US20110027269A1 - 14-3-3 Antagonists for the Prevention and Treatment of Arthritis - Google Patents

14-3-3 Antagonists for the Prevention and Treatment of Arthritis Download PDF

Info

Publication number
US20110027269A1
US20110027269A1 US12/745,229 US74522908A US2011027269A1 US 20110027269 A1 US20110027269 A1 US 20110027269A1 US 74522908 A US74522908 A US 74522908A US 2011027269 A1 US2011027269 A1 US 2011027269A1
Authority
US
United States
Prior art keywords
antibody
antagonist
eta
peptide
seq
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Abandoned
Application number
US12/745,229
Other languages
English (en)
Inventor
Anthony Marrotta
Aziz Ghahary
Walter Wolodmyr Peter Maksy mowych
Ruhangiz Kilani
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Unversity of British Office
Original Assignee
Unversity of British Office
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Unversity of British Office filed Critical Unversity of British Office
Priority to US12/745,229 priority Critical patent/US20110027269A1/en
Publication of US20110027269A1 publication Critical patent/US20110027269A1/en
Abandoned legal-status Critical Current

Links

Images

Classifications

    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K16/00Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
    • C07K16/18Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K39/0005Vertebrate antigens
    • A61K39/0011Cancer antigens
    • A61K39/001154Enzymes
    • A61K39/001162Kinases, e.g. Raf or Src
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K39/0005Vertebrate antigens
    • A61K39/0011Cancer antigens
    • A61K39/001154Enzymes
    • A61K39/001163Phosphatases
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K39/395Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P19/00Drugs for skeletal disorders
    • A61P19/02Drugs for skeletal disorders for joint disorders, e.g. arthritis, arthrosis
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P29/00Non-central analgesic, antipyretic or antiinflammatory agents, e.g. antirheumatic agents; Non-steroidal antiinflammatory drugs [NSAID]
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P37/00Drugs for immunological or allergic disorders
    • A61P37/02Immunomodulators
    • A61P37/06Immunosuppressants, e.g. drugs for graft rejection
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P43/00Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53Immunoassay; Biospecific binding assay; Materials therefor
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/68Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
    • G01N33/6893Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids related to diseases not provided for elsewhere
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K2039/505Medicinal preparations containing antigens or antibodies comprising antibodies
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K2039/51Medicinal preparations containing antigens or antibodies comprising whole cells, viruses or DNA/RNA
    • A61K2039/515Animal cells
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2317/00Immunoglobulins specific features
    • C07K2317/20Immunoglobulins specific features characterized by taxonomic origin
    • C07K2317/24Immunoglobulins specific features characterized by taxonomic origin containing regions, domains or residues from different species, e.g. chimeric, humanized or veneered
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2317/00Immunoglobulins specific features
    • C07K2317/30Immunoglobulins specific features characterized by aspects of specificity or valency
    • C07K2317/33Crossreactivity, e.g. for species or epitope, or lack of said crossreactivity
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2317/00Immunoglobulins specific features
    • C07K2317/30Immunoglobulins specific features characterized by aspects of specificity or valency
    • C07K2317/34Identification of a linear epitope shorter than 20 amino acid residues or of a conformational epitope defined by amino acid residues
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2317/00Immunoglobulins specific features
    • C07K2317/70Immunoglobulins specific features characterized by effect upon binding to a cell or to an antigen
    • C07K2317/76Antagonist effect on antigen, e.g. neutralization or inhibition of binding
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2333/00Assays involving biological materials from specific organisms or of a specific nature
    • G01N2333/435Assays involving biological materials from specific organisms or of a specific nature from animals; from humans
    • G01N2333/46Assays involving biological materials from specific organisms or of a specific nature from animals; from humans from vertebrates
    • G01N2333/47Assays involving proteins of known structure or function as defined in the subgroups
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2800/00Detection or diagnosis of diseases
    • G01N2800/10Musculoskeletal or connective tissue disorders
    • G01N2800/101Diffuse connective tissue disease, e.g. Sjögren, Wegener's granulomatosis
    • G01N2800/102Arthritis; Rheumatoid arthritis, i.e. inflammation of peripheral joints
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/564Immunoassay; Biospecific binding assay; Materials therefor for pre-existing immune complex or autoimmune disease, i.e. systemic lupus erythematosus, rheumatoid arthritis, multiple sclerosis, rheumatoid factors or complement components C1-C9

Definitions

  • the invention relates to the involvement of 14-3-3 proteins in arthritis, and compositions and methods for the prevention and treatment of arthritis.
  • Arthritis generally refers to inflammatory disorders of the joints of the body, and is usually accompanied by pain, swelling and stiffness. Arthritis may result from any of several causes including infection, trauma, degenerative disorders, metabolic disorders or disturbances or other unknown etiologies. Osteoarthritis (OA) is a common form of arthritis that may occur following trauma to a joint, following an infection of a joint or simply as a result of aging. Osteoarthritis is also known as degenerative joint disease. Rheumatoid arthritis (RA) is traditionally considered a chronic, inflammatory autoimmune disorder that causes the immune system to attack the joints.
  • Ankylosing spondylitis is a chronic, painful, degenerative inflammatory arthritis primarily affecting the spine and sacroiliac joints, causing eventual fusion of the spine.
  • synovial joints The body's articulating joints are called synovial joints, and each synovial joint generally comprises the opposing ends of two adjacent bones.
  • the ends of the bones are encased in cartilage tissue while the entire joint area is encased in a protective soft tissue called synovium which comprises synovial membrane.
  • synovium which comprises synovial membrane.
  • the synovial membrane produces and releases a lubricating synovial fluid into cavities within the joint. In normal joints, the volume of synovial fluid is quite small. In addition to its lubricating function, synovial fluid also acts as a reservoir for solutes and a few resting mononuclear and synovial cells.
  • the synovium can become irritated and thickened in response to many insults believed to promote arthritis, including trauma to the joint and/or malfunction of the body's immune system.
  • the consequences of such insults include excessive production and release of synovial fluid into the joint, thereby causing swelling within and about the joint area.
  • the increased volumes are typically accompanied by increased concentrations in the synovial, fluid of fibroblast-like synoviocytes cells (FLS cells), pro-inflammatory cytokines such as Interleukin-1 (IL-1) and tumor necrosis factor (TNF-alpha), histamine proteins and peptides, and degradative enzymes such as matrix metalloproteases (MMPs).
  • FLS cells fibroblast-like synoviocytes cells
  • pro-inflammatory cytokines such as Interleukin-1 (IL-1) and tumor necrosis factor (TNF-alpha
  • TNF-alpha tumor necrosis factor
  • MMPs matrix metalloproteases
  • the FLS cells comprise about two-thirds of the synovial cells in normal synovial fluid, have well-defined secretory systems, and under conditions of trauma or inflammation commonly secrete large amounts of MMPs into the synovial fluid, specifically MMP-1, 3, 8, 9, 10, 11 and 13.
  • MMP-1 and MMP-3 are considered to have significant roles in the progressive structural damage of cartilage and underlying bone tissues comprising joints.
  • Known factors that activate FLS cells to produce MMP-1 and MMP-3 include IL-1 and TNF-alpha.
  • 14-3-3 proteins are a family of conserved intracellular regulatory molecules that are ubiquitously expressed in eukaryotes. 14-3-3 proteins have the ability to bind a multitude of functionally diverse signaling proteins, including kinases, phosphatases, and transmembrane receptors. Indeed, more than 100 signaling proteins have been reported as 14-3-3 ligands. 14-3-3 proteins may be considered evolved members of the Tetratrico Peptide Repeat superfamily. They generally have 9 or 10 alpha helices, and usually form homo- and/or hetero-dimer interactions along their amino-termini helices. These proteins contain a number of known domains, including regions for divalent cation interaction, phosphorylation & acetylation, and proteolytic cleavage, among others.
  • 14-3-3 protein isoforms There are seven distinct genetically encoded isoforms of the 14-3-3 proteins that are known to be expressed in mammals, with each isoform comprising between 242-255 amino acids.
  • the seven 14-3-3 protein isoforms are designated as 14-3-3 ⁇ / ⁇ (alpha/beta), 14-3-3 ⁇ / ⁇ (delta/zeta), 14-3-3 ⁇ (epsilon), 14-3-3 ⁇ (gamma), 14-3-3 ⁇ (eta), 14-3-3 ⁇ / ⁇ (tau/theta), and 14-3-3 ⁇ (sigma/stratifin).
  • the invention stems in part from the findings that (1) 14-3-3 protein is aberrantly localized in the extracellular synovial space in arthritis, (ii) such extracellular 14-3-3 protein can induce effectors of arthritis, and (iii) 14-3-3 antagonists directed to such extracellular 14-3-3 proteins can reduce the effectors of arthritis.
  • the invention provides methods of treating arthritis.
  • the invention provides methods of treating a disease selected from the group consisting of ankylosing spondylitis, Behçet's Disease, diffuse idiopathic skeletal hyperostosis (DISH), Ehlers-Danlos Syndrome (EDS), Felty's Syndrome, fibromyalgia, gout, infectious arthritis, juvenile arthritis, lupus, mixed connective tissue disease (MCTD), osteoarthritis, Paget's Disease, polymyalgia rheumatica, polymyositis and dermatomyositis, pseudogout, psoriatic arthritis, Raynaud's Phenomenon, reactive arthritis, rheumatoid arthritis, scleroderma, Sjögren's Syndrome, Still's Disease, and Wegener's granulomatosis.
  • a disease selected from the group consisting of ankylosing spondylitis, Behçet's Disease,
  • the methods involve administration of a 14-3-3 antagonist to an affected patient, wherein the 14-3-3 antagonist is targeted to 14-3-3 protein that is localized extracellularly.
  • the 14-3-3 protein is 14-3-3 eta or 14-3-3 gamma.
  • the 14-3-3 antagonists used may be prior art compositions, or novel compositions disclosed herein. Therapeutic compositions are formulated and administration is such that the 14-3-3 antagonist so delivered is available to engage extracellular 14-3-3 protein. In one embodiment, the 14-3-3 antagonist is a peptide or an anti-14-3-3 antibody.
  • the 14-3-3 antagonist used is capable of inhibiting the induction of MMP by a 14-3-3 protein to which it binds.
  • the MMP is selected from the group consisting of MMP-1, 3, 8, 9, 10, 11 and 13, with MMP-1 and MMP-3 being especially preferred.
  • the method involves a combination treatment, wherein at least one other therapeutic agent is administered in addition to one or more 14-3-3 antagonists.
  • the therapeutic agent is selected from the group consisting of disease-modifying antirheumatic drugs (DMARDs) and disease modifying osteoarthritis drugs (DMOADs; for example, see Loeser, Reumatologia, 21:104-106, 2005).
  • one or more anti-14-3-3 antagonists is administered in combination with at least one agent selected from the group consisting of anti-TNF ⁇ antibody, anti-IL-1 antibody, anti-CD4 antibody, anti-CTLA4 antibody, anti-IL-6 antibody, anti-CD20 antibody, leflunomide, sulfasalazine, and methotrexate.
  • a 14-3-3 antagonist is administered in the form of an encoding nucleic acid that is expressed to deliver the 14-3-3 antagonist.
  • the method involves administering to a patient a cell that delivers a 14-3-3 antagonist.
  • the 14-3-3 antagonist so delivered is a peptide or an anti-14-3-3 antibody.
  • the cell is a fibroblast or an FLS cell.
  • the invention provides prophylactic methods for preventing the development of arthritis in a subject at risk of developing arthritis.
  • the methods comprise administering to the subject one or more 14-3-3 antagonists.
  • the invention provides methods for reducing the damage to a joint injured by trauma.
  • the methods comprise administering one or more 14-3-3 antagonists to a subject having a joint injured by trauma.
  • a 14-3-3 antagonist is administered as a component of a combination therapy described herein.
  • the invention provides methods of decreasing MMP expression.
  • the MMP expression to be decreased is in the synovium.
  • the methods comprise delivering one or more 14-3-3 antagonists to a tissue or compartment in which MMP producing cells are present, wherein the MMP producing cells are responsive to 14-3-3 proteins to which the 14-3-3 antagonists bind. Delivery may be direct to the affected tissue or compartment, or indirect.
  • the responsive cells are fibroblasts or FLS cells
  • the MMP expression that is to be decreased is MMP expression that is associated with arthritis.
  • the MMP expression that is to be decreased is that of an MMP selected from the group consisting of MMP-1, 3, 8, 9, 10, 11 and 13. In an especially preferred embodiment, the MMP expression that is to be decreased is that of MMP-1 or MMP-3.
  • the invention provides methods of inhibiting MMP induction by a 14-3-3 protein. Inhibition may be partial or complete.
  • the methods comprise delivering one or more 14-3-3 antagonists to a tissue or compartment in which MMP producing cells are present, wherein the MMP producing cells are responsive to 14-3-3 proteins to which the 14-3-3 antagonists specifically bind. Delivery may be direct to the affected tissue or compartment, or indirect.
  • the one or more 14-3-3 antagonists are administered to the synovium.
  • the responsive cells are fibroblasts or FLS cells.
  • the MMP induction that is to be inhibited is that of an MMP which is upregulated in arthritis.
  • the MMP induction that is to be inhibited is that of an MMP selected from the group consisting of MMP-1, 3, 8, 9, 10, 11 and 13. In an especially preferred embodiment, the MMP induction that is to be inhibited is that of MMP-1 or MMP-3.
  • the invention provides methods of decreasing joint swelling in a subject.
  • the methods comprise administering one or more 14-3-3 antagonists to an affected subject.
  • the invention provides methods of decreasing cartilage degradation in a subject.
  • the methods comprise administering one or more 14-3-3 antagonists to an affected subject.
  • the invention provides methods of decreasing bone degradation in a subject.
  • the methods comprise administering one or more 14-3-3 antagonists to an affected subject.
  • the invention provides methods of decreasing pro-inflammatory cytokine accumulation in synovial fluid.
  • the methods comprise administering one or more 14-3-3 antagonists to an affected subject.
  • intracapsular delivery of antagonist is used.
  • systemic delivery of antagonist is used.
  • the therapeutic compositions are formulated and administration is such that the 14-3-3 antagonist so delivered is available to engage extracellularly localized 14-3-3 protein.
  • the 14-3-3 antagonist is a peptide.
  • the peptide comprises the amino acid sequence designated “R-18”.
  • the peptide consists essentially of the R-18 sequence.
  • the peptide comprises multiple iterations of the R-18 sequence.
  • the peptide binds to a region of 14-3-3 protein that is capable of binding to R-18.
  • the peptide binds to a region of a 14-3-3 protein that is capable of binding to an intracellular 14-3-3 binding partner, preferably Raf.
  • the peptide binds to a 14-3-3 protein without disrupting binding of the 14-3-3 protein to an intracellular 14-3-3 binding partner.
  • the 14-3-3 antagonist is a phosphopeptide.
  • the 14-3-3 antagonist is a mode I phosphopeptide, as is known in the art.
  • the 14-3-3 antagonist is a mode II phosphopeptide, as is known in the art.
  • the 14-3-3 antagonist is an anti-14-3-3 antibody.
  • the anti-14-3-3 antibody is a pan 14-3-3 antibody.
  • the anti-14-3-3 antibody is capable of distinguishing between 14-3-3 isoforms.
  • the anti-14-3-3 antibody specifically binds to a peptide selected from the group consisting of 14-3-3 loop peptides, 14-3-3 helix peptides, and non-helix 14-3-3 peptides.
  • the anti-14-34 antibody is an anti-14-3-3 gamma antibody.
  • the anti-14-3-3 gamma antibody binds to a 14-3-3 peptide comprising a segment of the amino acid sequence set forth in SEQ ID NO:64.
  • the segment is at least 6, more preferably at least 7, more preferably at least 8 amino acids in length.
  • an anti-14-34 gamma antibody binds to a 14-3-3 peptide that is a 14-3-3 gamma loop peptide.
  • the 14-3-3 gamma loop peptide comprises an amino acid sequence selected from the group consisting of SEQ ID NOs:44-49.
  • the 14-3-3 gamma loop peptide consists essentially of an amino acid sequence selected from the group consisting of SEQ ID NOs:44-49.
  • an anti-14-3-3 gamma antibody binds to a region of 14-3-3 gamma that overlaps with an amino acid sequence corresponding to a sequence selected from the group consisting of SEQ ID NOs:44-49.
  • an anti-14-3-3 gamma antibody binds to a 14-3-3 peptide that is a 14-3-3 gamma helix peptide.
  • the 14-3-3 gamma helix peptide comprises an amino acid sequence selected from the group consisting of SEQ ID NOs:33-43.
  • the 14-3-3 gamma helix peptide consists essentially of an amino acid sequence selected from the group consisting of SEQ ID NOs:33-43.
  • an anti-14-3-3 gamma antibody binds to a region of 14-3-3 gamma that overlaps with an amino acid sequence corresponding to a sequence selected from the group consisting of SEQ ID NOs:33-43.
  • an anti-14-3-3 gamma antibody binds to a 14-3-3 peptide that is a non-helix 14-3-3 gamma peptide.
  • the non-helix 14-3-3 gamma peptide comprises an amino acid sequence selected from the group consisting of SEQ ID NOs:50-62.
  • the non-helix 14-3-3 gamma peptide consists essentially of an amino acid sequence selected from the group consisting of SEQ ID NOs:50-62.
  • an anti-14-3-3 gamma antibody binds to a region of 14-3-3 gamma that overlaps with an amino acid sequence corresponding to a sequence selected from the group consisting of SEQ ID NOs:50-62.
  • the anti-14-3-3 antibody is an anti-14-3-3 eta antibody.
  • the anti-14-3-3 eta antibody binds to a 14-3-3 peptide comprising a segment of the amino acid sequence set forth in SEQ ID NO:63.
  • the segment is at least 6, more preferably at least 7, more preferably at least 8 amino acids in length.
  • an anti-14-3-3 eta antibody of the invention does not bind to an epitope located at the N-terminus of the human 14-3-3 eta protein.
  • an anti-14-3-3 eta antibody binds to a 14-3-3 peptide that is a 14-3-3 eta loop peptide.
  • the 14-3-3 eta loop peptide comprises an amino acid sequence selected from the group consisting of SEQ ID NOs:11-16.
  • the 14-3-3 eta loop peptide consists essentially of an amino acid sequence selected from the group consisting of SEQ ID NOs:11-16.
  • an anti-14-3-3 eta antibody binds to a region of 14-3-3 eta that overlaps with an amino acid sequence corresponding to a sequence selected from the group consisting of SEQ ID NOs:11-16.
  • an anti-14-3-3 eta antibody binds to a 14-3-3 peptide that is a 14-3-3 eta helix peptide.
  • the 14-3-3 eta helix peptide comprises an amino acid sequence selected from the group consisting of SEQ ID NOs:1-10.
  • the 14-3-3 eta helix peptide consists essentially of an amino acid sequence selected from the group consisting of SEQ ID NOs:1-10.
  • an anti-14-3-3 eta antibody binds to a region of 14-3-3 eta that overlaps with an amino acid sequence corresponding to a sequence selected from the group consisting of SEQ ID NOs:1-10.
  • an anti-14-3-3 eta antibody binds to a 14-3-3 peptide that is a non-helix 14-3-3 eta peptide.
  • the non-helix 14-3-3 eta peptide comprises an amino acid sequence selected from the group consisting of SEQ ID NOs:17-32.
  • the non-helix 14-3-3 eta peptide consists essentially of an amino acid sequence selected from the group consisting of SEQ ID NOs:17-32.
  • an anti-14-3-3 eta antibody binds to a region of 14-3-3 eta that overlaps with an amino acid sequence corresponding to a sequence selected from the group consisting of SEQ ID NOs:17-32.
  • an anti-14-3-3 eta antibody of the invention binds to an amino acid sequence selected from the group consisting of LDKFLIKNSNDF (SEQ ID NO:30), KKLEKVKAYR (SEQ ID NO:31), and KNSVVEASEAAYKEA (SEQ ID NO:32).
  • Exemplary 14-3-3 eta loop, helix, and non-helix peptides are disclosed in Table 1 herein.
  • SEQ ID NO:30 varies from corresponding 14-3-3 eta sequence in that a cysteine occurring in 14-3-3 eta sequence has been replaced by serine to avoid disulfide bond formation.
  • the invention provides antibodies that also bind to the natural 14-3-3 sequence correlate of SEQ NO:30 comprising a cysteine.
  • the invention provides antibodies capable of binding to peptide sequences that vary from those listed in the epitope tables herein by substitution of serine for cysteine.
  • an anti-14-3-3 antibody is capable of discriminating between 14-3-3 protein isoforms.
  • an anti-14-3-3 antibody is a monoclonal antibody.
  • an anti-14-3-3 antibody is a humanized antibody.
  • the invention provides novel 14-3-3 antagonists. In one embodiment, the invention provides novel 14-3-3 antagonist peptides. In another embodiment, the invention provides novel anti-14-3-3 antibodies. In one aspect, the invention provides methods of making 14-3-3 antagonists.
  • the invention provides nucleic acids encoding 14-34 antagonists that are peptides or antibodies. Also provided are vectors, including expression vectors, comprising such nucleic acids. Also provided are host, cells comprising such nucleic acids and host cells comprising such vectors. Also provided are methods of making a 14.3-3 antagonist, which comprise the use of such host cells.
  • the invention provides cells capable of producing 14-3-3 antagonists.
  • the cell is a hybridoma
  • the 14-3-3 antagonist is an anti-14-3-3 antibody.
  • the cell is a genetically modified fibroblast or FLS cell
  • the 14-3-3 antagonist is a peptide or an anti-14-3-3 antibody.
  • the invention provides methods of screening for a 14-3-3 antagonist.
  • the methods comprise screening candidate agents for the ability to inhibit binding of a 14-3-3 eta protein or 14-3-3 gamma protein to 14-3-3 eta ligand or a 14-3-3 gamma ligand; respectively.
  • the ligand is a 14-3-3 antagonist peptide.
  • the ligand is an anti-14-3-3 antibody.
  • the ligand is an intracellular 14-3-3 binding partner.
  • the methods comprise analyzing the ability of the candidate agent to inhibit induction of MMP by a 14-3-3 protein.
  • a 14-3-3 antagonist competitively inhibits the binding of a 14-3-3 eta protein or a 14-3-3 gamma protein to an anti-14-3-3 antibody or a 14-3-3 antagonist peptide disclosed herein.
  • the 14-3-3 antagonist is a small molecule chemical composition.
  • a 14-3-3 antagonist binds to a region of 14-3-3 protein that is capable of binding to R-18. In a preferred embodiment, a 14-3-3 antagonist binds to a region of 14-3-3 protein that is capable binding to an intracellular 14-3-3 binding partner, preferably Raf. In one embodiment, a 14-3-3 antagonist binds to a 14-3-3 protein without inhibiting the binding of an intracellular 14-3-3 binding partner.
  • the invention provides pharmaceutical compositions for the treatment of arthritis.
  • the pharmaceutical compositions comprise one or more 14-3-3 antagonists.
  • the pharmaceutical compositions are formulated to provide for engagement of extracellular 14-3-3 protein by the 14-3-3 antagonist.
  • the invention provides methods for preparing a medicament useful for treating arthritis.
  • a medicament comprises one or more 14-3-3 antagonists.
  • the medicament is formulated to provide for engagement of extracellular 14-3-3 protein by the 14-3-3 antagonist.
  • the invention accordingly involves the use of a 14-3-3 antagonist, such as a 14-3-3 antagonist that is capable of specifically binding to an extracellularly-localized 14-3-3 protein and inhibiting the activity of the 14-3-3 protein, for treating arthritis or to formulate a medicament for treating arthritis.
  • a 14-3-3 antagonist such as a 14-3-3 antagonist that is capable of specifically binding to an extracellularly-localized 14-3-3 protein and inhibiting the activity of the 14-3-3 protein, for treating arthritis or to formulate a medicament for treating arthritis.
  • FIG. 1 ELISA: Test Bleed Titration of Mouse Anti-AUG1-CLDK Immune Serum (after 2nd boost) on AUG1-CLDK-BSA Antigen (IgG response only).
  • FIG. 2 ELISA: Test Bleed Titration of Mouse Anti-AUG2-KKLE Immune Serum (after 2nd boost) on AUG2-KKLE-BSA antigen (IgG response only).
  • FIG. 3 ELISA: Test Bleed Titration of Mouse Anti-AUG3-CKNS Immune Serum (after 2nd boost) on AUG3-CKNS-BSA Antigen (IgG response only).
  • FIG. 4 Sequence alignment for various 14-3-3 protein isoforms.
  • FIG. 5 R-18 interacts with extracellular 14-3-3 protein and inhibits induction of MMP-1 expression induced by extracellular 14-3-3 protein.
  • FIG. 6 Western Blot showing cell lysate-derived 14-3-3 eta protein and human recombinant 14-3-3 eta immunoprecipated by monoclonal antibody raised against full length human recombinant 14-3-3 eta.
  • FIG. 7 Western Blot showing cell lysate-derived 14-3-3 eta protein and human recombinant 14-3-3 eta immunoprecipated by monoclonal antibody raised against a human 14-3-3 eta peptide fragment 142-158 SEQ ID NO:24 from a non-helical region of the protein.
  • FIG. 8 ELISA: Test Bleed Titration of Mouse anti-14-3-3 eta Immune Sera (after 2nd boost) on 14-3-3 eta Antigen (IgG response only)
  • the invention provides methods of treating arthritis, including methods of treating ankylosing spondylitis, Behçet's Disease, diffuse idiopathic skeletal hyperostosis (DISH), Ehlers-Danlos Syndrome (EDS), Felty's Syndrome, fibromyalgia, gout, infectious arthritis, juvenile arthritis, lupus, mixed connective tissue disease (MCTD), osteoarthritis, Paget's Disease, polymyalgia rheumatica, polymyositis and dermatomyositis pseudogout, psoriatic arthritis, Raynaud's Phenomenon, reactive arthritis, rheumatoid arthritis, scleroderma, Sjögren's Syndrome, Still's Disease, and Wegener's granulomatosis.
  • ankylosing spondylitis including methods of treating ankylosing spondylitis, Behçet's Disease, diffuse idiopathic skeletal hyperostos
  • arthritis refers to an inflammatory disorder of the joints of the body. Pain, swelling, stiffness and difficulty of movement are frequently associated with arthritis diseases. Arthritis may result from any of several causes including infection, trauma, degenerative disorders, metabolic disorders or disturbances or other unknown etiologies.
  • DAS Disease Activity Score
  • TEN Number of joints tender to the touch
  • SW number of swollen joints
  • ESR erythrocyte sedimentation rate
  • VAS patient assessment of disease activity
  • a DAS may include C-reactive protein marker assessment (CRP) (Skogh T et al 2003. Ann Rheum Dis 62:681-682).
  • CRP C-reactive protein marker assessment
  • one may utilize diagnostic biomarkers, including 14-3-3 eta and/or gamma, to measure the presence or absence of disease, or to determine disease severity.
  • treatment or % rear refer to both prophylactic or preventative treatment as well as curative or disease modifying treatment, including treatment of a patient at risk of contracting the disease or suspected to have contracted the disease as well as patients who are ill or have been diagnosed as suffering from a disease or medical condition, and includes suppression of clinical relapse.
  • a 14-3-3 antagonist of the invention binds to a 14-3-3 protein, particularly 14-3-3 eta or gamma, and antagonizes the activity thereof.
  • an ‘isoform’ refers to two or more functionally similar proteins that have a similar but not identical amino acid sequence and are either encoded by different genes or by different RNA transcripts, primary or processed, from the same gene.
  • Reference to a 14-3-3 eta protein or a 14-3-3 gamma protein may include fragments thereof.
  • the invention provides methods of screening for a 14-3-3 antagonist which, in a preferred embodiment, comprise screening candidate agents for the ability to inhibit binding of a 14-3-3 ligand to a 14-3-3 protein. It will be understood that an appropriate fragment of a 14-3-3 protein can be used in the assay.
  • R18 inhibitory peptide is the R18 inhibitory peptide (Wang et al. 1999—REF 35).
  • the R18 peptide also referred to herein as ‘R18’, is a small peptide which is capable of blocking the association of 14-3-3 proteins with Raf-1.
  • Other examples of peptides that bind to 14-3-3 proteins are known (see, for example, Wang et al. 1999—REF 35, infra; Yaffe et al., Cell, 91:961-971, 1997; Shaw et al., U.S. Pat. No. 5,948,765; Petosa et al., JBC 273:16305-16310, 1998; Fu at al., US 2004/0152630).
  • These and others when formulated to engage aberrantly localized extracellular 14.3-3 protein may find utility in the present invention as therapeutics for the treatment of arthritis.
  • Antibody refers to a composition comprising a protein that binds specifically to a corresponding antigen and has a common, general structure of immunoglobulins.
  • the term antibody specifically covers polyclonal antibodies, monoclonal antibodies, dimers, multimers, multispecific antibodies (e.g., bispecific antibodies), and antibody fragments, so long as they exhibit the desired biological activity.
  • Antibodies may be murine, human, humanized, chimeric, or derived from other species.
  • an antibody will comprise at least two heavy chains and two light chains interconnected by disulfide bonds, which when combined form a binding domain that interacts with an antigen.
  • Each heavy chain is comprised of a heavy chain variable region (VH) and a heavy chain constant region (CH).
  • VH heavy chain variable region
  • CH heavy chain constant region
  • the heavy chain constant region is comprised of three domains, CH1, CH2 and CH3, and may be of the mu, delta, gamma, alpha or epsilon isotype.
  • the light chain is comprised of a light chain variable region (VL) and a light chain constant region (CL).
  • the light chain constant region is comprised of one domain, CL, which may be of the kappa or lambda isotype.
  • CL complementarity determining regions
  • FR framework regions
  • Each VH and VL is composed of three CDRs and four FRs, arranged from amino-terminus to carboxy-terminus in the following order: FR1, CDR1, FR2, CDR2, FR3, CDR3, FR4.
  • the variable regions of the heavy and light chains contain a binding domain that interacts with an antigen.
  • the constant regions of the antibodies may mediate the binding of the immunoglobulin to host tissues or factors, including various cells of the immune system (e.g., effector cells) and the first component (Clq) of the classical complement system.
  • the heavy chain constant region mediates binding of the immunoglobulin to host tissue or host factors, particularly through, cellular receptors such as the Fc receptors (e.g., Fc ⁇ RI, Fc ⁇ RII, Fc ⁇ RIII, etc.).
  • Fc receptors e.g., Fc ⁇ RI, Fc ⁇ RII, Fc ⁇ RIII, etc.
  • antibody also includes an antigen binding portion of an immunoglobulin that retains the ability to bind antigen. These include, as examples, F(ab), a monovalent fragment of VL CL and VH CH antibody domains; and F(ab′) 2 fragment, a bivalent fragment comprising two Fab fragments linked by a disulfide bridge at the hinge region.
  • antibody also refers to recombinant single chain Fv fragments (scFv) and bispecific molecules such as, e.g., diabodies, triabodies, and tetrabodies (see, e.g., U.S. Pat. No. 5,844,094).
  • scFv single chain Fv fragments
  • bispecific molecules such as, e.g., diabodies, triabodies, and tetrabodies (see, e.g., U.S. Pat. No. 5,844,094).
  • Antibodies may be produced and used in many forms, including antibody complexes.
  • antibody complex refers to a complex of one or more antibodies with another antibody or with an antibody fragment or fragments, or a complex of two or more antibody fragments.
  • Antibody complexes include multimeric forms of anti-14-3-3 antibodies such as homoconjugates and heteroconjugates as well as other cross-linked antibodies as described herein.
  • Antigen is to be construed broadly and refers to any molecule, composition, or particle that can bind specifically to an antibody.
  • An antigen has one or more epitopes that interact with the antibody, although it does not necessarily induce production of that antibody.
  • cross-linked refers to the attachment of two or more antibodies to form antibody complexes, and may also be referred to as multimerization.
  • Cross-linking or multimerization includes the attachment of two or more of the same antibodies (e.g. homodimerization), as well as the attachment of two or more different antibodies (e.g. heterodimerization).
  • homodimerization the attachment of two or more antibodies to form antibody complexes
  • heterodimerization e.g. heterodimerization
  • Such conjugates may involve the attachment of two or more monoclonal antibodies of the same clonal origin (homoconjugates) or the attachment of two or more antibodies of different clonal origin (also referred to as heteroconjugates or bispecific).
  • Antibodies may be crosslinked by non-covalent or covalent attachment. Numerous techniques suitable for cross-linking will be appreciated by those of skill in the art. Non-covalent attachment may be achieved through the use of a secondary antibody that is specific to the primary antibody species. For example, a goat anti-mouse (GAM) secondary antibody may be used to cross-link a mouse monoclonal antibody. Covalent attachment may be achieved through the use of chemical cross-linkers.
  • GAM goat anti-mouse
  • Epitope refers to a determinant capable of specific binding to an antibody.
  • Epitopes are chemical features generally present on surfaces of molecules and accessible to interaction with an antibody. Typical chemical features are amino acids and sugar moieties, having three-dimensional structural characteristics as well as chemical properties including charge, hydrophilicity, and lipophilicity. Conformational epitopes are distinguished from non-conformational epitopes by loss of reactivity with an antibody following a change in the spatial elements of the molecule without any change in the underlying chemical structure.
  • Humanized antibody refers to an immunoglobulin molecule containing a minimal sequence derived from non-human immunoglobulin.
  • Humanized antibodies include human immunoglobulins (recipient antibody) in which residues from a complementary determining region (CDR) of the recipient are replaced by residues from a CDR of a non-human species (donor antibody) such as mouse, rat or rabbit having the desired specificity, affinity and capacity.
  • CDR complementary determining region
  • donor antibody such as mouse, rat or rabbit having the desired specificity, affinity and capacity.
  • Fv framework residues of the human immunoglobulin are replaced by corresponding non-human residues.
  • Humanized antibodies may also comprise residues which are found neither in the recipient antibody nor in the imported CDR or framework sequences.
  • a humanized antibody will comprise substantially all of at least one, and typically two, variable domains, in which all or substantially all of the CDR regions correspond to those of a non-human immunoglobulin and all or substantially all of the framework (FR) regions are those of a human immunoglobulin consensus sequence.
  • a humanized antibody will also encompass immunoglobulins comprising at least a portion of an immunoglobulin constant region (Fc), generally that of a human immunoglobulin (Jones et al., Nature 321:522-525 (1986); Reichmann at al, Nature 332:323-329 (1986)).
  • Immunogen refers to a substance, compound, or composition which stimulates the production of an immune response.
  • immunoglobulin locus refers to a genetic element or set of finked genetic elements that comprise information that can be used by a B cell or B cell precursor to express an immunoglobulin polypeptide.
  • This polypeptide can be a heavy chain polypeptide, a tight chain polypeptide, or the fusion of a heavy and a light chain polypeptide.
  • the genetic elements are assembled by a B cell precursor to form the gene encoding an immunoglobulin polypeptide.
  • a gene encoding an immunoglobulin polypeptide is contained within the locus.
  • Isotype refers to an antibody class defined by its heavy chain constant region. Heavy chains are generally classified as gamma, mu, alpha, delta, epsilon and designated as IgG, IgM, IgA, IgD, and IgE. Variations within each isotype are categorized into subtypes, for example subtypes of IgG are divided into IgG1, IgG2, IgG3, and IgG4, while IgA is divided into IgA1 and IgA2. The IgY isotype is specific to birds.
  • “Monoclonal antibody” or “monoclonal antibody composition” refers to a preparation of antibody molecules of single molecular composition. A monoclonal antibody composition displays a single binding specificity and affinity for a particular epitope.
  • human monoclonal antibody includes antibodies displaying a single binding specificity which have variable and/or constant regions (if present) derived from human immunoglobulin sequences.
  • the human monoclonal antibodies are produced by a hybridoma which includes a B cell obtained from a transgenic non-human animal, e.g., a transgenic mouse, having a genome comprising a human heavy chain transgene and a light chain transgene, fused to an immortalized cell.
  • Single chain Fv refers to an antibody comprising the VH and VL regions of an antibody, wherein these domains are present in a single polypeptide chain.
  • an scFv further comprises a polypeptide linker between the VH and VL domains which enables the scFv to form the desired structure for antigen binding.
  • Subject or “patient” are used interchangeably and refer to, except where indicated, mammals such as humans and non-human primates, as well as rabbits, rats, mice, goats, pigs, and other mammalian species.
  • Recombinant antibody refers to all antibodies produced by recombinant techniques. These include antibodies obtained from an animal that is transgenic for the immunoglobulin locus, antibodies expressed from a recombinant expression vector, or antibodies created, prepared, and expressed by splicing of any immunoglobulin gene sequence to any other nucleic acid sequence.
  • the invention provides novel anti-14-3-3 antibodies that bind specifically to 14-3-3 eta or 14-3-3 gamma protein.
  • an anti-14-3-3 antibody of the invention is capable of specifically binding to 14-3-3 protein in its natural 3-D configuration.
  • By specifically binding to a 14-3-3 protein in its “natural configuration” is meant an ability to bind to 14-3-3 protein as encountered in vivo. This may be evidenced, for example, by the ability of antibody to immunoprecipitate 14-3-3 eta protein from a biological sample.
  • an anti-14-3-3 eta antibody of the invention is capable of binding to 14-3-3 protein that is aberrantly localized in the extracellular synovial space in arthritis. This may be evidenced, for example, by immunoprecipitation of 14-3-3 protein present in a synovial fluid sample from a patient having arthritis.
  • an anti-14-3-3 antibody of the invention is capable of discriminating between 14-3-3 protein isoforms.
  • Such antibodies have an ability to bind specifically to a particular 14-3-3 protein isoform and bind preferentially to that isoform over other 14-3-3 protein isoforms under the same conditions. This may be evidenced, for example, using an ELISA assay, which may be done using, for example, supernatant from hybridoma clones.
  • a control e.g., pre-immune serum is preferably used.
  • a “selective” antibody is capable of recognizing a particular 14-3-3 isoform and generating a higher signal against that isoform as compared to other isoforms, preferably at least a 1.5 fold, more preferably at least a 2 fold higher signal as compared to other isoforms.
  • a selective antibody has an ability to selectively immunoprecipitate the particular 14-3-3 eta as compared to other 14-3-3 isoforms.
  • the anti-14-3-3 antibody exhibits such selectivity for 14-3-3 eta protein over 14-3-3 alpha, beta, delta, epsilon, gamma, tau, and zeta proteins. This may be evidenced, for example, by ELISA.
  • the anti-14-3-3 antibody exhibits such selectivity for 14-3-3 gamma protein over 14-3-3 alpha, beta, delta, epsilon, eta, tau, and zeta proteins. This may be evidenced, for example, by ELISA.
  • an anti-14-3-3 antibody of the invention is a 14-3-3 antagonist, though other anti-14-3-3 antibodies are also contemplated within the scope of the invention.
  • an anti-14-3-3 antibody is capable of inhibiting the induction of MMP by 14-3-3 protein, particularly 14-3-3 gamma or 14-3-3 eta.
  • the MMP is selected from the group consisting of MMP-1, 3, 8, 9, 10, 11 and 13, with MMP-1 and MMP-3 being especially preferred.
  • Such capability may be determined by an in vitro assay or in vivo assay.
  • the assays will be designed such that in the absence of anti-14-3-3 antibody, the presence of 14-3-3 protein will result in the induction of MMP. An ability to reduce this induction of MMP by 143-3 protein can evidence such a function-inhibiting capability for an anti-14-3-3 antibody.
  • the invention provides anti-14-3.3 eta antibodies.
  • the anti-14-3-3 eta antibody binds to a 14-3-3 peptide comprising a segment of the amino acid sequence set forth in SEQ ID NO:63.
  • the segment is at least 6, more preferably at least 7, more preferably at least 8 amino acids in length.
  • an anti-14-3-3 eta antibody of the invention does not bind to an epitope located at the N-terminus of the human 14-3-3 eta protein.
  • an anti-14-3-3 eta antibody binds to a 14-3-3 peptide that is a 14-3-3 eta loop peptide.
  • the 14-3-3 eta loop peptide comprises an amino acid sequence selected from the group consisting of SEQ ID NOs:11-16.
  • the 14-3-3 eta loop peptide consists essentially of an amino acid sequence selected from the group consisting of SEQ ID NOs:11-16.
  • an anti-14-3-3 eta antibody binds to a region of 14-3-3 eta that overlaps with an amino acid sequence corresponding to a sequence selected from the group consisting of SEQ ID NOs:11-16.
  • an anti-14-3-3 eta antibody binds to a 14-3-3 peptide that is a 14-3-3 eta helix peptide.
  • the 14-3-3 eta helix peptide comprises an amino acid sequence selected from the group consisting of SEQ ID NOs:1-10.
  • the 14-3-3 eta helix peptide consists essentially of an amino acid sequence selected from the group consisting of SEQ ID NOs:1-10.
  • an anti-14-3-3 eta antibody binds to a region of 14-3-3 eta that overlaps with an amino acid sequence corresponding to a sequence selected from the group consisting of SEQ ID NOs:1-10.
  • an anti-14-3-3 eta antibody binds to a 14-3-3 peptide that is a non-helix 14-3-3 eta peptide.
  • the non-helix 14-3-3 eta peptide comprises an amino acid sequence selected from the group consisting of SEQ ID NOs:17-32.
  • the non-helix 14-3-3 eta peptide consists essentially of an amino acid sequence selected from the group consisting of SEQ ID NOs:17-32.
  • an anti-14-3-3 eta antibody binds to a region of 14-3-3 eta that overlaps with an amino acid sequence corresponding to a sequence selected from the group consisting of SEQ ID NOs:17-32.
  • an anti-14-3-3 eta antibody of the invention binds to an amino acid sequence selected from the group consisting of LDKFLIKNSNDF (SEQ ID NO:30), KKLEKVKAYR (SEQ ID NO:31), and KNSVVEASEAAYKEA (SEQ ID NO:32).
  • Exemplary 14-3-3 eta loop, helix, and non-helix peptides are disclosed in Table 1 herein.
  • SEQ ID NO:30 varies from corresponding 14-3-3 eta sequence in that a cysteine occurring in 14-3-3 eta sequence has been replaced by serine to avoid disulfide bond formation.
  • the invention provides antibodies that also bind to the natural 14-3-3 sequence correlate of SEQ ID NO:30 comprising a cysteine.
  • the invention provides antibodies capable of binding to peptide sequences that vary from those listed in the epitope tables herein by substitution of serine for cysteine.
  • the invention provides anti-14-3-3 gamma antibodies.
  • the anti-14-3-3 gamma antibody binds to a 14-3-3 peptide comprising a segment of the amino acid sequence set forth in SEQ ID NO:84.
  • the segment is at least 6, more preferably at least 7, more preferably at least 8 amino acids in length.
  • an anti-14-3-3 gamma antibody binds to a 14-3-3 peptide that is a 14-3-3 gamma loop peptide.
  • the 14-3-3 gamma loop peptide comprises an amino acid sequence selected from the group consisting of SEQ ID NOs:44-49.
  • the 14-3-3 gamma loop peptide consists essentially of an amino acid sequence selected from the group consisting of SEQ ID NOs:44-49.
  • an anti-14-33 gamma antibody binds to a region of 14-3-3 gamma that overlaps with an amino acid sequence corresponding to a sequence selected from the group consisting of SEQ ID NOs:44-49.
  • an anti-14-3-3 gamma antibody binds to a 14-3-3 peptide that is a 14-3-3 gamma helix peptide.
  • the 14-3-3 gamma helix peptide comprises an amino acid sequence selected from the group consisting of SEQ ID NOs:33-43.
  • the 14-3-3 gamma helix peptide consists essentially of an amino acid sequence selected from the group consisting of SEQ ID NOs:33-43.
  • an anti-14-3-3 gamma antibody binds to a region of 14-3-3 gamma that overlaps with an amino acid sequence corresponding to a sequence selected from the group consisting of SEQ ID NOs:33-43.
  • an anti-14-3-3 gamma antibody binds to a 14-3-3 peptide that is a non-helix 14-3-3 gamma peptide.
  • the non-helix 14-3-3 gamma peptide comprises an amino acid sequence selected from the group consisting of SEQ ID NOs:50-62.
  • the non-helix 14-3-3 gamma peptide consists essentially of an amino acid sequence selected from the group consisting of SEQ ID NOs:50-62.
  • an anti-14-3-3 gamma antibody binds to a region of 14-3-3 gamma that overlaps with an amino acid sequence corresponding to a sequence selected from the group consisting of SEQ ID NOs:50-62.
  • the present disclosure provides monoclonal antibodies that specifically bind to 14-3-3 eta protein, as wall as monoclonal antibodies that specifically bind to 14-3-3 gamma protein. Also provided are hybridoma cell lines capable of producing such antibodies.
  • the invention provides monoclonal anti-14-3-3 eta antibodies that bind to a 14-3-3 eta loop, helix, or non-helix peptide.
  • the peptide comprises an amino acid sequence selected from the group consisting of SEQ ID NOs:1-32.
  • the invention provides anti-14-3-3 eta monoclonal antibodies that specifically bind to an amino acid sequence selected from the group consisting of LDKFLIKNSNDF (SEQ ID NO:30), KKLEKVKAYR (SEQ ID NO:31), and KNSVVEASEAAYKEA (SEQ ID NO:32). Also provided are hybridoma cell lines capable of producing such antibodies.
  • the invention provides hybridomas produced by fusion of a spleen cell derived from a mouse immunized with an immunogen comprising a 14-3-3 eta loop, helix, or non-helix peptide.
  • the peptide comprises an amino acid sequence selected from the group consisting of SEQ ID NOs:1-32.
  • the invention provides hybridomas produced by fusion of spleen cells derived from mice immunized with an immunogen comprising LDKFLIKNSNDF (SEQ ID NO:30), KKLEKVKAYR (SEQ ID NO:31), or KNSVVEASEAAYKEA (SEQ ID NO:32). Also provided are monoclonal antibodies produced by such hybridomas.
  • the invention provides monoclonal anti-14-3-3 gamma antibodies that bind to a 14-3-3 gamma loop, helix, or non-helix peptide.
  • the peptide comprises an amino acid sequence selected from the group consisting of SEQ ID NOs:33-62. Also provided are hybridoma cell lines capable of producing such antibodies.
  • the invention provides hybridomas produced by fusion of a spleen cell derived from a mouse immunized with an immunogen comprising a 14-3-3 gamma loop, helix, or non-helix peptide.
  • the peptide comprises an amino acid sequence selected from the group consisting of SEQ ID NOs:33-62. Also provided are monoclonal antibodies produced by such hybridomas.
  • the present disclosure further provides methods of producing such monoclonal antibodies, or derivatives thereof, comprising cultivating a hybridoma of the invention under suitable conditions, whereby a monoclonal antibody is produced, and obtaining the antibody and/or derivative thereof from the cell and/or from the cell culture medium.
  • Antibodies can be produced readily by one skilled in the art.
  • the general methodology for making monoclonal antibodies by hybridomas is now well known to the art. See, e.g., M. Schreier et al., Hybridoma Techniques (Cold Spring Harbor Laboratory) 1980; Hammerling et al., Monoclonal Antibodies and T-Cell Hybridomas (Elsevier Biomedical Press) 1981.
  • these methods comprise cultivating a hybridoma cell under suitable conditions wherein the antibody is produced; and obtaining the antibody and/or derivative thereof from the cell and/or from the cell culture medium.
  • the present invention also contemplates the use of phage libraries to pan for antibodies capable of binding to the 14-3-3 peptides of interest described herein. For example, see Konthur et al., Targets, 1: 30-36, 2002.
  • the antibodies produced by any means can be purified by methods known to the skilled artisan. Purification methods include, among others, selective precipitation, liquid chromatography, HPLC, electrophoresis, chromatofocusing, and various affinity techniques. Selective precipitation may use ammonium sulfate, ethanol (Cohn precipitation), polyethylene glycol, or other agents available in the art.
  • Liquid chromatography mediums include, among others, ion exchange medium DEAE, polyaspartate, hydroxylapatite, site exclusion (e.g., those based on crosslinked agarose, acrylamide, dextran, etc.), hydrophobic matrices (e.g., Blue Sepharose).
  • Protein A from Staphylococcus aureas can be used to purify antibodies that are based on human ⁇ 1, ⁇ 2, or ⁇ 4 heavy chains (Lindmark et al., J. Immunol. Meth. 62:1-13 (1983)).
  • Protein G from C and G streptococci is useful for all mouse isotypes and for human ⁇ 3 puss et al., EMBO J. 5:15671575 (1986)).
  • Protein L a Peptostreptococcus magnus cell-wall protein that binds immunoglobulins (Ig) through k light-chain interactions (BD Bioscience/ClonTech.
  • IgM IgA
  • IgD IgG
  • IgE IgY
  • Recombinant forms of these proteins are also commercially available.
  • metal binding residues such as phage display antibodies constructed to contain histidine tags
  • metal affinity chromatography may be used.
  • antigen affinity matrices may be made with the cells to provide an affinity method for purifying the antibodies.
  • isolation involves affinity chromatography using an appropriate 14-3-3 protein or fragment thereof.
  • antibody fragment or “antigen-binding portion” of an antibody (or simply “antibody portion”) of the present invention, as used herein, refers to one or more fragments of an antibody that retain the ability to specifically bind to an antigen. It has been shown that the antigen-binding function of an antibody can be performed by fragments of a full-length antibody.
  • binding fragments encompassed within the term “antibody fragment” or “antigen-binding portion” of an antibody include (i) a Fab fragment, a monovalent fragment consisting of the VL, VH, CL and CH1 domains; (ii) a F(ab′)2 fragment, a bivalent fragment comprising two Fab fragments linked by a disulfide bridge at the hinge region; (iii) a Fd fragment consisting of the VH and CH1 domains; (iv) a Fv fragment consisting of the VL and VH domains of a single arm of an antibody, (v) a dAb fragment (e.g., Ward et al., (1989) Nature 341:544-546), which consists of a VH domain; and (vi) an isolated complementarity determining region (CDR), and (vii) bispecific single chain Fv dimers (e.g., PCT/US92/09965).
  • a Fab fragment a monovalent fragment consisting of the V
  • the two domains of the Fv fragment, VL and VH are coded for by separate genes, they can be joined, using recombinant methods, by a synthetic linker that enables them to be made as a single protein chain in which the VL and VH regions pair to form monovalent molecules (known as single chain Fv (scFv); see e.g., Bird et al. (1988) Science 242:423-425; and Huston et al. (1988) Proc. Natl. Acad. Sci. USA 85:5879-5883).
  • single chain Fv single chain Fv
  • Such single chain antibodies are also intended to be encompassed within the term “antigen-binding portion” of an antibody.
  • antibody fragments are obtained using conventional techniques known to those with skill in the art, and the fragments are screened for utility in the same manner as are intact antibodies.
  • the antibody fragments may be modified.
  • the molecules may be stabilized by the incorporation of disulphide bridges linking the VH and VL domains (Reiter et al., 1996, Nature Biotech. 14:1239-1245).
  • Immunoglobulin molecules can be cleaved into fragments.
  • the antigen binding region of the molecule can be divided into either F(ab′)2 or Fab fragments.
  • the F(ab′)2 fragment is divalent and is useful when the Fc region is either undesirable or not a required feature.
  • the Fab fragment is univalent and is useful when an antibody has a very high avidity for its antigen. Eliminating the Fc region from the antibody decreases non-specific binding between the Fc region and Fc receptor bearing cells.
  • the antibodies are digested with an enzyme.
  • proteases that cleave at the hinge region of an immunoglobulin molecule preserve the disulfide bond(s) linking the Fab domains such that they remain together following cleavage.
  • a suitable protease for this purpose is pepsin.
  • proteases are chosen such that cleavage occurs above the hinge region containing the disulfide bonds that join the heavy chains but which leaves intact the disulfide bond linking the heavy and light chain.
  • a suitable protease for making Fab fragments is papain. The fragments are purified by the methods described above, with the exception of affinity techniques requiring the intact Fc region (e.g., Protein A affinity chromatography).
  • Antibody fragments can be produced by limited proteolysis of antibodies and are called proteolytic antibody fragments. These include, but are not limited to, the following: F(ab′)2 fragments, Fab′ fragments, Fab′-SH fragments, and Fab fragments. “F(ab′)2 fragments” are released from an antibody by limited exposure of the antibody to a proteolytic enzyme, e.g., pepsin or ficin. An F(ab′)2 fragment comprises two “arms,” each of which comprises a variable region that is directed to and specifically binds a common antigen.
  • Fab′ fragments contain a single antigen-binding domain comprising an Fab and an additional portion of the heavy chain through the hinge region.
  • Fab′-SH fragments are typically produced from F(ab′)2 fragments, which are held together by disulfide bond(s) between the H chains in an F(ab′)2 fragment.
  • Fab′-SH fragments are monovalent and monospecific.
  • Fab fragments i.e., an antibody fragment that contains the antigen-binding domain and comprises a light chain and part of a heavy chain bridged by a disulfide bond
  • a convenient method is to use papain immobilized on a resin so that the enzyme can be easily removed and the digestion terminated.
  • Fab fragments do not have the disulfide bond(s) between the H chains present in an F(ab′)2 fragment.
  • Single-chain antibodies are one type of antibody fragment.
  • the term single chain antibody is often abbreviated as “scFv” or “sFv.” These antibody fragments are produced using recombinant DNA technology.
  • a single-chain antibody consists of a polypeptide chain that comprises both a V H and a V L domains which interact to form an antigen-binding site. The V H and V L domains are usually linked by a peptide of 10 to 25 amino acid residues.
  • single-chain antibody further includes but is not limited to a disulfide-linked Fv (dsFv) in which two single-chain antibodies (each of which may be directed to a different epitope) are linked together by a disulfide bond; a bispecific sFv in which two discrete scFvs of different specificity are connected with a peptide linker; a diabody (a dimerized sFv formed when the V H domain of a first sFv assembles with the V L domain of a second sFv and the V L domain of the first sFv assembles with the V H domain of the second sFv; the two antigen-binding regions of the diabody may be directed towards the same or different epitopes); and a triabody (a trimerized sFv, formed in a manner similar to a diabody, but in which three antigen-binding domains are created in a single complex; the three antigen binding domains
  • CDR peptides are another form of an antibody fragment.
  • the invention provides such CDR peptides that are 14-3-3 antagonists.
  • a CDR peptide also known as “minimal recognition unit” is a peptide corresponding to a single complementarity-determining region (CDR), and can be prepared by constructing genes encoding the CDR of an antibody of interest. Such genes are prepared, for example, by using the polymerase chain reaction to synthesize the variable region from RNA of antibody-producing cells. See, for example, Larrick et al., Methods: A Companion to Methods in Enzymology 2:108, 1991.
  • cysteine-modified antibodies a cysteine amino acid is inserted or substituted on the surface of antibody by genetic manipulation and used to conjugate the antibody to another molecule via, e.g., a disulfide bridge. Cysteine substitutions or insertions for antibodies have been described (see U.S. Pat. No. 5,219,996). Methods for introducing Cys residues info the constant region of the IgG antibodies for use in site-specific conjugation of antibodies are described byskyl et al. (J. Biol. Chem. 275:330445-30450, 2000).
  • the present disclosure further provides humanized and non-humanized antibodies.
  • Humanized forms of non-human (e.g., mouse) antibodies are chimeric antibodies that contain minimal sequence derived from non-human immunoglobulin.
  • humanized antibodies are non-human antibodies that have had the variable-domain framework regions swapped for sequences found in human antibodies.
  • the humanized antibodies may be human immunoglobulins (recipient antibody) in which residues from a hypervariable region of the recipient are replaced by residues from a hypervariable region of a non-human species (donor antibody) such as mouse, rat, rabbit or nonhuman primate having the desired specificity, affinity, and capacity.
  • donor antibody such as mouse, rat, rabbit or nonhuman primate having the desired specificity, affinity, and capacity.
  • framework region (FR) residues of the human immunoglobulin are replaced by corresponding non-human residues.
  • humanized antibodies may comprise residues that are not found in the recipient antibody or in the donor antibody. These modifications are made to further refine antibody performance.
  • the humanized antibody will comprise substantially all of at least one, and typically two, variable domains, in which all or substantially all of the hypervariable loops correspond to those of a non-human immunoglobulin and all or substantially all of the FRs are those of a human immunoglobulin sequence.
  • the humanized antibody optionally also will comprise at least a portion of an immunoglobulin constant region (Fc), typically that of a human immunoglobulin.
  • Fc immunoglobulin constant region
  • a humanized antibody the entire antibody, except the CDRs, is encoded by a polynucleotide of human origin or is identical to such an antibody except within its CDRs.
  • the CDRs some or all of which are encoded by nucleic acids originating in a non-human organism, are grafted into the beta-sheet framework of a human antibody variable region to create an antibody, the specificity of which is determined by the engrafted CDRs.
  • the creation of such antibodies is described in, e.g., WO 92/11018, Jones, 1986, Nature 321:522-525, Verhoeyen et al., 1988, Science 239:1534-1536.
  • Humanized antibodies can also be generated using mice with a genetically engineered immune system. e.g., Roque et al., 2004, Biotechnol. Prog. 20:639-654.
  • cysteine residue(s) can be introduced into the Fc region, thereby allowing interchain disulfide bond formation, in this region.
  • Homodimeric antibodies can also be prepared using heterobifunctional cross-linkers, e.g., Wolff et al. Cancer Research, 53:2560-2565 (1993).
  • an antibody can be engineered that has dual Fc regions. See for example Stevenson et al., Anti-Cancer Drug Design, 3:219-230 (1989).
  • the present invention provides 14-3-3 antibodies that are modified antibodies which are derived from an antibody that specifically binds a 14-3-3 protein. Modified antibodies also include recombinant antibodies as described herein.
  • modified or recombinant antibodies include, without limitation, engineered monoclonal antibodies (e.g. chimeric monoclonal antibodies, humanized monoclonal antibodies), domain antibodies (e.g. Fab; Fv, VH, scFV, and dsFv fragments), multivalent or multispecific antibodies (e.g. diabodies, minibodies, miniantibodies, (scFV)2, tribodies, and tetrabodies), and antibody conjugates as described herein.
  • engineered monoclonal antibodies e.g. chimeric monoclonal antibodies, humanized monoclonal antibodies
  • domain antibodies e.g. Fab; Fv, VH, scFV, and dsFv fragments
  • multivalent or multispecific antibodies e.g. diabodies, minibodies, miniantibodies, (scFV)2, tribodies, and tetrabodies
  • antibody conjugates as described herein.
  • the present invention provides anti-14-3-3 antibodies which are domain antibodies.
  • “Domain antibodies” are functional binding domains of antibodies, corresponding to the variable regions of either the heavy (VH) or light (VL) chains of human antibodies. Domain antibodies may have a molecular weight of approximately 13 kDa, or less than one-tenth the size of a full antibody. They are well expressed in a variety of hosts including bacterial, yeast, and mammalian cell systems. In addition, domain antibodies are highly stable and retain activity even after being subjected to harsh conditions, such as freeze-drying or heat denaturation. See, for example, U.S. Pat. No. 6,291,1513; 6,582,915; 9,593,081; 6,172,197; US Serial No.
  • the domain antibody of the present invention is a single domain.
  • Single domain antibodies may be prepared, for example, as described in U.S. Pat. No. 6,248,516.
  • the present invention includes multi-specific antibodies.
  • Multi-specific antibodies include bispecific, trispecific, etc. antibodies.
  • Bispecific antibodies can be produced via recombinant means, for example by using leucine zipper moieties (i.e., from the Fos and Jun proteins, which preferentially form heterodimers; e.g., Kostelny et al., 1992, J. Immunol. 148:1547) or other lock and key interactive domain structures, for example as described in U.S. Pat. No. 5,582,996. Additional useful techniques include those described in U.S. Pat. No. 5,959,083; and U.S. Pat. No. 5,807,706.
  • Bispecific antibodies are also sometimes referred to as “diabodies.” These are antibodies that bind to two (or more) different antigens. Also known in the art are triabodies (a trimerized sFv, formed in a manner similar to a diabody, but in which three antigen-binding domains are created in a single complex; the three antigen binding domains may be directed towards the same or different epitopes) or tetrabodies (four antigen-binding domains created in a single complex where the four antigen binding domains may be directed towards the same or different epitopes).
  • triabodies a trimerized sFv, formed in a manner similar to a diabody, but in which three antigen-binding domains are created in a single complex; the three antigen binding domains may be directed towards the same or different epitopes
  • tetrabodies four antigen-binding domains created in a single complex where the four antigen binding domains may be directed towards the same or different epitope
  • Dia-, tria- and tetrabodies can be manufactured in a variety of ways known in the art (e.g., Holliger and Winter, 1993, Current Opinion Biotechnol. 4:446-449), e.g., prepared chemically or from hybrid hybridomas.
  • such antibodies and fragments thereof may be constructed by gene fusion (e.g., Tomlinson et. al., 2000, Methods Enzymol. 326:461-479: WO94/13804: Holliger et al., 1993, Proc. Natl. Acad. Sci. U.S.A. 90; 6444-6448).
  • the present invention provides minibodies, which are minimized antibody-like proteins that include a scFV joined to a CH3 domain, that are derived from an antibody that specifically binds 14-3-3 protein.
  • Minibodies can be made as described in the art (e.g., Hu et al., 1996, Cancer Res. 56:3055-3061).
  • the present invention provides 14-3-3 binding domain-immunglobulin fusion proteins.
  • the fusion protein may include a 14-3-3 binding domain polypeptide fused to an immunoglobulin hinge region polypeptide, which is fused to an immunoglobulin heavy chain CH2 constant region polypeptide fused to an immunoglobulin heavy chain CH3 constant region polypeptide.
  • 14-3-3 antibody fusion proteins can be made by methods appreciated by those of skill in the art (See for example published U.S. Patent Application Nos. 20050238646, 20050202534, 20050202028, 2005020023. 2005020212, 200501866216, 20050180970, and 20050175614).
  • the present invention provides a heavy-chain protein derived from a 14-3-3 antibody.
  • Naturally-occurring heavy chain antibodies e.g. camelidae antibodies having no light chains
  • Heavy chain proteins derived from a 14-3-3 heavy chain antibody may be made by methods appreciated by those of skill in the art (See for example published U.S. Patent Application Nos: 20060246477, 20060211088, 20060149041, 20060115470, and 20050214857). Further, regarding the production of heavy chain-only antibodies in light chain-deficient mice, see for example Zou et al., JEM, 204:3271-3283, 2007.
  • the present invention provides a modified antibody that is a human antibody.
  • fully human 14-3-3 antibodies are provided.
  • Fully human antibody or “complete human antibody” refers to a human antibody having only the gene sequence of an antibody derived from a human chromosome.
  • the anti-14-3-3 complete human antibody can be obtained by a method using a human antibody-producing mouse having, a human chromosome fragment containing the genes for a heavy chain and light chain of a human antibody [see for example Tomizuka, K. et al., Nature Genetics, 16, p. 133-143, 1997; Kuroiwa, Y. et al., Nuc. Acids Res., 26, p.
  • the present invention provides a 14-3-3 antibody that is an antibody analog, sometimes referred to as “synthetic antibodies.”
  • synthetic antibodies include, but are not limited to, synthetic scaffolds consisting, for example, of biocompatible polymers. See, for example, Korndorfer et al., 2003, Proteins: Structure, Function, and Bioinformatics, Volume 53, Issue 1:121-129. Rogue et al., 2004, Biotechnol. Prog. 20:639-654.
  • PAMs peptide antibody mimetics
  • the present invention provides cross-linked antibodies that include two or more antibodies described herein attached to each other to form antibody complexes.
  • Cross-linked antibodies are also referred to as antibody multimers, homoconjugates, and heteroconjugates.
  • the antibody complexes provided herein include multimeric forms of anti-14-3-3 antibodies.
  • antibody complexes of the invention may take the form of antibody dimers, trimers, or higher-order multimers of monomeric immunoglobulin molecules.
  • Crosslinking of antibodies can be done through various methods know in the art. For example, crosslinking of antibodies may be accomplished through natural aggregation of antibodies, through chemical or recombinant linking techniques or other methods known in the art. For example, purified antibody preparations can spontaneously form protein aggregates containing antibody homodimers, and other higher-order antibody multimers.
  • the present invention provides homodimerized antibodies that specifically bind to 14-3-3 antigen.
  • Antibodies can be cross-linked or dimerized through linkage techniques known in the art. Non-covalent methods of attachment may be utilized. In a specific embodiment, crosslinking of antibodies can be achieved through the use of a secondary crosslinker antibody.
  • the crosslinker antibody can be derived from a different animal compared to the antibody of interest. For example, a goat anti-mouse antibody (Fab specific) may be added to a mouse monoclonal antibody to form a heterodimer. This bivalent crosslinker antibody recognizes the Fab or Fc region of the two antibodies of interest forming a homodimer.
  • an antibody that specifically binds to 14-3-3 antigen is cross-linked using a goat anti-mouse antibody (GAM).
  • GAM goat anti-mouse antibody
  • the GAM crosslinker recognizes the Fab or Fc region of two antibodies, each of which specifically binds a 14-3-3 antigen.
  • Chemical crosslinkers can be homo or heterobifunctional and will covalently bind with two antibodies forming a homodimer.
  • Cross-linking agents are well known in the art; for example, home- or hetero-bifunctional linkers as are well known (see the 2006 Pierce Chemical Company Crosslinking Reagents Technical Handbook; Hermanson, G. T., Bioconjugate Techniques, Academic Press, San Diego, Calif. (1996); Aslam M.
  • Suitable examples of chemical crosslinkers used for antibody crosslinking include, but not limited to, SMCC [succinimidyl 4-(maleimidomethyl)cyclohexane-1-carboxylate], SATA [N-succinimidyl S-acethylthio-acetate], hemi-succinate esters of N-hydroxysuccinimide; sulfo-N-hydroxy-succinimide; hydroxybenzotriazole, and p-nitrophenol; dicyclohexylcarbodiimide (DCC), 1-(3-dimethylaminopropyl)-3-ethylcarbodiimide (ECU), and 1-(3-dimethylaminopropyl)-3-ethylcarbodiimide methiodide (EDCl) (see, e.g., U.S.
  • DCC dicyclohexylcarbodiimide
  • ECU 1-(3-dimethylaminopropyl
  • linking reagents include glutathione, 3-(diethoxyphosphoryloxy)-1,2,3-benzotriazin-4(3H)-one (DEPBT), onium salt-based coupling reagents, polyoxyethylene-based heterobifunctional cross-linking reagents, and other reagents (Haltao, et al., Organ Lett 1:91-94 (1999); Albericio et al., J Organic Chemistry 63:9678-9683 (1998); Arpicco et al., Bioconjugate Chem. 8:327-337 (1997); Frisch et al., Bioconjugate Chem.
  • the antibody-antibody conjugates of this invention can be covalently bound to each other by techniques known in the art such as the use of the heterobifunctional cross-linking reagents, GMBS (maleimidobutryloxy succinimide), and SPDP (N-succinimidyl 3-(2-pyridyldithio)propionate) [see, e.g., Hardy, “Purification And Coupling Of Fluorescent Proteins For Use in Flow Cytometry”, Handbook Of Experimental Immunology, Volume 1, Immunochemistry, Weir et al. (eds.), pp. 31.4-31.12 4th Ed., (1986), and Ledbetter et al. U.S. Pat. No. 6,010,902].
  • GMBS maleimidobutryloxy succinimide
  • SPDP N-succinimidyl 3-(2-pyridyldithio)propionate
  • antibodies may be linked via a thioether cross-link as described in U.S. Patent Publication 20060216284, U.S. Pat. No. 6,368,596.
  • antibodies can be crosslinked at the Fab region.
  • the 14-3-3 antagonists disclosed herein include antibodies conjugated to inorganic or organic compounds, including, by way of example and not limitation, other proteins, nucleic acids, carbohydrates, steroids, and lipids (see for example Green, et al., Cancer Treatment Reviews, 20:209-286 (2000).
  • the compound may be bioactive. Bioactive refers to a compound having a physiological effect on the cell as compared to a cell not exposed to the compound. A physiological effect is a change in a biological process, including, by way of example and not limitation, DNA replication and repair, recombination, transcription, translation, secretion, membrane turnover, cell adhesion, signal transduction, cell death, and the like.
  • a bioactive compound includes pharmaceutical compounds.
  • a 14-3-3 antibody is conjugated to a 14-3-3 antagonist peptide, preferably R-18, preferably via a linker.
  • the invention provides 14-3-3 antagonists that are peptides.
  • Such peptides include CDR peptides.
  • the peptide binds to a region of the 14-3-3 protein that is capable of binding to an anti-14-3-3 antibody or other 14-3-3 antagonist peptide.
  • the term “peptide” or “oligopeptide” as used herein is meant to encompass peptide analogs, derivatives, fusion proteins and the like, as well as peptide compositions, including those exemplified in the present disclosure.
  • the peptide comprises the amino acid sequence designated “R-18”. In another preferred embodiment, the peptide consists essentially of the R-18 sequence.
  • the peptide comprises a segment of the R-18 sequence. In another preferred embodiment, the peptide comprises multiple iterations of the R-18 sequence, preferably separated by a linker.
  • the peptide binds to a region of a 14-3-3 protein that is capable of binding to R-18. In another preferred embodiment, the peptide binds to a region of a 14-3-3 protein that is capable of binding to an intracellular 14-3-3 binding partner, preferably Raf.
  • the peptide binds to a 14-3-3 protein without disrupting binding of the 14-3-3 protein to an intracellular 14-3-3 binding partner.
  • the 14-34 antagonist is a phosphopeptide.
  • the subject peptides may be modified in a variety of conventional ways well known to the skilled artisan. Any number of modifications may be done to achieve a peptide having desired characteristics. What is required of a peptide of the invention is that it retain the ability to function as a 14-3-3 antagonist.
  • modifications include the following.
  • the terminal amino group and/or carboxyl group of the peptide and/or amino acid side chains may be modified by alkylation, amidation, or acylation to provide esters, amides or substituted amino groups.
  • Heteroatoms may be included in ‘aliphatic Modifying’ groups. This is done using conventional chemical synthetic methods.
  • Other modifications include deamination of glutamyl and asparaginyl residues to the corresponding glutamyl and aspartyl residues, respectively; hydroxylation of proline and lysine; phosphorylation of hydroxyl groups of serine or threonine; and methylation of amino groups of lysine, arginine, and histidine side chains (see, for example, T. E. Creighton, Proteins: Structure and Molecular Properties, W.H. Freeman & Co. San Francisco, Calif., 1983).
  • one or both, usually one terminus of the peptide may be substituted with a lipophilic group, usually aliphatic or aralkyl group, which may include heteroatoms. Chains may be saturated or unsaturated.
  • aliphatic fatty acids, alcohols and amines may be used, such as caprylic acid, capric acid, lauric acid, myristic acid and myristyl alcohol, palmitic acid, paimitoleic acid, stearic acid and stearyl amine, oleic acid, linoleic acid, docosahexaenoic acid, etc. (see U.S. Pat. No. 6,225,444).
  • Lipophilic molecules include glyceryl lipids and sterols, such as cholesterol.
  • the lipophilic groups may be reacted with the appropriate functional group on the oligopeptide in accordance with conventional methods, frequently during the synthesis on a support, depending on the site of attachment of the oligopeptide to the support. Lipid attachment is useful where oligopeptides may be introduced into the lumen of the liposome, along with other therapeutic agents for administering the peptides and agents into a host.
  • either or both the N- and C-terminus of the peptide may be extended by not more than a total of about 100, usually not more than a total of about 30, more usually not more than about 20 amino acids, often not more than about 9 amino acids, where the amino acids will have fewer than 25%, more usually fewer than 20% polar amino acids, more particularly, fewer than 20% which are charged amino acids.
  • extensions of the above sequences in either direction are mainly done with lipophilic, uncharged amino acids, particularly non-polar aliphatic amino acids and aromatic amino acids.
  • the peptides may comprise L-amino acids, D-amino acids, or mixtures of D- and L-amino acids. Exceptions to the number of amino acid extensions are contemplated when the oligopeptides are expressed as fusion or chimeric proteins, as described below.
  • the peptides may also be in the form of oligomers, especially dimers of the peptides, which may be head to head, tail to tail, or head to tail, preferably with not more than about 6 repeats of the peptide.
  • the oligomer may contain, one or more D-stereoisomer amino acids, up to all of the amino acids.
  • the oligomers may or may not include linker sequences between the peptides.
  • Suitable linkers include, but are not limited to, those comprising uncharged amino acids and (Gly)n, where n is 1-7, Gly-Ser (e.g., (GS) n , (GSGGS) n and (GGGS) n , where n is at feast 1), Gly-Ala, Ala-Ser, or other flexible linkers, as known in the art.
  • Gly-Ser e.g., (GS) n , (GSGGS) n and (GGGS) n , where n is at feast 1
  • Gly-Ser e.g., (GS) n , (GSGGS) n and (GGGS) n , where n is at feast 1
  • Gly-Ser e.g., (GS) n , (GSGGS) n and (GGGS) n , where n is at feast 1
  • Gly-Ala e.g., Ala-Ser
  • Peptides may also be in a structurally constrained form, such as cyclic peptides, preferably of from about 9-50, usually 12 to 38 amino acids, where amino acids other than the specified amino acids may be present as a bridge.
  • cyclic peptides preferably of from about 9-50, usually 12 to 38 amino acids, where amino acids other than the specified amino acids may be present as a bridge.
  • addition of terminal cysteines allows formation of disulfide bridges to form a ring peptide.
  • one may use other than amino acids to cyclize the peptide.
  • Bifunctional crosslinking agents are useful in linking two or more amino acids of the peptide.
  • Other methods for ring formation are known in the art, see for example Chen, S. et al., Proc. Natl. Acad. Sci. USA 89:5872-5876 (1992); Wu, T. P.
  • structurally constrained peptides are made by addition of dimerization sequences to the N- and C-terminal ends of the peptide, where interaction between dimerization sequences lead to formation of a cyclic type structure (see, e.g., WO/0166566).
  • the subject peptides are expressed as fusions to other proteins, which provide a scaffold for constrained display on a surface exposed structure, such as a loop of a coiled-coil or ⁇ -turn structure.
  • the subject peptides may also be modified by attachment to other compounds for the purposes of incorporation into carrier molecules, changing peptide bioavailability, extending or shortening half-life, controlling distribution to various tissues or the blood stream, diminishing or enhancing binding to blood components, and the like.
  • the subject peptides may be bound to these other components by linkers which are cleavable or non-cleavable in the physiological environment, e.g., by MMPs in the synovium.
  • the peptides may be joined at any point of the peptide where a functional group is present, such as hydroxyl, thiol, carboxyl, amino, or the like.
  • modification will be at either the N-terminus or the C-terminus.
  • the subject peptides may be modified by covalently attaching polymers, such as polyethylene glycol, polypropylene glycol, carboxymethyl cellulose, dextran, polyvinyl alcohol, polyvinylpyrrolidine, polyproline, poly(divinyl-ether-co-maleic anhydride), poly(styrene-c-maleic anhydride), etc.
  • Water-soluble polymers such a polyethylene glycol and polyvinyl pyrrolidine are known to decrease clearance of attached compounds from the blood stream as compared to unmodified compounds.
  • the modifications can also increase solubility in aqueous media and reduce aggregation of the peptides. What is required is that the peptide, when delivered and/or released, retains 14-3-3 antagonist function.
  • the peptide is conjugated to small molecules for detection and isolation of the peptides, or to target or transport the oligopeptide to specific cells, tissues, or Organs.
  • Small molecule conjugates include haptens, which are substances that do not initiate an immune response when introduced by themselves into an animal. Generally, haptens are small molecules of molecular weight less than about 2 kD, and more preferably less that about 1 kD. Haptens include small organic molecules (e.g., p-nitrophenol, digoxin, heroin, cocaine, morphine, mescaline, lysergic acid, tetrahydrocannabinol, cannabinol, steroids, pentamidine, biotin, etc.). Binding to the hapten, for example for purposes of detection or purification, are done with hapten specific antibodies or specific binding partners, such as avidin which binds biotin.
  • Small molecules that target the conjugate to specific cells or tissues may also be used.
  • the peptides are joined to any of a wide variety of other peptides or proteins for a variety of purposes.
  • the peptides may be linked to peptides or proteins to provide convenient functionalities for bonding, such as amino groups for amide or substituted amine formation, e.g., reductive amination; thiol groups for thioether or formation; carboxyl groups for amide formation; and the like.
  • peptides of at least 2, more usually 3, and not more than about 60 lysine groups, particularly polylysines of from about 4 to 20, usually 6 to 18 lysine units referred to as multiple antigenic peptide system (MAPS), where the subject peptides are bonded to the lysine amino groups, generally at least about 20%, more usually at least about 50%, of available amino groups, to provide a multipeptide product
  • MAPS multiple antigenic peptide system
  • the peptides are conjugated to other peptides or proteins for targeting the oligopeptide to cells and tissues, or adding additional functionalities to the peptides.
  • the protein or peptide used for conjugation will be selected based on the cell or tissue being targeted for therapy (Lee, R. et al., Arthritis. Rheum. 46: 2109-2120 (2002); Pasqualini, R., Q. J. Nucl. Med. 43: 159-62 (1999); Pasgualinl, R., Nature 380: 364-366 (1996)).
  • the proteins may also compromise poly-amino acids including, but not limited to, polyarginine; and polylysine, polyaspartic acid, etc., which may be incorporated into other polymers, such as polyethylene glycol, for preparation of vesicles or particles containing the conjugated peptides.
  • the subject peptides may be expressed or synthesized in conjunction with other peptides or proteins, to be a portion of the polypeptide chain, either internal, or at the N- or C-terminus to form chimeric proteins or fusion proteins.
  • fusion polypeptide or “fusion protein” or “chimeric protein” herein is meant a protein composed of a plurality of protein components that, while typically joined in the native state, are joined by the respective amino and carboxy termini through a peptide linkage to form a continuous polypeptide. It will be appreciated that the protein components can be joined directly or joined through a peptide linker/spacer.
  • Fusion polypeptides may be made to a variety of peptides or proteins to display the subject oligopeptides in a conformationally restricted form, for targeting to cells and tissues, for targeting to intracellular compartments, tracking the fusion protein in a cell or an organism, and screening for other molecules that bind the oligopeptides.
  • Proteins useful for generating fusion proteins include various reporter proteins, structural proteins, cell surface receptors, receptor ligands, toxins, and enzymes.
  • Exemplary proteins include fluorescent proteins (e.g., Aequodia victoria GFP, Renilla renifomis GRP, Renilla muelledi GFP, luciferases, etc., and variants thereof); ⁇ -galactosidase; alkaline phosphatase; E. coli . maltose binding protein; coat proteins of filamentous bacteriophage; T cell receptor; charybdotoxin; and the like.
  • fluorescent proteins e.g., Aequodia victoria GFP, Renilla renifomis GRP, Renilla muelledi GFP, luciferases, etc., and variants thereof
  • ⁇ -galactosidase alkaline phosphatase
  • E. coli . maltose binding protein coat proteins of filamentous bacteriophage
  • T cell receptor charybdotoxin
  • Fusion proteins also encompass fusions with fragments of proteins or other peptides, either alone or as part of a larger protein sequence.
  • the fusion polypeptides may comprise fusion partners.
  • fusion partners herein is meant a sequence that is associated with the peptide that confers all members of the proteins in that class a common function or ability. Fusion partners can be heterologous (i.e., not native to the host cell) or synthetic (i.e., not native to any cell).
  • the fusion partners include, but are not limited to, a) presentation structures, which provide the oligopeptides in a conformationally restricted or stable form; b) targeting sequences, which allow localization of the peptide to a subcellular or extracellular compartment; c) stability sequences, which affects stability or protection from degradation to the peptide or the nucleic acid encoding it; d) linker sequences, which conformationally decouples the oligopeptide from the fusion partner; and e) any combination of the above.
  • the fusion partner is a presentation structure.
  • presentation structure as used herein is meant a sequence that when fused to the subject peptides presents the peptides in a conformationally restricted form.
  • Preferred presentation structures enhance binding interactions with other binding partners by presenting a peptide on a solvent exposed exterior surface.
  • presentation structures comprise a first portion joined to the N-terminus of the oligopeptide and a second portion joined to the C-terminal end of the oligopeptide. That is, the peptide of the present invention is inserted into the presentation structures.
  • the presentation structures are selected or designed to have minimal biological activity when expressed in the target cells.
  • the presentation structures maximize accessibility to the peptides by displaying or presenting the peptide or an exterior loop.
  • Suitable presentation structures include, but are not limited to, coiled coil stem structures, minibody structures, loops on ⁇ -turns, dimerization sequences, cysteine linked structures, transglutaminase linked structures, cyclic peptides, helical barrels, leucine zipper motifs, etc.
  • the presentation structure is a coiled-coil structure, which allows presentation of the subject peptide on an exterior loop (e.g., Myszka, D. G. et al., Biochemistry 33: 2363-2373 (1994)), such as a coiled-coil leucine zipper domain (Martin, F. et al., EMBO J. 13: 5303-5309 (1994)).
  • the presentation structure may also comprise minibody structures, which, is essentially comprised of a minimal antibody complementary region.
  • the minibody structure generally provides two peptide regions that are presented along a single face of the tertiary structure in the folded protein (e.g., Bianchi, E. et al., J. Mol. Biol. 236: 649-659 (1994); Tramontano, A. et al., J. Mol. Recognit. 7: 9-24 (1994)).
  • the presentation structure comprises two dimerization sequences.
  • the dimerization sequences which can be same or different, associate non-covalently with sufficient affinity under physiological conditions to structurally constrain the displayed peptide.
  • a dimerization sequence is used at each terminus of the subject oligopeptide, the resulting structure can display the subject peptide in a structurally limited or constrained form.
  • a variety of sequences are suitable as dimerization sequences (see for example, WO 99/51625; incorporated by reference). Any number of protein-protein interaction sequences known in the art are useful for present purposes.
  • the presentation sequence confers the ability to bind metal ions to generate a conformationally restricted secondary structure.
  • C2H2 zinc finger sequences are used.
  • C2H2 sequences have two cysteines and two histidines placed such that a zinc ion is chelated.
  • Zinc finger domains are known to occur independently in multiple zinc-finger peptides to form structurally independent, flexibly linked domains (e.g., Nakaseko, Y. et al., J. Mol. Biol. 228: 619-636 (1992)).
  • a general consensus sequence is (5 amino acids)-C-(2 to 3 amino acids)-C-(4 to 12 amino acids)-H-(3 amino acids)-H-(5 amino acids) (SEQ ID NO:66).
  • a preferred example would be -FQCEEC-random peptide of 3 to 20 amino acids-HIRSHTG (SEQ ID NO:67).
  • CCHC boxes having a consensus sequence -C-(2 amino acids)-C-(4 to 20 random peptide)-H-(4 amino acids)-C- (SEQ ID NO:68) can be used, (Bavoso, A. et al., Biochem. Biophys. Res. Commun. 242: 385389 (1998)).
  • Examples include (1)-VKCFNC-4 to 20 random amino acids-HTARNCR- (SEQ ID NO: 69), based on the nucleocapsid protein P2; (2) a sequence modified from that of the naturally occurring zinc-binding peptide of the Lasp-1 LIM domain (Hammarstrom, A. et al., Biochemistry 35: 12723-32 (1996)); and (3) -MNPNCARCG-4 to 20 random amino acids-HKACF- (SEQ ID NO:70), based on the NMR structural ensemble IZFP (Hammarstrom et al., supra).
  • the presentation structure is a sequence that comprises two or more cysteine residues, such that a disulfide bond may be formed, resulting in a conformationally constrained structure. That is, use of cysteine containing peptide sequences at each terminus of the subject oligopeptides results in cyclic peptide structures, as described above.
  • a cyclic structure reduces susceptibility of the presented peptide to proteolysis and increases accessibility to its target molecules. As will be appreciated by those skilled in the art, this particular embodiment is particularly suited when secretory targeting sequences are used to direct the peptide to the extracellular space.
  • sequences that are recognized and cleaved by proteases such as the matrix metalloproteases (e.g., MMP-1, MMP-3), may be used. These residues are used to form circular peptides to increase peptide half-life or membrane permeability. Subsequent cleavage of the circular peptide with the appropriate protease releases the active, linear form of the peptide at the desired location.
  • proteases such as the matrix metalloproteases (e.g., MMP-1, MMP-3)
  • the fusion partner is a targeting sequence.
  • Targeting sequences comprise binding sequences capable of causing binding of the expressed product to a predetermined molecule or class of molecules while retaining bioactivity of the expression product; sequences signaling selective degradation of the fusion protein or binding partners; and sequences capable of constitutively localizing peptides to a predetermined cellular locale.
  • Typical cellular locations include subcellular locations (e.g., Golgi, endoplasmic recticulum, nucleus, nucleoli, nuclear membrane, mitochondria, secretory vesicles, lysosomes) and extracellular locations by use of secretory signals.
  • TM transmembrane domain
  • TM segment is positioned appropriately on the expressed fusion protein to display the subject peptide either intracellularly or extracellularly, as is known in the art. Especially preferred is extracellular presentation.
  • Membrane anchoring sequences and signal sequences include, but are not limited to, those derived from (a) class I integral membrane proteins such as IL-2 receptor (3-chain; Hatakeyama, M.
  • Membrane anchoring sequences also include the GPI anchor, which results in covalent bond formation between the GPI anchor sequence and the lipid bilayer via a glycosyl-phosphatidylinositol.
  • GPI anchor sequences are found in various proteins, including Thy-1 and DAF (Homans, S. W. et al., Nature 333: 269-272 (1988)).
  • acylation sequences allow for attachment of lipid moieties, e.g., isoprenylation (ie., farnesyl and geranyl-geranyl; see Farnsworth, C. C. et al., Proc. Natl. Aced. Sci.
  • the subject peptide will be bound to a lipid group at a terminus, so as to be able to be bound to a lipid membrane, such as a liposome.
  • the targeting sequence is a secretory signal sequence which effects secretion of the peptide.
  • secretory signal sequence A large number of secretory sequences are known to direct secretion of a peptide into the extracellular space when placed at the amino end relative to the peptide of interest, particularly for secretion of a peptide by cells, including transplanted cells. Suitable secretory signals included those found in IL-2 (Villinger, F. et al., J. Immuno. 155: 3946-3954 (1995)), growth hormone (Roskam, W. G. et al., Nucleic Acids Res. 7: 305-320 (1979)), preproinsulin, and influenza HA protein.
  • the fusion partner may further comprise a stability sequence, which confers stability to the fusion protein or the nucleic acid encoding it.
  • a stability sequence which confers stability to the fusion protein or the nucleic acid encoding it.
  • incorporation of glycines after the initiating methionine e.g., MG or MGG
  • Additional amino acids may be added for tagging the peptide for purposes of detection or purification.
  • These sequences may comprise epitopes recognized by antibodies or sequences that bind ligands, such a metals ions.
  • ligands such as a metals ions.
  • tag sequences and ligand binding sequences are well known in the art.
  • poly-histidine e.g., 6 ⁇ His tags, which are recognized by antibodies but also bind divalent metal ions
  • poly-histidine-glycine poly-his-gly
  • flu HA tag polypeptide e.g., Hopp et al., BioTechnology 6: 1204-1210 (1988)
  • KT3 epitope peptide tubulin epitope peptide (e.g., Skinner et al., J. Biol. Chem.
  • T7 gene 10 protein peptide tag e.g., Lutz-Freyermuth et al., Proc. Natl. Acad. Sci. USA 87: 6363-6397 (1990)
  • Fusion partners include linker or tethering sequences, as discussed herein, for linking the peptides and for presenting the peptides in an unhindered structure.
  • combinations of fusion partners may be used. Any number of combinations of presentation structures, targeting sequences, tag sequences and stability sequences may be used with or without linker sequences.
  • the peptides of the invention may be prepared in a number of ways. Chemical synthesis of peptides is well known in the art. Solid phase synthesis is commonly used and various commercial synthetic apparatuses are available, for example automated synthesizers by Applied Biosystems Inc., Foster City, Calif.; Beckman; etc. Solution phase synthetic methods may also be used, particularly for large-scale productions. By using these standard techniques, naturally occurring amino acids may be substituted with unnatural amino acids, particularly D-stereoisomers, and with amino acids with side chains having different lengths or functionalities.
  • Functional groups for conjugating to small molecules, label moieties, peptides, or proteins, or for purposes of forming cyclized peptides may be introduced into the molecule during chemical synthesis. In addition, small molecules and label moieties may be attached during the synthetic process. Preferably, introduction of the functional groups and conjugation to other molecules minimally affects the structure and function of the subject peptide.
  • the peptides of the present invention may also be present in the form of a salt, generally in a salt form which is pharmaceutically acceptable.
  • a salt generally in a salt form which is pharmaceutically acceptable.
  • These include inorganic salts of sodium, potassium, lithium, ammonium, calcium, magnesium, iron, zinc, copper, manganese, and the like.
  • Various organic salts of the peptide may also be made with, including, but not limited to, acetic acid, propionic acid, pyruvic acid, maleic acid, succinic acid, tartaric acid, citric acid, benozic acid, cinnamic acid, salicylic acid, etc.
  • Synthesis of the oligopeptides and derivatives thereof may also be carried out by using recombinant techniques.
  • a nucleic acid sequence may be made which encodes a single oligopeptide or preferably a plurality of the subject peptides in tandem with an intervening amino acid or sequence, which allows for cleavage to the single peptide or head to tail dimers.
  • an intervening methionine or tryptophane may be incorporated, which allows for single amino acid cleavage using CNBr or BNPS-Skatole (2-(2-nitrophenylsulfenyl)-3-methyl-3-bromoindolenine), respectively.
  • cleavage is accomplished by use of sequences that are recognized by particular proteases for enzymatic cleavage or sequences that act as self-cleaving sites (e.g., 2A sequences of apthoviruses and cardioviruses; Donnelly, M. L., J. Gen. Virol. 78:13-21 (1997); Donnelly, M. L., J. Gen. Virol. 82:1027-41 (2001)).
  • the subject peptide may also be made as part of a larger peptide, which can be isolated and the oligopeptide obtained by proteolytic cleavage or chemical cleavage.
  • the particular sequence and the manner of preparation will be determined by convenience, economics, purity required, and the like.
  • a gene encoding a particular peptide, protein, or fusion protein is joined to a DNA sequence encoding the oligopeptides of the present invention to form a fusion nucleic acid, which is introduced into an expression vector.
  • Expression of the fusion nucleic acid is under the control of a suitable promoter and other control sequences, as defined below, for expression in a particular host cell or organism (Sambrook et al., Molecular Biology: A Laboratory Manual, Cold Spring Harbor Press, Cold Spring Harbor, N.Y. (3rd ed. 2001); Ausubel, F. et al., Current Protocols in Molecular Biology, John Wiley & Sons, New York, N.Y., (updates up to 2002) (1988)).
  • conjugating various molecules to the peptides of the present invention functional groups on the oligopeptides and the other molecule are reacted in presence of an appropriate conjugating (e.g., crosslinking) agent.
  • conjugating or crosslinking agent used will depend on the functional groups, such as primary amines, sulfhydryls, carbonyls, carbohydrates and carboxylic acids being used.
  • reactive functional groups on the oligopeptide not selected for modification are protected prior to coupling of the peptide to other reactive molecules to limit undesired side reactions.
  • protecting group as used herein is a molecule bound to a specific functional group which is selectively removable to reexpose the functional group (Greene, T. W.
  • the peptides may be synthesized with protected amino acid precursors or reacted with protecting groups following synthesis but before reacting with crosslinking agent. Conjugations may also be indirect, for example by attaching a biotin moiety, which can be contacted with a compound or molecule which is coupled to streptavidin or avidin.
  • the linkage between the oligopeptides and the conjugated compound is chosen to be sufficiently labile to result in cleavage under desired conditions, for example after transport to desired cells or tissues.
  • Biologically labile covalent bonds e.g., Imimo bonds and esters, are well known in the art (see, e.g., U.S. Pat. No. 5,108,921). These modifications permit administration of the oligopeptides in potentially a less active form, which is then activated by cleavage of the labile bond.
  • 14-3-3 antagonists which are proteins, including peptides and antibodies, may be synthesized using nucleic acids encoding the same. This may be done to produce 14-3-3 antagonists which are subsequently isolated for use. Alternatively, such nucleic acids may be used therapeutically.
  • the nucleic acids are cloned into expression vectors and introduced into cells or a host.
  • the expression vectors are either self-replicating extrachromosomal vectors or vectors that integrate into the host chromosome, for example vectors based on retroviruses, vectors with site specific recombination sequences, or by homologous recombination.
  • these vectors include control sequences operably linked to the nucleic acids encoding the oligopeptides.
  • control sequences is meant nucleic acid sequences necessary for expression of the subject peptides in a particular host organism.
  • control sequences include sequences required for transcription and translation of the nucleic acids, including, but not limited to, promoter sequences, enhancer or transcriptional activator sequences, ribosomal binding sites, transcriptional start and stop sequences; polyadenylation signals; etc.
  • the cell is a fibroblast or FLS cell.
  • the cells is a synovial cell.
  • the cell is engineered to express a 14-3-3 antagonist.
  • the cell may be manipulated in vitro and introduced into a recipient. Alternatively, the cell may be manipulated in vivo.
  • promoters are useful in expressing the peptides of the present invention.
  • the promoters may be constitutive, inducible, and/or cell specific, and may comprise natural promoters, synthetic promoters (e.g., tTA tetracycline inducible promoters), or hybrids of various promoters. Promoters are chosen based on, among other considerations, the cell or organism in which the proteins are to be expressed, the level of desired expression, and any desired regulation of expression.
  • Suitable promoters are bacterial promoters (e.g., pL1 phage promoter, tac promoter, lac promoter, etc.); yeast based promoters (e.g., GAL4 promoter, alcohol dehydrogenase promoter, tryptophane synthase promoter, copper inducible CUPI promoter, etc.), plant promoters (e.g., CaMV S35, nopoline synthase promoter, tobacco mosaic virus promoter, etc), insect promoters (e.g., Autographa nuclear polyhedrosis virus, Aedes DNV viral p& and p61, hsp70, etc.), and promoters for expression mammalian cells (e.g., ubiquitin gene promoter, ribosomal gene promoter, ⁇ -globin promoter, thymidine kinase promoter, heat shock protein promoters, and ribosomal gene promoters, etc.), and particularly viral promoters, such as
  • operably linked herein is meant that a nucleic acid is placed into a functional relationship with another nucleic acid.
  • operably linked means that the control sequences are positioned relative to the nucleic acid sequence encoding the subject 14-3-3 antagonists in such a manner that expression of the encoded antagonist occurs.
  • the vectors may comprise plasmids or comprise viral vectors, for example retroviral vectors, which are useful delivery systems if the cells are dividing cells, or lentiviral and adenoviral vectors if the cells are non-dividing cells.
  • retroviral vectors which have inactivated viral promoters at the 3′-LTR, thereby permitting control of expression of heterologous genes by use of non-viral promoters inserted into the viral vector (see, e.g., Hofmann, A. et al., Proc. Natl. Acad. Sci. USA 93: 5185-5190 (1996)).
  • SIN vectors self-inactivating retroviral vectors
  • modifications of the system by pseudotyping allows use of retroviral vectors for all eukaryotic cells, particularly for higher eukaryotes (Morgan, R. A. et al., J. Virol. 67: 4712-4721 (1993); Yang, Y. et al., Hum. Gene Ther. 6:1203-1213 (1995)).
  • the expression vectors also contain a selectable marker gene to allow selection of transformed host cells.
  • the selection will confer a detectable phenotype that enriches for cells containing the expression vector and further permits differentiation between cells that express and do not express the selection gene.
  • Selection genes are well known in the art and will vary with the host cell used. Suitable selection genes include genes that render the cell resistant to a drug, genes that permit growth in nutritionally deficient media, and reporter genes (e.g., ⁇ -galactosidase, fluorescent proteins, glucouronidase, etc.), all of which are well known in the art and available to the skilled artisan.
  • nucleic acids there are a variety of techniques available for introducing nucleic acids into viable cells.
  • introduction into herein is meant that the nucleic acid enters the cells in a manner suitable for subsequent expression of the nucleic acid.
  • Techniques for introducing the nucleic acids will vary depending on whether the nucleic acid is transferred in vitro into cultured cells or in vivo into the cells of the intended host organism and will also depend on the type of host organism. Methods for introducing the nucleic acids in vitro include the use of liposomes, LipofectinTM, electroporation, microinjection, cell fusion, DEAE dextran, calcium phosphate precipitation, and biolistic particle bombardment.
  • nucleic acids expressing the 14-3-3 antagonists of the present invention may exist transiently or stably in the cell or stably integrate into the chromosome of the host.
  • an agent that targets the target cells or tissues such as an antibody specific for a cell surface protein or the target cell e.g., a fibroblast or FLS cell, a ligand for a receptor on the target cell, a lipid component on the cell membrane, or a carbohydrate on the cell surface.
  • proteins that bind a cell surface protein which is endocytosed may be used for targeting and/or facilitating uptake. These include as non-limiting examples, capsid proteins or fragments thereof tropic for a particular cell types, antibodies for proteins which undergo internalization (Wu, G. Y. et al., J. Biol. Chem. 262: 4429-4432 (1987); Wagner, E. et al., Proc. Natl. Aced. Sci. USA 87: 3410-3414 (1990)), or enhance in vivo half-life.
  • oligopeptides of the present invention may be expressed in, among others, E. coli, Saccharomyces cerevislae, Saccharomyces pombe , Tobacco or Arabidopsis plants, insect Schneider cells, and mammalian cells, such as COS, CHO, HeLa, and the like, either intracellularly or in a secreted form by fusing the peptides to an appropriate signal peptide.
  • Secretion from the host cell may be done by fusing the DNA encoding the oligopeptide and a DNA encoding a signal peptide.
  • Nucleic acids expressing the oligopeptides may be inserted into cells, for example stem cells for tissue expression or bacteria for gut expression, and the cells transplanted into the host to provide an in vivo source of the oligopeptides.
  • the oligopeptides of the present invention may be purified or isolated after synthesis or expression.
  • purified or “isolated” is meant free from the environment in which the peptide is synthesized or expressed and in a form where it can be practically used.
  • purified or isolated is meant that the peptide or its derivative is substantially pure, i.e., more than 90% pure, preferably more than 95% pure, and preferably more than 99% pure.
  • the oligopeptides and derivatives thereof may be purified and isolated by methods known to those skilled in the art, depending on other components present in the sample.
  • Standard purification methods include electrophoretic, immunological, and chromatographic techniques, including ion exchange, hydrophobic, affinity, size exclusion, reverse phase HPLC, and chromatofocusing.
  • the proteins may also be purified by selective solubility, for instance in the presence of salts or organic solvents. The degree of purification necessary will vary depending on use of the subject oligopeptides. Thus, in some instances no purification will be necessary.
  • compositions used will comprise at least 20% by weight of the desired product, more usually at least about 75% by weight, preferably at least about 95% by weight, and usually at least about 99.5% by weight, relative to contaminants related to the method of product preparation, the purification procedure, and its intended use, for example with a pharmaceutical carrier for the purposes of therapeutic treatment.
  • percentages will be based upon total protein.
  • the 14-3-3 antagonists of the invention can be incorporated into pharmaceutical compositions suitable for administration to a subject.
  • the pharmaceutical composition comprises a 14-3-3 antagonist of the invention and a pharmaceutically acceptable carrier.
  • pharmaceutically acceptable carrier includes any and all solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents, and the like that are physiologically compatible.
  • pharmaceutically acceptable carriers include one or more of water, saline, phosphate buffered saline, dextrose, glycerol, ethanol and the like, as well as combinations thereof.
  • isotonic agents for example, sugars, polyalcohols such as mannitol, sorbitol, or sodium chloride in the composition.
  • Pharmaceutically acceptable substances such as wetting or minor amounts of auxiliary substances such as wetting or emulsifying agents, preservatives or buffers, which enhance the shelf life or effectiveness of the 14-3-3 antagonist.
  • the 14-3-3 antagonists are targeted to 14-3-3 protein that is localized extracellularly. Accordingly, therapeutic compositions are formulated and administration is such that the 14-3-3 antagonist so delivered is available to engage extracellular 14-3-3 protein.
  • compositions of this invention may be in a variety of forms. These include, for example, liquid, semi-solid and solid dosage forms, such as liquid solutions (e.g., injectable and infusible solutions), dispersions or suspensions, tablets, pills, powders, liposomes and suppositories.
  • liquid solutions e.g., injectable and infusible solutions
  • dispersions or suspensions tablets, pills, powders, liposomes and suppositories.
  • the preferred form depends on the intended mode of administration and therapeutic application. Typical preferred compositions are in the form of injectable or infusible solutions, such as compositions similar to those used for passive immunization of humans with other antibodies.
  • the preferred mode of administration is parenteral (e.g., intravenous, subcutaneous, intraperitoneal, intramuscular, with intracapsular being especially preferred).
  • the 14-3-3 antagonist is administered by intravenous infusion or injection.
  • the 14-3-3 antagonist is administered by intramuscular or subcutaneous injection.
  • compositions typically must be sterile and stable under the conditions of manufacture and storage.
  • the composition can be formulated as a solution, microemulsion, dispersion, liposome, or other ordered structure suitable to high drug concentration.
  • Sterile injectable solutions can be prepared by incorporating the active compound in the required amount in an appropriate solvent with one or a combination of ingredients enumerated above, as required, followed by filtered sterilization.
  • dispersions are prepared by incorporating the active compound into a sterile vehicle that contains a basic dispersion medium and the required other ingredients from those enumerated above.
  • the preferred methods of preparation are vacuum drying and freeze-drying that yields a powder of the active ingredient plus any additional desired ingredient from a previously sterile-filtered solution thereof.
  • the proper fluidity of a solution can be maintained, for example, by the use of a coating such as lecithin, by the maintenance of the required particle size in the case of dispersion and by the use of surfactants.
  • Prolonged absorption of injectable compositions can be brought about by including in the composition an agent that delays absorption, for example, monostearate salts and gelatin.
  • the 14-3-3 antagonists of the present invention can be administered by a variety of methods known in the art, including intravenous injection or infusion. Direct administration to the synovium is one preferred route of administration. As will be appreciated by the skilled artisan, the route and/or mode of administration will vary depending upon the desired results.
  • the active compound may be prepared with a carrier that will protect the compound against rapid release, such as a controlled release formulation, including implants, transdermal patches, and microencapsulated delivery systems.
  • a controlled release formulation including implants, transdermal patches, and microencapsulated delivery systems.
  • Biodegradable, biocompatible polymers can be used, such as ethylene vinyl acetate, polyanhydrides, polyglycolic acid, collagen, polyorthoesters, and polylactic acid. Many methods for the preparation of such formulations are patented or generally known to those skilled in the art.
  • a 14-3-3 antagonist of the invention may be orally administered, for example, with an inert diluent or an assimilable edible carrier.
  • the compound (and other ingredients, if desired) may also be enclosed in a hard or soft shell gelatin capsule, compressed into tablets, or incorporated directly into the subject's diet.
  • the compounds may be incorporated with excipients and used in the form of ingestible tablets, buccal tablets, troches, capsules, elixirs, suspensions, syrups, wafers, and the like.
  • Supplementary active compounds can also be incorporated into the compositions.
  • a 14-3-3 antagonist of the invention is coformulated with and/or coadministered with one or more additional therapeutic agents.
  • additional therapeutic agents for example, a DMARD or DMOAD.
  • Such combination therapies may advantageously utilize lower dosages of the administered therapeutic agents, thus avoiding possible toxicities or complications associated with the various monotherapies.
  • compositions of the invention may include a “therapeutically effective amount” or a “prophylactically effective amount” of an antibody of the invention.
  • a “therapeutically effective amount” refers to an amount effective, at dosages and for periods of time necessary, to achieve the desired therapeutic result.
  • a therapeutically effective amount of the 14-3-3 antagonist may vary according to factors such as the disease state, age, sex, and weight of the individual, and the ability of the 14-3-3 antagonist to elicit a desired response in the individual.
  • a therapeutically effective amount is also one in which any toxic or detrimental effects of the antibody are outweighed by the therapeutically beneficial effects.
  • a “prophylactically effective amount” refers to an amount effective, at dosages and for periods of time necessary, to achieve the desired prophylactic result. Typically, since a prophylactic dose is used in subjects prior to or at an earlier stage of disease, the prophylactically effective amount will be less than the therapeutically effective amount.
  • Dosage regimens may be adjusted to provide the optimum desired response (e.g., a therapeutic or prophylactic response). For example, a single bolus may be administered, several divided doses may be administered over time or the dose may be proportionally reduced or increased as indicated by the exigencies of the therapeutic situation. It is especially advantageous to formulate parenteral compositions in dosage unit form for ease of administration and uniformity of dosage.
  • Dosage unit form as used herein refers to physically discrete units suited as unitary dosages for the mammalian subjects to be treated; each unit containing a predetermined quantity of active compound calculated to produce the desired therapeutic effect in association with the required pharmaceutical carrier.
  • An exemplary, non-limiting range for a therapeutically or prophylactically effective amount of an antibody of the invention is 0.1-20 mg/kg, more preferably 1-10 mg/kg. It is to be noted that dosage values may vary with the type and severity of the condition to be alleviated. It is to be further understood that for any particular subject, specific dosage regimens should be adjusted over time according to the individual need and the professional judgment of the person administering or supervising the administration of the compositions, and that dosage ranges set forth herein are exemplary only and are not intended to limit the scope or practice of the claimed composition.
  • compositions described herein may be presented in unit-dose or multi-dose containers, such as sealed ampoules or vials. Such containers are typically sealed in such a way to preserve the sterility and stability of the formulation until use.
  • formulations may be stored as suspensions, solutions or emulsions in oily or aqueous vehicles, as indicated above.
  • a pharmaceutical composition may be stored in a freeze-dried condition requiring only the addition of a sterile liquid carrier immediately prior to use.
  • treatment herein is meant therapeutic or prophylactic treatment, or a suppressive measure for the disease, disorder or undesirable condition.
  • Treatment encompasses administration of the subject 14-3-3 antagonists in an appropriate form prior to the onset of disease symptoms and/or after clinical manifestations, or other manifestations, of the disease to reduce disease severity, halt disease progression, or eliminate the disease.
  • Prevention of the disease includes prolonging or delaying the onset of symptoms of the disorder or disease, preferably in a subject with increased susceptibility to the disease.
  • the invention provides methods of treating arthritis, including methods of treating ankylosing spondylitis, Behçet's Disease, diffuse idiopathic skeletal hyperostosis (DISH), Ehlers-Danlos Syndrome (EDS), Felty's Syndrome, fibromyalgia, gout, infectious arthritis, juvenile arthritis, lupus, mixed connective tissue disease (MCTD), osteoarthritis, Paget's Disease, polymyalgia rheumatica, polymyositis and dermatomyositis, pseudogout, psoriatic arthritis, Raynaud's Phenomenon, reactive arthritis, rheumatoid arthritis, scleroderma, Sjögren's Syndrome, Still's Disease, and Wegener's granulomatosis.
  • ankylosing spondylitis including methods of treating ankylosing spondylitis, Behçet's Disease, diffuse idiopathic skeletal hyperosto
  • the methods comprise administering a 14-3-3 antagonist to a patient, either alone or in combination with other therapeutic agents to increase treatment efficacy.
  • the invention provides methods of screening for 14-3-3 antagonists.
  • the compounds screened can range from small organic molecules to large polymers and biopolymers, and can include, by way of example and not limitation, small organic compounds, saccharides, carbohydrates, polysaccharides, lectins, peptides and analogs thereof, polypeptides, proteins, antibodies, oligonucleotides, polynucleotides, nucleic acids, etc.
  • the candidate compounds screened are small organic molecules, preferably having a molecular weight in the range of about 100-2500 daltons, though other molecules may be used.
  • Such candidate molecules will often comprise cyclical structures composed of carbon atoms or mixtures of carbon atoms and one or more heteroatoms and/or aromatic, polyaromatic, heteroaromatic and/or polyaromatic structures.
  • the candidate agents may include a wide variety of functional group substituents.
  • the substituent(s) are independently selected from the group of substituents known to interact with proteins, such as, for example, amine, carbonyl, hydroxyl and carboxyl groups.
  • the candidate compounds may be screened on a compound-by-compound basis or, alternatively, using one of the myriad library techniques commonly employed in the art.
  • synthetic combinatorial compound libraries, natural products libraries and/or peptide libraries may be screened using the assays of the invention to identify compounds that compete with a 14-3-3 ligand for binding to a 14-3-3 protein.
  • These competitive binding assays can identify compounds that bind the 14-3-3 protein at approximately the same site as the 14-3-3 ligand.
  • Myriad techniques for carrying out competitive binding assays are known in the art. Any of these techniques may be employed in the present invention.
  • Such binding experiments may be conducted wholly in solution or, alternatively, using a solid support, e.g., a glass or other bead, or a solid surface such as, for example, the bottom of a petri dish, to immobilize a reagent.
  • the immobilization may be mediated by non-covalent interactions or by covalent interactions.
  • Methods for immobilizing myriad types of compounds and proteins on solid supports are well-known. Any of these methods may be used.
  • the 14-3-3 protein and candidate compound are typically contacted with one another under conditions conducive to binding.
  • the actual conditions used can vary, typically the binding assays are carried out under physiological conditions. Actual concentrations suitable for a particular assay will be apparent to those of skill in the art.
  • the assays further comprise functional assays for the ability of a candidate agent to antagonize 14-3-3 protein activity. In one embodiment, the assays comprise determining the ability of a candidate agent to reduce the induction of MMP by 14-3-3 protein. In one embodiment, candidate agent is mixed with 14-3-3 protein, and the mixture may be added to cells capable of inducing MMP in response to 14-3-3 protein. In another embodiment, candidate agent is added with 14-3-3 protein to cells capable of inducing MMP in response to 14-3-3 protein.
  • cysteine residue is replaced by a serine residue to avoid the formation of disulfide bonds.
  • the cysteine may be an internal cysteine residue or a terminal cysteine residue.
  • Peptide epitopes may be modified for various purposes, including conjugation to an additional moiety, e.g., conjugation to a moiety to produce an immunogen comprising the epitope.
  • cysteine may be placed appropriately for conjugation to carrier and to provide for exposure of the area that is desired to be exposed for purposes of making antibody. In case of KKLE the cysteine was added on to the C-terminal end in order to expose the other side.
  • the carrier used may be quite large and may mask the first few amino acids.
  • Immunogen #1 C-LDKFLIKNSNDF (SEQ ID NO:76) (Amino Acid Sequence 104-115; “AUG1-CLDK”).
  • a peptide corresponding to a segment of human 14-3-3 eta residues 104-115 was modified by addition of an N-terminal cysteine moiety for conjugation to carrier, and replacement of internal cysteine-112 moiety to avoid formation of internal disulphide bonds.
  • Immunogen #2 KKLEKVKAYR-C (SEQ ID NO:77) (Amino Acid Sequence 77-86; “AUG2-KKLE”). A peptide corresponding to a segment of human 14-3-3 eta residues 77-86 was modified by addition of a C-terminal cysteine moiety for conjugation to carrier.
  • Immunogen #3 C-KNSVVEASEAAYKEA (SEQ ID NO:78) (Amino Acid Sequence 143-157; “AUG3-CKNS”). A peptide corresponding to a segment of human 14-3-3 eta residues 143-157 was modified by addition of an N-terminal cysteine moiety for conjugation to carrier.
  • Immunogen #4 Full length human recombinant 14-3-3 eta (SEQ ID NO: 63), Protein Accession #: NP — 003396.
  • mice Groups of 4 female BALB/c mice were initially immunized by intraperitoneal injections using 50 ug of antigen (Immunogen #1, #2, #3 or #4) per mouse in Complete Freund's Adjuvant. Four subsequent boosts were administered as above, spaced at 3 week intervals, with antigen in Incomplete Freund's Adjuvant.
  • the 2 highest responders in each group were each boosted intravenously with 10 ug of antigen in 100 ul of sterile PBS pH 7.4.
  • the titrations of serum samples from the immunized mice taken after the second boost are shown in FIG. 1 (Immunogen #1; CLDK), FIG. 2 (Immunogen #2; KKLE), FIG. 3 (Immunogen #3; CKNS) and FIG. 8 (Immunogen #4).
  • the donor mice were sacrificed and the spleen cells were harvested and pooled. Fusion of the splenocytes with SP2/0 BALB/c parental myeloma cells was performed as previously described (Kohler et al., infra), except that one-step selection and cloning of the hybridomas was performed.
  • Clones were picked 11 days post fusion and resuspended in wells of 96-well tissue culture plates in: 200 ⁇ l of D-MEM medium containing 1% hypoxanthine/thymidine, 20% fetal bovine serum, 2 mM GlutaMax I, 1 mM Sodium Pyruvate, 50 ⁇ g/ml Gentamycin, 1% OPI and 0.6 ng/ml IL-6. After 4 days, the supernatants were screened by ELISA for antibody activity on plates coated with 1 ug/well of purified antigen.
  • Hybridoma cell lines that were growing slowly or looked unhealthy could usually be rescued by the addition of a rich growth media containing: D-MEM medium with 1% hypoxanthine/thymidine, 20% fetal bovine serum, 2 mM GlutaMax I, 1 mM Sodium Pyruvate, 50 ⁇ g/ml Gentamycin, 1% OPI, 20% conditioned EL-4 tissue culture supernatant and 0.6 ng/ml IL-6.
  • D-MEM medium with 1% hypoxanthine/thymidine, 20% fetal bovine serum, 2 mM GlutaMax I, 1 mM Sodium Pyruvate, 50 ⁇ g/ml Gentamycin, 1% OPI, 20% conditioned EL-4 tissue culture supernatant and 0.6 ng/ml IL-6.
  • EL-4 is a murine thymoma cell line, which when stimulated with phorbal 12-myristate 12-acetate (PMA, from Sigma, cat #P-8139) causes the cells to secrete interleukin 2 (IL-2), a B cell differentiating factor (EL-BCDF-nak), and two B cell growth factors (BSF-p1 and EL-BCGF-swa) and other additional lymphokines, which greatly enhance lymphocyte growth and differentiation.
  • PMA phorbal 12-myristate 12-acetate
  • EL-BCDF-nak interleukin 2
  • BSF-p1 and EL-BCGF-swa B cell growth factors
  • a total of 100 viable clones were obtained that secreted IgG capable of recognizing recombinant 14-3-3 eta.
  • the 100 viable clones were screened using a series of methods including: immunoblotting (dot blot), a trapping assay and a custom capture (sandwich) ELISA. All 100 clones were also tested for cross-reactivity using the custom capture (sandwich) ELISA with the other six 14-3-3 isoforms.
  • the Custom Capture ELISA experiment in Table 4 was carried out as follows. ELISA plates were coated with neat overgrown TC supernatant at 100 ⁇ L/well and incubated overnight at 4° C. Biotin-labelled 14-3-3 (corresponding to all seven isoforms) was titrated from 1/500 to 1/16000 overtop and incubated for 1 hour at room temperature. Plates were then blocked with 3% skim milk powder in PBS (pH 7.4) at 100 ⁇ L/well and incubated for 1 hour at room temperature. 1/8000 Streptavidin-HRPO was diluted in PBS-Tween, added at 100 ⁇ L/well and incubated for 1 hour at 37° C. with shaking. TMB buffer was added at 50 ⁇ L per well and incubated in the dark at room temperature. Reactions were stopped with 50 ⁇ L 1M HCl per well after 10 minutes and read at OD450 nm.
  • MMP-1 and MMP-3 demonstrate significant correlation with the expression of the 14-3-3 ⁇ and ⁇ isoforms in both synovial fluid and serum (Table 5).
  • R-18 Peptide Interacts with Extracellular 14-3-3 Protein and Inhibits Induction of MMP-1 Expression Induced by Extracellular 14-3-3 Protein
  • biotinylated R18 is as follows: Biotin-Pro-His-Cys-Val-Pro-Arg-Asp-Leu-Ser-Trp-Leu-Asp-Leu-Glu-Ala-Asn-Met-Cys-Leu-Pro-OH (SEQ ID NO:79).
  • KLCCM keratinocyte-like cell conditioned medium
  • Monoclonal anti-14-3-3 antibodies from Example 1 were tested for their ability to immunoprecipitate or “capture” both recombinant and endogenous cellular 14-3-3 eta.
  • Culture supernatants from anti 14-3-3 eta hybridoma clones were incubated at 4° C. for 2 hours with either buffer containing 100 ng human recombinant 14-3-3 eta, or buffer containing supernatant (200 ⁇ g protein) from lysed HeLa cells. Immunoprecipitates were collected with Protein A/G agarose using standard methodology.
  • FIG. 6 shows a Western Blot obtained using Hybridoma clone 7B11, which was made using Immunogen #4 (full length recombinant 14-3-3 eta.
  • Lane 1 Protein NG agarose beads alone; Lane 2: Protein A/G agarose beads were mixed with cell lysate; Lane 3: Protein NG agarose beads were mixed with recombinant human 14-3-3 eta; Lane 4: Protein A/G agarose beads were mixed with hybridoma supernatant; Lane 5: Protein A/G agarose beads were mixed with hybridoma supernatant and cell lysate; Lane 6: Protein NG agarose beads were mixed with hybridoma supernatant and recombinant 14-3-3 eta.
  • the data show that clone 7B11 immunoprecipitated both HeLa cell-derived 14-3-3 eta (Lane 5) and human recombinant 14-3-3 eta (Lane 6).
  • FIG. 7 shows a Western Blot obtained by using hybridoma clone 2D5 made against Immunogen #3 (CKNS).
  • Lane 1 Protein NG agarose beads alone;
  • Lane 2 Protein NG agarose beads were mixed with cell lysate;
  • Lane 3 Protein A/G agarose beads were mixed with recombinant human 14-3-3 eta;
  • Lane 4 Protein NG agarose beads were mixed with hybridoma supernatant;
  • Lane 5 Protein A/G agarose beads were mixed with hybridoma supernatant and cell lysate;
  • Lane 6 Protein NG agarose beads were mixed with hybridoma supernatant and recombinant 14-3-3 eta.
  • the data show that clone 2D5 immunoprecipitated both HeLa cell lysate-derived 14-3-3 eta (Lane 5) and human recombinant 14-3-3 eta (Lane 6).
  • Example 1 Similar analyses were performed for several other hybridoma clones (data not shown). These experiments demonstrate that the monoclonal antibodies produced in Example 1 are capable of binding to and immunoprecipitating or “capturing” 14-3-3 eta in its native configuration, as evidenced by the immunoprecipitation of the protein from HeLa cell lysates.
  • Anti-14-4-3 Antibody Reduces MMP Expression in Mouse RA Model
  • 14-3-3 Antagonist Peptide Reduces MMP Expression in Mouse RA Model
  • Collagen-induced arthritis is induced in Male DBA mice by injection of 100 ⁇ g of purified type II collagen emulsified in Freund's complete adjuvant at the base of the tail as described in Williams et al., PNAS, 89:9784-9788, 1992. Mice are inspected daily thereafter and mice that exhibit erythema and/or swelling in one of more limbs are assigned randomly to a treatment regimen with one or more antagonists 14-3-3 eta described herein or to a placebo treatment. Alternatively, a treatment regimen is begun on the day prior to immunization with type II collagen. Various treatment regimens are implemented, using groups of 10 mice, as follows:
  • R-18 peptide is administered at various dosages ranging from 0.1 and 20 mg/kg (a) intraperitoneally or (b) into the synovium, twice weekly.
  • Selected anti-14-3-3 eta antibodies obtained and purified from the hybridoma supernatants of Example 1 are administered at various dosages ranging from 0.10 to 20 mg/kg (a) intraperitoneally or (b) into the synovium, twice weekly.
  • the arthritis is monitored over a 20-day treatment period, and the following disease indices are evaluated.
  • Clinical score Mouse limbs are assessed for swelling, erythema, joint rigidity, and paw swelling. The clinical indicia of arthritis is reduced in animals in which the treatment regimen has been efficacious, as compared to placebo controls.
  • 14-3-3 MMP-1 and/or MMP-3 expression in the synovium.
  • Synovial samples are taken at various time points, and the 14-3-3, preferably 14-3-3 gamma and/or 14-3-3 eta, and MMP-1 and/or MMP-3 levels are determined.
  • the levels of MMP-1 and MMP-3 are reduced in animals in which the treatment regimen has been efficacious, as compared to placebo controls.
  • Anti-14-4-3 Antibody Reduces MMP Expression in Rabbit RA Model; 14-3-3 Antagonist Peptide Reduces MMP Expression in Rabbit RA Model Induced by Implantation of Cells Secreting IL-1
  • the 14-3-3 eta antagonists of the invention are evaluated in a rabbit model in which arthritis is induced by the implantation of 5 ⁇ 10 5 IL-1 producing cells into the knee joints of New Zealand white rabbits as described in Yao et al., Arthritis Research and Therapy 2006, 8:R16, available on line at http://arthritis-research.com/content/8/1/R16. Testing and evaluation is done essentially as described in Example 8.
  • Anti-14-4-3 Antibody Reduces MMP Expression in RA Model
  • 14-3-3 Antagonist Peptide Reduces MMP Expression in RA
  • CIA collagen-induced arthritis
  • Other models of rheumatoid arthritis can be found for example, in the following references: Williams, Methods Mol. Med. 2004; 98:207-16. Collagen-induced arthritis as a model for rheumatoid arthritis; Brand, Corn. Med., 55:114-122, 2005; Vierboom et al., Drug Discovery Today, 12:327-335, 2007; Sakaguchi et al., Curr. Opin. Immunol., 17:589-594, 2005.
  • the model Prior to commencing an initial therapeutic regimen in a particular animal model, it is preferable to first validate the model as an inflammatory disorder model involving 14-3-3.
  • the levels of 14-3-3 and MMP, preferably 14-3-3 eta and/or 14-3-3 gamma, and preferably MMP-1 and/or MMP-3 are determined to show elevation following the induction of experimental arthritis in the model.
  • Samples (synovial fluid or serum (2 ⁇ l of each), recombinant human 14-3-3 eta, cell lysates or cell-lysate immunoprecipitates) were subjected to SDS-PAGE analysis with 12-15% (wt/vol) acrylamide gel, and electrotransferred onto PVDF membranes. Non-specific proteins on membranes were blocked in 5% skim milk powder in PBS-0.1% Tween-20 overnight. Immunoblotting for Example 3 was performed using 2 ⁇ g/ml of 7 isoforms specific rabbit anti-human 14-3-3 polyclonal antibodies (Martin H, Patel Y, Jones D, Howell S, Robinson K and Aitken A 1993. Antibodies against the major brain isoforms of 14-3-3 protein.
  • Example 7 An antibody specific for the N-acetylated amino-terminus of a protein. FEBS Letters. 331:296-303).
  • the immunprecipitates were resolved by SDS-PAGE and the membranes were blocked in skim milk and then incubated with primary 14-3-3 eta (1:1000, BioMol International SE-486) and then the appropriate secondary horseradish peroxidise conjugated anti-rabbit IgG or anti-mouse IgG antibodies (1:2500 dilution). Immunoreactive proteins were then visualized using the ECL plus western blotting detection system. Keratinocyte cell lysate (K), recombinant protein and for HeLa cell lysate was used as a positive control.
  • SF synovial fluid
  • PS patient serum.
  • Synovial fluid was obtained from the knee joints of patients with active synovitis prior to the institution of anti-TNF therapeutics. All patients had a DAS score >6.0. Matched blood samples were obtained by standard venipuncture procedures. The clot was removed by centrifugation.
  • cDNA for keratinocyte-derived 14-3-3 eta was prepared from total RNA extracted from human keratinocytes, cloned and expressed in E. coli , and affinity purified, following the methods described in Ghahary et al 2004 J Invest Dermatol 122:1188-1197 (REF 36, infra).
  • Primers used for PCR amplification of the 14-3-3 eta cDNA were (GCGAATTCCTGCAGCGGGCGCGGCTGGCCGA) (SEQ ID NO:80) and (GCTCGAGCCTGAAGGATCTTCAGTTGCCTTC) (SEQ ID NO:81).
  • cDNA was derived from a human source, cloned and expressed in E. coli , and affinity purified.
  • Primers used for the PCR amplification of the 14-3-3 eta cDNA were: (agaattcagttgccttctctgctt) (SEQ ID NO: 82) and (acatatgggggaccggga) (SEQ ID NO:83); for 14-3-3 gamma (agaattcttaattgttgccttcgccg) (SEQ ID NO:84) and (acatatggtggaccgcgagc) (SEQ ID NO:85); for 14-3-3 beta (acatatgacaatggataaaagtgagctg) (SEQ ID NO: 86) and (agaattcttagttctctcctcccagc) (SEQ ID NO:87); for 14-3-3 epsilon (acatat
  • For screening and testing 1.0 ⁇ g/well of anti-AUG1-CLDK, anti-AUG2-KKLE, anti-AUG3-CKNS or anti-14-3-3 ETA antigen was coated onto ELISA plates in dH 2 O at 50 ⁇ L/well and dried down overnight at 37° C. Testing on 14-3-3 ETA antigen 0.25 ug/well was coated in carbonate coating buffer and incubated at 4° C. overnight.
  • HT human transferrin
  • Capture ELISA For testing by Capture ELISA: ELISA plate was coated with neat overgrown TC sup at 100 ⁇ L/well incubated overnight at 4° C. Biotin labelled 14-3-3 ETA (or one of the six other 14-3-3 family members) was titrated from 1/500 to 1/16000 overtop and incubated for 1 hour at room temperature.
  • Mouse anti-AUG1-CLDK, anti-AUG2-KKLE, anti-AUG3-CKNS or anti-14-3-3 eta hybridoma tissue culture supernatant and mouse monoclonal controls were added at 100 ⁇ L neat per well for screening and testing.
  • Mouse anti-AUG1-CLDK, anti-AUG2-KKLE, anti-AUG3-CKNS or anti-14-3-3 eta immune serum and mouse pre-immune serum were diluted 1/500 in SP2/0 tissue culture supernatant added at 100 ⁇ L/well for screening and testing. Incubated for 1 hour at 37° C. with shaking for both the screening and testing.
  • 2° antibody used for screening and testing 1/25000 Goat anti-mouse IgG Fc HRP conjugated (Jackson cat#115-035-164) was used in screening and testing. Secondary antibody diluted in PBS-Tween added at 100 ⁇ L/well and incubated for 1 hour at 37° C. with shaking.
  • Streptavidin used for Capture ELISA Add 100 ul/well of Streptavidin HRPO (1:8000, CedarLane cat#CLCSA1007) and incubated for 1 hour at room temperature with shaking.
  • TMB buffer BioFx cat# TMBW-1000-01 was added at 50 ⁇ L per well and incubated in the dark at room temperature. Reactions for screening and testing were stopped with 50 ⁇ L 1M HCl per well after 10 minutes and read at OD 450 nm.
  • PVDF membrane was blocked with 5% milk powder in PBS (pH 7.4) for 1 hour at room temperature. Blot was washed after blocking for 15 minutes with several changes of PBS-Tween pH7.4. Blots were allowed to dry on paper towels face up for 10 minutes prior to primary antibody application.
  • Mouse AUG1-CLDK, anti-AUG2-KKLE, anti-AUG3-CKNS or anti-14-3-3 eta hybridoma tissue culture supernatant and mouse monoclonal controls were incubated with blots in separate petri dishes.
  • Mouse anti-AUG1-CLDK, anti-AUG2-KKLE, anti-AUG3-CKNS or anti-14-3-3 eta immune and mouse pre-immune sera were diluted 1/500 in SP2/0 tissue culture supernatant used as controls. Blots were incubated with shaking for 1 hour at room temp. Blots were washed after primary antibody incubation for 30 minutes with 5 changes of PBS-Tween pH7.4.
  • Substrate BCIP/NBT developer 1 component AP membrane substrate (BioFX product # BCID-1000-01) was dripped onto blot neat at room temp. The reaction was stopped after 5 minutes with cold tap water and results were determined quantitatively by eye and given a score of strong positive +++, moderate positive ++, weak positive +, slight positive +/ ⁇ , negative ⁇ .

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Immunology (AREA)
  • Medicinal Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Microbiology (AREA)
  • Animal Behavior & Ethology (AREA)
  • Veterinary Medicine (AREA)
  • Public Health (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Organic Chemistry (AREA)
  • Molecular Biology (AREA)
  • Mycology (AREA)
  • Epidemiology (AREA)
  • Oncology (AREA)
  • Biochemistry (AREA)
  • Urology & Nephrology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Hematology (AREA)
  • Biomedical Technology (AREA)
  • Biophysics (AREA)
  • Genetics & Genomics (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Cell Biology (AREA)
  • Food Science & Technology (AREA)
  • Pathology (AREA)
  • General Physics & Mathematics (AREA)
  • Analytical Chemistry (AREA)
  • Biotechnology (AREA)
  • Physics & Mathematics (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Rheumatology (AREA)
  • Orthopedic Medicine & Surgery (AREA)
  • Pain & Pain Management (AREA)
  • Transplantation (AREA)
  • Physical Education & Sports Medicine (AREA)
US12/745,229 2007-11-27 2008-11-26 14-3-3 Antagonists for the Prevention and Treatment of Arthritis Abandoned US20110027269A1 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
US12/745,229 US20110027269A1 (en) 2007-11-27 2008-11-26 14-3-3 Antagonists for the Prevention and Treatment of Arthritis

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
US99052007P 2007-11-27 2007-11-27
US7712308P 2008-06-30 2008-06-30
PCT/CA2008/002154 WO2009067820A1 (en) 2007-11-27 2008-11-26 14-3-3 antagonists for the prevention and treatment of arthritis
US12/745,229 US20110027269A1 (en) 2007-11-27 2008-11-26 14-3-3 Antagonists for the Prevention and Treatment of Arthritis

Related Parent Applications (1)

Application Number Title Priority Date Filing Date
PCT/CA2008/002154 A-371-Of-International WO2009067820A1 (en) 2007-11-27 2008-11-26 14-3-3 antagonists for the prevention and treatment of arthritis

Related Child Applications (1)

Application Number Title Priority Date Filing Date
US14/873,157 Continuation US20160185842A1 (en) 2007-11-27 2015-10-01 14-3-3 Antagonists for the Prevention and Treatment of Arthritis

Publications (1)

Publication Number Publication Date
US20110027269A1 true US20110027269A1 (en) 2011-02-03

Family

ID=40677991

Family Applications (6)

Application Number Title Priority Date Filing Date
US12/745,229 Abandoned US20110027269A1 (en) 2007-11-27 2008-11-26 14-3-3 Antagonists for the Prevention and Treatment of Arthritis
US12/745,235 Active 2030-04-13 US9079947B2 (en) 2007-11-27 2008-11-26 14-3-3 eta antibodies and uses thereof for the diagnosis and treatment of arthritis
US14/798,398 Active 2029-12-15 US10995136B2 (en) 2007-11-27 2015-07-13 14-3-3 eta antibodies and uses thereof for the diagnosis and treatment of arthritis
US14/873,157 Abandoned US20160185842A1 (en) 2007-11-27 2015-10-01 14-3-3 Antagonists for the Prevention and Treatment of Arthritis
US16/528,470 Abandoned US20200157195A1 (en) 2007-11-27 2019-07-31 14-3-3 Antagonists for the Prevention and Treatment of Arthritis
US17/306,913 Active 2029-08-24 US12275779B2 (en) 2007-11-27 2021-05-03 14-3-3 eta antibodies and uses thereof for the diagnosis and treatment of arthritis

Family Applications After (5)

Application Number Title Priority Date Filing Date
US12/745,235 Active 2030-04-13 US9079947B2 (en) 2007-11-27 2008-11-26 14-3-3 eta antibodies and uses thereof for the diagnosis and treatment of arthritis
US14/798,398 Active 2029-12-15 US10995136B2 (en) 2007-11-27 2015-07-13 14-3-3 eta antibodies and uses thereof for the diagnosis and treatment of arthritis
US14/873,157 Abandoned US20160185842A1 (en) 2007-11-27 2015-10-01 14-3-3 Antagonists for the Prevention and Treatment of Arthritis
US16/528,470 Abandoned US20200157195A1 (en) 2007-11-27 2019-07-31 14-3-3 Antagonists for the Prevention and Treatment of Arthritis
US17/306,913 Active 2029-08-24 US12275779B2 (en) 2007-11-27 2021-05-03 14-3-3 eta antibodies and uses thereof for the diagnosis and treatment of arthritis

Country Status (11)

Country Link
US (6) US20110027269A1 (enExample)
EP (4) EP3192807B1 (enExample)
JP (5) JP5615181B2 (enExample)
KR (5) KR20170116184A (enExample)
CN (3) CN101925364B (enExample)
AU (2) AU2008329466B2 (enExample)
BR (2) BRPI0819066A2 (enExample)
CA (2) CA2706479C (enExample)
HK (1) HK1253516A1 (enExample)
IL (3) IL205907A0 (enExample)
WO (2) WO2009067811A1 (enExample)

Cited By (12)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20110087236A1 (en) * 2009-10-08 2011-04-14 Ethicon Endo-Surgery, Inc. Laparoscopic device with compound angulation
US20120058498A1 (en) * 2009-03-11 2012-03-08 Anthony Marotta Compositions and Methods for Characterizing Arthritic Conditions
US9226760B2 (en) 2010-05-07 2016-01-05 Ethicon Endo-Surgery, Inc. Laparoscopic devices with flexible actuation mechanisms
US20160116652A1 (en) * 2013-06-20 2016-04-28 Merck Patent Gmbh Method for controlling the optical properties of uv filter layers
US9468426B2 (en) 2010-05-07 2016-10-18 Ethicon Endo-Surgery, Inc. Compound angle laparoscopic methods and devices
US20190088623A1 (en) * 2017-09-19 2019-03-21 Toshiba Memory Corporation Semiconductor package
CN109593131A (zh) * 2018-12-27 2019-04-09 南京医科大学 一种抗14-3-3η蛋白单克隆抗体及其用途
CN110579600A (zh) * 2018-05-23 2019-12-17 科美诊断技术股份有限公司 通过生物标记物联检体外评估类风湿性关节炎是否存在的方法
US11306121B2 (en) 2018-12-26 2022-04-19 Caregen Co., Ltd. Composition for muscle relaxation
US11828013B2 (en) 2019-11-19 2023-11-28 Whirlpool Corporation Laundry appliance having a processing belt
US11913950B2 (en) 2011-10-21 2024-02-27 Augurex Life Sciences Corp. Antigens derived from citrullinated 14-3-3 and uses thereof in the diagnosis of rheumatoid arthritis
US12275779B2 (en) 2007-11-27 2025-04-15 The University Of British Columbia 14-3-3 eta antibodies and uses thereof for the diagnosis and treatment of arthritis

Families Citing this family (23)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
PT2021792E (pt) * 2006-05-09 2013-05-23 Univ British Columbia Marcadores proteicos dissolvidos para artrite
GB201016494D0 (en) 2010-09-30 2010-11-17 Queen Mary Innovation Ltd Polypeptide
GB201200555D0 (en) * 2012-01-13 2012-02-29 Univ Birmingham Peptide
CN103060360A (zh) * 2013-01-04 2013-04-24 昆明理工大学 黑大豆14-3-3j蛋白基因的原核表达载体及其应用
CN104099348B (zh) * 2013-04-15 2017-03-29 上海市农业科学院 一种来源于耐高温菌的重金属结合蛋白基因及其抗重金属应用
CN103555750B (zh) * 2013-05-17 2015-04-08 温州医科大学附属第二医院 一种人子宫肌瘤14-3-3 γ高表达载体的构建方法及应用
KR101489844B1 (ko) * 2013-06-27 2015-02-06 강원대학교산학협력단 14-3-3 시그마 유전자 결손 마우스, 이를 이용한 인 비보 패혈증 연구모델 개발 방법 및 그 응용
WO2015031645A1 (en) 2013-08-28 2015-03-05 Washington University Monoclonal antibodies to human 14-3-3 epsilon and human 14-3-3 epsilon sv
US10583115B2 (en) 2014-10-08 2020-03-10 University Of South Australia Modulators of 14-3-3 functionality and uses thereof
KR101946884B1 (ko) * 2017-04-25 2019-02-13 고려대학교 산학협력단 대사체 분석을 이용한 베체트병의 진단방법
CN109596829A (zh) * 2017-12-07 2019-04-09 南京医科大学 一种肝癌标志蛋白及其检测方法
US11564958B2 (en) 2017-12-21 2023-01-31 Resolys Bio, Inc. Compositions and methods of treatment of Ehlers-Danlos syndromes
CN108344865A (zh) * 2018-01-05 2018-07-31 北京科美生物技术有限公司 检测14-3-3eta蛋白的均相免疫检测试剂盒及其应用
CN110579597A (zh) * 2018-05-23 2019-12-17 科美诊断技术股份有限公司 检测14-3-3 eta蛋白的非均相化学发光免疫检测试剂盒及其应用
CN110726843A (zh) * 2018-07-16 2020-01-24 科美诊断技术股份有限公司 检测14-3-3eta蛋白的化学发光免疫检测试剂盒及其应用
WO2020102623A1 (en) * 2018-11-15 2020-05-22 The University Of Toledo Materials and methods for the prevention of rheumatoid arthritis
WO2020138674A1 (ko) * 2018-12-26 2020-07-02 (주)케어젠 근육 이완용 조성물
CN109897109B (zh) * 2019-01-30 2022-09-09 常州市第二人民医院 抗肿瘤标志蛋白单克隆抗体及其用途
CN111606977B (zh) * 2020-05-27 2021-11-09 福建农林大学 一种利用GF14f蛋白靶向多肽配体调控水稻弱势籽粒灌浆的方法
CN114286684B (zh) * 2020-07-27 2024-01-05 华中科技大学 与stat3相关的疾病的预防和/或治疗
CN117024557B (zh) * 2023-10-10 2024-01-30 天津外泌体科技有限公司 14-3-3蛋白theta异构体作为细胞外囊泡支架蛋白的应用和细胞外囊泡
CN117899196B (zh) * 2024-03-18 2024-06-04 中国人民解放军总医院第一医学中心 14-3-3zeta蛋白或YWHAZ基因在角膜损伤治疗中的应用
WO2025202717A1 (en) * 2024-03-27 2025-10-02 Augurex Life Sciences Corp System and method for detection of 14-3-3 eta protein in capillary blood

Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5958765A (en) * 1995-06-07 1999-09-28 Idec Pharmaceuticals Corporation Neutralizing high affinity human monoclonal antibodies specific to RSV F-protein and methods for their manufacture and therapeutic use thereof
US5976852A (en) * 1996-05-24 1999-11-02 Genentech, Inc. Kκ/μ-like protein tyrosine phosphatase, PTP λ
US20040152630A1 (en) * 2001-02-21 2004-08-05 Haian Fu 14-3-3 Binding molecules as sensitizers for anticancer therapies
US7056677B2 (en) * 2000-03-17 2006-06-06 Gemini Science, Inc. Soluble mast cell function associated antigen (MAFA) pharmaceutical compositions and methods of making and using them
US7101962B2 (en) * 2003-05-15 2006-09-05 Bristol-Myers Squibb Company Antibodies of the P2Y10 receptor useful in altering T lymphocyte function

Family Cites Families (62)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4526714A (en) 1982-12-13 1985-07-02 Cordis Europa N.V. Conjugates of anticoagulant and protein
US4956281A (en) 1987-06-03 1990-09-11 Biogen, Inc. DNA sequences, recombinant DNA molecules and processes for producing lymphocyte function associated antigen-3
GB8720833D0 (en) 1987-09-04 1987-10-14 Celltech Ltd Recombinant dna product
US6010902A (en) 1988-04-04 2000-01-04 Bristol-Meyers Squibb Company Antibody heteroconjugates and bispecific antibodies for use in regulation of lymphocyte activity
ES2052027T5 (es) 1988-11-11 2005-04-16 Medical Research Council Clonacion de secuencias de dominio variable de inmunoglobulina.
US5530101A (en) 1988-12-28 1996-06-25 Protein Design Labs, Inc. Humanized immunoglobulins
US5108921A (en) 1989-04-03 1992-04-28 Purdue Research Foundation Method for enhanced transmembrane transport of exogenous molecules
US6291158B1 (en) 1989-05-16 2001-09-18 Scripps Research Institute Method for tapping the immunological repertoire
US5674980A (en) 1989-12-21 1997-10-07 Biogen Inc Fusion protein comprising tat-derived transport moiety
US6596476B1 (en) 1989-12-22 2003-07-22 Abbott Laboratories Hepatitis C assay
US6172197B1 (en) 1991-07-10 2001-01-09 Medical Research Council Methods for producing members of specific binding pairs
US5582996A (en) 1990-12-04 1996-12-10 The Wistar Institute Of Anatomy & Biology Bifunctional antibodies and method of preparing same
DE4118120A1 (de) 1991-06-03 1992-12-10 Behringwerke Ag Tetravalente bispezifische rezeptoren, ihre herstellung und verwendung
PT1696031E (pt) 1991-12-02 2010-06-25 Medical Res Council Produção de auto-anticorpos a partir de reportórios de segmentos de anticorpo e exibidos em fagos
EP0672068A4 (en) 1992-09-25 1997-02-26 Commw Scient Ind Res Org TARGET MOLECULES BINDING POLYPEPTIDES.
JP3720353B2 (ja) 1992-12-04 2005-11-24 メディカル リサーチ カウンシル 多価および多重特異性の結合タンパク質、それらの製造および使用
US5359681A (en) 1993-01-11 1994-10-25 University Of Washington Fiber optic sensor and methods and apparatus relating thereto
US5731168A (en) 1995-03-01 1998-03-24 Genentech, Inc. Method for making heteromultimeric polypeptides
US5948765A (en) 1996-03-15 1999-09-07 Washington University Inhibition of intracellular signal transduction by 14-3-3-binding peptides
US5998149A (en) 1996-04-05 1999-12-07 The United States Of America As Represented By The Department Of Health And Human Services Method of detecting transmissible spongiform encephalopathies
AU5601298A (en) 1996-12-12 1998-07-03 Neuromark Methods of detecting transmissible spongiform encephalopathies by detecting 14-3-3 protein isoforms
WO1999002567A2 (en) 1997-07-08 1999-01-21 Board Of Regents, The University Of Texas System Compositions and methods for producing homoconjugates of antibodies which induce growth arrest or apoptosis of tumor cells
GB9722131D0 (en) 1997-10-20 1997-12-17 Medical Res Council Method
US6225444B1 (en) 1998-02-10 2001-05-01 Protarga, Inc. Neuroprotective peptides and uses thereof
DE19810721A1 (de) * 1998-03-12 1999-10-14 Werner Mueller Anwendung der 14-3-3 Proteine sowie Verfahren zur schnellen Bestimmung der 14-3-3 Proteine als sensitive Biomarker für Pollution u. a. mit polychlorierten Biphenylen (PCBs) und (Xeno)Östrogenen
WO1999051625A2 (en) 1998-04-02 1999-10-14 Rigel Pharmaceuticals, Inc. Peptides causing formation of compact structures
US7011952B2 (en) 2000-02-22 2006-03-14 University Of Iowa Research Foundation Diagnostics and therapeutics for macular degeneration-related disorders
AU2001247296A1 (en) 2000-03-06 2001-09-17 Rigel Pharmaceuticals, Inc. In vivo production of cyclic peptides
US20060062786A1 (en) 2000-11-08 2006-03-23 Human Genome Sciences, Inc. Antibodies that immunospecifically bind to TRAIL receptors
US20030133939A1 (en) 2001-01-17 2003-07-17 Genecraft, Inc. Binding domain-immunoglobulin fusion proteins
KR100380147B1 (ko) 2001-01-18 2003-04-11 주식회사 엘지생명과학 류마티스성 자가면역 항체의 검출방법 및 검출키트
DE10131912A1 (de) 2001-06-06 2002-12-19 Werner E G Mueller Verwendung von 14-3-3 Proteinen und Verfahren zu deren Bestimmung
US7171311B2 (en) 2001-06-18 2007-01-30 Rosetta Inpharmatics Llc Methods of assigning treatment to breast cancer patients
AU2002319402B2 (en) 2001-06-28 2008-09-11 Domantis Limited Dual-specific ligand and its use
US7172905B2 (en) 2001-08-07 2007-02-06 The University Of Chicago Polypeptide immobilization
DE10159414A1 (de) 2001-12-04 2003-06-18 Infineon Technologies Ag Bipolar-Transistor und Verfahren zum Herstellen desselben
US20050214857A1 (en) 2001-12-11 2005-09-29 Algonomics N.V. Method for displaying loops from immunoglobulin domains in different contexts
GB0208331D0 (en) * 2002-04-11 2002-05-22 Oxford Glycosciences Uk Ltd Proteins
EP1600459A3 (en) 2002-06-28 2005-12-07 Domantis Limited Ligand
EP2284192A3 (en) 2002-11-08 2011-07-20 Ablynx N.V. Camelidae antibodies for sublingual administration
JP2006523090A (ja) 2002-12-27 2006-10-12 ドマンティス リミテッド リガンドに、そしてリガンド受容体に特異的な二重特異性単一ドメイン抗体
WO2005049806A2 (en) * 2003-03-14 2005-06-02 Nuvelo, Inc. Novel nucleic acids and polypeptides
DE102004026815A1 (de) 2003-06-03 2005-01-13 Kabushiki Kaisha Tokai Rika Denki Seisakusho Steuerung für ein Fernbedienungssystem
AU2004249814A1 (en) 2003-06-25 2004-12-29 Queen's University At Kingston Methods for diagnosing, monitoring, staging and treating heart failure
AU2004294933B2 (en) * 2003-11-21 2011-11-17 Johns Hopkins University Biomolecule partition motifs and uses thereof
TWI281473B (en) 2003-12-19 2007-05-21 Ind Tech Res Inst Biomarkers for liver diseases and method for using same
AU2005238446B2 (en) 2004-04-15 2009-07-30 Banyan Biomarkers Inc. Neural proteins as biomarkers for nervous system injury and other neural disorders
US20070253961A1 (en) * 2004-06-09 2007-11-01 Ulsan Industrial Education Foundation Pharmaceutical Composition Comprising the Anti-4-1Bb Antibody for Treating or Preventing Rheumatoid Arthritis
CA2595682A1 (en) 2005-01-31 2006-08-03 Ablynx N.V. Method for generating variable domain sequences of heavy chain antibodies
CA2600844A1 (en) 2005-03-14 2006-09-21 Medimmune, Inc. Macromolecules comprising a thioether cross-link
GB2426581A (en) 2005-05-27 2006-11-29 Univ Nottingham Immunoassay methods
GB2428240A (en) 2005-07-14 2007-01-24 Univ Gen Ve Diagnostic method for brain damage-related disorders
PT2021792E (pt) 2006-05-09 2013-05-23 Univ British Columbia Marcadores proteicos dissolvidos para artrite
CA2694154A1 (en) 2007-10-03 2009-04-09 Osi Pharmaceuticals, Inc. Biological markers predictive of anti-cancer response to insulin-like growth factor-1 receptor kinase inhibitors
WO2009046267A1 (en) 2007-10-05 2009-04-09 University Of Virginia Patent Foundation Protein-based biomarkers for abdominal aortic aneurysm
US7919262B2 (en) 2007-11-07 2011-04-05 The Uab Research Foundation 14-3-3 proteins for diagnosis of Parkinson's disease
US20110027269A1 (en) 2007-11-27 2011-02-03 The Unversity of British Office 14-3-3 Antagonists for the Prevention and Treatment of Arthritis
WO2009097584A1 (en) 2008-01-30 2009-08-06 Proteogenix, Inc. Maternal serum biomarkers for detection of pre-eclampsia
WO2009137832A2 (en) 2008-05-09 2009-11-12 Duke University Autoantibodies in the detection and treatment of cancer
MX2012014268A (es) 2010-07-09 2013-02-12 Somalogic Inc Biomarcadores de cancer de pulmon y usos de los mismos.
CN103429753A (zh) 2010-09-27 2013-12-04 私募蛋白质体公司 间皮瘤生物标记及其用途
US9209965B2 (en) 2014-01-14 2015-12-08 Microsemi Semiconductor Ulc Network interface with clock recovery module on line card

Patent Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5958765A (en) * 1995-06-07 1999-09-28 Idec Pharmaceuticals Corporation Neutralizing high affinity human monoclonal antibodies specific to RSV F-protein and methods for their manufacture and therapeutic use thereof
US5976852A (en) * 1996-05-24 1999-11-02 Genentech, Inc. Kκ/μ-like protein tyrosine phosphatase, PTP λ
US7056677B2 (en) * 2000-03-17 2006-06-06 Gemini Science, Inc. Soluble mast cell function associated antigen (MAFA) pharmaceutical compositions and methods of making and using them
US20040152630A1 (en) * 2001-02-21 2004-08-05 Haian Fu 14-3-3 Binding molecules as sensitizers for anticancer therapies
US7101962B2 (en) * 2003-05-15 2006-09-05 Bristol-Myers Squibb Company Antibodies of the P2Y10 receptor useful in altering T lymphocyte function

Cited By (16)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US12275779B2 (en) 2007-11-27 2025-04-15 The University Of British Columbia 14-3-3 eta antibodies and uses thereof for the diagnosis and treatment of arthritis
US11054419B2 (en) * 2009-03-11 2021-07-06 Anthony Marotta Compositions and methods for characterizing arthritic conditions
US20120058498A1 (en) * 2009-03-11 2012-03-08 Anthony Marotta Compositions and Methods for Characterizing Arthritic Conditions
US9333001B2 (en) 2009-10-08 2016-05-10 Ethicon Endo-Surgery, Inc. Articulable laparoscopic instrument
US9474540B2 (en) 2009-10-08 2016-10-25 Ethicon-Endo-Surgery, Inc. Laparoscopic device with compound angulation
US20110087236A1 (en) * 2009-10-08 2011-04-14 Ethicon Endo-Surgery, Inc. Laparoscopic device with compound angulation
US9226760B2 (en) 2010-05-07 2016-01-05 Ethicon Endo-Surgery, Inc. Laparoscopic devices with flexible actuation mechanisms
US9468426B2 (en) 2010-05-07 2016-10-18 Ethicon Endo-Surgery, Inc. Compound angle laparoscopic methods and devices
US10206701B2 (en) 2010-05-07 2019-02-19 Ethicon Llc Compound angle laparoscopic methods and devices
US11913950B2 (en) 2011-10-21 2024-02-27 Augurex Life Sciences Corp. Antigens derived from citrullinated 14-3-3 and uses thereof in the diagnosis of rheumatoid arthritis
US20160116652A1 (en) * 2013-06-20 2016-04-28 Merck Patent Gmbh Method for controlling the optical properties of uv filter layers
US20190088623A1 (en) * 2017-09-19 2019-03-21 Toshiba Memory Corporation Semiconductor package
CN110579600A (zh) * 2018-05-23 2019-12-17 科美诊断技术股份有限公司 通过生物标记物联检体外评估类风湿性关节炎是否存在的方法
US11306121B2 (en) 2018-12-26 2022-04-19 Caregen Co., Ltd. Composition for muscle relaxation
CN109593131A (zh) * 2018-12-27 2019-04-09 南京医科大学 一种抗14-3-3η蛋白单克隆抗体及其用途
US11828013B2 (en) 2019-11-19 2023-11-28 Whirlpool Corporation Laundry appliance having a processing belt

Also Published As

Publication number Publication date
EP3192807A1 (en) 2017-07-19
EP2222704A4 (en) 2011-02-09
JP2017149716A (ja) 2017-08-31
IL205907A0 (en) 2010-11-30
WO2009067811A1 (en) 2009-06-04
HK1151728A1 (en) 2012-02-10
WO2009067820A1 (en) 2009-06-04
AU2008329466A1 (en) 2009-06-04
CA2706479C (en) 2023-02-28
KR20100100912A (ko) 2010-09-15
CA2706476A1 (en) 2009-06-04
EP2222704A1 (en) 2010-09-01
EP2224955A4 (en) 2011-02-16
KR20100099221A (ko) 2010-09-10
US20220106386A1 (en) 2022-04-07
CN101925364B (zh) 2014-04-30
KR101945394B1 (ko) 2019-02-07
US9079947B2 (en) 2015-07-14
CN101925364A (zh) 2010-12-22
CA2706476C (en) 2021-08-03
US20200157195A1 (en) 2020-05-21
IL254157A0 (en) 2017-10-31
BRPI0819066A2 (pt) 2020-08-18
AU2008329529B2 (en) 2015-02-19
BRPI0819063A2 (pt) 2020-08-18
HK1253516A1 (zh) 2019-06-21
IL254157B (en) 2019-05-30
EP3192808A1 (en) 2017-07-19
CN107880122A (zh) 2018-04-06
JP6105516B2 (ja) 2017-03-29
AU2008329466B2 (en) 2015-04-09
JP2015096511A (ja) 2015-05-21
US20110052573A1 (en) 2011-03-03
KR20160127177A (ko) 2016-11-02
JP5781764B2 (ja) 2015-09-24
KR20180102215A (ko) 2018-09-14
JP5615181B2 (ja) 2014-10-29
CN101952313B (zh) 2017-12-15
EP2224955A1 (en) 2010-09-08
CN101952313A (zh) 2011-01-19
US12275779B2 (en) 2025-04-15
JP6054936B2 (ja) 2016-12-27
US20160185842A1 (en) 2016-06-30
JP2014221758A (ja) 2014-11-27
US20160039918A1 (en) 2016-02-11
IL205948A0 (en) 2010-11-30
CA2706479A1 (en) 2009-06-04
IL205948A (en) 2017-09-28
US10995136B2 (en) 2021-05-04
KR20170116184A (ko) 2017-10-18
EP3192807B1 (en) 2026-04-29
JP2011504876A (ja) 2011-02-17
AU2008329529A1 (en) 2009-06-04
JP2011504877A (ja) 2011-02-17

Similar Documents

Publication Publication Date Title
US20200157195A1 (en) 14-3-3 Antagonists for the Prevention and Treatment of Arthritis
AU2015202689B2 (en) 14-3-3 eta antibodies and uses thereof for the diagnosis and treatment of arthritis
HK1240955A1 (en) 14-3-3 antagonists for the prevention and treatment of arthritis
HK1151728B (en) 14-3-3 antagonists for the prevention and treatment of arthritis
HK1240954A1 (en) 14-3-3 eta antibodies and uses thereof for the diagnosis and treatment of arthritis
HK1152316B (en) 14-3-3 eta antibodies and uses thereof for the diagnosis and treatment of arthritis

Legal Events

Date Code Title Description
STCB Information on status: application discontinuation

Free format text: ABANDONED -- FAILURE TO RESPOND TO AN OFFICE ACTION