US20080050739A1 - Diagnosis of fetal abnormalities using polymorphisms including short tandem repeats - Google Patents

Diagnosis of fetal abnormalities using polymorphisms including short tandem repeats Download PDF

Info

Publication number
US20080050739A1
US20080050739A1 US11/763,426 US76342607A US2008050739A1 US 20080050739 A1 US20080050739 A1 US 20080050739A1 US 76342607 A US76342607 A US 76342607A US 2008050739 A1 US2008050739 A1 US 2008050739A1
Authority
US
United States
Prior art keywords
fetal
cells
sample
maternal
pcr
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Abandoned
Application number
US11/763,426
Inventor
Roland Stoughton
Ravi Kapur
Barb Cohen
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
LIVING MICROSYSTEMS Inc
Verinata Health Inc
Original Assignee
LIVING MICROSYSTEMS Inc
Artemis Health Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority to US11/763,426 priority Critical patent/US20080050739A1/en
Application filed by LIVING MICROSYSTEMS Inc, Artemis Health Inc filed Critical LIVING MICROSYSTEMS Inc
Assigned to LIVING MICROSYSTEMS INC. reassignment LIVING MICROSYSTEMS INC. ASSIGNMENT OF ASSIGNORS INTEREST (SEE DOCUMENT FOR DETAILS). Assignors: STOUGHTON, ROLAND, KAPUR, RAVI, COHEN, BARB ARIEL
Assigned to ARTEMIS HEALTH, INC. reassignment ARTEMIS HEALTH, INC. CHANGE OF NAME (SEE DOCUMENT FOR DETAILS). Assignors: LIVING MICROSYSTEMS, INC.
Publication of US20080050739A1 publication Critical patent/US20080050739A1/en
Priority to US12/413,485 priority patent/US20090280492A1/en
Priority to US12/725,240 priority patent/US20110171638A1/en
Priority to US12/751,908 priority patent/US20100291571A1/en
Assigned to VERINATA HEALTH, INC. reassignment VERINATA HEALTH, INC. CHANGE OF NAME (SEE DOCUMENT FOR DETAILS). Assignors: ARTEMIS HEALTH, INC.
Priority to US13/433,232 priority patent/US20120183963A1/en
Priority to US13/738,268 priority patent/US20130288242A1/en
Priority to US13/830,871 priority patent/US10591391B2/en
Priority to US16/819,992 priority patent/US11378498B2/en
Priority to US17/850,599 priority patent/US20230168160A1/en
Abandoned legal-status Critical Current

Links

Images

Classifications

    • GPHYSICS
    • G16INFORMATION AND COMMUNICATION TECHNOLOGY [ICT] SPECIALLY ADAPTED FOR SPECIFIC APPLICATION FIELDS
    • G16BBIOINFORMATICS, i.e. INFORMATION AND COMMUNICATION TECHNOLOGY [ICT] SPECIALLY ADAPTED FOR GENETIC OR PROTEIN-RELATED DATA PROCESSING IN COMPUTATIONAL MOLECULAR BIOLOGY
    • G16B20/00ICT specially adapted for functional genomics or proteomics, e.g. genotype-phenotype associations
    • G16B20/20Allele or variant detection, e.g. single nucleotide polymorphism [SNP] detection
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N1/00Sampling; Preparing specimens for investigation
    • G01N1/28Preparing specimens for investigation including physical details of (bio-)chemical methods covered elsewhere, e.g. G01N33/50, C12Q
    • G01N1/30Staining; Impregnating ; Fixation; Dehydration; Multistep processes for preparing samples of tissue, cell or nucleic acid material and the like for analysis
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • GPHYSICS
    • G16INFORMATION AND COMMUNICATION TECHNOLOGY [ICT] SPECIALLY ADAPTED FOR SPECIFIC APPLICATION FIELDS
    • G16BBIOINFORMATICS, i.e. INFORMATION AND COMMUNICATION TECHNOLOGY [ICT] SPECIALLY ADAPTED FOR GENETIC OR PROTEIN-RELATED DATA PROCESSING IN COMPUTATIONAL MOLECULAR BIOLOGY
    • G16B20/00ICT specially adapted for functional genomics or proteomics, e.g. genotype-phenotype associations
    • G16B20/10Ploidy or copy number detection
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/156Polymorphic or mutational markers
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/158Expression markers
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/16Primer sets for multiplex assays
    • GPHYSICS
    • G16INFORMATION AND COMMUNICATION TECHNOLOGY [ICT] SPECIALLY ADAPTED FOR SPECIFIC APPLICATION FIELDS
    • G16BBIOINFORMATICS, i.e. INFORMATION AND COMMUNICATION TECHNOLOGY [ICT] SPECIALLY ADAPTED FOR GENETIC OR PROTEIN-RELATED DATA PROCESSING IN COMPUTATIONAL MOLECULAR BIOLOGY
    • G16B20/00ICT specially adapted for functional genomics or proteomics, e.g. genotype-phenotype associations

Definitions

  • Analysis of specific cells can give insight into a variety of diseases. These analyses can provide non-invasive tests for detection, diagnosis and prognosis of diseases, thereby eliminating the risk of invasive diagnosis. For instance, social developments have resulted in an increased number of prenatal tests. However, the available methods today, amniocentesis and chorionic villus sampling (CVS) are potentially harmful to the mother and to the fetus. The rate of miscarriage for pregnant women undergoing amniocentesis is increased by 0.5-1%, and that figure is slightly higher for CVS.
  • non-invasive tests for detection, diagnosis and prognosis of diseases.
  • maternal serum alpha-fetoprotein, and levels of unconjugated estriol and human chorionic gonadotropin are used to identify a proportion of fetuses with Down's syndrome, however, these tests are not one hundred percent accurate.
  • ultrasonography is used to determine congenital defects involving neural tube defects and limb abnormalities, but is useful only after fifteen weeks' gestation.
  • the methods of the present invention allow for the detection of fetal cells and fetal abnormalities when fetal cells are present in a mixed population of cells, even when maternal cells dominate the mixture.
  • fetal cells are rare as compared to the presence of maternal cells in the blood. Therefore, any proposed analysis of fetal cells to diagnose fetal abnormalities requires enrichment of fetal cells. Enriching fetal cells from maternal peripheral blood is challenging, time intensive and any analysis derived therefrom is prone to error. The present invention addresses these challenges.
  • the present invention relates to methods for determining the presence of fetal cells and fetal abnormalities when fetal cells are present in a mixed sample (e.g. maternal blood sample).
  • determining the presence of fetal cells or of a fetal abnormality includes comparing the level of genomic DNA from a mixed sample to the level of genomic DNA in a control sample.
  • the control or reference sample can be a mixed sample that has been sufficiently diluted to be free of fetal cells.
  • the mixed sample can contain at least one fetal cell and one non-fetal cell. In other embodiments, the sample comprises up to 50% fetal cells.
  • determining the presence of fetal cells and/or abnormalities involves quantifying one or more regions of genomic DNA regions from the mixed sample and determining from the quantification the presence of a fetal abnormality.
  • regions are polymorphic e.g. short tandem repeat (STR) regions.
  • fetal abnormalities that can be determined by quantifying regions on one or more chromosomes include trisomy 13, trisomy 18, trisomy 21 (Dow-Syndrome), Klinefelter Syndrome (XXY) and other irregular number of sex or autosomal chromosomes.
  • abnormal fetal genotypes that can be determined by quantifying regions on one or more chromosomes include, but are not limited to, aneuploidy such as, monosomy of one or more chromosomes (X chromosome monosomy, also known as Turner's syndrome), trisomy of one or more chromosomes (such as 13, 18, 21, and X), tetrasomy and pentasomy of one or more chromosomes (which in humans is most commonly observed in the sex chromosomes, e.g.
  • aneuploidy such as, monosomy of one or more chromosomes (X chromosome monosomy, also known as Turner's syndrome), trisomy of one or more chromosomes (such as 13, 18, 21, and X), tetrasomy and pentasomy of one or more chromosomes (which in humans is most commonly observed in the sex chromosomes, e.g.
  • an abnormal fetal genotype is a segmental aneuploidy.
  • segmental aneuploidy examples include, but are not Limited to, 1p36 duplication, dup(17)(p11.2p11.2) syndrome, Down syndrome, Pelizaeus-Merzbacher disease, dup(22)(q11.2q11.2) syndrome, and cat-eye syndrome.
  • an abnormal fetal genotype is due to one or more deletions of sex or autosomal chromosomes, which may result in a condition such as Cri-du-chat syndrome, Wolf-Hirschorn, Williams-Beuren syndrome, Charcot-Marie-Tooth disease, Hereditary neuropathy with liability to pressure palsies, Smith-Magenis syndrome, Neurofibromatosis, Alagille syndrome, Velocardiofacial syndrome, DiGeorge syndrome, Steroid sulfatase deficiency, Kallmann syndrome, Microphthalmia with linear skin defects, Adrenal hypoplasia, Glycerol kinase deficiency, Pelizaeus-Merzbacher disease, Testis-determining factor on Y, Azospermia (factor a), Azospermia (factor b), Azospermia (factor c), or 1p36 deletion.
  • a decrease in chromosomal number results in an XO syndrome.
  • the methods herein can distinguish maternal trisomy from paternal trisomy, and total aneuploidy from segmental aneuploidy. Segmental aneuploidies can be caused by an intra-chromosomal event such as a deletion, duplication or translocation event. Additionally, the methods herein can be used to identify monoploidy, triploidy, tetraploidy, pentaploidy and other higher multiples of the normal haploid state. In some embodiments, the maternal or paternal origin of the fetal abnormality can be determined.
  • the genomic DNA region(s) can be quantified by amplifying the regions using, for example, PCR, or preferably quantitative PCR. Alternatively, quantification of the regions can be achieved using capillary gel electrophoresis (CGE). In some embodiments, total genomic DNA is pre-amplified prior to the quantitative amplification step to increase the overall abundance of DNA. Such pre-amplification step can involve the use of multiple displacement amplification.
  • the genomic DNA regions quantified can be in one chromosome or in 2 or more chromosomes.
  • the polymorphic regions can be quantified on either or both sex chromosomes X and Y, and on autosomal chromosomes including chromosomes 13, 18 and 21.
  • a mixed sample suspected of having fetal cells can be enriched for fetal cells.
  • Fetal cell enrichment can be accomplished using any method known in the art including size-based separation, affinity (e.g. magnetic) separation, FACS, laser microdisection, and magnetic bead separation.
  • a mixed sample containing as few as 10 fetal cells can be enriched.
  • the fetal cells in the enriched sample constitute less than 50% of the total number of cells.
  • the size-based separation method includes applying a mixed sample into a system that separates a first component of the mixed sample (e.g. fetal cells), which comprises cells that are larger than a critical size, in a first direction, and a second component of the mixed sample (e.g. enucleated maternal red blood cells), which comprises cells that are smaller than a critical size, towards a second exit port.
  • a first component of the mixed sample e.g. fetal cells
  • a second component of the mixed sample e.g. enucleated maternal red blood cells
  • the separation system can be a device that includes one or more arrays of obstacles that form a network of gaps.
  • enrichment that is achieved by size-based separation is followed by one or more additional enrichment procedures including magnetic separation, fluorescence activated cell sorting (FACS), laser microdisection, and magnetic bead separation.
  • FACS fluorescence activated cell sorting
  • a sample enriched by size-based separation is subjected to affinity/magnetic separation and is further enriched for rare cells using fluorescence activated cell sorting (FACS) or selective lysis of a subset of the cells (e.g. fetal cells).
  • kits for detecting the fetal abnormalities wherein the kits include separation devices and the reagents needed to perform the genetic analysis.
  • the kit may include arrays for size based enrichment, a device for magnetic enrichment and reagents for performing PCR.
  • the methods can further comprise inputting the data from the quantification step into data model(s) for the association of DNA quantity with maternal and non-maternal alleles.
  • the invention provides for a computer program product, which includes a computer executable logic recorded on a computer readable medium that can be used for diagnosing a fetal abnormality.
  • the computer program is designed to receive data from one of more quantified DNA genomic regions from a mixed sample containing at least one fetal cell, determine the presence or absence of a fetal abnormality from the data, and generate an output that comprises the evaluation of the fetal abnormality. Methods for using the computer program product are also disclosed.
  • FIG. 1 illustrates a flow chart of one embodiment of the present invention.
  • FIGS. 2A-2D illustrate one embodiment of a size-based separation module.
  • FIGS. 3A-3C illustrate one embodiment of an affinity separation module.
  • FIG. 4 illustrates one embodiment of a magnetic separation module.
  • FIG. 5 illustrates typical locus patterns arising from a normal (diploid) fetus and mother.
  • FIG. 6 illustrates typical locus patterns arising from trisomic fetal cells.
  • FIGS. 7A-7D illustrate various embodiments of a size-based separation module
  • FIGS. 8A-8B illustrate cell smears of the product and waste fractions.
  • FIGS. 9A-9F illustrate isolated fetal cells confirmed by the reliable presence of male Y chromosome.
  • FIG. 10 illustrates trisomy 21 pathology in an isolated fetal nucleated red blood cell.
  • FIG. 11 depicts a flow chart depicting the major steps involved in detecting paternal alleles in a fetal enriched sample using fluorescently labeled primers.
  • FIG. 12 illustrates a table with STR loci that can be used for fetal detection.
  • FIG. 13 illustrates a table with exemplary external primers for STR loci.
  • FIG. 14 illustrates a table with exemplary internal primers for STR loci.
  • FIG. 15 illustrates the resolution for the ABI 310 bioanalyzer.
  • FIG. 16 illustrates the detection limit on fixed cord blood.
  • FIG. 17 illustrates the detection of 10 fetal cells at 10% purity without nested PCR.
  • FIG. 18 illustrates the generation of STR markers on fixed cells recovered from a slide.
  • FIG. 19 illustrates detection of fetal alleles at less than 10% purity after nested PCR amplification of STRs.
  • FIG. 20 illustrates the detection of single copies of a fetal cell genome by qPCR.
  • FIG. 21 illustrates detection of single fetal cells in binned samples by SNP analysis.
  • FIG. 22 illustrates a method of trisomy testing.
  • the trisomy 21 screen is based on scoring of target cells obtained from maternal blood. Blood is processed using a cell separation module for hemoglobin enrichment (CSM-HE). Enriched cells are transferred to slides that are first stained and subsequently probed by FISH. Images are acquired, such as from bright field or fluorescent microscopy, and scored. The proportion of trisomic cells of certain classes serves as a classifier for risk of fetal trisomy 21.
  • CSM-HE hemoglobin enrichment
  • Fetal genome identification can performed using assays such as: (1) STR markers; (2) qPCR using primers and probes directed to loci, such as the multi-repeat DYZ locus on the Y-chromosome; (3) SNP detection; and (4) CGH (comparative genome hybridization) array detection.
  • assays such as: (1) STR markers; (2) qPCR using primers and probes directed to loci, such as the multi-repeat DYZ locus on the Y-chromosome; (3) SNP detection; and (4) CGH (comparative genome hybridization) array detection.
  • FIG. 23 illustrates assays that can produce information on the presence of aneuploidy and other genetic disorders in target cells
  • Information on anueploidy and other genetic disorders in target cells may be acquired using technologies such as: (1) a CGH array established for chromosome counting, which can be used for aneuploidy determination and/or detection of intra-chromosomal deletions; (2) SNP/taqman assays, which can be used for detection of single nucleotide polymorphisms; and (3) ultra-deep sequencing, which can be used to produce partial or complete genome sequences for analysis.
  • FIG. 24 illustrates methods of fetal diagnostic assays.
  • Fetal cells are isolated by CSM-HE enrichment of target cells from blood.
  • the designation of the fetal cells may be confirmed using techniques comprising FISH staining (using slides or membranes and optionally an automated detector), FACS, and/or binning.
  • Binning may comprise distribution of enriched cells across wells in a plate (such as a 96 or 384 well plate), microencapsulation of cells in droplets that are separated in an emulsion, or by introduction of cells into microarrays of nanofluidic bins.
  • Fetal cells are then identified using methods that may comprise the use of biomarkers (such as fetal (gamma) hemoglobin), allele-specific SNP panels that could detect fetal genome DNA, detection of differentially expressed maternal and fetal transcripts (such as Affymetrix chips), or primers and probes directed to fetal specific loci (such as the multi-repeat DYZ locus on the Y-chromosome).
  • biomarkers such as fetal (gamma) hemoglobin
  • allele-specific SNP panels that could detect fetal genome DNA, detection of differentially expressed maternal and fetal transcripts (such as Affymetrix chips), or primers and probes directed to fetal specific loci (such as the multi-repeat DYZ locus on the Y-chromosome).
  • Binning sites that contain fetal cells are then be analyzed for aneuploidy and/or other genetic defects using a technique such as CGH array detection, ultra deep sequencing (such as Solexa, 454 or mass
  • FIG. 25 illustrates methods of fetal diagnostic assays, further comprising the step of whole genome amplification prior to analysis of aneuploidy and/or other genetic defects.
  • the present invention provides systems, apparatuses, and methods to detect the presence and condition (e.g. aneuploidy) of fetal cells in a mixed cell population, e.g. a sample wherein fetal cells consist of ⁇ 50%, 45%, 40%, 35%, 30%, 25%, 20%, 15%, 10%, 5%, 1%, or 0.5% of all cells in a mixed sample.
  • a mixed cell population e.g. a sample wherein fetal cells consist of ⁇ 50%, 45%, 40%, 35%, 30%, 25%, 20%, 15%, 10%, 5%, 1%, or 0.5% of all cells in a mixed sample.
  • FIG. 1 illustrates an overview of one embodiment of the present invention.
  • a sample containing (or suspected of containing) 1 or more fetal cells is obtained.
  • Samples can be obtained from an animal suspected of being pregnant, pregnant, or that has been pregnant to detect the presence of a fetus or fetal abnormality.
  • Such animal can be a human or a domesticated animal such as a cow, chicken, pig, horse, rabbit, dog, cat, or goat.
  • Samples derived from an animal or human can include, e.g., whole blood, sweat, tears, ear flow, sputum, lymph, bone marrow suspension, lymph, urine, saliva, semen, vaginal flow, cerebrospinal fluid, brain fluid, ascites, milk, secretions of the respiratory, intestinal or genitourinary tracts fluid.
  • a blood sample can be optionally pre-treated or processed prior to enrichment.
  • pre-treatment steps include the addition of a reagent such as a stabilizer, a preservative, a fixant, a lysing reagent, a diluent, an anti-apoptotic reagent, an anti-coagulation reagent, an anti-thrombotic reagent, magnetic property regulating reagent, a buffering reagent, an osmolality regulating reagent, a pH regulating reagent, and/or a cross-linking reagent.
  • a reagent such as a stabilizer, a preservative, a fixant, a lysing reagent, a diluent, an anti-apoptotic reagent, an anti-coagulation reagent, an anti-thrombotic reagent, magnetic property regulating reagent, a buffering reagent, an osmolality regulating reagent, a pH regulating
  • a preservative such an anti-coagulation agent and/or a stabilizer can be added to the sample prior to enrichment. This allows for extended time for analysis/detection.
  • a sample such as a blood sample, can be enriched and/or analyzed under any of the methods and systems herein within 1 week, 6 days, 5 days, 4 days, 3 days, 2 days, 1 day, 12 hrs, 6 hrs, 3 hrs, 2 hrs, or 1 hr from the time the sample is obtained.
  • a blood sample can be combined with an agent that selectively lysed one or more cells or components in a blood sample.
  • fetal cells can be selectively lysed releasing their nuclei when a blood sample including fetal cells is combined with deionized water.
  • Such selective lysis allows for the subsequent enrichment of fetal nuclei using, e.g., size or affinity based separation.
  • platelets and/or enucleated red blood cells are selectively lysed to generate a sample enriched in nucleated cells, such as fetal nucleated red blood cells (fnRBC) and maternal nucleated blood cells (mnBC).
  • fnRBC fetal nucleated red blood cells
  • mnBC maternal nucleated blood cells
  • the amount can vary depending upon animal size, its gestation period, and or the condition being screened. In some embodiments, up to 50, 40, 30, 20, 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 mL of a sample is obtained. In some embodiments, 1-50, 2-40, 3-30, or 4-20 mL of sample is obtained. In some embodiments, more than 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95 or 100 mL of a sample is obtained.
  • a blood sample can be obtained from a pregnant animal or human within 36, 24, 22, 20, 18, 16, 14, 12, 10, 8, 6 or 4 weeks of gestation.
  • a reference sample is obtained.
  • the reference sample consists of substantially all or all maternal cells.
  • a reference sample is a maternal blood sample enriched for white blood cells (WBC's) such that it consists of substantially all or all maternal WBC's.
  • WBC's white blood cells
  • a reference sample is a diluted mixed sample wherein the dilution results in a sample free of fetal cells.
  • a maternal blood sample of 10-50 ML can be diluted by at least 2, 5, 10, 20, 50, or 100 fold to reduce the likelihood that it will include fetal cells.
  • step 102 when the sample to be tested or analyzed is a mixed sample (e.g. maternal blood sample), it is enriched for rare cells or rare DNA (e.g. fetal cells, fetal DNA or fetal nuclei) using one or more methods known in the art or disclosed herein. Such enrichment increases the ratio of fetal cells to non-fetal cells; the concentration of fetal DNA to non-fetal DNA; or the concentration of fetal cells in volume per total volume of the mixed sample.
  • rare cells or rare DNA e.g. fetal cells, fetal DNA or fetal nuclei
  • enrichment occurs by selective lysis as described above.
  • enucleated cells may be selectively lysed prior to subsequent enrichment steps or fetal nucleated cells may be selectively lysed prior to separation of the fetal nuclei from other cells and components in the sample.
  • size-based separation modules include filtration modules, sieves, matrixes, etc., including those disclosed in International Publication Nos, WO 2004/113877, WO 2004/0144651, and US Application Publication No. 2004/011956.
  • a size-based separation module includes one or more arrays of obstacles that form a network of gaps.
  • the obstacles are configured to direct particles (e.g. cells or nuclei) as they flow through the array/network of gaps into different directions or outlets based on the particle's hydrodynamic size.
  • nucleated cells or cells having a hydrodynamic size larger than a critical size e.g., 8 microns
  • a critical size e.g. 8 microns
  • the enucleated cells or cells having a hydrodynamic size smaller than a critical size e.g., 8 microns
  • a second outlet also located on the opposite side of the array of obstacles from the fluid flow inlet.
  • An array can be configured to separate cells smaller than a critical size from those larger than the critical size by adjusting the size of the gaps, obstacles, and offset in the period between each successive row of obstacles.
  • obstacles and/or gaps between obstacles can be up to 10, 20, 50, 70, 100, 120, 150, 170, or 200 microns in length or about 2, 4, 6, 8 or 10 microns in length.
  • an array for size-based separation includes more than 100, 500, 1,000, 5,000, 10,000, 50,000 or 100,000 obstacles that are arranged into more than 10, 20, 50, 100, 200, 500, or 1000 rows.
  • obstacles in a first row of obstacles are offset from a previous (upstream) row of obstacles by up to 50% of the period of the previous row of obstacles.
  • obstacles in a first row of obstacles are offset from a previous row of obstacles by up to 45, 40, 35, 30, 25, 20, 15 or 10% the period of the previous row of obstacles.
  • the distance between a first row of obstacles and a second row of obstacles can be up to 10, 20, 50, 70, 100, 120, 150, 170 or 200 microns.
  • a particular offset can be continuous (repeating for multiple rows) or non-continuous.
  • a separation module includes multiple discrete arrays of obstacles fluidly coupled such that they are in series with one another. Each array of obstacles has a continuous offset. But each subsequent (downstream) array of obstacles has an offset that is different from the previous (upstream) offset.
  • each subsequent array of obstacles has a smaller offset that the previous array of obstacles.
  • a plurality of arrays can be fluidly coupled in series or in parallel, (e.g., more than 2, 4, 6, 8, 10, 20, 30, 40, 50). Fluidly coupling separation modules (e.g., arrays) in parallel allows for high-throughput analysis of the sample, such that at least 1, 2, 5, 10, 20, 50, 100, 200, or 500 mL per hour flows through the enrichment modules or at least 1, 5, 10, or 50 million cells per hour are sorted or flow through the device.
  • FIGS. 2A-2D illustrate one example of a size-based separation module.
  • Obstacles (which may be of any shape) are coupled to a flat substrate to form an array of gaps.
  • a transparent cover or lid may be used to cover the array.
  • the obstacles form a two-dimensional array with each successive row shifted horizontally with respect to the previous row of obstacles, where the array of obstacles directs components having a hydrodynamic size smaller than a critical size in a first direction and components having a hydrodynamic size larger that a critical size in a second direction. See FIGS. 2B-2D .
  • the flow of sample into the array of obstacles can be aligned at a small angle (flow angle) with respect to a line-of-sight of the array (lateral flow angle).
  • the array is coupled to an infusion pump to perfuse the sample through the obstacles.
  • the flow conditions of the size-based separation module described herein are such that cells are sorted by the array with minimal damage. This allows for downstream analysis of intact cells and intact nuclei to be more efficient and reliable.
  • a size-based separation module comprises an array of obstacles configured to direct rare cells larger than a critical size to migrate along a line-of-sight within the array towards a first outlet or bypass channel leading to a first outlet, while directing cells and analytes smaller than a critical size through the array of obstacles in a different direction towards a second outlet.
  • a variety of enrichment protocols may be utilized although gentle handling of the cells is preferred to reduce any mechanical damage to the cells or their DNA. This gentle handling also preserves the small number of fetal cells in the sample. Integrity of the nucleic acid being evaluated is an important feature in some embodiments to permit the distinction between the genomic material from the fetal cells and other cells in the sample.
  • the enrichment and separation of the fetal cells using the arrays of obstacles produces gentle treatment which minimizes cellular damage and maximizes nucleic acid integrity permitting exceptional levels of separation and the ability to subsequently utilize various formats to very accurately analyze the genome of the cells which are present in the sample in extremely low numbers.
  • enrichment of fetal cells occurs using one or more capture modules that selectively inhibit the mobility of one or more cells of interest.
  • a capture module is fluidly coupled downstream to a size-based separation module.
  • Capture modules can include a substrate having multiple obstacles that restrict the movement of cells or analytes greater than a critical size. Examples of capture modules that inhibit the migration of cells based on size are disclosed in U.S. Pat. Nos. 5,837,115 and 6,692,952.
  • a capture module includes a two dimensional array of obstacles that selectively filters or captures cells or analytes having a hydrodynamic size greater than a particular gap size, e.g., critical sized.
  • Arrays of obstacles adapted for separation by capture can include obstacles having one or more shapes and can be arranged in a uniform or non-uniform order.
  • a two-dimensional array of obstacles is staggered such that each subsequent row of obstacles is offset from the previous row of obstacles to increase the number of interactions between the analytes being sorted (separated) and the obstacles.
  • An affinity-based separation module capture analytes or cells of interest based on their affinity to a structure or particle as oppose to their size.
  • An affinity-based separation module is an array of obstacles that are adapted for complete sample flow through, but for the fact that the obstacles are covered with binding moieties that selectively bind one or more analytes (e.g., cell population) of interest (e.g., red blood cells, fetal cells, or nucleated cells) or analytes not-of-interest (e.g., white blood cells).
  • Binding moieties can include e.g., proteins (e.g., ligands/receptors), nucleic acids having complementary counterparts in retained analytes, antibodies, etc.
  • an affinity-based separation module comprises a two-dimensional array of obstacles covered with one or more antibodies selected from the group consisting of: anti-CD71, anti-CD235a, anti-CD36, anti-carbohydrates, anti-selectin, anti-CD45, anti-GPA, and anti-antigen-i.
  • FIG. 3A illustrates a path of a first analyte through an array of posts wherein an analyte that does not specifically bind to a post continues to migrate through the array, while an analyte that does bind a post is captured by the array.
  • FIG. 3B is a picture of antibody coated posts.
  • FIG. 3C illustrates one method of coupling of antibodies to a substrate (e.g., obstacles, side walls, etc.) as contemplated by the present invention. Examples of such affinity-based separation modules are described in International Publication No. WO 2004/029221 and U.S. application Ser. No. 10/529,453, both of which are incorporated by reference.
  • a capture module utilizes a magnetic field to separate and/or enrich one or more analytes (cells) that has a magnetic property or magnetic potential.
  • analytes cells
  • red blood cells which are slightly diamagnetic (repelled by magnetic field) in physiological conditions can be made paramagnetic (attributed by magnetic field) by deoxygenation of the hemoglobin into methemoglobin.
  • This magnetic property can be achieved through physical or chemical treatment of the red blood cells.
  • a sample containing one or more red blood cells and one or more non-red blood cells can be enriched for the red blood cells by first inducing a magnetic property and then separating the above red blood cells from other analytes using a magnetic field (uniform or non-uniform).
  • a maternal blood sample can flow first through a size-based separation module to remove enucleated cells and cellular components (e.g. analytes having a hydrodynamic size less than 6 ⁇ ms) based on size. Subsequently, the enriched nucleated cells (e.g., analytes having a hydrodynamic size greater than 6 ⁇ ms) white blood cells and nucleated red blood cells are treated with a reagent, such as CO 2 , N 2 or NaNO 2 , that changes the magnetic property of the red blood cells' hemoglobin.
  • a reagent such as CO 2 , N 2 or NaNO 2
  • the treated sample then flows through a magnetic field (e.g., a column coupled to an external magnet), such that the paramagnetic analytes (e.g., red blood cells) will be captured by the magnetic field while the white blood cells and any other non-red blood cells will flow through the device to result in a sample enriched in nucleated red blood cells (including fnRBC's).
  • a magnetic field e.g., a column coupled to an external magnet
  • Subsequent enrichment steps can be used to separate the rare cells (e.g. fnRBC's) from the non-rare maternal nucleated red blood cells (non-RBC's).
  • a sample enriched by size-based separation followed by affinity/magnetic separation is further enriched for rare cells using fluorescence activated cell sorting (FACS) or selective lysis of a subset of the cells (e.g. fetal cells).
  • FACS fluorescence activated cell sorting
  • fetal cells are selectively bound to an anti-antigen i binding moiety (e.g. an antibody) to separate them from the mnRBC's.
  • the antibody binds to a fetal cell ligand.
  • the fetal cells are stimulated so as to induce expression of ligands which are targeted by an antibody.
  • the fetal cells are lysed and the nuclei of the fetal cells are separated from other cellular components by binding them with an antibody.
  • fetal cells are selectively bound to receptors which target fetal cell ligands.
  • fetal cells are selectively bound to a lectin.
  • fetal cells or fetal DNA is distinguished from non-fetal cells or non-fetal DNA by forcing the rare cells (fetal cells) to become apoptotic, thus condensing their nuclei and optionally ejecting their nuclei.
  • Rare cells such as fetal cells can be forced into apoptosis using various means including subjecting the cells to hyperbaric pressure (e.g. 4% CO 2 ).
  • the condensed nuclei can be detected and/or isolated for further analysis using any technique known in the art including DNA gel electrophoresis, in situ labeling of DNA nicks (terminal deoxynucleotidyl transferase (TdT))-mediated dUTP in situ nick labeling (also known as TUNEL) (Gavrieli, Y., et al., J.
  • a magnetic particle e.g., a bead
  • compound e.g., Fe 3+
  • a bead coupled to an antibody that selectively binds to an analyte of interest can be decorated with an antibody elected from the group of anti CD71 or CD75.
  • a magnetic compound, such as Fe 3+ can be couple to an antibody such as those described above.
  • the magnetic particles or magnetic antibodies herein may be coupled to any one or more of the devices herein prior to contact with a sample or may be mixed with the sample prior to delivery of the sample to the device(s).
  • Magnetic field used to separate analytes/cells in any of the embodiments herein can uniform or non-uniform as well as external or internal to the device(s) herein.
  • An external magnetic field is one whose source is outside a device herein (e.g., container, channel, obstacles).
  • An internal magnetic field is one whose source is within a device contemplated herein.
  • An example of an internal magnetic field is one where magnetic particles may be attached to obstacles present in the device (or manipulated to create obstacles) to increase surface area for analytes to interact with to increase the likelihood of binding.
  • Analytes captured by a magnetic field can be released by demagnetizing the magnetic regions retaining the magnetic particles. For selective release of analytes from regions, the demagnetization can be limited to selected obstacles or regions.
  • the magnetic field can be designed to be electromagnetic, enabling turn-on and turn-off off the magnetic fields for each individual region or obstacle at will.
  • FIG. 4 illustrates an embodiment of a device configured for capture and isolation of cells expressing the transferrin receptor from a complex mixture.
  • Monoclonal antibodies to CD71 receptor are readily available off-the-shelf and can be covalently coupled to magnetic materials comprising any conventional ferroparticles, such as, but not limited to ferrous doped polystyrene and ferroparticles or ferro-colloids (e.g., from Miltenyi or Dynal).
  • the anti CD71 bound to magnetic particles is flowed into the device.
  • the antibody coated particles are drawn to the obstacles (e.g., posts), floor, and walls and are retained by the strength of the magnetic field interaction between the particles and the magnetic field.
  • the particles between the obstacles and those loosely retained with the sphere of influence of the local magnetic fields away from the obstacles are removed by a rinse.
  • One or more of the enrichment modules herein may be fluidly coupled in series or in parallel with one another.
  • a first outlet from a separation module can be fluidly coupled to a capture module.
  • the separation module and capture module are integrated such that a plurality of obstacles acts both to deflect certain analytes according to size and direct them in a path different than the direction of analyte(s) of interest, and also as a capture module to capture, retain, or bind certain analytes based on size, affinity, magnetism or other physical property.
  • the enrichment steps performed have a specificity and/or sensitivity >50, 60, 70, 80, 90, 95, 96, 97, 98, 99, 99.1, 99.2, 99.3, 99.4, 99.5, 99.6, 99.7, 99.8, 99.9 or 99.95%
  • the retention rate of the enrichment module(s) herein is such that ⁇ 50, 60, 70, 80, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 99.9% of the analytes or cells of interest (e.g., nucleated cells or nucleated red blood cells or nucleated from red blood cells) are retained.
  • the enrichment modules are configured to remove ⁇ 50, 60, 70, 80, 85, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 99.9% of all unwanted analytes (e.g., red blood-platelet enriched cells) from a sample.
  • unwanted analytes e.g., red blood-platelet enriched cells
  • any or all of the enrichment steps can occur with minimal dilution of the sample.
  • the analytes of interest are retained in an enriched solution that is less than 50, 40, 30, 20, 10, 9.0, 8.0, 7.0, 6.0, 5.0, 4.5, 4.0, 3.5, 3.0, 2.5, 2.0, 1.5, 1.0, or 0.5 fold diluted from the original sample.
  • any or all of the enrichment steps increase the concentration of the analyte of interest (fetal cell), for example, by transferring them from the fluid sample to an enriched fluid sample (sometimes in a new fluid medium, such as a buffer).
  • the new concentration of the analyte of interest may be at least 2, 4, 6, 8, 10, 20, 50, 100, 200, 500, 1,000, 2,000, 5,000, 10,000, 20,000, 50,000, 100,000, 200,000, 500,000, 1,000,000, 2,000,000, 5,000,000, 10,000,000, 20,000,000, 50,000,000, 100,000,000, 200,000,000, 500,000,000, 1,000,000,000, 2,000,000,000, or 5,000,000,000 fold more concentrated than in the original samples.
  • a 10 times concentration increase of a first cell type out of a blood sample means that the ratio of first cell type/all cells in a sample is 10 times greater after the sample was applied to the apparatus herein.
  • Such concentration can take a fluid sample (e.g., a blood sample) of greater than 10, 15, 20, 50, or 100 mL total volume comprising rare components of interest, and it can concentrate such rare component of interest into a concentrated solution of less than 0.5, 1, 2, 3, 5, or 10 mL total volume.
  • a fluid sample e.g., a blood sample
  • concentration can take a fluid sample (e.g., a blood sample) of greater than 10, 15, 20, 50, or 100 mL total volume comprising rare components of interest, and it can concentrate such rare component of interest into a concentrated solution of less than 0.5, 1, 2, 3, 5, or 10 mL total volume.
  • the final concentration of fetal cells in relation to non-fetal cells after enrichment can be about 1/10,000-1/10, or 1/1,000-1/100.
  • the concentration of fetal cells to maternal cells may be up to 1/1,000-1/100, or 1/10 or as low as 1/100, 1/1,000 or 1/10,000.
  • fetal cells are at a concentration of less than 1:2, 1:4, 1:10, 1:50, 1:100, 1:1000, 1:10,000, 1:100,000, 1,000,000, 1:10,000,000 or 1:100,000,000 of all cells in a mixed sample to be analyzed or at a concentration of less than 1 ⁇ 10 ⁇ 3 , 1 ⁇ 10 ⁇ 4 , 1 ⁇ 10, 1 ⁇ 10 ⁇ 6 , or 1 ⁇ 10 ⁇ 6 cells/ ⁇ L of the mixed sample.
  • the number of fetal cells in a mixed sample (e.g. enriched sample) has up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 30, 40, 50, 100 total fetal cells.
  • Enriched target cells may be “binned” prior to further analysis of the enriched cells ( FIGS. 24 and 25 ).
  • Binning is any process which results in the reduction of complexity and/or total cell number of the enriched cell output.
  • Binning may be performed by any method known in the art or described herein.
  • One method of binning is by serial dilution. Such dilution may be carried out using any appropriate platform (e.g., PCR wells, microtiter plates) and appropriate buffers.
  • Other methods include nanofluidic systems which can separate samples into droplets (e.g., BioTrove, Raindance, Fluidigm). Such nanofluidic systems may result in the presence of a single cell present in a nanodroplet.
  • Binning may be preceded by positive selection for target cells including, hut not limited to, affinity binding (e.g. using anti-CD71 antibodies). Alternately, negative selection of non-target cells may precede binning.
  • output from a size-based separation module may be passed through a magnetic hemoglobin enrichment module (MHEM) which selectively removes WBCs from the enriched sample by attracting magnetized hemoglobin-containing cells.
  • MHEM magnetic hemoglobin enrichment module
  • the possible cellular content of output from enriched maternal blood which has been passed through a size-based separation module may consist of: 1) approximately 20 fnRBC; 2) 1,500 nmRBC; 3) 4,000-40,000 WBC; 4) 15 ⁇ 10 6 RBC. If this sample is separated into 100 bins (PCR wells or other acceptable binning platform), each bin would be expected to contain: 1) 80 negative bins and 20 bins positive for one fnRBC; 2) 150 nmRBC; 3) 400-4,000 WBC; 4) 15 ⁇ 10 4 RBC.
  • each bin would be expected to contain: 1) 9,980 negative bins and 20 bins positive for one fnRBC; 2) 8,500 negative bins and 1,500 bins positive for one mnC; 3) ⁇ 1-4 WBC; 4) 15 ⁇ 10 2 RBC.
  • the number of bins may be increased or decreased depending on experimental design and/or the platform used for binning. Reduced complexity of the binned cell populations may facilitate further genetic and/or cellular analysis of the target cells by reducing the number of non-target cells in an individual bin.
  • Analysis may be performed on individual bins to confirm the presence of target cells (e.g. fnRBC) in the individual bin.
  • target cells e.g. fnRBC
  • Such analysis may consist of any method known in the art including, but not limited to, FISH, PCR, STR detection, SNP analysis, biomarker detection, and sequence analysis ( FIGS. 24 and 25 ).
  • fetal biomarkers may be used to detect and/or isolate fetal cells, after enrichment or after detection of fetal abnormality or lack thereof. For example, this may be performed by distinguishing between fetal and maternal nRBCs based on relative expression of a gene (e.g., DYS1, DYZ, CD-71, ⁇ - and ⁇ -globin) that is differentially expressed during fetal development.
  • biomarker genes are differentially expressed in the first and/or second trimester.
  • “Differentially expressed,” as applied to nucleotide sequences or polypeptide sequences in a cell or cell nuclei, refers to differences in over/under-expression of that sequence when compared to the level of expression of the same sequence in another sample, a control or a reference sample.
  • expression differences can be temporal and/or cell-specific.
  • differential expression of one or more biomarkers in the cell(s) of interest can be higher or lower relative to background cell populations. Detection of such difference in expression of the biomarker may indicate the presence of a rare cell (e.g., fnRBC) versus other cells in a mixed sample (e.g., background cell populations).
  • a ratio of two or more such biomarkers that are differentially expressed can be measured and used to detect rare cells.
  • fetal biomarkers comprise differentially expressed hemoglobins.
  • Erythroblasts nRBCs
  • nRBCs Erythroblasts
  • trophoblast cells fetal erythroblasts are not prone to mosaic characteristics.
  • Yolk sac erythroblasts synthesize ⁇ -, ⁇ -, ⁇ - and ⁇ -globins, these combine to form the embryonic hemoglobins.
  • the primary site of erythropoiesis shifts from the yolk sac to the liver, the three embryonic hemoglobins are replaced by fetal hemoglobin (HbF) as the predominant oxygen transport system, and ⁇ - and ⁇ -globin production gives way to ⁇ -, ⁇ - and ⁇ -globin production within definitive erythrocytes (Peschle et al., 1985).
  • HbF remains the principal hemoglobin until birth, when the second globin switch occurs and ⁇ -globin production accelerates.
  • Hemoglobin (Hb) is a heterodimer composed of two identical ⁇ globin chains and two copies of a second globin. Due to differential gene expression during fetal development, the composition of the second chain changes from c globin during early embryonic development (1 to 4 weeks of gestation) to ⁇ globin during fetal development (6 to 8 weeks of gestation) to ⁇ globin in neonates and adults as illustrated in (Table 1). TABLE 1 Relative expression of ⁇ , ⁇ and ⁇ in maternal and fetal RBCs. ⁇ ⁇ B 1 st trimester Fetal ++ ++ ⁇ Maternal ⁇ +/ ⁇ ++ 2 nd trimester Fetal ⁇ ++ +/ ⁇ Maternal ⁇ +/ ⁇ ++
  • fnRBCs In the late-first trimester, the earliest time that fetal cells may be sampled by CVS, fnRBCs contain, in addition to ⁇ globin, primarily ⁇ and ⁇ globin. In the early to mid second trimester, when amniocentesis is typically performed, fnRBCs contain primarily ⁇ globin with some adult is globin. Maternal cells contain almost exclusively ⁇ and ⁇ globin, with traces of ⁇ detectable in some samples. Therefore, by measuring the relative expression of the ⁇ , ⁇ and ⁇ genes in RBCs purified from maternal blood samples, the presence of fetal cells in the sample can be determined. Furthermore, positive controls can be utilized to assess failure of the FISH analysis itself.
  • fetal cells are distinguished from maternal cells based on the differential expression of hemoglobins ⁇ , ⁇ or ⁇ .
  • Expression levels or RNA levels can be determined in the cytoplasm or in the nucleus of cells.
  • the methods herein involve determining levels of messenger RNA (in RNA), ribosomal RNA (rRNA), or nuclear RNA (nRNA).
  • identification of fnRBCs can be achieved by measuring the levels of at least two hemoglobins in the cytoplasm or nucleus of a cell.
  • identification and assay is from 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15 or 20 fetal nuclei.
  • total nuclei arrayed on one or more slides can number from about 100, 200, 300, 400, 500, 700, 800, 5000, 10,000, 100,000, 1,000,000, 2,000,000 to about 3,000,000.
  • a ratio for ⁇ / ⁇ or ⁇ / ⁇ is used to determine the presence of fetal cells, where a number less than one indicates that a fnRBC(s) is not present.
  • the relative expression of ⁇ / ⁇ or ⁇ / ⁇ provides a fnRBC index (“FNI”), as measured by ⁇ or ⁇ relative to ⁇ .
  • FNI fnRBC index
  • a FNI for ⁇ / ⁇ greater than 5, 10, 15, 20, 25, 30, 35, 40, 45, 90, 180, 360, 720, 975, 1020, 1024, 1250 to about 1250 indicate that a fnRBC(s) is present.
  • a FNI for ⁇ / ⁇ of less than about 1 indicates that a fnRBC(s) is not present.
  • the above FNI is determined from a sample obtained during a first trimester, However, similar ratios can be used during second trimester and third trimester.
  • the expression levels are determined by measuring nuclear RNA transcripts including, nascent or unprocessed transcripts. In another embodiment, expression levels are determined by measuring mRNA, including ribosomal RNA. There are many methods known in the art for imaging (e.g., measuring) nucleic acids or RNA including, but not limited to, using expression arrays from Affymetrix, Inc. or Illumina, Inc.
  • RT-PCR primers can be designed by targeting the globin variable regions, selecting the amplicon size, and adjusting the primers annealing temperature to achieve equal PCR amplification efficiency.
  • TaqMan probes can be designed for each of the amplicons with well-separated fluorescent dyes, Alexa Fluor®-355 for ⁇ , Alexa Fluor®-488 for A, and Alexa Fluor-555 for ⁇ .
  • the specificity of these primers can be first verified using ⁇ , ⁇ , and ⁇ cDNA as templates.
  • the primer sets that give the best specificity can be selected for further assay development.
  • the primers can be selected from two exons spanning an intron sequence to amplify only the mRNA to eliminate the genomic DNA contamination.
  • the primers selected can be tested first in a duplex format to verify their specificity, limit of detection, and amplification efficiency using target cDNA templates.
  • the best combinations of primers can be further tested in a triplex format for its amplification efficiency, detection dynamic range, and limit of detection.
  • RT-PCR RNA containing RNA sequences
  • reagents such as One-step RT-PCR reagents, including Qiagen One-Step RT-PCR Kit and Applied Biosystems TaqMan One-Step RT-PCR Master Mix Reagents kit.
  • Such reagents can be used to establish the expression ratio of ⁇ , ⁇ and ⁇ using purified RNA from enriched samples.
  • Forward primers can be labeled for each of the targets, using Alexa fluor-355 for ⁇ , Alexa fluor-488 for ⁇ , and Alexa fluor-555 for ⁇ .
  • Enriched cells can be deposited by cytospinning onto glass slides. Additionally, cytospinning the enriched cells can be performed after in situ RT-PCR.
  • the reverse transcription time and PCR cycles can be optimized to maximize the amplicon signal:background ratio to have maximal separation of fetal over maternal signature.
  • signal:background ratio is greater than 5, 10, 50 or 100 and the overall cell loss during the process is less than 50, 10 or 5%.
  • the detection and analysis steps may involve quantifying genomic DNA regions from cells in a sample or enriched sample.
  • the quantified genomic DNA regions are polymorphic sites such as short tandem repeats (STRs) or variable number of tandem repeats (VNTRs).
  • step 103 polymorphic genomic DNA region(s) or whole genome(s) from the mixed sample and optionally reference sample are pre-amplified to increase the overall abundance of DNA used for quantification and analysis.
  • Pre-amplification can be preformed using multiple displacement amplification (MDA) (Gonzalez et al. Envircon Microbiol; 7(7); 1024-S (2005)) or amplification with outer primers in a nested PCR approach. This permits detection and analysis of fetal DNA even if the total amount of fetal DNA in the mixed (e.g.
  • MDA multiple displacement amplification
  • enriched) sample is only up to 1 ⁇ g, 500 ng, 200 ng, 100 ng, 50 ng, 40 ng, 30 ng, 20 ng, 10 ng, 5 ng, 1 ng, 500 pg, 200 pg, 100 pg, 50 pg, 40 pg, 30 pg, 20 p, 10 pg, 5 pg, or 1 pg or between 1-5 ⁇ g, 5-10 ⁇ g, or 10-50 ⁇ g.
  • Pre-amplification allows the products to be split into multiple reactions at the next step.
  • polymorphic DNA region(s) such as short tandem repeats (STRs) or variable number of tandem repeats (VNTRs) are selected on suspected trisomic chromosome(s) (e.g., 13, 18, 21, X or Y) or chromosome(s) associated with a condition to be detected and optionally on control (non-trisomic) chromosomes.
  • STRs short tandem repeats
  • VNTRs variable number of tandem repeats
  • STRs loci are selected for high heterozygosity (variety of alleles) so that the paternal allele of the fetal cells is more likely to be distinct in length from the maternal alleles. This results in an improved power to detect the presence of fetal cells in the mixed sample and potential fetal abnormalities in such cells.
  • the polymorphic regions selected are STR loci, di-, tri-, tetra- or penta-nucleotide repeat loci can be used for detection and analysis of fetal cells.
  • STR loci examples include: D21 S1414, D21 S1411, D21S1412, D21S11 MBP, D13S634, D13S631, D18S535, AmgXY, XHPRT, as well as those listed in FIG. 12 .
  • the methods of the invention allow for the determination of maternal or paternal trisomy.
  • the polymorphic loci selected are amplified. This can be used to detect non-maternal fetal alleles in the mixed sample and to determine the copy number of such alleles.
  • primers are selected to be multiplexable (fairly uniform melting temperature, absence of cross-priming on the human genome, and absence of primer-primer interaction based on sequence analysis) with other primer pairs. Primers and loci are chosen so that the amplicon lengths from a given locus do not overlap with those from another locus.
  • multiple dyes and multi-color fluorescence readout may be used to increase the multiplexing capacity, e.g. of a single CGE. This ensures that the loci are kept distinct in the readout (e.g. CGE readout).
  • PCR primer pairs can be grouped and the same end-labeling is applied to the members of a group.
  • PCR techniques that can be used to amplify the DNA regions herein include, but are not limited, to quantitative PCR, quantitative fluorescent PCR (QF-PCR), multiplex fluorescent PCR (MF-PCR), real time PCR (RT-PCR), single cell PCR, restriction fragment length polymorphism PCR(PCR-RELP), PCR-RFLP/RT-PCR-RFLP, hot start PCR, nested PCR, in situ polonony PCR, in situ rolling circle amplification (RCA), bridge PCR, picotiter PCR and emulsion PCR.
  • QF-PCR quantitative fluorescent PCR
  • MF-PCR multiplex fluorescent PCR
  • RT-PCR real time PCR
  • single cell PCR single cell PCR
  • restriction fragment length polymorphism PCR(PCR-RELP) PCR-RFLP/RT-PCR-RFLP
  • hot start PCR nested PCR
  • in situ polonony PCR in situ rolling circle amplification (RCA)
  • RCA in situ rolling circle amplification
  • LCR ligase chain reaction
  • transcription amplification self-sustained sequence replication
  • selective amplification of target polynucleotide sequences consensus sequence primed polymerase chain reaction (CP-PCR), arbitrarily primed polymerase chain reaction (AP-PCR), degenerate oligonucleotide-primed PCR (DOP-PCR) and nucleic acid based sequence amplification (NABSA).
  • CP-PCR consensus sequence primed polymerase chain reaction
  • AP-PCR arbitrarily primed polymerase chain reaction
  • DOP-PCR degenerate oligonucleotide-primed PCR
  • NABSA nucleic acid based sequence amplification
  • Other amplification methods that may be used to amplify specific polymorphic loci include those described in, U.S. Pat. Nos. 5,242,794, 5,494,810, 4,988,617 and 6,582,938.
  • the amplified DNA polymorphic regions (e.g. STR loci) from both mixed and reference samples are characterized and quantified using any method known in the art.
  • methods include, but are not limited to, gas chromatography, supercritical fluid chromatography, liquid chromatography, including partition chromatography, adsorption chromatography, ion exchange chromatography, size-exclusion chromatography, thin-layer chromatography, and affinity chromatography, electrophoresis, including capillary electrophoresis, capillary zone electrophoresis, capillary isoelectric focusing, capillary electrochromatography, micellar electrokinetic capillary chromatography, isotachophoresis, transient isotachophoresis and capillary gel electrophoresis, comparative genomic hybridization (CGH), microarrays, bead arrays, high-throughput genotyping technology, such as molecular inversion probe (MIP), and Genescan.
  • CGH comparative genomic hybridization
  • microarrays bea
  • capillary gel electrophoresis is used to quantify STRs in both the mixed and reference samples. This can be used to detect non-maternal fetal alleles in the mixed sample and to determine the copy number of such alleles.
  • the mixed sample and the reference sample can be analyzed in separate reactions, e.g. separate CGE lanes.
  • the mixed and the reference sample can be run in the same reaction, e.g. same CGE lane, by using two different dye labels, e.g. differently labeled PCR primers.
  • the alleles show up as peaks in the CGE.
  • each trace typically will need to undergo a length transformation, such as a low-order (cubic or quartic) polynomial transformation, in order to map to the data from the trace corresponding to the previous amplification point.
  • This mapping can be determined by adjusting the transformation parameters to achieve the best fit of the one data trace to the other, with both normalized to the same total sum of squares or summed peak heights.
  • the maternal peaks at each locus provide an estimate of the secondary ‘stutter’ structure at each locus due to PCR errors.
  • the locations of these small secondary peaks can be used to blank out length regions that are contaminated by this stutter when looking for and using the non-maternal allele peaks (as described herein for example).
  • more sophisticated ‘decouvolution’ algorithms can be applied to remove the stutter Stoughton, et al., Electrophoresis; 18(1): 1-S (1997).
  • the sample containing an unknown mixture of fetal and maternal cells is analyzed as in Step (b). This could be done in a separate CGE lane, or in the same CGE lane as the maternal sample by using two different dye labels on the PCR primers. Because each CGE trace has a slightly different relation between DNA fragment size (and sequence) and mobility, these data typically will need to undergo a length transformation, such as a low-order (cubic or quartic) polynomial transformation in order to map one trace onto the other to facilitate peak identification and model fitting. This mapping can be determined by adjusting the transformation parameters to achieve the best fit of the peak locations in one data trace to the other. This mapping will be well determined in the assumed situation where the maternal cells are more numerous than the fetal cells, because the maternal signature will dominate and will be shared in the two data sets.
  • a length transformation such as a low-order (cubic or quartic) polynomial transformation
  • FIG. 5 illustrates typical locus patterns arising from a normal (diploid) fetus and mother.
  • the paternal allele is the same as the left hand maternal allele, and adds to its apparent height.
  • the paternal allele has a length between the lengths of the maternal alleles.
  • the maternal sample is homozygous leading to only one main peak, and the paternal allele is distinct from this allele.
  • FIG. 6 illustrates locus patterns arising from trisomic fetal cells.
  • the dashed trace represents mixed sample containing trisomic fetal cells, superposed on material sample trace (solid black).
  • Trisomy causes excess amplitude in maternal alleles at loci contained within the aneuploid region (here assumed to contain Loci 1 and 2 but not Locus 3).
  • the left hand maternal peak at Locus 1 contains contributions from the trisomy and from a paternal allele.
  • step 107 data models are constructed. From the data obtained from the quantifying step different data models can be constructed depending upon different assumptions.
  • a data model for the CGE patterns in FIGS. 5 and 6 can be as follows:
  • data and data model is represented as discrete peak masses (or heights) and peak locations or as vectors of values representing the actual peak profiles.
  • the ‘addition’ operation in Equations 1-3 denotes summation of peak height or mass at the discrete allele location.
  • summation denotes summation of signals bin by bin over the CGE trace, and in this case it may be helpful to zero the data except in the immediate vicinity of actual peaks. Representation via peak characteristics is preferable when using the PCR linearization technique described above.
  • the differences between the structure of the ⁇ -term that appears in the first and second equations above is determined.
  • the first case there is an additional contribution to both maternal alleles along with the paternal allele
  • the second case there is an additional contribution only to one of the maternal alleles along with the paternal allele.
  • the essence of the presence/absence declaration for fetal cells lies in the evidence for ⁇ being greater than zero.
  • step 108 the best overall fit of model to data is selected from among all the model sets.
  • This modeling approach optimally uses information contained in the increase of chromosome copy number with aneuploidy and its association with the strength of non-maternal alleles.
  • CGE signals representing m1 and m2 at each locus are obtained by profiling the maternal-only sample and mapping the peak locations to the corresponding ones of the mixed sample.
  • the heights of m1 and m2 may be unequal, and this helps cortect for PCR amplification biases associated with particular alleles.
  • the values of p, p1, p2, ⁇ , and ⁇ are determined from the mixed sample data by fitting Equations 1-3 to the data, optionally by using the least squares, or the maximum likelihood methods.
  • Segmental aneuploidies also could be tested by hypothesizing that different contiguous subsets of loci are contained within the aneuploid region.
  • ⁇ and ⁇ have to be determined and the parameters describing the paternal alleles have to be determined at each locus for each model variant.
  • the paternal allele peak height and shape can be assumed to be an average of the known maternal ones at that locus, while the paternal allele location needs to be fit to the data.
  • the possible locations for the paternal allele will be the location of m1, the location of m2, and ‘elsewhere in the locus window’ where this latter possibility involves a search over discrete shifts smaller than a typical peak half-width at half maximum.
  • Prior probabilities on the choices of p, taken from population allele frequency data, can be used, if their product lengths can be predicted.
  • suboptimal searches can be used for computational efficiency.
  • one possible approach involves iterative methods, such as the following, which would be applied to each data model variant.
  • step 109 the presence or absence of fetal DNA is determined using the models described above.
  • the best overall fit for such models yields the values of ⁇ , ⁇ that can be called ⁇ max , ⁇ max .
  • the ratio is a measure of the amount of evidence for fetal DNA.
  • a threshold for declaring fetal DNA is the likelihood ratio of approximately 1000 or more.
  • the likelihood calculation can be approximated by a Chi-squared calculation involving the sum of squared residuals between the data and the model, where each residual is normalized by the expected rms error.
  • the test is declared to be non-informative. If it is decided that fetal DNA is present in the mixed sample, then the likelihoods of the data given the different data model types can be compared to declare trisomy or another condition.
  • step 110 the likelihood ratios of trisomy models (Equations 1 and 3) to the normal model (Equation 2) are calculated and these ratios are compared to a predefined threshold.
  • This threshold can be set so that in controlled tests all the trisomic cases are declared aneuploid, and so that it is expected that the vast majority (>99.9%) of all truly trisomic cases are declared aneuploid by the test.
  • the likelihood ratio threshold is increased beyond what is necessary to declare all the known trisomic cases in the validation set by a factor of 1000/N, where N is the number of trisomy cases in the validation set.
  • step 111 errors that may arise from the experimental procedure used to obtain the data can be taken into account in the model calculation(s).
  • CGE data contain small additive errors associated with CGE readout and larger multiplicative errors associated with PCR amplification efficiencies being different from locus to locus and from allele to allele within a locus.
  • the maternal-only data to define m1 and m2 peak characteristics at each locus, the effects of PCR amplification biases associated with different primers and different amplicons from the same primers have been mostly controlled. Nevertheless, small variations in the process from day to day and the statistics of small numbers of starting genome copies will cause some random errors to remain.
  • the presence of fetal cells in a mixed sample and fetal abnormalities in said cells is determined without trying to integrate them in a data-model fitting procedure described above.
  • steps 100 - 107 can be performed as described above.
  • analysis using Equations 1 and 2 focuses on two indications.
  • aneuploidy results in an excess of DNA for the trisomic chromosome, and this is indicated by the difference in mean strengths of the alleles on the trisomic chromosome compared to control chromosomes.
  • a t-test can be applied to the two distributions of m1 and m2 peak heights.
  • Equations 1 and 2 show that aneuploidy is associated with less inequality in the heights of m1 and m2 at a given locus, particularly for loci where the paternal allele is distinct from the maternal alleles, Loci are selected where a third (paternal) allele is visibly distinct from two maternal alleles, and the distribution of the inequalities (measured in %) between the m1 and m2 peaks are compared between suspected trisomy chromosomes and control chromosomes.
  • peak heights first are normalized by the maternal-only sample. These two lines of evidence are combined to create an overall likelihood, such as by multiplying the probability values from the two lines of evidence.
  • the presence/absence call is done in a simplified way by looking for loci where a third allele is clearly visible, and comparing the distribution of these peak heights between the maternal and mixed samples. Again, a t-test between these distributions gives the probability of fetal DNA being present.
  • the methods herein only determine presence or absence of fetal DNA, and aneuploidy information is known from another sources (e.g. fluorescence in situ hybridization (FISH) assay).
  • FISH fluorescence in situ hybridization
  • FISH fluorescence in situ hybridization
  • the process may be simplified by focusing on detecting the presence of non-maternal alleles without regard to associating them with increases in the maternal allele strengths at the same locus.
  • a process similar to the one outlined above may be used but it is not as necessary to arrange the PCR product lengths so that the products from different loci have distinct length windows in the CGE readout.
  • the alleles from the different loci can be allowed to fall essentially anywhere in the effective measurement length window of the CGE. It also is not necessary to ‘lineate’ the PCR result(s) via multiple CGE readouts at different stages in the PCR cycling as is suggested in step 107 .
  • maternal-only and mixed samples are run and mapped to each other to align maternal allele peak locations, as described above.
  • PCR is run to saturation, or nearly to saturation, to be sure to detect the low abundance fetal sequences.
  • the evidence for fetal DNA then arises from extra peaks in the mixed-sample data with respect to the maternal-sample data.
  • the chance of not seeing a distinct paternal allele (distinct from both maternal alleles) when fetal DNA is in fact present decreases approximately as (0.7 2 ) N , where N is the number of loci included.
  • N is the number of loci included.
  • the present invention provides methods to determine when there are insufficient fetal cells for a determination and report a non-informative case.
  • the present invention involves quantifying regions of genomic DNA from a mixed sample. More particularly the invention involves quantifying DNA polymorphisms from the mixed sample. In some embodiments, one or more than 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20 DNA polymorphism loci (particularly STRs) per target chromosome are analyzed to verify presence of fetal cells.
  • any of the steps above can be performed by a computer program product that comprises a computer executable logic that is recorded on a computer readable medium.
  • the computer program can execute some or all of the following functions: (i) controlling enrichment of fetal cells or DNA from mixed sample and reference sample, (ii) pre-amplifying DNA from both samples, (iii) amplifying specific polymorphic DNA regions from both samples, (iv) identifying and quantifying maternal alleles in the reference sample, (v) identifying maternal and non-maternal alleles in the mixed sample, (vi) fitting data on alleles detected from mixed and/or reference samples into data models, (vii) determining the presence or absence of fetal cells in the mixed sample, (viii) declaring nodal or abnormal phenotype for a fetus based on data models or declaring non-informative results, and (ix) declaring a specific fetal abnormality based on the above results.
  • the computer executable logic can fit data on the quantity of DNA polymorphism(s) (e.g. STR's) into one or more data models.
  • a data model provides a determination of a fetal abnormality from given data signals obtained by molecular analysis e.g. CGE.
  • the computer executable logic provides for a determination of the presence or absence of a trisomy, and distinguish whether the trisomy is paternally derived or if it originates from a maternal non-disjunction event. For example, given the following data signals that can be obtained by molecular analysis (e.g. CGE)
  • m1 which represents a signal obtained from one of the maternal alleles (m1) at a given locus
  • p1 and p2 which are signals obtained from the paternal alleles at one given locus when a paternally derived trisomy occurs
  • the computer executable logic can work in any computer that may be any of a variety of types of general-purpose computers such as a personal computer, network server, workstation, or other computer platform now or later developed.
  • a computer program product is described comprising a computer usable medium having the computer executable logic (computer software program, including program code) stored therein.
  • the computer executable logic can be executed by a processor, causing the processor to perform functions described herein.
  • some functions are implemented primarily in hardware using, for example, a hardware state machine. Implementation of the hardware state machine so as to perform the functions described herein will be apparent to those skilled in the relevant arts.
  • the program can provide a method of evaluating the presence or absence of trisomy in a mixed cell sample by accessing data that reflects the level of polymorphism(s) at two alleles at two or more given loci in a mixed sample (maternal and fetal cells) and in a sample enriched in fetal cells, relating the levels of polymorphism(s) to the number of maternal and fetal cells ( ⁇ and ⁇ in equations 1-3), and determining the presence or absence of trisomy in the samples.
  • the computer executing the computer logic of the invention may also include a digital input device such as a scanner.
  • the digital input device can provide information on the polymorphism levels/quantity.
  • a scanner of this invention can provide an image of the DNA polymorphism (particularly STRs) according to method herein.
  • a scanner can provide an image by detecting fluorescent, radioactive, or other emission; by detecting transmitted, reflected, or scattered radiation, by detecting electromagnetic properties or other characteristics; or by other techniques.
  • the data detected is typically stored in a memory device in the form of a data file.
  • a scanner may identify one or more labeled targets.
  • a first DNA polymorphism may be labeled with a first dye that fluoresces at a particular characteristic frequency, or narrow band of frequencies, in response to an excitation source of a particular frequency.
  • a second DNA polymorphism may be labeled with a second dye that fluoresces at a different characteristic frequency.
  • the excitation sources for the second dye may, but need not, have a different excitation frequency than the source that excites the first dye, e.g., the excitation sources could be the same, or different, lasers.
  • kits containing the devices and reagents for performing the enrichment and genetic analysis may include the materials for any individual step disclosed, any combination of devices and reagents or the devices and reagents for performing all of the steps.
  • a kit may include the arrays for size-based enrichment, the device for magnetic separation of the cells and reagents for performing PCR or CGE.
  • the reagents for performing multiple displacement amplification may be included. This is an exemplary kit and the kits can be constructed using any combination of disclosed materials and devices.
  • the use of the size-based enrichment provides gentle handling that is particularly advantageous for permitting subsequent genetic analysis.
  • FIGS. 7A-7D illustrates a schematic of the device used to separate nucleated cells from fetal cord blood.
  • the arrays and channels were fabricated in silicon using standard photolithography and deep silicon reactive etching techniques. The etch depth is 140 ⁇ m. Through holes for fluid access are made using KOH wet etching. The silicon substrate was sealed on the etched face to form enclosed fluidic channels using a blood compatible pressure sensitive adhesive (9795, 3M, St Paul, Minn.).
  • the device was mechanically mated to a plastic manifold with external fluidic reservoirs to deliver blood and buffer to the device and extract the generated fractions.
  • An external pressure source was used to apply a pressure of 2.0 PSI to the buffer and blood reservoirs to modulate fluidic delivery and extraction from the packaged device.
  • Nucleated cells from the blood were separated from enucleated cells (red blood cells and platelets), and plasma delivered into a buffer stream of calcium and magnesium-free Dulbecco's Phosphate Buffered Saline (14190-144, Invitrogen, Carlsbad, Calif.) containing 1% Bovine Serum Albumin (BSA) (A8412-100 ML, Sigma-Aldrich, St Louis, Mo.) and 2 mM EDTA (15575-020, Invitrogen, Carlsbad, Calif.).
  • BSA Bovine Serum Albumin
  • FIG. 8A-8B Cell smears of the product and waste fractions ( FIG. 8A-8B ) were prepared and stained with modified Wright-Giemsa (WG16, Sigma Aldrich, St. Louis, Mo.).
  • Example 1 The device and process described in detail in Example 1 were used in combination with immunomagnetic affinity enrichment techniques to demonstrate the feasibility of isolating fetal cells from maternal blood.
  • Nucleated cells from the blood were separated from enucleated cells (red blood cells and platelets), and plasma delivered into a buffer stream of calcium and magnesium-free Dulbecco's Phosphate Buffered Saline (14190-144, Invitrogen, Carlsbad, Calif.) containing 1% Bovine Serum Albumin (BSA) (A8412-100 mL, Sigma-Aldrich, St Louis, Mo.).
  • BSA Bovine Serum Albumin
  • the nucleated cell fraction was labeled with anti-CD71 microbeads (130-046-201, Miltenyi Biotech Inc., Auburn, Calif.) and enriched using the MiniMACSTM MS column (130-042-201, Miltenyi Biotech Inc., Auburn, Calif.) according to the manufacturer's specifications. Finally, the CD71-positive fraction was spotted onto glass slides.
  • Measurement techniques Spotted slides were stained using fluorescence in situ hybridization (FISH) techniques according to the manufacturer's specifications using Vysis probes (Abbott Laboratories, Downer's Grove, Ill.). Samples were stained from the presence of X and Y chromosomes. In one case, a sample prepared from a known Trisomy 21 pregnancy was also stained for chromosome 21.
  • FISH fluorescence in situ hybridization
  • enriched fnRBC are binned by dividing the sample into 100 PCR wells. Prior to binning, enriched samples may be screened by FISH to determine the presence of any fnRBC containing an aneuploidy of interest. Because of the low number of fnRBC in maternal blood, only a portion of the wells will contain a single fnRBC (the other wells are expected to be negative for fnRBC).
  • the cells are fixed in 2% Paraformaldehyde and stored at 4° C. Cells in each bin are pelleted and resuspended in 5 ⁇ l PBS plus 1 ⁇ l 20 mg/ml Proteinase K (Sigma #P-2308). Cells are lysed by incubation at 65° C. for 60 minutes followed by inactivation of the Proteinase K by incubation for 15 minutes at 95° C.
  • primer sets (DYZ forward primer TCGAGTGCAATTCCATTCCG; DYZ reverse primer ATGGAATGGCATCAAACGGAA; and DYZ Taqman Probe 6FAM-TGGCTGTCCATTCCA-MGBNFQ), TaqMan Universal PCR master mix, No AmpErase and water are added.
  • the samples are run and analysis is performed on an ABI 7300: 2 minutes at 50° C., 10 minutes 95° C. followed by 40 cycles of 95° C. (15 seconds) and 60° C. (1 minute).
  • further analysis of bins containing fnRBC is performed. Positive bins may be pooled prior to further analysis.
  • FIG. 20 shows the results expected from such an experiment.
  • the data in FIG. 20 was collected by the following protocol. Nucleated red blood cells were enriched from cord cell blood of a male fetus by sucrose gradient two Heme Extractions (HE). The cells were fixed in 2% paraformaldehyde and stored at 4° C. Approximately 10 ⁇ 1000 cells were pelleted and resuspended each in 5 ⁇ l PBS plus 1 ⁇ l 20 mg/ml Proteinase K (Sigma #P-2308). Cells were lysed by incubation at 65° C. for 60 minutes followed by a inactivation of the Proteinase K by 15 minute at 95° C.
  • HE Heme Extractions
  • Maternal blood is processed through a size-based separation module, with or without subsequent MHEM enhancement of fnRBCs.
  • the enhanced sample is then subjected to FISH analysis using probes specific to the aneuploidy of interest (e.g., triploidy 13, triploidy 18, and XYY).
  • Individual positive cells are isolated by “plucking” individual positive cells from the enhanced sample using standard micromanipulation techniques.
  • STR marker sets are amplified and analyzed to confirm that the FISH-positive aneuploid cell(s) are of fetal origin. For this analysis, comparison to the maternal genotype is typical.
  • Table 2 An example of a potential resulting data set is shown in Table 2.
  • Non-maternal alleles may be proven to be paternal alleles by paternal genotyping or genotyping of known fetal tissue samples. As can be seen, the presence of paternal alleles in the resulting cells, demonstrates that the cell is of fetal origin (cells # 1, 2, 9, and 10). Positive cells may be pooled for further analysis to diagnose aneuploidy of the fetus, or may be further analyzed individually.
  • Maternal blood is processed through a size-based separation module, with or without subsequent MHEM enhancement of fnRBCs.
  • the enhanced sample is then subjected to FISH analysis using probes specific to the aneuploidy of interest (e.g., triploidy 13, triploidy 18, and XYY).
  • Probes specific to the aneuploidy of interest e.g., triploidy 13, triploidy 18, and XYY.
  • Samples testing positive with FISH analysis are then binned into 96 microtiter wells, each well containing 15 ⁇ l of the enhanced sample. Of the 96 wells, 5-10 are expected to contain a single fnRBC and each well should contain approximately 1000 nucleated maternal cells (both WBC and mnRBC).
  • Cells are pelleted and resuspended in 5 ⁇ l PBS plus 1 ⁇ l 20 mg/ml Proteinase K (Sigma #P-2308). Cells are lysed by incubation at 65° C. for 60 minutes followed by a inactivation of the Proteinase K by 15 minute at 95° C.
  • the maternal genotype (BB) and fetal genotype (AB) for a particular set of SNPs is known.
  • the genotypes A and B encompass all three SNPs and differ from each other at all three SNPs.
  • the following sequence from chromosome 7 contains these three SNPs (rs7795605, rs7795611 and rs7795233 indicated in brackets, respectively) (ATGCAGCAAGGCACAGACTAA[G/A]CAAGGAGA[G/C]GCAAAATTTTC[A/G]TAGGGGAGAGAAATGGGTCATT).
  • genomic DNA from binned enriched cells is amplified using primers specific to the outer portion of the fetal-specific allele A and which flank the interior SNP (forward primer ATGCAGCAAGGCACAGACTACG; reverse primer AGAGGCGACAGAAATGGGTCATT).
  • amplification using real time SYBR Green PCR is performed with primers specific to the inner portion of allele A and which encompass the interior SNP (forward primer CAAGGCACAGACTAAGCAAGGAGAG; reverse primer GGCAAAATTTTCATAGGGGAGAGAAATGGGTCATT).
  • FIG. 11 illustrates a diagram of the planned protocol for clinical practice where a reference sample (maternal blood) and a fetal enriched sample will be processed in parallel. Twelve polymorphic STRs are chosen (See FIG. 12 ) and associated nested PCR primers were designed ( FIG. 13-14 ).
  • Cell Lysis Cells are lysed in a proteinase K solution by heating samples for 60 minutes at 65° C., followed by a heating step of 15 minutes at 95° C.
  • a polymerase mix that includes 12 specialized STR primer pairs is added to the crude lysate.
  • a master PCR mix is generated according to the number of samples as per the recipe below. For the reference sample 44 ⁇ L of the master mix are added directly to the cell lysate. For the sample recovered from the slide the volume of the reaction is adjusted as necessary. (e.g. 32 ⁇ L crude lysate in a 100 ⁇ L total reaction volume). A no template or negative control is generated to test for contamination.
  • Nested PCR After PCR, optionally, diluted products are added to a second nested primer PCR reaction. Two ul aliquot of each 12-plex PCR reaction is diluted 40 fold (to 80 ul total) with nuclease free water from the PCR kit. The diluted fetal enriched 12-plex reaction could be used as template for a master mix for 8 nested PCR reactions with HAM labeled primers. A second master mix can be generated using the dilution from the maternal reference for 8 nested PCR reactions with VIC labeled primers. The following primer pairs are suggested. A no template or negative control is generated to test for contamination.
  • Nested STR primer facts Reaction Fragment size rxn# temp STR primers ranges 1 68 CSF1P0 THO1 295-327, 171-215 2 68 TPOX CYARO4 220-256, 172-205 3 68 F13A 179-235 4 68 FIBRA 158-286 5 63 VWA D21S11 122-182 202-265 6 63 CD4 86-141 7 63 D14S1434 70-102 8 63 D22S1045 76-109
  • Step Temp (C.) Time (mins) 1.0 95 0.5 2.0 94 0.5 3.0 X 1.5 4.0 72 1.5 5.0 cycle to step 2, 44 times 6.0 72 10
  • the amplification with the nested PCR primers is run with an annealing temperature of 63° C. or 68° C. depending on the primer pair being amplified as indicated in FIG. 13 and FIG. 14 .
  • PCR products are detected on an Agilent Bioanalyzer.
  • the maternal reference VIC labeled PCR reaction products is diluted 10 fold in nano-pure water (17.8 uOhms).
  • Another 10 fold dilution of the fetal enriched FAM-PCR products is generated.
  • the ABI loading buffer is prepared by adding 0.5 ⁇ L LIZ 500 size standard to 12 ⁇ L Hi Di Formamide (scale as appropriate to the number of samples, include enough buffer for the negative control to test for contamination).
  • 1 ⁇ L diluted PCR product is added to 12 ul loading buffer.
  • the sample is heated to 95° C. for 2 minutes and then placed on ice.
  • the samples are loaded onto the ABI 310 as per the manufacturer's instructions.
  • STR primer facts table For analysis the ABI fragments output are examined for the expected peak sizes as per the nested STR primer facts table ( FIG. 13 and FIG. 14 ). For each STR locus is determined whether there are 1 or 2 alleles (homozygous or heterozygous) for the fetal enriched (PAM labeled sample) or the maternal reference (VIC labeled sample). Alleles generated from the fetal enriched (FAM labeled sample) that are not present in the maternal reference (VIC labeled sample) are unique to the fetus and verify the presence of fetal cells in the sample. If the number of fetal cells is particularly low ( ⁇ 5 cells), not all loci or alleles will always amplify. Allele drop out can generate a false negative.
  • a false positive is most likely generated from contamination and has not been observed in tests to date. If the purity of fetal cells is particularly low ( ⁇ 10% in tests executed on the bioanalyzer) signal intensity of paternal alleles can be very weak. This can also generate a false negative result.
  • the amplicons will have different fluorescent labels incorporated into them marking them as the maternal reference or the fetal enriched samples. The labels allow the samples to be loaded simultaneously into an ABI 310 capillary and differentiated. Paternal alleles are identified as those unique to the fetal enriched sample in comparison to the maternal reference. The efficiency of the overall process is determined after sufficient samples have been analyzed on the ABI 310 to establish the input cell purity and minimum number of fetal cells necessary to achieve 99% detection at 0.1% false positive rate.
  • the protocol detection limit was determined using fixed cells from cord blood.
  • Cord blood from clinical sample SVH0003C was subjected to erythrocyte lysis and the remaining leukocytes were fixed in a solution of PBS and 2% para-formaldehyde.
  • Cell numbers were estimated from hemocytometer counts and dilutions made into a Tris protienase K (PK) solution.
  • PK Tris protienase K
  • a PCR cocktail including primers for STR loci TPOX and CSF1P0 was added directly to the crude lysate and amplified as described in Example 6. The products were analyzed on an Agilent bioanalyzer.
  • FIGS. 15A-15B shows representative results. TPOX and CSF1P0 amplification products are underline in boxes. Detection for the PCR protocol from fixed cord blood can occur with less than 10 cells as shown by the result in FIG. 16 .
  • FIG. 17 shows representative results. The mother and fetus are identical at the D21S11 locus but the child has a unique (paternal) allele at the VWA locus. FIG. 17 shows that detection of the paternal VWA allele is lost when the fetal purity drops below 10%.
  • FIG. 18 shows representative results. VWA and LIPOL amplicons are underlined by boxes in the figure. These results show that STRs markers can be generated from fixed cells recovered from a slide.
  • Mutliplex PCR reactions from samples with 10 fetal cells in a background of maternal cells generating at 10%, 5% and 2% fetal cells purity concentration were performed as described in Example 6.
  • a dilution of the three multiplex PCR reactions was used as template in nested PCR reactions for STRs TPOX/CYAR04, VWA/D21S11, and D14S1434 as described in Example 6.
  • FIG. 19 shows representative results.
  • the underlined loci are known to have unique fetal alleles which are designated by arrows when visible in the gel. The three loci were visible when fetal cells constituted 10% of the sample.
  • D14S1434 loci was visible when fetal cells constituted 5% and 2% of the sample.
  • FIG. 15A shows that the Bioanalyzer can resolve a 16 base pair difference between the 99 base pair D14S1434 maternal allele and the 83 base pair paternal allele in a mixed fetal sample at 5% purity (also shown in FIG. 11 , lane 6).
  • FIG. 15B shows that the output of fragments calibration standards. The output of an ABI310 fragment calibration standard is shown in blue or FAM label. Fragments of 232, 234, 236 and 238 are easily resolved from one another. For a resolution comparison note that the orange, VIC labeled, 246 size standard peak is 8 bases away from the FAM labeled 238 peak, half the distance as the maternal and paternal alleles in the Bioanalyzer trace.
  • Genomic DNA from enriched fetal cells and a maternal control sample will be genotyped for specific STR loci in order to assess the presence of chromosomal abnormalities, such as trisomy. Due to the small number of fetal cells typically isolated from maternal blood it is advantageous to perform a pre-amplification step prior to analysis, using a protocol such as improved primer extension pre-amplification (IPEP) PCR.
  • IPEP primer extension pre-amplification
  • Cell lysis is carried out in 10 ul High Fidelity buffer (50 mM Tris-HCL, 22 mM (NH.sub.4).sub.2 SO.sub.4 2.5 mM MgCl.sub.2, pH 8.9) which also contained 4 mg/ml proteinase K and 0.5 vol % Tween 20 (Merck) for 12 hours at 48° C. The enzyme is then inactivated for 15 minutes at 94° C. Lysis is performed in parallel batches in 5 ul, 200 mM KOH, 50 mM dithiothreitol for 10 minutes at 65.degree. The batches are then neutralized with 5 ul 900 mM Tris HCl pH 8.3, 300 mM KCl.
  • High Fidelity buffer 50 mM Tris-HCL, 22 mM (NH.sub.4).sub.2 SO.sub.4 2.5 mM MgCl.sub.2, pH 8.9
  • the enzyme is then inactivated for 15 minutes at 94° C. Ly
  • Preamplication is then carried out for each sample using completely randomized 15-mer primers (16 uM) and dNTP (100 uM) with 5 units of a mixture of Taq polymerase (Boehringer Mannheim) and Pwo polymerase (Boehringer Mannheim) in a ratio of 10:1 under standard PCR buffer conditions (50 mM Tris-HCL, 22 mM (NH 4 ) 2 SO 4 , 2.5 mM Mg 2 , pH 8.9, also containing 5% by vol. of DMSO) in a total volume of 60 ul with the following 50 thermal cycles: Step Temperature Time (1) 92° C. 1 Min 30 Sec; (2) 92° C. 40 Min (3) 37° C. 2 Min; (4) ramp: 0.1° C./sec to 55° C. (5) 55° C. 4 Min (6) 68° C. 30 Sec (7) go to step 2, 49 times (8) 8° C. 15 Min.
  • Dye labeled primers will then be selected from Table 3 based on STR loci on a chromosomes of interest, such as 13, 18, 21 or X.
  • the primers are designed so that one primer of each pair contains a fluorescent dye, such as ROX, HEX, JOE, NED, PAM, TAMARA or LIZ.
  • the primers are placed into multiplex mixes based on expected product size, fluorescent tag compatibility and melting temperature. This allows multiple STR loci to be assayed at once and yet still conserves the amount of initial starting material required. All primers are initially diluted to a working dilution of 10 pM. The primers are then combined in a cocktail that has a final volume of 40 ul. Final primer concentration is determined by reaction optimization.
  • Additional PCR grade water is added if the primer mix is below 40 ul.
  • a reaction mix containing 6 ul of Sigma PCR grade water, 1.25 ul of Perkin Elmer Goldamp PCR buffer, 0.5 ul of dNTPs, 5 ul of the primer cocktail, 0.12 ul of Perkin Elmer Taq Gold Polymerase and 1.25 ul of Mg (25 mM) is mixed for each sample.
  • a 1 ul sample containing preamplified DNA from enriched fetal cells or maternal control genomic DNA is added.
  • the reaction mix is amplified in a DNA thermocyler, (PTC-200; MJ Research) using an amplification cycle optimized for the melting temperature of the primers and the amount of sample DNA.
  • the amplification product will then analyzed using an automated DNA sequencer system, such as the ABI 310, 377, 3100, 3130, 3700 or 3730, or the Li-Cor 4000, 4100, 4200 or 4300.
  • an automated DNA sequencer system such as the ABI 310, 377, 3100, 3130, 3700 or 3730, or the Li-Cor 4000, 4100, 4200 or 4300.
  • 6 ul of products will be removed and combined with 1.6 ul of loading buffer mix.
  • the master loading buffer mix contains 90 ul deionized formamide combined with 25 ul Perkin Elmer loading dye and 10 ul of a size standard, such as the ROX 350 size standard.
  • a size standard such as the ROX 350 size standard.
  • Various other standards can be used interchangeably depending on the sizes of the labeled PCR products.
  • the loading buffer and sample are then heat denatured at 95° C. for 3 minutes followed by flash cooling on ice. 2 ul of the product/buffer mix is then

Abstract

The present invention provides systems, apparatuses, and methods to detect the presence of fetal cells when mixed with a population of maternal cells in a sample and to test fetal abnormalities, i.e. aneuploidy. In addition, the present invention provides methods to determine when there are insufficient fetal cells for a determination and report a non-informative case. The present invention involves quantifying regions of genomic DNA from a mixed sample. More particularly the invention involves quantifying DNA polymorphisms from the mixed sample.

Description

    CROSS-REFERENCE
  • This application claims the benefit of U.S. Provisional Application No. 60/804,815, filed Jun. 14, 2006, which application is incorporated herein by reference.
  • BACKGROUND OF THE INVENTION
  • Analysis of specific cells can give insight into a variety of diseases. These analyses can provide non-invasive tests for detection, diagnosis and prognosis of diseases, thereby eliminating the risk of invasive diagnosis. For instance, social developments have resulted in an increased number of prenatal tests. However, the available methods today, amniocentesis and chorionic villus sampling (CVS) are potentially harmful to the mother and to the fetus. The rate of miscarriage for pregnant women undergoing amniocentesis is increased by 0.5-1%, and that figure is slightly higher for CVS. Because of the inherent risks posed by amniocentesis and CVS, these procedures are offered primarily to older women, i.e., those over 35 years of age, who have a statistically greater probability of bearing children with congenital defects. As a result, a pregnant woman at the age of 35 has to balance an average risk of 0.5-1% to induce an abortion by amniocentesis against an age related probability for trisomy 21 of less than 0.3%.
  • To eliminate the risks associated with invasive prenatal screening procedures, non-invasive tests for detection, diagnosis and prognosis of diseases, have been utilized. For example, maternal serum alpha-fetoprotein, and levels of unconjugated estriol and human chorionic gonadotropin are used to identify a proportion of fetuses with Down's syndrome, however, these tests are not one hundred percent accurate. Similarly, ultrasonography is used to determine congenital defects involving neural tube defects and limb abnormalities, but is useful only after fifteen weeks' gestation.
  • The methods of the present invention allow for the detection of fetal cells and fetal abnormalities when fetal cells are present in a mixed population of cells, even when maternal cells dominate the mixture.
  • SUMMARY OF THE INVENTION
  • The presence of fetal cells in maternal circulation offers the opportunity to develop a prenatal diagnostic that obviates the risk associated with today's invasive diagnostics procedures. However, fetal cells are rare as compared to the presence of maternal cells in the blood. Therefore, any proposed analysis of fetal cells to diagnose fetal abnormalities requires enrichment of fetal cells. Enriching fetal cells from maternal peripheral blood is challenging, time intensive and any analysis derived therefrom is prone to error. The present invention addresses these challenges.
  • The present invention relates to methods for determining the presence of fetal cells and fetal abnormalities when fetal cells are present in a mixed sample (e.g. maternal blood sample). In some embodiments, determining the presence of fetal cells or of a fetal abnormality includes comparing the level of genomic DNA from a mixed sample to the level of genomic DNA in a control sample. The control or reference sample can be a mixed sample that has been sufficiently diluted to be free of fetal cells. The mixed sample can contain at least one fetal cell and one non-fetal cell. In other embodiments, the sample comprises up to 50% fetal cells.
  • In some embodiments, determining the presence of fetal cells and/or abnormalities involves quantifying one or more regions of genomic DNA regions from the mixed sample and determining from the quantification the presence of a fetal abnormality. Preferably, such regions are polymorphic e.g. short tandem repeat (STR) regions.
  • Examples of fetal abnormalities that can be determined by quantifying regions on one or more chromosomes include trisomy 13, trisomy 18, trisomy 21 (Dow-Syndrome), Klinefelter Syndrome (XXY) and other irregular number of sex or autosomal chromosomes. Other examples of abnormal fetal genotypes that can be determined by quantifying regions on one or more chromosomes include, but are not limited to, aneuploidy such as, monosomy of one or more chromosomes (X chromosome monosomy, also known as Turner's syndrome), trisomy of one or more chromosomes (such as 13, 18, 21, and X), tetrasomy and pentasomy of one or more chromosomes (which in humans is most commonly observed in the sex chromosomes, e.g. XXXX, XXYY, XXXY, XYYY, XXXXX, XXXXY, XXXYY, XYYYY and XXYYY), triploidy (tee of every chromosome, e.g. 69 chromosomes in humans), tetraploidy (four of every chromosome, e.g. 92 chromosomes in humans) and multiploidy. In some embodiments, an abnormal fetal genotype is a segmental aneuploidy. Examples of segmental aneuploidy include, but are not Limited to, 1p36 duplication, dup(17)(p11.2p11.2) syndrome, Down syndrome, Pelizaeus-Merzbacher disease, dup(22)(q11.2q11.2) syndrome, and cat-eye syndrome. In some cases, an abnormal fetal genotype is due to one or more deletions of sex or autosomal chromosomes, which may result in a condition such as Cri-du-chat syndrome, Wolf-Hirschorn, Williams-Beuren syndrome, Charcot-Marie-Tooth disease, Hereditary neuropathy with liability to pressure palsies, Smith-Magenis syndrome, Neurofibromatosis, Alagille syndrome, Velocardiofacial syndrome, DiGeorge syndrome, Steroid sulfatase deficiency, Kallmann syndrome, Microphthalmia with linear skin defects, Adrenal hypoplasia, Glycerol kinase deficiency, Pelizaeus-Merzbacher disease, Testis-determining factor on Y, Azospermia (factor a), Azospermia (factor b), Azospermia (factor c), or 1p36 deletion. In some embodiments, a decrease in chromosomal number results in an XO syndrome.
  • Furthermore, the methods herein can distinguish maternal trisomy from paternal trisomy, and total aneuploidy from segmental aneuploidy. Segmental aneuploidies can be caused by an intra-chromosomal event such as a deletion, duplication or translocation event. Additionally, the methods herein can be used to identify monoploidy, triploidy, tetraploidy, pentaploidy and other higher multiples of the normal haploid state. In some embodiments, the maternal or paternal origin of the fetal abnormality can be determined.
  • The genomic DNA region(s) can be quantified by amplifying the regions using, for example, PCR, or preferably quantitative PCR. Alternatively, quantification of the regions can be achieved using capillary gel electrophoresis (CGE). In some embodiments, total genomic DNA is pre-amplified prior to the quantitative amplification step to increase the overall abundance of DNA. Such pre-amplification step can involve the use of multiple displacement amplification.
  • In some embodiments the genomic DNA regions quantified can be in one chromosome or in 2 or more chromosomes. The polymorphic regions can be quantified on either or both sex chromosomes X and Y, and on autosomal chromosomes including chromosomes 13, 18 and 21.
  • Prior to analysis a mixed sample suspected of having fetal cells (e.g. a maternal blood sample) can be enriched for fetal cells. Fetal cell enrichment can be accomplished using any method known in the art including size-based separation, affinity (e.g. magnetic) separation, FACS, laser microdisection, and magnetic bead separation. A mixed sample containing as few as 10 fetal cells can be enriched. In some embodiments, the fetal cells in the enriched sample constitute less than 50% of the total number of cells.
  • In some embodiments, the size-based separation method includes applying a mixed sample into a system that separates a first component of the mixed sample (e.g. fetal cells), which comprises cells that are larger than a critical size, in a first direction, and a second component of the mixed sample (e.g. enucleated maternal red blood cells), which comprises cells that are smaller than a critical size, towards a second exit port. The separation system can be a device that includes one or more arrays of obstacles that form a network of gaps.
  • In some embodiments, enrichment that is achieved by size-based separation is followed by one or more additional enrichment procedures including magnetic separation, fluorescence activated cell sorting (FACS), laser microdisection, and magnetic bead separation. In some embodiments, a sample enriched by size-based separation is subjected to affinity/magnetic separation and is further enriched for rare cells using fluorescence activated cell sorting (FACS) or selective lysis of a subset of the cells (e.g. fetal cells).
  • In some embodiments there are provided kits for detecting the fetal abnormalities wherein the kits include separation devices and the reagents needed to perform the genetic analysis. For example, the kit may include arrays for size based enrichment, a device for magnetic enrichment and reagents for performing PCR.
  • The methods can further comprise inputting the data from the quantification step into data model(s) for the association of DNA quantity with maternal and non-maternal alleles. The invention provides for a computer program product, which includes a computer executable logic recorded on a computer readable medium that can be used for diagnosing a fetal abnormality. The computer program is designed to receive data from one of more quantified DNA genomic regions from a mixed sample containing at least one fetal cell, determine the presence or absence of a fetal abnormality from the data, and generate an output that comprises the evaluation of the fetal abnormality. Methods for using the computer program product are also disclosed.
  • SUMMARY OF THE DRAWINGS
  • The novel features of the invention are set forth with particularity in the appended claims. A better understanding of the features and advantages of the present invention will be obtained by reference to the following detailed description that sets forth illustrative embodiments, in which the principles of the invention are utilized, and the accompanying drawings of which:
  • FIG. 1 illustrates a flow chart of one embodiment of the present invention.
  • FIGS. 2A-2D illustrate one embodiment of a size-based separation module.
  • FIGS. 3A-3C illustrate one embodiment of an affinity separation module.
  • FIG. 4 illustrates one embodiment of a magnetic separation module.
  • FIG. 5 illustrates typical locus patterns arising from a normal (diploid) fetus and mother.
  • FIG. 6 illustrates typical locus patterns arising from trisomic fetal cells.
  • FIGS. 7A-7D illustrate various embodiments of a size-based separation module,
  • FIGS. 8A-8B illustrate cell smears of the product and waste fractions.
  • FIGS. 9A-9F illustrate isolated fetal cells confirmed by the reliable presence of male Y chromosome.
  • FIG. 10 illustrates trisomy 21 pathology in an isolated fetal nucleated red blood cell.
  • FIG. 11 depicts a flow chart depicting the major steps involved in detecting paternal alleles in a fetal enriched sample using fluorescently labeled primers.
  • FIG. 12 illustrates a table with STR loci that can be used for fetal detection.
  • FIG. 13 illustrates a table with exemplary external primers for STR loci.
  • FIG. 14 illustrates a table with exemplary internal primers for STR loci.
  • FIG. 15 illustrates the resolution for the ABI 310 bioanalyzer.
  • FIG. 16 illustrates the detection limit on fixed cord blood.
  • FIG. 17 illustrates the detection of 10 fetal cells at 10% purity without nested PCR.
  • FIG. 18 illustrates the generation of STR markers on fixed cells recovered from a slide.
  • FIG. 19 illustrates detection of fetal alleles at less than 10% purity after nested PCR amplification of STRs.
  • FIG. 20 illustrates the detection of single copies of a fetal cell genome by qPCR.
  • FIG. 21 illustrates detection of single fetal cells in binned samples by SNP analysis.
  • FIG. 22 illustrates a method of trisomy testing. The trisomy 21 screen is based on scoring of target cells obtained from maternal blood. Blood is processed using a cell separation module for hemoglobin enrichment (CSM-HE). Enriched cells are transferred to slides that are first stained and subsequently probed by FISH. Images are acquired, such as from bright field or fluorescent microscopy, and scored. The proportion of trisomic cells of certain classes serves as a classifier for risk of fetal trisomy 21. Fetal genome identification can performed using assays such as: (1) STR markers; (2) qPCR using primers and probes directed to loci, such as the multi-repeat DYZ locus on the Y-chromosome; (3) SNP detection; and (4) CGH (comparative genome hybridization) array detection.
  • FIG. 23 illustrates assays that can produce information on the presence of aneuploidy and other genetic disorders in target cells, Information on anueploidy and other genetic disorders in target cells may be acquired using technologies such as: (1) a CGH array established for chromosome counting, which can be used for aneuploidy determination and/or detection of intra-chromosomal deletions; (2) SNP/taqman assays, which can be used for detection of single nucleotide polymorphisms; and (3) ultra-deep sequencing, which can be used to produce partial or complete genome sequences for analysis.
  • FIG. 24 illustrates methods of fetal diagnostic assays. Fetal cells are isolated by CSM-HE enrichment of target cells from blood. The designation of the fetal cells may be confirmed using techniques comprising FISH staining (using slides or membranes and optionally an automated detector), FACS, and/or binning. Binning may comprise distribution of enriched cells across wells in a plate (such as a 96 or 384 well plate), microencapsulation of cells in droplets that are separated in an emulsion, or by introduction of cells into microarrays of nanofluidic bins. Fetal cells are then identified using methods that may comprise the use of biomarkers (such as fetal (gamma) hemoglobin), allele-specific SNP panels that could detect fetal genome DNA, detection of differentially expressed maternal and fetal transcripts (such as Affymetrix chips), or primers and probes directed to fetal specific loci (such as the multi-repeat DYZ locus on the Y-chromosome). Binning sites that contain fetal cells are then be analyzed for aneuploidy and/or other genetic defects using a technique such as CGH array detection, ultra deep sequencing (such as Solexa, 454 or mass spectrometry), STR analysis, or SNP detection.
  • FIG. 25 illustrates methods of fetal diagnostic assays, further comprising the step of whole genome amplification prior to analysis of aneuploidy and/or other genetic defects.
  • INCORPORATION BY REFERENCE
  • All publications and patent applications mentioned in this specification are herein incorporated by reference to the same extent as if each individual publication or patent application was specifically and individually indicated to be incorporated by reference.
  • DETAILED DESCRIPTION OF THE INVENTION
  • The present invention provides systems, apparatuses, and methods to detect the presence and condition (e.g. aneuploidy) of fetal cells in a mixed cell population, e.g. a sample wherein fetal cells consist of <50%, 45%, 40%, 35%, 30%, 25%, 20%, 15%, 10%, 5%, 1%, or 0.5% of all cells in a mixed sample.
  • FIG. 1 illustrates an overview of one embodiment of the present invention.
  • In step 100, a sample containing (or suspected of containing) 1 or more fetal cells is obtained. Samples can be obtained from an animal suspected of being pregnant, pregnant, or that has been pregnant to detect the presence of a fetus or fetal abnormality. Such animal can be a human or a domesticated animal such as a cow, chicken, pig, horse, rabbit, dog, cat, or goat. Samples derived from an animal or human can include, e.g., whole blood, sweat, tears, ear flow, sputum, lymph, bone marrow suspension, lymph, urine, saliva, semen, vaginal flow, cerebrospinal fluid, brain fluid, ascites, milk, secretions of the respiratory, intestinal or genitourinary tracts fluid.
  • To obtain a blood sample, any technique known in the art may be used, e.g. a syringe or other vacuum suction device. A blood sample can be optionally pre-treated or processed prior to enrichment. Examples of pre-treatment steps include the addition of a reagent such as a stabilizer, a preservative, a fixant, a lysing reagent, a diluent, an anti-apoptotic reagent, an anti-coagulation reagent, an anti-thrombotic reagent, magnetic property regulating reagent, a buffering reagent, an osmolality regulating reagent, a pH regulating reagent, and/or a cross-linking reagent.
  • When a blood sample is obtained, a preservative such an anti-coagulation agent and/or a stabilizer can be added to the sample prior to enrichment. This allows for extended time for analysis/detection. Thus, a sample, such as a blood sample, can be enriched and/or analyzed under any of the methods and systems herein within 1 week, 6 days, 5 days, 4 days, 3 days, 2 days, 1 day, 12 hrs, 6 hrs, 3 hrs, 2 hrs, or 1 hr from the time the sample is obtained.
  • In some embodiments, a blood sample can be combined with an agent that selectively lysed one or more cells or components in a blood sample. For example, fetal cells can be selectively lysed releasing their nuclei when a blood sample including fetal cells is combined with deionized water. Such selective lysis allows for the subsequent enrichment of fetal nuclei using, e.g., size or affinity based separation. In another example, platelets and/or enucleated red blood cells are selectively lysed to generate a sample enriched in nucleated cells, such as fetal nucleated red blood cells (fnRBC) and maternal nucleated blood cells (mnBC). The fnRBC's can subsequently be separated from the in BC's using, e.g., affinity to antigen-i or magnetism differences in fetal and adult hemoglobin.
  • When obtaining a sample from an animal (e.g., blood sample), the amount can vary depending upon animal size, its gestation period, and or the condition being screened. In some embodiments, up to 50, 40, 30, 20, 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 mL of a sample is obtained. In some embodiments, 1-50, 2-40, 3-30, or 4-20 mL of sample is obtained. In some embodiments, more than 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95 or 100 mL of a sample is obtained.
  • To detect fetal abnormality, a blood sample can be obtained from a pregnant animal or human within 36, 24, 22, 20, 18, 16, 14, 12, 10, 8, 6 or 4 weeks of gestation.
  • In step 101, a reference sample is obtained. The reference sample consists of substantially all or all maternal cells. In some embodiments, a reference sample is a maternal blood sample enriched for white blood cells (WBC's) such that it consists of substantially all or all maternal WBC's. In some embodiments, a reference sample is a diluted mixed sample wherein the dilution results in a sample free of fetal cells. For example, a maternal blood sample of 10-50 ML can be diluted by at least 2, 5, 10, 20, 50, or 100 fold to reduce the likelihood that it will include fetal cells.
  • In step 102, when the sample to be tested or analyzed is a mixed sample (e.g. maternal blood sample), it is enriched for rare cells or rare DNA (e.g. fetal cells, fetal DNA or fetal nuclei) using one or more methods known in the art or disclosed herein. Such enrichment increases the ratio of fetal cells to non-fetal cells; the concentration of fetal DNA to non-fetal DNA; or the concentration of fetal cells in volume per total volume of the mixed sample.
  • In some embodiments, enrichment occurs by selective lysis as described above. For example, enucleated cells may be selectively lysed prior to subsequent enrichment steps or fetal nucleated cells may be selectively lysed prior to separation of the fetal nuclei from other cells and components in the sample.
  • In some embodiments, enrichment of fetal cells or fetal nuclei occurs using one or more size-based separation modules. Size-based separation modules include filtration modules, sieves, matrixes, etc., including those disclosed in International Publication Nos, WO 2004/113877, WO 2004/0144651, and US Application Publication No. 2004/011956.
  • In some embodiments, a size-based separation module includes one or more arrays of obstacles that form a network of gaps. The obstacles are configured to direct particles (e.g. cells or nuclei) as they flow through the array/network of gaps into different directions or outlets based on the particle's hydrodynamic size. For example, as a blood sample flows through an array of obstacles, nucleated cells or cells having a hydrodynamic size larger than a critical size, e.g., 8 microns, are directed to a first outlet located on the opposite side of the array of obstacles from the fluid flow inlet, while the enucleated cells or cells having a hydrodynamic size smaller than a critical size, e.g., 8 microns, are directed to a second outlet also located on the opposite side of the array of obstacles from the fluid flow inlet.
  • An array can be configured to separate cells smaller than a critical size from those larger than the critical size by adjusting the size of the gaps, obstacles, and offset in the period between each successive row of obstacles. For example, in some embodiments, obstacles and/or gaps between obstacles can be up to 10, 20, 50, 70, 100, 120, 150, 170, or 200 microns in length or about 2, 4, 6, 8 or 10 microns in length. In some embodiments, an array for size-based separation includes more than 100, 500, 1,000, 5,000, 10,000, 50,000 or 100,000 obstacles that are arranged into more than 10, 20, 50, 100, 200, 500, or 1000 rows. Preferably, obstacles in a first row of obstacles are offset from a previous (upstream) row of obstacles by up to 50% of the period of the previous row of obstacles. In some embodiments, obstacles in a first row of obstacles are offset from a previous row of obstacles by up to 45, 40, 35, 30, 25, 20, 15 or 10% the period of the previous row of obstacles. Furthermore, the distance between a first row of obstacles and a second row of obstacles can be up to 10, 20, 50, 70, 100, 120, 150, 170 or 200 microns. A particular offset can be continuous (repeating for multiple rows) or non-continuous. In some embodiments, a separation module includes multiple discrete arrays of obstacles fluidly coupled such that they are in series with one another. Each array of obstacles has a continuous offset. But each subsequent (downstream) array of obstacles has an offset that is different from the previous (upstream) offset. Preferably, each subsequent array of obstacles has a smaller offset that the previous array of obstacles. This allows for a refinement in the separation process as cells migrate through the array of obstacles. Thus, a plurality of arrays can be fluidly coupled in series or in parallel, (e.g., more than 2, 4, 6, 8, 10, 20, 30, 40, 50). Fluidly coupling separation modules (e.g., arrays) in parallel allows for high-throughput analysis of the sample, such that at least 1, 2, 5, 10, 20, 50, 100, 200, or 500 mL per hour flows through the enrichment modules or at least 1, 5, 10, or 50 million cells per hour are sorted or flow through the device.
  • FIGS. 2A-2D illustrate one example of a size-based separation module. Obstacles (which may be of any shape) are coupled to a flat substrate to form an array of gaps. A transparent cover or lid may be used to cover the array. The obstacles form a two-dimensional array with each successive row shifted horizontally with respect to the previous row of obstacles, where the array of obstacles directs components having a hydrodynamic size smaller than a critical size in a first direction and components having a hydrodynamic size larger that a critical size in a second direction. See FIGS. 2B-2D. The flow of sample into the array of obstacles can be aligned at a small angle (flow angle) with respect to a line-of-sight of the array (lateral flow angle). Optionally, the array is coupled to an infusion pump to perfuse the sample through the obstacles. The flow conditions of the size-based separation module described herein are such that cells are sorted by the array with minimal damage. This allows for downstream analysis of intact cells and intact nuclei to be more efficient and reliable.
  • In one embodiment, a size-based separation module comprises an array of obstacles configured to direct rare cells larger than a critical size to migrate along a line-of-sight within the array towards a first outlet or bypass channel leading to a first outlet, while directing cells and analytes smaller than a critical size through the array of obstacles in a different direction towards a second outlet.
  • A variety of enrichment protocols may be utilized although gentle handling of the cells is preferred to reduce any mechanical damage to the cells or their DNA. This gentle handling also preserves the small number of fetal cells in the sample. Integrity of the nucleic acid being evaluated is an important feature in some embodiments to permit the distinction between the genomic material from the fetal cells and other cells in the sample. In particular, the enrichment and separation of the fetal cells using the arrays of obstacles produces gentle treatment which minimizes cellular damage and maximizes nucleic acid integrity permitting exceptional levels of separation and the ability to subsequently utilize various formats to very accurately analyze the genome of the cells which are present in the sample in extremely low numbers.
  • In some embodiments, enrichment of fetal cells occurs using one or more capture modules that selectively inhibit the mobility of one or more cells of interest. Preferably a capture module is fluidly coupled downstream to a size-based separation module. Capture modules can include a substrate having multiple obstacles that restrict the movement of cells or analytes greater than a critical size. Examples of capture modules that inhibit the migration of cells based on size are disclosed in U.S. Pat. Nos. 5,837,115 and 6,692,952.
  • In some embodiments, a capture module includes a two dimensional array of obstacles that selectively filters or captures cells or analytes having a hydrodynamic size greater than a particular gap size, e.g., critical sized. Arrays of obstacles adapted for separation by capture can include obstacles having one or more shapes and can be arranged in a uniform or non-uniform order. In some embodiments, a two-dimensional array of obstacles is staggered such that each subsequent row of obstacles is offset from the previous row of obstacles to increase the number of interactions between the analytes being sorted (separated) and the obstacles.
  • Another example of a capture module is an affinity-based separation module. An affinity-based separation module capture analytes or cells of interest based on their affinity to a structure or particle as oppose to their size. One example of an affinity-based separation module is an array of obstacles that are adapted for complete sample flow through, but for the fact that the obstacles are covered with binding moieties that selectively bind one or more analytes (e.g., cell population) of interest (e.g., red blood cells, fetal cells, or nucleated cells) or analytes not-of-interest (e.g., white blood cells). Binding moieties can include e.g., proteins (e.g., ligands/receptors), nucleic acids having complementary counterparts in retained analytes, antibodies, etc. In some embodiments, an affinity-based separation module comprises a two-dimensional array of obstacles covered with one or more antibodies selected from the group consisting of: anti-CD71, anti-CD235a, anti-CD36, anti-carbohydrates, anti-selectin, anti-CD45, anti-GPA, and anti-antigen-i.
  • FIG. 3A illustrates a path of a first analyte through an array of posts wherein an analyte that does not specifically bind to a post continues to migrate through the array, while an analyte that does bind a post is captured by the array. FIG. 3B is a picture of antibody coated posts. FIG. 3C illustrates one method of coupling of antibodies to a substrate (e.g., obstacles, side walls, etc.) as contemplated by the present invention. Examples of such affinity-based separation modules are described in International Publication No. WO 2004/029221 and U.S. application Ser. No. 10/529,453, both of which are incorporated by reference.
  • In some embodiments, a capture module utilizes a magnetic field to separate and/or enrich one or more analytes (cells) that has a magnetic property or magnetic potential. For example, red blood cells which are slightly diamagnetic (repelled by magnetic field) in physiological conditions can be made paramagnetic (attributed by magnetic field) by deoxygenation of the hemoglobin into methemoglobin. This magnetic property can be achieved through physical or chemical treatment of the red blood cells. Thus, a sample containing one or more red blood cells and one or more non-red blood cells can be enriched for the red blood cells by first inducing a magnetic property and then separating the above red blood cells from other analytes using a magnetic field (uniform or non-uniform). For example, a maternal blood sample can flow first through a size-based separation module to remove enucleated cells and cellular components (e.g. analytes having a hydrodynamic size less than 6 μms) based on size. Subsequently, the enriched nucleated cells (e.g., analytes having a hydrodynamic size greater than 6 μms) white blood cells and nucleated red blood cells are treated with a reagent, such as CO2, N2 or NaNO2, that changes the magnetic property of the red blood cells' hemoglobin. The treated sample then flows through a magnetic field (e.g., a column coupled to an external magnet), such that the paramagnetic analytes (e.g., red blood cells) will be captured by the magnetic field while the white blood cells and any other non-red blood cells will flow through the device to result in a sample enriched in nucleated red blood cells (including fnRBC's). Additional examples of magnetic separation modules are described in U.S. application Ser. No. 11/323,971, filed Dec. 29, 2005 entitled “Devices and Methods for Magnetic Enrichment of Cells and Other Particles” and U.S. application Ser. No. 11/227,904, filed Sep. 15, 2005, entitled “Devices and Methods for Enrichment and Alteration of Cells and Other Particles”.
  • Subsequent enrichment steps can be used to separate the rare cells (e.g. fnRBC's) from the non-rare maternal nucleated red blood cells (non-RBC's). In some embodiments, a sample enriched by size-based separation followed by affinity/magnetic separation is further enriched for rare cells using fluorescence activated cell sorting (FACS) or selective lysis of a subset of the cells (e.g. fetal cells). In some embodiments, fetal cells are selectively bound to an anti-antigen i binding moiety (e.g. an antibody) to separate them from the mnRBC's. In some embodiments, the antibody binds to a fetal cell ligand. In some related embodiments the fetal cells are stimulated so as to induce expression of ligands which are targeted by an antibody. In some embodiments the fetal cells are lysed and the nuclei of the fetal cells are separated from other cellular components by binding them with an antibody. In some embodiments, fetal cells are selectively bound to receptors which target fetal cell ligands. In some embodiments, fetal cells are selectively bound to a lectin. In some embodiments, fetal cells or fetal DNA is distinguished from non-fetal cells or non-fetal DNA by forcing the rare cells (fetal cells) to become apoptotic, thus condensing their nuclei and optionally ejecting their nuclei. Rare cells such as fetal cells can be forced into apoptosis using various means including subjecting the cells to hyperbaric pressure (e.g. 4% CO2). The condensed nuclei can be detected and/or isolated for further analysis using any technique known in the art including DNA gel electrophoresis, in situ labeling of DNA nicks (terminal deoxynucleotidyl transferase (TdT))-mediated dUTP in situ nick labeling (also known as TUNEL) (Gavrieli, Y., et al., J. Cell Biol 119:493-501 (1992)) and ligation of DNA strand breaks having one or two-base 3′ overhangs (Taq polymerase-based in situ ligation). (Dideniko V., et al. J. Cell Biol. 135:1369-76 (1996)).
  • In some embodiments, when the analyte desired to be separated (e.g., red blood cells or white blood cells) is not ferromagnetic or does not have a magnetic property, a magnetic particle (e.g., a bead) or compound (e.g., Fe3+) can be coupled to the analyte to give it a magnetic property. In some embodiments, a bead coupled to an antibody that selectively binds to an analyte of interest can be decorated with an antibody elected from the group of anti CD71 or CD75. In some embodiments a magnetic compound, such as Fe3+, can be couple to an antibody such as those described above. The magnetic particles or magnetic antibodies herein may be coupled to any one or more of the devices herein prior to contact with a sample or may be mixed with the sample prior to delivery of the sample to the device(s).
  • Magnetic field used to separate analytes/cells in any of the embodiments herein can uniform or non-uniform as well as external or internal to the device(s) herein. An external magnetic field is one whose source is outside a device herein (e.g., container, channel, obstacles). An internal magnetic field is one whose source is within a device contemplated herein. An example of an internal magnetic field is one where magnetic particles may be attached to obstacles present in the device (or manipulated to create obstacles) to increase surface area for analytes to interact with to increase the likelihood of binding. Analytes captured by a magnetic field can be released by demagnetizing the magnetic regions retaining the magnetic particles. For selective release of analytes from regions, the demagnetization can be limited to selected obstacles or regions. For example, the magnetic field can be designed to be electromagnetic, enabling turn-on and turn-off off the magnetic fields for each individual region or obstacle at will.
  • FIG. 4 illustrates an embodiment of a device configured for capture and isolation of cells expressing the transferrin receptor from a complex mixture. Monoclonal antibodies to CD71 receptor are readily available off-the-shelf and can be covalently coupled to magnetic materials comprising any conventional ferroparticles, such as, but not limited to ferrous doped polystyrene and ferroparticles or ferro-colloids (e.g., from Miltenyi or Dynal). The anti CD71 bound to magnetic particles is flowed into the device. The antibody coated particles are drawn to the obstacles (e.g., posts), floor, and walls and are retained by the strength of the magnetic field interaction between the particles and the magnetic field. The particles between the obstacles and those loosely retained with the sphere of influence of the local magnetic fields away from the obstacles are removed by a rinse.
  • One or more of the enrichment modules herein (e.g., size-based separation module(s) and capture module(s)) may be fluidly coupled in series or in parallel with one another. For example a first outlet from a separation module can be fluidly coupled to a capture module. In some embodiments, the separation module and capture module are integrated such that a plurality of obstacles acts both to deflect certain analytes according to size and direct them in a path different than the direction of analyte(s) of interest, and also as a capture module to capture, retain, or bind certain analytes based on size, affinity, magnetism or other physical property.
  • In any of the embodiments herein, the enrichment steps performed have a specificity and/or sensitivity >50, 60, 70, 80, 90, 95, 96, 97, 98, 99, 99.1, 99.2, 99.3, 99.4, 99.5, 99.6, 99.7, 99.8, 99.9 or 99.95% The retention rate of the enrichment module(s) herein is such that ≧50, 60, 70, 80, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 99.9% of the analytes or cells of interest (e.g., nucleated cells or nucleated red blood cells or nucleated from red blood cells) are retained. Simultaneously, the enrichment modules are configured to remove ≧−50, 60, 70, 80, 85, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 99.9% of all unwanted analytes (e.g., red blood-platelet enriched cells) from a sample.
  • Any or all of the enrichment steps can occur with minimal dilution of the sample. For example, in some embodiments the analytes of interest are retained in an enriched solution that is less than 50, 40, 30, 20, 10, 9.0, 8.0, 7.0, 6.0, 5.0, 4.5, 4.0, 3.5, 3.0, 2.5, 2.0, 1.5, 1.0, or 0.5 fold diluted from the original sample. In some embodiments, any or all of the enrichment steps increase the concentration of the analyte of interest (fetal cell), for example, by transferring them from the fluid sample to an enriched fluid sample (sometimes in a new fluid medium, such as a buffer). The new concentration of the analyte of interest may be at least 2, 4, 6, 8, 10, 20, 50, 100, 200, 500, 1,000, 2,000, 5,000, 10,000, 20,000, 50,000, 100,000, 200,000, 500,000, 1,000,000, 2,000,000, 5,000,000, 10,000,000, 20,000,000, 50,000,000, 100,000,000, 200,000,000, 500,000,000, 1,000,000,000, 2,000,000,000, or 5,000,000,000 fold more concentrated than in the original samples. For example, a 10 times concentration increase of a first cell type out of a blood sample means that the ratio of first cell type/all cells in a sample is 10 times greater after the sample was applied to the apparatus herein. Such concentration can take a fluid sample (e.g., a blood sample) of greater than 10, 15, 20, 50, or 100 mL total volume comprising rare components of interest, and it can concentrate such rare component of interest into a concentrated solution of less than 0.5, 1, 2, 3, 5, or 10 mL total volume.
  • The final concentration of fetal cells in relation to non-fetal cells after enrichment can be about 1/10,000-1/10, or 1/1,000-1/100. In some embodiments, the concentration of fetal cells to maternal cells may be up to 1/1,000-1/100, or 1/10 or as low as 1/100, 1/1,000 or 1/10,000.
  • Thus, detection and analysis of the fetal cells can occur even if the non-fetal (e.g. maternal) cells are >50%, 60%, 70%, 80%, 90%, 95%, or 99% of all cells in a sample. In some embodiments, fetal cells are at a concentration of less than 1:2, 1:4, 1:10, 1:50, 1:100, 1:1000, 1:10,000, 1:100,000, 1,000,000, 1:10,000,000 or 1:100,000,000 of all cells in a mixed sample to be analyzed or at a concentration of less than 1×10−3, 1×10−4, 1×10, 1×10−−6, or 1×10−6 cells/μL of the mixed sample. Over all, the number of fetal cells in a mixed sample, (e.g. enriched sample) has up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 30, 40, 50, 100 total fetal cells.
  • Enriched target cells (e.g., fnRBC) may be “binned” prior to further analysis of the enriched cells (FIGS. 24 and 25). Binning is any process which results in the reduction of complexity and/or total cell number of the enriched cell output. Binning may be performed by any method known in the art or described herein. One method of binning is by serial dilution. Such dilution may be carried out using any appropriate platform (e.g., PCR wells, microtiter plates) and appropriate buffers. Other methods include nanofluidic systems which can separate samples into droplets (e.g., BioTrove, Raindance, Fluidigm). Such nanofluidic systems may result in the presence of a single cell present in a nanodroplet.
  • Binning may be preceded by positive selection for target cells including, hut not limited to, affinity binding (e.g. using anti-CD71 antibodies). Alternately, negative selection of non-target cells may precede binning. For example, output from a size-based separation module may be passed through a magnetic hemoglobin enrichment module (MHEM) which selectively removes WBCs from the enriched sample by attracting magnetized hemoglobin-containing cells.
  • For example, the possible cellular content of output from enriched maternal blood which has been passed through a size-based separation module (with or without further enrichment by passing the enriched sample through a MHEM) may consist of: 1) approximately 20 fnRBC; 2) 1,500 nmRBC; 3) 4,000-40,000 WBC; 4) 15×106 RBC. If this sample is separated into 100 bins (PCR wells or other acceptable binning platform), each bin would be expected to contain: 1) 80 negative bins and 20 bins positive for one fnRBC; 2) 150 nmRBC; 3) 400-4,000 WBC; 4) 15×104 RBC. If separated into 10,000 bins, each bin would be expected to contain: 1) 9,980 negative bins and 20 bins positive for one fnRBC; 2) 8,500 negative bins and 1,500 bins positive for one mnC; 3) <1-4 WBC; 4) 15×102 RBC. One of skill in the art will recognize that the number of bins may be increased or decreased depending on experimental design and/or the platform used for binning. Reduced complexity of the binned cell populations may facilitate further genetic and/or cellular analysis of the target cells by reducing the number of non-target cells in an individual bin.
  • Analysis may be performed on individual bins to confirm the presence of target cells (e.g. fnRBC) in the individual bin. Such analysis may consist of any method known in the art including, but not limited to, FISH, PCR, STR detection, SNP analysis, biomarker detection, and sequence analysis (FIGS. 24 and 25).
  • Fetal Biomarkers
  • In some embodiments fetal biomarkers may be used to detect and/or isolate fetal cells, after enrichment or after detection of fetal abnormality or lack thereof. For example, this may be performed by distinguishing between fetal and maternal nRBCs based on relative expression of a gene (e.g., DYS1, DYZ, CD-71, ε- and ζ-globin) that is differentially expressed during fetal development. In preferred embodiments, biomarker genes are differentially expressed in the first and/or second trimester. “Differentially expressed,” as applied to nucleotide sequences or polypeptide sequences in a cell or cell nuclei, refers to differences in over/under-expression of that sequence when compared to the level of expression of the same sequence in another sample, a control or a reference sample. In some embodiments, expression differences can be temporal and/or cell-specific. For example, for cell-specific expression of biomarkers, differential expression of one or more biomarkers in the cell(s) of interest can be higher or lower relative to background cell populations. Detection of such difference in expression of the biomarker may indicate the presence of a rare cell (e.g., fnRBC) versus other cells in a mixed sample (e.g., background cell populations). In other embodiments, a ratio of two or more such biomarkers that are differentially expressed can be measured and used to detect rare cells.
  • In one embodiment, fetal biomarkers comprise differentially expressed hemoglobins. Erythroblasts (nRBCs) are very abundant in the early fetal circulation, virtually absent in normal adult blood and by having a short finite lifespan, there is no risk of obtaining fnRBC which may persist from a previous pregnancy. Furthermore, unlike trophoblast cells, fetal erythroblasts are not prone to mosaic characteristics.
  • Yolk sac erythroblasts synthesize ε-, ζ-, γ- and α-globins, these combine to form the embryonic hemoglobins. Between six and eight weeks, the primary site of erythropoiesis shifts from the yolk sac to the liver, the three embryonic hemoglobins are replaced by fetal hemoglobin (HbF) as the predominant oxygen transport system, and ε- and ζ-globin production gives way to γ-, α- and β-globin production within definitive erythrocytes (Peschle et al., 1985). HbF remains the principal hemoglobin until birth, when the second globin switch occurs and β-globin production accelerates.
  • Hemoglobin (Hb) is a heterodimer composed of two identical α globin chains and two copies of a second globin. Due to differential gene expression during fetal development, the composition of the second chain changes from c globin during early embryonic development (1 to 4 weeks of gestation) to γ globin during fetal development (6 to 8 weeks of gestation) to β globin in neonates and adults as illustrated in (Table 1).
    TABLE 1
    Relative expression of ε, γ and β in maternal and fetal RBCs.
    ε γ B
    1st trimester Fetal ++ ++
    Maternal +/− ++
    2nd trimester Fetal ++ +/−
    Maternal +/− ++
  • In the late-first trimester, the earliest time that fetal cells may be sampled by CVS, fnRBCs contain, in addition to α globin, primarily ε and γ globin. In the early to mid second trimester, when amniocentesis is typically performed, fnRBCs contain primarily γ globin with some adult is globin. Maternal cells contain almost exclusively α and β globin, with traces of γ detectable in some samples. Therefore, by measuring the relative expression of the ε, γ and β genes in RBCs purified from maternal blood samples, the presence of fetal cells in the sample can be determined. Furthermore, positive controls can be utilized to assess failure of the FISH analysis itself.
  • In various embodiments, fetal cells are distinguished from maternal cells based on the differential expression of hemoglobins β, γ or ε. Expression levels or RNA levels can be determined in the cytoplasm or in the nucleus of cells. Thus in some embodiments, the methods herein involve determining levels of messenger RNA (in RNA), ribosomal RNA (rRNA), or nuclear RNA (nRNA).
  • In some embodiments, identification of fnRBCs can be achieved by measuring the levels of at least two hemoglobins in the cytoplasm or nucleus of a cell. In various embodiments, identification and assay is from 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15 or 20 fetal nuclei. Furthermore, total nuclei arrayed on one or more slides can number from about 100, 200, 300, 400, 500, 700, 800, 5000, 10,000, 100,000, 1,000,000, 2,000,000 to about 3,000,000. In some embodiments, a ratio for γ/β or ε/β is used to determine the presence of fetal cells, where a number less than one indicates that a fnRBC(s) is not present. In some embodiments, the relative expression of γ/β or ε/β provides a fnRBC index (“FNI”), as measured by γ or ε relative to β. In some embodiments, a FNI for γ/β greater than 5, 10, 15, 20, 25, 30, 35, 40, 45, 90, 180, 360, 720, 975, 1020, 1024, 1250 to about 1250, indicate that a fnRBC(s) is present. In yet other embodiments, a FNI for γ/β of less than about 1 indicates that a fnRBC(s) is not present. Preferably, the above FNI is determined from a sample obtained during a first trimester, However, similar ratios can be used during second trimester and third trimester.
  • In some embodiments, the expression levels are determined by measuring nuclear RNA transcripts including, nascent or unprocessed transcripts. In another embodiment, expression levels are determined by measuring mRNA, including ribosomal RNA. There are many methods known in the art for imaging (e.g., measuring) nucleic acids or RNA including, but not limited to, using expression arrays from Affymetrix, Inc. or Illumina, Inc.
  • RT-PCR primers can be designed by targeting the globin variable regions, selecting the amplicon size, and adjusting the primers annealing temperature to achieve equal PCR amplification efficiency. Thus TaqMan probes can be designed for each of the amplicons with well-separated fluorescent dyes, Alexa Fluor®-355 for ε, Alexa Fluor®-488 for A, and Alexa Fluor-555 for β. The specificity of these primers can be first verified using ε, γ, and β cDNA as templates. The primer sets that give the best specificity can be selected for further assay development. As an alternative, the primers can be selected from two exons spanning an intron sequence to amplify only the mRNA to eliminate the genomic DNA contamination.
  • The primers selected can be tested first in a duplex format to verify their specificity, limit of detection, and amplification efficiency using target cDNA templates. The best combinations of primers can be further tested in a triplex format for its amplification efficiency, detection dynamic range, and limit of detection.
  • Various commercially available reagents are available for RT-PCR, such as One-step RT-PCR reagents, including Qiagen One-Step RT-PCR Kit and Applied Biosystems TaqMan One-Step RT-PCR Master Mix Reagents kit. Such reagents can be used to establish the expression ratio of ε, γ and β using purified RNA from enriched samples. Forward primers can be labeled for each of the targets, using Alexa fluor-355 for ε, Alexa fluor-488 for γ, and Alexa fluor-555 for β. Enriched cells can be deposited by cytospinning onto glass slides. Additionally, cytospinning the enriched cells can be performed after in situ RT-PCR. Thereafter, the presence of the fluorescent-labeled amplicons can be visualized by fluorescence microscopy. The reverse transcription time and PCR cycles can be optimized to maximize the amplicon signal:background ratio to have maximal separation of fetal over maternal signature. Preferably, signal:background ratio is greater than 5, 10, 50 or 100 and the overall cell loss during the process is less than 50, 10 or 5%.
  • Fetal Cell Analysis
  • The detection and analysis steps may involve quantifying genomic DNA regions from cells in a sample or enriched sample. In some embodiments, the quantified genomic DNA regions are polymorphic sites such as short tandem repeats (STRs) or variable number of tandem repeats (VNTRs).
  • In step 103, polymorphic genomic DNA region(s) or whole genome(s) from the mixed sample and optionally reference sample are pre-amplified to increase the overall abundance of DNA used for quantification and analysis. Pre-amplification can be preformed using multiple displacement amplification (MDA) (Gonzalez et al. Envircon Microbiol; 7(7); 1024-S (2005)) or amplification with outer primers in a nested PCR approach. This permits detection and analysis of fetal DNA even if the total amount of fetal DNA in the mixed (e.g. enriched) sample is only up to 1 μg, 500 ng, 200 ng, 100 ng, 50 ng, 40 ng, 30 ng, 20 ng, 10 ng, 5 ng, 1 ng, 500 pg, 200 pg, 100 pg, 50 pg, 40 pg, 30 pg, 20 p, 10 pg, 5 pg, or 1 pg or between 1-5 μg, 5-10 μg, or 10-50 μg. Pre-amplification allows the products to be split into multiple reactions at the next step.
  • In step 104, polymorphic DNA region(s) such as short tandem repeats (STRs) or variable number of tandem repeats (VNTRs) are selected on suspected trisomic chromosome(s) (e.g., 13, 18, 21, X or Y) or chromosome(s) associated with a condition to be detected and optionally on control (non-trisomic) chromosomes. In some embodiments, 1 or more than 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20 DNA polymorphic loci are selected per target chromosome. Multiple polymorphic regions can be analyzed independently or at the same time in the same reaction. The polymorphic DNA regions, e.g. STRs loci, are selected for high heterozygosity (variety of alleles) so that the paternal allele of the fetal cells is more likely to be distinct in length from the maternal alleles. This results in an improved power to detect the presence of fetal cells in the mixed sample and potential fetal abnormalities in such cells. When the polymorphic regions selected are STR loci, di-, tri-, tetra- or penta-nucleotide repeat loci can be used for detection and analysis of fetal cells. Examples of STR loci that may be selected include: D21 S1414, D21 S1411, D21S1412, D21S11 MBP, D13S634, D13S631, D18S535, AmgXY, XHPRT, as well as those listed in FIG. 12. In some embodiment, the methods of the invention allow for the determination of maternal or paternal trisomy.
  • In step 105, the polymorphic loci selected are amplified. This can be used to detect non-maternal fetal alleles in the mixed sample and to determine the copy number of such alleles. When amplifying more than one polymorphic loci or DNA regions, primers are selected to be multiplexable (fairly uniform melting temperature, absence of cross-priming on the human genome, and absence of primer-primer interaction based on sequence analysis) with other primer pairs. Primers and loci are chosen so that the amplicon lengths from a given locus do not overlap with those from another locus.
  • In some embodiments, multiple dyes and multi-color fluorescence readout may be used to increase the multiplexing capacity, e.g. of a single CGE. This ensures that the loci are kept distinct in the readout (e.g. CGE readout). In such a case, PCR primer pairs can be grouped and the same end-labeling is applied to the members of a group.
  • Examples of primers known in the art that correspond to specific STR loci that can be used in the present invention are described in FIG. 13 and FIG. 14.
  • Examples of PCR techniques that can be used to amplify the DNA regions herein include, but are not limited, to quantitative PCR, quantitative fluorescent PCR (QF-PCR), multiplex fluorescent PCR (MF-PCR), real time PCR (RT-PCR), single cell PCR, restriction fragment length polymorphism PCR(PCR-RELP), PCR-RFLP/RT-PCR-RFLP, hot start PCR, nested PCR, in situ polonony PCR, in situ rolling circle amplification (RCA), bridge PCR, picotiter PCR and emulsion PCR. Other suitable amplification methods include the ligase chain reaction (LCR), transcription amplification, self-sustained sequence replication, selective amplification of target polynucleotide sequences, consensus sequence primed polymerase chain reaction (CP-PCR), arbitrarily primed polymerase chain reaction (AP-PCR), degenerate oligonucleotide-primed PCR (DOP-PCR) and nucleic acid based sequence amplification (NABSA). Other amplification methods that may be used to amplify specific polymorphic loci include those described in, U.S. Pat. Nos. 5,242,794, 5,494,810, 4,988,617 and 6,582,938.
  • In step 106, the amplified DNA polymorphic regions (e.g. STR loci) from both mixed and reference samples are characterized and quantified using any method known in the art. Examples of such methods include, but are not limited to, gas chromatography, supercritical fluid chromatography, liquid chromatography, including partition chromatography, adsorption chromatography, ion exchange chromatography, size-exclusion chromatography, thin-layer chromatography, and affinity chromatography, electrophoresis, including capillary electrophoresis, capillary zone electrophoresis, capillary isoelectric focusing, capillary electrochromatography, micellar electrokinetic capillary chromatography, isotachophoresis, transient isotachophoresis and capillary gel electrophoresis, comparative genomic hybridization (CGH), microarrays, bead arrays, high-throughput genotyping technology, such as molecular inversion probe (MIP), and Genescan.
  • In one embodiment, capillary gel electrophoresis (CGE) is used to quantify STRs in both the mixed and reference samples. This can be used to detect non-maternal fetal alleles in the mixed sample and to determine the copy number of such alleles. The mixed sample and the reference sample can be analyzed in separate reactions, e.g. separate CGE lanes. Alternatively, the mixed and the reference sample can be run in the same reaction, e.g. same CGE lane, by using two different dye labels, e.g. differently labeled PCR primers. When a reference sample is run through the PCR/CGE process, the alleles show up as peaks in the CGE. It is desirable, but not essential, to associate these peaks with known alleles in the population at each locus. When performing PCR/CGE it may be very useful to reduce the non-linearities in the response of PCR to input DNA copies (i.e. to effect more quantitative PCR) so that the data can be more easily related to models of aneuploidy. This ‘linearization’ can be accomplished by the following procedure:
  • (a) The PCR reaction is initiated.
  • (b) The PCR reaction is interrupted after N cycles (N=5 to 10) and ˜one third of the reaction products are removed and run on CGE. PCR cycling is re-initiated. Repeat until 40 PCR cycles or saturation is achieved.
  • (c) CGE peak masses are determined and normalized to correct for the depletion of the reaction products at each iteration of (b).
  • (d) A saturation (splining) curve is fit to the normalized data for each allele peak, and quantitative starting concentrations are inferred as in customary qPCR.
  • The above procedure tends to accomplish quantitative PCR while enabling a high degree of multiplexing. Because each CGE run has a slightly different relation between DNA fragment size (and sequence) and mobility, each trace typically will need to undergo a length transformation, such as a low-order (cubic or quartic) polynomial transformation, in order to map to the data from the trace corresponding to the previous amplification point. This mapping can be determined by adjusting the transformation parameters to achieve the best fit of the one data trace to the other, with both normalized to the same total sum of squares or summed peak heights.
  • The maternal peaks at each locus provide an estimate of the secondary ‘stutter’ structure at each locus due to PCR errors. The locations of these small secondary peaks can be used to blank out length regions that are contaminated by this stutter when looking for and using the non-maternal allele peaks (as described herein for example). Alternatively, more sophisticated ‘decouvolution’ algorithms can be applied to remove the stutter Stoughton, et al., Electrophoresis; 18(1): 1-S (1997).
  • The sample containing an unknown mixture of fetal and maternal cells is analyzed as in Step (b). This could be done in a separate CGE lane, or in the same CGE lane as the maternal sample by using two different dye labels on the PCR primers. Because each CGE trace has a slightly different relation between DNA fragment size (and sequence) and mobility, these data typically will need to undergo a length transformation, such as a low-order (cubic or quartic) polynomial transformation in order to map one trace onto the other to facilitate peak identification and model fitting. This mapping can be determined by adjusting the transformation parameters to achieve the best fit of the peak locations in one data trace to the other. This mapping will be well determined in the assumed situation where the maternal cells are more numerous than the fetal cells, because the maternal signature will dominate and will be shared in the two data sets.
  • FIG. 5 illustrates typical locus patterns arising from a normal (diploid) fetus and mother. At Locus 1, the paternal allele is the same as the left hand maternal allele, and adds to its apparent height. At Locus 2, the paternal allele has a length between the lengths of the maternal alleles. In addition, there is a secondary ‘stutter’ peak on the shoulder of the right hand maternal peak. In Locus 3, the maternal sample is homozygous leading to only one main peak, and the paternal allele is distinct from this allele.
  • FIG. 6 illustrates locus patterns arising from trisomic fetal cells. The dashed trace represents mixed sample containing trisomic fetal cells, superposed on material sample trace (solid black). Trisomy causes excess amplitude in maternal alleles at loci contained within the aneuploid region (here assumed to contain Loci 1 and 2 but not Locus 3). The left hand maternal peak at Locus 1 contains contributions from the trisomy and from a paternal allele.
  • In step 107, data models are constructed. From the data obtained from the quantifying step different data models can be constructed depending upon different assumptions.
  • For example, a data model for the CGE patterns in FIGS. 5 and 6 can be as follows:
  • Let m1 denote the CGE signal obtained from one of the maternal alleles at a given locus and m2 the signal obtained from the other maternal allele, which might be the same allele, Let p denote the CGE signal obtained from the paternal allele at a given locus. Let p1 and p2 denote the CGE signals obtained from the paternal alleles at a given locus when a paternally derived trisomy occurs. Let α and β denote the relative number of maternal and fetal cells, respectively. Then in the case of a chromosome with maternal non-dysjunction trisomy, the data will have the form
    x=α(m1+m2)+β(m1+m2+p),  (1)
  • A normal (diploid) chromosome will give
    x=α(m1+m2)+β([m1 or m2]+p),  (2)
  • and a paternally derived trisomy will give
    x=α(m1+m2)+β([m1 or m2+p1]+p2).  (3)
  • In some embodiments, data and data model is represented as discrete peak masses (or heights) and peak locations or as vectors of values representing the actual peak profiles. In the case of representation by peak characteristics, the ‘addition’ operation in Equations 1-3 denotes summation of peak height or mass at the discrete allele location. In the case where the fall peak profiles are represented, summation denotes summation of signals bin by bin over the CGE trace, and in this case it may be helpful to zero the data except in the immediate vicinity of actual peaks. Representation via peak characteristics is preferable when using the PCR linearization technique described above.
  • To determine aneuploidy, the differences between the structure of the β-term that appears in the first and second equations above is determined. In the first case, there is an additional contribution to both maternal alleles along with the paternal allele, and in the second case there is an additional contribution only to one of the maternal alleles along with the paternal allele. The essence of the presence/absence declaration for fetal cells lies in the evidence for β being greater than zero.
  • In step 108, the best overall fit of model to data is selected from among all the model sets. This modeling approach optimally uses information contained in the increase of chromosome copy number with aneuploidy and its association with the strength of non-maternal alleles.
  • In some embodiments, CGE signals representing m1 and m2 at each locus are obtained by profiling the maternal-only sample and mapping the peak locations to the corresponding ones of the mixed sample. The heights of m1 and m2 may be unequal, and this helps cortect for PCR amplification biases associated with particular alleles, The values of p, p1, p2, α, and β are determined from the mixed sample data by fitting Equations 1-3 to the data, optionally by using the least squares, or the maximum likelihood methods.
  • The three models need to be fit to each chromosome with suspected trisomy, e.g. chromosomes 13, 18, 21, X and/or Y. If there are only 3 suspected chromosomes, this results in 27 model variants (3×3×3=27). In Equations 2 and 3, there is also the ambiguity between using m1 or m2 in the β-term, so there are 5 model variants for each chromosome, with 5×5×5=125 total variants over three suspected trisomy chromosomes.
  • Segmental aneuploidies also could be tested by hypothesizing that different contiguous subsets of loci are contained within the aneuploid region. With each model variant, α and β have to be determined and the parameters describing the paternal alleles have to be determined at each locus for each model variant. The paternal allele peak height and shape can be assumed to be an average of the known maternal ones at that locus, while the paternal allele location needs to be fit to the data. The possible locations for the paternal allele will be the location of m1, the location of m2, and ‘elsewhere in the locus window’ where this latter possibility involves a search over discrete shifts smaller than a typical peak half-width at half maximum. Prior probabilities on the choices of p, taken from population allele frequency data, can be used, if their product lengths can be predicted.
  • In some cases, because of the number of parameters being fit, suboptimal searches can be used for computational efficiency. For example, one possible approach involves iterative methods, such as the following, which would be applied to each data model variant.
  • (i) Set β to 0 and solve for α.
  • (ii) Set β to a value where β/α is the smallest fetal/maternal cell ratio for which fetal cells are likely to be detectable.
  • (iii) Solve for paternal allele location(s) at each locus, one locus at a time that minimize data-model residuals.
  • (iv) Fix the paternal allele parameters and adjust β to minimize residuals over all the data.
  • (v) Now vary only a to minimize residuals.
  • (vi) Repeat iv and v until convergence.
  • (vii) Repeat iii through v until convergence.
  • In step 109, the presence or absence of fetal DNA is determined using the models described above. The best overall fit for such models yields the values of β, α that can be called βmax, αmax. The likelihood of observing the data given βmax can be compared to the likelihood given β=0. The ratio is a measure of the amount of evidence for fetal DNA. A threshold for declaring fetal DNA is the likelihood ratio of approximately 1000 or more. The likelihood calculation can be approximated by a Chi-squared calculation involving the sum of squared residuals between the data and the model, where each residual is normalized by the expected rms error.
  • If it is determined that fetal DNA is not present in the mixed sample as calculated above, then the test is declared to be non-informative. On the other hand, if it is decided that fetal DNA is present in the mixed sample, then the likelihoods of the data given the different data model types can be compared to declare trisomy or another condition.
  • In step 110, the likelihood ratios of trisomy models (Equations 1 and 3) to the normal model (Equation 2) are calculated and these ratios are compared to a predefined threshold. This threshold can be set so that in controlled tests all the trisomic cases are declared aneuploid, and so that it is expected that the vast majority (>99.9%) of all truly trisomic cases are declared aneuploid by the test. In one embodiment, to accomplish a detection rate of >90% or 95% or approximately 99.9%, the likelihood ratio threshold is increased beyond what is necessary to declare all the known trisomic cases in the validation set by a factor of 1000/N, where N is the number of trisomy cases in the validation set.
  • In step 111, errors that may arise from the experimental procedure used to obtain the data can be taken into account in the model calculation(s). For instance, in the example described above, CGE data contain small additive errors associated with CGE readout and larger multiplicative errors associated with PCR amplification efficiencies being different from locus to locus and from allele to allele within a locus. By using the maternal-only data to define m1 and m2 peak characteristics at each locus, the effects of PCR amplification biases associated with different primers and different amplicons from the same primers have been mostly controlled. Nevertheless, small variations in the process from day to day and the statistics of small numbers of starting genome copies will cause some random errors to remain. These tend to be multiplicative errors in the resulting CGE peak heights; e.g. two peaks may be 20% different in height although the starting concentrations of the alleles were identical. In one embodiment, it may be assumed that errors are random from peak to peak, and have relatively small additive errors, and larger Poisson and multiplicative error components. The magnitudes of these error components can be estimated from repeated PCR/CGE processing of identical samples. The Chi-square residuals calculation for any data-model fit then can be supported with these modeled squared errors for any peak height or data bin.
  • In another aspect of the present invention, the presence of fetal cells in a mixed sample and fetal abnormalities in said cells is determined without trying to integrate them in a data-model fitting procedure described above. For example, steps 100-107 can be performed as described above. Then, analysis using Equations 1 and 2 focuses on two indications. First, aneuploidy results in an excess of DNA for the trisomic chromosome, and this is indicated by the difference in mean strengths of the alleles on the trisomic chromosome compared to control chromosomes. A t-test can be applied to the two distributions of m1 and m2 peak heights. These peak heights are normalized to (e.g., divided peak-by-peak by) the corresponding peaks in the maternal-only sample to reduce PCR amplification biases. Second, Equations 1 and 2 show that aneuploidy is associated with less inequality in the heights of m1 and m2 at a given locus, particularly for loci where the paternal allele is distinct from the maternal alleles, Loci are selected where a third (paternal) allele is visibly distinct from two maternal alleles, and the distribution of the inequalities (measured in %) between the m1 and m2 peaks are compared between suspected trisomy chromosomes and control chromosomes. Again, peak heights first are normalized by the maternal-only sample. These two lines of evidence are combined to create an overall likelihood, such as by multiplying the probability values from the two lines of evidence. The presence/absence call is done in a simplified way by looking for loci where a third allele is clearly visible, and comparing the distribution of these peak heights between the maternal and mixed samples. Again, a t-test between these distributions gives the probability of fetal DNA being present.
  • In another aspect of the invention, the methods herein only determine presence or absence of fetal DNA, and aneuploidy information is known from another sources (e.g. fluorescence in situ hybridization (FISH) assay). For example, it may be desirable only to verify the presence or absence of fetal cells to ensure that a diploid test result is truly due to a normal fetus and not to failure of an assay (e.g. FISH). In this case, the process may be simplified by focusing on detecting the presence of non-maternal alleles without regard to associating them with increases in the maternal allele strengths at the same locus. Thus a process similar to the one outlined above may be used but it is not as necessary to arrange the PCR product lengths so that the products from different loci have distinct length windows in the CGE readout. The alleles from the different loci can be allowed to fall essentially anywhere in the effective measurement length window of the CGE. It also is not necessary to ‘lineate’ the PCR result(s) via multiple CGE readouts at different stages in the PCR cycling as is suggested in step 107.
  • Therefore, maternal-only and mixed samples are run and mapped to each other to align maternal allele peak locations, as described above. PCR is run to saturation, or nearly to saturation, to be sure to detect the low abundance fetal sequences. The evidence for fetal DNA then arises from extra peaks in the mixed-sample data with respect to the maternal-sample data. Based on typical heterozygosities of approximately 0.7 for highly polymorphic STRs, the chance of not seeing a distinct paternal allele (distinct from both maternal alleles) when fetal DNA is in fact present decreases approximately as (0.72)N, where N is the number of loci included. Thus approximately ten STR loci will provide ˜99.9% probability of detection. In addition, the present invention provides methods to determine when there are insufficient fetal cells for a determination and report a non-informative case. The present invention involves quantifying regions of genomic DNA from a mixed sample. More particularly the invention involves quantifying DNA polymorphisms from the mixed sample. In some embodiments, one or more than 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20 DNA polymorphism loci (particularly STRs) per target chromosome are analyzed to verify presence of fetal cells.
  • Any of the steps above can be performed by a computer program product that comprises a computer executable logic that is recorded on a computer readable medium. For example, the computer program can execute some or all of the following functions: (i) controlling enrichment of fetal cells or DNA from mixed sample and reference sample, (ii) pre-amplifying DNA from both samples, (iii) amplifying specific polymorphic DNA regions from both samples, (iv) identifying and quantifying maternal alleles in the reference sample, (v) identifying maternal and non-maternal alleles in the mixed sample, (vi) fitting data on alleles detected from mixed and/or reference samples into data models, (vii) determining the presence or absence of fetal cells in the mixed sample, (viii) declaring nodal or abnormal phenotype for a fetus based on data models or declaring non-informative results, and (ix) declaring a specific fetal abnormality based on the above results. In particular, the computer executable logic can fit data on the quantity of DNA polymorphism(s) (e.g. STR's) into one or more data models. One example of a data model provides a determination of a fetal abnormality from given data signals obtained by molecular analysis e.g. CGE. The computer executable logic provides for a determination of the presence or absence of a trisomy, and distinguish whether the trisomy is paternally derived or if it originates from a maternal non-disjunction event. For example, given the following data signals that can be obtained by molecular analysis (e.g. CGE)
  • m1, which represents a signal obtained from one of the maternal alleles (m1) at a given locus,
  • m2, which represents a signal obtained from the other maternal allele, which might be the same allele,
  • p, which is a signal that is obtained from the paternal allele at a given locus, and
  • p1 and p2, which are signals obtained from the paternal alleles at one given locus when a paternally derived trisomy occurs, and
  • letting α and β, which denote the relative number of maternal and fetal cells, respectively,
  • the following determinations can be made. In the case of a chromosome with maternal non-disjunction trisomy, the data will have the form
    x=α(m1m2)+β(m1m2+p).  (1)
    A normal (diploid) chromosome will give
  • x=α(m1m2)+β([m1 or m2]+p),  (2)
  • and a paternally derived trisomy will give
    x=α(m1+m2)+β([m1 or m2]p1+p2).  (3)
  • The computer executable logic can work in any computer that may be any of a variety of types of general-purpose computers such as a personal computer, network server, workstation, or other computer platform now or later developed. In some embodiments, a computer program product is described comprising a computer usable medium having the computer executable logic (computer software program, including program code) stored therein. The computer executable logic can be executed by a processor, causing the processor to perform functions described herein. In other embodiments, some functions are implemented primarily in hardware using, for example, a hardware state machine. Implementation of the hardware state machine so as to perform the functions described herein will be apparent to those skilled in the relevant arts.
  • The program can provide a method of evaluating the presence or absence of trisomy in a mixed cell sample by accessing data that reflects the level of polymorphism(s) at two alleles at two or more given loci in a mixed sample (maternal and fetal cells) and in a sample enriched in fetal cells, relating the levels of polymorphism(s) to the number of maternal and fetal cells (α and β in equations 1-3), and determining the presence or absence of trisomy in the samples.
  • In one embodiment, the computer executing the computer logic of the invention may also include a digital input device such as a scanner. The digital input device can provide information on the polymorphism levels/quantity. For example, a scanner of this invention can provide an image of the DNA polymorphism (particularly STRs) according to method herein. For instance, a scanner can provide an image by detecting fluorescent, radioactive, or other emission; by detecting transmitted, reflected, or scattered radiation, by detecting electromagnetic properties or other characteristics; or by other techniques. The data detected is typically stored in a memory device in the form of a data file. In one embodiment, a scanner may identify one or more labeled targets. For instance, a first DNA polymorphism may be labeled with a first dye that fluoresces at a particular characteristic frequency, or narrow band of frequencies, in response to an excitation source of a particular frequency. A second DNA polymorphism may be labeled with a second dye that fluoresces at a different characteristic frequency. The excitation sources for the second dye may, but need not, have a different excitation frequency than the source that excites the first dye, e.g., the excitation sources could be the same, or different, lasers.
  • Another aspect of the invention includes kits containing the devices and reagents for performing the enrichment and genetic analysis. Such kits may include the materials for any individual step disclosed, any combination of devices and reagents or the devices and reagents for performing all of the steps. For example, a kit may include the arrays for size-based enrichment, the device for magnetic separation of the cells and reagents for performing PCR or CGE. Also included may be the reagents for performing multiple displacement amplification. This is an exemplary kit and the kits can be constructed using any combination of disclosed materials and devices. The use of the size-based enrichment provides gentle handling that is particularly advantageous for permitting subsequent genetic analysis.
  • While preferred embodiments of the present invention have been shown and described herein, it will be obvious to those skilled in the art that such embodiments are provided by way of example only. Numerous variations, changes, and substitutions will now occur to those skilled in the art without departing from the invention. It should be understood that various alternatives to the embodiments of the invention described herein may be employed in practicing the invention. It is intended that the following claims define the scope of the invention and that methods and structures within the scope of these claims and their equivalents be covered thereby.
  • EXAMPLES Example 1 Separation of Fetal Cord Blood
  • FIGS. 7A-7D illustrates a schematic of the device used to separate nucleated cells from fetal cord blood.
  • Dimensions: 100 mm×28 mm×1 mm
  • Array design: 3 stages, gap size=18, 12 and 8 μm for the first, second and third stage, respectively.
  • Device fabrication: The arrays and channels were fabricated in silicon using standard photolithography and deep silicon reactive etching techniques. The etch depth is 140 μm. Through holes for fluid access are made using KOH wet etching. The silicon substrate was sealed on the etched face to form enclosed fluidic channels using a blood compatible pressure sensitive adhesive (9795, 3M, St Paul, Minn.).
  • Device packaging: The device was mechanically mated to a plastic manifold with external fluidic reservoirs to deliver blood and buffer to the device and extract the generated fractions.
  • Device operation: An external pressure source was used to apply a pressure of 2.0 PSI to the buffer and blood reservoirs to modulate fluidic delivery and extraction from the packaged device.
  • Experimental conditions: Human fetal cord blood was drawn into phosphate buffered saline containing Acid Citrate Dextrose anticoagulants. Ira of blood was processed at 3 mL/hr using the device described above at room temperature and within 48 hrs of draw. Nucleated cells from the blood were separated from enucleated cells (red blood cells and platelets), and plasma delivered into a buffer stream of calcium and magnesium-free Dulbecco's Phosphate Buffered Saline (14190-144, Invitrogen, Carlsbad, Calif.) containing 1% Bovine Serum Albumin (BSA) (A8412-100 ML, Sigma-Aldrich, St Louis, Mo.) and 2 mM EDTA (15575-020, Invitrogen, Carlsbad, Calif.).
  • Measurement techniques: Cell smears of the product and waste fractions (FIG. 8A-8B) were prepared and stained with modified Wright-Giemsa (WG16, Sigma Aldrich, St. Louis, Mo.).
  • Performance: Fetal nucleated red blood cells were observed in the product fraction (FIG. 8A) and absent from the waste fraction (FIG. 8B).
  • Example 2 Isolation of Fetal Cells from Maternal Blood
  • The device and process described in detail in Example 1 were used in combination with immunomagnetic affinity enrichment techniques to demonstrate the feasibility of isolating fetal cells from maternal blood.
  • Experimental conditions: blood from consenting maternal donors carrying male fetuses was collected into K2EDTA vacutainers (366643, Becton Dickinson, Franklin Lakes, N.J.) immediately following elective termination of pregnancy. The undiluted blood was processed using the device described in Example 1 at room temperature and within 9 hrs of draw. Nucleated cells from the blood were separated from enucleated cells (red blood cells and platelets), and plasma delivered into a buffer stream of calcium and magnesium-free Dulbecco's Phosphate Buffered Saline (14190-144, Invitrogen, Carlsbad, Calif.) containing 1% Bovine Serum Albumin (BSA) (A8412-100 mL, Sigma-Aldrich, St Louis, Mo.). Subsequently, the nucleated cell fraction was labeled with anti-CD71 microbeads (130-046-201, Miltenyi Biotech Inc., Auburn, Calif.) and enriched using the MiniMACS™ MS column (130-042-201, Miltenyi Biotech Inc., Auburn, Calif.) according to the manufacturer's specifications. Finally, the CD71-positive fraction was spotted onto glass slides.
  • Measurement techniques: Spotted slides were stained using fluorescence in situ hybridization (FISH) techniques according to the manufacturer's specifications using Vysis probes (Abbott Laboratories, Downer's Grove, Ill.). Samples were stained from the presence of X and Y chromosomes. In one case, a sample prepared from a known Trisomy 21 pregnancy was also stained for chromosome 21.
  • Performance: Isolation of fetal cells was confirmed by the reliable presence of male cells in the CD71-positive population prepared from the nucleated cell fractions (FIG. 9). In the single abnormal case tested, the trisomy 21 pathology was also identified (FIG. 10).
  • Example 3 Confirmation of the Presence of Male Fetal Cells in Enriched Samples
  • Confirmation of the presence of a male fetal cell in an enriched sample is performed using qPCR with primers specific for DYZ, a marker repeated in high copy number on the Y chromosome. After enrichment of fnRBC by any of the methods described herein, the resulting enriched fnRBC are binned by dividing the sample into 100 PCR wells. Prior to binning, enriched samples may be screened by FISH to determine the presence of any fnRBC containing an aneuploidy of interest. Because of the low number of fnRBC in maternal blood, only a portion of the wells will contain a single fnRBC (the other wells are expected to be negative for fnRBC). The cells are fixed in 2% Paraformaldehyde and stored at 4° C. Cells in each bin are pelleted and resuspended in 5 μl PBS plus 1 μl 20 mg/ml Proteinase K (Sigma #P-2308). Cells are lysed by incubation at 65° C. for 60 minutes followed by inactivation of the Proteinase K by incubation for 15 minutes at 95° C. For each reaction, primer sets (DYZ forward primer TCGAGTGCAATTCCATTCCG; DYZ reverse primer ATGGAATGGCATCAAACGGAA; and DYZ Taqman Probe 6FAM-TGGCTGTCCATTCCA-MGBNFQ), TaqMan Universal PCR master mix, No AmpErase and water are added. The samples are run and analysis is performed on an ABI 7300: 2 minutes at 50° C., 10 minutes 95° C. followed by 40 cycles of 95° C. (15 seconds) and 60° C. (1 minute). Following confirmation of the presence of male fetal cells, further analysis of bins containing fnRBC is performed. Positive bins may be pooled prior to further analysis.
  • FIG. 20 shows the results expected from such an experiment. The data in FIG. 20 was collected by the following protocol. Nucleated red blood cells were enriched from cord cell blood of a male fetus by sucrose gradient two Heme Extractions (HE). The cells were fixed in 2% paraformaldehyde and stored at 4° C. Approximately 10×1000 cells were pelleted and resuspended each in 5 μl PBS plus 1 μl 20 mg/ml Proteinase K (Sigma #P-2308). Cells were lysed by incubation at 65° C. for 60 minutes followed by a inactivation of the Proteinase K by 15 minute at 95° C. Cells were combined and serially diluted 10-fold in PBS for 100, 10 and 1 cell per 6 μl final concentration were obtained. Six μl of each dilution was assayed in quadruplicate in 96 well format. For each reaction, primer sets (DYZ forward primer TCGAGTGCATTCCATCCCG; 0.9 uM DYX reverse primer ATGGAATGGCATCAAACGGAA; and 0.5 uM DYZ TaqMan Probe 6FAM-TGGCTGTCCATFTCCA-MGBNFQ), TaqMan Universal PCR master mix, No AmpErase and water were added to a final volume of 25 μl per reaction. Plates were run and analyzed on an ABI 7300: 2 minutes at 50° C., 10 minutes 95° C. followed by 40 cycles of 95° C. (15 seconds) and 60° C. (1 minute). These results show that detection of a single fnRBC in a bin is possible using this method.
  • Example 4 Confirmation of the Presence of Fetal Cells in Enriched Samples by STR Analysis
  • Maternal blood is processed through a size-based separation module, with or without subsequent MHEM enhancement of fnRBCs. The enhanced sample is then subjected to FISH analysis using probes specific to the aneuploidy of interest (e.g., triploidy 13, triploidy 18, and XYY). Individual positive cells are isolated by “plucking” individual positive cells from the enhanced sample using standard micromanipulation techniques. Using a nested PCR protocol, STR marker sets are amplified and analyzed to confirm that the FISH-positive aneuploid cell(s) are of fetal origin. For this analysis, comparison to the maternal genotype is typical. An example of a potential resulting data set is shown in Table 2. Non-maternal alleles may be proven to be paternal alleles by paternal genotyping or genotyping of known fetal tissue samples. As can be seen, the presence of paternal alleles in the resulting cells, demonstrates that the cell is of fetal origin ( cells # 1, 2, 9, and 10). Positive cells may be pooled for further analysis to diagnose aneuploidy of the fetus, or may be further analyzed individually.
    TABLE 2
    STR locus alleles in maternal and fetal cells
    STR
    locus STR locus STR locus STR locus STR locus
    DNA Source D14S D16S D8S F13B vWA
    Maternal
    14, 17 11, 12 12, 14 9, 9 16, 17
    alleles
    Cell #
    1 alleles  8 19
    Cell #2 alleles 17 15
    Cell #3 alleles 14
    Cell #4 alleles
    Cell #
    5 alleles 17 12 9
    Cell #6 alleles
    Cell #7 alleles 19
    Cell #8 alleles
    Cell #
    9 alleles 17 14 7, 9 17, 19
    Cell #10 alleles 15
  • Example 5 Confirmation of the Presence of Fetal Cells in Enriched Samples by SNP Analysis
  • Maternal blood is processed through a size-based separation module, with or without subsequent MHEM enhancement of fnRBCs. The enhanced sample is then subjected to FISH analysis using probes specific to the aneuploidy of interest (e.g., triploidy 13, triploidy 18, and XYY). Samples testing positive with FISH analysis are then binned into 96 microtiter wells, each well containing 15 μl of the enhanced sample. Of the 96 wells, 5-10 are expected to contain a single fnRBC and each well should contain approximately 1000 nucleated maternal cells (both WBC and mnRBC). Cells are pelleted and resuspended in 5 μl PBS plus 1 μl 20 mg/ml Proteinase K (Sigma #P-2308). Cells are lysed by incubation at 65° C. for 60 minutes followed by a inactivation of the Proteinase K by 15 minute at 95° C.
  • In this example, the maternal genotype (BB) and fetal genotype (AB) for a particular set of SNPs is known. The genotypes A and B encompass all three SNPs and differ from each other at all three SNPs. The following sequence from chromosome 7 contains these three SNPs (rs7795605, rs7795611 and rs7795233 indicated in brackets, respectively) (ATGCAGCAAGGCACAGACTAA[G/A]CAAGGAGA[G/C]GCAAAATTTTC[A/G]TAGGGGAGAGAAATGGGTCATT).
  • In the first round of PCR, genomic DNA from binned enriched cells is amplified using primers specific to the outer portion of the fetal-specific allele A and which flank the interior SNP (forward primer ATGCAGCAAGGCACAGACTACG; reverse primer AGAGGCGACAGAAATGGGTCATT). In the second round of PCR, amplification using real time SYBR Green PCR is performed with primers specific to the inner portion of allele A and which encompass the interior SNP (forward primer CAAGGCACAGACTAAGCAAGGAGAG; reverse primer GGCAAAATTTTCATAGGGGAGAGAAATGGGTCATT).
  • Expected results are shown in FIG. 31. Here, six of the 96 wells test positive for allele A, confirming the presence of cells of fetal origin, because the maternal genotype (BB) is known and cannot be positive for allele A. DNA from positive wells may be pooled for further analysis or analyzed individually.
  • Example 6 Analysis of STR's
  • FIG. 11 illustrates a diagram of the planned protocol for clinical practice where a reference sample (maternal blood) and a fetal enriched sample will be processed in parallel. Twelve polymorphic STRs are chosen (See FIG. 12) and associated nested PCR primers were designed (FIG. 13-14).
  • Cell Lysis: Cells are lysed in a proteinase K solution by heating samples for 60 minutes at 65° C., followed by a heating step of 15 minutes at 95° C.
  • 1st round of PCR; A polymerase mix that includes 12 specialized STR primer pairs is added to the crude lysate. A master PCR mix is generated according to the number of samples as per the recipe below. For the reference sample 44 μL of the master mix are added directly to the cell lysate. For the sample recovered from the slide the volume of the reaction is adjusted as necessary. (e.g. 32 μL crude lysate in a 100 μL total reaction volume). A no template or negative control is generated to test for contamination.
    Master mix Multiplex PCR cylce
    outer 12-plex 1 rxn Step Temp (C.) Time (mins)
    2X Qiagen Mix 25.0 1.0 95 0.5
    titanium 1.0 2.0 94 0.5
    Qiagen Q factor 5.0 3.0 68 1.5
    water 10.0 4.0 72 1.5
    4.2 uM 12 plex 3.0 5.0 cycle to step 2, 44 times
    primers
    Cell lysate 6.0 6.0 72 10
    50.0
  • Nested PCR: After PCR, optionally, diluted products are added to a second nested primer PCR reaction. Two ul aliquot of each 12-plex PCR reaction is diluted 40 fold (to 80 ul total) with nuclease free water from the PCR kit. The diluted fetal enriched 12-plex reaction could be used as template for a master mix for 8 nested PCR reactions with HAM labeled primers. A second master mix can be generated using the dilution from the maternal reference for 8 nested PCR reactions with VIC labeled primers. The following primer pairs are suggested. A no template or negative control is generated to test for contamination.
    Nested STR primer facts
    Reaction Fragment size
    rxn# temp STR primers ranges
    1 68 CSF1P0 THO1 295-327, 171-215
    2 68 TPOX CYARO4 220-256, 172-205
    3 68 F13A 179-235
    4 68 FIBRA 158-286
    5 63 VWA D21S11 122-182 202-265
    6 63 CD4 86-141
    7 63 D14S1434 70-102
    8 63 D22S1045 76-109
  • Master mix for nested primers
    1 rxn 9 rxns
    2X Q Mix 12.5
    112.5
    titanium 0.5 4.5
    Q 2.5
    22.5
    water 3.3
    29.3
    5 uM primers 1.3
    40X diluted template 5.0
    45.0
    25.0
    213.8
  • Nested PCR cycle
    Step Temp (C.) Time (mins)
    1.0 95 0.5
    2.0 94 0.5
    3.0 X 1.5
    4.0 72 1.5
    5.0 cycle to step 2, 44 times
    6.0 72 10
  • The amplification with the nested PCR primers is run with an annealing temperature of 63° C. or 68° C. depending on the primer pair being amplified as indicated in FIG. 13 and FIG. 14.
  • Detection on ABI 310 Instrument: PCR products are detected on an Agilent Bioanalyzer. The maternal reference VIC labeled PCR reaction products is diluted 10 fold in nano-pure water (17.8 uOhms). Another 10 fold dilution of the fetal enriched FAM-PCR products is generated. The ABI loading buffer is prepared by adding 0.5 μL LIZ 500 size standard to 12 μL Hi Di Formamide (scale as appropriate to the number of samples, include enough buffer for the negative control to test for contamination). 1 μL diluted PCR product is added to 12 ul loading buffer. The sample is heated to 95° C. for 2 minutes and then placed on ice. The samples are loaded onto the ABI 310 as per the manufacturer's instructions.
  • Analysis: For analysis the ABI fragments output are examined for the expected peak sizes as per the nested STR primer facts table (FIG. 13 and FIG. 14). For each STR locus is determined whether there are 1 or 2 alleles (homozygous or heterozygous) for the fetal enriched (PAM labeled sample) or the maternal reference (VIC labeled sample). Alleles generated from the fetal enriched (FAM labeled sample) that are not present in the maternal reference (VIC labeled sample) are unique to the fetus and verify the presence of fetal cells in the sample. If the number of fetal cells is particularly low (<5 cells), not all loci or alleles will always amplify. Allele drop out can generate a false negative. A false positive is most likely generated from contamination and has not been observed in tests to date. If the purity of fetal cells is particularly low (<10% in tests executed on the bioanalyzer) signal intensity of paternal alleles can be very weak. This can also generate a false negative result. In clinical practice the amplicons will have different fluorescent labels incorporated into them marking them as the maternal reference or the fetal enriched samples. The labels allow the samples to be loaded simultaneously into an ABI 310 capillary and differentiated. Paternal alleles are identified as those unique to the fetal enriched sample in comparison to the maternal reference. The efficiency of the overall process is determined after sufficient samples have been analyzed on the ABI 310 to establish the input cell purity and minimum number of fetal cells necessary to achieve 99% detection at 0.1% false positive rate.
  • Example 7 Cord Blood Experiment
  • The protocol detection limit was determined using fixed cells from cord blood. Cord blood from clinical sample SVH0003C was subjected to erythrocyte lysis and the remaining leukocytes were fixed in a solution of PBS and 2% para-formaldehyde. Cell numbers were estimated from hemocytometer counts and dilutions made into a Tris protienase K (PK) solution. After cell lysis and PK inactivation a PCR cocktail including primers for STR loci TPOX and CSF1P0 was added directly to the crude lysate and amplified as described in Example 6. The products were analyzed on an Agilent bioanalyzer. FIGS. 15A-15B shows representative results. TPOX and CSF1P0 amplification products are underline in boxes. Detection for the PCR protocol from fixed cord blood can occur with less than 10 cells as shown by the result in FIG. 16.
  • Example 9 Detection of 10 Fetal Cells at 10% Purity without Nested PCR
  • An estimated 10 fetal cells were mixed with increasing amounts of material cells (approximately 0-4000 cells as measured by hemocytometer counts). After proteinase K lysis, only a 1st round of PCR with primers to STR loci D21S11 and VWA was executed as described in Example 6. FIG. 17 shows representative results. The mother and fetus are identical at the D21S11 locus but the child has a unique (paternal) allele at the VWA locus. FIG. 17 shows that detection of the paternal VWA allele is lost when the fetal purity drops below 10%.
  • Example 9 Generation of STR Markers
  • Approximately 100 cells were spotted onto a poly-L-lysine slide and heat dried. Cells were fixed in a MeOH acetic acid solution and rinsed in MeOH. After air drying the slide was treated with 2% para-formaldehyde for 10 minutes then washed in 1×PBS. The slide was dehydrated in passes of EtOH for 1 ruin each in 70%, 80%, 90%, and finally 100%. A dam was applied around the cells and 30 ul of proteinase K was added on top of the cells and a cover slip adhered over the dam. The slide was incubated on a heat block at 65° C. for 60 minutes and 95° C. for 15 minutes. The lysate solution was then transferred directly to a 100 ul PCR reaction with VWA and LIPOL primer. PCR protocol and analysis were performed as described in Example 6. FIG. 18 shows representative results. VWA and LIPOL amplicons are underlined by boxes in the figure. These results show that STRs markers can be generated from fixed cells recovered from a slide.
  • Example 10 Detection of Fetal Alleles at Less than 10% Purity after Nested PCR Amplification of STRs
  • Mutliplex PCR reactions from samples with 10 fetal cells in a background of maternal cells generating at 10%, 5% and 2% fetal cells purity concentration were performed as described in Example 6. A dilution of the three multiplex PCR reactions was used as template in nested PCR reactions for STRs TPOX/CYAR04, VWA/D21S11, and D14S1434 as described in Example 6. FIG. 19 shows representative results. The underlined loci are known to have unique fetal alleles which are designated by arrows when visible in the gel. The three loci were visible when fetal cells constituted 10% of the sample. D14S1434 loci was visible when fetal cells constituted 5% and 2% of the sample.
  • Example 11 Resolution of the Bioanalyzer
  • FIG. 15A shows that the Bioanalyzer can resolve a 16 base pair difference between the 99 base pair D14S1434 maternal allele and the 83 base pair paternal allele in a mixed fetal sample at 5% purity (also shown in FIG. 11, lane 6). FIG. 15B shows that the output of fragments calibration standards. The output of an ABI310 fragment calibration standard is shown in blue or FAM label. Fragments of 232, 234, 236 and 238 are easily resolved from one another. For a resolution comparison note that the orange, VIC labeled, 246 size standard peak is 8 bases away from the FAM labeled 238 peak, half the distance as the maternal and paternal alleles in the Bioanalyzer trace.
  • Example 12 Analysis of STR's Using Quantitative Fluorescence
  • Genomic DNA from enriched fetal cells and a maternal control sample will be genotyped for specific STR loci in order to assess the presence of chromosomal abnormalities, such as trisomy. Due to the small number of fetal cells typically isolated from maternal blood it is advantageous to perform a pre-amplification step prior to analysis, using a protocol such as improved primer extension pre-amplification (IPEP) PCR. Cell lysis is carried out in 10 ul High Fidelity buffer (50 mM Tris-HCL, 22 mM (NH.sub.4).sub.2 SO.sub.4 2.5 mM MgCl.sub.2, pH 8.9) which also contained 4 mg/ml proteinase K and 0.5 vol % Tween 20 (Merck) for 12 hours at 48° C. The enzyme is then inactivated for 15 minutes at 94° C. Lysis is performed in parallel batches in 5 ul, 200 mM KOH, 50 mM dithiothreitol for 10 minutes at 65.degree. The batches are then neutralized with 5 ul 900 mM Tris HCl pH 8.3, 300 mM KCl. Preamplication is then carried out for each sample using completely randomized 15-mer primers (16 uM) and dNTP (100 uM) with 5 units of a mixture of Taq polymerase (Boehringer Mannheim) and Pwo polymerase (Boehringer Mannheim) in a ratio of 10:1 under standard PCR buffer conditions (50 mM Tris-HCL, 22 mM (NH4)2 SO4, 2.5 mM Mg2, pH 8.9, also containing 5% by vol. of DMSO) in a total volume of 60 ul with the following 50 thermal cycles: Step Temperature Time (1) 92° C. 1 Min 30 Sec; (2) 92° C. 40 Min (3) 37° C. 2 Min; (4) ramp: 0.1° C./sec to 55° C. (5) 55° C. 4 Min (6) 68° C. 30 Sec (7) go to step 2, 49 times (8) 8° C. 15 Min.
  • Dye labeled primers will then be selected from Table 3 based on STR loci on a chromosomes of interest, such as 13, 18, 21 or X. The primers are designed so that one primer of each pair contains a fluorescent dye, such as ROX, HEX, JOE, NED, PAM, TAMARA or LIZ. The primers are placed into multiplex mixes based on expected product size, fluorescent tag compatibility and melting temperature. This allows multiple STR loci to be assayed at once and yet still conserves the amount of initial starting material required. All primers are initially diluted to a working dilution of 10 pM. The primers are then combined in a cocktail that has a final volume of 40 ul. Final primer concentration is determined by reaction optimization. Additional PCR grade water is added if the primer mix is below 40 ul. A reaction mix containing 6 ul of Sigma PCR grade water, 1.25 ul of Perkin Elmer Goldamp PCR buffer, 0.5 ul of dNTPs, 5 ul of the primer cocktail, 0.12 ul of Perkin Elmer Taq Gold Polymerase and 1.25 ul of Mg (25 mM) is mixed for each sample. To this a 1 ul sample containing preamplified DNA from enriched fetal cells or maternal control genomic DNA is added.
  • The reaction mix is amplified in a DNA thermocyler, (PTC-200; MJ Research) using an amplification cycle optimized for the melting temperature of the primers and the amount of sample DNA.
  • The amplification product will then analyzed using an automated DNA sequencer system, such as the ABI 310, 377, 3100, 3130, 3700 or 3730, or the Li-Cor 4000, 4100, 4200 or 4300. For example when the amplification products are prepared for analysis on a ABI 377 sequencer, 6 ul of products will be removed and combined with 1.6 ul of loading buffer mix. The master loading buffer mix contains 90 ul deionized formamide combined with 25 ul Perkin Elmer loading dye and 10 ul of a size standard, such as the ROX 350 size standard. Various other standards can be used interchangeably depending on the sizes of the labeled PCR products. The loading buffer and sample are then heat denatured at 95° C. for 3 minutes followed by flash cooling on ice. 2 ul of the product/buffer mix is then electrophoresed on a 12 inch 6% (19:1) polyacrylamide gel on an ARI 377 sequencer.
  • The results will then be analyzed using ABI Genotyper software. The incorporation of a fluorochrome during amplification allows product quantification for each chromosome specific STR, with 2 fluorescent peaks observed in a normal heterozygous individual with an approximate ratio of 1:1. By comparison in trisomic samples, either 3 fluorescent peaks with a ratio of 1:1:1 (trialleleic) or 2 peaks with a ratio of around 2:1 (diallelic) are observed. Using this method screening may be carried out for common trisomies and sex chromosome aneuploidy in a single reaction.
    TABLE 3
    Primer Sets for STRs on Chromsomes 13, 18, 21 and X
    Ch. STR Marker Primer 1 Primer 2
    13 D13S317 5ACAGAAGTCTGGGATGTGGA (SEQ ID NO 1) GCCCAAAAAGACAGACAGAA (SEQ ID NO 2)
    D13S1493 ACCTGTTGTATGGCAGCAGT (SEQ ID NO 3) AGTTGACTCTTTCCCCAACTA (SEQ ID NO 4)
    D1351807 TTTGGTAAGAAAAACATCTCCC (SEQ ID NO 5) GGCTGCAGTTAGCTGTCATT (SEQ ID NO 6)
    D13S256 CCTGGGCAACAAGAGCAAA (SEQ ID NO 7) AGCAGAGAGACATAATTGTG (SEQ ID NO 8)
    D13S258- ACCTGCCAAATTTTACCAGG (SEQ ID NO 9) GACAGAGAGAGGGAATAAACC (SEQ ID NO 10)
    D13S285 ATATATGCACATCCATCCATG (SEQ ID NO 11) GGCCAAAGATAGATAGCAAGGTA (SEQ ID NO 12)
    D13S303 ACATCGCTCCTTACCCCATC (SEQ ID NO 13) TGTACCCATTAACCATCCCCA (SEQ ID NO 14)
    D13S317 ACAGAAGTCTGGGATGTGGA (SEQ ID NO 15) GCCCAAAAAGACAGACAGAA (SEQ ID NO 16)
    D13S779 AGAGTGAGATTCTGTCTCAATTAA (SEQ ID NO 17) GGCCCTGTGTAGAAGCTGTA (SEQ ID NO 18)
    D13S787 ATCAGGATTCCAGGAGGAAA (SEQ ID NO 19) ACCTGGGAGGCGGAGCTC (SEQ ID NO 20)
    D13S793 GGCATAAAAATAGTACAGCAAGC (SEQ ID NO 21) ATTTGAACAGAGGCATGTAC (SEQ ID NO 22)
    D13S796 CATGGATGCAGAATTCACAG (SEQ ID NO 23) TCATCTCCCTGTTTGGTAGC (SEQ ID NO 24)
    D13S800 AGGGATCTTCAGAGAAACAGG (SEQ ID NO 25) TGACACTATCAGCTCTCTGGC (SEQ ID NO 26)
    D13S894 GGTGCTTGCTGTAAATATAATTG (SEQ ID NO 27) CACTACAGCAGATTGCACCA (SEQ ID NO 28)
    18 D18S51 CAAACCCGACTACCAGCAAC (SEQ ID NO 29) GAGCCATGTTCATGCCACTG (SEQ ID NO 30)
    D18S1002 CAAAGAGTGAATGCTGTACAAACAGC (SEQ ID NO 31) CAAGATGTGAGTGTGCTTTTCAGGAG (SEQ ID NO 32)
    D18S1357 ATCCCACAGGATGCCTATTT (SEQ ID NO 33) ACGGGAGCTTTTGAGAAGTT (SEQ ID NO 34)
    D18S1364 TCAAATTTTTAAGTCTCACCAGG (SEQ ID NO 35) GCCTGTAGAAAGCAACAACC (SEQ ID NO 36)
    D18S1370 GGTGACAGAGCAAGACCTTG (SEQ ID NO 37) GCCTCTTGTCATCCCAAGTA (SEQ ID NO 38)
    D18S1371 CTCTCTTCATCCACCATTGG (SEQ ID NO 39) GCTGTAAGAGACCTGTGTTG (SEQ ID NO 40)
    D18S1376 TGGAACCACTTCATTCTTGG (SEQ ID NO 41) ATTTCAGACCAAGATAGGC (SEQ ID NO 42)
    D18S1390 CCTATTTAAGTTTCTGTAAGG (SEQ ID NO 43) ATGGTGTAGACCCTGTGGAA (SEQ ID NO 44)
    D18S499 CTGCACAACATAGTGAGACCTG (SEQ ID NO 45) AGATTACCCAGAAATGAGATCAGC (SEQ ID NO 46)
    D18S535 TCATGTGACAAAAGCCACAC (SEQ ID NO 47) AGACAGAAATATAGATGAGAATGCA (SEQ ID NO 48)
    D18S535 TCATGTGACAAAAGCCACAC (SEQ ID NO 49) AGACAGAAATATAGATGAGAATGCA (SEQ ID NO 50)
    D18S542 TTTCCAGTGGAAACCAAACT (SEQ ID NO 51) TCCAGCAACAACAAGAGACA (SEQ ID NO 52)
    D18S843 GTCCTCATCCTGTAAAACGGG (SEQ ID NO 53) CCACTAACTAGTTTGTGACTTTGG (SEQ ID NO 54)
    D18S851 CTGTCCTCTAGGCTCATTTAGC (SEQ ID NO 55) TTATGAAGCAGTGATGCCAA (SEQ ID NO 56)
    D18S858 AGCTGGAGAGGGATAGCATT (SEQ ID NO 57) TGCATTGCATGAAAGTAGGA (SEQ ID NO 58)
    D18S877 GATGATAGAGATGGCACATGA (SEQ ID NO 59) TCTTCATACATGCTTTATCATGC (SEQ ID NO 60)
    D21S11 GTGAGTCAATTCCCCAAG (SEQ ID NO 61) GTTGTATTAGTCAATGTTCTCC (SEQ ID NO 62)
    D21S1411 ATGATGAATGCATAGATGGATG (SEQ ID NO 63) AATGTGTGTCCTTCCAGGC (SEQ ID NO 64)
    D21S1413 TTGCAGGGAAACCACAGTT (SEQ ID NO 65) TCCTTGGAATAAATTCCCGG (SEQ ID NO 66)
    D21S1432 CTTAGAGGGACAGAACTAATAGGC (SEQ ID NO 67) AGCCTATTGTGGGTTTGTGA (SEQ ID NO 68)
    D21S1437 ATGTACATGTGTCTGGGAAGG (SEQ ID NO 69) TTCTCTACATATTTACTGCCAACA (SEQ ID NO 70)
    D21S1440 GAGTTTGAAAATAAAGTGTTCTGC (SEQ ID NO 71) CCCCACCCCTTTTAGTTTTA (SEQ ID NO 72)
    D21S1446 ATGTACGATACGTAATACTTGACAA (SEQ ID NO 73) GTCCCAAAGGACCTGCTC (SEQ ID NO 74)
    D21S2052 GCACCCCTTTATACTTGGGTG (SEQ ID NO 75) TAGTACTCTACCATCCATCTATCCC (SEQ ID NO 76)
    D21S2055 AACAGAACCAATAGGCTATCTATC (SEQ ID NO 77) TACAGTAAATCACTTGGTAGGAGA (SEQ ID NO 78)
    X SBMA TCCGCGAAGTGAAGAAC (SEQ ID NO 79) CTTGGGGAGAACCATCCTCA (SEQ ID NO 80)
    DXS1047 CCGGCTACAAGTGATGTCTA (SEQ ID NO 81) CCTAGGTAACATAGTGAGACCTTG (SEQ ID NO 82)
    DXS1068 CCTCTAAAGCATAGGGTCCA (SEQ ID NO 83) CCCATCTGAGAACACGCTG (SEQ ID NO 84)
    DXS1283E AGTTTAGGAGATTATCAAGCTGG (SEQ ID NO 85) GTTCCCATAATAGATGTATCCAG (SEQ ID NO 86)
    DXS6789 TTGGTACTTAATAAACCCTCTTTT (SEQ ID NO 87) CTAGAGGGACAGAACCAATAGG (SEQ ID NO 88)
    DXS6795 TGTCTGCTAATGAATGATTTGG (SEQ ID NO 89) CCATCCCCTAAACCTCTCAT (SEQ ID NO 90)
    DXS6800 GTGGGACCTTGTGATTGTGT (SEQ ID NO 91) CTGGCTGACACTTAGGGAAA (SEQ ID NO 92)
    DXS6810 ACAGAAAACCTTTTGGGACC (SEQ ID NO 93) CCCAGCCCTGAATATTATCA (SEQ ID NO 94)
    DXS7127 TGCACTTAATATCTGGTGATGG (SEQ ID NO 95) ATTTCTTTCCCTCTGCAACC (SEQ ID NO 96)
    DXS7132 AGCCCATTTTCATAATAAATCC (SEQ ID NO 97) AATCAGTGCTTTCTGTACTATTGG (SEQ ID NO 98)
    DXS8377 CACTTCATGGCTTACCACAG (SEQ ID NO 99) GACCTTTGGAAAGCTAGTGT (SEQ ID NO 100)
    DXS9893 TGTCACGTTTACCCTGGAAC (SEQ ID NO 101) TATTCTTCTATCCAACCAACAGC (SEQ ID NO 102)
    DXS9895 TTGGGTGGGGACACAGAG (SEQ ID NO 103) CCTGGCTCAAGGAATTACAA (SEQ ID NO 104)
    DXS9896 CCAGCCTGGCTGTTAGAGTA (SEQ ID NO 105) ATATTCTTATATTCCATATGGCACA (SEQ ID NO 106)
    DXS9902 TGGAGTCTCTGGGTGAAGAG (SEQ ID NO 107) CAGGAGTATGGGATCACCAG (SEQ ID NO 108)
    DXS998 CAGCAATTTTTCAAAGGC (SEQ ID NO 109) AGATCATTCATATAACCTCAAAAGA (SEQ ID NO 110)

Claims (33)

1. A method for diagnosing a fetal abnormality comprising:
enriching one or more fetal cells from a maternal blood sample using size-based separation,
analyzing one or more regions of genomic DNA from said fetal cells for STRs, and
determining a fetal abnormality based on the STR analysis.
2. The method of claim 1, wherein said enriching comprises applying said sample to a device comprising an array of obstacles on a substrate.
3. The method of claim 1, wherein said enriching comprises applying said sample into a system that separates a first component of said mixed sample in a first direction and a second component of said mixed sample in a second direction, and wherein said first component has a larger hydrodynamic size than said second component.
4. The method of claim 1, wherein said enriching step further comprises performing magnetic separation on the mixed sample.
5. The method of claim 1, wherein said enriching step further comprises performing FACS on the mixed sample.
6. The method of claim 1, wherein said enriching step further comprises performing laser microdissection on the mixed sample.
7. The method of claim 1, wherein said enriching step further comprises performing a magnetic separation on the mixed sample.
8. The method of claim 1, wherein said fetal abnormality is aneuploidy.
9. (canceled)
10. The method of claim 8, wherein said aneuploidy is trisomy selected from the group consisting of: trisomy 13, trisomy 18, trisomy 21 (Down Syndrome), Klinefelter Syndrome (XXY), other irregular number of sex or autosomal chromosomes, and a combination thereof.
11. The method of claim 8, wherein whether said aneuploidy is maternally or paternally derived is determined.
12. The method of claim 1, wherein the fetal abnormality is a segmental aneuploidy.
13. The method of claim 1, wherein said fetal abnormality is a condition associated with said regions of genomic DNA.
14. The method of claim 1, wherein said analyzing involves the amplification of one or more regions of genomic DNA by PCR.
15. The method of claim 14, further comprising a pre-PCR step comprising multiple displacement amplification.
16. The method of claim 1, wherein said analyzing of genomic DNA regions is performed by CGE or qPCR.
17. (canceled)
18. The method of claim 1, wherein said regions of genomic DNA are localized in a specific chromosome.
19. The method of claim 18, wherein said chromosome is selected from the group consisting of: X chromosome, Y chromosome, chromosome 21, chromosome 13 and chromosome 18.
20. The method of claim 1, wherein said obtaining further comprises enriching fetal cells in said maternal blood sample.
21. The method of claim 20, wherein said enriched fetal cells constitute less than 50% of total cells.
22. (canceled)
23. The method of claim 1, wherein said determining further comprises inputting data from said comparing step into a predetermined data model for the association of DNA quantity with maternal and non-maternal alleles.
24. A method for diagnosing a fetal abnormality comprising:
enriching one or more fetal cells from a maternal blood sample, wherein said sample is applied to a device comprising an array of obstacles on a substrate,
analyzing one or more regions of genomic DNA from said fetal cells, and
determining a fetal abnormality from the analyzed regions.
25-46. (canceled)
47. A method comprising
comparing levels of genomic DNA from a control sample and a mixed sample comprising at least one fetal cell, wherein the control sample comprises a dilution of said mixed maternal blood sample, and
determining a fetal abnormality from said comparison
48-69. (canceled)
70. A computer program product comprising a computer readable medium having a computer executable logic recorded thereon for enabling a processor to diagnose a fetal abnormality comprising a receiving procedure for receiving data from one of more DNA genomic regions from a mixed sample containing at least one fetal cell,
computer assisted logic for analyzing a fetal abnormality from said received data; and
an output procedure for generating an output indicating the presence, absence or kind of said fetal abnormality.
71-92. (canceled)
93. A method for determining a fetal condition comprising:
comparing the level of polymorphisms of at least two alleles at two or more loci in a control sample and a test sample comprising fetal cells, wherein said test sample is enriched for fetal cells using size-based separation from a maternal blood sample.
94-98. (canceled)
99. The method of claim 93, further comprising
(a) estimating the relative number of fetal and maternal cells in said control sample and said test sample,
(b) relating said level of polymorphisms of at least two alleles at two or more loci to said relative number of maternal and fetal cells, and
(c) determining the presence or absence of trisomy in the sample enriched in fetal cells based on the comparison.
100-101. (canceled)
US11/763,426 2006-06-14 2007-06-14 Diagnosis of fetal abnormalities using polymorphisms including short tandem repeats Abandoned US20080050739A1 (en)

Priority Applications (9)

Application Number Priority Date Filing Date Title
US11/763,426 US20080050739A1 (en) 2006-06-14 2007-06-14 Diagnosis of fetal abnormalities using polymorphisms including short tandem repeats
US12/413,485 US20090280492A1 (en) 2006-06-14 2009-03-27 Diagnosis of fetal abnormalities using polymorphisms including short tandem repeats
US12/725,240 US20110171638A1 (en) 2006-06-14 2010-03-16 Diagnosis of fetal abnormalities using polymorphisms including short tandem repeats
US12/751,908 US20100291571A1 (en) 2006-06-14 2010-03-31 Diagnosis of fetal aneuploidy by quantification of genomic dna from mixed samples
US13/433,232 US20120183963A1 (en) 2006-06-14 2012-03-28 Determination of fetal aneuploidy by quantification of genomic dna from mixed samples
US13/738,268 US20130288242A1 (en) 2006-06-14 2013-01-10 Determination of fetal aneuploidy by quantification of genomic dna from mixed samples
US13/830,871 US10591391B2 (en) 2006-06-14 2013-03-14 Diagnosis of fetal abnormalities using polymorphisms including short tandem repeats
US16/819,992 US11378498B2 (en) 2006-06-14 2020-03-16 Diagnosis of fetal abnormalities using polymorphisms including short tandem repeats
US17/850,599 US20230168160A1 (en) 2006-06-14 2022-06-27 Diagnosis of fetal abnormalities using polymorphisms including short tandem repeats

Applications Claiming Priority (3)

Application Number Priority Date Filing Date Title
US80481506P 2006-06-14 2006-06-14
US82077806P 2006-07-28 2006-07-28
US11/763,426 US20080050739A1 (en) 2006-06-14 2007-06-14 Diagnosis of fetal abnormalities using polymorphisms including short tandem repeats

Related Child Applications (3)

Application Number Title Priority Date Filing Date
US12/413,485 Continuation US20090280492A1 (en) 2006-06-14 2009-03-27 Diagnosis of fetal abnormalities using polymorphisms including short tandem repeats
US12/725,240 Continuation US20110171638A1 (en) 2006-06-14 2010-03-16 Diagnosis of fetal abnormalities using polymorphisms including short tandem repeats
US12/751,908 Continuation US20100291571A1 (en) 2006-06-14 2010-03-31 Diagnosis of fetal aneuploidy by quantification of genomic dna from mixed samples

Publications (1)

Publication Number Publication Date
US20080050739A1 true US20080050739A1 (en) 2008-02-28

Family

ID=39113892

Family Applications (9)

Application Number Title Priority Date Filing Date
US11/763,426 Abandoned US20080050739A1 (en) 2006-06-14 2007-06-14 Diagnosis of fetal abnormalities using polymorphisms including short tandem repeats
US12/413,485 Abandoned US20090280492A1 (en) 2006-06-14 2009-03-27 Diagnosis of fetal abnormalities using polymorphisms including short tandem repeats
US12/725,240 Abandoned US20110171638A1 (en) 2006-06-14 2010-03-16 Diagnosis of fetal abnormalities using polymorphisms including short tandem repeats
US12/751,908 Abandoned US20100291571A1 (en) 2006-06-14 2010-03-31 Diagnosis of fetal aneuploidy by quantification of genomic dna from mixed samples
US13/433,232 Abandoned US20120183963A1 (en) 2006-06-14 2012-03-28 Determination of fetal aneuploidy by quantification of genomic dna from mixed samples
US13/738,268 Abandoned US20130288242A1 (en) 2006-06-14 2013-01-10 Determination of fetal aneuploidy by quantification of genomic dna from mixed samples
US13/830,871 Active 2027-06-27 US10591391B2 (en) 2006-06-14 2013-03-14 Diagnosis of fetal abnormalities using polymorphisms including short tandem repeats
US16/819,992 Active US11378498B2 (en) 2006-06-14 2020-03-16 Diagnosis of fetal abnormalities using polymorphisms including short tandem repeats
US17/850,599 Pending US20230168160A1 (en) 2006-06-14 2022-06-27 Diagnosis of fetal abnormalities using polymorphisms including short tandem repeats

Family Applications After (8)

Application Number Title Priority Date Filing Date
US12/413,485 Abandoned US20090280492A1 (en) 2006-06-14 2009-03-27 Diagnosis of fetal abnormalities using polymorphisms including short tandem repeats
US12/725,240 Abandoned US20110171638A1 (en) 2006-06-14 2010-03-16 Diagnosis of fetal abnormalities using polymorphisms including short tandem repeats
US12/751,908 Abandoned US20100291571A1 (en) 2006-06-14 2010-03-31 Diagnosis of fetal aneuploidy by quantification of genomic dna from mixed samples
US13/433,232 Abandoned US20120183963A1 (en) 2006-06-14 2012-03-28 Determination of fetal aneuploidy by quantification of genomic dna from mixed samples
US13/738,268 Abandoned US20130288242A1 (en) 2006-06-14 2013-01-10 Determination of fetal aneuploidy by quantification of genomic dna from mixed samples
US13/830,871 Active 2027-06-27 US10591391B2 (en) 2006-06-14 2013-03-14 Diagnosis of fetal abnormalities using polymorphisms including short tandem repeats
US16/819,992 Active US11378498B2 (en) 2006-06-14 2020-03-16 Diagnosis of fetal abnormalities using polymorphisms including short tandem repeats
US17/850,599 Pending US20230168160A1 (en) 2006-06-14 2022-06-27 Diagnosis of fetal abnormalities using polymorphisms including short tandem repeats

Country Status (1)

Country Link
US (9) US20080050739A1 (en)

Cited By (55)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20070026418A1 (en) * 2005-07-29 2007-02-01 Martin Fuchs Devices and methods for enrichment and alteration of circulating tumor cells and other particles
US20070202525A1 (en) * 2006-02-02 2007-08-30 The Board Of Trustees Of The Leland Stanford Junior University Non-invasive fetal genetic screening by digital analysis
US20080070792A1 (en) * 2006-06-14 2008-03-20 Roland Stoughton Use of highly parallel snp genotyping for fetal diagnosis
US20080138809A1 (en) * 2006-06-14 2008-06-12 Ravi Kapur Methods for the Diagnosis of Fetal Abnormalities
US20080220422A1 (en) * 2006-06-14 2008-09-11 Daniel Shoemaker Rare cell analysis using sample splitting and dna tags
US20090029377A1 (en) * 2007-07-23 2009-01-29 The Chinese University Of Hong Kong Diagnosing fetal chromosomal aneuploidy using massively parallel genomic sequencing
US20090181421A1 (en) * 2005-07-29 2009-07-16 Ravi Kapur Diagnosis of fetal abnormalities using nucleated red blood cells
US20090280492A1 (en) * 2006-06-14 2009-11-12 Roland Stoughton Diagnosis of fetal abnormalities using polymorphisms including short tandem repeats
US20100112575A1 (en) * 2008-09-20 2010-05-06 The Board Of Trustees Of The Leland Stanford Junior University Noninvasive Diagnosis of Fetal Aneuploidy by Sequencing
US20100112590A1 (en) * 2007-07-23 2010-05-06 The Chinese University Of Hong Kong Diagnosing Fetal Chromosomal Aneuploidy Using Genomic Sequencing With Enrichment
US20100304978A1 (en) * 2009-01-26 2010-12-02 David Xingfei Deng Methods and compositions for identifying a fetal cell
US20110129841A1 (en) * 2005-06-02 2011-06-02 Fluidigm Corporation Analysis using microfluidic partitioning devices
WO2011090556A1 (en) 2010-01-19 2011-07-28 Verinata Health, Inc. Methods for determining fraction of fetal nucleic acid in maternal samples
US20110201507A1 (en) * 2010-01-19 2011-08-18 Rava Richard P Sequencing methods and compositions for prenatal diagnoses
US20110230358A1 (en) * 2010-01-19 2011-09-22 Artemis Health, Inc. Identification of polymorphic sequences in mixtures of genomic dna by whole genome sequencing
US8318430B2 (en) 2010-01-23 2012-11-27 Verinata Health, Inc. Methods of fetal abnormality detection
WO2013015793A1 (en) * 2011-07-26 2013-01-31 Verinata Health, Inc. Method for determining the presence or absence of different aneuploidies in a sample
US8532936B2 (en) 2011-04-14 2013-09-10 Verinata Health, Inc. Normalizing chromosomes for the determination and verification of common and rare chromosomal aneuploidies
US8774488B2 (en) 2010-03-11 2014-07-08 Cellscape Corporation Method and device for identification of nucleated red blood cells from a maternal blood sample
US8921102B2 (en) 2005-07-29 2014-12-30 Gpb Scientific, Llc Devices and methods for enrichment and alteration of circulating tumor cells and other particles
US9115401B2 (en) 2010-01-19 2015-08-25 Verinata Health, Inc. Partition defined detection methods
US9217131B2 (en) 2010-01-21 2015-12-22 Biocep Ltd. Magnetic separation of rare cells
US9260745B2 (en) 2010-01-19 2016-02-16 Verinata Health, Inc. Detecting and classifying copy number variation
US9323888B2 (en) 2010-01-19 2016-04-26 Verinata Health, Inc. Detecting and classifying copy number variation
US9411937B2 (en) 2011-04-15 2016-08-09 Verinata Health, Inc. Detecting and classifying copy number variation
US9447453B2 (en) 2011-04-12 2016-09-20 Verinata Health, Inc. Resolving genome fractions using polymorphism counts
WO2016161081A1 (en) * 2015-04-03 2016-10-06 Fluxion Biosciences, Inc. Molecular characterization of single cells and cell populations for non-invasive diagnostics
US9547748B2 (en) 2011-06-29 2017-01-17 Bgi Health Service Co., Ltd. Method for determining fetal chromosomal abnormality
US9840732B2 (en) 2012-05-21 2017-12-12 Fluidigm Corporation Single-particle analysis of particle populations
US10364467B2 (en) 2015-01-13 2019-07-30 The Chinese University Of Hong Kong Using size and number aberrations in plasma DNA for detecting cancer
US10388403B2 (en) 2010-01-19 2019-08-20 Verinata Health, Inc. Analyzing copy number variation in the detection of cancer
US11111544B2 (en) 2005-07-29 2021-09-07 Natera, Inc. System and method for cleaning noisy genetic data and determining chromosome copy number
US11111543B2 (en) 2005-07-29 2021-09-07 Natera, Inc. System and method for cleaning noisy genetic data and determining chromosome copy number
US11111545B2 (en) 2010-05-18 2021-09-07 Natera, Inc. Methods for simultaneous amplification of target loci
US11186863B2 (en) 2019-04-02 2021-11-30 Progenity, Inc. Methods, systems, and compositions for counting nucleic acid molecules
CN113736876A (en) * 2021-10-14 2021-12-03 胜亚生物科技(厦门)有限公司 Kit for rapidly detecting chromosome number abnormality and application thereof
US11230731B2 (en) 2018-04-02 2022-01-25 Progenity, Inc. Methods, systems, and compositions for counting nucleic acid molecules
US11286530B2 (en) 2010-05-18 2022-03-29 Natera, Inc. Methods for simultaneous amplification of target loci
US11306359B2 (en) 2005-11-26 2022-04-19 Natera, Inc. System and method for cleaning noisy genetic data from target individuals using genetic data from genetically related individuals
US11306357B2 (en) 2010-05-18 2022-04-19 Natera, Inc. Methods for non-invasive prenatal ploidy calling
US11319596B2 (en) 2014-04-21 2022-05-03 Natera, Inc. Detecting mutations and ploidy in chromosomal segments
US11322224B2 (en) 2010-05-18 2022-05-03 Natera, Inc. Methods for non-invasive prenatal ploidy calling
US11326208B2 (en) 2010-05-18 2022-05-10 Natera, Inc. Methods for nested PCR amplification of cell-free DNA
US11332785B2 (en) 2010-05-18 2022-05-17 Natera, Inc. Methods for non-invasive prenatal ploidy calling
US11332793B2 (en) 2010-05-18 2022-05-17 Natera, Inc. Methods for simultaneous amplification of target loci
US11332774B2 (en) 2010-10-26 2022-05-17 Verinata Health, Inc. Method for determining copy number variations
US11339429B2 (en) 2010-05-18 2022-05-24 Natera, Inc. Methods for non-invasive prenatal ploidy calling
US11390916B2 (en) 2014-04-21 2022-07-19 Natera, Inc. Methods for simultaneous amplification of target loci
US11408031B2 (en) 2010-05-18 2022-08-09 Natera, Inc. Methods for non-invasive prenatal paternity testing
US11479812B2 (en) 2015-05-11 2022-10-25 Natera, Inc. Methods and compositions for determining ploidy
US11485996B2 (en) 2016-10-04 2022-11-01 Natera, Inc. Methods for characterizing copy number variation using proximity-litigation sequencing
US11519028B2 (en) 2016-12-07 2022-12-06 Natera, Inc. Compositions and methods for identifying nucleic acid molecules
US11525159B2 (en) 2018-07-03 2022-12-13 Natera, Inc. Methods for detection of donor-derived cell-free DNA
US11939634B2 (en) 2010-05-18 2024-03-26 Natera, Inc. Methods for simultaneous amplification of target loci
US11959129B2 (en) 2021-10-13 2024-04-16 Enumera Molecular, Inc. Methods, systems, and compositions for counting nucleic acid molecules

Families Citing this family (32)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2010126614A2 (en) 2009-04-30 2010-11-04 Good Start Genetics, Inc. Methods and compositions for evaluating genetic markers
US20120034603A1 (en) 2010-08-06 2012-02-09 Tandem Diagnostics, Inc. Ligation-based detection of genetic variants
US11031095B2 (en) 2010-08-06 2021-06-08 Ariosa Diagnostics, Inc. Assay systems for determination of fetal copy number variation
US8700338B2 (en) 2011-01-25 2014-04-15 Ariosa Diagnosis, Inc. Risk calculation for evaluation of fetal aneuploidy
US20140342940A1 (en) 2011-01-25 2014-11-20 Ariosa Diagnostics, Inc. Detection of Target Nucleic Acids using Hybridization
US10533223B2 (en) 2010-08-06 2020-01-14 Ariosa Diagnostics, Inc. Detection of target nucleic acids using hybridization
US11203786B2 (en) 2010-08-06 2021-12-21 Ariosa Diagnostics, Inc. Detection of target nucleic acids using hybridization
US20130261003A1 (en) 2010-08-06 2013-10-03 Ariosa Diagnostics, In. Ligation-based detection of genetic variants
US20130040375A1 (en) 2011-08-08 2013-02-14 Tandem Diagnotics, Inc. Assay systems for genetic analysis
US10167508B2 (en) 2010-08-06 2019-01-01 Ariosa Diagnostics, Inc. Detection of genetic abnormalities
US9163281B2 (en) 2010-12-23 2015-10-20 Good Start Genetics, Inc. Methods for maintaining the integrity and identification of a nucleic acid template in a multiplex sequencing reaction
US8756020B2 (en) 2011-01-25 2014-06-17 Ariosa Diagnostics, Inc. Enhanced risk probabilities using biomolecule estimations
US9994897B2 (en) 2013-03-08 2018-06-12 Ariosa Diagnostics, Inc. Non-invasive fetal sex determination
US11270781B2 (en) 2011-01-25 2022-03-08 Ariosa Diagnostics, Inc. Statistical analysis for non-invasive sex chromosome aneuploidy determination
US10131947B2 (en) 2011-01-25 2018-11-20 Ariosa Diagnostics, Inc. Noninvasive detection of fetal aneuploidy in egg donor pregnancies
US8712697B2 (en) 2011-09-07 2014-04-29 Ariosa Diagnostics, Inc. Determination of copy number variations using binomial probability calculations
US9228233B2 (en) 2011-10-17 2016-01-05 Good Start Genetics, Inc. Analysis methods
US8209130B1 (en) 2012-04-04 2012-06-26 Good Start Genetics, Inc. Sequence assembly
US10227635B2 (en) 2012-04-16 2019-03-12 Molecular Loop Biosolutions, Llc Capture reactions
US10289800B2 (en) 2012-05-21 2019-05-14 Ariosa Diagnostics, Inc. Processes for calculating phased fetal genomic sequences
CA2878280A1 (en) 2012-07-19 2014-01-23 Ariosa Diagnostics, Inc. Multiplexed sequential ligation-based detection of genetic variants
EP2971159B1 (en) 2013-03-14 2019-05-08 Molecular Loop Biosolutions, LLC Methods for analyzing nucleic acids
US10851414B2 (en) 2013-10-18 2020-12-01 Good Start Genetics, Inc. Methods for determining carrier status
WO2015175530A1 (en) 2014-05-12 2015-11-19 Gore Athurva Methods for detecting aneuploidy
WO2016040446A1 (en) 2014-09-10 2016-03-17 Good Start Genetics, Inc. Methods for selectively suppressing non-target sequences
US10429399B2 (en) 2014-09-24 2019-10-01 Good Start Genetics, Inc. Process control for increased robustness of genetic assays
CA3002133A1 (en) * 2014-10-17 2016-04-21 Good Start Genetics, Inc. Pre-implantation genetic screening and aneuploidy detection
EP4095261A1 (en) 2015-01-06 2022-11-30 Molecular Loop Biosciences, Inc. Screening for structural variants
CN104818323B (en) * 2015-04-10 2017-08-29 上海五色石医学研究有限公司 The mankind 13, the gene parting detecting reagent of 18 and No. 21 chromosome, 20 str locus seats
KR101848438B1 (en) 2015-10-29 2018-04-13 바이오코아 주식회사 A method for prenatal diagnosis using digital PCR
CA3037366A1 (en) 2016-09-29 2018-04-05 Myriad Women's Health, Inc. Noninvasive prenatal screening using dynamic iterative depth optimization
KR102036609B1 (en) * 2018-02-12 2019-10-28 바이오코아 주식회사 A method for prenatal diagnosis using digital PCR

Citations (94)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4800159A (en) * 1986-02-07 1989-01-24 Cetus Corporation Process for amplifying, detecting, and/or cloning nucleic acid sequences
US5296375A (en) * 1992-05-01 1994-03-22 Trustees Of The University Of Pennsylvania Mesoscale sperm handling devices
US5486335A (en) * 1992-05-01 1996-01-23 Trustees Of The University Of Pennsylvania Analysis based on flow restriction
US5498392A (en) * 1992-05-01 1996-03-12 Trustees Of The University Of Pennsylvania Mesoscale polynucleotide amplification device and method
US5707799A (en) * 1994-09-30 1998-01-13 Abbott Laboratories Devices and methods utilizing arrays of structures for analyte capture
US5709943A (en) * 1995-05-04 1998-01-20 Minnesota Mining And Manufacturing Company Biological adsorption supports
US5715946A (en) * 1995-06-07 1998-02-10 Reichenbach; Steven H. Method and apparatus for sorting particles suspended in a fluid
US5726026A (en) * 1992-05-01 1998-03-10 Trustees Of The University Of Pennsylvania Mesoscale sample preparation device and systems for determination and processing of analytes
US5858649A (en) * 1992-07-17 1999-01-12 Aprogenex, Inc. Amplification of mRNA for distinguishing fetal cells in maternal blood
US5866345A (en) * 1992-05-01 1999-02-02 The Trustees Of The University Of Pennsylvania Apparatus for the detection of an analyte utilizing mesoscale flow systems
US5879883A (en) * 1991-10-03 1999-03-09 Indiana University Foundation Method for screening for alzheimer's disease
US6013188A (en) * 1996-06-07 2000-01-11 Immunivest Corporation Methods for biological substance analysis employing internal magnetic gradients separation and an externally-applied transport force
US6176962B1 (en) * 1990-02-28 2001-01-23 Aclara Biosciences, Inc. Methods for fabricating enclosed microchannel structures
US6184043B1 (en) * 1992-09-14 2001-02-06 FODSTAD øYSTEIN Method for detection of specific target cells in specialized or mixed cell population and solutions containing mixed cell populations
US6186660B1 (en) * 1997-10-09 2001-02-13 Caliper Technologies Corp. Microfluidic systems incorporating varied channel dimensions
US6197523B1 (en) * 1997-11-24 2001-03-06 Robert A. Levine Method for the detection, identification, enumeration and confirmation of circulating cancer and/or hematologic progenitor cells in whole blood
US6200765B1 (en) * 1998-05-04 2001-03-13 Pacific Northwest Cancer Foundation Non-invasive methods to detect prostate cancer
US20020006621A1 (en) * 1989-11-13 2002-01-17 Children's Medical Center Corporation Non-invasive method for isolation and detection of fetal DNA
US20020009738A1 (en) * 2000-04-03 2002-01-24 Houghton Raymond L. Methods, compositions and kits for the detection and monitoring of breast cancer
US20020012930A1 (en) * 1999-09-16 2002-01-31 Rothberg Jonathan M. Method of sequencing a nucleic acid
US20020012931A1 (en) * 2000-03-27 2002-01-31 Waldman Scott A. High specificity marker detection
US6344326B1 (en) * 1996-07-30 2002-02-05 Aclara Bio Sciences, Inc. Microfluidic method for nucleic acid purification and processing
US20020016450A1 (en) * 1997-10-31 2002-02-07 Bbi Bioseq, Inc., A Masachusetts Corporation Pressure-enhanced extraction and purification
US20020019001A1 (en) * 1999-10-15 2002-02-14 Ventana Medical Systems, Inc. Method of detecting single gene copies in-situ
US20020028431A1 (en) * 1998-08-25 2002-03-07 Julien Jean-Claude Bisconte De Saint Process, device and reagent for cell separation
US6361958B1 (en) * 1999-11-12 2002-03-26 Motorola, Inc. Biochannel assay for hybridization with biomaterial
US20030004402A1 (en) * 2000-07-18 2003-01-02 Hitt Ben A. Process for discriminating between biological states based on hidden patterns from biological data
US20030013101A1 (en) * 1999-09-29 2003-01-16 Shankar Balasubramanian Polynucleotide sequencing
US20030017514A1 (en) * 2001-06-02 2003-01-23 Katharina Pachmann Method for quantitative detection of vital epithelial tumor cells in a body fluid
US6511967B1 (en) * 1999-04-23 2003-01-28 The General Hospital Corporation Use of an internalizing transferrin receptor to image transgene expression
US20030022207A1 (en) * 1998-10-16 2003-01-30 Solexa, Ltd. Arrayed polynucleotides and their use in genome analysis
US20030033091A1 (en) * 2001-04-20 2003-02-13 Sequenom, Inc. Systems and methods for testing a biological sample
US20030044781A1 (en) * 1999-05-19 2003-03-06 Jonas Korlach Method for sequencing nucleic acid molecules
US20030044388A1 (en) * 2001-08-31 2003-03-06 The Chinese University Of Hong Kong Methods for detecting DNA originating from different individuals
US6673541B1 (en) * 1998-09-18 2004-01-06 Micromet Ag DNA amplification of a single cell
US6674525B2 (en) * 2001-04-03 2004-01-06 Micronics, Inc. Split focusing cytometer
US20040005582A1 (en) * 2000-08-10 2004-01-08 Nanobiodynamics, Incorporated Biospecific desorption microflow systems and methods for studying biospecific interactions and their modulators
US20040009471A1 (en) * 2002-04-25 2004-01-15 Bo Cao Methods and kits for detecting a target cell
US20040018116A1 (en) * 2002-07-26 2004-01-29 Desmond Sean M. Microfluidic size-exclusion devices, systems, and methods
US6685841B2 (en) * 2001-02-14 2004-02-03 Gabriel P. Lopez Nanostructured devices for separation and analysis
US6689615B1 (en) * 2000-10-04 2004-02-10 James Murto Methods and devices for processing blood samples
US20040037470A1 (en) * 2002-08-23 2004-02-26 Simske Steven J. Systems and methods for processing text-based electronic documents
US20040043506A1 (en) * 2002-08-30 2004-03-04 Horst Haussecker Cascaded hydrodynamic focusing in microfluidic channels
US20040048360A1 (en) * 1999-08-26 2004-03-11 Caliper Technologies Corp. Microfluidic analytic detection assays, devices, and integrated systems
US20040053352A1 (en) * 1998-09-28 2004-03-18 Tianmei Ouyang Diagnostics based on tetrazolium compounds
US20050014208A1 (en) * 2001-09-06 2005-01-20 Alf-Andreas Krehan Method and kit for diagnosing or controlling the treatment of breast cancer
US20050019792A1 (en) * 2001-11-30 2005-01-27 Fluidigm Corporation Microfluidic device and methods of using same
US20050037388A1 (en) * 2001-06-22 2005-02-17 University Of Geneva Method for detecting diseases caused by chromosomal imbalances
US6858439B1 (en) * 1999-03-15 2005-02-22 Aviva Biosciences Compositions and methods for separation of moieties on chips
US20050042685A1 (en) * 2001-09-06 2005-02-24 Winfried Albert Method and diagnosis kit for selecting and or qualitative and/or quantitative detection of cells
US20050042623A1 (en) * 2002-10-30 2005-02-24 Dana Ault-Riche Systems for capture and analysis of biological particles and methods using the systems
US20050049793A1 (en) * 2001-04-30 2005-03-03 Patrizia Paterlini-Brechot Prenatal diagnosis method on isolated foetal cell of maternal blood
US20050052773A1 (en) * 2003-09-05 2005-03-10 Hitachi Global Storage Technologies Increasing head-disk interface reliability using controlled heating
US20050064476A1 (en) * 2002-11-11 2005-03-24 Affymetrix, Inc. Methods for identifying DNA copy number changes
US20050061962A1 (en) * 2003-07-31 2005-03-24 Arryx, Inc. Multiple laminar flow-based rate zonal or isopycnic separation with holographic optical trapping of blood cells and other static components
US20060000772A1 (en) * 2002-11-29 2006-01-05 Toru Sano Separation apparatus and separation method
US20060008807A1 (en) * 2002-08-23 2006-01-12 O'hara Shawn M Multiparameter analysis of comprehensive nucleic acids and morphological features on the same sample
US20060008824A1 (en) * 2004-05-20 2006-01-12 Leland Stanford Junior University Methods and compositions for clonal amplification of nucleic acid
US20060024678A1 (en) * 2004-07-28 2006-02-02 Helicos Biosciences Corporation Use of single-stranded nucleic acid binding proteins in sequencing
US20060024756A1 (en) * 2002-02-14 2006-02-02 Arjan Tibbe Methods and algorithms for cell enumeration in low-cost cytometer
US20060024711A1 (en) * 2004-07-02 2006-02-02 Helicos Biosciences Corporation Methods for nucleic acid amplification and sequence determination
US20060046258A1 (en) * 2004-02-27 2006-03-02 Lapidus Stanley N Applications of single molecule sequencing
US20060051265A1 (en) * 2004-09-08 2006-03-09 Health Research, Inc. Apparatus and method for sorting microstructures in a fluid medium
US20060060767A1 (en) * 2001-04-27 2006-03-23 Wang Mark M Methods and apparatus for use of optical forces for identification, characterization and/or sorting of particles
US20070017633A1 (en) * 2005-03-23 2007-01-25 Tonkovich Anna L Surface features in microprocess technology
US20070026417A1 (en) * 2005-07-29 2007-02-01 Martin Fuchs Devices and methods for enrichment and alteration of circulating tumor cells and other particles
US20070026413A1 (en) * 2005-07-29 2007-02-01 Mehmet Toner Devices and methods for enrichment and alteration of circulating tumor cells and other particles
US20070026415A1 (en) * 2005-07-29 2007-02-01 Martin Fuchs Devices and methods for enrichment and alteration of circulating tumor cells and other particles
US20070026419A1 (en) * 2005-07-29 2007-02-01 Martin Fuchs Devices and methods for enrichment and alteration of circulating tumor cells and other particles
US20070026381A1 (en) * 2005-04-05 2007-02-01 Huang Lotien R Devices and methods for enrichment and alteration of cells and other particles
US20070026414A1 (en) * 2005-07-29 2007-02-01 Martin Fuchs Devices and methods for enrichment and alteration of circulating tumor cells and other particles
US20070026418A1 (en) * 2005-07-29 2007-02-01 Martin Fuchs Devices and methods for enrichment and alteration of circulating tumor cells and other particles
US20070026469A1 (en) * 2005-07-29 2007-02-01 Martin Fuchs Devices and methods for enrichment and alteration of circulating tumor cells and other particles
US20070026416A1 (en) * 2005-07-29 2007-02-01 Martin Fuchs Devices and methods for enrichment and alteration of circulating tumor cells and other particles
US7171975B2 (en) * 2002-02-12 2007-02-06 Kionix, Inc. Fabrication of ultra-shallow channels for microfluidic devices and systems
US20070037273A1 (en) * 2001-04-25 2007-02-15 Michael Shuler Devices and methods for pharmacokinetic-based cell culture system
US20070037172A1 (en) * 2005-08-11 2007-02-15 Chiu Daniel T Separation and concentration of biological cells and biological particles using a one-dimensional channel
US20070037173A1 (en) * 2005-08-12 2007-02-15 Allard Jeffrey W Circulating tumor cells (CTC's): early assessment of time to progression, survival and response to therapy in metastatic cancer patients
US20070042339A1 (en) * 2003-08-08 2007-02-22 Massachusetts General Hospital Preservation of biomaterials with transported preservation agents
US20070042360A1 (en) * 2001-09-17 2007-02-22 Eos Biotechnology, Inc. Methods of diagnosis of cancer, compositions and methods of screening for modulators of cancer
US20070042238A1 (en) * 2005-08-22 2007-02-22 Lg Electronics Inc. Fuel cell having water type radiating device
US20070042368A1 (en) * 2003-03-24 2007-02-22 Corixa Corporation Detection and monitoring of lung cancer
US20070048750A1 (en) * 2005-09-01 2007-03-01 National Health Research Institute Rapid efficacy assessment method for lung cancer therapy
US20070054287A1 (en) * 2005-05-31 2007-03-08 Applera Corporation Method for identifying medically important cell populations using micro rna as tissue specific biomarkers
US20070054268A1 (en) * 2002-09-05 2007-03-08 Robert Sutherland Methods of diagnosis and prognosis of ovarian cancer
US20080020390A1 (en) * 2006-02-28 2008-01-24 Mitchell Aoy T Detecting fetal chromosomal abnormalities using tandem single nucleotide polymorphisms
US20080023399A1 (en) * 2006-06-01 2008-01-31 Inglis David W Apparatus and method for continuous particle separation
US20080026390A1 (en) * 2006-06-14 2008-01-31 Roland Stoughton Diagnosis of Fetal Abnormalities by Comparative Genomic Hybridization Analysis
US20080038733A1 (en) * 2006-03-28 2008-02-14 Baylor College Of Medicine Screening for down syndrome
US7332277B2 (en) * 2002-03-01 2008-02-19 Ravgen, Inc. Methods for detection of genetic disorders
US7476363B2 (en) * 2003-04-03 2009-01-13 Fluidigm Corporation Microfluidic devices and methods of using same
US20090029377A1 (en) * 2007-07-23 2009-01-29 The Chinese University Of Hong Kong Diagnosing fetal chromosomal aneuploidy using massively parallel genomic sequencing
US7645576B2 (en) * 2005-03-18 2010-01-12 The Chinese University Of Hong Kong Method for the detection of chromosomal aneuploidies
US7655399B2 (en) * 2003-10-08 2010-02-02 Trustees Of Boston University Methods for prenatal diagnosis of chromosomal abnormalities

Family Cites Families (467)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US3560754A (en) 1965-11-17 1971-02-02 Ibm Photoelectric particle separator using time delay
DE3274800D1 (en) 1981-02-05 1987-02-05 Asahi Chemical Ind Apparatus for separating blood components
US5310674A (en) 1982-05-10 1994-05-10 Bar-Ilan University Apertured cell carrier
US4508625A (en) 1982-10-18 1985-04-02 Graham Marshall D Magnetic separation using chelated magnetic ions
US4675286A (en) 1985-01-28 1987-06-23 Aspen Diagnostics, Inc. Fetal cell separation and testing
US4683202A (en) 1985-03-28 1987-07-28 Cetus Corporation Process for amplifying nucleic acid sequences
US5164598A (en) 1985-08-05 1992-11-17 Biotrack Capillary flow device
US7115709B1 (en) 1986-01-16 2006-10-03 The Regents Of The University Of California Methods of staining target chromosomal DNA employing high complexity nucleic acid probes
US5721098A (en) 1986-01-16 1998-02-24 The Regents Of The University Of California Comparative genomic hybridization
US4789628A (en) 1986-06-16 1988-12-06 Vxr, Inc. Devices for carrying out ligand/anti-ligand assays, methods of using such devices and diagnostic reagents and kits incorporating such devices
US4886761A (en) 1987-03-26 1989-12-12 Yellowstone Diagnostics Corporation Polysilicon binding assay support and methods
US4971904A (en) 1987-06-26 1990-11-20 E. I. Du Pont De Nemours And Company Heterogeneous immunoassay
US4936465A (en) 1987-12-07 1990-06-26 Zoeld Tibor Method and apparatus for fast, reliable, and environmentally safe dispensing of fluids, gases and individual particles of a suspension through pressure control at well defined parts of a closed flow-through system
US4977078A (en) 1987-12-22 1990-12-11 Olympus Optical Co., Ltd. Plate substrate immunoassay device and method for performing a multi-test immunoassay on a specimen
CA1339210C (en) 1988-05-31 1997-08-05 John Lewicki Recombinant techniques for production of novel natriuretic and vasodilator peptides
US5215926A (en) 1988-06-03 1993-06-01 Cellpro, Inc. Procedure for designing efficient affinity cell separation processes
ATE161960T1 (en) 1988-12-06 1998-01-15 Flinders Technologies Pty Ltd ISOLATION OF FETAL CELLS FROM MATERNAL BLOOD TO PERFORM PRENATAL DIAGNOSTICS
CA1340565C (en) 1989-06-29 1999-05-25 Thomas B. Okarma Device and process for cell capture and recovery
US5302509A (en) 1989-08-14 1994-04-12 Beckman Instruments, Inc. Method for sequencing polynucleotides
ATE162631T1 (en) 1989-11-13 1998-02-15 Childrens Medical Center A NON-INVASIVE METHOD FOR SEPARATION AND DETECTION OF FETAL DNA
US5770029A (en) 1996-07-30 1998-06-23 Soane Biosciences Integrated electrophoretic microdevices
US5153117A (en) 1990-03-27 1992-10-06 Genetype A.G. Fetal cell recovery method
CA2036946C (en) 1990-04-06 2001-10-16 Kenneth V. Deugau Indexing linkers
CA2081203A1 (en) 1990-04-23 1991-10-24 Ronald J. Berenson Method for enriching fetal cells from maternal blood
US5622831A (en) 1990-09-26 1997-04-22 Immunivest Corporation Methods and devices for manipulation of magnetically collected material
US5541072A (en) 1994-04-18 1996-07-30 Immunivest Corporation Method for magnetic separation featuring magnetic particles in a multi-phase system
US5217627A (en) 1990-11-06 1993-06-08 Pall Corporation System and method for processing biological fluid
US5646001A (en) 1991-03-25 1997-07-08 Immunivest Corporation Affinity-binding separation and release of one or more selected subset of biological entities from a mixed population thereof
US5846708A (en) 1991-11-19 1998-12-08 Massachusetts Institiute Of Technology Optical and electrical methods and apparatus for molecule detection
JP3558294B2 (en) 1992-05-01 2004-08-25 トラスティーズ・オブ・ザ・ユニバーシティ・オブ・ペンシルベニア Polynucleotide amplification analysis using microfabrication equipment
US5304487A (en) 1992-05-01 1994-04-19 Trustees Of The University Of Pennsylvania Fluid handling in mesoscale analytical devices
US6143576A (en) 1992-05-21 2000-11-07 Biosite Diagnostics, Inc. Non-porous diagnostic devices for the controlled movement of reagents
US6156270A (en) 1992-05-21 2000-12-05 Biosite Diagnostics, Inc. Diagnostic devices and apparatus for the controlled movement of reagents without membranes
WO1994003638A1 (en) 1992-07-30 1994-02-17 Applied Biosystems, Inc. Method of detecting aneuploidy by amplified short tandem repeats
DE4244715C2 (en) 1992-08-26 1995-06-14 Kuebler Gmbh Dr Process for the preparation of individual-specific anti-tumor antigen monoclonal antibodies
US5489506A (en) 1992-10-26 1996-02-06 Biolife Systems, Inc. Dielectrophoretic cell stream sorter
US6953668B1 (en) 1992-11-05 2005-10-11 Sloan-Kettering Institute For Cancer Research Prostate-specific membrane antigen
EP1757694A3 (en) 1992-11-05 2008-02-27 Sloan Kettering Institute For Cancer Research Prostate-specific membrane antigen
US5427663A (en) 1993-06-08 1995-06-27 British Technology Group Usa Inc. Microlithographic array for macromolecule and cell fractionation
US6027923A (en) 1993-07-23 2000-02-22 Bio-Rad Laboratories, Inc. Linked linear amplification of nucleic acids
US5556773A (en) 1993-08-06 1996-09-17 Yourno; Joseph Method and apparatus for nested polymerase chain reaction (PCR) with single closed reaction tubes
AU7921194A (en) 1993-09-27 1995-04-18 Oncor, Inc. Methods for detecting and analyzing individual rare cells in a population
EP1157743B1 (en) 1993-10-28 2009-03-11 Houston Advanced Research Center Microfabricated, flowthrough porous apparatus for discrete detection of binding reactions
WO1996026272A1 (en) 1995-02-24 1996-08-29 Sloan-Kettering Institute For Cancer Research Prostate-specific membrane antigen and uses thereof
US5432054A (en) 1994-01-31 1995-07-11 Applied Imaging Method for separating rare cells from a population of cells
US5798042A (en) 1994-03-07 1998-08-25 Regents Of The University Of California Microfabricated filter with specially constructed channel walls, and containment well and capsule constructed with such filters
NO180658C (en) 1994-03-10 1997-05-21 Oeystein Fodstad Method and Device for Detecting Specific Target Cells in Specialized or Mixed Cell Populations and Solutions Containing Mixed Cell Populations
US5962332A (en) 1994-03-17 1999-10-05 University Of Massachusetts Detection of trinucleotide repeats by in situ hybridization
US6071394A (en) 1996-09-06 2000-06-06 Nanogen, Inc. Channel-less separation of bioparticles on a bioelectronic chip by dielectrophoresis
US5840502A (en) 1994-08-31 1998-11-24 Activated Cell Therapy, Inc. Methods for enriching specific cell-types by density gradient centrifugation
US5695934A (en) 1994-10-13 1997-12-09 Lynx Therapeutics, Inc. Massively parallel sequencing of sorted polynucleotides
US5662813A (en) 1994-10-21 1997-09-02 Bioseparations, Inc. Method for separation of nucleated fetal erythrocytes from maternal blood samples
ATE269160T1 (en) 1994-11-14 2004-07-15 Univ Pennsylvania MINIATURIZED SAMPLE PREPARATION DEVICES AND SYSTEMS FOR DETECTING AND TREATING ANALYTES
US5750339A (en) 1994-11-30 1998-05-12 Thomas Jefferson University Methods for identifying fetal cells
US5639669A (en) 1995-06-07 1997-06-17 Ledley; Robert Separation of fetal cells from maternal blood
US5856174A (en) 1995-06-29 1999-01-05 Affymetrix, Inc. Integrated nucleic acid diagnostic device
US6190870B1 (en) 1995-08-28 2001-02-20 Amcell Corporation Efficient enrichment and detection of disseminated tumor cells
US5661028A (en) 1995-09-29 1997-08-26 Lockheed Martin Energy Systems, Inc. Large scale DNA microsequencing device
US6582904B2 (en) 1995-11-16 2003-06-24 Michael W. Dahm Method of quantifying tumour cells in a body fluid and a suitable test kit
US5780231A (en) 1995-11-17 1998-07-14 Lynx Therapeutics, Inc. DNA extension and analysis with rolling primers
DE69612013T2 (en) 1995-11-21 2001-08-02 Univ Yale New Haven UNIMOLECULAR SEGMENT AMPLIFICATION AND DETERMINATION
US20030119724A1 (en) 1995-11-22 2003-06-26 Ts`O Paul O.P. Ligands to enhance cellular uptake of biomolecules
CA2238379A1 (en) 1995-11-22 1997-06-12 The Johns-Hopkins University Ligands to enhance cellular uptake of biomolecules
US6718053B1 (en) 1996-11-27 2004-04-06 Chromavision Medical Systems, Inc. Method and apparatus for automated image analysis of biological specimens
EP1300713A3 (en) 1995-11-30 2004-11-03 Chromavision Medical Systems, Inc. Method and apparatus for automated image analysis of biological specimens
US5670325A (en) 1996-08-14 1997-09-23 Exact Laboratories, Inc. Method for the detection of clonal populations of transformed cells in a genomically heterogeneous cellular sample
US5863502A (en) 1996-01-24 1999-01-26 Sarnoff Corporation Parallel reaction cassette and associated devices
NO961031D0 (en) 1996-03-13 1996-03-13 Det Norske Radiumshospital Tum Procedure for killing unwanted target cells
US5972721A (en) 1996-03-14 1999-10-26 The United States Of America As Represented By The Secretary Of The Air Force Immunomagnetic assay system for clinical diagnosis and other purposes
CA2248981C (en) 1996-03-15 2009-11-24 The Penn State Research Foundation Detection of extracellular tumor-associated nucleic acid in blood plasma or serum using nucleic acid amplification assays
US5891651A (en) 1996-03-29 1999-04-06 Mayo Foundation For Medical Education And Research Methods of recovering colorectal epithelial cells or fragments thereof from stool
US7297331B2 (en) 1996-04-03 2007-11-20 The Rogosin Institute Beads containing restricted cancer cells producing material suppressing cancer cell proliferation
EP0891550A1 (en) 1996-04-05 1999-01-20 The Johns Hopkins University School Of Medicine A method of enriching rare cells
US6387707B1 (en) 1996-04-25 2002-05-14 Bioarray Solutions Array Cytometry
US6958245B2 (en) 1996-04-25 2005-10-25 Bioarray Solutions Ltd. Array cytometry
US5989835A (en) 1997-02-27 1999-11-23 Cellomics, Inc. System for cell-based screening
US6890426B2 (en) 1996-06-07 2005-05-10 Immunivest Corporation Magnetic separation apparatus and methods
NZ333346A (en) 1996-06-28 2000-03-27 Caliper Techn Corp High-throughput screening assay systems in microscale fluidic devices
IT1294964B1 (en) 1996-07-12 1999-04-23 Domenico Valerio INSULATION AND CULTURE OF FETAL CELLS FROM THE MATERNAL PERIPHERAL BLOOD
US6280967B1 (en) 1996-08-02 2001-08-28 Axiom Biotechnologies, Inc. Cell flow apparatus and method for real-time of cellular responses
US6100029A (en) 1996-08-14 2000-08-08 Exact Laboratories, Inc. Methods for the detection of chromosomal aberrations
US6300077B1 (en) 1996-08-14 2001-10-09 Exact Sciences Corporation Methods for the detection of nucleic acids
AU4164597A (en) 1996-08-26 1998-03-19 Princeton University Reversibly sealable microstructure sorting devices
JP2002503334A (en) 1996-09-04 2002-01-29 テクニカル ユニバーシティ オブ デンマーク Microflow system for particle separation and analysis
GB9620209D0 (en) 1996-09-27 1996-11-13 Cemu Bioteknik Ab Method of sequencing DNA
EP0941335A2 (en) 1996-10-31 1999-09-15 Human Genome Sciences Streptococcus pneumoniae polynucleotides and sequences
US6008010A (en) 1996-11-01 1999-12-28 University Of Pittsburgh Method and apparatus for holding cells
NO308755B1 (en) 1996-12-20 2000-10-23 Iystein Fodstad Method for characterizing abnormal cells, use and kits for carrying out the method
US6235474B1 (en) 1996-12-30 2001-05-22 The Johns Hopkins University Methods and kits for diagnosing and determination of the predisposition for diseases
US5879624A (en) 1997-01-15 1999-03-09 Boehringer Laboratories, Inc. Method and apparatus for collecting and processing blood
US6306584B1 (en) 1997-01-21 2001-10-23 President And Fellows Of Harvard College Electronic-property probing of biological molecules at surfaces
US6008007A (en) 1997-01-31 1999-12-28 Oncotech, Inc. Radiation resistance assay for predicting treatment response and clinical outcome
HUP0003152A3 (en) 1997-02-28 2002-09-30 Burstein Lab Inc Irvine Laboratory in a disk
GB9704444D0 (en) 1997-03-04 1997-04-23 Isis Innovation Non-invasive prenatal diagnosis
US20010051341A1 (en) 1997-03-04 2001-12-13 Isis Innovation Limited Non-invasive prenatal diagnosis
US6623983B1 (en) 1997-03-25 2003-09-23 Immunivest Corporation Apparatus and methods for capture and analysis of particulate entities
US6391622B1 (en) 1997-04-04 2002-05-21 Caliper Technologies Corp. Closed-loop biochemical analyzers
TR199902553T2 (en) 1997-04-14 2000-03-21 Micromet Gesellschaft F�R Biomedizinische Forschung Mbh New methods and uses for the production of antigen receptors against the human body.
US6066449A (en) 1997-04-15 2000-05-23 The Trustees Of Columbia University In The City Of New York Method of detecting metastatic thyroid cancer
US6143496A (en) 1997-04-17 2000-11-07 Cytonix Corporation Method of sampling, amplifying and quantifying segment of nucleic acid, polymerase chain reaction assembly having nanoliter-sized sample chambers, and method of filling assembly
WO1998049344A1 (en) 1997-04-28 1998-11-05 Lockheed Martin Energy Research Corporation Method and apparatus for analyzing nucleic acids
US6632619B1 (en) 1997-05-16 2003-10-14 The Governors Of The University Of Alberta Microfluidic system and methods of use
US6156273A (en) 1997-05-27 2000-12-05 Purdue Research Corporation Separation columns and methods for manufacturing the improved separation columns
JP4124830B2 (en) 1997-06-12 2008-07-23 クリニカル・マイクロ・センサーズ・インコーポレイテッド Electrical method for analyte detection
US6566101B1 (en) 1997-06-16 2003-05-20 Anthony P. Shuber Primer extension methods for detecting nucleic acids
US6294331B1 (en) 1997-08-08 2001-09-25 The United States Of America As Represented By The Department Of Health And Human Services Methods for assessing genetic and phenotypic markers by simultaneous multicolor visualization of chromogenic dyes using brightfield microscopy and spectral imaging
US6368871B1 (en) 1997-08-13 2002-04-09 Cepheid Non-planar microstructures for manipulation of fluid samples
US6540895B1 (en) 1997-09-23 2003-04-01 California Institute Of Technology Microfabricated cell sorter for chemical and biological materials
US7214298B2 (en) 1997-09-23 2007-05-08 California Institute Of Technology Microfabricated cell sorter
US6124120A (en) 1997-10-08 2000-09-26 Yale University Multiple displacement amplification
US5962234A (en) 1997-10-20 1999-10-05 Applied Imaging Corporation Use of anti-embryonic epsilon hemoglobin antibodies to identify fetal cells
US6120985A (en) 1997-10-31 2000-09-19 Bbi Bioseq, Inc. Pressure-enhanced extraction and purification
CA2253965C (en) 1997-11-22 2003-01-21 Robert A. Levine Method for the detection, identification, enumeration and confirmation of circulating cancer cells and/or hematologic progenitor cells in whole blood
CA2318880C (en) 1998-02-04 2010-07-27 Perkin-Elmer Corporation Determination of a genotype of an amplification product at multiple allelic sites
JP2002503814A (en) 1998-02-12 2002-02-05 イムニベスト・コーポレイション Methods and reagents for rapid and efficient isolation of circulating cancer cells
US20020172987A1 (en) 1998-02-12 2002-11-21 Terstappen Leon W.M.M. Methods and reagents for the rapid and efficient isolation of circulating cancer cells
US6036857A (en) 1998-02-20 2000-03-14 Florida State University Research Foundation, Inc. Apparatus for continuous magnetic separation of components from a mixture
CA2322282A1 (en) 1998-02-27 1999-09-02 Cli Oncology, Inc. Method and compositions for differential detection of primary tumor cells and metastatic cells
US6210910B1 (en) 1998-03-02 2001-04-03 Trustees Of Tufts College Optical fiber biosensor array comprising cell populations confined to microcavities
GB9805918D0 (en) 1998-03-19 1998-05-13 Nycomed Amersham Plc Sequencing by hybridisation
CA2323725A1 (en) 1998-03-20 1999-09-23 The Rockefeller University Assays for screening compounds which interact with cation channel proteins, mutant prokaryotic cation channel proteins, and uses thereof
US20070092917A1 (en) 1998-05-01 2007-04-26 Isabelle Guyon Biomarkers for screening, predicting, and monitoring prostate disease
EP1078257A4 (en) 1998-05-09 2007-07-18 Iconisys Inc Method and apparatus for computer controlled rare cell, including fetal cell, based diagnosis
ATE530891T1 (en) 1998-05-22 2011-11-15 California Inst Of Techn MINIATURIZED CELL SORTER
US6606413B1 (en) 1998-06-01 2003-08-12 Trestle Acquisition Corp. Compression packaged image transmission for telemicroscopy
US6576478B1 (en) 1998-07-14 2003-06-10 Zyomyx, Inc. Microdevices for high-throughput screening of biomolecules
US6897073B2 (en) 1998-07-14 2005-05-24 Zyomyx, Inc. Non-specific binding resistant protein arrays and methods for making the same
WO2000005582A2 (en) 1998-07-21 2000-02-03 Burstein Laboratories, Inc. Optical disc-based assay devices and methods
WO2000006770A1 (en) 1998-07-30 2000-02-10 Solexa Ltd. Arrayed biomolecules and their use in sequencing
US6245227B1 (en) 1998-09-17 2001-06-12 Kionix, Inc. Integrated monolithic microfabricated electrospray and liquid chromatography system and method
US6637463B1 (en) 1998-10-13 2003-10-28 Biomicro Systems, Inc. Multi-channel microfluidic system design with balanced fluid flow distribution
WO2000026666A2 (en) 1998-10-29 2000-05-11 Cell Works Inc. Multiple marker characterization of single cells
US6086740A (en) 1998-10-29 2000-07-11 Caliper Technologies Corp. Multiplexed microfluidic devices and systems
US6277489B1 (en) 1998-12-04 2001-08-21 The Regents Of The University Of California Support for high performance affinity chromatography and other uses
ES2310055T3 (en) 1998-12-16 2008-12-16 Novartis Vaccines & Diagnostic CYCLIN DEPENDENT HUMAN KINASE (HPNQALRE).
JP2002536962A (en) 1998-12-23 2002-11-05 ナノゲン・インコーポレイテッド Integrated portable biological detection system
US6887693B2 (en) 1998-12-24 2005-05-03 Cepheid Device and method for lysing cells, spores, or microorganisms
GB9828785D0 (en) 1998-12-30 1999-02-17 Amersham Pharm Biotech Ab Sequencing systems
US6150119A (en) 1999-01-19 2000-11-21 Caliper Technologies Corp. Optimized high-throughput analytical system
AU2876900A (en) 1999-02-10 2000-08-29 Cell Works Inc. Class characterization of circulating cancer cells isolated from body fluids andmethods of use
EP1163052B1 (en) 1999-02-23 2010-06-02 Caliper Life Sciences, Inc. Manipulation of microparticles in microfluidic systems
TW496775B (en) 1999-03-15 2002-08-01 Aviva Bioscience Corp Individually addressable micro-electromagnetic unit array chips
JP2002541494A (en) 1999-04-13 2002-12-03 クロマビジョン メディカル システムズ インコーポレイテッド Histological reconstruction and automatic image analysis
US6942771B1 (en) 1999-04-21 2005-09-13 Clinical Micro Sensors, Inc. Microfluidic systems in the electrochemical detection of target analytes
US6994969B1 (en) 1999-04-30 2006-02-07 Methexis Genomics, N.V. Diagnostic sequencing by a combination of specific cleavage and mass spectrometry
US7166573B1 (en) 1999-05-28 2007-01-23 Ludwig Institute For Cancer Research Breast, gastric and prostate cancer associated antigens and uses therefor
US6818395B1 (en) 1999-06-28 2004-11-16 California Institute Of Technology Methods and apparatus for analyzing polynucleotide sequences
US6440706B1 (en) 1999-08-02 2002-08-27 Johns Hopkins University Digital amplification
US7192698B1 (en) 1999-08-17 2007-03-20 Purdue Research Foundation EphA2 as a diagnostic target for metastatic cancer
FR2798673B1 (en) 1999-09-16 2004-05-28 Exonhit Therapeutics Sa METHODS AND COMPOSITIONS FOR DETECTION OF PATHOLOGICAL EVENTS
US6623945B1 (en) 1999-09-16 2003-09-23 Motorola, Inc. System and method for microwave cell lysing of small samples
US6274320B1 (en) 1999-09-16 2001-08-14 Curagen Corporation Method of sequencing a nucleic acid
AU4504001A (en) 1999-11-04 2001-06-04 Princeton University Electrodeless dielectrophoresis for polarizable particles
CA2390375A1 (en) 1999-11-10 2001-05-17 Massachusetts Institute Of Technology Cell analysis and sorting apparatus for manipulation of cells
US20060128006A1 (en) 1999-11-10 2006-06-15 Gerhardt Antimony L Hydrodynamic capture and release mechanisms for particle manipulation
US6692952B1 (en) 1999-11-10 2004-02-17 Massachusetts Institute Of Technology Cell analysis and sorting apparatus for manipulation of cells
US6875619B2 (en) 1999-11-12 2005-04-05 Motorola, Inc. Microfluidic devices comprising biochannels
WO2001037192A1 (en) 1999-11-18 2001-05-25 Ikonisys, Inc. Method and apparatus for computer controlled cell based diagnosis
AU2001227913A1 (en) 2000-01-13 2001-07-24 Immunivest Corporation Ferrofluid based arrays
CA2398107C (en) 2000-01-28 2013-11-19 Althea Technologies, Inc. Methods for analysis of gene expression
US7582420B2 (en) 2001-07-12 2009-09-01 Illumina, Inc. Multiplex nucleic acid reactions
US7955794B2 (en) 2000-09-21 2011-06-07 Illumina, Inc. Multiplex nucleic acid reactions
US20030219765A1 (en) 2000-03-23 2003-11-27 Jose Costa Methods for evaluating cancer risk
US20030170631A1 (en) 2000-04-03 2003-09-11 Corixa Corporation Methods, compositions and kits for the detection and monitoring of breast cancer
US7641856B2 (en) 2004-05-14 2010-01-05 Honeywell International Inc. Portable sample analyzer with removable cartridge
ATE304174T1 (en) 2000-06-14 2005-09-15 Univ Texas SYSTEMS AND METHODS FOR CELL PART POPULATION ANALYSIS
US7083924B2 (en) 2000-07-10 2006-08-01 Btg International Limited Diagnostic method for the identification of foetal DNA in a material sample
US6984522B2 (en) 2000-08-03 2006-01-10 Regents Of The University Of Michigan Isolation and use of solid tumor stem cells
AU2000274922A1 (en) 2000-08-08 2002-02-18 Aviva Biosciences Corporation Methods for manipulating moieties in microfluidic systems
US6610499B1 (en) 2000-08-31 2003-08-26 The Regents Of The University Of California Capillary array and related methods
GB0021617D0 (en) 2000-09-02 2000-10-18 Imp College Innovations Ltd Diagnosis and treatment of cancer
US20020164825A1 (en) 2000-09-09 2002-11-07 Wen-Tien Chen Cell separation matrix
CA2422162C (en) 2000-09-09 2012-10-23 The Research Foundation Of State University Of New York Method and compositions for isolating metastatic cancer cells, and use in measuring metastatic potential of a cancer thereof
EP1334347A1 (en) 2000-09-15 2003-08-13 California Institute Of Technology Microfabricated crossflow devices and methods
CA2421828A1 (en) 2000-09-30 2002-04-11 Xiao-Bo Wang Apparatuses containing multiple force generating elements and uses thereof
WO2002031506A1 (en) 2000-10-09 2002-04-18 Aviva Biosciences Coropration Compositions and methods for separation of moieties on chips
CA2424941A1 (en) 2000-10-10 2002-04-18 Aviva Biosciences Corporation An integrated biochip system for sample preparation and analysis
US6664056B2 (en) 2000-10-17 2003-12-16 The Chinese University Of Hong Kong Non-invasive prenatal monitoring
CA2427319A1 (en) 2000-10-30 2002-12-27 Gene Logic, Inc. Partially double-stranded nucleic acids, methods of making, and use thereof
US20020115163A1 (en) 2000-11-13 2002-08-22 Genoptix Methods for sorting particles by size and elasticity
US6784420B2 (en) 2000-11-13 2004-08-31 Genoptix, Inc. Method of separating particles using an optical gradient
US6744038B2 (en) 2000-11-13 2004-06-01 Genoptix, Inc. Methods of separating particles using an optical gradient
US20020108859A1 (en) 2000-11-13 2002-08-15 Genoptix Methods for modifying interaction between dielectric particles and surfaces
US20020123112A1 (en) 2000-11-13 2002-09-05 Genoptix Methods for increasing detection sensitivity in optical dielectric sorting systems
US6833542B2 (en) 2000-11-13 2004-12-21 Genoptix, Inc. Method for sorting particles
CA2428757A1 (en) 2000-11-15 2002-07-18 Roche Diagnostics Corporation Methods and reagents for identifying rare fetal cells in the maternal circulation
US6495340B2 (en) 2000-11-28 2002-12-17 Medis El Ltd. Cell carrier grids
JP2004536027A (en) 2000-12-01 2004-12-02 ジョーンズ・ホプキンス・ユニーバーシティー Glycosylated / galactosylated peptide conjugates, bifunctional linkers, and nucleotide monomers / polymers, and related compositions and methods of use
US6770434B2 (en) 2000-12-29 2004-08-03 The Provost, Fellows And Scholars Of The College Of The Holy & Undivided Trinity Of Queen Elizabeth Near Dublin Biological assay method
US7205157B2 (en) 2001-01-08 2007-04-17 Becton, Dickinson And Company Method of separating cells from a sample
US6993169B2 (en) 2001-01-11 2006-01-31 Trestle Corporation System and method for finding regions of interest for microscopic digital montage imaging
WO2002057786A2 (en) 2001-01-18 2002-07-25 The Regents Of The University Of Michigan Compositions and methods for the use of fibronectin fragments in the diagnosis of cancer
EP1360333A2 (en) 2001-01-31 2003-11-12 Ambion, Inc. Comparative analysis of nucleic acids using population tagging
US20020160363A1 (en) 2001-01-31 2002-10-31 Mcdevitt John T. Magnetic-based placement and retention of sensor elements in a sensor array
US20020110835A1 (en) 2001-02-13 2002-08-15 Rajan Kumar Microfluidic devices and methods
US6913697B2 (en) 2001-02-14 2005-07-05 Science & Technology Corporation @ Unm Nanostructured separation and analysis devices for biological membranes
GB0104690D0 (en) 2001-02-26 2001-04-11 Cytogenetic Dna Services Ltd Diagnostic test
US7078168B2 (en) 2001-02-27 2006-07-18 Biotage Ab Method for determining allele frequencies
US20050196785A1 (en) 2001-03-05 2005-09-08 California Institute Of Technology Combinational array for nucleic acid analysis
US20030190602A1 (en) 2001-03-12 2003-10-09 Monogen, Inc. Cell-based detection and differentiation of disease states
US6939670B2 (en) 2001-03-12 2005-09-06 Monogen, Inc. Cell-based detection and differentiation of lung cancer
AU2002307152A1 (en) 2001-04-06 2002-10-21 California Institute Of Technology Nucleic acid amplification utilizing microfluidic devices
US20020164816A1 (en) 2001-04-06 2002-11-07 California Institute Of Technology Microfluidic sample separation device
WO2002081710A1 (en) 2001-04-06 2002-10-17 The Government Of The United States Of America, As Represented By The Secretary, Department Of Health And Human Services Artificial chromosomes that can shuttle between bacteria, yeast, and mammalian cells
US7713705B2 (en) 2002-12-24 2010-05-11 Biosite, Inc. Markers for differential diagnosis and methods of use thereof
US7262030B2 (en) 2001-05-09 2007-08-28 Virginia Commonwealth University Multiple sequencible and ligatible structures for genomic analysis
US20020166760A1 (en) 2001-05-11 2002-11-14 Prentiss Mara G. Micromagentic systems and methods for microfluidics
US7118907B2 (en) 2001-06-06 2006-10-10 Li-Cor, Inc. Single molecule detection systems and methods
US7189507B2 (en) 2001-06-18 2007-03-13 Pdl Biopharma, Inc. Methods of diagnosis of ovarian cancer, compositions and methods of screening for modulators of ovarian cancer
WO2003003057A2 (en) 2001-06-27 2003-01-09 Bioview Ltd. System and method for capturing multi-color fish images
US20060019235A1 (en) 2001-07-02 2006-01-26 The Board Of Trustees Of The Leland Stanford Junior University Molecular and functional profiling using a cellular microarray
US20050009022A1 (en) 2001-07-06 2005-01-13 Weiner Michael P. Method for isolation of independent, parallel chemical micro-reactions using a porous filter
US7381535B2 (en) 2002-07-10 2008-06-03 The Board Of Trustees Of The Leland Stanford Junior Methods and compositions for detecting receptor-ligand interactions in single cells
US6783928B2 (en) 2001-07-17 2004-08-31 Georgi Hvichia Microstructures for cell proliferation assays and semen analysis
US7993908B2 (en) 2001-07-17 2011-08-09 Parsortix, Inc. Microstructure for particle and cell separation, identification, sorting, and manipulation
KR20040030984A (en) 2001-08-23 2004-04-09 이뮤니베스트 코포레이션 Analysis of circulating tumor cells, fragments, and debris
US7863012B2 (en) 2004-02-17 2011-01-04 Veridex, Llc Analysis of circulating tumor cells, fragments, and debris
AUPR749901A0 (en) 2001-09-06 2001-09-27 Monash University Method of identifying chromosomal abnormalities and prenatal diagnosis
ES2284927T3 (en) 2001-09-06 2007-11-16 Adnagen Ag PROCEDURE AND KIT FOR DIAGNOSIS OR CONTROL OF CANCER TREATMENT.
US7202045B2 (en) 2001-09-19 2007-04-10 Regents Of The University Of Michigan Detection and treatment of cancers of the lung
AU2002343394A1 (en) 2001-09-21 2003-04-01 The Regents Of The University Of California Methods of cytodiagnostic staging of neoplasia and squamous cell carcinoma
US8980568B2 (en) 2001-10-11 2015-03-17 Aviva Biosciences Corporation Methods and compositions for detecting non-hematopoietic cells from a blood sample
US20030072682A1 (en) 2001-10-11 2003-04-17 Dan Kikinis Method and apparatus for performing biochemical testing in a microenvironment
US8986944B2 (en) 2001-10-11 2015-03-24 Aviva Biosciences Corporation Methods and compositions for separating rare cells from fluid samples
US7166443B2 (en) 2001-10-11 2007-01-23 Aviva Biosciences Corporation Methods, compositions, and automated systems for separating rare cells from fluid samples
US6949355B2 (en) 2001-10-11 2005-09-27 Aviva Biosciences Methods, compositions, and automated systems for separating rare cells from fluid samples
US6783647B2 (en) 2001-10-19 2004-08-31 Ut-Battelle, Llc Microfluidic systems and methods of transport and lysis of cells and analysis of cell lysate
KR20040047971A (en) 2001-10-26 2004-06-05 이뮤니베스트 코포레이션 Multiparameter analysis of comprehensive nucleic acids and morphological features on the same sample
US7262269B2 (en) 2001-10-26 2007-08-28 The Regents Of University Of California Method for screening combinational bead library; ligands for cancer cells
US20050095606A1 (en) 2001-10-30 2005-05-05 Glenn Hoke Partially double-stranded nucleic acids, methods of making, and use thereof
AU2002353443A1 (en) 2001-11-07 2003-05-19 Bioview Ltd. Kits and methods for preparing cell samples optimized for dual staining
US20030232350A1 (en) 2001-11-13 2003-12-18 Eos Biotechnology, Inc. Methods of diagnosis of cancer, compositions and methods of screening for modulators of cancer
US20050244843A1 (en) 2001-11-16 2005-11-03 Wen-Tien Chen Blood test prototypes and methods for the detection of circulating tumor and endothelial cells
AU2002366098A1 (en) 2001-11-19 2003-06-10 Parallele Bioscience Inc Multiplex pcr
DE60232013D1 (en) 2001-11-20 2009-05-28 Exact Sciences Corp AUTOMATIC SAMPLE PREPARATION METHOD AND DEVICES
AU2002219137A1 (en) 2001-11-22 2003-06-10 Adnagen Ag Diagnosis kit, dna chip, and methods for diagnosing or supervising the treatment of testicular cancer
EP1463796B1 (en) 2001-11-30 2013-01-09 Fluidigm Corporation Microfluidic device and methods of using same
KR100966779B1 (en) 2001-12-11 2010-06-29 가부시키가이샤 네테크 Blood cell separation system
WO2003060486A1 (en) 2002-01-10 2003-07-24 Board Of Regents, The University Of Texas System Flow sorting system and methods regarding same
US7383134B2 (en) 2002-01-15 2008-06-03 Piper James R Method and/or system for analyzing biological samples using a computer system
US20030178641A1 (en) 2002-01-23 2003-09-25 Blair Steven M. Microfluidic platforms for use with specific binding assays, specific binding assays that employ microfluidics, and methods
WO2003066191A1 (en) 2002-02-04 2003-08-14 Colorado School Of Mines Laminar flow-based separations of colloidal and cellular particles
US6826666B2 (en) * 2002-02-07 2004-11-30 Microsoft Corporation Method and system for transporting data content on a storage area network
US7764821B2 (en) 2002-02-14 2010-07-27 Veridex, Llc Methods and algorithms for cell enumeration in a low-cost cytometer
CA2477611A1 (en) 2002-03-01 2003-09-12 Ravgen, Inc. Rapid analysis of variations in a genome
EP2799555B1 (en) 2002-03-13 2017-02-22 Genomic Health, Inc. Gene expression profiling in biopsied tumor tissues
US7223371B2 (en) 2002-03-14 2007-05-29 Micronics, Inc. Microfluidic channel network device
AU2003285849A1 (en) 2002-03-20 2004-03-29 Advanced Sensor Technologies, Inc. Personal monitor to detect exposure to toxic agents
US7214427B2 (en) 2002-03-21 2007-05-08 Aviva Biosciences Corporation Composite beads comprising magnetizable substance and electro-conductive substance
US7312085B2 (en) 2002-04-01 2007-12-25 Fluidigm Corporation Microfluidic particle-analysis systems
US20040241707A1 (en) 2002-04-01 2004-12-02 Gao Chun L. Enhanced diagnostic potential of prostate-specific antigen expressing cells
EP1499706A4 (en) 2002-04-01 2010-11-03 Fluidigm Corp Microfluidic particle-analysis systems
JP2005524833A (en) 2002-05-03 2005-08-18 イムニベスト・コーポレイション Devices and methods for analytical cell imaging
US20070178478A1 (en) 2002-05-08 2007-08-02 Dhallan Ravinder S Methods for detection of genetic disorders
US7442506B2 (en) 2002-05-08 2008-10-28 Ravgen, Inc. Methods for detection of genetic disorders
US7727720B2 (en) 2002-05-08 2010-06-01 Ravgen, Inc. Methods for detection of genetic disorders
CA2526950C (en) 2002-05-27 2012-06-26 Leif Hakansson Method for determining immune system affecting compounds
US7272252B2 (en) 2002-06-12 2007-09-18 Clarient, Inc. Automated system for combining bright field and fluorescent microscopy
US7229838B2 (en) 2002-07-08 2007-06-12 Innovative Micro Technology MEMS actuator and method of manufacture for MEMS particle sorting device
US7220594B2 (en) 2002-07-08 2007-05-22 Innovative Micro Technology Method and apparatus for sorting particles with a MEMS device
US6838056B2 (en) 2002-07-08 2005-01-04 Innovative Micro Technology Method and apparatus for sorting biological cells with a MEMS device
US20040018611A1 (en) 2002-07-23 2004-01-29 Ward Michael Dennis Microfluidic devices for high gradient magnetic separation
US9435799B2 (en) 2002-07-31 2016-09-06 Janssen Diagnostics, Inc. Methods and reagents for improved selection of biological materials
US7252976B2 (en) 2002-08-28 2007-08-07 Board Of Regents The University Of Texas System Quantitative RT-PCR to AC133 to diagnose cancer and monitor angiogenic activity in a cell sample
ES2375724T3 (en) 2002-09-27 2012-03-05 The General Hospital Corporation MICROFLUDE DEVICE FOR SEPERATION OF CELLS AND ITS USES.
CN1684977A (en) 2002-09-27 2005-10-19 奥里迪斯生物医学研究及开发有限责任公司 Polypeptides and nucleic acids encoding these and their use for the prevention, diagnosis or treatment of liver disorders and epithelial cancer
ATE463292T1 (en) 2002-10-23 2010-04-15 Univ Princeton METHOD FOR CONTINUOUS PARTICLE SEPARATION USING OBSTACLE ARRAYS ASYMMETRICALLY ALIGNED IN FIELDS
US6811385B2 (en) 2002-10-31 2004-11-02 Hewlett-Packard Development Company, L.P. Acoustic micro-pump
WO2004042033A2 (en) 2002-11-01 2004-05-21 The Board Of Trustees Of The Leland Stanford Junior University Circulating stem cells and uses related thereto
US7122384B2 (en) 2002-11-06 2006-10-17 E. I. Du Pont De Nemours And Company Resonant light scattering microparticle methods
AU2002952696A0 (en) 2002-11-14 2002-11-28 Genomics Research Partners Pty Ltd Status determination
US7704687B2 (en) 2002-11-15 2010-04-27 The Johns Hopkins University Digital karyotyping
JP4078398B2 (en) * 2002-12-11 2008-04-23 ソニー・エリクソン・モバイルコミュニケーションズ株式会社 Information processing device
DE10259703A1 (en) 2002-12-19 2004-07-08 Ivonex Gmbh separation process
CN100379882C (en) 2003-01-17 2008-04-09 香港中文大学 Circulating mRNA as diagnostic markers for pregnancy-related disorders
US20040146883A1 (en) 2003-01-28 2004-07-29 Affymetrix, Inc. Methods for prenatal diagnosis
US6746503B1 (en) 2003-01-30 2004-06-08 The Regents Of The University Of California Precision gap particle separator
JP4593557B2 (en) 2003-02-27 2010-12-08 ベリデックス・リミテッド・ライアビリティ・カンパニー Circulating tumor cells (CTC): early assessment of time to progression, survival and response to therapy in patients with metastatic cancer
EP1604184A4 (en) 2003-02-27 2010-10-27 Stephen A Lesko Standardized evaluation of therapeutic efficacy based on cellular biomarkers
EP1599608A4 (en) 2003-03-05 2007-07-18 Genetic Technologies Ltd Identification of fetal dna and fetal cell markers in maternal plasma or serum
US20040209299A1 (en) 2003-03-07 2004-10-21 Rubicon Genomics, Inc. In vitro DNA immortalization and whole genome amplification using libraries generated from randomly fragmented DNA
DE10313201A1 (en) 2003-03-21 2004-10-07 Steag Microparts Gmbh Microstructured separator and microfluidic process for separating liquid components from a liquid containing particles
AU2003901671A0 (en) 2003-04-02 2003-05-01 The University Of Adelaide Comparative genomic hybridization
US7666361B2 (en) 2003-04-03 2010-02-23 Fluidigm Corporation Microfluidic devices and methods of using same
US20040197832A1 (en) 2003-04-03 2004-10-07 Mor Research Applications Ltd. Non-invasive prenatal genetic diagnosis using transcervical cells
US7604965B2 (en) 2003-04-03 2009-10-20 Fluidigm Corporation Thermal reaction device and method for using the same
AU2004226167A1 (en) 2003-04-03 2004-10-14 Institut National De La Sante Et De La Recherche Medicale (Inserm) Antibodies with enhanced ability to immunomodulate cell functions
US20050145496A1 (en) 2003-04-03 2005-07-07 Federico Goodsaid Thermal reaction device and method for using the same
US20040197839A1 (en) 2003-04-04 2004-10-07 Bioview Ltd. Methods of detecting cancer cells in biological samples
JP2004351309A (en) 2003-05-28 2004-12-16 Kyocera Corp Microchemical chip and its production method
CN1539992A (en) 2003-04-23 2004-10-27 林大钦 Method in use for testing gene of fetus in antepartum
US7319010B2 (en) 2003-05-12 2008-01-15 The Regents Of The University Of Michigan Detection and treatment of cancers of the colon
WO2005020784A2 (en) 2003-05-23 2005-03-10 Mount Sinai School Of Medicine Of New York University Surrogate cell gene expression signatures for evaluating the physical state of a subject
WO2005010147A2 (en) 2003-06-13 2005-02-03 The General Hospital Corporation Device and method for contacting pocoliter volumes of fluids
AU2004250131A1 (en) 2003-06-13 2004-12-29 The General Hospital Corporation Microfluidic systems for size based removal of red blood cells and platelets from blood
US20070092881A1 (en) 2003-07-10 2007-04-26 Central Institute For Experimental Animals Gene markers of tumor metastasis
US7461048B2 (en) 2003-07-21 2008-12-02 Aureon Laboratories, Inc. Systems and methods for treating, diagnosing and predicting the occurrence of a medical condition
EP1664716A4 (en) 2003-08-15 2008-08-13 Smithkline Beecham Corp Biomarkers in cancer
AU2004269406B2 (en) 2003-08-28 2010-12-16 Progenity, Inc. Methods and apparatus for sorting cells using an optical switch in a microfluidic channel network
US20070178458A1 (en) 2003-09-05 2007-08-02 O'brien Philippa Methods of diagnosis and prognosis of ovarian cancer II
EP2354253A3 (en) 2003-09-05 2011-11-16 Trustees of Boston University Method for non-invasive prenatal diagnosis
US7824856B2 (en) 2003-09-10 2010-11-02 Althea Technologies, Inc. Expression profiling using microarrays
US20070092444A1 (en) 2003-09-11 2007-04-26 The Uab Research Foundation Inhibition of inward sodium currents in cancer
CA2539108A1 (en) 2003-09-18 2005-03-31 Immunivest Corporation Operator independent programmable sample preparation and analysis system
US20070202109A1 (en) 2003-09-24 2007-08-30 Oncotherapy Science, Inc. Method Of Diagnosing Breast Cancer
DE60328193D1 (en) 2003-10-16 2009-08-13 Sequenom Inc Non-invasive detection of fetal genetic traits
US20050221341A1 (en) 2003-10-22 2005-10-06 Shimkets Richard A Sequence-based karyotyping
US8062849B2 (en) 2003-10-28 2011-11-22 The Johns Hopkins University Quantitative multiplex methylation-specific PCR
JP2007515947A (en) 2003-10-30 2007-06-21 タフツ−ニュー イングランド メディカル センター Prenatal diagnosis using acellular fetal DNA in amniotic fluid
EP1706720A4 (en) 2003-10-31 2007-02-28 Vitatex Inc Blood test prototypes and methods for the detection of circulating tumor and endothelial cells
US7169560B2 (en) 2003-11-12 2007-01-30 Helicos Biosciences Corporation Short cycle methods for sequencing polynucleotides
WO2005049168A2 (en) 2003-11-17 2005-06-02 Immunivest Corporation Method and apparatus for pre-enrichment and recovery of cells from densified whole blood
WO2005047532A1 (en) 2003-11-17 2005-05-26 Gribbles Molecular Science Pty Ltd Improved method of performing genetic analyses on reproductive tract cell samples
WO2005056838A1 (en) 2003-12-08 2005-06-23 The Clinic For Special Children Association of tspyl polymorphisms with siddt syndrome
JP5060134B2 (en) 2003-12-12 2012-10-31 ガバメント オブ ザ ユナイテッド ステイツ オブ アメリカ・アズ リプレゼンテッド バイ ザ セクレタリー・デパートメント オブ ヘルス アンド ヒューマン サービシーズ Epitope of human cytotoxic T lymphocytes and its non-variable number of non-VNTR (non-variable number of nucleotide repeat sequences) of MUC-1
US7939249B2 (en) 2003-12-24 2011-05-10 3M Innovative Properties Company Methods for nucleic acid isolation and kits using a microfluidic device and concentration step
US20050147977A1 (en) 2003-12-29 2005-07-07 Tae-Woong Koo Methods and compositions for nucleic acid detection and sequence analysis
CN1590563A (en) 2004-01-07 2005-03-09 四川大学 Detecting method of biological noneuploid
EP2311873B1 (en) 2004-01-07 2018-08-29 Novartis Vaccines and Diagnostics, Inc. M-csf-specific monoclonal antibody and uses thereof
EP1561507A1 (en) 2004-01-27 2005-08-10 Future Diagnostics B.V. System for characterising a fluid, microfluidic device for characterising or analysing concentration components, a method of characterising or analysing such concentrations and a measurement device
US7425253B2 (en) 2004-01-29 2008-09-16 Massachusetts Institute Of Technology Microscale sorting cytometer
US20050181353A1 (en) 2004-02-17 2005-08-18 Rao Galla C. Stabilization of cells and biological specimens for analysis
US20100216151A1 (en) 2004-02-27 2010-08-26 Helicos Biosciences Corporation Methods for detecting fetal nucleic acids and diagnosing fetal abnormalities
EP1725684A2 (en) 2004-02-27 2006-11-29 Applera Corporation Genetic polymorphisms associated with stroke, methods of detection and uses thereof
US20100216153A1 (en) 2004-02-27 2010-08-26 Helicos Biosciences Corporation Methods for detecting fetal nucleic acids and diagnosing fetal abnormalities
US20050191636A1 (en) 2004-03-01 2005-09-01 Biocept, Inc. Detection of STRP, such as fragile X syndrome
US20070077578A1 (en) 2004-03-02 2007-04-05 Primagen Holding B.V. Diagnosis of (a risk of ) disease and monitoring of therapy
WO2005085861A2 (en) 2004-03-03 2005-09-15 Oridis Biomed Forschungs- Und Entwicklungs Gmbh Nucleic acids and encoded polypeptides for use in liver disorders and epithelial cancer
US20050266433A1 (en) 2004-03-03 2005-12-01 Ravi Kapur Magnetic device for isolation of cells and biomolecules in a microfluidic environment
WO2005084380A2 (en) 2004-03-03 2005-09-15 The General Hospital Corporation System for delivering a diluted solution
US20060121624A1 (en) 2004-03-03 2006-06-08 Huang Lotien R Methods and systems for fluid delivery
DE602005011585D1 (en) 2004-03-23 2009-01-22 Amminex As USE OF AN AMMONIUM STORAGE DEVICE IN THE MANUFACTURE OF ENERGY
US7390388B2 (en) 2004-03-25 2008-06-24 Hewlett-Packard Development Company, L.P. Method of sorting cells on a biodevice
WO2005098046A2 (en) 2004-04-01 2005-10-20 Immunivest Corporation Methods for the determination of cell specific biomarkers
WO2005098034A1 (en) 2004-04-08 2005-10-20 Hiltrud Brauch Ercc2 polymorphisms
US20050282196A1 (en) 2004-04-30 2005-12-22 Jose Costa Methods and compositions for cancer diagnosis
JP2008500611A (en) 2004-05-03 2008-01-10 サイジーン ラボラトリーズ インク. Method and system for providing anonymous testing and reporting based on a comprehensive knowledge database and selective access to testing results and reports
US7468249B2 (en) 2004-05-05 2008-12-23 Biocept, Inc. Detection of chromosomal disorders
WO2005108963A1 (en) 2004-05-06 2005-11-17 Nanyang Technological University Microfluidic cell sorter system
WO2005111624A2 (en) 2004-05-07 2005-11-24 Beckman Coulter, Inc. Mhc bridging system for detecting ctl-mediated lysis of antigen presenting cells
WO2005111242A2 (en) 2004-05-10 2005-11-24 Parallele Bioscience, Inc. Digital profiling of polynucleotide populations
WO2005116264A2 (en) 2004-05-24 2005-12-08 Immunivest Corporation A blood test to monitor the genetic changes of progressive cancer using immunomagnetic enrichment and fluorescence in situ hybridization (fish)
US7709194B2 (en) 2004-06-04 2010-05-04 The Chinese University Of Hong Kong Marker for prenatal diagnosis and monitoring
EP1607485A1 (en) 2004-06-14 2005-12-21 Institut National De La Sante Et De La Recherche Medicale (Inserm) Method for quantifying VEGF121 isoform in a biological sample
DE102004036285A1 (en) 2004-07-27 2006-02-16 Advalytix Ag Method for determining the frequency of sequences of a sample
US7820382B2 (en) 2004-08-03 2010-10-26 Bauer A Robert Method for the early detection of breast cancer, lung cancer, pancreatic cancer and colon polyps, growths and cancers as well as other gastrointestinal disease conditions and the preoperative and postoperative monitoring of transplanted organs from the donor and in the recipient and their associated conditions related and unrelated to the organ transplantation
CA2576059A1 (en) 2004-08-04 2006-04-27 Spinx, Inc. Devices and methods for interfacing microfluidic devices with fluid handling devices
WO2006020936A2 (en) 2004-08-12 2006-02-23 Immunivest Corporation A method for assessing disease states by profile analysis of isolated circulating endothelial cells
EP1781986B8 (en) 2004-08-17 2014-03-05 Veridex, LLC A diagnostic imaging device for the analysis of circulating rare cells
US8024128B2 (en) 2004-09-07 2011-09-20 Gene Security Network, Inc. System and method for improving clinical decisions by aggregating, validating and analysing genetic and phenotypic data
WO2006041453A1 (en) 2004-09-30 2006-04-20 Immunivest Corporation Circulating tumor cells (ctc’s): apoptotic assessment in prostate cancer patients
ES2301268B1 (en) 2004-10-25 2009-05-01 Centro De Investigacion Biomolecular Aplicada Salamanca, S.L. USE OF GEN SLUG, OR ITS REPLICATION, TRANSCRIPTION OR EXPRESSION PRODUCTS, IN THE IDENTIFICATION, DIAGNOSIS, PREVENTION OR TREATMENT OF CANCER DISSEMINATION AND / OR METASTASIS DEVELOPMENT.
US20060094109A1 (en) 2004-11-02 2006-05-04 Immunivest Corporation Device and method for analytical cell imaging
AU2006204858A1 (en) 2005-01-13 2006-07-20 Perkinelmer Health Sciences, Inc. Microfluidic rare cell detection device
KR20070116585A (en) 2005-01-18 2007-12-10 바이오셉트 인코포레이티드 Cell separation using microchannel having patterned posts
US20060252087A1 (en) 2005-01-18 2006-11-09 Biocept, Inc. Recovery of rare cells using a microchannel apparatus with patterned posts
US8158410B2 (en) 2005-01-18 2012-04-17 Biocept, Inc. Recovery of rare cells using a microchannel apparatus with patterned posts
US7407757B2 (en) 2005-02-10 2008-08-05 Population Genetics Technologies Genetic analysis by sequence-specific sorting
US20060205057A1 (en) 2005-02-18 2006-09-14 Wayner Danial D M Microfluidic microarray with high surface area active regions
WO2007024264A2 (en) 2005-02-23 2007-03-01 Bioimagene, Inc. Method and system for digital image based tissue independent simultaneous nucleus, cytoplasm and membrane quantitation
DK1861509T3 (en) 2005-03-14 2015-12-07 Janssen Diagnostics Llc PROCEDURE FOR PREVENTION OF PROGRESSION-FREE AND GENERAL SURVIVAL FOR EACH FOLLOW TIME WHEN TREATING PATIENTS WITH METASTATIC BREAST CANCER USING CIRCULATING TUMOR CELLS
US8383357B2 (en) 2005-03-16 2013-02-26 OSI Pharmaceuticals, LLC Biological markers predictive of anti-cancer response to epidermal growth factor receptor kinase inhibitors
EP2612928A3 (en) 2005-03-18 2013-09-11 The Chinese University Of Hong Kong Markers for prenatal diagnosis and monitoring
FR2883488B1 (en) 2005-03-24 2010-12-10 Inst Nat Sante Rech Med METHOD AND DEVICE FOR SEPARATING BY VERTICAL FILTRATION BIOLOGICAL PARTICLES CONTAINED IN A LIQUID
WO2006104530A1 (en) 2005-03-28 2006-10-05 Cell Works Therapeutics, Inc. Therapeutics targeted to renal cells
JP2008538282A (en) 2005-04-05 2008-10-23 セルポイント ダイアグノスティクス, インコーポレイテッド Device and method for enrichment and modification of circulating tumor cells and other particles
US20060223178A1 (en) 2005-04-05 2006-10-05 Tom Barber Devices and methods for magnetic enrichment of cells and other particles
US20060228721A1 (en) 2005-04-12 2006-10-12 Leamon John H Methods for determining sequence variants using ultra-deep sequencing
GB0509500D0 (en) 2005-05-10 2005-06-15 Revealcyte Method of fetal cell enrichment
EP2703499A1 (en) 2005-06-02 2014-03-05 Fluidigm Corporation Analysis using microfluidic partitioning devices to generate single cell samples
EP1907858A4 (en) 2005-06-13 2009-04-08 Univ Michigan Compositions and methods for treating and diagnosing cancer
WO2007001259A1 (en) 2005-06-16 2007-01-04 Government Of The United States Of America, Represented By The Secretary, Department Of Health And Human Services Methods and materials for identifying polymorphic variants, diagnosing susceptibilities, and treating disease
US10083273B2 (en) 2005-07-29 2018-09-25 Natera, Inc. System and method for cleaning noisy genetic data and determining chromosome copy number
US20070059680A1 (en) * 2005-09-15 2007-03-15 Ravi Kapur System for cell enrichment
US9424392B2 (en) 2005-11-26 2016-08-23 Natera, Inc. System and method for cleaning noisy genetic data from target individuals using genetic data from genetically related individuals
US20070027636A1 (en) 2005-07-29 2007-02-01 Matthew Rabinowitz System and method for using genetic, phentoypic and clinical data to make predictions for clinical or lifestyle decisions
US8515679B2 (en) 2005-12-06 2013-08-20 Natera, Inc. System and method for cleaning noisy genetic data and determining chromosome copy number
US8532930B2 (en) 2005-11-26 2013-09-10 Natera, Inc. Method for determining the number of copies of a chromosome in the genome of a target individual using genetic data from genetically related individuals
US20070178501A1 (en) 2005-12-06 2007-08-02 Matthew Rabinowitz System and method for integrating and validating genotypic, phenotypic and medical information into a database according to a standardized ontology
US7901950B2 (en) 2005-08-12 2011-03-08 Veridex, Llc Method for assessing disease states by profile analysis of isolated circulating endothelial cells
JP2009504168A (en) 2005-08-17 2009-02-05 メディクシス エス.エー. Composition and method for confirming CK19 expression
AU2006287175A1 (en) 2005-09-01 2007-03-08 Precision Therapeutics, Inc. Chemo-sensitivity assays using tumor cells exhibiting persistent phenotypic characteristics
WO2007033167A2 (en) 2005-09-12 2007-03-22 The Regents Of The University Of Michigan Compositions and methods for detecting and treating cancer
US20070059716A1 (en) * 2005-09-15 2007-03-15 Ulysses Balis Methods for detecting fetal abnormality
US20070059683A1 (en) 2005-09-15 2007-03-15 Tom Barber Veterinary diagnostic system
US20070059718A1 (en) * 2005-09-15 2007-03-15 Mehmet Toner Systems and methods for enrichment of analytes
US20070059719A1 (en) * 2005-09-15 2007-03-15 Michael Grisham Business methods for prenatal Diagnosis
US20070059781A1 (en) 2005-09-15 2007-03-15 Ravi Kapur System for size based separation and analysis
WO2007030949A2 (en) 2005-09-15 2007-03-22 Val-Chum, S.E.C. Methods of diagnosing ovarian cancer and kits therefor
US20070059774A1 (en) 2005-09-15 2007-03-15 Michael Grisham Kits for Prenatal Testing
AU2006292394A1 (en) 2005-09-15 2007-03-29 Artemis Health, Inc. Systems and methods for enrichment of analytes
ES2374450T3 (en) 2005-09-20 2012-02-16 OSI Pharmaceuticals, LLC ANTI-BANGEOUS RESPONSE BIOLOGICAL MARKERS FOR KINNER INHIBITORS OF THE GROWTH FACTOR RECEIVER 1 SIMILAR TO INSULIN.
EP3211086B1 (en) 2005-09-20 2021-06-09 Menarini Silicon Biosystems S.p.A. Methods and composition to generate unique sequence dna probes, labeling of dna probes and the use of these probes
CA2623445A1 (en) 2005-09-21 2007-03-29 Ccc Diagnostics, Llc Comprehensive diagnostic testing procedures for personalized anticancer chemotherapy (pac)
WO2007038264A2 (en) 2005-09-22 2007-04-05 Biogen Idec Ma Inc. Gapr-1 methods
GB0519405D0 (en) 2005-09-23 2005-11-02 Univ Aberdeen Cancer therapy prognosis and target
AU2006297033B2 (en) 2005-09-27 2011-09-08 University Of Saskatchewan Use of N-myristoyltransferase on non-tumor tissue for cancer diagnosis
EP1770171A1 (en) 2005-09-29 2007-04-04 Universität Zu Köln DNA microarray for rapid identification of Candida albicans in blood cultures.
US8158107B2 (en) 2005-09-30 2012-04-17 National Jewish Health Genes and proteins associated with angiogenesis and uses thereof
US20070202106A1 (en) 2005-10-06 2007-08-30 Baylor Research Institute Compositions and methods for the treatment of cancer
US8343756B2 (en) 2005-10-07 2013-01-01 The General Hospital Corporation Devices and methods for cell manipulation
WO2007048076A2 (en) 2005-10-21 2007-04-26 The General Hospital Corporation Method for the diagnosis and prognosis of cancer
US20110052570A1 (en) 2005-10-26 2011-03-03 Children's Medical Center Corporation Method to prognose response to anti-egfr therapeutics
WO2007053648A2 (en) 2005-10-31 2007-05-10 The Regents Of The University Of Michigan Compositions and methods for treating and diagnosing cancer
US20100062426A1 (en) 2005-11-03 2010-03-11 O'hara Shawn Mark AGR2 and TFF3 Regulation in the Diagnosis and Treatment of Cancer
US20070178067A1 (en) 2005-11-09 2007-08-02 John Maier System and method for cytological analysis by raman spectroscopic imaging
ES2356080T3 (en) 2005-11-10 2011-04-04 Bristol-Myers Squibb Pharma Company MOESINA, CAVEOLINA AND PROTEINA 1 ASSOCIATED WITH YES AS MARKERS OF RESPONSE TO DASATINIB IN CANCERES DE MAMA.
US20070122856A1 (en) 2005-11-10 2007-05-31 Aurelium Biopharma Inc. Tissue diagnostics for ovarian cancer
GB0523276D0 (en) 2005-11-15 2005-12-21 London Bridge Fertility Chromosomal analysis by molecular karyotyping
US8642278B2 (en) 2005-11-22 2014-02-04 University Of South Florida Inhibition of cell proliferation
US20070238094A1 (en) 2005-12-09 2007-10-11 Baylor Research Institute Diagnosis, prognosis and monitoring of disease progression of systemic lupus erythematosus through blood leukocyte microarray analysis
US7566573B2 (en) 2005-12-19 2009-07-28 Idexx Laboratories, Inc. Dual standard curve immunoassay
CA2634591A1 (en) 2005-12-22 2007-07-05 Memorial Sloan-Kettering Cancer Center Method for detection of cancer cells using virus
WO2007079229A2 (en) 2005-12-29 2007-07-12 Cellpoint Diagnostics, Inc. Devices and methods for enrichment and alteration of circulating tumor cells and other particles
EP1803822A1 (en) 2005-12-30 2007-07-04 Adnagen AG Method for the individual characterization of therapeutic target molecules and use thereof
WO2007082144A2 (en) 2006-01-05 2007-07-19 Mayo Foundation For Medical Education And Research B7-h1 and survivin in cancer
WO2007082154A2 (en) 2006-01-05 2007-07-19 Mayo Foundation For Medical Education And Research B7-h1 and b7-h4 in cancer
WO2007080583A2 (en) 2006-01-10 2007-07-19 Applied Spectral Imaging Ltd. Methods and systems for analyzing biological samples
US20070160974A1 (en) 2006-01-10 2007-07-12 South Eastern Sydney And Illawarra Area Health Service Human embryonic stem cell clones
US7842465B2 (en) 2006-01-17 2010-11-30 Palo Alto Research Center Incorporated Immunocytostaining methods for enhanced dye ratio discrimination in rare event detection
US7548145B2 (en) 2006-01-19 2009-06-16 Innovative Micro Technology Hysteretic MEMS thermal device and method of manufacture
US20090075272A1 (en) 2006-01-20 2009-03-19 Hollmann C Annette Method to Identify CD40-Sensitive Cells Using Gene Expression
EP1989329A2 (en) 2006-01-25 2008-11-12 Board of Regents, The University of Texas System Detection and diagnosis of smoking related cancers
JP2009525468A (en) 2006-01-30 2009-07-09 ザ・スクリプス・リサーチ・インステイチユート Method for detecting circulating tumor cells and method for diagnosing cancer in a mammalian subject
AU2007211251A1 (en) 2006-01-31 2007-08-09 Georgetown University Method to detect breast cancer cells
WO2007092713A2 (en) 2006-02-02 2007-08-16 Trustees Of The University Of Pennsylvania Microfluidic system and method for analysis of gene expression in cell-containing samples and detection of disease
HUE030215T2 (en) 2006-02-02 2017-04-28 Univ Leland Stanford Junior Non-invasive fetal genetic screening by digital analysis
US7976842B2 (en) 2006-02-09 2011-07-12 Micromet Ag Treatment of metastatic breast cancer
EP1818413A1 (en) 2006-02-10 2007-08-15 Fundacion para la Investigacion Clinica y Molecular del Cancer de Pulmon Method of determining outcome of non small-cell lung cancer according to XRCC3 polymorphism
CA2643194A1 (en) 2006-02-21 2007-08-30 The Trustees Of Princeton University High-yield activation of polymer surfaces for covalent attachment of molecules
US20100166707A1 (en) 2006-02-24 2010-07-01 Government Of The United States Of America, Repres Extracellular matrix/metastasis modifier genes for the prevention or inhibition of metastasis or growth of tumor and for characterization of tumor
US8609338B2 (en) 2006-02-28 2013-12-17 University Of Louisville Research Foundation, Inc. Detecting fetal chromosomal abnormalities using tandem single nucleotide polymorphisms
CN101395280A (en) 2006-03-01 2009-03-25 凯津公司 High throughput sequence-based detection of snps using ligation assays
BRPI0709545A2 (en) 2006-03-06 2011-07-19 Univ Columbia sequence-specific amplification of fetal DNA from a mixture of fetal-maternal origin
EP1832661A1 (en) 2006-03-09 2007-09-12 Adnagen AG Method for the individual staging of tumor diseases
US8337755B2 (en) 2006-03-13 2012-12-25 Veridex, Llc Operator independent programmable sample preparation and analysis system
US20090181358A1 (en) 2006-03-30 2009-07-16 Gross Susan J Marker for Chromosomal Abnormalities
US8058055B2 (en) 2006-04-07 2011-11-15 Agilent Technologies, Inc. High resolution chromosomal mapping
US7901884B2 (en) 2006-05-03 2011-03-08 The Chinese University Of Hong Kong Markers for prenatal diagnosis and monitoring
US7754428B2 (en) 2006-05-03 2010-07-13 The Chinese University Of Hong Kong Fetal methylation markers
US8137912B2 (en) 2006-06-14 2012-03-20 The General Hospital Corporation Methods for the diagnosis of fetal abnormalities
US20080050739A1 (en) 2006-06-14 2008-02-28 Roland Stoughton Diagnosis of fetal abnormalities using polymorphisms including short tandem repeats
DK2029778T3 (en) 2006-06-14 2018-08-20 Verinata Health Inc DIAGNOSIS OF Fetal ABNORMITIES
EP4108780A1 (en) 2006-06-14 2022-12-28 Verinata Health, Inc. Rare cell analysis using sample splitting and dna tags
EP2029779A4 (en) 2006-06-14 2010-01-20 Living Microsystems Inc Use of highly parallel snp genotyping for fetal diagnosis
EP2024512A4 (en) 2006-06-14 2009-12-09 Artemis Health Inc Methods for the diagnosis of fetal abnormalities
US8372584B2 (en) 2006-06-14 2013-02-12 The General Hospital Corporation Rare cell analysis using sample splitting and DNA tags
US20080090239A1 (en) 2006-06-14 2008-04-17 Daniel Shoemaker Rare cell analysis using sample splitting and dna tags
CA2655269A1 (en) 2006-06-16 2007-12-21 Sequenom, Inc. Methods and compositions for the amplification, detection and quantification of nucleic acid from a sample
WO2008014516A2 (en) 2006-07-28 2008-01-31 Living Microsystems, Inc. Selection of cells using biomarkers
GB0616045D0 (en) 2006-08-11 2006-09-20 Univ Bristol Blood cell separation
EP2076609A1 (en) 2006-10-10 2009-07-08 Illumina Inc. Compositions and methods for representational selection of nucleic acids fro complex mixtures using hybridization
US20080113350A1 (en) 2006-11-09 2008-05-15 Terstappen Leon W M M Blood test to monitor the genetic changes of progressive cancer using immunomagnetic enrichment and fluorescence in situ hybridization (FISH)
AU2008213634B2 (en) 2007-02-08 2013-09-05 Sequenom, Inc. Nucleic acid-based tests for RhD typing, gender determination and nucleic acid quantification
EP2153361A4 (en) 2007-05-04 2010-09-29 Genes It Software Ltd System, method and device for comprehensive individualized genetic information or genetic counseling
WO2009009769A2 (en) 2007-07-11 2009-01-15 Artemis Health, Inc. Diagnosis of fetal abnormalities using nucleated red blood cells
US20100112590A1 (en) 2007-07-23 2010-05-06 The Chinese University Of Hong Kong Diagnosing Fetal Chromosomal Aneuploidy Using Genomic Sequencing With Enrichment
US20090053719A1 (en) 2007-08-03 2009-02-26 The Chinese University Of Hong Kong Analysis of nucleic acids by digital pcr
US7882722B2 (en) * 2007-08-03 2011-02-08 Hubbell Incorporated Jaw assembly
EP2334812B1 (en) 2008-09-20 2016-12-21 The Board of Trustees of The Leland Stanford Junior University Noninvasive diagnosis of fetal aneuploidy by sequencing
WO2010045617A2 (en) 2008-10-17 2010-04-22 University Of Louisville Research Foundation Detecting genetic abnormalities
US8343440B2 (en) 2009-03-27 2013-01-01 Seiko Epson Corporation Cell separating apparatus and cell separating method
US8481699B2 (en) 2009-07-14 2013-07-09 Academia Sinica Multiplex barcoded Paired-End ditag (mbPED) library construction for ultra high throughput sequencing
PT3241914T (en) 2009-11-05 2019-04-30 Sequenom Inc Fetal genomic analysis from a maternal biological sample
US20120010085A1 (en) 2010-01-19 2012-01-12 Rava Richard P Methods for determining fraction of fetal nucleic acids in maternal samples
US20110312503A1 (en) 2010-01-23 2011-12-22 Artemis Health, Inc. Methods of fetal abnormality detection
US20130143219A1 (en) 2010-01-28 2013-06-06 Medical College of Wisconsin Inc. Methods and compositions for high yield, specific amplification

Patent Citations (99)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4800159A (en) * 1986-02-07 1989-01-24 Cetus Corporation Process for amplifying, detecting, and/or cloning nucleic acid sequences
US20020006621A1 (en) * 1989-11-13 2002-01-17 Children's Medical Center Corporation Non-invasive method for isolation and detection of fetal DNA
US20040018509A1 (en) * 1989-11-13 2004-01-29 Bianchi Diana W. Non-invasive method for isolation and detection of fetal DNA
US20070015171A1 (en) * 1989-11-13 2007-01-18 The Children's Hospital Non-invasive method for isolation and detection of fetal DNA
US20060051775A1 (en) * 1989-11-13 2006-03-09 The Children's Hospital Non-invasive method for isolation and detection of fetal DNA
US6176962B1 (en) * 1990-02-28 2001-01-23 Aclara Biosciences, Inc. Methods for fabricating enclosed microchannel structures
US5879883A (en) * 1991-10-03 1999-03-09 Indiana University Foundation Method for screening for alzheimer's disease
US5498392A (en) * 1992-05-01 1996-03-12 Trustees Of The University Of Pennsylvania Mesoscale polynucleotide amplification device and method
US5866345A (en) * 1992-05-01 1999-02-02 The Trustees Of The University Of Pennsylvania Apparatus for the detection of an analyte utilizing mesoscale flow systems
US5726026A (en) * 1992-05-01 1998-03-10 Trustees Of The University Of Pennsylvania Mesoscale sample preparation device and systems for determination and processing of analytes
US5486335A (en) * 1992-05-01 1996-01-23 Trustees Of The University Of Pennsylvania Analysis based on flow restriction
US5296375A (en) * 1992-05-01 1994-03-22 Trustees Of The University Of Pennsylvania Mesoscale sperm handling devices
US5858649A (en) * 1992-07-17 1999-01-12 Aprogenex, Inc. Amplification of mRNA for distinguishing fetal cells in maternal blood
US6184043B1 (en) * 1992-09-14 2001-02-06 FODSTAD øYSTEIN Method for detection of specific target cells in specialized or mixed cell population and solutions containing mixed cell populations
US5707799A (en) * 1994-09-30 1998-01-13 Abbott Laboratories Devices and methods utilizing arrays of structures for analyte capture
US5709943A (en) * 1995-05-04 1998-01-20 Minnesota Mining And Manufacturing Company Biological adsorption supports
US5715946A (en) * 1995-06-07 1998-02-10 Reichenbach; Steven H. Method and apparatus for sorting particles suspended in a fluid
US6013188A (en) * 1996-06-07 2000-01-11 Immunivest Corporation Methods for biological substance analysis employing internal magnetic gradients separation and an externally-applied transport force
US6344326B1 (en) * 1996-07-30 2002-02-05 Aclara Bio Sciences, Inc. Microfluidic method for nucleic acid purification and processing
US6186660B1 (en) * 1997-10-09 2001-02-13 Caliper Technologies Corp. Microfluidic systems incorporating varied channel dimensions
US6517234B1 (en) * 1997-10-09 2003-02-11 Caliper Technologies Corp. Microfluidic systems incorporating varied channel dimensions
US20020016450A1 (en) * 1997-10-31 2002-02-07 Bbi Bioseq, Inc., A Masachusetts Corporation Pressure-enhanced extraction and purification
US6197523B1 (en) * 1997-11-24 2001-03-06 Robert A. Levine Method for the detection, identification, enumeration and confirmation of circulating cancer and/or hematologic progenitor cells in whole blood
US6200765B1 (en) * 1998-05-04 2001-03-13 Pacific Northwest Cancer Foundation Non-invasive methods to detect prostate cancer
US20020028431A1 (en) * 1998-08-25 2002-03-07 Julien Jean-Claude Bisconte De Saint Process, device and reagent for cell separation
US6673541B1 (en) * 1998-09-18 2004-01-06 Micromet Ag DNA amplification of a single cell
US20040053352A1 (en) * 1998-09-28 2004-03-18 Tianmei Ouyang Diagnostics based on tetrazolium compounds
US20030022207A1 (en) * 1998-10-16 2003-01-30 Solexa, Ltd. Arrayed polynucleotides and their use in genome analysis
US6858439B1 (en) * 1999-03-15 2005-02-22 Aviva Biosciences Compositions and methods for separation of moieties on chips
US6511967B1 (en) * 1999-04-23 2003-01-28 The General Hospital Corporation Use of an internalizing transferrin receptor to image transgene expression
US20030044781A1 (en) * 1999-05-19 2003-03-06 Jonas Korlach Method for sequencing nucleic acid molecules
US20040048360A1 (en) * 1999-08-26 2004-03-11 Caliper Technologies Corp. Microfluidic analytic detection assays, devices, and integrated systems
US20020012930A1 (en) * 1999-09-16 2002-01-31 Rothberg Jonathan M. Method of sequencing a nucleic acid
US20030013101A1 (en) * 1999-09-29 2003-01-16 Shankar Balasubramanian Polynucleotide sequencing
US20020019001A1 (en) * 1999-10-15 2002-02-14 Ventana Medical Systems, Inc. Method of detecting single gene copies in-situ
US6361958B1 (en) * 1999-11-12 2002-03-26 Motorola, Inc. Biochannel assay for hybridization with biomaterial
US20020012931A1 (en) * 2000-03-27 2002-01-31 Waldman Scott A. High specificity marker detection
US20020009738A1 (en) * 2000-04-03 2002-01-24 Houghton Raymond L. Methods, compositions and kits for the detection and monitoring of breast cancer
US20030004402A1 (en) * 2000-07-18 2003-01-02 Hitt Ben A. Process for discriminating between biological states based on hidden patterns from biological data
US20040005582A1 (en) * 2000-08-10 2004-01-08 Nanobiodynamics, Incorporated Biospecific desorption microflow systems and methods for studying biospecific interactions and their modulators
US6689615B1 (en) * 2000-10-04 2004-02-10 James Murto Methods and devices for processing blood samples
US6685841B2 (en) * 2001-02-14 2004-02-03 Gabriel P. Lopez Nanostructured devices for separation and analysis
US6674525B2 (en) * 2001-04-03 2004-01-06 Micronics, Inc. Split focusing cytometer
US20030033091A1 (en) * 2001-04-20 2003-02-13 Sequenom, Inc. Systems and methods for testing a biological sample
US20070037275A1 (en) * 2001-04-25 2007-02-15 Michael Shuler Devices and methods for pharmacokinetic-based cell culture system
US20070037273A1 (en) * 2001-04-25 2007-02-15 Michael Shuler Devices and methods for pharmacokinetic-based cell culture system
US20060060767A1 (en) * 2001-04-27 2006-03-23 Wang Mark M Methods and apparatus for use of optical forces for identification, characterization and/or sorting of particles
US20050049793A1 (en) * 2001-04-30 2005-03-03 Patrizia Paterlini-Brechot Prenatal diagnosis method on isolated foetal cell of maternal blood
US20030017514A1 (en) * 2001-06-02 2003-01-23 Katharina Pachmann Method for quantitative detection of vital epithelial tumor cells in a body fluid
US20050037388A1 (en) * 2001-06-22 2005-02-17 University Of Geneva Method for detecting diseases caused by chromosomal imbalances
US20030044388A1 (en) * 2001-08-31 2003-03-06 The Chinese University Of Hong Kong Methods for detecting DNA originating from different individuals
US20050014208A1 (en) * 2001-09-06 2005-01-20 Alf-Andreas Krehan Method and kit for diagnosing or controlling the treatment of breast cancer
US20050042685A1 (en) * 2001-09-06 2005-02-24 Winfried Albert Method and diagnosis kit for selecting and or qualitative and/or quantitative detection of cells
US20070042360A1 (en) * 2001-09-17 2007-02-22 Eos Biotechnology, Inc. Methods of diagnosis of cancer, compositions and methods of screening for modulators of cancer
US20050019792A1 (en) * 2001-11-30 2005-01-27 Fluidigm Corporation Microfluidic device and methods of using same
US7171975B2 (en) * 2002-02-12 2007-02-06 Kionix, Inc. Fabrication of ultra-shallow channels for microfluidic devices and systems
US20060024756A1 (en) * 2002-02-14 2006-02-02 Arjan Tibbe Methods and algorithms for cell enumeration in low-cost cytometer
US7332277B2 (en) * 2002-03-01 2008-02-19 Ravgen, Inc. Methods for detection of genetic disorders
US20040009471A1 (en) * 2002-04-25 2004-01-15 Bo Cao Methods and kits for detecting a target cell
US20040018116A1 (en) * 2002-07-26 2004-01-29 Desmond Sean M. Microfluidic size-exclusion devices, systems, and methods
US20040037470A1 (en) * 2002-08-23 2004-02-26 Simske Steven J. Systems and methods for processing text-based electronic documents
US20060008807A1 (en) * 2002-08-23 2006-01-12 O'hara Shawn M Multiparameter analysis of comprehensive nucleic acids and morphological features on the same sample
US20040043506A1 (en) * 2002-08-30 2004-03-04 Horst Haussecker Cascaded hydrodynamic focusing in microfluidic channels
US20070054268A1 (en) * 2002-09-05 2007-03-08 Robert Sutherland Methods of diagnosis and prognosis of ovarian cancer
US20050042623A1 (en) * 2002-10-30 2005-02-24 Dana Ault-Riche Systems for capture and analysis of biological particles and methods using the systems
US20050064476A1 (en) * 2002-11-11 2005-03-24 Affymetrix, Inc. Methods for identifying DNA copy number changes
US20060000772A1 (en) * 2002-11-29 2006-01-05 Toru Sano Separation apparatus and separation method
US20070042368A1 (en) * 2003-03-24 2007-02-22 Corixa Corporation Detection and monitoring of lung cancer
US7476363B2 (en) * 2003-04-03 2009-01-13 Fluidigm Corporation Microfluidic devices and methods of using same
US20050061962A1 (en) * 2003-07-31 2005-03-24 Arryx, Inc. Multiple laminar flow-based rate zonal or isopycnic separation with holographic optical trapping of blood cells and other static components
US20070042339A1 (en) * 2003-08-08 2007-02-22 Massachusetts General Hospital Preservation of biomaterials with transported preservation agents
US20050052773A1 (en) * 2003-09-05 2005-03-10 Hitachi Global Storage Technologies Increasing head-disk interface reliability using controlled heating
US7655399B2 (en) * 2003-10-08 2010-02-02 Trustees Of Boston University Methods for prenatal diagnosis of chromosomal abnormalities
US20060046258A1 (en) * 2004-02-27 2006-03-02 Lapidus Stanley N Applications of single molecule sequencing
US20060008824A1 (en) * 2004-05-20 2006-01-12 Leland Stanford Junior University Methods and compositions for clonal amplification of nucleic acid
US20060024711A1 (en) * 2004-07-02 2006-02-02 Helicos Biosciences Corporation Methods for nucleic acid amplification and sequence determination
US20060024678A1 (en) * 2004-07-28 2006-02-02 Helicos Biosciences Corporation Use of single-stranded nucleic acid binding proteins in sequencing
US20060051265A1 (en) * 2004-09-08 2006-03-09 Health Research, Inc. Apparatus and method for sorting microstructures in a fluid medium
US7645576B2 (en) * 2005-03-18 2010-01-12 The Chinese University Of Hong Kong Method for the detection of chromosomal aneuploidies
US20070017633A1 (en) * 2005-03-23 2007-01-25 Tonkovich Anna L Surface features in microprocess technology
US20070026381A1 (en) * 2005-04-05 2007-02-01 Huang Lotien R Devices and methods for enrichment and alteration of cells and other particles
US20070054287A1 (en) * 2005-05-31 2007-03-08 Applera Corporation Method for identifying medically important cell populations using micro rna as tissue specific biomarkers
US20070026414A1 (en) * 2005-07-29 2007-02-01 Martin Fuchs Devices and methods for enrichment and alteration of circulating tumor cells and other particles
US20070026419A1 (en) * 2005-07-29 2007-02-01 Martin Fuchs Devices and methods for enrichment and alteration of circulating tumor cells and other particles
US20070026416A1 (en) * 2005-07-29 2007-02-01 Martin Fuchs Devices and methods for enrichment and alteration of circulating tumor cells and other particles
US20070026469A1 (en) * 2005-07-29 2007-02-01 Martin Fuchs Devices and methods for enrichment and alteration of circulating tumor cells and other particles
US20070026418A1 (en) * 2005-07-29 2007-02-01 Martin Fuchs Devices and methods for enrichment and alteration of circulating tumor cells and other particles
US20070026417A1 (en) * 2005-07-29 2007-02-01 Martin Fuchs Devices and methods for enrichment and alteration of circulating tumor cells and other particles
US20070026413A1 (en) * 2005-07-29 2007-02-01 Mehmet Toner Devices and methods for enrichment and alteration of circulating tumor cells and other particles
US20070026415A1 (en) * 2005-07-29 2007-02-01 Martin Fuchs Devices and methods for enrichment and alteration of circulating tumor cells and other particles
US20070037172A1 (en) * 2005-08-11 2007-02-15 Chiu Daniel T Separation and concentration of biological cells and biological particles using a one-dimensional channel
US20070037173A1 (en) * 2005-08-12 2007-02-15 Allard Jeffrey W Circulating tumor cells (CTC's): early assessment of time to progression, survival and response to therapy in metastatic cancer patients
US20070042238A1 (en) * 2005-08-22 2007-02-22 Lg Electronics Inc. Fuel cell having water type radiating device
US20070048750A1 (en) * 2005-09-01 2007-03-01 National Health Research Institute Rapid efficacy assessment method for lung cancer therapy
US20080020390A1 (en) * 2006-02-28 2008-01-24 Mitchell Aoy T Detecting fetal chromosomal abnormalities using tandem single nucleotide polymorphisms
US20080038733A1 (en) * 2006-03-28 2008-02-14 Baylor College Of Medicine Screening for down syndrome
US20080023399A1 (en) * 2006-06-01 2008-01-31 Inglis David W Apparatus and method for continuous particle separation
US20080026390A1 (en) * 2006-06-14 2008-01-31 Roland Stoughton Diagnosis of Fetal Abnormalities by Comparative Genomic Hybridization Analysis
US20090029377A1 (en) * 2007-07-23 2009-01-29 The Chinese University Of Hong Kong Diagnosing fetal chromosomal aneuploidy using massively parallel genomic sequencing

Cited By (154)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US9364829B2 (en) 2005-06-02 2016-06-14 Fluidigm Corporation Analysis using microfluidic partitioning devices
US20110143949A1 (en) * 2005-06-02 2011-06-16 Fluidigm Corporation Analysis using microfluidic partitioning devices
US20110129841A1 (en) * 2005-06-02 2011-06-02 Fluidigm Corporation Analysis using microfluidic partitioning devices
US11111544B2 (en) 2005-07-29 2021-09-07 Natera, Inc. System and method for cleaning noisy genetic data and determining chromosome copy number
US8921102B2 (en) 2005-07-29 2014-12-30 Gpb Scientific, Llc Devices and methods for enrichment and alteration of circulating tumor cells and other particles
US20070026418A1 (en) * 2005-07-29 2007-02-01 Martin Fuchs Devices and methods for enrichment and alteration of circulating tumor cells and other particles
US11111543B2 (en) 2005-07-29 2021-09-07 Natera, Inc. System and method for cleaning noisy genetic data and determining chromosome copy number
US20090181421A1 (en) * 2005-07-29 2009-07-16 Ravi Kapur Diagnosis of fetal abnormalities using nucleated red blood cells
US11306359B2 (en) 2005-11-26 2022-04-19 Natera, Inc. System and method for cleaning noisy genetic data from target individuals using genetic data from genetically related individuals
US20090170113A1 (en) * 2006-02-02 2009-07-02 The Board Of Trustees Of The Leland Stanford Junior University Non-Invasive Fetal Genetic Screening by Digital Analysis
US20100255493A1 (en) * 2006-02-02 2010-10-07 The Board Of Trustees Of The Leland Stanford Junior University Non-Invasive Fetal Genetic Screening by Digital Analysis
US8293470B2 (en) 2006-02-02 2012-10-23 The Board Of Trustees Of The Leland Stanford Junior University Non-invasive fetal genetic screening by digital analysis
US20100124752A1 (en) * 2006-02-02 2010-05-20 The Board Of Trustees Of The Leland Stanford Junior University Non-Invasive Fetal Genetic Screening by Digital Analysis
US20100124751A1 (en) * 2006-02-02 2010-05-20 The Board Of Trustees Of The Leland Stanford Junior University Non-Invasive Fetal Genetic Screening by Digital Analysis
US9777329B2 (en) 2006-02-02 2017-10-03 The Board Of Trustees Of The Leland Stanford Junior University Non-invasive fetal genetic screening by digital analysis
US20100256013A1 (en) * 2006-02-02 2010-10-07 The Board Of Trustees Of The Leland Stanford Junior University Non-Invasive Fetal Genetic Screening by Digital Analysis
US10072295B2 (en) 2006-02-02 2018-09-11 The Board Of Trustees Of The Leland Stanford Junior University Non-invasive fetal genetic screening by digtal analysis
US20100255492A1 (en) * 2006-02-02 2010-10-07 The Board Of Trustees Of The Leland Stanford Junior University Non-Invasive Fetal Genetic Screening by Digital Analysis
US20090170114A1 (en) * 2006-02-02 2009-07-02 The Board Of Trustees Of The Leland Stanford Junior University Non-Invasive Fetal Genetic Screening by Digital Analysis
US8008018B2 (en) 2006-02-02 2011-08-30 The Board Of Trustees Of The Leland Stanford Junior University Determination of fetal aneuploidies by massively parallel DNA sequencing
US7888017B2 (en) 2006-02-02 2011-02-15 The Board Of Trustees Of The Leland Stanford Junior University Non-invasive fetal genetic screening by digital analysis
US9777328B2 (en) 2006-02-02 2017-10-03 The Board Of Trustees Of The Leland Stanford Junior University Non-invasive fetal genetic screening by digital analysis
US9441273B2 (en) 2006-02-02 2016-09-13 The Board Of Trustees Of The Leland Stanford Junior University Non-invasive fetal genetic screening by digital analysis
US20070202525A1 (en) * 2006-02-02 2007-08-30 The Board Of Trustees Of The Leland Stanford Junior University Non-invasive fetal genetic screening by digital analysis
US11692225B2 (en) 2006-02-02 2023-07-04 The Board Of Trustees Of The Leland Stanford Junior University Non-invasive fetal genetic screening by digital analysis
US8137912B2 (en) 2006-06-14 2012-03-20 The General Hospital Corporation Methods for the diagnosis of fetal abnormalities
US10155984B2 (en) 2006-06-14 2018-12-18 The General Hospital Corporation Rare cell analysis using sample splitting and DNA tags
US11781187B2 (en) 2006-06-14 2023-10-10 The General Hospital Corporation Rare cell analysis using sample splitting and DNA tags
US9273355B2 (en) 2006-06-14 2016-03-01 The General Hospital Corporation Rare cell analysis using sample splitting and DNA tags
US9347100B2 (en) 2006-06-14 2016-05-24 Gpb Scientific, Llc Rare cell analysis using sample splitting and DNA tags
US20100291572A1 (en) * 2006-06-14 2010-11-18 Artemis Health, Inc. Fetal aneuploidy detection by sequencing
US9017942B2 (en) 2006-06-14 2015-04-28 The General Hospital Corporation Rare cell analysis using sample splitting and DNA tags
US20080070792A1 (en) * 2006-06-14 2008-03-20 Roland Stoughton Use of highly parallel snp genotyping for fetal diagnosis
US20080138809A1 (en) * 2006-06-14 2008-06-12 Ravi Kapur Methods for the Diagnosis of Fetal Abnormalities
US10704090B2 (en) 2006-06-14 2020-07-07 Verinata Health, Inc. Fetal aneuploidy detection by sequencing
US8168389B2 (en) 2006-06-14 2012-05-01 The General Hospital Corporation Fetal cell analysis using sample splitting
US20080220422A1 (en) * 2006-06-14 2008-09-11 Daniel Shoemaker Rare cell analysis using sample splitting and dna tags
US20090280492A1 (en) * 2006-06-14 2009-11-12 Roland Stoughton Diagnosis of fetal abnormalities using polymorphisms including short tandem repeats
US8372584B2 (en) 2006-06-14 2013-02-12 The General Hospital Corporation Rare cell analysis using sample splitting and DNA tags
US11674176B2 (en) 2006-06-14 2023-06-13 Verinata Health, Inc Fetal aneuploidy detection by sequencing
US10591391B2 (en) 2006-06-14 2020-03-17 Verinata Health, Inc. Diagnosis of fetal abnormalities using polymorphisms including short tandem repeats
US8972202B2 (en) 2007-07-23 2015-03-03 The Chinese University Of Hong Kong Diagnosing fetal chromosomal aneuploidy using massively parallel genomic sequencing
US10619214B2 (en) 2007-07-23 2020-04-14 The Chinese University Of Hong Kong Detecting genetic aberrations associated with cancer using genomic sequencing
US11142799B2 (en) 2007-07-23 2021-10-12 The Chinese University Of Hong Kong Detecting chromosomal aberrations associated with cancer using genomic sequencing
US9051616B2 (en) 2007-07-23 2015-06-09 The Chinese University Of Hong Kong Diagnosing fetal chromosomal aneuploidy using massively parallel genomic sequencing
US8442774B2 (en) 2007-07-23 2013-05-14 The Chinese University Of Hong Kong Diagnosing fetal chromosomal aneuploidy using paired end
US9121069B2 (en) 2007-07-23 2015-09-01 The Chinese University Of Hong Kong Diagnosing cancer using genomic sequencing
US20100112590A1 (en) * 2007-07-23 2010-05-06 The Chinese University Of Hong Kong Diagnosing Fetal Chromosomal Aneuploidy Using Genomic Sequencing With Enrichment
US20090029377A1 (en) * 2007-07-23 2009-01-29 The Chinese University Of Hong Kong Diagnosing fetal chromosomal aneuploidy using massively parallel genomic sequencing
US20100138165A1 (en) * 2008-09-20 2010-06-03 The Board Of Trustees Of The Leland Stanford Junior University Noninvasive Diagnosis of Fetal Aneuploidy by Sequencing
US9404157B2 (en) 2008-09-20 2016-08-02 The Board Of Trustees Of The Leland Stanford Junior University Noninvasive diagnosis of fetal aneuploidy by sequencing
EP3751005A3 (en) * 2008-09-20 2021-02-24 The Board of Trustees of the Leland Stanford Junior University Noninvasive diagnosis of fetal aneuploidy by sequencing
US8296076B2 (en) 2008-09-20 2012-10-23 The Board Of Trustees Of The Leland Stanford Junior University Noninvasive diagnosis of fetal aneuoploidy by sequencing
US10669585B2 (en) 2008-09-20 2020-06-02 The Board Of Trustees Of The Leland Stanford Junior University Noninvasive diagnosis of fetal aneuploidy by sequencing
US9353414B2 (en) 2008-09-20 2016-05-31 The Board Of Trustees Of The Leland Stanford Junior University Noninvasive diagnosis of fetal aneuploidy by sequencing
US20100112575A1 (en) * 2008-09-20 2010-05-06 The Board Of Trustees Of The Leland Stanford Junior University Noninvasive Diagnosis of Fetal Aneuploidy by Sequencing
EP2334812A4 (en) * 2008-09-20 2013-02-27 Univ Leland Stanford Junior Noninvasive diagnosis of fetal aneuploidy by sequencing
US8682594B2 (en) 2008-09-20 2014-03-25 The Board Of Trustees Of The Leland Stanford Junior University Noninvasive diagnosis of fetal aneuploidy by sequencing
US8195415B2 (en) 2008-09-20 2012-06-05 The Board Of Trustees Of The Leland Stanford Junior University Noninvasive diagnosis of fetal aneuploidy by sequencing
US20100304978A1 (en) * 2009-01-26 2010-12-02 David Xingfei Deng Methods and compositions for identifying a fetal cell
US11286520B2 (en) 2010-01-19 2022-03-29 Verinata Health, Inc. Method for determining copy number variations
US11130995B2 (en) 2010-01-19 2021-09-28 Verinata Health, Inc. Simultaneous determination of aneuploidy and fetal fraction
US9260745B2 (en) 2010-01-19 2016-02-16 Verinata Health, Inc. Detecting and classifying copy number variation
US9115401B2 (en) 2010-01-19 2015-08-25 Verinata Health, Inc. Partition defined detection methods
EP3006573A1 (en) 2010-01-19 2016-04-13 Verinata Health, Inc Methods for determining fraction of fetal nucleic acids in maternal samples
US9323888B2 (en) 2010-01-19 2016-04-26 Verinata Health, Inc. Detecting and classifying copy number variation
EP2883965A1 (en) * 2010-01-19 2015-06-17 Verinata Health, Inc Method for determining copy number variations
EP2848703A1 (en) * 2010-01-19 2015-03-18 Verinata Health, Inc Simultaneous determination of aneuploidy and fetal fraction
EP2848704A1 (en) * 2010-01-19 2015-03-18 Verinata Health, Inc Sequencing methods and compositions for prenatal diagnoses
EP2376661B1 (en) * 2010-01-19 2015-01-21 Verinata Health, Inc Simultaneous determination of aneuploidy and fetal fraction
US11952623B2 (en) 2010-01-19 2024-04-09 Verinata Health, Inc. Simultaneous determination of aneuploidy and fetal fraction
US11884975B2 (en) 2010-01-19 2024-01-30 Verinata Health, Inc. Sequencing methods and compositions for prenatal diagnoses
US11875899B2 (en) 2010-01-19 2024-01-16 Verinata Health, Inc. Analyzing copy number variation in the detection of cancer
WO2011090556A1 (en) 2010-01-19 2011-07-28 Verinata Health, Inc. Methods for determining fraction of fetal nucleic acid in maternal samples
US9493828B2 (en) 2010-01-19 2016-11-15 Verinata Health, Inc. Methods for determining fraction of fetal nucleic acids in maternal samples
US11697846B2 (en) 2010-01-19 2023-07-11 Verinata Health, Inc. Detecting and classifying copy number variation
US20110201507A1 (en) * 2010-01-19 2011-08-18 Rava Richard P Sequencing methods and compositions for prenatal diagnoses
US20110224087A1 (en) * 2010-01-19 2011-09-15 Stephen Quake Simultaneous determination of aneuploidy and fetal fraction
US9657342B2 (en) 2010-01-19 2017-05-23 Verinata Health, Inc. Sequencing methods for prenatal diagnoses
EP4074838A1 (en) * 2010-01-19 2022-10-19 Verinata Health, Inc. Novel protocol for preparing sequencing libraries
EP2513341A4 (en) * 2010-01-19 2013-08-14 Verinata Health Inc Identification of polymorphic sequences in mixtures of genomic dna by whole genome sequencing
EP2366031A1 (en) * 2010-01-19 2011-09-21 Verinata Health, Inc Sequencing methods and compositions for prenatal diagnoses
EP3260555A1 (en) * 2010-01-19 2017-12-27 Verinata Health, Inc Novel protocol for preparing sequencing libraries
EP2513339A4 (en) * 2010-01-19 2013-05-29 Verinata Health Inc Methods for determining fraction of fetal nucleic acid in maternal samples
EP3382037A1 (en) 2010-01-19 2018-10-03 Verinata Health, Inc Methods for determining fraction of fetal nucleic acids in maternal samples
US20110230358A1 (en) * 2010-01-19 2011-09-22 Artemis Health, Inc. Identification of polymorphic sequences in mixtures of genomic dna by whole genome sequencing
EP2370599A1 (en) * 2010-01-19 2011-10-05 Verinata Health, Inc Method for determining copy number variations
EP3492601A1 (en) * 2010-01-19 2019-06-05 Verinata Health, Inc Novel protocol for preparing sequencing libraries
EP3878973A1 (en) 2010-01-19 2021-09-15 Verinata Health, Inc. Methods for determining fraction of fetal nucleic in maternal samples
US10388403B2 (en) 2010-01-19 2019-08-20 Verinata Health, Inc. Analyzing copy number variation in the detection of cancer
US10415089B2 (en) 2010-01-19 2019-09-17 Verinata Health, Inc. Detecting and classifying copy number variation
US10482993B2 (en) 2010-01-19 2019-11-19 Verinata Health, Inc. Analyzing copy number variation in the detection of cancer
US10586610B2 (en) 2010-01-19 2020-03-10 Verinata Health, Inc. Detecting and classifying copy number variation
EP2376661A1 (en) * 2010-01-19 2011-10-19 Verinata Health, Inc Simultaneous determination of aneuploidy and fetal fraction
US10612096B2 (en) 2010-01-19 2020-04-07 Verinata Health, Inc. Methods for determining fraction of fetal nucleic acids in maternal samples
EP2513341A1 (en) * 2010-01-19 2012-10-24 Verinata Health, Inc Identification of polymorphic sequences in mixtures of genomic dna by whole genome sequencing
EP2376661A4 (en) * 2010-01-19 2012-03-21 Verinata Health Inc Simultaneous determination of aneuploidy and fetal fraction
US10662474B2 (en) 2010-01-19 2020-05-26 Verinata Health, Inc. Identification of polymorphic sequences in mixtures of genomic DNA by whole genome sequencing
EP2513339A1 (en) * 2010-01-19 2012-10-24 Verinata Health, Inc Methods for determining fraction of fetal nucleic acid in maternal samples
EP2366031A4 (en) * 2010-01-19 2012-03-21 Verinata Health Inc Sequencing methods and compositions for prenatal diagnoses
US10941442B2 (en) 2010-01-19 2021-03-09 Verinata Health, Inc. Sequencing methods and compositions for prenatal diagnoses
EP2370599A4 (en) * 2010-01-19 2012-03-21 Verinata Health Inc Method for determining copy number variations
US9217131B2 (en) 2010-01-21 2015-12-22 Biocep Ltd. Magnetic separation of rare cells
US9546392B2 (en) 2010-01-21 2017-01-17 Biocep Ltd. Magnetic separation of rare cells
US10718020B2 (en) 2010-01-23 2020-07-21 Verinata Health, Inc. Methods of fetal abnormality detection
US8318430B2 (en) 2010-01-23 2012-11-27 Verinata Health, Inc. Methods of fetal abnormality detection
US9493831B2 (en) 2010-01-23 2016-11-15 Verinata Health, Inc. Methods of fetal abnormality detection
US8774488B2 (en) 2010-03-11 2014-07-08 Cellscape Corporation Method and device for identification of nucleated red blood cells from a maternal blood sample
US11306357B2 (en) 2010-05-18 2022-04-19 Natera, Inc. Methods for non-invasive prenatal ploidy calling
US11322224B2 (en) 2010-05-18 2022-05-03 Natera, Inc. Methods for non-invasive prenatal ploidy calling
US11482300B2 (en) * 2010-05-18 2022-10-25 Natera, Inc. Methods for preparing a DNA fraction from a biological sample for analyzing genotypes of cell-free DNA
US11746376B2 (en) 2010-05-18 2023-09-05 Natera, Inc. Methods for amplification of cell-free DNA using ligated adaptors and universal and inner target-specific primers for multiplexed nested PCR
US11111545B2 (en) 2010-05-18 2021-09-07 Natera, Inc. Methods for simultaneous amplification of target loci
US11519035B2 (en) 2010-05-18 2022-12-06 Natera, Inc. Methods for simultaneous amplification of target loci
US11286530B2 (en) 2010-05-18 2022-03-29 Natera, Inc. Methods for simultaneous amplification of target loci
US11408031B2 (en) 2010-05-18 2022-08-09 Natera, Inc. Methods for non-invasive prenatal paternity testing
US11525162B2 (en) 2010-05-18 2022-12-13 Natera, Inc. Methods for simultaneous amplification of target loci
US11312996B2 (en) 2010-05-18 2022-04-26 Natera, Inc. Methods for simultaneous amplification of target loci
US11339429B2 (en) 2010-05-18 2022-05-24 Natera, Inc. Methods for non-invasive prenatal ploidy calling
US11939634B2 (en) 2010-05-18 2024-03-26 Natera, Inc. Methods for simultaneous amplification of target loci
US11332793B2 (en) 2010-05-18 2022-05-17 Natera, Inc. Methods for simultaneous amplification of target loci
US11326208B2 (en) 2010-05-18 2022-05-10 Natera, Inc. Methods for nested PCR amplification of cell-free DNA
US11332785B2 (en) 2010-05-18 2022-05-17 Natera, Inc. Methods for non-invasive prenatal ploidy calling
US11332774B2 (en) 2010-10-26 2022-05-17 Verinata Health, Inc. Method for determining copy number variations
US10658070B2 (en) 2011-04-12 2020-05-19 Verinata Health, Inc. Resolving genome fractions using polymorphism counts
US9447453B2 (en) 2011-04-12 2016-09-20 Verinata Health, Inc. Resolving genome fractions using polymorphism counts
US8532936B2 (en) 2011-04-14 2013-09-10 Verinata Health, Inc. Normalizing chromosomes for the determination and verification of common and rare chromosomal aneuploidies
US9411937B2 (en) 2011-04-15 2016-08-09 Verinata Health, Inc. Detecting and classifying copy number variation
US9547748B2 (en) 2011-06-29 2017-01-17 Bgi Health Service Co., Ltd. Method for determining fetal chromosomal abnormality
WO2013015793A1 (en) * 2011-07-26 2013-01-31 Verinata Health, Inc. Method for determining the presence or absence of different aneuploidies in a sample
US9840732B2 (en) 2012-05-21 2017-12-12 Fluidigm Corporation Single-particle analysis of particle populations
US11390916B2 (en) 2014-04-21 2022-07-19 Natera, Inc. Methods for simultaneous amplification of target loci
US11319595B2 (en) 2014-04-21 2022-05-03 Natera, Inc. Detecting mutations and ploidy in chromosomal segments
US11414709B2 (en) 2014-04-21 2022-08-16 Natera, Inc. Detecting mutations and ploidy in chromosomal segments
US11319596B2 (en) 2014-04-21 2022-05-03 Natera, Inc. Detecting mutations and ploidy in chromosomal segments
US11486008B2 (en) 2014-04-21 2022-11-01 Natera, Inc. Detecting mutations and ploidy in chromosomal segments
US11530454B2 (en) 2014-04-21 2022-12-20 Natera, Inc. Detecting mutations and ploidy in chromosomal segments
US11408037B2 (en) 2014-04-21 2022-08-09 Natera, Inc. Detecting mutations and ploidy in chromosomal segments
US11371100B2 (en) 2014-04-21 2022-06-28 Natera, Inc. Detecting mutations and ploidy in chromosomal segments
US10364467B2 (en) 2015-01-13 2019-07-30 The Chinese University Of Hong Kong Using size and number aberrations in plasma DNA for detecting cancer
US11098352B2 (en) 2015-04-03 2021-08-24 Fluxion Biosciences, Inc. Molecular characterization of single cells and cell populations for non-invasive diagnostics
WO2016161081A1 (en) * 2015-04-03 2016-10-06 Fluxion Biosciences, Inc. Molecular characterization of single cells and cell populations for non-invasive diagnostics
US10167502B2 (en) 2015-04-03 2019-01-01 Fluxion Biosciences, Inc. Molecular characterization of single cells and cell populations for non-invasive diagnostics
US11946101B2 (en) 2015-05-11 2024-04-02 Natera, Inc. Methods and compositions for determining ploidy
US11479812B2 (en) 2015-05-11 2022-10-25 Natera, Inc. Methods and compositions for determining ploidy
US11485996B2 (en) 2016-10-04 2022-11-01 Natera, Inc. Methods for characterizing copy number variation using proximity-litigation sequencing
US11530442B2 (en) 2016-12-07 2022-12-20 Natera, Inc. Compositions and methods for identifying nucleic acid molecules
US11519028B2 (en) 2016-12-07 2022-12-06 Natera, Inc. Compositions and methods for identifying nucleic acid molecules
US11230731B2 (en) 2018-04-02 2022-01-25 Progenity, Inc. Methods, systems, and compositions for counting nucleic acid molecules
US11788121B2 (en) 2018-04-02 2023-10-17 Enumera Molecular, Inc. Methods, systems, and compositions for counting nucleic acid molecules
US11525159B2 (en) 2018-07-03 2022-12-13 Natera, Inc. Methods for detection of donor-derived cell-free DNA
US11186863B2 (en) 2019-04-02 2021-11-30 Progenity, Inc. Methods, systems, and compositions for counting nucleic acid molecules
US11959129B2 (en) 2021-10-13 2024-04-16 Enumera Molecular, Inc. Methods, systems, and compositions for counting nucleic acid molecules
CN113736876A (en) * 2021-10-14 2021-12-03 胜亚生物科技(厦门)有限公司 Kit for rapidly detecting chromosome number abnormality and application thereof

Also Published As

Publication number Publication date
US20100291571A1 (en) 2010-11-18
US20230168160A1 (en) 2023-06-01
US20120183963A1 (en) 2012-07-19
US20090280492A1 (en) 2009-11-12
US20110171638A1 (en) 2011-07-14
US10591391B2 (en) 2020-03-17
US11378498B2 (en) 2022-07-05
US20210010913A1 (en) 2021-01-14
US20130288242A1 (en) 2013-10-31
US20130280709A1 (en) 2013-10-24

Similar Documents

Publication Publication Date Title
US11378498B2 (en) Diagnosis of fetal abnormalities using polymorphisms including short tandem repeats
EP2029778B1 (en) Diagnosis of fetal abnormalities
US11674176B2 (en) Fetal aneuploidy detection by sequencing
US11261492B2 (en) Methods for the diagnosis of fetal abnormalities
US20080026390A1 (en) Diagnosis of Fetal Abnormalities by Comparative Genomic Hybridization Analysis
EP3406736B1 (en) Methods for the diagnosis of fetal abnormalities
US20080113358A1 (en) Selection of cells using biomarkers
US20100304978A1 (en) Methods and compositions for identifying a fetal cell
EP4108780A1 (en) Rare cell analysis using sample splitting and dna tags

Legal Events

Date Code Title Description
AS Assignment

Owner name: LIVING MICROSYSTEMS INC., MASSACHUSETTS

Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNORS:STOUGHTON, ROLAND;KAPUR, RAVI;COHEN, BARB ARIEL;REEL/FRAME:019908/0877;SIGNING DATES FROM 20070813 TO 20070816

AS Assignment

Owner name: ARTEMIS HEALTH, INC., MASSACHUSETTS

Free format text: CHANGE OF NAME;ASSIGNOR:LIVING MICROSYSTEMS, INC.;REEL/FRAME:019931/0171

Effective date: 20070815

AS Assignment

Owner name: VERINATA HEALTH, INC., CALIFORNIA

Free format text: CHANGE OF NAME;ASSIGNOR:ARTEMIS HEALTH, INC.;REEL/FRAME:026711/0626

Effective date: 20110413

STCB Information on status: application discontinuation

Free format text: ABANDONED -- FAILURE TO RESPOND TO AN OFFICE ACTION