQ ID NO:2).
- the allele-specific interrogation set consisted of two tandem ligation primers, each with a different locus/allele code and a different allele-specific base at the SNP position.
- This second oligo was designed for each selected nucleic acid to provide a predicted uniform T m with a two degree variation across all interrogations in the assay set that was substantially the same T m range as the first oligo set.
- one or more bridging oligos was used that were complementary to the genomic locus sequence between the region complementary to the first and second fixed sequence oligos used for each selected nucleic acid region. In specific aspects tested, more than one bridging oligo was used to span the gap between the fixed sequence oligonucleotides, and the one or more oligo may optionally be designed to identify one or more SNPs in the sequence. The length of the bridging oligonucleotides used in the assay systems varied from 5 to 36 base pairs.
- the bridging oligo(s) were designed to hybridize to a region not directly abutting the first and/or second oligos, such that there was a 1 base gap between the bridging oligo(s) and the first and/or second oligos.
- oligonucleotides used in the tandem ligation formats were synthesized using conventional solid-phase chemistry.
- the oligos of the second fixed set and the bridging oligonucleotides were synthesized with 5′ phosphate moieties to enable ligation to 3′ hydroxyl termini of adjacent oligonucleotides.
- Genomic DNA from a Caucasian male (NA12801) or a Caucasian female (NA11995) was obtained from Coriell Cell Repositories (Camden, N.J.) and fragmented by acoustic shearing (Covaris, Woburn, Mass.) to a mean fragment size of approximately 200 bp.
- the Coriell DNA was biotinylated using standard procedures. Briefly, the Covaris fragmented DNA was end-repaired by mixing the following components in a 1.5 ml microtube: 5 ⁇ g DNA, 12 ⁇ l 10 ⁇ T4 ligase buffer, 50 U T4 polynucleotide kinase, and H 2 0 to 120 ⁇ l. This reaction was incubated at 37° C. for 30 minutes. The end-repaired DNA was diluted using 10 mM Tris 1 mM EDTA pH 8.5 to a concentration of ⁇ 2 ng/ ⁇ l.
- the plate was sealed with an adhesive plate sealer and mixed using an IKA plate vortexer for 2 minutes at 3000 rpm. 27.5 ⁇ l of isopropanol was added into each well, the plate sealed with adhesive plate sealer, and vortexed for 5 minutes at 3000 rpm. The plate was spun for 20 minutes at 3000 ⁇ g, the supernatant was decanted, and the plate inverted and centrifuged at 10 ⁇ g for 1 minute onto an absorbent wipe. The plate was air-dried for 5 minutes, and the pellet resuspended in 30 ⁇ l 10 mM Tris pH8.0, 1 mM EDTA.
- the exemplary assay systems of the invention were designed to comprise 96 or more interrogations per loci in a genetic sample, and in cases where SNPs were detected the assay formats utilized 192 or more separate interrogations, each utilizing the detection of different alleles per 96 loci in genetic samples.
- each assay format utilized two different sets of fixed sequence oligonucleotides and/or bridging oligos (as described in Example 1), comprising a total 96 or 192 interrogation reactions for the selected nucleic acid regions depending upon whether or not SNPs were identified.
- a first exemplary assay format used locus-specific fixed sequence oligos and bridging oligos, where there was a one base gap between the first fixed sequence oligo and the bridging oligos, and a second one base gap between the bridging oligos and the second fixed sequence oligo. Each of the two gaps encompassed two different SNPs.
- a DNA polymerase was used to incorporate each of the SNP bases, and ligase was used to seal the nicks formed thereby. SNP base discrimination derived from the fidelity of base incorporation by the polymerase, and in the event of mis-incorporation, the tendency of ligase to not seal nicks adjacent to mismatched bases.
- the second exemplary assay format used two locus-specific fixed sequence oligonucleotides without a bridging oligo, where there was a ⁇ 15-35 base gap between the fixed sequence oligos, and where the gap spanned one or more SNPs.
- a polymerase was used to incorporate the missing bases of the gap, and a ligase was used to seal the nick formed thereby.
- SNP base discrimination derived from the fidelity of base incorporation by the polymerase, and in the event of misincorporation, the tendency of ligase to not seal nicks adjacent to mismatched bases.
- a third exemplary assay format used allele-specific first and second fixed sequence oligos without a bridging oligo, where there was a ⁇ 15-35 base gap between the first and second fixed sequence oligos, and where the gap spanned one or more SNPs.
- Two separate allele-specific first fixed sequence oligos and two separate allele-specific second fixed sequence oligos were used.
- a polymerase was used to incorporate the missing bases, and a ligase was used to seal the nick formed thereby.
- SNP base discrimination derived from hybridization specificity, the tendency of non-proofreading polymerase to not extend annealed primers with mismatches near the 3′ end, and the tendency of the ligase to not seal nicks adjacent to mismatched bases.
- a fourth exemplary format used allele-specific fixed sequence oligos and a locus-specific bridging oligo.
- this format two separate fixed sequence oligos complementary to the 3′ end of the loci of interest, the first with a 3′ base specific for one allele of the targeted SNP, and the second with a 3′ base specific for the other allele of the targeted SNP.
- two separate second fixed sequence oligos were used, the first with a 5′ base specific for one allele of a second targeted SNP, and the second with a 5′ base specific for the other allele of the second targeted SNP.
- the bridging oligos hybridized directly adjacent to the first and second fixed sequence oligos, and thus no polymerase was needed prior to ligation.
- Ligase was used to seal the nicks between the fixed sequence oligos and the bridging oligo. SNP base discrimination in this assay format derived from hybridization specificity and the tendency of the ligase to not seal nicks adjacent to mismatched bases. This exemplary format was tested using either T4 ligase or Taq ligase for creation of the contiguous template, and both were proved effective in the reaction as described below.
- a fifth exemplary format used locus-specific fixed sequence oligos that were complementary to adjacent regions on the nucleic acid of interest, and thus no gap was created by hybridization of these oligos.
- this format no polymerase was required, and a ligase was used to seal the single nick between the oligos.
- a sixth exemplary format used allele-specific fixed sequence oligos and locus-specific bridging oligos, where there was a 5 base gap between the loci region complementary to the fixed sequence oligos.
- the locus-specific bridging oligo in this example was a 5mer complementary to the regions directly adjacent to the regions complementary to the first and second fixed sequence oligos.
- no polymerase was required, and a ligase was used to seal the two nicks between the oligos.
- a seventh exemplary format used locus-specific fixed sequence oligos and a locus-specific bridging oligo, where there was a 5 base gap containing a SNP in the region complementary to the bridging oligo. Allele-specific bridging oligos corresponding to the SNP alleles were included in the hybridization and ligation reaction. In this format, no polymerase was required, and a ligase was used to seal the two nicks between the oligos. SNP base discrimination in this assay format derived from hybridization specificity and the tendency of the ligase to not seal nicks near mismatched bases.
- An eighth exemplary format used locus-specific fixed sequence oligos and two adjacent locus-specific bridging oligos, where there was a 10 base gap between the regions complementary to the first and second fixed sequence oligos.
- a mixture of pentamers corresponding to the potential variations in the 10 base pair gap of the different loci interrogated were included in the ligation reaction, with the gap requiring two contiguous pentamers to bridge the gap.
- no polymerase was required, and a ligase was used to seal the three nicks between the oligos.
- an equimolar pool (40 nM each) of sets of first and second loci- or allele-specific fixed oligonucleotides was created from the oligos prepared as set forth in Example 2.
- a separate equimolar pool (20 ⁇ M each) of bridging oligonucleotides was likewise created for the assay processes based on the sequences of the selected genomic loci.
- the plate was placed on a raised bar magnetic plate for 2 minutes to pull the magnetic beads and associated DNA to the side of the wells.
- the supernatant was removed by pipetting, and was replaced with 50 ⁇ l of 60% BB2 (v/v in water).
- the beads were resuspended by vortexing, placed on the magnet again, and the supernatant was removed.
- This bead wash procedure was repeated once using 50 ⁇ l 60% BB2, and repeated twice more using 50 ⁇ l wash buffer (10 mM Tris pH 8.0, 1 mM EDTA, 50 mM NaCl 2 ).
- the beads were resuspended in 37 ⁇ l ligation reaction mix consisting of 1 ⁇ Taq ligase buffer, 10U Taq ligase, and 2 ⁇ M bridging oligo pool (depending on the assay format), and incubated at 37° C. for one hour. Where appropriate, and depending on the assay format, a non-proofreading thermostable polymerase plus 200 nM each dNTP was included in this mixture.
- the plate was placed on a raised bar magnetic plate for 2 minutes to pull the magnetic beads and associated DNA to the side of the wells. The supernatant was removed by pipetting, and was replaced with 50 uL wash buffer. The beads were resuspended by vortexing, placed on the magnet again, and the supernatant was removed. The wash procedure was repeated once.
- the polymerized and/or ligated nucleic acids were amplified using universal PCR primers complementary to the universal sequences present in the first and second fixed sequence oligos hybridized to the nucleic acid regions of interest. 25 ⁇ l of each of the reaction mixtures of Example 3 were used in each amplification reaction.
- a 50 ⁇ l universal PCR reaction consisting of 25 ⁇ l eluted ligation product plus 1 ⁇ polymerase buffer, 1M Betaine, 400 nM each dNTP, 1 U error-correcting thermostable DNA polymerase, and the following primer pairs: TAATGATACGGCGACCACCGAGATCTACACCGGCGTTATGCGTCGAGA (SEQ ID NO:3) and TCAAGCAGAAGACGGCATACGAGATXAAACGACGCGATCATCGGTCCCC GCAA (SEQ ID NO:4), where X represents one of 96 different sample tags used to uniquely identify individual samples prior to pooling and sequencing.
- the PCR was carried out under stringent conditions using a BioRad TetradTM thermocycler.
- the purified PCR products from 96 samples were sequenced on a single lane of a slide on an Illumina HiSeq 2000. Sequencing runs typically give rise to ⁇ 100M raw reads, of which ⁇ 85M (85%) mapped to expected assay structures. This translated to an average of ⁇ 885K reads/sample across the 96 samples, and (in the case of an experiment using 96 loci) 9.2K reads/sample/locus across 96 loci.
- the mapped reads were parsed into replicate/locus/allele counts, and various metrics were computed for each condition, including:
- Yield a metric of the proportion of input DNA that was queried in sequencing, computed as the average number of unique reads per locus (only counting unique identification code reads per replicate/locus) divided by the total number of genomic equivalents contained in the input DNA.
- 80 percentile locus frequency range a metric of the locus frequency variability in the sequencing data, interpreted as the fold range that encompasses 80% of the loci. It was computed on the distribution of total reads per locus, across all loci, as the 90 th percentile of total reads per locus divided by the 10 th percentile of the total reads per locus.
- SNP error rate a metric of the error rate at the SNP position, and computed as the proportion of reads containing a discordant base at the SNP position.
- Table 1 indicates that the locus-specific tandem ligation assay using a bridging oligo (Assay format 1) converted template DNA into targeted product with high yield ( ⁇ 10%), with a high proportion of product derived from targeted loci (15% of reads did not contain expected assay structures), with limited locus bias (80% of loci fall within a ⁇ 5-fold concentration range), and with high SNP accuracy (0.2% SNP error rate).
- the locus-specific tandem ligation assay without the use of a bridging oligo (Assay format 2) produced reduced yields and substantial locus bias, but still produced high accuracy SNP genotyping data.
- the allele-specific tandem ligation assay with a bridging oligo (Assay format 4) produced intermediate yields compared to the locus-specific assay using both T4 and Taq ligase, but still produced limited locus bias and high accuracy SNP genotyping data.
- the allele-specific tandem ligation assay without a bridging oligo (Assay format 3) produced reduced yields and substantial locus bias, but still produced high accuracy SNP genotyping data.
- FIG. 12 illustrates the genotyping performance that was obtained using assay format seven, comparing the sequence counts for the two alleles of all polymorphic assays observed in a single sample. Note the clear separation of the homozygous and heterozygous clusters, as well as the low background counts observed amongst the homozygous clusters.
- One exemplary assay system of the invention was designed to determine percent fetal DNA concentration in a genetic sample as well as to provide counts for selected loci within the sample.
- This exemplary assay comprised 480 separate interrogations, each utilizing the detection of different loci in a maternal sample.
- the initial example utilized a determination of percent fetal DNA in subjects carrying a male fetus, and so loci on the Y chromosome were utilized as well as loci containing a paternally-inherited fetal SNP that is different from the maternal sequence.
- 480 selected nucleic acids were interrogated using the assay system.
- the 480 selected nucleic acids comprised 48 sequence-specific interrogations of nucleic acids corresponding to loci on chromosome Y, 192 sequence-specific interrogations of nucleic acids corresponding to loci on chromosome 21, 192 sequence-specific interrogations of selected nucleic acids corresponding to loci on chromosome 18, and 144 sequence-specific interrogations of selected nucleic acids corresponding to polymorphic loci on chromosomes 1-16 which.
- These assays were designed based on human genomic sequences, and each interrogation used three oligos per selected nucleic acid interrogated in the assay.
- the first oligo used for each interrogation was complementary to the 3′ region of the selected genomic region, and comprised the following sequential (5′ to 3′) oligo elements: a universal PCR priming sequence common to all assays: TACACCGGCGTTATGCGTCGAGAC (SEQ ID NO:1); an identification code specific to the selected loci comprising nine nucleotides; and a 20-24 bp sequence complementary to the selected genomic locus.
- This first oligo was designed for each selected nucleic acid to provide a predicted uniform T m with a two degree variation across all interrogations in the 480 assay set.
- the second oligo used for each interrogation was a bridging oligo complementary to the genomic locus sequence directly adjacent to the genomic region complementary to the first oligonucleotide. Based on the selected nucleic acids of interest, the bridging oligos were designed to allow utilization of a total of 12 oligonucleotide sequences that could serve as bridging oligos for all of the 480 interrogations in the assay set. For polymorphic assays, two or more bridging oligos per locus were included, one complimentary to each allele.
- the third oligo used for each interrogation was complementary to the 5′ region of the selected genomic locus, comprised the following sequential (5′ to 3′) elements: a 20-24 b sequence complimentary to the 5′ region in the genomic locus; a hybridization breaking nucleotide which was different from the corresponding base in the genomic locus; and a universal PCR priming sequence which was common to all third oligos in the assay set: ATTGCGGGGACCGATGATCGCGTC (SEQ ID NO:2).
- This third oligo was designed for each selected nucleic acid to provide a predicted uniform T m with a two degree variation across all interrogations in the 480 assay set, and the T m range was substantially the same as the T m range as the first oligo set.
- All oligonucleotides were synthesized using conventional solid-phase chemistry.
- the first and bridging oligonucleotides were synthesized with 5′ phosphate moieties to enable ligation to 3′ hydroxyl termini of adjacent oligonucleotides.
- An equimolar pool of sets of the first and third oligonucleotides used for all interrogations in the multiplexed assay was created, and a separate equimolar pool of all bridging oligonucleotides was created to allow for separate hybridization reactions.
- Genomic DNA was isolated from 5 mL plasma using the Dynal Silane viral NA kit (Invitrogen, Carlsbad, Calif.). Approximately 12 ng DNA was processed from each of 37 females, including 7 non-pregnant female subjects, 10 female subjects pregnant with males, and 22 female subjects pregnant with females. The DNA was biotinylated using standard procedures, and the biotinylated DNA was immobilized on a solid surface coated with streptavidin to allow retention of the genomic DNA in subsequent assay steps.
- the immobilized DNA was hybridized to the first pool comprising the first and third oligos for each interrogated sequences under stringent hybridization conditions.
- the unhybridized oligos in the pool were then washed from the surface of the solid support, and the immobilized DNA was hybridized to the pool comprising the bridging oligonucleotides under stringent hybridization conditions. Once the bridging oligonucleotides were allow to hybridize to the immobilized DNA, the remaining unbound oligos were washed from the surface and the three hybridized oligos bound to the selected nucleic acid regions were ligated using T4 ligase to provide a contiguous DNA template for amplification.
- the ligated DNA was amplified from the solid substrate using an error correcting thermostable DNA polymerase, a first universal PCR primer TAATGATACGGCGACCACCGAGATCTACACCGGCGTTATGCGTCGAGA (SEQ ID NO:3) and a second universal PCR primer TCAAGCAGAAGACGGCATACGAGATXAAACGACGCGATCATCGGTCC CCGCAA (SEQ ID NO:4), where X represents one of 96 different sample indices used to uniquely identify individual samples prior to pooling and sequencing.
- the purified PCR product was sequenced on 6 lanes of a single slide on an Illumina HiSeqTM 2000.
- the sequencing run gave rise to 384M raw reads, of which 343M (89%) mapped to expected genomic loci, resulting in an average of 3.8M reads per sample across the 37 samples, and 8K reads per sample per locus across the 480 loci.
- the mapped reads were parsed into sample and locus counts, and two separate metrics of percent fetal DNA were computed as follows.
- Percent male DNA detected by chromosome Y loci corresponds to the relative proportion of reads derived from chromosome Y locus interrogations versus the relative proportion of reads derived from autosomal locus interrogations, and was computed as (number of chromosome Y reads in a test subject/number of autosome reads in test subject)/(number of reads in male control subject/number of autosome reads in the male control subject). This metric was used as a measure of percent fetal DNA in the case of a male fetus using the relative reads of chromosome Y.
- Percent fetal DNA detected by polymorphic loci corresponds to the proportion of reads derived from non-maternal versus maternal alleles at loci where such a distinction can be made.
- the number of reads for the allele with the fewest counts (the low frequency allele) was divided by the total number of reads to provide a minor allele frequency (MAF) for each locus.
- loci with an MAF between 0.075% and 15% were identified as informative loci.
- the estimated percent fetal DNA for the sample was calculated as the mean of the minor allele frequency of the informative loci multiplied by two, i.e. computed as 2 ⁇ average (MAF) occurrence where 0.075% ⁇ MAF ⁇ 15%.
- FIG. 13 demonstrates the results from these computations.
- the percent male loci determined using the above-described chromosome Y metrics can separate pregnancies involving male fetuses from pregnancies involving female fetuses (grey diamonds) and non-pregnant samples (black circles).
- computation of the percent fetal amount in a sample by polymorphic loci metric can distinguish pregnant samples from non-pregnant samples.
Landscapes
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Zoology (AREA)
- Engineering & Computer Science (AREA)
- Wood Science & Technology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Analytical Chemistry (AREA)
- Molecular Biology (AREA)
- Microbiology (AREA)
- Immunology (AREA)
- Biotechnology (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Physics & Mathematics (AREA)
- Biophysics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Priority Applications (61)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US13/013,732 US20120034603A1 (en) | 2010-08-06 | 2011-01-25 | Ligation-based detection of genetic variants |
| AU2011285512A AU2011285512B2 (en) | 2010-08-06 | 2011-08-08 | Ligation-based detection of genetic variants |
| AU2011285518A AU2011285518B2 (en) | 2010-08-06 | 2011-08-08 | Assay systems for genetic analysis |
| EP18167314.6A EP3418394B1 (en) | 2010-08-06 | 2011-08-08 | Assay method for genetic analysis |
| CA2807572A CA2807572C (en) | 2010-08-06 | 2011-08-08 | Assay systems for determination of source contribution in a sample |
| US13/205,570 US9890421B2 (en) | 2010-08-06 | 2011-08-08 | Assay systems for genetic analysis |
| PCT/US2011/046963 WO2012019193A2 (en) | 2010-08-06 | 2011-08-08 | Assay systems for genetic analysis |
| JP2013523386A JP6141185B2 (ja) | 2010-08-06 | 2011-08-08 | 試料中の発生源寄与の決定のためのアッセイシステム |
| ES18163473T ES2863778T3 (es) | 2010-08-06 | 2011-08-08 | Procedimientos de ensayo para la determinación de la contribución de una fuente en una muestra |
| PCT/US2011/046981 WO2012019200A2 (en) | 2010-08-06 | 2011-08-08 | Assay systems for determination of source contribution in a sample |
| CA2807594A CA2807594C (en) | 2010-08-06 | 2011-08-08 | Assay systems for genetic analysis |
| EP11745883.6A EP2601311B1 (en) | 2010-08-06 | 2011-08-08 | Assay systems for determination of source contribution in a sample |
| EP11745880.2A EP2601309A2 (en) | 2010-08-06 | 2011-08-08 | Ligation-based detection of genetic variants |
| PCT/US2011/046976 WO2012019198A2 (en) | 2010-08-06 | 2011-08-08 | Assay systems for genetic analysis |
| AU2011285477A AU2011285477C1 (en) | 2010-08-06 | 2011-08-08 | Assay systems for determination of source contribution in a sample |
| ES11745881T ES2718111T3 (es) | 2010-08-06 | 2011-08-08 | Sistemas de ensayo para análisis genético |
| EP11745881.0A EP2601310B1 (en) | 2010-08-06 | 2011-08-08 | Assay systems for genetic analysis |
| ES18167314T ES2913402T3 (es) | 2010-08-06 | 2011-08-08 | Sistemas de ensayo para análisis genético |
| CA2807569A CA2807569A1 (en) | 2010-08-06 | 2011-08-08 | Ligation-based detection of genetic variants |
| ES11745883.6T ES2685465T3 (es) | 2010-08-06 | 2011-08-08 | Sistemas de ensayo para la determinación de la contribución de fuente en una muestra |
| PCT/US2011/046935 WO2012019187A2 (en) | 2010-08-06 | 2011-08-08 | Ligation-based detection of genetic variants |
| US13/205,603 US10308981B2 (en) | 2010-08-06 | 2011-08-08 | Assay systems for determination of source contribution in a sample |
| EP18163473.4A EP3395955B1 (en) | 2010-08-06 | 2011-08-08 | Assay methods for determination of source contribution in a sample |
| US13/245,133 US20120077185A1 (en) | 2010-08-06 | 2011-09-26 | Detection of genetic abnormalities and infectious disease |
| US13/293,419 US10131937B2 (en) | 2010-08-06 | 2011-11-10 | Assay systems for genetic analysis |
| US13/407,978 US10167508B2 (en) | 2010-08-06 | 2012-02-29 | Detection of genetic abnormalities |
| US13/426,157 US11031095B2 (en) | 2010-08-06 | 2012-03-21 | Assay systems for determination of fetal copy number variation |
| US13/687,169 US20130122500A1 (en) | 2010-08-06 | 2012-11-28 | Assay systems for genetic analysis |
| US13/687,025 US20130090250A1 (en) | 2010-08-06 | 2012-11-28 | Assay systems for genetic analysis |
| IL224556A IL224556A (en) | 2010-08-06 | 2013-02-03 | Genetic Analysis Testing Systems |
| IL224554A IL224554A (en) | 2010-08-06 | 2013-02-03 | Detection of genetic variants based on binding |
| IL224557A IL224557A (en) | 2010-08-06 | 2013-02-03 | Test systems to determine a sample donation source |
| US13/789,789 US20130172211A1 (en) | 2010-08-06 | 2013-03-08 | Ligation-based detection of genetic variants |
| US13/789,765 US20130210640A1 (en) | 2010-08-06 | 2013-03-08 | Assay systems for genetic analysis |
| US13/789,846 US20130172213A1 (en) | 2010-08-06 | 2013-03-08 | Ligation-based detection of genetic variants |
| US13/789,817 US20130172212A1 (en) | 2010-08-06 | 2013-03-08 | Ligation-based detection of genetic variants |
| US13/840,383 US20130261003A1 (en) | 2010-08-06 | 2013-03-15 | Ligation-based detection of genetic variants |
| US13/933,092 US20130288252A1 (en) | 2010-08-06 | 2013-07-01 | Assay systems for genetic analysis |
| US14/450,144 US20140342940A1 (en) | 2011-01-25 | 2014-08-01 | Detection of Target Nucleic Acids using Hybridization |
| US14/453,396 US9567639B2 (en) | 2010-08-06 | 2014-08-06 | Detection of target nucleic acids using hybridization |
| AU2015201176A AU2015201176B2 (en) | 2010-08-06 | 2015-03-06 | Assay systems for determination of source contribution in a sample |
| AU2015201175A AU2015201175B2 (en) | 2010-08-06 | 2015-03-06 | Assay systems for determination of source contribution in a sample |
| AU2015201392A AU2015201392B2 (en) | 2010-08-06 | 2015-03-17 | Assay systems for genetic analysis |
| AU2015201389A AU2015201389B2 (en) | 2010-08-06 | 2015-03-17 | Assay systems for genetic analysis |
| AU2015202048A AU2015202048B2 (en) | 2010-08-06 | 2015-04-22 | Ligation-based detection of genetic variants |
| US14/880,093 US10233496B2 (en) | 2010-08-06 | 2015-10-09 | Ligation-based detection of genetic variants |
| US15/206,202 US10131951B2 (en) | 2010-08-06 | 2016-07-08 | Assay systems for genetic analysis |
| US15/385,785 US10533223B2 (en) | 2010-08-06 | 2016-12-20 | Detection of target nucleic acids using hybridization |
| JP2017091888A JP6637920B2 (ja) | 2010-08-06 | 2017-05-02 | 試料中の発生源寄与の決定のためのアッセイシステム |
| JP2017091887A JP6356866B2 (ja) | 2010-08-06 | 2017-05-02 | 試料中の発生源寄与の決定のためのアッセイシステム |
| AU2017272273A AU2017272273B2 (en) | 2010-08-06 | 2017-12-07 | Assay systems for determination of source contribution in a sample |
| US15/851,363 US11319578B2 (en) | 2010-08-06 | 2017-12-21 | Assay systems for genetic analysis |
| US16/159,588 US10907198B2 (en) | 2010-08-06 | 2018-10-12 | Assay systems for genetic analysis |
| US16/159,575 US11091807B2 (en) | 2010-08-06 | 2018-10-12 | Assay systems for genetic analysis |
| US16/255,064 US10954566B2 (en) | 2010-08-06 | 2019-01-23 | Ligation-based detection of genetic variants |
| US16/421,398 US11299772B2 (en) | 2010-08-06 | 2019-05-23 | Assay systems for genetic analysis |
| US16/741,665 US11203786B2 (en) | 2010-08-06 | 2020-01-13 | Detection of target nucleic acids using hybridization |
| US17/326,060 US20210343361A1 (en) | 2010-08-06 | 2021-05-20 | Assay systems for determination of fetal copy number variation |
| US17/535,496 US20220081718A1 (en) | 2010-08-06 | 2021-11-24 | Determination of fetal dna fraction in a sample |
| US17/561,562 US12180548B2 (en) | 2010-08-06 | 2021-12-23 | Detection of target nucleic acids using hybridization |
| US17/711,769 US12344887B2 (en) | 2010-08-06 | 2022-04-01 | Assay systems for genetic analysis |
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US37160510P | 2010-08-06 | 2010-08-06 | |
| US13/013,732 US20120034603A1 (en) | 2010-08-06 | 2011-01-25 | Ligation-based detection of genetic variants |
Related Parent Applications (2)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| US13/205,409 Continuation-In-Part US8771085B1 (en) | 2010-08-06 | 2011-08-08 | Modular law enforcement baton |
| US13/205,490 Continuation-In-Part US20130040375A1 (en) | 2010-08-06 | 2011-08-08 | Assay systems for genetic analysis |
Related Child Applications (10)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| US13/205,490 Continuation-In-Part US20130040375A1 (en) | 2010-08-06 | 2011-08-08 | Assay systems for genetic analysis |
| US13/205,570 Continuation-In-Part US9890421B2 (en) | 2010-08-06 | 2011-08-08 | Assay systems for genetic analysis |
| US13/205,603 Continuation-In-Part US10308981B2 (en) | 2010-08-06 | 2011-08-08 | Assay systems for determination of source contribution in a sample |
| US13/245,133 Continuation-In-Part US20120077185A1 (en) | 2010-08-06 | 2011-09-26 | Detection of genetic abnormalities and infectious disease |
| US13/316,154 Continuation-In-Part US20120190557A1 (en) | 2010-08-06 | 2011-12-09 | Risk calculation for evaluation of fetal aneuploidy |
| US13/407,978 Continuation-In-Part US10167508B2 (en) | 2010-08-06 | 2012-02-29 | Detection of genetic abnormalities |
| US13/789,846 Continuation US20130172213A1 (en) | 2010-08-06 | 2013-03-08 | Ligation-based detection of genetic variants |
| US13/789,817 Continuation US20130172212A1 (en) | 2010-08-06 | 2013-03-08 | Ligation-based detection of genetic variants |
| US13/789,789 Continuation US20130172211A1 (en) | 2010-08-06 | 2013-03-08 | Ligation-based detection of genetic variants |
| US14/450,144 Continuation-In-Part US20140342940A1 (en) | 2010-08-06 | 2014-08-01 | Detection of Target Nucleic Acids using Hybridization |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| US20120034603A1 true US20120034603A1 (en) | 2012-02-09 |
Family
ID=44630473
Family Applications (12)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| US13/013,732 Abandoned US20120034603A1 (en) | 2010-08-06 | 2011-01-25 | Ligation-based detection of genetic variants |
| US13/205,570 Active US9890421B2 (en) | 2010-08-06 | 2011-08-08 | Assay systems for genetic analysis |
| US13/205,603 Active 2032-02-07 US10308981B2 (en) | 2010-08-06 | 2011-08-08 | Assay systems for determination of source contribution in a sample |
| US13/293,419 Active US10131937B2 (en) | 2010-08-06 | 2011-11-10 | Assay systems for genetic analysis |
| US13/687,025 Abandoned US20130090250A1 (en) | 2010-08-06 | 2012-11-28 | Assay systems for genetic analysis |
| US13/789,817 Abandoned US20130172212A1 (en) | 2010-08-06 | 2013-03-08 | Ligation-based detection of genetic variants |
| US13/789,789 Abandoned US20130172211A1 (en) | 2010-08-06 | 2013-03-08 | Ligation-based detection of genetic variants |
| US13/789,846 Abandoned US20130172213A1 (en) | 2010-08-06 | 2013-03-08 | Ligation-based detection of genetic variants |
| US15/851,363 Active US11319578B2 (en) | 2010-08-06 | 2017-12-21 | Assay systems for genetic analysis |
| US16/159,588 Active 2031-01-29 US10907198B2 (en) | 2010-08-06 | 2018-10-12 | Assay systems for genetic analysis |
| US16/421,398 Active US11299772B2 (en) | 2010-08-06 | 2019-05-23 | Assay systems for genetic analysis |
| US17/711,769 Active 2031-07-15 US12344887B2 (en) | 2010-08-06 | 2022-04-01 | Assay systems for genetic analysis |
Family Applications After (11)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| US13/205,570 Active US9890421B2 (en) | 2010-08-06 | 2011-08-08 | Assay systems for genetic analysis |
| US13/205,603 Active 2032-02-07 US10308981B2 (en) | 2010-08-06 | 2011-08-08 | Assay systems for determination of source contribution in a sample |
| US13/293,419 Active US10131937B2 (en) | 2010-08-06 | 2011-11-10 | Assay systems for genetic analysis |
| US13/687,025 Abandoned US20130090250A1 (en) | 2010-08-06 | 2012-11-28 | Assay systems for genetic analysis |
| US13/789,817 Abandoned US20130172212A1 (en) | 2010-08-06 | 2013-03-08 | Ligation-based detection of genetic variants |
| US13/789,789 Abandoned US20130172211A1 (en) | 2010-08-06 | 2013-03-08 | Ligation-based detection of genetic variants |
| US13/789,846 Abandoned US20130172213A1 (en) | 2010-08-06 | 2013-03-08 | Ligation-based detection of genetic variants |
| US15/851,363 Active US11319578B2 (en) | 2010-08-06 | 2017-12-21 | Assay systems for genetic analysis |
| US16/159,588 Active 2031-01-29 US10907198B2 (en) | 2010-08-06 | 2018-10-12 | Assay systems for genetic analysis |
| US16/421,398 Active US11299772B2 (en) | 2010-08-06 | 2019-05-23 | Assay systems for genetic analysis |
| US17/711,769 Active 2031-07-15 US12344887B2 (en) | 2010-08-06 | 2022-04-01 | Assay systems for genetic analysis |
Country Status (8)
| Country | Link |
|---|---|
| US (12) | US20120034603A1 (https=) |
| EP (5) | EP3418394B1 (https=) |
| JP (3) | JP6141185B2 (https=) |
| AU (3) | AU2011285512B2 (https=) |
| CA (3) | CA2807594C (https=) |
| ES (4) | ES2863778T3 (https=) |
| IL (3) | IL224554A (https=) |
| WO (4) | WO2012019187A2 (https=) |
Cited By (93)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20110033862A1 (en) * | 2008-02-19 | 2011-02-10 | Gene Security Network, Inc. | Methods for cell genotyping |
| US20110092763A1 (en) * | 2008-05-27 | 2011-04-21 | Gene Security Network, Inc. | Methods for Embryo Characterization and Comparison |
| US20110178719A1 (en) * | 2008-08-04 | 2011-07-21 | Gene Security Network, Inc. | Methods for Allele Calling and Ploidy Calling |
| US20110224087A1 (en) * | 2010-01-19 | 2011-09-15 | Stephen Quake | Simultaneous determination of aneuploidy and fetal fraction |
| US20110230358A1 (en) * | 2010-01-19 | 2011-09-22 | Artemis Health, Inc. | Identification of polymorphic sequences in mixtures of genomic dna by whole genome sequencing |
| US8318430B2 (en) | 2010-01-23 | 2012-11-27 | Verinata Health, Inc. | Methods of fetal abnormality detection |
| US8532936B2 (en) | 2011-04-14 | 2013-09-10 | Verinata Health, Inc. | Normalizing chromosomes for the determination and verification of common and rare chromosomal aneuploidies |
| WO2014015269A1 (en) * | 2012-07-19 | 2014-01-23 | Ariosa Diagnostics, Inc. | Multiplexed sequential ligation-based detection of genetic variants |
| US8682592B2 (en) | 2005-11-26 | 2014-03-25 | Natera, Inc. | System and method for cleaning noisy genetic data from target individuals using genetic data from genetically related individuals |
| US20140162269A1 (en) * | 2010-05-18 | 2014-06-12 | Natera, Inc. | Methods for non-invasive prenatal ploidy calling |
| US20140242582A1 (en) * | 2013-02-28 | 2014-08-28 | Ariosa Diagnostics, Inc. | Detection of genetic abnormalities using ligation-based detection and digital pcr |
| WO2014099919A3 (en) * | 2012-12-19 | 2014-10-09 | Ariosa Diagnostics, Inc. | Noninvasive detection of fetal aneuploidy in egg donor pregnancies |
| US9115401B2 (en) | 2010-01-19 | 2015-08-25 | Verinata Health, Inc. | Partition defined detection methods |
| US9163282B2 (en) | 2010-05-18 | 2015-10-20 | Natera, Inc. | Methods for non-invasive prenatal ploidy calling |
| US9212394B2 (en) | 2013-08-19 | 2015-12-15 | Singular Bio, Inc. | Assays for single molecule detection and use thereof |
| US9228234B2 (en) | 2009-09-30 | 2016-01-05 | Natera, Inc. | Methods for non-invasive prenatal ploidy calling |
| US9260745B2 (en) | 2010-01-19 | 2016-02-16 | Verinata Health, Inc. | Detecting and classifying copy number variation |
| WO2016037142A1 (en) * | 2014-09-05 | 2016-03-10 | Zhi Zheng | Methods of detecting nucleic acids and applications thereof |
| US9323888B2 (en) | 2010-01-19 | 2016-04-26 | Verinata Health, Inc. | Detecting and classifying copy number variation |
| US9411937B2 (en) | 2011-04-15 | 2016-08-09 | Verinata Health, Inc. | Detecting and classifying copy number variation |
| US9424392B2 (en) | 2005-11-26 | 2016-08-23 | Natera, Inc. | System and method for cleaning noisy genetic data from target individuals using genetic data from genetically related individuals |
| US9447453B2 (en) | 2011-04-12 | 2016-09-20 | Verinata Health, Inc. | Resolving genome fractions using polymorphism counts |
| US9493828B2 (en) | 2010-01-19 | 2016-11-15 | Verinata Health, Inc. | Methods for determining fraction of fetal nucleic acids in maternal samples |
| US9499870B2 (en) | 2013-09-27 | 2016-11-22 | Natera, Inc. | Cell free DNA diagnostic testing standards |
| WO2016189388A1 (en) | 2015-05-22 | 2016-12-01 | Nipd Genetics Ltd | Multiplexed parallel analysis of targeted genomic regions for non-invasive prenatal testing |
| US9567639B2 (en) | 2010-08-06 | 2017-02-14 | Ariosa Diagnostics, Inc. | Detection of target nucleic acids using hybridization |
| US9677118B2 (en) | 2014-04-21 | 2017-06-13 | Natera, Inc. | Methods for simultaneous amplification of target loci |
| US9797001B2 (en) | 2013-04-17 | 2017-10-24 | Pioneer Hi-Bred International, Inc. | Methods for characterizing a target DNA sequence composition in a plant genome |
| US9890421B2 (en) | 2010-08-06 | 2018-02-13 | Ariosa Diagnostics, Inc. | Assay systems for genetic analysis |
| US9994897B2 (en) | 2013-03-08 | 2018-06-12 | Ariosa Diagnostics, Inc. | Non-invasive fetal sex determination |
| US10011870B2 (en) | 2016-12-07 | 2018-07-03 | Natera, Inc. | Compositions and methods for identifying nucleic acid molecules |
| US10083273B2 (en) | 2005-07-29 | 2018-09-25 | Natera, Inc. | System and method for cleaning noisy genetic data and determining chromosome copy number |
| US10081839B2 (en) | 2005-07-29 | 2018-09-25 | Natera, Inc | System and method for cleaning noisy genetic data and determining chromosome copy number |
| US10113196B2 (en) | 2010-05-18 | 2018-10-30 | Natera, Inc. | Prenatal paternity testing using maternal blood, free floating fetal DNA and SNP genotyping |
| US10131951B2 (en) | 2010-08-06 | 2018-11-20 | Ariosa Diagnostics, Inc. | Assay systems for genetic analysis |
| US10167508B2 (en) | 2010-08-06 | 2019-01-01 | Ariosa Diagnostics, Inc. | Detection of genetic abnormalities |
| US10179937B2 (en) | 2014-04-21 | 2019-01-15 | Natera, Inc. | Detecting mutations and ploidy in chromosomal segments |
| US10233496B2 (en) | 2010-08-06 | 2019-03-19 | Ariosa Diagnostics, Inc. | Ligation-based detection of genetic variants |
| US10262755B2 (en) | 2014-04-21 | 2019-04-16 | Natera, Inc. | Detecting cancer mutations and aneuploidy in chromosomal segments |
| US10289800B2 (en) | 2012-05-21 | 2019-05-14 | Ariosa Diagnostics, Inc. | Processes for calculating phased fetal genomic sequences |
| US10316362B2 (en) | 2010-05-18 | 2019-06-11 | Natera, Inc. | Methods for simultaneous amplification of target loci |
| WO2019152395A1 (en) * | 2018-01-31 | 2019-08-08 | Bio-Rad Laboratories, Inc. | Methods and compositions for deconvoluting partition barcodes |
| US10388403B2 (en) | 2010-01-19 | 2019-08-20 | Verinata Health, Inc. | Analyzing copy number variation in the detection of cancer |
| WO2019165318A1 (en) * | 2018-02-22 | 2019-08-29 | 10X Genomics, Inc. | Ligation mediated analysis of nucleic acids |
| US10526658B2 (en) | 2010-05-18 | 2020-01-07 | Natera, Inc. | Methods for simultaneous amplification of target loci |
| US10533223B2 (en) | 2010-08-06 | 2020-01-14 | Ariosa Diagnostics, Inc. | Detection of target nucleic acids using hybridization |
| US10557164B2 (en) | 2008-01-17 | 2020-02-11 | Sequenom, Inc. | Methods and compositions for the analysis of biological molecules |
| US10577655B2 (en) | 2013-09-27 | 2020-03-03 | Natera, Inc. | Cell free DNA diagnostic testing standards |
| US10718019B2 (en) | 2011-01-25 | 2020-07-21 | Ariosa Diagnostics, Inc. | Risk calculation for evaluation of fetal aneuploidy |
| US10752949B2 (en) | 2012-08-14 | 2020-08-25 | 10X Genomics, Inc. | Methods and systems for processing polynucleotides |
| US10752950B2 (en) | 2012-08-14 | 2020-08-25 | 10X Genomics, Inc. | Methods and systems for processing polynucleotides |
| US10847250B2 (en) | 2011-09-07 | 2020-11-24 | Ariosa Diagnostics, Inc. | Determination of copy number variations using binomial probability calculations |
| US10894976B2 (en) | 2017-02-21 | 2021-01-19 | Natera, Inc. | Compositions, methods, and kits for isolating nucleic acids |
| US11031095B2 (en) | 2010-08-06 | 2021-06-08 | Ariosa Diagnostics, Inc. | Assay systems for determination of fetal copy number variation |
| US20210198733A1 (en) | 2018-07-03 | 2021-07-01 | Natera, Inc. | Methods for detection of donor-derived cell-free dna |
| US11078522B2 (en) | 2012-08-14 | 2021-08-03 | 10X Genomics, Inc. | Capsule array devices and methods of use |
| US11111544B2 (en) | 2005-07-29 | 2021-09-07 | Natera, Inc. | System and method for cleaning noisy genetic data and determining chromosome copy number |
| US11111543B2 (en) | 2005-07-29 | 2021-09-07 | Natera, Inc. | System and method for cleaning noisy genetic data and determining chromosome copy number |
| US11193121B2 (en) | 2013-02-08 | 2021-12-07 | 10X Genomics, Inc. | Partitioning and processing of analytes and other species |
| US11203786B2 (en) | 2010-08-06 | 2021-12-21 | Ariosa Diagnostics, Inc. | Detection of target nucleic acids using hybridization |
| US11270781B2 (en) | 2011-01-25 | 2022-03-08 | Ariosa Diagnostics, Inc. | Statistical analysis for non-invasive sex chromosome aneuploidy determination |
| US11322224B2 (en) | 2010-05-18 | 2022-05-03 | Natera, Inc. | Methods for non-invasive prenatal ploidy calling |
| US11326208B2 (en) | 2010-05-18 | 2022-05-10 | Natera, Inc. | Methods for nested PCR amplification of cell-free DNA |
| US11332774B2 (en) | 2010-10-26 | 2022-05-17 | Verinata Health, Inc. | Method for determining copy number variations |
| US11332793B2 (en) | 2010-05-18 | 2022-05-17 | Natera, Inc. | Methods for simultaneous amplification of target loci |
| US11332785B2 (en) | 2010-05-18 | 2022-05-17 | Natera, Inc. | Methods for non-invasive prenatal ploidy calling |
| US11339429B2 (en) | 2010-05-18 | 2022-05-24 | Natera, Inc. | Methods for non-invasive prenatal ploidy calling |
| US11408031B2 (en) | 2010-05-18 | 2022-08-09 | Natera, Inc. | Methods for non-invasive prenatal paternity testing |
| US11421274B2 (en) | 2012-12-14 | 2022-08-23 | 10X Genomics, Inc. | Methods and systems for processing polynucleotides |
| US11441179B2 (en) | 2012-08-14 | 2022-09-13 | 10X Genomics, Inc. | Methods and systems for processing polynucleotides |
| US11473138B2 (en) | 2012-12-14 | 2022-10-18 | 10X Genomics, Inc. | Methods and systems for processing polynucleotides |
| US11479812B2 (en) | 2015-05-11 | 2022-10-25 | Natera, Inc. | Methods and compositions for determining ploidy |
| US11485996B2 (en) | 2016-10-04 | 2022-11-01 | Natera, Inc. | Methods for characterizing copy number variation using proximity-litigation sequencing |
| US11591637B2 (en) | 2012-08-14 | 2023-02-28 | 10X Genomics, Inc. | Compositions and methods for sample processing |
| US11629344B2 (en) | 2014-06-26 | 2023-04-18 | 10X Genomics, Inc. | Methods and systems for processing polynucleotides |
| US11639928B2 (en) | 2018-02-22 | 2023-05-02 | 10X Genomics, Inc. | Methods and systems for characterizing analytes from individual cells or cell populations |
| US11739371B2 (en) | 2015-02-18 | 2023-08-29 | Invitae Corporation | Arrays for single molecule detection and use thereof |
| US11939634B2 (en) | 2010-05-18 | 2024-03-26 | Natera, Inc. | Methods for simultaneous amplification of target loci |
| US11952626B2 (en) | 2021-02-23 | 2024-04-09 | 10X Genomics, Inc. | Probe-based analysis of nucleic acids and proteins |
| US12024738B2 (en) | 2018-04-14 | 2024-07-02 | Natera, Inc. | Methods for cancer detection and monitoring |
| US12084720B2 (en) | 2017-12-14 | 2024-09-10 | Natera, Inc. | Assessing graft suitability for transplantation |
| US12100478B2 (en) | 2012-08-17 | 2024-09-24 | Natera, Inc. | Method for non-invasive prenatal testing using parental mosaicism data |
| US12146195B2 (en) | 2016-04-15 | 2024-11-19 | Natera, Inc. | Methods for lung cancer detection |
| US12152275B2 (en) | 2010-05-18 | 2024-11-26 | Natera, Inc. | Methods for non-invasive prenatal ploidy calling |
| US12221653B2 (en) | 2010-05-18 | 2025-02-11 | Natera, Inc. | Methods for simultaneous amplification of target loci |
| US12260934B2 (en) | 2014-06-05 | 2025-03-25 | Natera, Inc. | Systems and methods for detection of aneuploidy |
| US12305235B2 (en) | 2019-06-06 | 2025-05-20 | Natera, Inc. | Methods for detecting immune cell DNA and monitoring immune system |
| US12312640B2 (en) | 2014-06-26 | 2025-05-27 | 10X Genomics, Inc. | Analysis of nucleic acid sequences |
| US12398389B2 (en) | 2018-02-15 | 2025-08-26 | Natera, Inc. | Methods for isolating nucleic acids with size selection |
| US12460264B2 (en) | 2016-11-02 | 2025-11-04 | Natera, Inc. | Method of detecting tumour recurrence |
| US12492429B2 (en) | 2014-04-21 | 2025-12-09 | Natera, Inc. | Detecting mutations and ploidy in chromosomal segments |
| US12545960B2 (en) | 2010-05-18 | 2026-02-10 | Natera, Inc. | Methods for simultaneous amplification of target loci |
| US12559788B2 (en) | 2019-06-07 | 2026-02-24 | Bio-Rad Laboratories, Inc. | Multiple beads per droplet resolution |
Families Citing this family (53)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20060275782A1 (en) | 1999-04-20 | 2006-12-07 | Illumina, Inc. | Detection of nucleic acid reactions on bead arrays |
| US9598737B2 (en) | 2012-05-09 | 2017-03-21 | Longhorn Vaccines And Diagnostics, Llc | Next generation genomic sequencing methods |
| US20240068031A1 (en) * | 2010-05-18 | 2024-02-29 | Natera, Inc. | Methods for simultaneous amplification of target loci |
| US20190309358A1 (en) * | 2010-05-18 | 2019-10-10 | Natera, Inc. | Methods for non-invasive prenatal ploidy calling |
| CN105243295B (zh) | 2010-11-30 | 2018-08-17 | 香港中文大学 | 与癌症相关的遗传或分子畸变的检测 |
| SG10201605049QA (en) * | 2011-05-20 | 2016-07-28 | Fluidigm Corp | Nucleic acid encoding reactions |
| DK2729580T3 (en) | 2011-07-08 | 2015-12-14 | Keygene Nv | SEQUENCE BASED genotyping BASED ON OLIGONUKLEOTIDLIGERINGSASSAYS |
| EP3741871A3 (en) * | 2012-04-19 | 2021-02-17 | The Medical College of Wisconsin, Inc. | Highly sensitive surveillance using detection of cell free dna |
| CA2976934C (en) * | 2012-05-09 | 2019-09-03 | Longhorn Vaccines & Diagnostics, Llc | Ion torrent genomic sequencing |
| US11913065B2 (en) | 2012-09-04 | 2024-02-27 | Guardent Health, Inc. | Systems and methods to detect rare mutations and copy number variation |
| US10876152B2 (en) | 2012-09-04 | 2020-12-29 | Guardant Health, Inc. | Systems and methods to detect rare mutations and copy number variation |
| CN104781421B (zh) | 2012-09-04 | 2020-06-05 | 夸登特健康公司 | 检测稀有突变和拷贝数变异的系统和方法 |
| US20160040229A1 (en) | 2013-08-16 | 2016-02-11 | Guardant Health, Inc. | Systems and methods to detect rare mutations and copy number variation |
| WO2014165267A2 (en) * | 2013-03-12 | 2014-10-09 | Counsyl, Inc. | Systems and methods for prenatal genetic analysis |
| WO2014194113A2 (en) * | 2013-05-29 | 2014-12-04 | Chronix Biomedical | Detection and quantification of donor cell-free dna in the circulation of organ transplant recipients |
| WO2014204991A1 (en) * | 2013-06-17 | 2014-12-24 | Verinata Health, Inc. | Method for determining copy number variations in sex chromosomes |
| CN106170560A (zh) * | 2013-10-29 | 2016-11-30 | 长角牛疫苗和诊断有限责任公司 | 下一代基因组测序方法 |
| GB2520765A (en) * | 2013-12-02 | 2015-06-03 | Vanadis Diagnostics Ab | Multiplex detection of nucleic acids |
| GB2520763A (en) | 2013-12-02 | 2015-06-03 | Vanadis Diagnostics Ab | Nucleic acid probe and method of detecting genomic fragments |
| ES2660989T3 (es) | 2013-12-28 | 2018-03-27 | Guardant Health, Inc. | Métodos y sistemas para detectar variantes genéticas |
| TR201907106T4 (tr) | 2014-03-14 | 2019-06-21 | Caredx Inc | Bir transplant alıcısında immünosüpresif terapileri izleme yöntemleri. |
| JP6681841B2 (ja) | 2014-05-09 | 2020-04-15 | ライフコーデックス アーゲー | 特別な細胞タイプに由来するdnaの検出とそれに関連する方法 |
| EP2942400A1 (en) | 2014-05-09 | 2015-11-11 | Lifecodexx AG | Multiplex detection of DNA that originates from a specific cell-type |
| US9909167B2 (en) | 2014-06-23 | 2018-03-06 | The Board Of Trustees Of The Leland Stanford Junior University | On-slide staining by primer extension |
| JP6793112B2 (ja) * | 2014-08-01 | 2020-12-02 | アリオサ ダイアグノスティックス インコーポレイテッドAriosa Diagnostics,Inc. | 胎児コピー数変異の統計的尤度を提供するアッセイ方法および胎児染色体異数性の尤度決定のためのアッセイ方法 |
| GB201507376D0 (en) | 2015-04-30 | 2015-06-17 | Vanadis Diagnostics Ab | Use of a porous transparent capillary membrane for counting rolling circle amplification products |
| KR102753113B1 (ko) * | 2015-09-18 | 2025-01-09 | 바나디스 다이아그노스틱스 | Dna 샘플의 분석을 위한 프로브 세트 및 이의 사용 방법 |
| HUE050491T2 (hu) * | 2015-11-10 | 2020-12-28 | Eurofins Lifecodexx Gmbh | Magzati kromoszomális aneuploidiák kimutatása olyan DNS régiókat alkalmazva, amelyek különbözõképpen vannak metilezve a magzat és a terhes nõstény között |
| CN108603224B (zh) | 2015-12-16 | 2022-06-28 | 富鲁达公司 | 高水平多路复用扩增 |
| SG11201805119QA (en) | 2015-12-17 | 2018-07-30 | Guardant Health Inc | Methods to determine tumor gene copy number by analysis of cell-free dna |
| WO2017176630A1 (en) * | 2016-04-07 | 2017-10-12 | The Board Of Trustees Of The Leland Stanford Junior University | Noninvasive diagnostics by sequencing 5-hydroxymethylated cell-free dna |
| US20170298422A1 (en) | 2016-04-18 | 2017-10-19 | The Board Of Trustees Of The Leland Stanford Junior University | Simultaneous single-molecule epigenetic imaging of dna methylation and hydroxymethylation |
| AU2017302300B2 (en) | 2016-07-27 | 2023-08-17 | The Board Of Trustees Of The Leland Stanford Junior University | Highly-multiplexed fluorescent imaging |
| EP3497242B1 (en) * | 2016-08-10 | 2025-01-22 | Grail, Inc. | Methods of analyzing nucleic acid fragments |
| US10503929B2 (en) | 2016-08-22 | 2019-12-10 | International Business Machines Corporation | Visually configurable privacy enforcement |
| EP3526349B1 (en) | 2016-10-13 | 2021-03-17 | F. Hoffmann-La Roche AG | Molecular detection and counting using nanopores |
| BR112019007865A2 (pt) | 2016-10-27 | 2019-07-02 | Vanadis Diagnostics | método para processamento de produtos de amplificação do círculo rolante |
| US11773434B2 (en) | 2017-06-20 | 2023-10-03 | The Medical College Of Wisconsin, Inc. | Assessing transplant complication risk with total cell-free DNA |
| US11117128B2 (en) | 2017-08-25 | 2021-09-14 | Vanadis Diagnostics Ab | Filtration device |
| ES2702432B2 (es) | 2017-08-31 | 2019-08-05 | Venegas Pedro Manuel Medina | Método y dispositivo para el análisis de ácidos nucleicos |
| WO2019222560A1 (en) * | 2018-05-16 | 2019-11-21 | Twinstrand Biosciences, Inc. | Methods and reagents for resolving nucleic acid mixtures and mixed cell populations and associated applications |
| AU2019287163B2 (en) | 2018-06-12 | 2025-08-21 | Keygene N.V. | Nucleic acid amplification method |
| JP2022519159A (ja) | 2018-12-17 | 2022-03-22 | ナテラ, インコーポレイテッド | 循環細胞の分析方法 |
| CA3127572A1 (en) | 2019-02-21 | 2020-08-27 | Keygene N.V. | Genotyping of polyploids |
| US11931674B2 (en) | 2019-04-04 | 2024-03-19 | Natera, Inc. | Materials and methods for processing blood samples |
| JP7441243B2 (ja) * | 2019-05-14 | 2024-02-29 | エフ. ホフマン-ラ ロシュ アーゲー | 試料分析のための装置および方法 |
| JP7775188B2 (ja) * | 2019-09-30 | 2025-11-25 | マイオーム,インコーポレイテッド | In vitro受精に関する多遺伝子リスクスコア |
| CN115461455A (zh) | 2020-04-17 | 2022-12-09 | 豪夫迈·罗氏有限公司 | 用于尿液样品分析的装置和方法 |
| WO2022225933A1 (en) | 2021-04-22 | 2022-10-27 | Natera, Inc. | Methods for determining velocity of tumor growth |
| EP4381099A1 (en) | 2021-08-02 | 2024-06-12 | Natera, Inc. | Methods for detecting neoplasm in pregnant women |
| US20250132047A1 (en) * | 2021-09-27 | 2025-04-24 | Myome, Inc. | Methods to Simulate Prospective Embryo Genotypes and Approximate Disease Occurrence Risk |
| WO2023133131A1 (en) | 2022-01-04 | 2023-07-13 | Natera, Inc. | Methods for cancer detection and monitoring |
| WO2024138002A1 (en) * | 2022-12-23 | 2024-06-27 | Caredx, Inc. | Determining amounts of contributor-derived nucleic acids of a mixed sample (3+ genetically distinct genomic contributors) of a transplant recipient |
Citations (10)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US5876924A (en) * | 1994-06-22 | 1999-03-02 | Mount Sinai School Of Medicine | Nucleic acid amplification method hybridization signal amplification method (HSAM) |
| US20010051341A1 (en) * | 1997-03-04 | 2001-12-13 | Isis Innovation Limited | Non-invasive prenatal diagnosis |
| US20020132241A1 (en) * | 2000-02-07 | 2002-09-19 | Jian-Bing Fan | Multiplexed detection of analytes |
| US20020160361A1 (en) * | 2000-01-28 | 2002-10-31 | Christine Loehrlein | Methods for analysis of gene expression |
| US20030108913A1 (en) * | 2000-02-15 | 2003-06-12 | Schouten Johannes Petrus | Multiplex ligatable probe amplification |
| US6858412B2 (en) * | 2000-10-24 | 2005-02-22 | The Board Of Trustees Of The Leland Stanford Junior University | Direct multiplex characterization of genomic DNA |
| US20070178478A1 (en) * | 2002-05-08 | 2007-08-02 | Dhallan Ravinder S | Methods for detection of genetic disorders |
| US20080090239A1 (en) * | 2006-06-14 | 2008-04-17 | Daniel Shoemaker | Rare cell analysis using sample splitting and dna tags |
| US20080096766A1 (en) * | 2006-06-16 | 2008-04-24 | Sequenom, Inc. | Methods and compositions for the amplification, detection and quantification of nucleic acid from a sample |
| US20090087847A1 (en) * | 2007-07-23 | 2009-04-02 | The Chinese University Of Hong Kong | Determining a nucleic acid sequence imbalance |
Family Cites Families (208)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US586245A (en) | 1897-07-13 | Lantern-slide carrier | ||
| NL285822A (https=) | 1961-11-23 | |||
| US4437975A (en) | 1977-07-20 | 1984-03-20 | Mobil Oil Corporation | Manufacture of lube base stock oil |
| US4318846A (en) | 1979-09-07 | 1982-03-09 | Syva Company | Novel ether substituted fluorescein polyamino acid compounds as fluorescers and quenchers |
| US4957858A (en) | 1986-04-16 | 1990-09-18 | The Salk Instute For Biological Studies | Replicative RNA reporter systems |
| US5242794A (en) | 1984-12-13 | 1993-09-07 | Applied Biosystems, Inc. | Detection of specific sequences in nucleic acids |
| US4683202A (en) | 1985-03-28 | 1987-07-28 | Cetus Corporation | Process for amplifying nucleic acid sequences |
| US4683195A (en) | 1986-01-30 | 1987-07-28 | Cetus Corporation | Process for amplifying, detecting, and/or-cloning nucleic acid sequences |
| US4757141A (en) | 1985-08-26 | 1988-07-12 | Applied Biosystems, Incorporated | Amino-derivatized phosphite and phosphate linking agents, phosphoramidite precursors, and useful conjugates thereof |
| US5091519A (en) | 1986-05-01 | 1992-02-25 | Amoco Corporation | Nucleotide compositions with linking groups |
| US5151507A (en) | 1986-07-02 | 1992-09-29 | E. I. Du Pont De Nemours And Company | Alkynylamino-nucleotides |
| WO1989001050A1 (en) | 1987-07-31 | 1989-02-09 | The Board Of Trustees Of The Leland Stanford Junior University | Selective amplification of target polynucleotide sequences |
| CA1340807C (en) | 1988-02-24 | 1999-11-02 | Lawrence T. Malek | Nucleic acid amplification process |
| JP2650159B2 (ja) | 1988-02-24 | 1997-09-03 | アクゾ・ノベル・エヌ・ベー | 核酸増幅方法 |
| US4988617A (en) | 1988-03-25 | 1991-01-29 | California Institute Of Technology | Method of detecting a nucleotide change in nucleic acids |
| US5066580A (en) | 1988-08-31 | 1991-11-19 | Becton Dickinson And Company | Xanthene dyes that emit to the red of fluorescein |
| CA2005589C (en) | 1988-12-16 | 2001-02-06 | Akzo Nobel Nv | Self-sustained, sequence replication system |
| US5856092A (en) | 1989-02-13 | 1999-01-05 | Geneco Pty Ltd | Detection of a nucleic acid sequence or a change therein |
| US5800992A (en) | 1989-06-07 | 1998-09-01 | Fodor; Stephen P.A. | Method of detecting nucleic acids |
| US5547839A (en) | 1989-06-07 | 1996-08-20 | Affymax Technologies N.V. | Sequencing of surface immobilized polymers utilizing microflourescence detection |
| US5871928A (en) | 1989-06-07 | 1999-02-16 | Fodor; Stephen P. A. | Methods for nucleic acid analysis |
| US5143854A (en) | 1989-06-07 | 1992-09-01 | Affymax Technologies N.V. | Large scale photolithographic solid phase synthesis of polypeptides and receptor binding screening thereof |
| CA2020958C (en) | 1989-07-11 | 2005-01-11 | Daniel L. Kacian | Nucleic acid sequence amplification methods |
| US5366860A (en) | 1989-09-29 | 1994-11-22 | Applied Biosystems, Inc. | Spectrally resolvable rhodamine dyes for nucleic acid sequence determination |
| US5188934A (en) | 1989-11-14 | 1993-02-23 | Applied Biosystems, Inc. | 4,7-dichlorofluorescein dyes as molecular probes |
| US5494810A (en) | 1990-05-03 | 1996-02-27 | Cornell Research Foundation, Inc. | Thermostable ligase-mediated DNA amplifications system for the detection of genetic disease |
| JPH06500471A (ja) | 1990-08-24 | 1994-01-20 | ザ・ユニバーシティ・オブ・テネシー・リサーチ・コーポレーション | Dna増幅フィンガープリント法 |
| WO1992007095A1 (en) | 1990-10-15 | 1992-04-30 | Stratagene | Arbitrarily primed polymerase chain reaction method for fingerprinting genomes |
| US5437975A (en) | 1991-02-25 | 1995-08-01 | California Institute Of Biological Research | Consensus sequence primed polymerase chain reaction method for fingerprinting genomes |
| US5270184A (en) | 1991-11-19 | 1993-12-14 | Becton, Dickinson And Company | Nucleic acid target generation |
| US5422252A (en) | 1993-06-04 | 1995-06-06 | Becton, Dickinson And Company | Simultaneous amplification of multiple targets |
| US6027923A (en) | 1993-07-23 | 2000-02-22 | Bio-Rad Laboratories, Inc. | Linked linear amplification of nucleic acids |
| CA2170604C (en) | 1993-08-30 | 2007-03-13 | Vikas V. Padhye | Nucleic acid purification compositions and methods |
| US6401267B1 (en) | 1993-09-27 | 2002-06-11 | Radoje Drmanac | Methods and compositions for efficient nucleic acid sequencing |
| US6045996A (en) | 1993-10-26 | 2000-04-04 | Affymetrix, Inc. | Hybridization assays on oligonucleotide arrays |
| CH686982A5 (fr) | 1993-12-16 | 1996-08-15 | Maurice Stroun | Méthode pour le diagnostic de cancers. |
| US5654419A (en) | 1994-02-01 | 1997-08-05 | The Regents Of The University Of California | Fluorescent labels and their use in separations |
| US6090555A (en) | 1997-12-11 | 2000-07-18 | Affymetrix, Inc. | Scanned image alignment systems and methods |
| US5578832A (en) | 1994-09-02 | 1996-11-26 | Affymetrix, Inc. | Method and apparatus for imaging a sample on a device |
| US5631734A (en) | 1994-02-10 | 1997-05-20 | Affymetrix, Inc. | Method and apparatus for detection of fluorescently labeled materials |
| US5705628A (en) | 1994-09-20 | 1998-01-06 | Whitehead Institute For Biomedical Research | DNA purification and isolation using magnetic particles |
| GB9425138D0 (en) | 1994-12-12 | 1995-02-08 | Dynal As | Isolation of nucleic acid |
| US7803529B1 (en) | 1995-04-11 | 2010-09-28 | Sequenom, Inc. | Solid phase sequencing of biopolymers |
| US5648245A (en) | 1995-05-09 | 1997-07-15 | Carnegie Institution Of Washington | Method for constructing an oligonucleotide concatamer library by rolling circle replication |
| US5545531A (en) | 1995-06-07 | 1996-08-13 | Affymax Technologies N.V. | Methods for making a device for concurrently processing multiple biological chip assays |
| DK0862656T3 (da) | 1995-11-21 | 2001-04-09 | Univ Yale | Unimolekylær segmentamplifikation og -detektering |
| US6852487B1 (en) | 1996-02-09 | 2005-02-08 | Cornell Research Foundation, Inc. | Detection of nucleic acid sequence differences using the ligase detection reaction with addressable arrays |
| GB2307276A (en) | 1996-03-06 | 1997-05-21 | Shell Int Research | Multi-phase fluid compressor |
| AU2324997A (en) | 1996-03-15 | 1997-10-01 | Penn State Research Foundation, The | Detection of extracellular tumor-associated nucleic acid in blood plasma or ser um using nucleic acid amplification assays |
| DE69739909D1 (de) | 1996-03-26 | 2010-07-29 | Michael S Kopreski | Methoden aus plasma oder serum extrahierte extrazelluraere rna zur diagnoseüberwachung oder evaluation von krebs verwenden |
| US6114122A (en) | 1996-03-26 | 2000-09-05 | Affymetrix, Inc. | Fluidics station with a mounting system and method of using |
| US5800996A (en) | 1996-05-03 | 1998-09-01 | The Perkin Elmer Corporation | Energy transfer dyes with enchanced fluorescence |
| US5847162A (en) | 1996-06-27 | 1998-12-08 | The Perkin Elmer Corporation | 4, 7-Dichlororhodamine dyes |
| EP0902885A4 (en) | 1996-05-16 | 2006-09-27 | Affymetrix Inc | SYSTEMS AND METHODS FOR DETECTION OF BRANDED PRODUCTS |
| EP2369007B1 (en) | 1996-05-29 | 2015-07-29 | Cornell Research Foundation, Inc. | Detection of nucleic acid sequence differences using coupled ligase detection and polymerase chain reactions |
| US6312892B1 (en) | 1996-07-19 | 2001-11-06 | Cornell Research Foundation, Inc. | High fidelity detection of nucleic acid differences by ligase detection reaction |
| GB9620209D0 (en) | 1996-09-27 | 1996-11-13 | Cemu Bioteknik Ab | Method of sequencing DNA |
| US6309824B1 (en) | 1997-01-16 | 2001-10-30 | Hyseq, Inc. | Methods for analyzing a target nucleic acid using immobilized heterogeneous mixtures of oligonucleotide probes |
| GB9704444D0 (en) | 1997-03-04 | 1997-04-23 | Isis Innovation | Non-invasive prenatal diagnosis |
| US5888740A (en) | 1997-09-19 | 1999-03-30 | Genaco Biomedical Products, Inc. | Detection of aneuploidy and gene deletion by PCR-based gene- dose co-amplification of chromosome specific sequences with synthetic sequences with synthetic internal controls |
| JP4304348B2 (ja) | 1997-09-22 | 2009-07-29 | 独立行政法人理化学研究所 | Dnaの単離方法 |
| US6322901B1 (en) | 1997-11-13 | 2001-11-27 | Massachusetts Institute Of Technology | Highly luminescent color-selective nano-crystalline materials |
| US6207392B1 (en) | 1997-11-25 | 2001-03-27 | The Regents Of The University Of California | Semiconductor nanocrystal probes for biological applications and process for making and using such probes |
| US5990479A (en) | 1997-11-25 | 1999-11-23 | Regents Of The University Of California | Organo Luminescent semiconductor nanocrystal probes for biological applications and process for making and using such probes |
| US6914137B2 (en) | 1997-12-06 | 2005-07-05 | Dna Research Innovations Limited | Isolation of nucleic acids |
| US6201639B1 (en) | 1998-03-20 | 2001-03-13 | James W. Overbeck | Wide field of view and high speed scanning microscopy |
| US6185030B1 (en) | 1998-03-20 | 2001-02-06 | James W. Overbeck | Wide field of view and high speed scanning microscopy |
| AU3601599A (en) | 1998-03-25 | 1999-10-18 | Ulf Landegren | Rolling circle replication of padlock probes |
| US5936324A (en) | 1998-03-30 | 1999-08-10 | Genetic Microsystems Inc. | Moving magnet scanner |
| DK1076824T3 (da) | 1998-04-29 | 2006-09-18 | Nicholas John Wald | Prænatal screening for Downs syndrom |
| WO1999058664A1 (en) | 1998-05-14 | 1999-11-18 | Whitehead Institute For Biomedical Research | Solid phase technique for selectively isolating nucleic acids |
| WO2000004193A1 (en) | 1998-07-20 | 2000-01-27 | Yale University | Method for detecting nucleic acids using target-mediated ligation of bipartite primers |
| US6787308B2 (en) | 1998-07-30 | 2004-09-07 | Solexa Ltd. | Arrayed biomolecules and their use in sequencing |
| US6426513B1 (en) | 1998-09-18 | 2002-07-30 | Massachusetts Institute Of Technology | Water-soluble thiol-capped nanocrystals |
| US6251303B1 (en) | 1998-09-18 | 2001-06-26 | Massachusetts Institute Of Technology | Water-soluble fluorescent nanocrystals |
| US6036603A (en) | 1998-09-29 | 2000-03-14 | Universal Studios, Inc. | Whirlpool simulation effect |
| US6136229A (en) | 1998-10-15 | 2000-10-24 | Alliedsignal Inc. | Method for the mechanochemical preparation of high performance ceramics |
| US6949370B1 (en) | 1998-10-30 | 2005-09-27 | Cornell Research Foundation, Inc. | High fidelity thermostable ligase and uses thereof |
| US6864052B1 (en) | 1999-01-06 | 2005-03-08 | Callida Genomics, Inc. | Enhanced sequencing by hybridization using pools of probes |
| US6534293B1 (en) | 1999-01-06 | 2003-03-18 | Cornell Research Foundation, Inc. | Accelerating identification of single nucleotide polymorphisms and alignment of clones in genomic sequencing |
| GB9901475D0 (en) | 1999-01-22 | 1999-03-17 | Pyrosequencing Ab | A method of DNA sequencing |
| EP1147226B1 (en) | 1999-01-27 | 2013-01-23 | Folim G. Halaka | Materials and methods for the purification of polyelectrolytes |
| US7014994B1 (en) | 1999-03-19 | 2006-03-21 | Cornell Research Foundation,Inc. | Coupled polymerase chain reaction-restriction-endonuclease digestion-ligase detection reaction process |
| US6506594B1 (en) | 1999-03-19 | 2003-01-14 | Cornell Res Foundation Inc | Detection of nucleic acid sequence differences using the ligase detection reaction with addressable arrays |
| US6310199B1 (en) | 1999-05-14 | 2001-10-30 | Promega Corporation | pH dependent ion exchange matrix and method of use in the isolation of nucleic acids |
| US6218803B1 (en) | 1999-06-04 | 2001-04-17 | Genetic Microsystems, Inc. | Position sensing with variable capacitance transducers |
| US6818395B1 (en) | 1999-06-28 | 2004-11-16 | California Institute Of Technology | Methods and apparatus for analyzing polynucleotide sequences |
| AU7537200A (en) | 1999-09-29 | 2001-04-30 | Solexa Ltd. | Polynucleotide sequencing |
| US7582420B2 (en) | 2001-07-12 | 2009-09-01 | Illumina, Inc. | Multiplex nucleic acid reactions |
| US20050202461A1 (en) * | 2000-03-08 | 2005-09-15 | Getts Robert C. | Method for converting generic nucleic acid priming sequences |
| WO2001079548A2 (en) | 2000-04-14 | 2001-10-25 | Cornell Research Foundation, Inc. | Method of designing addressable array for detection of nucleic acid sequence differences using ligase detection reaction |
| US6386749B1 (en) | 2000-06-26 | 2002-05-14 | Affymetrix, Inc. | Systems and methods for heating and mixing fluids |
| ATE377093T1 (de) | 2000-07-07 | 2007-11-15 | Visigen Biotechnologies Inc | Sequenzbestimmung in echtzeit |
| GB0021977D0 (en) | 2000-09-07 | 2000-10-25 | Pyrosequencing Ab | Method of sequencing DNA |
| US6649138B2 (en) | 2000-10-13 | 2003-11-18 | Quantum Dot Corporation | Surface-modified semiconductive and metallic nanoparticles having enhanced dispersibility in aqueous media |
| US6664056B2 (en) | 2000-10-17 | 2003-12-16 | The Chinese University Of Hong Kong | Non-invasive prenatal monitoring |
| AU2002230526A1 (en) | 2000-12-01 | 2002-06-11 | Cornell Research Foundation, Inc. | Detection of nucleic acid differences using combined endonuclease cleavage and ligation reactions |
| US6576291B2 (en) | 2000-12-08 | 2003-06-10 | Massachusetts Institute Of Technology | Preparation of nanocrystallites |
| US20020197618A1 (en) * | 2001-01-20 | 2002-12-26 | Sampson Jeffrey R. | Synthesis and amplification of unstructured nucleic acids for rapid sequencing |
| US6787063B2 (en) | 2001-03-12 | 2004-09-07 | Seiko Epson Corporation | Compositions, methods for producing films, functional elements, methods for producing functional elements, methods for producing electro-optical devices and methods for producing electronic apparatus |
| IL159482A0 (en) | 2001-06-22 | 2004-06-01 | Univ Geneve | Method for detecting diseases caused by chromosomal imbalances |
| US6950755B2 (en) | 2001-07-02 | 2005-09-27 | City Of Hope | Genotype pattern recognition and classification |
| JP4567436B2 (ja) | 2001-07-20 | 2010-10-20 | ライフ テクノロジーズ コーポレーション | 発光ナノ粒子およびそれらの調製方法 |
| US6927028B2 (en) | 2001-08-31 | 2005-08-09 | Chinese University Of Hong Kong | Non-invasive methods for detecting non-host DNA in a host using epigenetic differences between the host and non-host DNA |
| DE10154318A1 (de) | 2001-10-26 | 2003-05-15 | Epigenomics Ag | Verfahren zur Analyse genomischer Methylierungsmuster |
| JP2005535283A (ja) | 2001-11-13 | 2005-11-24 | ルビコン ゲノミクス インコーポレイテッド | ランダムフラグメント化により生成されたdna分子を用いたdna増幅および配列決定 |
| IL163600A0 (en) | 2002-03-01 | 2005-12-18 | Ravgen Inc | Methods for detection of genetic disorders |
| US6977162B2 (en) | 2002-03-01 | 2005-12-20 | Ravgen, Inc. | Rapid analysis of variations in a genome |
| US7727720B2 (en) | 2002-05-08 | 2010-06-01 | Ravgen, Inc. | Methods for detection of genetic disorders |
| US7442506B2 (en) | 2002-05-08 | 2008-10-28 | Ravgen, Inc. | Methods for detection of genetic disorders |
| US20040009518A1 (en) | 2002-05-14 | 2004-01-15 | The Chinese University Of Hong Kong | Methods for evaluating a disease condition by nucleic acid detection and fractionation |
| US20040086864A1 (en) | 2002-10-22 | 2004-05-06 | The Chinese University Of Hong Kong | Novel classification methods for pleural effusions |
| US20060204495A1 (en) | 2002-12-31 | 2006-09-14 | Zang Jingwu Z | Isolation and identification of cross-reactive t cells |
| WO2004065629A1 (en) | 2003-01-17 | 2004-08-05 | The Chinese University Of Hong Kong | Circulating mrna as diagnostic markers for pregnancy-related disorders |
| CA2513899C (en) | 2003-01-29 | 2013-03-26 | 454 Corporation | Methods of amplifying and sequencing nucleic acids |
| US7601491B2 (en) | 2003-02-06 | 2009-10-13 | Becton, Dickinson And Company | Pretreatment method for extraction of nucleic acid from biological samples and kits therefor |
| WO2005007869A2 (en) | 2003-07-10 | 2005-01-27 | Third Wave Technologies, Inc. | Assays for the direct measurement of gene dosage |
| US7371525B2 (en) | 2003-07-29 | 2008-05-13 | The Chinese University Of Hong Kong | Compositions and methods for diagnosing and treating severe acute respiratory syndrome (SARS) |
| US7343190B2 (en) | 2003-07-29 | 2008-03-11 | Ntd Laboratories, Inc. | System and method for assessing fetal abnormality based on landmarks |
| US7244233B2 (en) | 2003-07-29 | 2007-07-17 | Ntd Laboratories, Inc. | System and method for utilizing shape analysis to assess fetal abnormality |
| US8808991B2 (en) * | 2003-09-02 | 2014-08-19 | Keygene N.V. | Ola-based methods for the detection of target nucleic avid sequences |
| WO2005023091A2 (en) | 2003-09-05 | 2005-03-17 | The Trustees Of Boston University | Method for non-invasive prenatal diagnosis |
| EP1685380A2 (en) | 2003-09-18 | 2006-08-02 | Parallele Bioscience, Inc. | System and methods for enhancing signal-to-noise ratios of microarray-based measurements |
| US7315787B2 (en) | 2003-10-07 | 2008-01-01 | Ntd Laboratories, Inc. | Multi-marker screening protocol for fetal abnormalities |
| ATE435301T1 (de) * | 2003-10-16 | 2009-07-15 | Sequenom Inc | Nicht invasiver nachweis fötaler genetischer merkmale |
| CA2555704A1 (en) | 2004-02-10 | 2005-08-25 | Cornell Research Foundation, Inc. | Method for detection of promoter methylation status |
| US7622281B2 (en) | 2004-05-20 | 2009-11-24 | The Board Of Trustees Of The Leland Stanford Junior University | Methods and compositions for clonal amplification of nucleic acid |
| US7709194B2 (en) | 2004-06-04 | 2010-05-04 | The Chinese University Of Hong Kong | Marker for prenatal diagnosis and monitoring |
| US7527929B2 (en) | 2004-07-30 | 2009-05-05 | Agencourt Bioscience Corporation | Methods of isolating nucleic acids using multifunctional group-coated solid phase carriers |
| WO2006073504A2 (en) | 2004-08-04 | 2006-07-13 | President And Fellows Of Harvard College | Wobble sequencing |
| DE602005024987D1 (de) | 2004-08-24 | 2011-01-05 | Cornell Res Foundation Inc | Detektion von nucleinsäureunterschieden mit hilfe von endonucleasespaltungs-/ligaseabgabereaktionen und kapillarelektrophoresen oder mikroarrays |
| CA3007182A1 (en) | 2005-03-18 | 2006-09-21 | The Chinese University Of Hong Kong | Markers for prenatal diagnosis, monitoring or predicting preeclampsia |
| US7645576B2 (en) | 2005-03-18 | 2010-01-12 | The Chinese University Of Hong Kong | Method for the detection of chromosomal aneuploidies |
| US8515679B2 (en) * | 2005-12-06 | 2013-08-20 | Natera, Inc. | System and method for cleaning noisy genetic data and determining chromosome copy number |
| WO2007120208A2 (en) | 2005-11-14 | 2007-10-25 | President And Fellows Of Harvard College | Nanogrid rolling circle dna sequencing |
| ES2634665T3 (es) * | 2005-11-26 | 2017-09-28 | Natera, Inc. | Método y sistema para detectar anormalidades cromosómicas |
| WO2007087312A2 (en) | 2006-01-23 | 2007-08-02 | Population Genetics Technologies Ltd. | Molecular counting |
| EP3591068A1 (en) | 2006-02-02 | 2020-01-08 | The Board of Trustees of the Leland Stanford Junior University | Non-invasive fetal genetic screening by digital analysis |
| WO2007092538A2 (en) | 2006-02-07 | 2007-08-16 | President And Fellows Of Harvard College | Methods for making nucleotide probes for sequencing and synthesis |
| US20100184044A1 (en) | 2006-02-28 | 2010-07-22 | University Of Louisville Research Foundation | Detecting Genetic Abnormalities |
| EP2351858B1 (en) | 2006-02-28 | 2014-12-31 | University of Louisville Research Foundation | Detecting fetal chromosomal abnormalities using tandem single nucleotide polymorphisms |
| US20100184043A1 (en) | 2006-02-28 | 2010-07-22 | University Of Louisville Research Foundation | Detecting Genetic Abnormalities |
| US8609338B2 (en) | 2006-02-28 | 2013-12-17 | University Of Louisville Research Foundation, Inc. | Detecting fetal chromosomal abnormalities using tandem single nucleotide polymorphisms |
| EP1991698B1 (en) * | 2006-03-01 | 2013-12-18 | Keygene N.V. | High throughput sequence-based detection of snps using ligation assays |
| WO2007126377A1 (en) | 2006-04-27 | 2007-11-08 | Vytal Diagnostics Ab | Method and kit for molecular chromosomal quantification |
| US7901884B2 (en) | 2006-05-03 | 2011-03-08 | The Chinese University Of Hong Kong | Markers for prenatal diagnosis and monitoring |
| US7754428B2 (en) | 2006-05-03 | 2010-07-13 | The Chinese University Of Hong Kong | Fetal methylation markers |
| EP2029779A4 (en) | 2006-06-14 | 2010-01-20 | Living Microsystems Inc | HIGHLY PARALLEL SNP GENOTYPING UTILIZATION FOR FETAL DIAGNOSIS |
| US8137912B2 (en) | 2006-06-14 | 2012-03-20 | The General Hospital Corporation | Methods for the diagnosis of fetal abnormalities |
| EP2589668A1 (en) | 2006-06-14 | 2013-05-08 | Verinata Health, Inc | Rare cell analysis using sample splitting and DNA tags |
| US20080050739A1 (en) | 2006-06-14 | 2008-02-28 | Roland Stoughton | Diagnosis of fetal abnormalities using polymorphisms including short tandem repeats |
| ATE517192T1 (de) | 2006-08-10 | 2011-08-15 | Merck Patent Gmbh | Verfahren zur isolierung von zellen |
| TWI335354B (en) | 2006-09-27 | 2011-01-01 | Univ Hong Kong Chinese | Methods for the detection of the degree of the methylation of a target dna and kits |
| IL180095A0 (en) | 2006-12-14 | 2007-05-15 | Ohad Birk | Method for antenatal estimation of down syndrome risk |
| US7842482B2 (en) | 2007-02-26 | 2010-11-30 | The Chinese University Of Hong Kong | Methods and kits for diagnosis, prognosis or monitoring of Epstein-Barr virus (EBV)-associated cancer |
| WO2008118998A2 (en) | 2007-03-27 | 2008-10-02 | Primera Biosystems Inc. | Method for multiplex detection and quantitation of nucleic acids |
| US12180549B2 (en) | 2007-07-23 | 2024-12-31 | The Chinese University Of Hong Kong | Diagnosing fetal chromosomal aneuploidy using genomic sequencing |
| US20090053719A1 (en) | 2007-08-03 | 2009-02-26 | The Chinese University Of Hong Kong | Analysis of nucleic acids by digital pcr |
| US8748100B2 (en) | 2007-08-30 | 2014-06-10 | The Chinese University Of Hong Kong | Methods and kits for selectively amplifying, detecting or quantifying target DNA with specific end sequences |
| JP4714196B2 (ja) | 2007-09-05 | 2011-06-29 | 信越化学工業株式会社 | トリクロロシランの製造方法および多結晶シリコンの製造方法 |
| EP2201143B2 (en) | 2007-09-21 | 2016-08-24 | Katholieke Universiteit Leuven | Tools and methods for genetic tests using next generation sequencing |
| US8518640B2 (en) | 2007-10-29 | 2013-08-27 | Complete Genomics, Inc. | Nucleic acid sequencing and process |
| US8852864B2 (en) | 2008-01-17 | 2014-10-07 | Sequenom Inc. | Methods and compositions for the analysis of nucleic acids |
| JP2011511644A (ja) * | 2008-02-12 | 2011-04-14 | ノバルティス アーゲー | 無細胞のアポトーシス性核酸または胎児核酸を単離するための方法 |
| EP2321642B1 (en) | 2008-08-04 | 2017-01-11 | Natera, Inc. | Methods for allele calling and ploidy calling |
| US8476013B2 (en) | 2008-09-16 | 2013-07-02 | Sequenom, Inc. | Processes and compositions for methylation-based acid enrichment of fetal nucleic acid from a maternal sample useful for non-invasive prenatal diagnoses |
| CA3069082C (en) | 2008-09-20 | 2022-03-22 | The Board Of Trustees Of The Leland Stanford Junior University | Noninvasive diagnosis of fetal aneuploidy by sequencing |
| US8312249B1 (en) | 2008-10-10 | 2012-11-13 | Apple Inc. | Dynamic trampoline and structured code generation in a signed code environment |
| CN102469993B (zh) | 2009-07-21 | 2014-07-16 | 株式会社岛津制作所 | 生物体光测量装置 |
| US20110027771A1 (en) | 2009-07-31 | 2011-02-03 | Artemis Health, Inc. | Methods and compositions for cell stabilization |
| JP5396238B2 (ja) | 2009-11-02 | 2014-01-22 | 株式会社Nttドコモ | 無線通信制御方法、基地局装置及び移動端末装置 |
| EP3783110B1 (en) | 2009-11-05 | 2022-11-23 | The Chinese University Of Hong Kong | Fetal genomic analysis from a maternal biological sample |
| CA2780016C (en) | 2009-11-06 | 2017-09-19 | The Chinese University Of Hong Kong | Size-based genomic analysis |
| JP2013511991A (ja) * | 2009-11-25 | 2013-04-11 | クアンタライフ, インコーポレイテッド | 遺伝子材料を検出する方法および組成物 |
| US8574842B2 (en) | 2009-12-22 | 2013-11-05 | The Board Of Trustees Of The Leland Stanford Junior University | Direct molecular diagnosis of fetal aneuploidy |
| EP2370599B1 (en) | 2010-01-19 | 2015-01-21 | Verinata Health, Inc | Method for determining copy number variations |
| WO2011091063A1 (en) | 2010-01-19 | 2011-07-28 | Verinata Health, Inc. | Partition defined detection methods |
| US20120010085A1 (en) | 2010-01-19 | 2012-01-12 | Rava Richard P | Methods for determining fraction of fetal nucleic acids in maternal samples |
| US9260745B2 (en) | 2010-01-19 | 2016-02-16 | Verinata Health, Inc. | Detecting and classifying copy number variation |
| US20120237928A1 (en) | 2010-10-26 | 2012-09-20 | Verinata Health, Inc. | Method for determining copy number variations |
| US20120270739A1 (en) | 2010-01-19 | 2012-10-25 | Verinata Health, Inc. | Method for sample analysis of aneuploidies in maternal samples |
| US20120100548A1 (en) | 2010-10-26 | 2012-04-26 | Verinata Health, Inc. | Method for determining copy number variations |
| US20110312503A1 (en) | 2010-01-23 | 2011-12-22 | Artemis Health, Inc. | Methods of fetal abnormality detection |
| WO2011146632A1 (en) | 2010-05-18 | 2011-11-24 | Gene Security Network Inc. | Methods for non-invasive prenatal ploidy calling |
| US20120190557A1 (en) | 2011-01-25 | 2012-07-26 | Aria Diagnostics, Inc. | Risk calculation for evaluation of fetal aneuploidy |
| US20130040375A1 (en) | 2011-08-08 | 2013-02-14 | Tandem Diagnotics, Inc. | Assay systems for genetic analysis |
| US8700338B2 (en) | 2011-01-25 | 2014-04-15 | Ariosa Diagnosis, Inc. | Risk calculation for evaluation of fetal aneuploidy |
| US11031095B2 (en) | 2010-08-06 | 2021-06-08 | Ariosa Diagnostics, Inc. | Assay systems for determination of fetal copy number variation |
| US20130261003A1 (en) * | 2010-08-06 | 2013-10-03 | Ariosa Diagnostics, In. | Ligation-based detection of genetic variants |
| US10533223B2 (en) | 2010-08-06 | 2020-01-14 | Ariosa Diagnostics, Inc. | Detection of target nucleic acids using hybridization |
| US20120034603A1 (en) | 2010-08-06 | 2012-02-09 | Tandem Diagnostics, Inc. | Ligation-based detection of genetic variants |
| US20140342940A1 (en) | 2011-01-25 | 2014-11-20 | Ariosa Diagnostics, Inc. | Detection of Target Nucleic Acids using Hybridization |
| IT1401427B1 (it) | 2010-08-11 | 2013-07-26 | Nuova Pignone S R L | Metodi e dispositivi usati per controllare automaticamente la velocita di un espansore |
| US9267174B2 (en) | 2010-10-26 | 2016-02-23 | Stanford University | Method of simultaneously screening for multiple genotypes and/or mutations |
| CN103608466B (zh) | 2010-12-22 | 2020-09-18 | 纳特拉公司 | 非侵入性产前亲子鉴定方法 |
| WO2012088348A2 (en) | 2010-12-23 | 2012-06-28 | Sequenom, Inc. | Fetal genetic variation detection |
| US8756020B2 (en) | 2011-01-25 | 2014-06-17 | Ariosa Diagnostics, Inc. | Enhanced risk probabilities using biomolecule estimations |
| US20120190020A1 (en) | 2011-01-25 | 2012-07-26 | Aria Diagnostics, Inc. | Detection of genetic abnormalities |
| ES2728131T3 (es) | 2011-01-25 | 2019-10-22 | Ariosa Diagnostics Inc | Cálculo del riesgo para la evaluación de la aneuploidia fetal |
| WO2012118745A1 (en) | 2011-02-28 | 2012-09-07 | Arnold Oliphant | Assay systems for detection of aneuploidy and sex determination |
| RS57837B1 (sr) | 2011-04-12 | 2018-12-31 | Verinata Health Inc | Razrešavanje genomskih frakcija upotrebom broja kopija polimorfizama |
| GB2484764B (en) | 2011-04-14 | 2012-09-05 | Verinata Health Inc | Normalizing chromosomes for the determination and verification of common and rare chromosomal aneuploidies |
| DK2729580T3 (en) | 2011-07-08 | 2015-12-14 | Keygene Nv | SEQUENCE BASED genotyping BASED ON OLIGONUKLEOTIDLIGERINGSASSAYS |
| US10196681B2 (en) | 2011-10-06 | 2019-02-05 | Sequenom, Inc. | Methods and processes for non-invasive assessment of genetic variations |
| WO2013192292A1 (en) | 2012-06-21 | 2013-12-27 | Justin Lamb | Massively-parallel multiplex locus-specific nucleic acid sequence analysis |
| EP2875156A4 (en) | 2012-07-19 | 2016-02-24 | Ariosa Diagnostics Inc | SEQUENTIAL LIGATION-BASED MULTIPLEX DETECTION OF GENETIC VARIANTS |
| JP6793112B2 (ja) | 2014-08-01 | 2020-12-02 | アリオサ ダイアグノスティックス インコーポレイテッドAriosa Diagnostics,Inc. | 胎児コピー数変異の統計的尤度を提供するアッセイ方法および胎児染色体異数性の尤度決定のためのアッセイ方法 |
| US9854317B1 (en) | 2014-11-24 | 2017-12-26 | Wew Entertainment Corporation | Enabling video viewer interaction |
-
2011
- 2011-01-25 US US13/013,732 patent/US20120034603A1/en not_active Abandoned
- 2011-08-08 EP EP18167314.6A patent/EP3418394B1/en active Active
- 2011-08-08 WO PCT/US2011/046935 patent/WO2012019187A2/en not_active Ceased
- 2011-08-08 AU AU2011285512A patent/AU2011285512B2/en not_active Ceased
- 2011-08-08 AU AU2011285477A patent/AU2011285477C1/en active Active
- 2011-08-08 CA CA2807594A patent/CA2807594C/en active Active
- 2011-08-08 US US13/205,570 patent/US9890421B2/en active Active
- 2011-08-08 CA CA2807572A patent/CA2807572C/en active Active
- 2011-08-08 WO PCT/US2011/046981 patent/WO2012019200A2/en not_active Ceased
- 2011-08-08 WO PCT/US2011/046963 patent/WO2012019193A2/en not_active Ceased
- 2011-08-08 ES ES18163473T patent/ES2863778T3/es active Active
- 2011-08-08 US US13/205,603 patent/US10308981B2/en active Active
- 2011-08-08 EP EP18163473.4A patent/EP3395955B1/en active Active
- 2011-08-08 EP EP11745883.6A patent/EP2601311B1/en active Active
- 2011-08-08 AU AU2011285518A patent/AU2011285518B2/en active Active
- 2011-08-08 ES ES18167314T patent/ES2913402T3/es active Active
- 2011-08-08 WO PCT/US2011/046976 patent/WO2012019198A2/en not_active Ceased
- 2011-08-08 ES ES11745883.6T patent/ES2685465T3/es active Active
- 2011-08-08 ES ES11745881T patent/ES2718111T3/es active Active
- 2011-08-08 CA CA2807569A patent/CA2807569A1/en not_active Abandoned
- 2011-08-08 EP EP11745880.2A patent/EP2601309A2/en not_active Withdrawn
- 2011-08-08 EP EP11745881.0A patent/EP2601310B1/en active Active
- 2011-08-08 JP JP2013523386A patent/JP6141185B2/ja active Active
- 2011-11-10 US US13/293,419 patent/US10131937B2/en active Active
-
2012
- 2012-11-28 US US13/687,025 patent/US20130090250A1/en not_active Abandoned
-
2013
- 2013-02-03 IL IL224554A patent/IL224554A/en active IP Right Grant
- 2013-02-03 IL IL224556A patent/IL224556A/en active IP Right Grant
- 2013-02-03 IL IL224557A patent/IL224557A/en active IP Right Grant
- 2013-03-08 US US13/789,817 patent/US20130172212A1/en not_active Abandoned
- 2013-03-08 US US13/789,789 patent/US20130172211A1/en not_active Abandoned
- 2013-03-08 US US13/789,846 patent/US20130172213A1/en not_active Abandoned
-
2017
- 2017-05-02 JP JP2017091887A patent/JP6356866B2/ja active Active
- 2017-05-02 JP JP2017091888A patent/JP6637920B2/ja active Active
- 2017-12-21 US US15/851,363 patent/US11319578B2/en active Active
-
2018
- 2018-10-12 US US16/159,588 patent/US10907198B2/en active Active
-
2019
- 2019-05-23 US US16/421,398 patent/US11299772B2/en active Active
-
2022
- 2022-04-01 US US17/711,769 patent/US12344887B2/en active Active
Patent Citations (10)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US5876924A (en) * | 1994-06-22 | 1999-03-02 | Mount Sinai School Of Medicine | Nucleic acid amplification method hybridization signal amplification method (HSAM) |
| US20010051341A1 (en) * | 1997-03-04 | 2001-12-13 | Isis Innovation Limited | Non-invasive prenatal diagnosis |
| US20020160361A1 (en) * | 2000-01-28 | 2002-10-31 | Christine Loehrlein | Methods for analysis of gene expression |
| US20020132241A1 (en) * | 2000-02-07 | 2002-09-19 | Jian-Bing Fan | Multiplexed detection of analytes |
| US20030108913A1 (en) * | 2000-02-15 | 2003-06-12 | Schouten Johannes Petrus | Multiplex ligatable probe amplification |
| US6858412B2 (en) * | 2000-10-24 | 2005-02-22 | The Board Of Trustees Of The Leland Stanford Junior University | Direct multiplex characterization of genomic DNA |
| US20070178478A1 (en) * | 2002-05-08 | 2007-08-02 | Dhallan Ravinder S | Methods for detection of genetic disorders |
| US20080090239A1 (en) * | 2006-06-14 | 2008-04-17 | Daniel Shoemaker | Rare cell analysis using sample splitting and dna tags |
| US20080096766A1 (en) * | 2006-06-16 | 2008-04-24 | Sequenom, Inc. | Methods and compositions for the amplification, detection and quantification of nucleic acid from a sample |
| US20090087847A1 (en) * | 2007-07-23 | 2009-04-02 | The Chinese University Of Hong Kong | Determining a nucleic acid sequence imbalance |
Non-Patent Citations (4)
| Title |
|---|
| Avent. Methods in Molecular Biology. 2008. 444:185-201. * |
| Mardis. Trends in Genetics. 2008. 24(3): 133-141. * |
| Shen et al. Genetics. 2008. 9:27. * |
| Van Opstal etal. European Journal of Human Genetics (2009) 17, 112-121. * |
Cited By (221)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US10083273B2 (en) | 2005-07-29 | 2018-09-25 | Natera, Inc. | System and method for cleaning noisy genetic data and determining chromosome copy number |
| US10392664B2 (en) | 2005-07-29 | 2019-08-27 | Natera, Inc. | System and method for cleaning noisy genetic data and determining chromosome copy number |
| US12509728B2 (en) | 2005-07-29 | 2025-12-30 | Natera, Inc. | System and method for cleaning noisy genetic data and determining chromosome copy number |
| US12571047B2 (en) | 2005-07-29 | 2026-03-10 | Natera, Inc. | System and method for cleaning noisy genetic data and determining chromosome copy number |
| US11111543B2 (en) | 2005-07-29 | 2021-09-07 | Natera, Inc. | System and method for cleaning noisy genetic data and determining chromosome copy number |
| US11111544B2 (en) | 2005-07-29 | 2021-09-07 | Natera, Inc. | System and method for cleaning noisy genetic data and determining chromosome copy number |
| US10081839B2 (en) | 2005-07-29 | 2018-09-25 | Natera, Inc | System and method for cleaning noisy genetic data and determining chromosome copy number |
| US10260096B2 (en) | 2005-07-29 | 2019-04-16 | Natera, Inc. | System and method for cleaning noisy genetic data and determining chromosome copy number |
| US10227652B2 (en) | 2005-07-29 | 2019-03-12 | Natera, Inc. | System and method for cleaning noisy genetic data from target individuals using genetic data from genetically related individuals |
| US10266893B2 (en) | 2005-07-29 | 2019-04-23 | Natera, Inc. | System and method for cleaning noisy genetic data and determining chromosome copy number |
| US8682592B2 (en) | 2005-11-26 | 2014-03-25 | Natera, Inc. | System and method for cleaning noisy genetic data from target individuals using genetic data from genetically related individuals |
| US11306359B2 (en) | 2005-11-26 | 2022-04-19 | Natera, Inc. | System and method for cleaning noisy genetic data from target individuals using genetic data from genetically related individuals |
| US10597724B2 (en) | 2005-11-26 | 2020-03-24 | Natera, Inc. | System and method for cleaning noisy genetic data from target individuals using genetic data from genetically related individuals |
| US9424392B2 (en) | 2005-11-26 | 2016-08-23 | Natera, Inc. | System and method for cleaning noisy genetic data from target individuals using genetic data from genetically related individuals |
| US9695477B2 (en) | 2005-11-26 | 2017-07-04 | Natera, Inc. | System and method for cleaning noisy genetic data from target individuals using genetic data from genetically related individuals |
| US10711309B2 (en) | 2005-11-26 | 2020-07-14 | Natera, Inc. | System and method for cleaning noisy genetic data from target individuals using genetic data from genetically related individuals |
| US9430611B2 (en) | 2005-11-26 | 2016-08-30 | Natera, Inc. | System and method for cleaning noisy genetic data from target individuals using genetic data from genetically related individuals |
| US12571043B2 (en) | 2005-11-26 | 2026-03-10 | Natera, Inc. | System and method for cleaning noisy genetic data from target individuals using genetic data from genetically related individuals |
| US10240202B2 (en) | 2005-11-26 | 2019-03-26 | Natera, Inc. | System and method for cleaning noisy genetic data from target individuals using genetic data from genetically related individuals |
| US10557164B2 (en) | 2008-01-17 | 2020-02-11 | Sequenom, Inc. | Methods and compositions for the analysis of biological molecules |
| US20110033862A1 (en) * | 2008-02-19 | 2011-02-10 | Gene Security Network, Inc. | Methods for cell genotyping |
| US20110092763A1 (en) * | 2008-05-27 | 2011-04-21 | Gene Security Network, Inc. | Methods for Embryo Characterization and Comparison |
| US9639657B2 (en) | 2008-08-04 | 2017-05-02 | Natera, Inc. | Methods for allele calling and ploidy calling |
| US20110178719A1 (en) * | 2008-08-04 | 2011-07-21 | Gene Security Network, Inc. | Methods for Allele Calling and Ploidy Calling |
| US9228234B2 (en) | 2009-09-30 | 2016-01-05 | Natera, Inc. | Methods for non-invasive prenatal ploidy calling |
| US10061890B2 (en) | 2009-09-30 | 2018-08-28 | Natera, Inc. | Methods for non-invasive prenatal ploidy calling |
| US10061889B2 (en) | 2009-09-30 | 2018-08-28 | Natera, Inc. | Methods for non-invasive prenatal ploidy calling |
| US10216896B2 (en) | 2009-09-30 | 2019-02-26 | Natera, Inc. | Methods for non-invasive prenatal ploidy calling |
| US10522242B2 (en) | 2009-09-30 | 2019-12-31 | Natera, Inc. | Methods for non-invasive prenatal ploidy calling |
| US10941442B2 (en) | 2010-01-19 | 2021-03-09 | Verinata Health, Inc. | Sequencing methods and compositions for prenatal diagnoses |
| US11875899B2 (en) | 2010-01-19 | 2024-01-16 | Verinata Health, Inc. | Analyzing copy number variation in the detection of cancer |
| US11697846B2 (en) | 2010-01-19 | 2023-07-11 | Verinata Health, Inc. | Detecting and classifying copy number variation |
| US12553084B2 (en) | 2010-01-19 | 2026-02-17 | Verinata Health, Inc. | Method for determining copy number variations |
| US20110224087A1 (en) * | 2010-01-19 | 2011-09-15 | Stephen Quake | Simultaneous determination of aneuploidy and fetal fraction |
| US11286520B2 (en) | 2010-01-19 | 2022-03-29 | Verinata Health, Inc. | Method for determining copy number variations |
| US9115401B2 (en) | 2010-01-19 | 2015-08-25 | Verinata Health, Inc. | Partition defined detection methods |
| US11130995B2 (en) | 2010-01-19 | 2021-09-28 | Verinata Health, Inc. | Simultaneous determination of aneuploidy and fetal fraction |
| US9657342B2 (en) | 2010-01-19 | 2017-05-23 | Verinata Health, Inc. | Sequencing methods for prenatal diagnoses |
| US20110230358A1 (en) * | 2010-01-19 | 2011-09-22 | Artemis Health, Inc. | Identification of polymorphic sequences in mixtures of genomic dna by whole genome sequencing |
| US10388403B2 (en) | 2010-01-19 | 2019-08-20 | Verinata Health, Inc. | Analyzing copy number variation in the detection of cancer |
| US12522869B2 (en) | 2010-01-19 | 2026-01-13 | Verinata Health, Inc. | Sequencing methods and compositions for prenatal diagnoses |
| US9493828B2 (en) | 2010-01-19 | 2016-11-15 | Verinata Health, Inc. | Methods for determining fraction of fetal nucleic acids in maternal samples |
| US12435373B2 (en) | 2010-01-19 | 2025-10-07 | Verinata Health, Inc. | Identification of polymorphic sequences in mixtures of genomic DNA |
| US11884975B2 (en) | 2010-01-19 | 2024-01-30 | Verinata Health, Inc. | Sequencing methods and compositions for prenatal diagnoses |
| US11952623B2 (en) | 2010-01-19 | 2024-04-09 | Verinata Health, Inc. | Simultaneous determination of aneuploidy and fetal fraction |
| US10415089B2 (en) | 2010-01-19 | 2019-09-17 | Verinata Health, Inc. | Detecting and classifying copy number variation |
| US10662474B2 (en) | 2010-01-19 | 2020-05-26 | Verinata Health, Inc. | Identification of polymorphic sequences in mixtures of genomic DNA by whole genome sequencing |
| US10612096B2 (en) | 2010-01-19 | 2020-04-07 | Verinata Health, Inc. | Methods for determining fraction of fetal nucleic acids in maternal samples |
| US9323888B2 (en) | 2010-01-19 | 2016-04-26 | Verinata Health, Inc. | Detecting and classifying copy number variation |
| US10586610B2 (en) | 2010-01-19 | 2020-03-10 | Verinata Health, Inc. | Detecting and classifying copy number variation |
| US9260745B2 (en) | 2010-01-19 | 2016-02-16 | Verinata Health, Inc. | Detecting and classifying copy number variation |
| US12139760B2 (en) | 2010-01-19 | 2024-11-12 | Verinata Health, Inc. | Methods for determining fraction of fetal nucleic acids in maternal samples |
| US10482993B2 (en) | 2010-01-19 | 2019-11-19 | Verinata Health, Inc. | Analyzing copy number variation in the detection of cancer |
| US10718020B2 (en) | 2010-01-23 | 2020-07-21 | Verinata Health, Inc. | Methods of fetal abnormality detection |
| US8318430B2 (en) | 2010-01-23 | 2012-11-27 | Verinata Health, Inc. | Methods of fetal abnormality detection |
| US9493831B2 (en) | 2010-01-23 | 2016-11-15 | Verinata Health, Inc. | Methods of fetal abnormality detection |
| US11111545B2 (en) | 2010-05-18 | 2021-09-07 | Natera, Inc. | Methods for simultaneous amplification of target loci |
| US10774380B2 (en) | 2010-05-18 | 2020-09-15 | Natera, Inc. | Methods for multiplex PCR amplification of target loci in a nucleic acid sample |
| US12553086B2 (en) | 2010-05-18 | 2026-02-17 | Natera, Inc. | Methods for simultaneous amplification of target loci |
| US9163282B2 (en) | 2010-05-18 | 2015-10-20 | Natera, Inc. | Methods for non-invasive prenatal ploidy calling |
| US12545960B2 (en) | 2010-05-18 | 2026-02-10 | Natera, Inc. | Methods for simultaneous amplification of target loci |
| US12509730B2 (en) | 2010-05-18 | 2025-12-30 | Natera, Inc. | Methods for simultaneous amplification of target loci |
| US11408031B2 (en) | 2010-05-18 | 2022-08-09 | Natera, Inc. | Methods for non-invasive prenatal paternity testing |
| US12410476B2 (en) | 2010-05-18 | 2025-09-09 | Natera, Inc. | Methods for simultaneous amplification of target loci |
| US8949036B2 (en) | 2010-05-18 | 2015-02-03 | Natera, Inc. | Methods for non-invasive prenatal ploidy calling |
| US11482300B2 (en) | 2010-05-18 | 2022-10-25 | Natera, Inc. | Methods for preparing a DNA fraction from a biological sample for analyzing genotypes of cell-free DNA |
| US11286530B2 (en) | 2010-05-18 | 2022-03-29 | Natera, Inc. | Methods for simultaneous amplification of target loci |
| US10316362B2 (en) | 2010-05-18 | 2019-06-11 | Natera, Inc. | Methods for simultaneous amplification of target loci |
| US10174369B2 (en) | 2010-05-18 | 2019-01-08 | Natera, Inc. | Methods for non-invasive prenatal ploidy calling |
| US11306357B2 (en) * | 2010-05-18 | 2022-04-19 | Natera, Inc. | Methods for non-invasive prenatal ploidy calling |
| US11939634B2 (en) | 2010-05-18 | 2024-03-26 | Natera, Inc. | Methods for simultaneous amplification of target loci |
| US11519035B2 (en) | 2010-05-18 | 2022-12-06 | Natera, Inc. | Methods for simultaneous amplification of target loci |
| US12270073B2 (en) | 2010-05-18 | 2025-04-08 | Natera, Inc. | Methods for preparing a biological sample obtained from an individual for use in a genetic testing assay |
| US11312996B2 (en) | 2010-05-18 | 2022-04-26 | Natera, Inc. | Methods for simultaneous amplification of target loci |
| US10793912B2 (en) | 2010-05-18 | 2020-10-06 | Natera, Inc. | Methods for simultaneous amplification of target loci |
| US12221653B2 (en) | 2010-05-18 | 2025-02-11 | Natera, Inc. | Methods for simultaneous amplification of target loci |
| US8825412B2 (en) | 2010-05-18 | 2014-09-02 | Natera, Inc. | Methods for non-invasive prenatal ploidy calling |
| US10526658B2 (en) | 2010-05-18 | 2020-01-07 | Natera, Inc. | Methods for simultaneous amplification of target loci |
| US11322224B2 (en) | 2010-05-18 | 2022-05-03 | Natera, Inc. | Methods for non-invasive prenatal ploidy calling |
| US11746376B2 (en) | 2010-05-18 | 2023-09-05 | Natera, Inc. | Methods for amplification of cell-free DNA using ligated adaptors and universal and inner target-specific primers for multiplexed nested PCR |
| US10538814B2 (en) | 2010-05-18 | 2020-01-21 | Natera, Inc. | Methods for simultaneous amplification of target loci |
| US10557172B2 (en) | 2010-05-18 | 2020-02-11 | Natera, Inc. | Methods for simultaneous amplification of target loci |
| US11525162B2 (en) | 2010-05-18 | 2022-12-13 | Natera, Inc. | Methods for simultaneous amplification of target loci |
| US12152275B2 (en) | 2010-05-18 | 2024-11-26 | Natera, Inc. | Methods for non-invasive prenatal ploidy calling |
| US10113196B2 (en) | 2010-05-18 | 2018-10-30 | Natera, Inc. | Prenatal paternity testing using maternal blood, free floating fetal DNA and SNP genotyping |
| US11339429B2 (en) | 2010-05-18 | 2022-05-24 | Natera, Inc. | Methods for non-invasive prenatal ploidy calling |
| US10590482B2 (en) | 2010-05-18 | 2020-03-17 | Natera, Inc. | Amplification of cell-free DNA using nested PCR |
| US12110552B2 (en) | 2010-05-18 | 2024-10-08 | Natera, Inc. | Methods for simultaneous amplification of target loci |
| US11332785B2 (en) | 2010-05-18 | 2022-05-17 | Natera, Inc. | Methods for non-invasive prenatal ploidy calling |
| US10597723B2 (en) | 2010-05-18 | 2020-03-24 | Natera, Inc. | Methods for simultaneous amplification of target loci |
| US20140162269A1 (en) * | 2010-05-18 | 2014-06-12 | Natera, Inc. | Methods for non-invasive prenatal ploidy calling |
| US11332793B2 (en) | 2010-05-18 | 2022-05-17 | Natera, Inc. | Methods for simultaneous amplification of target loci |
| US9334541B2 (en) | 2010-05-18 | 2016-05-10 | Natera, Inc. | Methods for non-invasive prenatal ploidy calling |
| US12553083B2 (en) | 2010-05-18 | 2026-02-17 | Natera, Inc. | Methods for enriching and sequencing nucleic acids for non-invasive cancer testing |
| US10655180B2 (en) | 2010-05-18 | 2020-05-19 | Natera, Inc. | Methods for simultaneous amplification of target loci |
| US10731220B2 (en) | 2010-05-18 | 2020-08-04 | Natera, Inc. | Methods for simultaneous amplification of target loci |
| US10017812B2 (en) | 2010-05-18 | 2018-07-10 | Natera, Inc. | Methods for non-invasive prenatal ploidy calling |
| US12020778B2 (en) | 2010-05-18 | 2024-06-25 | Natera, Inc. | Methods for non-invasive prenatal ploidy calling |
| US11326208B2 (en) | 2010-05-18 | 2022-05-10 | Natera, Inc. | Methods for nested PCR amplification of cell-free DNA |
| US12494267B2 (en) | 2010-05-18 | 2025-12-09 | Natera, Inc. | Methods for non-invasive prenatal ploidy calling |
| US9890421B2 (en) | 2010-08-06 | 2018-02-13 | Ariosa Diagnostics, Inc. | Assay systems for genetic analysis |
| US10308981B2 (en) | 2010-08-06 | 2019-06-04 | Ariosa Diagnostics, Inc. | Assay systems for determination of source contribution in a sample |
| US10233496B2 (en) | 2010-08-06 | 2019-03-19 | Ariosa Diagnostics, Inc. | Ligation-based detection of genetic variants |
| US10167508B2 (en) | 2010-08-06 | 2019-01-01 | Ariosa Diagnostics, Inc. | Detection of genetic abnormalities |
| US10533223B2 (en) | 2010-08-06 | 2020-01-14 | Ariosa Diagnostics, Inc. | Detection of target nucleic acids using hybridization |
| US11203786B2 (en) | 2010-08-06 | 2021-12-21 | Ariosa Diagnostics, Inc. | Detection of target nucleic acids using hybridization |
| US11031095B2 (en) | 2010-08-06 | 2021-06-08 | Ariosa Diagnostics, Inc. | Assay systems for determination of fetal copy number variation |
| US12344887B2 (en) | 2010-08-06 | 2025-07-01 | Roche Molecular Systems, Inc. | Assay systems for genetic analysis |
| US9567639B2 (en) | 2010-08-06 | 2017-02-14 | Ariosa Diagnostics, Inc. | Detection of target nucleic acids using hybridization |
| US10131937B2 (en) | 2010-08-06 | 2018-11-20 | Ariosa Diagnostics, Inc. | Assay systems for genetic analysis |
| US10131951B2 (en) | 2010-08-06 | 2018-11-20 | Ariosa Diagnostics, Inc. | Assay systems for genetic analysis |
| US11332774B2 (en) | 2010-10-26 | 2022-05-17 | Verinata Health, Inc. | Method for determining copy number variations |
| US10718024B2 (en) | 2011-01-25 | 2020-07-21 | Ariosa Diagnostics, Inc. | Risk calculation for evaluation of fetal aneuploidy |
| US10131947B2 (en) | 2011-01-25 | 2018-11-20 | Ariosa Diagnostics, Inc. | Noninvasive detection of fetal aneuploidy in egg donor pregnancies |
| US12195799B2 (en) | 2011-01-25 | 2025-01-14 | Ariosa Diagnostics, Inc. | Risk calculation for evaluation of fetal aneuploidy |
| US10718019B2 (en) | 2011-01-25 | 2020-07-21 | Ariosa Diagnostics, Inc. | Risk calculation for evaluation of fetal aneuploidy |
| US11441185B2 (en) | 2011-01-25 | 2022-09-13 | Roche Molecular Systems, Inc. | Noninvasive detection of fetal aneuploidy in egg donor pregnancies |
| US11270781B2 (en) | 2011-01-25 | 2022-03-08 | Ariosa Diagnostics, Inc. | Statistical analysis for non-invasive sex chromosome aneuploidy determination |
| US9447453B2 (en) | 2011-04-12 | 2016-09-20 | Verinata Health, Inc. | Resolving genome fractions using polymorphism counts |
| US10658070B2 (en) | 2011-04-12 | 2020-05-19 | Verinata Health, Inc. | Resolving genome fractions using polymorphism counts |
| US12367947B2 (en) | 2011-04-14 | 2025-07-22 | Verinata Health, Inc. | Normalizing chromosomes for the determination and verification of common and rare chromosomal aneuploidies |
| US8532936B2 (en) | 2011-04-14 | 2013-09-10 | Verinata Health, Inc. | Normalizing chromosomes for the determination and verification of common and rare chromosomal aneuploidies |
| US9411937B2 (en) | 2011-04-15 | 2016-08-09 | Verinata Health, Inc. | Detecting and classifying copy number variation |
| US11289176B2 (en) | 2011-09-07 | 2022-03-29 | Ariosa Diagnostics, Inc. | Determination of copy number variations using binomial probability calculations |
| US10847250B2 (en) | 2011-09-07 | 2020-11-24 | Ariosa Diagnostics, Inc. | Determination of copy number variations using binomial probability calculations |
| US10289800B2 (en) | 2012-05-21 | 2019-05-14 | Ariosa Diagnostics, Inc. | Processes for calculating phased fetal genomic sequences |
| US11404142B2 (en) | 2012-05-21 | 2022-08-02 | Roche Molecular Systems, Inc. | Processes for calculating phased fetal genomic sequences |
| WO2014015269A1 (en) * | 2012-07-19 | 2014-01-23 | Ariosa Diagnostics, Inc. | Multiplexed sequential ligation-based detection of genetic variants |
| US9206417B2 (en) | 2012-07-19 | 2015-12-08 | Ariosa Diagnostics, Inc. | Multiplexed sequential ligation-based detection of genetic variants |
| US9624490B2 (en) | 2012-07-19 | 2017-04-18 | Ariosa Diagnostics, Inc. | Multiplexed sequential ligation-based detection of genetic variants |
| CN104583421A (zh) * | 2012-07-19 | 2015-04-29 | 阿瑞奥萨诊断公司 | 遗传变体的基于多重的顺序连接的检测 |
| EP2875156A4 (en) * | 2012-07-19 | 2016-02-24 | Ariosa Diagnostics Inc | SEQUENTIAL LIGATION-BASED MULTIPLEX DETECTION OF GENETIC VARIANTS |
| US12037634B2 (en) | 2012-08-14 | 2024-07-16 | 10X Genomics, Inc. | Capsule array devices and methods of use |
| US11035002B2 (en) | 2012-08-14 | 2021-06-15 | 10X Genomics, Inc. | Methods and systems for processing polynucleotides |
| US11591637B2 (en) | 2012-08-14 | 2023-02-28 | 10X Genomics, Inc. | Compositions and methods for sample processing |
| US10752950B2 (en) | 2012-08-14 | 2020-08-25 | 10X Genomics, Inc. | Methods and systems for processing polynucleotides |
| US11078522B2 (en) | 2012-08-14 | 2021-08-03 | 10X Genomics, Inc. | Capsule array devices and methods of use |
| US12098423B2 (en) | 2012-08-14 | 2024-09-24 | 10X Genomics, Inc. | Methods and systems for processing polynucleotides |
| US10752949B2 (en) | 2012-08-14 | 2020-08-25 | 10X Genomics, Inc. | Methods and systems for processing polynucleotides |
| US11021749B2 (en) | 2012-08-14 | 2021-06-01 | 10X Genomics, Inc. | Methods and systems for processing polynucleotides |
| US11359239B2 (en) | 2012-08-14 | 2022-06-14 | 10X Genomics, Inc. | Methods and systems for processing polynucleotides |
| US11441179B2 (en) | 2012-08-14 | 2022-09-13 | 10X Genomics, Inc. | Methods and systems for processing polynucleotides |
| US12100478B2 (en) | 2012-08-17 | 2024-09-24 | Natera, Inc. | Method for non-invasive prenatal testing using parental mosaicism data |
| US11473138B2 (en) | 2012-12-14 | 2022-10-18 | 10X Genomics, Inc. | Methods and systems for processing polynucleotides |
| US11421274B2 (en) | 2012-12-14 | 2022-08-23 | 10X Genomics, Inc. | Methods and systems for processing polynucleotides |
| WO2014099919A3 (en) * | 2012-12-19 | 2014-10-09 | Ariosa Diagnostics, Inc. | Noninvasive detection of fetal aneuploidy in egg donor pregnancies |
| US11193121B2 (en) | 2013-02-08 | 2021-12-07 | 10X Genomics, Inc. | Partitioning and processing of analytes and other species |
| US20140242582A1 (en) * | 2013-02-28 | 2014-08-28 | Ariosa Diagnostics, Inc. | Detection of genetic abnormalities using ligation-based detection and digital pcr |
| US9994897B2 (en) | 2013-03-08 | 2018-06-12 | Ariosa Diagnostics, Inc. | Non-invasive fetal sex determination |
| US10941436B2 (en) | 2013-04-17 | 2021-03-09 | Pioneer Hi-Bred International, Inc. | Methods for characterizing DNA sequence composition in a genome |
| US10487352B2 (en) | 2013-04-17 | 2019-11-26 | Pioneer Hi-Bred International, Inc. | Methods for characterizing DNA sequence composition in a genome |
| US9797001B2 (en) | 2013-04-17 | 2017-10-24 | Pioneer Hi-Bred International, Inc. | Methods for characterizing a target DNA sequence composition in a plant genome |
| US11702685B2 (en) | 2013-04-17 | 2023-07-18 | Pioneer Hi-Bred International, Inc. | Methods for characterizing DNA sequence composition in a genome |
| US11326204B2 (en) | 2013-08-19 | 2022-05-10 | Invitae Corporation | Assays for single molecule detection and use thereof |
| US10626450B2 (en) | 2013-08-19 | 2020-04-21 | Singular Bio, Inc. | Assays for single molecule detection and use thereof |
| US9212394B2 (en) | 2013-08-19 | 2015-12-15 | Singular Bio, Inc. | Assays for single molecule detection and use thereof |
| US9758814B2 (en) | 2013-08-19 | 2017-09-12 | Singular Bio, Inc. | Assays for single molecule detection and use thereof |
| US10577655B2 (en) | 2013-09-27 | 2020-03-03 | Natera, Inc. | Cell free DNA diagnostic testing standards |
| US9499870B2 (en) | 2013-09-27 | 2016-11-22 | Natera, Inc. | Cell free DNA diagnostic testing standards |
| US11530454B2 (en) | 2014-04-21 | 2022-12-20 | Natera, Inc. | Detecting mutations and ploidy in chromosomal segments |
| US12486542B2 (en) | 2014-04-21 | 2025-12-02 | Natera, Inc. | Detecting mutations and ploidy in chromosomal segments |
| US11408037B2 (en) | 2014-04-21 | 2022-08-09 | Natera, Inc. | Detecting mutations and ploidy in chromosomal segments |
| US12305229B2 (en) | 2014-04-21 | 2025-05-20 | Natera, Inc. | Methods for simultaneous amplification of target loci |
| US11319596B2 (en) | 2014-04-21 | 2022-05-03 | Natera, Inc. | Detecting mutations and ploidy in chromosomal segments |
| US11371100B2 (en) | 2014-04-21 | 2022-06-28 | Natera, Inc. | Detecting mutations and ploidy in chromosomal segments |
| US10597709B2 (en) | 2014-04-21 | 2020-03-24 | Natera, Inc. | Methods for simultaneous amplification of target loci |
| US10597708B2 (en) | 2014-04-21 | 2020-03-24 | Natera, Inc. | Methods for simultaneous amplifications of target loci |
| US11319595B2 (en) | 2014-04-21 | 2022-05-03 | Natera, Inc. | Detecting mutations and ploidy in chromosomal segments |
| US9677118B2 (en) | 2014-04-21 | 2017-06-13 | Natera, Inc. | Methods for simultaneous amplification of target loci |
| US10351906B2 (en) | 2014-04-21 | 2019-07-16 | Natera, Inc. | Methods for simultaneous amplification of target loci |
| US10262755B2 (en) | 2014-04-21 | 2019-04-16 | Natera, Inc. | Detecting cancer mutations and aneuploidy in chromosomal segments |
| US11390916B2 (en) | 2014-04-21 | 2022-07-19 | Natera, Inc. | Methods for simultaneous amplification of target loci |
| US11486008B2 (en) | 2014-04-21 | 2022-11-01 | Natera, Inc. | Detecting mutations and ploidy in chromosomal segments |
| US12492429B2 (en) | 2014-04-21 | 2025-12-09 | Natera, Inc. | Detecting mutations and ploidy in chromosomal segments |
| US12203142B2 (en) | 2014-04-21 | 2025-01-21 | Natera, Inc. | Detecting mutations and ploidy in chromosomal segments |
| US10179937B2 (en) | 2014-04-21 | 2019-01-15 | Natera, Inc. | Detecting mutations and ploidy in chromosomal segments |
| US11414709B2 (en) | 2014-04-21 | 2022-08-16 | Natera, Inc. | Detecting mutations and ploidy in chromosomal segments |
| US12260934B2 (en) | 2014-06-05 | 2025-03-25 | Natera, Inc. | Systems and methods for detection of aneuploidy |
| US12312640B2 (en) | 2014-06-26 | 2025-05-27 | 10X Genomics, Inc. | Analysis of nucleic acid sequences |
| US11713457B2 (en) | 2014-06-26 | 2023-08-01 | 10X Genomics, Inc. | Methods and systems for processing polynucleotides |
| US11629344B2 (en) | 2014-06-26 | 2023-04-18 | 10X Genomics, Inc. | Methods and systems for processing polynucleotides |
| US20170275684A1 (en) * | 2014-09-05 | 2017-09-28 | Zhi Zheng | Methods of detecting nucleic acids and applications thereof |
| WO2016037142A1 (en) * | 2014-09-05 | 2016-03-10 | Zhi Zheng | Methods of detecting nucleic acids and applications thereof |
| US10590472B2 (en) * | 2014-09-05 | 2020-03-17 | Zhi Zheng | Methods of detecting nucleic acids and applications thereof |
| CN106661637A (zh) * | 2014-09-05 | 2017-05-10 | 郑直 | 检测核酸的方法和其应用 |
| US11739371B2 (en) | 2015-02-18 | 2023-08-29 | Invitae Corporation | Arrays for single molecule detection and use thereof |
| US11946101B2 (en) | 2015-05-11 | 2024-04-02 | Natera, Inc. | Methods and compositions for determining ploidy |
| US11479812B2 (en) | 2015-05-11 | 2022-10-25 | Natera, Inc. | Methods and compositions for determining ploidy |
| US12421551B2 (en) | 2015-05-22 | 2025-09-23 | Medicover Public Co Ltd | Multiplexed parallel analysis of targeted genomic regions for non-invasive prenatal testing |
| EP4428249A2 (en) | 2015-05-22 | 2024-09-11 | Medicover Public Co Ltd | Multiplexed parallel analysis of targeted genomic regions for non-invasive prenatal testing |
| US12480160B2 (en) | 2015-05-22 | 2025-11-25 | Medicover Public Co Ltd | Multiplexed parallel analysis of targeted genomic regions for non-invasive prenatal testing |
| US11111538B2 (en) | 2015-05-22 | 2021-09-07 | Nipd Genetics Public Company Ltd | Multiplexed parallel analysis of targeted genomic regions for non-invasive prenatal testing |
| EP3666902A1 (en) | 2015-05-22 | 2020-06-17 | Nipd Genetics Public Company Limited | Multiplexed parallel analysis of targeted genomic regions for non-invasive prenatal testing |
| WO2016189388A1 (en) | 2015-05-22 | 2016-12-01 | Nipd Genetics Ltd | Multiplexed parallel analysis of targeted genomic regions for non-invasive prenatal testing |
| US12146195B2 (en) | 2016-04-15 | 2024-11-19 | Natera, Inc. | Methods for lung cancer detection |
| US11485996B2 (en) | 2016-10-04 | 2022-11-01 | Natera, Inc. | Methods for characterizing copy number variation using proximity-litigation sequencing |
| US12460264B2 (en) | 2016-11-02 | 2025-11-04 | Natera, Inc. | Method of detecting tumour recurrence |
| US11530442B2 (en) | 2016-12-07 | 2022-12-20 | Natera, Inc. | Compositions and methods for identifying nucleic acid molecules |
| US11519028B2 (en) | 2016-12-07 | 2022-12-06 | Natera, Inc. | Compositions and methods for identifying nucleic acid molecules |
| US10577650B2 (en) | 2016-12-07 | 2020-03-03 | Natera, Inc. | Compositions and methods for identifying nucleic acid molecules |
| US12571034B2 (en) | 2016-12-07 | 2026-03-10 | Natera, Inc. | Compositions and methods for identifying nucleic acid molecules |
| US10533219B2 (en) | 2016-12-07 | 2020-01-14 | Natera, Inc. | Compositions and methods for identifying nucleic acid molecules |
| US10011870B2 (en) | 2016-12-07 | 2018-07-03 | Natera, Inc. | Compositions and methods for identifying nucleic acid molecules |
| US10894976B2 (en) | 2017-02-21 | 2021-01-19 | Natera, Inc. | Compositions, methods, and kits for isolating nucleic acids |
| US12084720B2 (en) | 2017-12-14 | 2024-09-10 | Natera, Inc. | Assessing graft suitability for transplantation |
| WO2019152395A1 (en) * | 2018-01-31 | 2019-08-08 | Bio-Rad Laboratories, Inc. | Methods and compositions for deconvoluting partition barcodes |
| US12209277B2 (en) | 2018-01-31 | 2025-01-28 | Bio-Rad Laboratories, Inc. | Methods and compositions for deconvoluting partition barcodes |
| CN111699253A (zh) * | 2018-01-31 | 2020-09-22 | 生物辐射实验室股份有限公司 | 用于解卷积分区条码的方法和组合物 |
| US12398389B2 (en) | 2018-02-15 | 2025-08-26 | Natera, Inc. | Methods for isolating nucleic acids with size selection |
| US11852628B2 (en) | 2018-02-22 | 2023-12-26 | 10X Genomics, Inc. | Methods and systems for characterizing analytes from individual cells or cell populations |
| US11639928B2 (en) | 2018-02-22 | 2023-05-02 | 10X Genomics, Inc. | Methods and systems for characterizing analytes from individual cells or cell populations |
| US12092635B2 (en) | 2018-02-22 | 2024-09-17 | 10X Genomics, Inc. | Methods and systems for characterizing analytes from individual cells or cell populations |
| WO2019165318A1 (en) * | 2018-02-22 | 2019-08-29 | 10X Genomics, Inc. | Ligation mediated analysis of nucleic acids |
| US12024738B2 (en) | 2018-04-14 | 2024-07-02 | Natera, Inc. | Methods for cancer detection and monitoring |
| US12385096B2 (en) | 2018-04-14 | 2025-08-12 | Natera, Inc. | Methods for cancer detection and monitoring |
| US20210198733A1 (en) | 2018-07-03 | 2021-07-01 | Natera, Inc. | Methods for detection of donor-derived cell-free dna |
| US12234509B2 (en) | 2018-07-03 | 2025-02-25 | Natera, Inc. | Methods for detection of donor-derived cell-free DNA |
| US12305235B2 (en) | 2019-06-06 | 2025-05-20 | Natera, Inc. | Methods for detecting immune cell DNA and monitoring immune system |
| US12559788B2 (en) | 2019-06-07 | 2026-02-24 | Bio-Rad Laboratories, Inc. | Multiple beads per droplet resolution |
| US11952626B2 (en) | 2021-02-23 | 2024-04-09 | 10X Genomics, Inc. | Probe-based analysis of nucleic acids and proteins |
| US12467088B2 (en) | 2021-02-23 | 2025-11-11 | 10X Genomics, Inc. | Probe-based analysis of nucleic acids and proteins |
Also Published As
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| AU2011285512B2 (en) | Ligation-based detection of genetic variants | |
| US10954566B2 (en) | Ligation-based detection of genetic variants | |
| US10131951B2 (en) | Assay systems for genetic analysis | |
| CN109243536B (zh) | 卵子供体妊娠中胎儿非整倍性的无创检测 | |
| US20120190020A1 (en) | Detection of genetic abnormalities | |
| AU2015202048B2 (en) | Ligation-based detection of genetic variants |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| AS | Assignment |
Owner name: TANDEM DIAGNOSTICS, INC., CALIFORNIA Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNORS:OLIPHANT, ARNOLD;SPARKS, ANDREW;SONG, KEN;AND OTHERS;REEL/FRAME:026059/0926 Effective date: 20110126 |
|
| AS | Assignment |
Owner name: ARIA DIAGNOSTICS, INC., CALIFORNIA Free format text: CHANGE OF NAME;ASSIGNOR:TANDEM TECHNOLOGIES INC.;REEL/FRAME:027493/0542 Effective date: 20111114 |
|
| AS | Assignment |
Owner name: ARIOSA DIAGNOSTICS, INC., CALIFORNIA Free format text: CHANGE OF NAME;ASSIGNOR:ARIA DIAGNOSTICS, INC.;REEL/FRAME:027987/0568 Effective date: 20120321 |
|
| STCB | Information on status: application discontinuation |
Free format text: ABANDONED -- FAILURE TO RESPOND TO AN OFFICE ACTION |
|
| AS | Assignment |
Owner name: ROCHE MOLECULAR SYSTEMS, INC., CALIFORNIA Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNOR:ARIOSA DIAGNOSTICS, INC.;REEL/FRAME:056969/0905 Effective date: 20210721 |
|
| AS | Assignment |
Owner name: ROCHE MOLECULAR SYSTEMS, INC., CALIFORNIA Free format text: CORRECTIVE ASSIGNMENT TO CORRECT THE CORRECT ASSIGNMENT RECORDAL BY REMOVING PATENT NUMBER 8399195 PREVIOUSLY RECORDED ON REEL 056969 FRAME 0905. ASSIGNOR(S) HEREBY CONFIRMS THE ASSIGNMENT;ASSIGNOR:ARIOSA DIAGNOSTICS, INC.;REEL/FRAME:059847/0803 Effective date: 20210721 |