KR102036609B1 - A method for prenatal diagnosis using digital PCR - Google Patents

Abstract

The present invention relates to a prenatal diagnostic method using digital PCR. The conventional amniotic fluid puncture method for prenatal diagnosis is an invasive test, and there is a risk of bacterial infection of the amniotic membrane with a syringe, a wound problem with a syringe, and a leak of amniotic fluid. Therefore, recently, a method of diagnosing genetic abnormalities of fetuses by obtaining fetal DNA from maternal blood has been introduced. However, since fetal DNA contains only a very small amount of fetal DNA compared to maternal DNA, fetal genetic information analysis is not accurate. It is very low. The present invention has been made to solve the above conventional technical problems, it is a method that can improve the accuracy of fetal genetic information analysis by concentrating fetal DNA during prenatal diagnosis using pregnant women's blood. The antenatal diagnostic method of the present invention is safe, simple, and reliable for both pregnant and fetus, and is expected to be widely utilized in the field of antenatal diagnosis.

Description

Prenatal diagnosis using digital PCR {A method for prenatal diagnosis using digital PCR}

The present invention relates to a prenatal diagnosis method using digital PCR.

Due to the aging of the married population and the aging of the childbearing age, the probability of developing fetal hereditary diseases has increased rapidly over the past 10 years. It is very important to diagnose a fetal genetic abnormality early when a disease including a fetal genetic abnormality is detected in the early pregnancy, as it enables prompt medical measures necessary for safety while reducing pain for the pregnant woman and the fetus. . Genetic abnormalities that can occur in the fetus include translocation, deletion, duplication, insertion, and number of chromosomal abnormalities (e.g., trisomy). If such chromosomal abnormalities are present, the structure throughout the fetus's body Abnormalities and functional abnormalities occur. In particular, it is known that numerical abnormalities of genes occur more frequently as the pregnant woman gets older.

Typically, the amniotic fluid puncture method is used to diagnose the genetic abnormality of the fetus.The amniotic fluid test is an invasive test, and there is a risk of bacterial infection of the amniotic membrane by a syringe, a wound problem by a syringe, and a problem of leaking amniotic fluid. If so, it could be a miscarriage. Therefore, in recent years, a method of diagnosing fetal genetic abnormalities by obtaining fetal DNA from pregnant women's blood has been introduced, but since the pregnant woman's blood contains only a very small amount of fetal DNA compared to the maternal DNA, the analysis of fetal genetic information is accurate. Is very low. In this regard, Korean Patent Publication No. 10-1387582 discloses a method for detecting cell-free fetal nucleic acids in the mother by performing real-time PCR targeting cell-free fetal nucleic acids present in a very small amount in the mother's blood. have. However, although the real-time PCR method is a non-invasive method, it has limitations in performing various types of tests at once, and the use of a standard curve is required to detect an abnormal number of genes in the fetus, and the amount of samples consumed needs to be over a certain level. There is a drawback of that.

Accordingly, the present invention has been devised to solve the problems of the prior art as described above, and is a method capable of improving the accuracy of fetal genetic information analysis by concentrating fetal DNA during prenatal diagnosis using the blood of a pregnant woman. The prenatal diagnosis method of the present invention is safe, simple, and reliable in accuracy for both a pregnant woman and a fetus, and is expected to be widely used in the field of prenatal diagnosis.

The present invention was conceived to solve the problems of the prior art as described above, and relates to a prenatal diagnosis method using digital PCR.

However, the technical problem to be achieved by the present invention is not limited to the problems mentioned above, and other problems that are not mentioned will be clearly understood by those of ordinary skill in the art from the following description.

Hereinafter, various embodiments described herein are described with reference to the drawings. In the following description, for a thorough understanding of the present invention, various specific details, such as specific forms, compositions and processes, etc. are set forth. However, certain embodiments may be practiced without one or more of these specific details, or with other known methods and forms. In other instances, well-known processes and manufacturing techniques have not been described in specific details in order not to unnecessarily obscure the present invention. Reference throughout this specification to “one embodiment” or “an embodiment” means that a particular feature, form, composition, or characteristic described in connection with the embodiment is included in one or more embodiments of the present invention. Thus, the context of “in one embodiment” or “an embodiment” expressed in various places throughout this specification does not necessarily represent the same embodiment of the invention. Additionally, particular features, forms, compositions, or properties may be combined in one or more embodiments in any suitable manner.

Unless otherwise defined in the specification, all scientific and technical terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which the present invention belongs.

In one embodiment of the present invention, "prenatal diagnosis" is used to diagnose congenital abnormalities before birth, and is also referred to as prenatal diagnosis or intrauterine diagnosis. Tests are performed using cytogenetics, biochemical analysis, and imaging using the fetus or the deciding material from the fetus as a sample. It aims at early detection of birth-related abnormalities and maternal protection. Techniques include invasive methods (amniocentesis, villi collection, fetal blood sampling, fetal skin biopsy, fetal liver biopsy) and non-invasive methods (ultrasound, fetal cell collection in maternal blood, etc.).

Adaptation to genetic prenatal diagnosis is suspicious of chromosomal abnormalities, single genetic diseases, congenital metabolic abnormalities, etc., confirming the recognition of abnormal childbirth, elderly pregnancy, addiction by ultrasound, etc. When it becomes possible, it is carried out. In the karyotyping analysis, amniocentesis is required for safety, but it is a rule to collect blood between 15 and 18 weeks of pregnancy. For DNA diagnosis, villi are also collected, which are collected either hard or transversely between the 9th and 11th weeks of pregnancy. Fetal blood is collected from the right after the 16th week of pregnancy. Cytogenetic diagnosis is carried out by means of fluorescence in situ hybridization (FISH) or fetal-derived cell culture. Direct diagnosis by Chain Reaction (PCR), Restriction Fragment Length Polymorphism (RFLP), and indirect diagnosis by PCR-RFLP method are being conducted.

In one embodiment of the present invention, the term "more than the number of chromosomes" is also referred to as aneuploidy, and the number of chromosomes per cell in a cell, individual or lineage does not become an integral multiple of the base number, and there are many or fewer of 1 to several relative to the integer multiple In other words, it means a state including a genome with an incomplete configuration, and cells or individuals in this state are called aneuploids. In general, a case where the number of chromosomes is more than an integer multiple of the base number is called a high number, and a case where the number of chromosomes is small is called a low number. In particular, in the case of diploid, if one pair of homologous chromosomes is missing, there is 0 chromosome, if one is missing and only the other is present, there is one chromosome, and in addition to one pair of homologous chromosomes, another one extra chromosome exists. This case is called trisomy.

The representative sex chromosome aneuploidy is XXY, and it is Klinefelter syndrome, which is characterized by testicular dysfunction. In addition, there is one X chromosome (XO) and Turner's syndrome in which the ovaries do not develop, XXX women with 3 X chromosomes, and YY syndrome of XYY (YY men). Representative autosomal aneuploidy is Down syndrome, chromosome 21 is trisomy, Edward syndrome, chromosome 18 is trisomy, which causes developmental disorders in the birth period, and chromosome 13 is trisomy, which is accompanied by a high degree of malformation. Patau syndrome and the like, but are not limited thereto. Cat crying syndrome is caused by a partial deletion of the short arm of chromosome 5 with a characteristic crying sound.

In one embodiment of the present invention, the term "real-time polymerase chain reaction (PCR)" is also referred to as real-time polymerase chain reaction, qPCR (quantitative real time polymerase chain reaction, qPCR), and target DNA It is a molecular biology experimental technique that measures the amplification and quantity of molecules at the same time. The commonly used RT-PCR refers to a reverse transcription polymerase chain reaction, and is not a real-time PCR. However, not all those skilled in the art will name it clearly. Real-time polymerase chain reaction can detect the absolute number or relative amount of gene copies for one or more specific sequences in a DNA sample.

The progress of the experiment follows a general polymerase chain reaction. An important feature is that the amplified DNA is measured in real time. This is the difference from the basic polymerase chain reaction in which DNA is observed at the end. Two general methods are used in real-time polymerase chain reactions. (1) Unspecified fluorescent staining capable of intervening in any DNA double helix, (2) Sequence-specific DNA probe consisting of oligonucleotides, labeled with fluorescence, and detected after binding to a complementary DNA target. Often, real-time polymerase chain reactions are performed in combination with reverse transcription polymerization to quantify cellular or tissue mRNA and non-coding RNA (RNA).

In one embodiment of the present invention, "digital PCR (Digital Polymerase Chain Reaction, Digital PCR)" is a new approach for detecting and quantifying nucleic acids, which enables accurate quantitative analysis and high-sensitivity detection of target nucleic acid molecules compared to existing qPCR. While the conventional qPCR result analysis method is analog, the result signal has a value of "0" or "1" and the digital PCR method is a digital method. It has the advantage of being able to perform various inspection items at once. Digital PCR (digital PCR) technology is a technology that enables absolute quantification of DNA samples by applying a single molecule counting method that does not require a standard curve, and performs more accurate absolute quantification by PCR reaction for one droplet per well. There are advantages to be able to do it (see Gudrun Pohl and le-Ming Shih, Principle and applications of digital PCR, Expert Rev. Mol. Diagn. 4(1), 41-47 (2004)).

In digital PCR, a sample gene template prepared to be diluted with an average of 0.5 to 1 copy number, each droplet including an amplification primer and a fluorescent probe, was distributed to one well, and emulsion PCR was performed, and then the well of the fluorescent signal was 1 Since the sample of the number of copies of the gene is distributed to represent the signal after amplification, it is counted as a value of "1", and the well without a fluorescent signal is set to "0" because the sample of the number of copies of 0 is not amplified and there is no signal. Absolute quantification can be achieved by counting.

In digital PCR, the reliability of data is guaranteed only when the number of gene copies per well in which the fluorescent signal is displayed is one. In other words, quantification in digital PCR is based on a poisson distribution, when a signal per well is present or absent, it is viewed as a digital value of 1 or 0, and the ratio of positive (value of 1) and negative (value of 0) is calculated. If the ratio of the positive to the sum of the total positive and negative is significantly out of one gene copy number of the Poisson distribution, it means that the number of gene copies per well exceeds one probabilistically, so the reliability of the data can be guaranteed. There will be no. For this reason, in digital PCR, if the quantified value after amplification does not satisfy the Poisson distribution, so when the number of gene copies per well exceeds 1, it is important to dilute the gene sample to satisfy the Poisson distribution. If the number of copies is close to one, it is important to quantify it with a corrected value (for example, it can be corrected using the Poisson 9 program).

However, despite the ease of quantitative analysis, large-volume analysis, and the ability to process a large amount of samples, the digital PCR method requires a correction technology for quantitative analysis to secure data reliability of digital PCR until now, and the number of gene copies per well is 1 There are technical difficulties in matching with dogs. In particular, in performing genetic analysis on the abnormality of the number of fetal genes from the blood or plasma of a pregnant woman as described above, digital PCR is performed using a primer pair and a probe specific for the target gene related to the abnormality of the number of genes. When performing, there is a problem that an abnormality in the number of genes related to the fetal target gene present in a small amount in the blood or plasma of a pregnant woman is not detected or is detected as an unclear signal due to the background signal of the maternal gene present in a large amount. There will be. This problem has become a barrier that makes it difficult to combine genotyping technology and digital PCR technology using fetal cell-free genes.

Therefore, when analyzing an abnormality in the number of fetal genes using fetal genes present in trace amounts in the blood or plasma of a pregnant woman based on digital PCR technology, it is difficult to separate only signals derived from fetal genes and maternal origin. While solving the problem caused by the genetic background signal, there is a need to provide a technology that can provide reliable quantitative results by satisfying the Poisson distribution required in digital PCR technology.

In one embodiment of the present invention, the "control gene" refers to a normal gene that serves as a standard for testing in order to determine the presence or absence of an abnormality in a target gene. For example, in the present specification, the control gene is a gene known not to be related to an abnormality in the number of genes in both the maternal-derived gene set or the fetal-derived gene set in the blood or plasma of a pregnant woman, but is not limited thereto. It can be chromosome or chromosome 2.

In one embodiment of the present invention, the "target gene" is a gene in which mutations useful for genotyping among genes in a sample to be analyzed exist, for example, a marker gene used for gene recognition or individual identification, or a specific disease. It refers to a marker gene used for diagnosis, a gene representing an abnormality in the number of chromosomes or an abnormality in the number of genes, a gene having a genetically significant mutation, a gene having a short tandem repeat (STR), a gene having a single nucleotide polymorphism, and the like. For example, in the present specification, the target gene is a gene that is subject to a test greater than or equal to the number of genes in the fetus, but is not limited thereto, but is not limited to chromosome 21 (Down syndrome), chromosome 18 (Edward syndrome), or chromosome 13 It may be (patau syndrome).

In one embodiment of the present invention, "diagnosis" means to confirm the presence or characteristics of a pathological condition, and for the purposes of the present invention, the diagnosis is to determine whether the number of chromosomes is abnormal by analyzing the genetic information of the fetus from the blood of a pregnant woman. Thing, but no more limiting.

In one embodiment of the present invention, (a) obtaining DNA from the blood of a pregnant woman; (b) classifying the DNA by size to obtain a DNA of 1,000 bp or less; (c) performing digital PCR with the DNA of step (b), but performing digital PCR on a control gene located on a chromosome that is not related to an abnormality in the number of chromosomes and a target gene located on a chromosome that is related to an abnormality in the number of chromosomes. ; (d) calculating a ratio of the quantitative digital PCR value of the target gene to the quantitative digital PCR value of the control gene; And (e) determining that the fetal chromosome number is normal if the ratio calculated in step (d) is 0.70 to 1.14, and the (d) If the ratio calculated in step is 0.95 to 1.10, it provides a method of providing information on the diagnosis of fetal chromosomal aneuploidy, including determining the fetal number of chromosomes as normal, and classifying the DNA of step (b) by size The method comprises the steps of: (a) first mixing magnetic beads with DNA (bead A) and obtaining unbound DNA; And (b) secondary mixing (bead B) a magnetic bead with the obtained DNA, and obtaining DNA bound to the bead, wherein the method for providing information on the diagnosis of fetal chromosomal aneuploidy, the bead A The addition ratio of and bead B is 0.75 to 1.25: Provides a method of providing information on the diagnosis of chromosomal aneuploidy in the fetus, and the addition ratio of the bead A and bead B is 0.75 to 1.0: 1 chromosomal aneuploidy diagnosis Provides a way to provide information about.

In another embodiment of the present invention, (a) obtaining DNA from the blood of a pregnant woman; (b) classifying the DNA by size to obtain a DNA of 1,000 bp or less; (c) performing digital PCR with the DNA of step (b), but performing digital PCR on a control gene located on a chromosome that is not related to an abnormality in the number of chromosomes and a target gene located on a chromosome that is related to an abnormality in the number of chromosomes. ; (d) calculating a ratio of the quantitative digital PCR value of the target gene to the quantitative digital PCR value of the control gene; And (e) if the ratio calculated in step (d) is 0.10 to 0.69, or 1.15 to 1.80, it provides a method of providing information on the diagnosis of fetal chromosomal aneuploidy comprising the step of determining more than the number of chromosomes of the fetus, and , If the ratio calculated in step (d) is 0.45 to 0.69, or 1.15 to 1.31, it provides a method of providing information on the diagnosis of fetal chromosomal aneuploidy comprising the step of determining the number of chromosomes or more of the fetus, and the ( If the ratio calculated in step d) is 0.10 to 0.69, it provides a method of providing information on the diagnosis of fetal chromosomal aneuploidy, including the step of determining the fetal chromosomality as monosomy, wherein the monosomy is Turner's syndrome. Provides a method of providing information on the diagnosis of chromosomal aneuploidy of a fetus, and if the ratio calculated in step (d) is 1.15 to 1.80, the fetal chromosome comprising the step of determining the fetal chromosomality as trisomy Provides a method of providing information on aneuploidy diagnosis, wherein the trisomy provides a method of providing information on chromosomal aneuploidy diagnosis of a fetus with Down syndrome, Edward syndrome or Patau syndrome, wherein the DNA of step (b) The method of classifying by size includes the steps of: (a) first mixing magnetic beads with DNA (bead A) and obtaining unbound DNA; And (b) secondary mixing (bead B) a magnetic bead with the obtained DNA, and obtaining DNA bound to the bead, wherein the method for providing information on the diagnosis of fetal chromosomal aneuploidy, the bead A The addition ratio of and bead B is 0.75 to 1.25: Provides a method of providing information on the diagnosis of chromosomal aneuploidy in the fetus, and the addition ratio of the bead A and bead B is 0.75 to 1.0: 1 chromosomal aneuploidy diagnosis Provides a way to provide information about.

In addition, in the method for providing information on the diagnosis of fetal chromosomal aneuploidy described above, the target gene is any one or more selected from the group consisting of genes having nucleotide sequences of SEQ ID NOs: 1 to 4, characterized in that the fetal chromosomal aneuploidy Provides a method of providing information on diagnosis, and as a primer pair for amplifying a target gene having a nucleotide sequence of SEQ ID NO: 1, a primer pair of SEQ ID NO: 7 and 8 is used, and a target having the nucleotide sequence of SEQ ID NO: 1 Provides a method for providing information on the diagnosis of fetal chromosomal aneuploidy, characterized in that the oligonucleotide of SEQ ID NO: 9 is used as a probe for detecting the gene amplification product, and the target gene having the nucleotide sequence of SEQ ID NO: 2 As a primer pair for amplifying, a primer pair of SEQ ID NO: 10 and 11 is used, and an oligonucleotide of SEQ ID NO: 12 is used as a probe for detecting a target gene amplification product having a nucleotide sequence of SEQ ID NO: 2. Provides a method of providing information on the diagnosis of fetal chromosomal aneuploidy, and as a primer pair for amplifying the target gene having the nucleotide sequence of SEQ ID NO: 3, a primer pair of SEQ ID NO: 13 and 14 is used, and the base of SEQ ID NO: 3 Provides a method for providing information on the diagnosis of fetal chromosomal aneuploidy, characterized in that the oligonucleotide of SEQ ID NO: 15 is used as a probe for detecting a target gene amplification product having a sequence, and the nucleotide sequence of SEQ ID NO: 4 As a primer pair for amplifying a target gene having a target gene, a primer pair of SEQ ID NO: 16 and 17 is used, and an oligonucleotide of SEQ ID NO: 18 is used as a probe for detecting a target gene amplification product having the nucleotide sequence of SEQ ID NO: 4 It provides a method of providing information on the diagnosis of fetal chromosomal aneuploidy, characterized in that.

In addition, in the method for providing information on the diagnosis of fetal chromosomal aneuploidy described above, the control gene is any one or more selected from the group consisting of genes having nucleotide sequences of SEQ ID NOs: 5 and 6 Provides a method of providing information on diagnosis, and as a primer pair for amplifying the control gene having the nucleotide sequence of SEQ ID NO: 5, a primer pair of SEQ ID NO: 19 and 20 is used, and a control having the nucleotide sequence of SEQ ID NO: 5 Provides a method for providing information on the diagnosis of fetal chromosomal aneuploidy, characterized in that the oligonucleotide of SEQ ID NO: 21 is used as a probe for detecting the gene amplification product, and a control gene having the nucleotide sequence of SEQ ID NO: 6 As a primer pair for amplifying, a primer pair of SEQ ID NO: 22 and 23 is used, and an oligonucleotide of SEQ ID NO: 24 is used as a probe for detecting a control gene amplification product having the nucleotide sequence of SEQ ID NO: 6. It provides a method of providing information about the diagnosis of fetal chromosomal aneuploidy.

Hereinafter, the present invention will be described in detail step by step.

The prenatal diagnosis method using digital PCR of the present invention is safe for pregnant women and the fetus by using a non-invasive sample collection method, and a small amount of fetal gene signals can be stably separated from the mother-derived gene background signal without omission or error, and thus fetal inheritance. Since it improves the accuracy of information, it is expected to be highly useful for early diagnosis of fetal genetic diseases.

1 is a diagram showing the locus of a target gene or a control gene on chromosomes 21, 1, and 2 according to an embodiment of the present invention.
2 is a result of performing digital PCR on normal and Down syndrome cells according to an embodiment of the present invention, and calculating the normalized value of the target gene relative to the digital PCR quantitative value of the control gene.
3 is a result of performing digital PCR on amniotic fluid samples of pregnant women with normal and Down syndrome fetuses according to an embodiment of the present invention, and calculating the normalized value of the target gene with respect to the digital PCR quantitative value of the control gene to be.
4 is a DNA sample in which a long-length DNA (LD) and a short-length DNA (SD) are mixed at 1:1 according to an embodiment of the present invention, and a DNA sample This is the result of analyzing how much LD is removed depending on the amount of the first bead (bead A) added.
5 is a result of quantifying the ratio of fetal-derived DNA and maternal-derived DNA from a blood sample of a pregnant woman using an APP gene according to an embodiment of the present invention.
6 is a result of performing digital PCR on a gDNA sample in which normal gDNA and Down's syndrome gDNA are mixed in various ratios according to an embodiment of the present invention, and calculating the ratio value of the amount of Down's syndrome gene compared to normal.
7 is a digital PCR performed by dividing the DNA according to the degree of fragmentation after extracting cfDNA from the plasma of a pregnant woman who is pregnant with a normal or Down syndrome (T21) fetus according to an embodiment of the present invention, and digital PCR of a control gene This is the result of calculating the normalized value of the target gene for the quantitative value.

Hereinafter, the present invention will be described in more detail through examples. These examples are only for describing the present invention in more detail, and it will be apparent to those of ordinary skill in the art that the scope of the present invention is not limited by these examples according to the gist of the present invention. .

Example One: Control gene And the selection of target genes primer Pair and Of the probe design

In order to perform genetic analysis on fetal-derived genes, such as trisomy, to perform gene number abnormality analysis, chromosome 21 (Down syndrome occurs when trisomy) is the target chromosome, and chromosomes 1 and 2 Chromosome 1 was set as a control chromosome. Next, for gene detection, the genes in four regions on chromosome 21 are set as target genes, and the genes in one region on chromosome 1 and one region on chromosome 2 are used as control genes, based on this. A primer pair to amplify each gene and a fluorescently labeled probe to confirm the result of the amplification reaction were designed. These primers, Bioneer Co., Ltd. (Daejeon, Korea), and probes were synthesized by requesting Thermo Fisher Scientific (USA). The set regions on chromosomes 21, 1, and 2 are shown in FIG. 1, and the sequences and primer pairs and designs of the probes are described in Tables 1 and 2.

Sequence number gene chromosome Gene position Base sequence SEQ ID NO: 1 Target gene 1 21 36616417-36616581 CTGCAGTTCTTTGTGAACACTCTCATTTGTTGTATCTGTAGGCTGTCTCTCTCAGTGGTAAATGCCTTCGTGTGTTTGTAATGCTGATGGTTACTTGAGGTAAATAAGAATGTACCACTTGGCTCAGTGTGCATGATGTAAGCTTGTCTTTGTTGTATGTTGGCT SEQ ID NO: 2 Target gene 2 21 36071971-36072131 TGACTATCACATGTCTTTGGTTGTAAACTGCTGTGATAGTTACCCTAAGTAATGGGACAGGAGATGAACCCACCCATTAAATAACACAGCAATTAAGCAGCCACTTTTAGAAAAATTTAAATGTGTGGCTTCGAGTTGGGTACTTGCATGTACAGCTTACT SEQ ID NO: 3 Target gene 3 21 44773359-44773476 CCCAGGCTATGCTAGAAGGTATGCTTACAATTGGAAAAGTGTAGGCAGATAACATTAAATGGCAATAGCATGTGTAAACTAACTGCAAATGAGGAAAAGGACATTCTAAAGACAGGAT SEQ ID NO: 4 Target gene 4 21 36465317-36465426 GGACCAGAGGTTTATTGGAGGTCTAAATATTTATGGAGAGCAATGATGGCTAATTTTAGAAACCATTAGGTTGCTATTTTTAAACGTGTGCTATAAGGATTTGCTAATTT SEQ ID NO: 5 Control gene 1 One 202879715-202879841 GAGGAAGCAACTAGAAAACAATGGAAGGGACTTCAGATGGTAAGGTTTCTGTTTAGTACTTATTTCAATTTTAGGCCTCCTGAATAGTAGAGGTGGTGACAGGAGGATACCTGAAACCTTGGTTATA SEQ ID NO: 6 Control gene 2 2 28398885-28398996 GGGAACATCCCAGGTTCAGTAAAAATACAGAGTATTTGCGTTAAACTGGACCTCAGTGGGGATGTGATGGGAGGTATGAGACAGATTGTGCCCTTATCCTTTTCTCTTCTTG

Forward primer (5'→3') Reverse primer (5'→3') Fluorescent probe (5'→3') SEQ ID NO: 1 (SEQ ID NO: 7)
CGTGTGTTTGTAATGCTGATGGT (SEQ ID NO: 8)
CATCATGCACACTGAGCCAAGT (SEQ ID NO: 9)
ACTTGAGGTAAATAAGAATGTAC
(5'-VIC, 3'-MGB_NFQ) SEQ ID NO: 2 (SEQ ID NO: 10)
CCCTAAGTAATGGGACAGGAGATG (SEQ ID NO: 11)
AAGTGGCTGCTTAATTGCTGTGT (SEQ ID NO: 12)
ACCCACCCATTAAAT
(5'-VIC, 3'-MGB_NFQ) SEQ ID NO: 3 (SEQ ID NO: 13)
TGCTAGAAGGTATGCTTACAATTGGA (SEQ ID NO: 14)
TCATTTGCAGTTAGTTTACACATGCT (SEQ ID NO: 15)
AAGTGTAGGCAGATAAC
(5'-VIC, 3'-MGB_NFQ) SEQ ID NO: 4 (SEQ ID NO: 16)
GACCAGAGGTTTATTGGAGGTCTAAAT (SEQ ID NO: 17)
CACGTTTAAAAATAGCAACCTAATGG (SEQ ID NO: 18)
TTTATGGAGAGCAATGAT
(5'-VIC, 3'-MGB_NFQ) SEQ ID NO: 5 (SEQ ID NO: 19)
CAACTAGAAAACAATGGAAGGGACTT (SEQ ID NO: 20)
TCAGGAGGCCTAAAATTGAAATAAG (SEQ ID NO: 21)
AGATGGTAAGGTTTCTGTTTAG
(5'-FAM, 3'-MGB_NFQ) SEQ ID NO: 6 (SEQ ID NO: 22)
CATCCCAGGTTCAGTAAAAATACAGA (SEQ ID NO: 23)
CTGTCTCATACCTCCCATCACATC (SEQ ID NO: 24)
TATTTGCGTTAAACTGGACC
(5'-FAM, 3'-MGB_NFQ)

Example 2. Digital for normal and Down syndrome cells PCR Perform

In order to calculate digital PCR results for gDNA of normal or Down's syndrome (T21), Coriell's normal or Down's syndrome (T21) gDNA was purchased.

PCR was performed using the gDNA as a template using a QX200 (Bio-Rad, USA) digital PCR equipment. In order to set an appropriate concentration of the sample for digital PCR, the gDNA sample was diluted stepwise in the range of 1 to 5000 times during the experiment. The master mix for digital PCR was prepared by adjusting the injection concentration of the sample to 2 to 10 ng under the conditions of 0.5 to 1.0 μM primer and 0.1 to 0.25 μM probe based on the total reaction solution 20 μM (see Table 3 below). ), was distributed to each PCR tube. After the PCR tube containing the solution was mounted on the fixture of DG8 droplet generator catridges, 20 µl of the sample was dispensed into the sample well, and 70 µl of the droplet generating oil was dispensed into the oil well. After that, after mounting a gasket on the cartridge, a droplet generation reaction was performed using a QX200 droplet generator, and the generated droplets were dispensed into a 96-well PCR plate and PCR was performed according to the temperature conditions in Table 4. .

No. PCR amplification composition Volume (µl) One Sample with DNA template One 2 Primer/Probe Set 9 3 ddPCR Supermix for Probes 10 Sum 20

No. step Temperature time cycle One Pretreatment 95℃ 10 minutes 2 denaturalization 94℃ 30 seconds 40 cycles 3 Annealing 60℃ 60 seconds 4 Hold 98℃ 10 minutes

The wells in which the above reaction has been completed are mounted on a QX200 droplet reader to analyze the number of copies (copies/µl) for each probe, and the number of copies (copies/µl) for each probe is used, The normalized values of the target genes (SEQ ID NOs: 1 to 4) with respect to the digital PCR quantitative values of the control gene (SEQ ID NO: 5 or 6) were calculated. The results are shown in FIG. 2.

As a result of the experiment, the output ratio values for the normal somatic cell sample (n=4) were 1.1714, 1.0256, 1.0821, and 1.0255, respectively, and the average value was 1.08. The calculation ratio values were 2.1000, 1.4388, 1.3611, and 1.1387, respectively, and the average value was 1.51. As a result, it was found that the calculation ratio of the sample with Down syndrome has a value of about 1.5 times that of the normal sample.

Example 3. Digital PCR on amniotic fluid samples of pregnant women with normal and Down syndrome fetuses

The cfDNA of the fetus was obtained from amniotic fluid samples of pregnant women with normal or Down syndrome (T21) fetuses, and digital PCR was performed as a template sample.

First, gDNA was extracted from the cells using QIAamp Circulating Nucleic Acid Kit (Qiagen Cat #55114) of QIAGEN, Germany. The gDNA extraction process was performed according to the manual provided by the manufacturer. Specifically, in order to increase the purity of the sample by lysing cells with a protein lysate buffer and removing protein components, 100 µl of proteinase K was added to a 50 ㎖ centrifuge tube. In addition, after adding an ACL buffer containing 1.0 μg carrier RNA to a 50 ml centrifuge tube to which proteinase K was added, vortexing was performed to mix the cell lysate and the ACL buffer. I did. After reacting the mixed solution at 60° C. for 30 minutes, 3.6 ml of ACB buffer (lysate buffer) was added to the centrifuge tube and vortexed to obtain an ACB buffer mixture, and then reacted on ice for 5 minutes. Made it.

A vacuum pump system was used to increase the yield of extracted gDNA by improving the adsorption of the membrane present on the column of the QIAamp Circulating Nucleic Acid Kit. A QIAamp Mini column and a 20 ml tube extender were mounted using a vacuum pump system to allow the ACB buffer mixture to flow through the QIAamp mini column. After the vacuum pump system was turned on and the ACB buffer mixture flowed, the value of the vacuum pump system was adjusted to zero and the tube extender was removed. Through this process, the maximum amount of reactants is bound to the membrane of the QIAamp mini-column. Then, 600 µl of ACW1 buffer, which is the first buffer solution to wash the reactants bound to the QIAamp mini-column, is flown into the QIAamp mini-column by operating the vacuum pump system, and then the vacuum pump system is adjusted to zero, and the tube The extender was removed. Through this process, the DNA bound to the QIAamp mini-column membrane is washed. In addition, a second washing operation is performed in order to obtain high-purity DNA. After 750 µl of the second washing solution, ACW2 buffer, was flown to the QIAamp mini column by operating the vacuum pump system, the value of the vacuum pump system was adjusted to 0, and the tube extender was removed. Through this process, the DNA bound to the QIAamp mini-column membrane is further washed, and high-purity DNA can be obtained.

750 [mu]l of ethanol (96% to 100%), the final washing solution, was flowed into the QIAamp mini column by operating the vacuum pump system, and the value of the vacuum pump system was adjusted to zero, and the tube extender was removed. In addition, after increasing the purity of the extracted DNA by drying and removing the ethanol component as much as possible, the lid of the QIAamp mini-column was closed and centrifuged at 20,000 g and 14,000 rpm for 3 minutes. The lid of the QIAamp mini column was opened and dried at 56° C. for 10 minutes. Thereafter, 20 µl of AVE buffer was added to the QIAamp mini column and reacted at room temperature for 3 minutes, and then the cap of the QIAamp mini column was closed and centrifuged for 1 minute at 20,000 g and 14,000 rpm. Thus, each corresponding gDNA sample was finally obtained from normal or Down's syndrome (T21) somatic cells.

Digital PCR from the sample was performed in the same manner and conditions as in Example 2. The results are shown in FIG. 3.

As a result of the experiment, the calculation ratio values for the amniotic fluid samples (n=4) of pregnant women with normal fetuses were 1.1991, 1.0574, 1.0006, and 0.9560, respectively, and the average value was 1.05, and Down syndrome (T21) fetuses were pregnant. The calculation ratio values for the amniotic fluid samples (n=4) of a pregnant woman were 1.6584, 1.6954, 1.4886, and 1.5062, respectively, and the average value was 1.59. As a result, it can be seen that the calculation ratio of the Down syndrome sample is about 1.5 times that of the normal sample, which represents a value similar to the result of an experiment using normal or Down syndrome cells as a sample.

Example 4. SPRIselsect Magnetic Bead Proportional DNA By shredding particle size Classification check

Since fetal DNA is smaller in size than maternal DNA, in order to increase the information reflection rate of fetal cfDNA having a short length (bp), a method of dividing and extracting DNA length during cfDNA extraction was sought. In order to produce DNA of different sizes, gDNA was crushed under two conditions (long length, short length; 5 minutes, 15 minutes) according to the manual of Thermo Fisher Scientific's Ion ShearTM Plus Reagents Kit (Cat #4471252). The classification of gDNA by shredding particle size was performed using the SPRIselsect Kit of Beckman Coulter, Germany, according to the manufacturer's manual. This will be described in detail as follows.

First, a sample containing gDNA and a magnetic bead (named bead A) were mixed so that long DNA (LD: long DNA) was preferentially adsorbed to the bead. Thereafter, after separating the beads using a magnet, the DNA remaining in the supernatant without being adsorbed on the beads is transferred to a new tube, and a new bead (named bead B) is added again to the remaining DNA (short-length DNA, SD: short DNA) was extracted. Adsorbed DNA was extracted from beads A and B in each tube.

In the above method, a DNA sample in which LD and SD were mixed at 1:1 was analyzed, and how much LD was removed according to the amount of beads A compared to the DNA sample was analyzed. The results are shown in FIG. 4.

As a result of the experiment, when bead A was added at a ratio of 0.5 times compared to the DNA sample, it was found that both beads A and B did not have a DNA size discrimination effect. However, in the case of 0.75 times ratio, bead A adsorbs DNA of 400 bp or more and bead B 500 bp or less, and in the case of 1.0 times ratio, bead A adsorbs DNA of 200 bp or more, and bead B is 300 bp or less, and 1.25 times ratio In the case of, it was found that the amount of LD to be removed also increased as the amount of bead A added increased, adsorbing DNA of 150 bp or more and 200 bp or less for bead A and 200 bp or less. Considering that the length of fetal cfDNA is about 150 bp or less, the ratio of the bead A to the DNA sample in the most preferable range for concentrating fetal cfDNA was 0.75 to 1.25, and a more preferable addition ratio was analyzed to be 0.75 to 1.0.

Example 5. Fetal origin from pregnant woman's blood sample DNA and Maternal origin DNA Ratio quantification

It is known that fetal DNA in the blood or plasma of a pregnant woman is smaller in size than DNA derived from the mother. Therefore, by amplifying small fetal DNA and maternal DNA with a larger size related to a specific gene by real-time PCR, fetal DNA and maternal DNA present in the blood or plasma of a pregnant woman are quantified in relation to a specific gene. You can do it, and from this you can find the ratio of the amount of their genes.

Therefore, in this example, as specific genes commonly present in fetal DNA and maternal DNA in a pregnant woman's blood or plasma sample, an amyloid precursor protein (APP) gene (GenBank accession No. NM_000484) and a β-actin gene were selected. , A primer pair capable of amplifying fetal DNA and maternal DNA related to the APP gene and β-actin gene, and a fluorescently labeled probe capable of confirming the result of the amplification reaction were designed (see Table 5 below).

Target
gene Amplicon length Forward primer Reverse primer Fluorescent probe (5'→3') (5'→3') (5'-FAM, 3'-TAMRA) APP 67 bp TCAGGTTGACGCCGCTGT
(SEQ ID NO: 25) TTCGTAGCCGTTCTGCTGC
(SEQ ID NO: 26) ACCCCAGAGGAGCGCCACCTG
(SEQ ID NO: 28) 180 bp TCTATAAATGGACACCGATGGGTAGT
(SEQ ID NO: 27) β-actin 83 bp TACAGGAAGTCCCTTGCCAT
(SEQ ID NO: 29) CCTGTGTGGACTTGGGAGAG
(SEQ ID NO: 30) CCCACTTCTCTCTAAGGAGAATGGCCC
(SEQ ID NO: 32) 170 bp CACGAAGGCTCATCATTCAA
(SEQ ID NO: 31) 67 bp AGAGCTACGAGCTGCCTGAC
(SEQ ID NO: 33) CCATCTCTTGCTCGAAGTCC
(SEQ ID NO: 34) TTCCGCTGCCCTGAGGCACT
(SEQ ID NO: 36) 169 bp GGCAGGACTTAGCTTCCACA
(SEQ ID NO: 35)

For reference, in Table 5 above, in order to evaluate the ratio of the amount of these genes through quantitative comparison between fetal DNA and maternal DNA using real-time PCR, it is considered that the size of the fetal DNA is smaller than the size of the maternal DNA. Thus, a primer pair was designed. In particular, as shown in Table 5, in order to accurately evaluate the amount of maternal-derived genes and the amount of fetal-derived genes and to unify the analysis conditions during quantitative evaluation, short amplicons from fetal DNA and maternal DNA and maternal DNA were used. The detection probe and the forward primer for a set of long amplicons were designed to be common and only the reverse primer was different. In addition, each detection probe is double-labeled with a fluorescent substance and a quenching substance to confirm the real-time PCR amplification reaction result and quantitatively analyze it. In this example, the 5'end of each detection probe was labeled with a fluorescent material, FAM, and the 3'end, was labeled with a quenching material, TAMRA.

As shown in Table 5 above, in the case of the APP target gene, short amplicons (length 67 bp) from fetal DNA and maternal DNA were obtained from the primer pairs of SEQ ID NOs: 25 and 26, and From the primer pair, long amplicons (180 bp in length) from parental DNA are obtained.

Using the short-length DNA enrichment method performed in this example, cfDNA of a pregnant woman with a normal fetus was obtained, and real-time PCR was performed to measure the ratio of SD to LD. In this example, real-time PCR was performed using a 7900HT Fast Real Time PCR System (Life Technologies, USA).

Each primer pair and detection probe for the APP gene, a DNA template prepared as described above, and a real-time PCR composition such as a real-time PCR master mixture were prepared as shown in Table 6 below, and the following Real-time PCR was performed under the real-time PCR amplification conditions of Table 7. On the other hand, the PCR amplification master mix of the PCR amplification composition is composed of, for example, a PCR buffer, dNTP, DNA polymerase, etc., and in this example, TaqMan 　 Universal Master Mix II, no UNG (Life Technologies, Cat. 4440040) was used. Whenever the real-time PCR amplification reaction was repeated once, the fluorescence value was measured at the FAM wavelength, and the fluorescence intensity for the reaction cycle was analyzed using SDS software. The results of real-time PCR quantification for the APP gene were summarized for each sample, and the results were divided into the results for the short amplicon (67 bp in length) and the long amplicon (180 bp in length), and shown in FIG. 5.

No. PCR amplification composition Volume (µl) One Sample with DNA template One 2 Primer set (forward + reverse) (10 ?M) One 3 Detection probe (5 ?M) 0.5 4 Distilled water 2.5 5 TaqManUniversal Master Mix II, no UNG 5 Sum 10

No. step Temperature time cycle One Prior denaturation 95℃ 10 minutes 2 denaturalization 95℃ 15 seconds 50 cycles 3 Annealing 60℃ 60 seconds 4 extension 72℃ 60 seconds

Example 6. Normal and Down syndrome gDNA Digital for mixed samples PCR Perform

Mixed gDNA was prepared by mixing normal gDNA and Down's syndrome gDNA in various ratios, and digital PCR was performed using the primers and probes in Table 2 as a template, and the ratio value of the amount of Down's syndrome genes compared to normal was calculated. The results are shown in FIG. 6.

As a result of the experiment, it was found that the lower the mixing ratio of Down syndrome gDNA was, the closer to 1 the ratio of the amount of Down syndrome genes compared to normal. In particular, it was confirmed that the ratio value appears close to the normal value (within 1.1) when the reflection rate of Down syndrome genetic information is less than 10%. Considering that only about 3 to 13% of the cfDNA present in the pregnant woman's blood is fetal-derived cfDNA, it was found that the accuracy of prenatal diagnosis of the fetus using the cfDNA extracted from the pregnant woman's blood as it was is very poor.

Example 7. Obtained from pregnant woman's blood cfDNA By shredding particle size Classification and digital PCR for it

CfDNA was extracted from plasma of pregnant women with normal or Down syndrome (T21) fetuses in the following manner.

First, cfDNA was extracted from plasma using Thermo Fisher Scientific's MagMAXTM Cell-Free DNA Isolation Kit (Cat #A29319). The cfDNA extraction process was performed on 2 mL of plasma according to the manufacturer's manual.

The extracted cfDNA was divided into DNA according to the crush particle size by the method of Example 4, and digital PCR was performed using the sample of the obtained SD compartment as a template. From the results of each sample, the ratio of the target gene to the control gene was calculated. The results are shown in FIG. 7.

As a result of the experiment, the calculation ratio of the normal sample (n=3) was 1.04, 1.08, and 0.98, respectively, but the calculation ratio of the Down syndrome sample (n=3) was 1.31, and 1.15 (2 cases are the same), respectively. Appeared. Accordingly, in the case of performing digital PCR with the SD compartment obtained by dividing the above DNA by breaking particle size, if the calculation ratio of the target gene to the control gene is 0.70 to 1.14, the fetal number of chromosomes can be determined as normal, and more preferably If the output ratio is 0.95 to 1.10, the fetal number of chromosomes can be determined as normal, and if the output ratio is 0.10 to 0.69, or 1.15 to 1.80, the number of chromosomes of the fetus can be determined or more, and more preferably, the output ratio is 0.45 to 0.69, or 1.15. To 1.31, it was found that the number of chromosomes in the fetus could be determined.

As described above, specific parts of the present invention have been described in detail, and for those of ordinary skill in the art, it is clear that these specific techniques are only preferred embodiments, and the scope of the present invention is not limited thereto. Therefore, it will be said that the practical scope of the present invention is defined by the appended claims and their equivalents.

<110> BIOCORE <120> A method for prenatal diagnosis using digital PCR <130> DPB155593k01 <150> KR 15/0151313 <151> 2015-10-29 <160> 36 <170> KoPatentIn 3.0 <210> 1 <211> 165 <212> DNA <213> Homo sapiens <400> 1 ctgcagttct ttgtgaacac tctcatttgt tgtatctgta ggctgtctct ctcagtggta 60 aatgccttcg tgtgtttgta atgctgatgg ttacttgagg taaataagaa tgtaccactt 120 ggctcagtgt gcatgatgta agcttgtctt tgttgtatgt tggct 165 <210> 2 <211> 161 <212> DNA <213> Homo sapiens <400> 2 tgactatcac atgtctttgg ttgtaaactg ctgtgatagt taccctaagt aatgggacag 60 gagatgaacc cacccattaa ataacacagc aattaagcag ccacttttag aaaaatttaa 120 atgtgtggct tcgagttggg tacttgcatg tacagcttac t 161 <210> 3 <211> 118 <212> DNA <213> Homo sapiens <400> 3 cccaggctat gctagaaggt atgcttacaa ttggaaaagt gtaggcagat aacattaaat 60 ggcaatagca tgtgtaaact aactgcaaat gaggaaaagg acattctaaa gacaggat 118 <210> 4 <211> 110 <212> DNA <213> Homo sapiens <400> 4 ggaccagagg tttattggag gtctaaatat ttatggagag caatgatggc taattttaga 60 aaccattagg ttgctatttt taaacgtgtg ctataaggat ttgctaattt 110 <210> 5 <211> 127 <212> DNA <213> Homo sapiens <400> 5 gaggaagcaa ctagaaaaca atggaaggga cttcagatgg taaggtttct gtttagtact 60 tatttcaatt ttaggcctcc tgaatagtag aggtggtgac aggaggatac ctgaaacctt 120 ggttata 127 <210> 6 <211> 112 <212> DNA <213> Homo sapiens <400> 6 gggaacatcc caggttcagt aaaaatacag agtatttgcg ttaaactgga cctcagtggg 60 gatgtgatgg gaggtatgag acagattgtg cccttatcct tttctcttct tg 112 <210> 7 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> Primer <400> 7 cgtgtgtttg taatgctgat ggt 23 <210> 8 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Primer <400> 8 catcatgcac actgagccaa gt 22 <210> 9 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> Probe <400> 9 acttgaggta aataagaatg tac 23 <210> 10 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> Primer <400> 10 ccctaagtaa tgggacagga gatg 24 <210> 11 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> Primer <400> 11 aagtggctgc ttaattgctg tgt 23 <210> 12 <211> 15 <212> DNA <213> Artificial Sequence <220> <223> Probe <400> 12 acccacccat taaat 15 <210> 13 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> Primer <400> 13 tgctagaagg tatgcttaca attgga 26 <210> 14 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> Primer <400> 14 tcatttgcag ttagtttaca catgct 26 <210> 15 <211> 17 <212> DNA <213> Artificial Sequence <220> <223> Probe <400> 15 aagtgtaggc agataac 17 <210> 16 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> Primer <400> 16 gaccagaggt ttattggagg tctaaat 27 <210> 17 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> Primer <400> 17 cacgtttaaa aatagcaacc taatgg 26 <210> 18 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> Probe <400> 18 tttatggaga gcaatgat 18 <210> 19 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> Primer <400> 19 caactagaaa acaatggaag ggactt 26 <210> 20 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> Primer <400> 20 tcaggaggcc taaaattgaa ataag 25 <210> 21 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Probe <400> 21 agatggtaag gtttctgttt ag 22 <210> 22 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> Primer <400> 22 catcccaggt tcagtaaaaa tacaga 26 <210> 23 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> Primer <400> 23 ctgtctcata cctcccatca catc 24 <210> 24 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Probe <400> 24 tatttgcgtt aaactggacc 20 <210> 25 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> Primer <400> 25 tcaggttgac gccgctgt 18 <210> 26 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Primer <400> 26 ttcgtagccg ttctgctgc 19 <210> 27 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> Primer <400> 27 tctataaatg gacaccgatg ggtagt 26 <210> 28 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Probe <400> 28 accccagagg agcgccacct g 21 <210> 29 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer <400> 29 tacaggaagt cccttgccat 20 <210> 30 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer <400> 30 cctgtgtgga cttgggagag 20 <210> 31 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer <400> 31 cacgaaggct catcattcaa 20 <210> 32 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> Probe <400> 32 cccacttctc tctaaggaga atggccc 27 <210> 33 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer <400> 33 agagctacga gctgcctgac 20 <210> 34 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer <400> 34 ccatctcttg ctcgaagtcc 20 <210> 35 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer <400> 35 ggcaggactt agcttccaca 20 <210> 36 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Probe <400> 36 ttccgctgcc ctgaggcact 20

Claims (20)

(a) a sample portion for obtaining DNA from maternal blood;
(b) a separation unit for classifying the DNA by size to obtain DNA of 1,000 bp or less;
(c) performing PCR with the DNA of step (b), wherein the amplification unit performs PCR on a target gene located on a chromosome associated with a control gene and a chromosome not related to a chromosome not related to the chromosome or more;
(d) a comparing unit calculating a ratio of the PCR quantitative value of the target gene to the PCR quantitative value of the control gene; And
(e) a fetal chromosome aberration diagnosing apparatus comprising a determination unit determining that the fetal chromosome number is normal when the ratio calculated in step (d) is 0.70 to 1.14,
The PCR is characterized in that the digital PCR,
PCR quantitative value of the target gene is the average value of using the nucleotide sequence of SEQ ID NO: 1 to 4 as the target gene,
The PCR quantitative value of the control gene is an average value of those using the nucleotide sequences of SEQ ID NOs: 5 and 6 as the control gene, chromosome aneumolecular diagnostic apparatus.
The method of claim 1,
When the ratio calculated in step (d) is 0.95 to 1.10 comprises a determination unit for determining the normal number of chromosomes of the fetus, fetal chromosome adifferent diagnostic device.
The method of claim 1,
Method of classifying the DNA of step (b) by size
(A) bead A mixing portion for first mixing magnetic beads with DNA (bead A) to obtain unbound DNA; And,
(B) A fetal chromosome aberration diagnosing apparatus comprising a bead B mixing unit for secondary mixing (bead B) the magnetic beads to the obtained DNA and obtaining DNA bound to the beads.
The method of claim 3, wherein
The addition ratio of bead A or bead B to the DNA is 1: 0.75 to 1.25, fetal chromosome aberration diagnostic device.
(a) a sample portion for obtaining DNA from maternal blood;
(b) a separation unit for classifying the DNA by size to obtain DNA of 1,000 bp or less;
(c) performing PCR with the DNA of step (b), wherein the amplification unit performs PCR on a target gene located on a chromosome associated with a control gene and a chromosome associated with a chromosome not related to the chromosome or more;
(d) a comparing unit calculating a ratio of the PCR quantitative value of the target gene to the PCR quantitative value of the control gene; And
(e) a fetal chromosome aberration diagnosing apparatus comprising a determining unit for determining the number of chromosomes of the fetus if the ratio calculated in step (d) is 0.10 to 0.69, or 1.15 to 1.80,
The PCR is characterized in that the digital PCR,
PCR quantitative value of the target gene is the average value of using the nucleotide sequence of SEQ ID NO: 1 to 4 as the target gene,
The PCR quantitative value of the control gene is an average value of those using the nucleotide sequences of SEQ ID NOs: 5 and 6 as the control gene, chromosome aneumolecular diagnostic apparatus.
The method of claim 5,
When the ratio calculated in step (d) is 0.45 to 0.69, or 1.15 to 1.31, comprising a determination unit for determining the number of chromosomes of the fetus, fetal chromosome adifferent diagnostic device.
The method of claim 5,
When the ratio calculated in step (d) is 0.10 to 0.69, comprising a determination unit for determining the chromosome of the fetus as chromosomal monochromatic, fetal chromosome aneumolecular diagnostic device.
The method of claim 7, wherein
The monosomy is Turner syndrome, chromosome aneumo-diagnostic apparatus of the fetus.
The method of claim 5,
When the ratio calculated in step (d) is 1.15 to 1.80, comprising a determination unit for determining the chromosome of the fetus as trisomy, fetal chromosome aneumolecular diagnostic device.
The method of claim 9,
The trisomy is Down syndrome, Edward syndrome or Fatau syndrome, fetal chromosome aberration diagnostic device.
The method of claim 5,
Method of classifying the DNA of step (b) by size
(A) bead A mixing portion for first mixing magnetic beads with DNA (bead A) to obtain unbound DNA; And,
(B) A fetal chromosome aberration diagnosing apparatus comprising a bead B mixing unit for secondary mixing (bead B) the magnetic beads to the obtained DNA and obtaining DNA bound to the beads.
The method of claim 11,
The addition ratio of bead A or bead B to the DNA is 1: 0.75 to 1.25, fetal chromosome aberration diagnostic device.
delete The method of claim 5,
As primer pairs for amplifying the target gene having the nucleotide sequence of SEQ ID NO: 1 primer pairs of SEQ ID NO: 7 and 8 are used, and a probe for detecting a target gene amplification product having the nucleotide sequence of SEQ ID NO: 1 SEQ ID NO: An oligonucleotide of 9 is used. The fetal chromosome aberration diagnostic apparatus.
The method of claim 5,
As a primer pair for amplifying a target gene having a nucleotide sequence of SEQ ID NO: 2, primer pairs of SEQ ID NOs: 10 and 11 are used, and as a probe for detecting a target gene amplification product having a nucleotide sequence of SEQ ID NO: 2, SEQ ID NO: A fetal chromosomal aneumolecular diagnostic apparatus, characterized in that 12 oligonucleotides are used.
The method of claim 5,
As a primer pair for amplifying the target gene having the nucleotide sequence of SEQ ID NO: 3, primer pairs of SEQ ID NO: 13 and 14 are used, and as a probe for detecting a target gene amplification product having the nucleotide sequence of SEQ ID NO: 3, SEQ ID NO: The fetal chromosome aneumodiagnostic apparatus, characterized in that 15 oligonucleotides are used.
The method of claim 5,
As a primer pair for amplifying a target gene having the nucleotide sequence of SEQ ID NO: 4, primer pairs of SEQ ID NO: 16 and 17 are used, and as a probe for detecting a target gene amplification product having the nucleotide sequence of SEQ ID NO: 4, SEQ ID NO: 18 fetal chromosome aneumolecular diagnostic apparatus, characterized in that oligonucleotides are used.
delete The method of claim 5,
As a primer pair for amplifying a control gene having a nucleotide sequence of SEQ ID NO: 5, primer pairs of SEQ ID NOs: 19 and 20 are used, and as a probe for detecting a control gene amplification product having a nucleotide sequence of SEQ ID NO: 5, SEQ ID NO: A fetal chromosome aberration diagnostic apparatus, characterized in that 21 oligonucleotides are used.
The method of claim 5,
As a primer pair for amplifying a control gene having a nucleotide sequence of SEQ ID NO: 6, primer pairs of SEQ ID NOs: 22 and 23 are used, and as a probe for detecting a control gene amplification product having a nucleotide sequence of SEQ ID NO: 6, SEQ ID NO: The fetus's chromosomal aneumolecular diagnostic apparatus, characterized in that 24 oligonucleotides are used.

Images