GB2488358A

GB2488358A - Enrichment of foetal DNA in maternal plasma

Info

Publication number: GB2488358A
Application number: GB201103277A
Authority: GB
Inventors: Tracey Elizabeth Madgett; Neil David Avent
Original assignee: Plymouth University
Current assignee: Plymouth University
Priority date: 2011-02-25
Filing date: 2011-02-25
Publication date: 2012-08-29
Also published as: GB201103277D0; WO2012114075A1

Abstract

A method for processing a sample of maternal plasma comprising maternal free DNA and foetal free DNA comprises the in situ enrichment of the amount of foetal DNA relative to the amount of maternal free DNA. The method is preferably based on in situ enrichment of foetal DNA on the basis of its shorter average length. In one embodiment, the amount of foetal DNA in the sample is increased, preferably by PCR using a critical denaturation temperature which is chosen so that only short DNA fragments are amplified. In an alternative embodiment, the amount of maternal DNA in the sample is decreased, preferably by selective PCR amplification of long DNA fragments using dUTP to incorporate uracil, followed by treatment with uracil deglycosylase (UNG) to degrade the amplified long DNA fragments. The plasma is preferably obtained by non-invasive means. The method is particularly useful in the detection of genetic abnormalities in the foetus, in particular Down Syndrome and other aneuploidies.

Description

METHOD FOR PROCESSING MATERNAL AND FETAL DNA

The present invention relates to a method for processing maternal and fetal DNA, in particular cell free fetal DNA (ffDNA), and its use in assisting with non-invasive prenatal diagnosis, (NIPD) of fetal genetic traits.

Conventional methods of prenatal diagnosis for detecting genetically inherited conditions involve the use of invasive technologies. These include the likes of amniocentesis and chorionic villus sampling. Invasive methods such as these are known to carry a 1-2% risk of miscarriage. Despite the potential risks to both the fetus and the mother, a significant number of pregnant women opt for invasive prenatal diagnosis methods. This is due to the fact that, currently, prenatal diagnosis (as opposed to screening) for conditions such as Down Syndrome, (also known as Trisomy 21), is at present only possible via invasive techniques such as those mentioned above. The principle method for the detection of Trisomy 21, after having obtained ffDNA via amniocentesis and/or chorionic villus sampling, is to assess the number and appearance of the fetal chromosomes (also known as karyotyping). In this way it is possible to detect whether there is an elevated amount of chromosome 21, which is indicative of Down syndrome.

EP 1329517 provides an example of how fetal DNA sampled invasively via amniocentesis and/or chorionic villus sampling may be used in real time Polymerase Chain Reaction (real time PCR) in order to determine gross chromosomal abnormalities, in particular Trisomy 21. This method is extremely sensitive and readily amenable to automation and high-throughput screening. In this method DNA or RNA is to be obtained from both the genetic test locus and a particular control locus. This method detects specific nucleic acid amplification products as they accumulate in real-time by a sequence specific fluorescently labelled oligonucleotide probe. RT-PCR therefore addresses the problem of end point analysis commonly observed in traditional PCR assays where excessive amplification can impede the quantification of the amount of starting nucleic acid material.

Alternative non-invasive methods, such as screening by ultrasonography and/or biochemical measurement of certain proteins, combined with maternal age, have typically been used as a first indicator to identify high risk pregnancies. In this way, pregnant women may deliberate whether to continue with more definitive, albeit riskier, invasive diagnostic procedures. Unfortunately these screening tests are prone to false positive results and detect only phenotypic features as opposed to the underlying genetic pathology giving rise to the particular condition. For example, screening can identify certain Trisomy 21 epiphenomena, such as thicker nuchal translucency, but cannot identify the core pathology of Trisomy 21. There is therefore a significant need for a method for the direct non-invasive detection of fetal genetic traits. It is of particular importance, however, to ensure that any such direct non-invasive procedure provides results to the same or better accuracy than those provided under current invasive prenatal diagnostic techniques, as mentioned above.

Since the discovery, in 1997 (Lo Y.M et al., Presence of fetal DNA in maternal plasma and serum', Lancet, Vol. 350, 1997, pages 485 to 487) of the presence of ffDNA within the maternal bloodstream, attempts have been made to replace the invasive procedures discussed above with a simple non-invasive blood test using ffDNA. The presence of ffDNA within the maternal bloodstream has been of limited use in clinical situations, principally used at present where the detection of paternally inherited conditions and/or fetal RhD blood group status in RhD negative mothers is required. In such cases, the amplification, by polymerase chain reaction (PCR) and/or real time PCR, of fetal genetic Ioci which are completely absent from the maternal genome and thus easily distinguishable as fetal specific has been a relatively simple exercise.

It has proved to be a much more complicated task to extend NIPD to cover the analysis of ffDNA for the determination of more complex fetal genetic traits, such as abnormal fetal chromosome copy numbers (aneuploidy), maternally inherited conditions and autosomal recessive monogenetic diseases. This is due in most part to the low concentration of ffDNA relative to the maternal free DNA. In particular, the low concentration of ff DNA makes it difficult to accurately detect single nucleotide polymorphisms when using standard techniques such as real-time PCR.

Although increasing with gestational age of the fetus, it has been reported by Lo, Y.M et al.,'Quantitative analysis of fetal DNA in maternal plasma and serum: implications for non invasive prenatal diagnosis' Am J Hum Genet 1998, 62, pages 768-775, that cell free fetal DNA represents at best 3-6% by mass of the free DNA in maternal plasma, the remainder being derived from maternal sources. As discussed above, the high background of maternal DNA can often interfere with the analysis of the ffDNA. A way of overcoming this effect is therefore required, before the NIPD methods such as real-time POP can be utilised and offered on a large scale.

It has been acknowledged by Chiu R.W.K et al., Non invasive prenatal diagnosis by single molecule counting technologies'; Trends Genet 2009; 25, pages 324-31, that fetal specific molecular markers such as placenta-specific methylation patterns and placentally derived mRNA may be used as an alternative in NIFD of fetal aneuploidies. This uses the same approach as outlined above, whereby distinguishable fetal specific nucleic acid markers are exploited in NIPD. While possible in principal, the so called epigenetic allelic ratio approach' is severely constrained in practice by the low abundance of ffDNA and the reliance on allelic heterozygosity between the fetus and the mother, as indicated by Voelkerding, K.V.

et al., Digital Fetal Aneuploidy Diagnosis by Next Generation Sequencing', Olinical Ohemistry 56, 2010, pages 336 to 338. An alternative and more preferred approach for the NIPD of Down syndrome is to provide a mechanism whereby it is possible to show the presence of an elevated amount of chromosome 21. Although feasible in theory, this approach is limited, once again, by a low concentration of ff DNA within the maternal plasma.

Lo, Y.M.D. et al., Digital FOR for the molecular detection of fetal chromosomal aneuploidy', PNAS, August 7, 2007, vol. 104, no. 32, pages 13116 to 13121, suggests the detection of ratios of fetal chromosomes by digital counting techniques. In particular, there is disclosed the use of FOR to determine whether there is an overrepresentation of chromosome 21 in the maternal plasma of women carrying trisomy 21 fetuses. This polymorphism independent method, so called the digital relative chromosome dosage' (ROD) method is specifically intended to overcome the shortcomings of using foetal-specific molecular markers, which as discussed above are informative only for heterozygous foetuses. Digital FOR comprises the dilution and compartmentalisation of maternal plasma sample so that individual fetal and maternal target loci may be amplified in different wells. In this way it is possible to directly count the number of positive wells in which the target amplicon has been amplified without interference between the maternal free DNA and the ffDNA. By quantitatively comparing the amount of amplified products from the target locus with that of a reference chromosome it is possible to deduce whether there is an imbalance in chromosome copy number. The effectiveness of digital FOR, however, is once again constrained by the low percentage of ffDNA present within the maternal plasma. Digital FOR is therefore a lengthy process, which requires many thousands of cycles of FOR in order to generate reliable results.

In order to achieve increased ffDNA fractional concentrations, methods for selective enrichment of ffDNA and/or depletion of maternal free DNA are needed.

Apart from treating the plasma samples with formaldehyde, (the effect of which has not been universally accepted as suggested in Ohiu R.W.K et al., Non invasive prenatal diagnosis by single molecule counting technologies'; Trends Genet 2009; 25, pages 324-3 1 and/or targeting fetal specific molecular markers (which as discussed above minimises background maternal DNA interference) enrichment of ffDNA may be achieved via physical separation methods which exploit the difference in size between the ffDNA and the maternal free DNA.

Significant research by Li, Y., et al., Size separation of circulatory DNA in maternal plasma permits ready detection of fetal DNA polymorphisms' Olin Ohem 2004, 50, 1002-1011, has revealed that ffDNA and maternal free DNA are fragmented in nature, although the fragments of ffDNA tend to be considerably shorter in length than the fragments of maternal free DNA. Specifically ff DNA comprises 300 base pairs or less, as opposed to more than 500 base pairs for free maternal DNA. Indeed, in some circumstances free DNA smaller than 500 base pairs appears to be almost entirely derived from the fetus. This is thought to be due to the fact that the ffDNA is derived from apoptotic trophoblasts.

US 2005/0164241 discloses a method for the non-invasive detection of fetal genetic traits, which exploits this observation. This method comprises a first stage wherein a sample of blood plasma or serum from a pregnant woman is physically separated into fIDNA and maternal tree DNA via size discrimination. Various types ot chromatography and electrophoresis techniques are employed in order to obtain a traction ot said sample in which the extracellular DNA present therein substantially consists ot DNA comprising 500 base pairs or less. Once the enriched sample-traction is obtained, determination ot the fetal genetic traits can be ettected by methods such as FOR, ligase chain reaction, probe hybridisation techniques, nucleic acid arrays and the like. In this way, NIFD ot fetal genetic traits, including those involved in chromosomal aberrations, such as Down syndrome is possible. However, this method involves two separate stages and theretore unnecessarily complicates and lengthens the diagnostic procedure.

Perhaps the most recently proposed diagnostic method to have exploited this observation has applied Digital FOR with high throughput next generation sequencing (NGS)-based plasma diagnostics. Ohiu, R.W et al., Non invasive prenatal assessment ot trisomy 21 by multiplexed maternal plasma DNA sequencing: large scale validity study, 2011; 342:c74Oldoi:10.1 136/bmj.c7401' discuss how NOS could be used tor the measuring small increments in chromosome 21 DNA concentration. NOS-based NIPD however is known to incur high equipment and reagent costs and requires substantial technical and biointormatic input and analysis.

It is tor these reasons that the implementation ot NGS-based NIPD will only be considered as an alternative to current screening techniques once these issues have been resolved.

There remains a need theretore tor an improved NIPD method, which is not limited in the way that the known methods discussed above are constrained. In particular it would be advantageous it the NIPD method could overcome the problems associated with the low tractional concentration ot ttDNA present within the maternal plasma sample, without imposing undue burden on the user.

It has now been tound possible to sign iticantly improve the etticiency and accuracy ot the analysis of tfDNA as part of a non-invasive diagnostic regime for fetuses by the in situ enrichment of the ffDNA content of the maternal plasma or serum.

In a first, general aspect, the present invention provides a method for processing maternal plasma comprising maternal free DNA and ffDNA, the method comprising the in situ enrichment of the amount of ffDNA relative to the amount of maternal free DNA.

In the present specification, the term in situ enrichment' is a reference to a method of increasing the relative amount of the ffDNA to the maternal free DNA in a maternal plasma sample with both DNA components being present, that is without physically separating or removing one or other of the DNA components from the plasma. The in situ enrichment may be performed by selectively increasing the amount of ffDNA in the plasma and/or by selectively decreasing the amount of free maternal DNA in the plasma.

The present invention provides the selective enriching of the amount of ffDNA present in the maternal plasma, without contamination from maternal free DNA. In this way, the enriched ffDNA product may be assessed using known methods. In particular, the enriched product is particularly suitable for use in conventionally applied, simple analytical methods, such as real time FOR and multiplex ligation-dependent probe amplification (MLPA). These methods are known and are being used routinely in the analysis of fetal material sampled by invasive methods. It is therefore an advantage of the method of the present invention that it can be used in conjunction with the known and routinely used techniques for diagnosis. The present invention therefore provides significant advantages over other methods such as costly digital FOR and NOS discussed above, which have yet to achieve widespread acceptance and use in routine diagnostic practice.

It will be appreciated that the method of the present invention may be used to provide ffDNA enriched material for further use in all prenatal diagnosis procedures, including those for the assessment of abnormal fetal chromosome copy numbers (aneuploidy), inherited disorders such as haemoglobinopathy and cystic fibrosis, without the need for invasive measures. In addition, the method of the present invention can improve the efficiency and accuracy of the existing methods for detecting genetic traits, such as RhD blood group and sex linked conditions, which as discussed previously are already detectable by NIPD techniques.

The method of the present invention has particular application in the assessment of Down syndrome and other aneuploidies.

The method of the present invention may be used alone, that is to produce a ffDNA enriched product, which may then be subjected to one or more diagnostic analyses. Alternatively, the method may be incorporated into a dedicated diagnostic regime for a particular disorder.

The method of the present invention comprises the in situ enrichment of the ffDNA in the sample, relative to the free maternal DNA. In this respect, the method does not physically separate DNA material from the sample. Rather, the If DNA is enriched relative to the free maternal DNA by either increasing the amount of ffDNA present or by depleting the amount of free maternal DNA present, or by a combination of both, either simultaneously or successively.

Any suitable technique for increasing the amount of ffDNA present in the sample may be employed. A preferred method for enriching the ffDNA is by selectively amplifying the shorter ffDNA from the admixture of ffDNA and maternal free DNA. Techniques for amplifying DNA are known and will be readily understood by the person skilled in the art. The method may comprise amplifying all of the ffDNA material present in the sample. More preferably, the method is employed to amplify only one or more selected regions of the genome from the IIDNA material. In particular, the method may be employed to selectively amplify those regions of the fetal genome that are relevant to the diagnosis being conducted. For example, in the case of the diagnosis of Down syndrome and other aneuploidies, the method is applied to selectively amplify polymorphic regions of chromosome 21 of the ffDNA material, without amplifying free maternal DNA material.

Suitable techniques for amplification of the ffDNA include FOR, including real time FOR, digital FOR and multi-plex FOR, and MLFA. In the case of PCR, the method of the present invention employs a limited denaturation of the DNA admix using conditions which result in essentially only the shorter DNA fragments present in the sample material being denatured. As noted above, ffDNA is present only in the shorter DNA material. Accordingly, selective amplification of the short DNA fragments present in the admixture of DNA will enrich the sample in ffDNA. The selective amplification is preferably conducted to target free DNA having less than 500 base pairs, more preferably less than 400 base pairs. It is especially preferred to selectively amplify DNA fragments having less than 300 base pairs, in order to provide increased efficiency in the enrichment of the ffDNA content and minimise the amplification of maternal DNA fragments.

The selective amplification of the smaller DNA fragments may be achieved using FOR techniques, operated under conditions that favour amplification of DNA fragments of the target size. In particular, it has been found that the smaller DNA fragments may be selectively amplified by appropriate selection of the denaturation temperature employed. PCR consists essentially of three steps: strand separation; hybridization of primers; and extension of primers by DNA synthesis. In a typical FOR, the first step is performed at a suitable denaturation temperature, in order to separate essentially all of the double stranded DNA fragments. The denaturation temperature is typically about 94 to 96°O. In the method of the present invention, however, the denaturation temperature is lowered, so that only the shorter DNA fragments and ffDNA are denatured and subsequently amplified. The specific critical denatu ration temperature will vary according to the length of the DNA fragments being targeted.

In a preferred embodiment, the method of the present invention involves the selective operation of the FOR in order to denature and subsequently amplify only those fragments of targeted fetal genes which are of use when diagnosing a particular disorder.

The critical denaturation temperature of the FOR employed may vary, according to the genetic material being targeted for amplification. In particular, depending on the region which is to be targeted the critical denaturation temperature employed will vary according such factors as the exact number and composition of nucleotides present within the targeted sequence. It is for this reason that, for each gene target, the critical denaturation temperature and/or primers may need to be optimised prior to use. It is a particular advantage of this method that optimisation of FOR conditions for multiple gene targets on different chromosomes will enable multiplex FCR to use similar conditions.

In order to selectively amplify the selected gene target, the denaturation temperature of the FOR will typically be less than 94°C, more preferably less than 90°C, still more preferably less than 85°C. Critical denaturation temperatures of less than 80°C may be employed in some embodiments, again depending upon the genetic target selected. The critical denatu ration temperature will generally be greater than 65°C, more preferably greater than 70°C. Critical denaturation temperatures of greater than 75°C may be employed, as required to selectively amplify the target sequence.

Use of the appropriate denaturation temperature will target the smaller DNA fragments in the sample, in particular the ffDNA, the strands of which are selectively separated. The strands of the longer, free maternal DNA fragments are not separated at the temperature selected. By use of appropriate primers, the amplification of ffDNA is achieved.

As noted above, the amplification of the ffDNA may be conducted to selectively target and amplify selected regions of the fetal genome. It is advantageous if an amplification technique is used which itself also provides an indication of the presence of genetic abnormalities. For example, real time FOR may be employed with a binding die, in known manner, to provide a measurable indication of the amount of amplified DNA produced in the method. In this way, enrichment of the ffDNA is accompanied by an indicator of the presence of the targeted portion of the fetal genome. In the case of Down Syndrome and other aneuploidies, the simultaneous amplification of polymorphic regions of chromosomes, such as one of chromosomes 13, 18 or 21, (depending on the exact aneuploidy) may be assessed to copy number of maternal and paternal alleles and compared with a reference chromosome, such as another of chromosome 13, 18 or 21.

As noted above, the ffDNA in the sample plasma may also be enriched relative to the free maternal DNA by the in situ reduction of the amount of free maternal DNA. In an alternative embodiment, the present invention provides a method for enriching the ffDNA by selectively depleting the larger maternal free DNA from an admixture of ffDNA and maternal free DNA.

A preferred means to reduce the free maternal DNA present in the sample is by selective amplification of the free maternal DNA material, whilst incorporating a moiety in the synthesised DNA to render it susceptible to degradation by one or more enzymes. In particular, it is preferred to amplify the free maternal DNA, for example by PCR techniques, while incorporating uracil in the synthesised DNA. The thus synthesised DNA may be degraded using a suitable enzyme, in particular uracil deglycosylase (U NO). The selective amplification of the free maternal DNA is achieved using specific primers for targeting the amplification of DNA fragments greater than a specified length. In particular, PCF{ is applied with appropriate primers to selectively amplify DNA fragments having more than 300 base pairs, preferably more than 400 base pairs, more preferably at least 500 base pairs. In this way, the smaller ffDNA fragments remain unamplified, as it is unlikely that both POR primers will find their target sites on the ffDNA fragments. The resulting product is subjected to enzyme treatment and the result is the depletion of free maternal DNA fragments larger than the target fragment length, leaving the ffDNA present in combination with only shorter fragments of maternal DNA and remnants of the degraded DNA material. The method may be used to deplete a portion, more preferably substantially all, of the free maternal DNA fragments above the threshold number of base pairs.

As noted, the enrichment of ffDNA relative to free maternal DNA in the sample may be employed as part of a diagnostic regime.

Accordingly, in a further aspect, the present invention provides a non-invasive method for identifying genetic abnormalities in the genome of a fetus, the method comprising: providing a sample of maternal plasma; enriching the ffDNA content of the plasma by a method as hereinbefore described; and analysing the ffDNA in the enriched sample to identify any genetic abnormalities in the fetus.

The ffDNA may be analysed to identify any abnormalities in the genetic material originating from the fetus, including sequence errors or chromosomal aneuploidies.

The ffDNA in the enriched sample may be analysed using any technique, including those known in the prior art and discussed hereinbefore. It is particularly advantageous that known and currently used techniques relying on samples obtained by invasive techniques can be used to analyse the enriched sample.

In a still further aspect, the present invention provides a ffDNA enriched plasma sample obtainable by the method as hereinbef ore described.

Further, the present invention also provides a method of diagnosing a condition in a fetus arising from a genetic abnormality, the method comprising enriching and analysing a sample of maternal plasma as hereinbefore described.

Conditions that may be diagnosed using the method of this aspect of the invention are as hereinbefore described, in particular Down Syndrome and other aneuploidies.

Embodiments of the present invention will now be described, for illustrative purposes only, by way of the following Examples.

EXAMPLE 1

Experiments were conducted using small synthetic stretches of DNA, to simulate ff DNA and circulating DNA from blood donors to act as maternal free DNA.

This example describes experiments conducted to determine the PCR critical denaturation temperature of the simulated ffDNA material.

A portion of the CCR5 gene (as annotated below) was employed to generate synthetic ffDNA, as follows: The CCR5 gene is located on chromosome 3 and is a member of the beta chemokine receptor family. A real time PCR assay targeting CCR5 is generally used as a control alongside the real time FOR assays in order to determine the RHD status of fetuses from RHD negative mothers. A real time FOR for CCR5 will detect CCR5 products in maternal and fetal DNA in such assays.

A portion of the CCR5 gene is set out below. The primers (bold) and probe (italics) used in the CCR5 real time FOR assay are shown. The size of the FOR amplicon was 9lbp.

AOTCACTGGTGTTOATOTTTGGTTTTGT0000AAOATGCTGGTOATCCTOATOOT GATAAactgcaaaaggctgaagagcATGACTGACATCTACCTGCTCAACCTGGCCATCT

CTGAOCTGTT TTTCCTTCTTACTG TCCCCTTC TGGGCTCAOTATGOTGOOGCCCA

GTGGGACTTTGGAAATAOAATGTGTOAAOTOTTGAOAGGGOTOTATTTTATAGG

OTTOTTOTOTGGAATOTTOTTOATOATOOTOOTGAOAATOGATAGGTAOOTGGOT

GTOGTOOATGOTGTGTTTGOTTTAAAAGOOAGGA003TOAOOTTTG000TGGTG AOAAGTGTGATOAOTTGGGTGGTGGOTGTGTTTGcgtctctcccaggaatcatcTTTAOOA

GATOTOAAAAAGAAGGTOTTOATTAOA

Frimers were designed so that a FOR amplicon of approximately 250 to 350 base pairs could be generated with the region required for the real time FOR assay in the middle of the amplicon. This fragment was used as synthetic ffDNA fragments having from 250 to 350 base pairs.

The gene sequence was obtained from the National Oenter for Biotechnology Information. Frimer3 software was used to search for primers in the relevant area of the gene. Several sets of primers were chosen by Frimer3 and these were all checked using BLAST software to ensure that there was a full match only to the gene of interest. One forward primer was ordered and two reverse primers.

The primers were tested in combination (forward with reverse A and forward with reverse B) using the appropriate annealing temperatures and male genomic DNA (ex. Fromega, U.K.) as a template. Following optimization of the FOR conditions, the FOR amplicon was purified using agarose gel electrophoresis and the OlAquick Gel Extraction Kit (cx. Qiagen, U.K.). The extracted DNA was quantified using the NanoVue Plus (cx. GE Healthcare Life Sdences, U.K.). The positions of the working primers are shown in the aforementioned sequence by the lower case letters. The ampUcon size was 326bp.

A portion of the SRY gene (as annotated below) was employed to generate synthetic ffDNA, as follows: A real time PCR assay for the single copy SRYgene was established by Lo et al. Quantitative Analysis of Fetal DNA in Maternal Plasma and Serum: implications for non-invasive pre-natal diagnosis', Am. J. Hum. Genet., 1998, 62, pages 768 to 775, in order to determine fetal sex from ffDNA. The SRYgene is located on the Y chromosome.

A portion of the SRYgene is set out below. The primers (bold) and probe (italics) used in the SRY real time PCR assay are indicated. The size of the PCR amplicon is 137bp.

AGCTTTGTTTTTTTAAAGATAACATACACATATATTGATAATGATAAACAATTCATA

TAgctttttgtgtcctctcgttttGTGACATAAAAGGTCAATGAAAAAATTGGCGATTAAGTCA

AATTCGCATTTTTCAGGACAGCAGTAGAGCAGTCAGGGAGGCAGATCAGCAGG

GCAAGTAGTCAACGTTACTGAATTACCATGTTTTGCTTGAGAATGAATACATTGT

CAGGGTACTAGGGGGTA000TGGTTGGGC0003TTGA0000gtgttgagggcggag aaatGCAAGTTTCATTACAAAAGTTAACGTAACAAAGAATCTGGTAGAAGTGAGTT

TTGGATAGT

Primers were designed in a similar manner as described above and two forward primers and one reverse primer were ordered. The primers were tested in combination (forward A with reverse and forward B with reverse) using the appropriate annealing temperatures and male genomic DNA as a template.

Following optimization of the POR conditions, the PCR amplicon was purified using agarose gel electrophoresis and the QlAquick Gel Extraction Kit. The extracted DNA was quantified using the NanoVue Plus. The positions of the working primers are shown in above by the lower case letters. The amplicon size was 230bp.

To establish that fIDNA may be selectively amplified using FOR, the primers from the real time FCR assays for CCR5 and SRYwere used to run gradient end point FCRs to determine the lowest denaturation temperature for each assay at which a product was no longer achieved using genomic DNA as a template, but was still achieved using the synthetic ffDNA fragments as templates. The products from the end point FCRs were separated using agarose gels.

For CCR5, each 25uL FOR reaction consisted of: lx Mastermix containing polymerase, dNTFs, buffer and Mg012 (TaqMan® Fast Universal FOR Mastermix, Applied Biosystems), primers as shown in bold above at 200nM (HFLO purified, Eurofins MWG Biotech, Germany), 5uL of genomic DNA template or synthetic ffDNA template at 0.O2ng!u L concentration.

The cycling conditions were as follows: 50°O for 2mins, 95°O for lOmins, 50°O for 1mm; 45 cycles of selected denaturation temperatures for lssecs; and 56°O for 1mm.

Similar conditions were used for SflYwith the appropriate primers shown in bold above.

The gradient FORs were run with six different temperatures at any one time and for CCR5 the initial denaturation temperature range was from 80°O-95°O.

Several FORs were run whereby the temperature range was narrowed and decreased to the extent that the critical denaturation temperature was found to be 81 °O for this assay. At this temperature no amplicon was produced with genomic DNA as a template but an amplicon was produced with the synthetic ffDNA as a template.

A similar process was employed for determining the critical denaturation temperature for the SRY assay and for this assay 79°O was found to be the critical temperature.

Real time FOR assays were then conducted for both CCR5 and SRYwith the probes (5' FAM label, 3' BHQ1 quencher for CCR5 and 5' Yakima Yellow, 3' BHQ1 quencher for S/Pr') detailed in italics above. Two plates were used in each case, with one plate used under conditions with a denaturation temperature of 95°C and the other plate used under conditions with a denaturation temperature of 81 °C for CCR5 and 79°C for SPY.

S The results are set out in Figures 1 to 4.

Referring to the results shown in Figure 1, there is shown the real time PCR CCR5 assay trace showing the increase in fluorescence with cycle number at a denatu ration temperature of 95°C where the templates were either genomic DNA or synthetic ffDNA. The threshold cycle was determined using StepOne Software automatically. With synthetic ffDNA as a starting template, the mean Ct value was 10.13 and with genomic DNA as a starting template, the mean Ct value was 35.3.

Referring to the results shown in Figure 2, there is shown the real time FCR CCR5 assay trace showing the increase in fluorescence with cycle number at a denaturation temperature of 81 °C where the templates were either genomic DNA or synthetic ffDNA. The threshold cycle was determined by StepOne Software automatically. With synthetic ffDNA as a starting template, the mean Ct value was 11.29 and with genomic DNA as a starting template, the mean Ct value was approximately 38 (one replicate undetermined).

Referring to Figure 3, there is shown the real time PCR SRYassay trace showing the increase in fluorescence with cycle number at a denaturation temperature of 95°C where the templates were either genomic DNA or synthetic ffDNA. The threshold cycle was determined by the StepOne Software automatically.

With synthetic ffDNA as a starting template, the mean Ct value was 10.51 and with genomic DNA as a starting template, the mean Ct value was 36.04.

Referring to Figure 4, there is shown the real time PCR SPY assay trace showing the increase in fluorescence with cycle number at a denaturation temperature of 79°C where the templates were either genomic DNA or synthetic ffDNA. The threshold cycle was determined by the StepOne Software automatically.

With synthetic ffDNA as a starting template, the mean Ct value was 20.41 and with genomic DNA as a starting template, the mean Ct value was undetermined (indicating no amplification).

The results indicate that, at the critical denaturation temperatures, only the synthetic ffDNA template and not the genomic DNA templates are amplified by the FOR.

EXAMPLE 2

Circulating free DNA was isolated from donor blood samples using the QlAamp Circulating Nucleic Acid Kit (ex. Qiagen, U.K). This type of DNA was used to simulate maternal free DNA from maternal plasma samples. Genomic DNA was also extracted from the buffy coat of the same blood samples using the QlAamp DNA Blood Mini Kit (ex. Qiagen, U.K). This DNA was used to determine the sex of the blood donors, using a real time FOR assay targeting the multi copy DYS14 sequence present on the Y chromosome, as described in Zimmermann et aL, Optimised Real Time Quantitative FOR Measurement of Male Fetal DNA in Maternal Plasma', Olin.

Ohem. 2005, 51, pages 1598 to 1604.

1 genome equivalent or copy number equals 6.6pg of DNA. Using this formula, the number of copies of DNA present in the circulating DNA samples was calculated, using a real time FOR assay for CCR5 and a standard curve with genomic DNA as a template.

Experiments to simulate the mixture of ffDNA and maternal free DNA found in maternal plasma were then performed, as follows: The synthetic ffDNA template was mixed with circulating DNA or genomic DNA to simulate the distribution of ffDNA and maternal free DNA when obtained from maternal plasma or serum. Two types of mixture were generated as follows: Female circulating DNA at 99% and synthetic ff DNA at 1%; Female circulating DNA at 99.9% and synthetic ffDNA at 0.1%; The percentages were calculated using copy number equivalents.

In addition to the mixed samples, samples of each DNA material at relevant concentrations, that is for circulating DNA at 99% and 99.9% and synthetic ffDNA at 1% and 0.1%, water negative controls and standard curves were included on the real time FOR plates.

The standard curves comprised circulating/genomic DNA in the range 250 copies/uL to 0.1 copy/uL.

Experiments were carried out with both the CCR5 and SRY assays. Two identical real time PCR plates were used, with one run with a denaturation temperature of 95°O and one run with a denatu ration temperature of 81 °O. Real time FOR results are shown in Figures 5 and 6. Results are shown for only the CCR5 assay.

Referring to Figure 5, there is shown the Real time FOR CCR5 assay trace showing the increase in fluorescence with cycle number at a denaturation temperature of 95°O where the templates were either genomic DNA, synthetic ffDNA or mixed samples. The threshold cycle was determined by the StepOne Software automatically. With synthetic ffDNA at 1% concentration with genomic DNA at 99% as a starting template, the mean Ot value was 10.67 and with synthetic ft DNA at 0.1% concentration with genomic DNA at 99.9% as a starting template, the mean Ot valuewas 14.27.

Referring to Figure 6, there is shown the real time FOR CCR5 assay trace showing the increase in fluorescence with cycle number at a denaturation temperature of 81 °O where the templates were either genomic DNA, synthetic ffDNA, or mixed samples. The threshold cycle was determined by the StepOne Software automatically. With synthetic ffDNA at 1% concentration with genomic DNA at 99% as a starting template, the mean Ot value was 12.54 and with synthetic ffDNA at 0.1% concentration with genomic DNA at 99.9% as a starting template, the mean Ot value was 16.42 Mean Ct values for the various samples at the two different denaturation temperatures are as follows: 95°C Genomic DNA at 99% -mean Ct value 28.61 (CCR5 signal from genomic DNA) Genomic DNA at 99.9% -mean Ct value 32.38 (CCR5 signal from genomic DNA) Synthetic ffDNA at 1% -mean Ct value 10.64 (CCR5 signal from synthetic ffDNA) Synthetic ffDNA at 0.1% -mean Ct value 14.40 (CCR5 signal from synthetic ffDNA) Synthetic ffDNA at 1% and genomic DNA at 99% -mean Ct value 10.67 (CCR5 signal from both genomic DNA and synthetic ffDNA) Synthetic ff DNA at 0.1% and genomic DNA at 99.9% -mean Ct value 14.27 (CCR5 signal from both genomic DNA and synthetic ffDNA) 81°C Genomic DNA at 99% -mean Ct value 32.91 (reduced CCR5 signal from genomic DNA) Genomic DNA at 99.9% -mean Ct value 35.96 (reduced CCR5 signal from genomic DNA) Synthetic ffDNA at 1% -mean Ct value 13.52 (still strong CCR5 signal from synthetic ffDNA) Synthetic ffDNA at 0.1% -mean Ct value 17.74 (still strong CCR5 signal from synthetic ft DNA) Synthetic ffDNA at 1% and genomic DNA at 99% -mean Ct value 12.54 (CCR5 signal mainly from synthetic ffDNA, reduced contribution from genomic DNA) Synthetic ffDNA at 0.1% and genomic DNA at 99.9% -mean Ct value 16.42 (CCR5 signal mainly from synthetic ffDNA, reduced contribution from genomic DNA) Having established the critical denaturation temperatures of the PCR enriched synthetic ffDNA for CCR5 and SRY, assays for chromosomes implicated in aneuploidies, principally chromosomes 21 (Down Syndrome), 18 (Edwards Syndrome) and 13 (Fatau Syndrome) were designed. Short tandem repeat (STIR) regions were assessed on each of these chromosomes and CA repeat regions chosen with high levels of heterozygosity.

In a similar manner to that described above, primers were designed to be able to amplify 250bp regions of DNA surrounding the CA repeat region by PCR.

Primers were also designed to amplify a region internal to the 250bp region by real time PCR.

EXAMPLE 3

Experiments were conducted to enrich maternal plasma in ffDNA by the selective depletion of free maternal DNA.

The region selected to target was exon 7 of the RHD gene. RHO exon 7 is one of the exons detected in the real time PCR assay to determine the RHO status of fetuses from D negative mothers using ffDNA from maternal plasma. The assay is described in Finning et aL, Effect of High Throughput RHD Typing of Fetal DNA in Maternal Plasma on use of Anti-RHD Immunoglobulin in RHD-negative pregnant women: prospective feasibility study', BMIJ, 2008, 336, pages 816 to 818.

The position of the RHO primers (in bold) and probe (in italics) are shown below. The RHO and RHCE genes show a high degree of sequence homology. The size of the amplicon for the real time PCR assay is 75bp.

The alignment of RHD and RHCE exon 7 sequences with real time primers and probe annotated is as follows: * 20 * 40 * 60 RHDEx7 GGGTGTTGTAACCGAGTGCTGGGGATTCCCCACAGCTCCATCATGGGCTACAACTTCAGC: 60 RHCFEx7 GTGTGTTGTAACCGAGTGCTGGGGATTCACCACATCTCCGTCATGCACTCCATCTTCAGC 60 C GTGTTGThACCGAGTGCTGGGGATTC CCACA CTCC TCATG CT CA CTTCAGC * 80 * 100 * 120 RHDEx7: TTGCTGGGTCTGCTTGGAGAGATCATCTACATTGTGCTGCTGGTGCTTGATACCGTCGGA 120 RHCEFx7 TTGCTGGGTCTGCTTGGAGAGATCACCTACATTGTGCTGCTGGTGCTTCATACTGTCTGG 120

TTGCTGGGTCTGCTTGGAGAGATCA CTACATTGTGCTGCTGGTGCTT ATAC GTC C *

RHDEx7 GCCGGCAATGGCAT 134 RHOEEx7 AACGGOAATGGCAT 134

CGGOAATGGCAT

The portion of the RHD gene sequence around exon 7 with primers annotated is as follows: CAGCAGCATT000ATCAOCTGGGAOOTTGTTAGAAATGOTGTTAGAC000 A000CACATCCAOTAAA000AGOTCTTCATTTOAACAAACT0000GATGA TGTGAGTGCACATTCAAGTCTGAGAA0000TTCTTTGAGGTGA000TTAG TG000ATCOCCCTTTGGTGGCCC000ATACOAAGGGTGTGTGAAAGGGGT GGGTA000AATAT000TCTOACCTGOCAATOTGOTTATaataacacttgt ccacagggGTGTTGTAAOOGAGTGCTGGGGATT0000ACAGCTCCATCAT

GGGCTACAACTTOAGCTTGCTGGGTCTGCTTGGAGAGA TCATCTACATTG

TGCTGCTGGTGCTTGATACCGTCGGAGCC030AAT300ATGT000TOACT 0000TTACCCCCCATCCCCTTAACAOTCCCCTCCAACTCAGGAAGAAATG TGTGCAGAGTOOTTAGCT000000TGTGCAOT00000Ccaggtgctcagt aggcttcgGTGAATATTTGTTGGCTGATTTATTCAGAAATTCTGTCCAGC CCCTACCTTGGATGGATTTATOACCTOTCCA0000ACCTCTTCTTTCCAA ATAGGGCCACCTAGGTATAGAOOAAAGACACGAAATOTTTTGTGAT000A CAAACACAGAGCAGGTCAAATA00000AA000AATTGAGACTGTGGTTCA GGTCGTGATGOAGAGOTTTGCTGTGGAOGTGOTCOCACT000TACTAGOT Primers were designed to generate a 250bp POP amplicon to simulate ffDNA for RHD exon 7 with this published assay region in the middle of the amplicon (final choice of primers shown in lowercase letters above). Primer design was carried out in a similar manner to that for CCR5 and SRY described in Examples 1 and 2 above.

Primers were designed to generate a 5OObp POP amplicon to simulate maternal DNA for RHD exon 7 with the 250bp POP amplicon in the middle of the larger amplicon. The primers were designed in a similar manner to those described above. The primers were consensus primers for RHD/RHCE and are shown underlined above (choice of two pairs).

These primers were used to generate 5OObp POR amplicons with the following templates: a) RHD positive genomic DNA b) RHD negative genomic DNA c) RHD positive genomic DNA spiked at 5% with RHD 250bp FOR amplicon (synthetic ffDNA) d) RHD negative genomic DNA spiked at 5% with RHO -250bp FOR amplicon (synthetic ffDNA) The amplification results are shown in Figure 7. In terms of nucleotides, dUTF was used instead of dTTF in the reactions.

In theory, the signal is coming from the following: a) RHD and RHCE genes (lane 4) b) RHCE gene (lane 6) c) RHO and RHCE genes (lane 8) d) RHCE gene (lane 10) Following 25 cycles of FOR, UNG treatment was applied to half of the tubes.

0.25u1 of UNG was added to 25uL FOR reactions and then incubated at SOt for 5 mins, followed by 95°O for 10 mins. The results of UNG treatment are shown in lanes 5, 7, 9 and 11 of Figure 7. There appears to be complete degradation of the amplified 500bp region of DNA in these samples.

The intact nature of the synthetic ffDNA in the mixture can also be assessed by the RHD exon 7 real time FOR assay.

The examples have applied the method of the present invention to the CCR5, SRY, and RHD genes. However, it will be appreciated that the method is equally applicable to any other region of the fetal genome of interest, for example polymorphic regions of chromosome 21.

Claims

CLAIMS1. A method for processing a sample of maternal plasma comprising maternal free DNA and ffDNA, the method comprising the in situ enrichment of the amount of ffDNA relative to the amount of maternal free DNA.
2. The method according to claim 1 wherein the sample of maternal plasma is obtained non-invasively.
3. The method according to either of claims 1 or 2, wherein the amount of ffDNA in the sample is increased.
4. The method according to claim 3, wherein the amount of ffDNA is increased by the selective amplification of one or more ffDNA fragments.
5. The method according to claim 4, wherein the amount of ffDNA is increased by the selective amplification of DNA fragments in the sample having less than 500 base pairs.
6. The method according to claim 5, wherein the amount of ffDNA is increased by the selective amplification of DNA fragments in the sample having less than 400 base pairs.
7. The method according to claim 6, wherein the amount of ffDNA is increased by the selective amplification of DNA fragments in the sample having less than 300 base pairs.
8. The method according to any of claims 4 to 7, wherein the ffDNA is selectively amplified using PCR.
9. The method according to claim 8, wherein the ffDNA is selectively amplified using real time PCR, digital PCR, multiplex PCR and/or MLPA.
10. The method according to any of claims 3 to 9, wherein one or more target regions of the fetal genome are selectively amplified by FOR employing a critical denaturation temperature which is specific to the one or more target regions.
11. The method according to claim 10, wherein the critical denaturation temperature is less than 90°C.
12. The method according to claim 11, wherein the critical denaturation temperature is less than 85°C.
13. The method according to claim 12, wherein the critical denaturation temperature is less than 80°C.
14. The method according to any of claims 10 to 13, wherein the critical denaturation temperature is greater than 70°C.
15. The method according to claim 14, wherein the critical denaturation temperature is greater than 75°C.
16. The method according to either of claims 1 or 2, wherein the amount of maternal free DNA in the sample is reduced.
17. The method according to claim 16, wherein the amount of maternal free DNA is first increased, the maternal free DNA in the sample thereafter being depleted.
18. The method according to claim 17, wherein the amount of maternal free DNA is increased by the selective amplification of DNA fragments having more than 300 base pairs.
19. The method according to claim 18, wherein the amount of maternal free DNA is increased by the selective amplification of DNA fragments having more than 400 base pairs.
20. The method according to claim 19, wherein the amount of maternal free DNA is increased by the selective amplification of DNA fragments having more than 500 base pairs.
21. The method according to any of claims 17 to 20, wherein the amount of maternal free DNA is increased using FOR.
22. The method according to claim 21, wherein the amount of maternal free DNA is increased using real time FOR, digital FOR, multiplex FOR and/or MLFA.
23. The method according to any of claims 17 to 22, wherein increasing the amount of maternal free DNA includes incorporating a moiety in the synthesised DNA to render it susceptible to degradation.
24. The method according to claim 23, wherein the moiety incorporated into the synthesised DNA renders it susceptible to degradation by an enzyme.
25. The method according to claim 24, wherein the moiety is uracil.
26. The method according to claim 25, wherein the enzyme is uracil degycosylase (UNG).
27. The method according to any preceding claim, further comprising analysing the enriched ffDNA to identify abnormalities in the fetal genome.
28. A non-invasive method for identifying genetic abnormalities in the genome of a fetus, the method comprising: providing a sample of maternal plasma; enriching the ffDNA content of the plasma in situ; and analysing the ffDNA in the enriched sample to identify any genetic abnormalities in the fetus.
29. The method according to claim 28, wherein the method for enriching the ffDNA content of the plasma is as claimed in any of claims 1 to 27.
30. The method according to either of claims 28 or 29, wherein the ffDNA is analysed to identify sequence errors or chromosomal aneuploidies.
31. A ffDNA enriched plasma sample obtainable by the method according to any S of clams 1 to 27.
32. A method of diagnosing a condition in a fetus arising from a genetic abnormality, the method comprising enriching a sample of maternal plasma by a method according to any of claims 1 to 27.
33. The method according to claim 32, wherein the condition is Down Syndrome or other aneuploidies.
34. A method for processing a sample of maternal plasma substantially as hereinbefore described, having reference to any one of Figures 1 to 6.